Ethiopian Biotechnology Institute

(EBTI)

Bioinformatics

Molalegne Bitew
(D.V.M, [Link].,Ph.D., Associate prof.)
Director Health Biotechnology

Dec 31, 2025 Molalegne Bitew (Ph.D.) 1

 CHAPTER - 4

Overview of Bioinformatics and

Sequence Retrieval

Dec 31, 2025 Molalegne Bitew (Ph.D.) 2

Bioinformatics - Definition

Bioinformatics is the use of databases and computers to

ask and answer biological questions.
Bioinformatics thus comprises two main activities:
• Computerized annotation of genomic and biological
information and data(databases).
• Transformation and manipulation of the data
(software tools).
Overall Aim of Bioinformatics:
•Provide biologically important predictions from annotated
data and transformation / manipulation of these data.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 3

Bioinformatics - Need and Use

• Bioinformatics plays a key role in modern biology and is

especially important in:
• Molecular biology
• Genomics
• Functional genomics
• Systems biology
• Protein design and engineering
• Pharmaceutical development
• Medicine
• Ecology / population genetics

Dec 31, 2025 Molalegne Bitew (Ph.D.) 4

 Analysis of genomics data

A critical failure of current bioinformatics is the lack of a single

software package that can perform all of these functions.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 5

 DNA (nucleotide sequences)
databases
• They are big databases and searching either one should
produce similar results because they exchange
information routinely.
• GenBank (NCBI): [Link]
• DDBJ (DNA DataBase of Japan):
[Link]
• TIGR: [Link]
• Yeast: [Link]
• E. coli: [Link]
• GISAID : Global initiative for sharing of all
Influenza data
• Specialized databases: Tissues, species…
• ESTs (Expressed Sequence Tags)
Dec 31, 2025 Molalegne Bitew (Ph.D.) 6
~ at NCBI [Link]
 Protein (amino acid) databases

• They are big databases too:

• Swiss-Prot (very high level of annotation)
[Link]
• PIR (protein identification resource): the world's most
comprehensive catalog of information on proteins

[Link]
• Translated databases:
• TREMBL (translated EMBL): includes entries that have
not been annotated yet into Swiss-Prot.

[Link]
• GenPept (translation of coding regions in GenBank)
• Dec
pdb (sequences derived
31, 2025 from
Molalegne Bitewthe
(Ph.D.) 3D structure 7
 Bioinformatics tools sites

• Textbook website - [Link]

• Has useful links to material discussed in text
• Must purchase textbook to get password
• The following are large sites with many links to servers
and software:
• CMS Molecular Biology Resource -
[Link]
• Baylor College of Medicine -
[Link]
• European Bioinformatics Institute - [Link]
• National Center for Biotechnology Information –
Dec 31, 2025 Molalegne Bitew (Ph.D.) 8
Retrieve the following sequence from the
database

Dec 31, 2025 Molalegne Bitew (Ph.D.) 9

 Primer Designing - I

Dec 31, 2025 Molalegne Bitew (Ph.D.) 10

 Polymerase chain reaction (PCR)

 Amplifies a single or a few copies of a piece of DNA

across several orders of magnitude, generating
thousands to millions of copies of a particular DNA
Sequence.
 Developed in 1985 by Kary Mullis
 PCR is now a common and often indispensable
technique used in medical and biological research labs
for a variety of applications.
 Cloning
 Sequencing,
 DNA-based phylogeny,
 functional analysis of genes etc….

Dec 31, 2025 Molalegne Bitew (Ph.D.) 11

 Polymerase chain reaction (PCR)

Dec 31, 2025 Molalegne Bitew (Ph.D.) 12

 Rules for Primer designing
 Design PCR primers with 18-30 oligonucleotides in length.
 Melting temperature (Tm) of the primers (Forward and
Reverse) used are not more than 5°C different from each other.
 is the temperature at which one half of the DNA duplex will
dissociate to become single stranded and indicates the duplex
stability.
 Aim for a Tm between 55 and 65°C for each primer over the
region of hybridization.
 Use an annealing temperature (Ta) of 5°C lower than the Tm.
 The GC content of each primer should be in the range of 40-
60% for optimum PCR efficiency.
 Try to have uniform distribution of G and C nucleotides, as
clusters of G’s or C’s can cause non-specific priming.
 Avoid long runs of repeat sequences.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 13

 Rules for Primer designing…….

 It is better to make the 3′ end of the primer terminate in

C (GC clamp). This increases the specificity.
 Check that primers are not self-complementary or
complementary to the other primer in the reaction
mixture
 intermolecular or intramolecular interactions can lead
to poor or no yield of the product.
 Δ G (Gibbs free energy) is the most important factor that
is to be taken into consideration in primer designing
 Δ G definition: The Gibbs Free Energy G is the measure
of the amount of work that can be extracted from a
process operating at a constant pressure. It is the
measure of the spontaneity of the reaction.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 14

 Rules for Primer designing…….

 Primer secondary structures: Presence of the primer

secondary structures adversely affect primer template
annealing and thus the amplification. They greatly
reduce the availability of primers to the reaction.
 Hairpins: It is formed by intramolecular interaction
within the primer and should be avoided.
 A 3' end hairpin with a ΔG of -2 kcal/mol and an
internal hairpin with a ΔG of -3 kcal/mol is tolerated
generally.
 Larger negative value for ΔG indicates stable,
undesirable hairpins. Presence of hairpins at the 3'
end most adversely affects the reaction.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 15

 Self Dimer : A primer self-dimer is formed by
intermolecular interactions between the two (same
sense) primers, where the primer is homologous to
itself.

A 3' end self dimer with a ΔG of -5 kcal/mol and an

internal self dimer with a ΔG of -6 kcal/mol is tolerated
generally.

 Cross Dimer: Primer cross dimers are formed by

intermolecular interaction between sense and antisense
primers, where they are homologous.

 Optimally a 3' end cross dimer with ΔG of -5 kcal/mol

and an internal cross dimer with a ΔG of -6 kcal/mol is
tolerated generally.
Dec 31, 2025 Molalegne Bitew (Ph.D.) 16
 Rules for Primer designing…….

 3' End Stability : It is the maximum ΔG value of the

five bases from the 3' end.
 the maximum ΔG value (-8.5 kCal/mol is the default,
however a value of -10 to -12kCal/mol is tolerated)
 An unstable 3' end (less negative ΔG) will result
in less false priming.
 Primers with pentamer ΔG more stable than -8.5
kCal/mol (more negative) have a tendency to false
prime and are more likely to form hairpins and
self dimers.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 17

Dec 31, 2025 Molalegne Bitew (Ph.D.) 18
 Real time PCR
A few key features of effective real-time qPCR primer
design are summarized below.
1. Primer pairs should amplify an amplicon of suitable size
(<300 bp, ideally 100 to 200 bp).
2. Primers should straddle an intron or flank a large intron.
3. Primer binding sites should not have extensive secondary
structure.
4. The 3’ ends of the primer should be free of secondary
structure and repetitive sequences.
5. Primers pairs should not significantly complement each
other or themselves.
6. Primer pairs should have approximately equal GC
content (between 40% to 70%) and have similar annealing
temperatures.

 NB: Annealing temperature analysis can be done using a

temperature
Dec 31, 2025 gradient [Link] Bitew (Ph.D.) 19
 Primer Designing is detailed here in three
sections:
 1. Designing primer for normal PCR

 2. Designing primer for PCR, further cloning and

expression in the Prokaryotic expression system

 3. Designing primer for PCR, further cloning and

expression in the Eukaryotic expression system

Dec 31, 2025 Molalegne Bitew (Ph.D.) 20

 Designing primer for normal PCR

 Step 1: Retreive the sequence of your gene of interest (GOI)

 Step 2: Create an edit sequence file in DNAstar software
 Open the edit sequence window

Dec 31, 2025 Molalegne Bitew (Ph.D.) 21

 Copy paste the sequence and name the file - NDV F [Link]

Dec 31, 2025 Molalegne Bitew (Ph.D.) 22

 Step 3 : Open Primer Select in DNAstar, enter the sequence,
add, press done and proceed for primer designing

Dec 31, 2025 Molalegne Bitew (Ph.D.) 23

 Step 3 contd..

Dec 31, 2025 Molalegne Bitew (Ph.D.) 24

Step 4 : Choosing parameters for primer designing

Dec 31, 2025 Molalegne Bitew (Ph.D.) 25

 • Step 5 : Locating primer pairs

Dec 31, 2025 Molalegne Bitew (Ph.D.) 26

 Step 5 contd….

Choose locate primer pairs from locate menu, move the

curtain ring on the right corner of the located primer pairs
to the left for accessing the advice curtain which gives a
brief note concerning the expected performance of each
primer pair, including the alternate pairs.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 27

Step 6 : Report of the amplification summary

Dec 31, 2025 Molalegne Bitew (Ph.D.) 28

 Step 7: Report of the primer self dimers, primer pair dimers
and primer hairpins

 All other ΔG
measures should be
greater than this
value and, for
dimerization, much
greater (i.e. not
stable).

 ΔG (worst) is the calculation of ΔG if each base in the

primer were to anneal to its complement.
 The idea behind ΔG (worst) is to provide a baseline for the
maximum stability.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 29

 Step 8 : Re-checking the primers in the gene tool : open gene
tool, Click on sequence editor, copy paste the sequence

Dec 31, 2025 Molalegne Bitew (Ph.D.) 30

 Step 9 : Finding primers in gene tool

Dec 31, 2025 Molalegne Bitew (Ph.D.) 31

 Step 9 contd…

Forward (positions 3 - 23)

STEP IX

Reverse (positions 794 - 814)

If there is a problem with the primers selected the box(es)
will be highlighted

Dec 31, 2025 Molalegne Bitew (Ph.D.) 32

 Print of the primers from gene tool can be obtained from the
file menu the output is as follows:

Dec 31, 2025 Molalegne Bitew (Ph.D.) 33

 Oligoanalyzer software
Step 10 : Re-checking the primers in the Oligoanalyzer software
 Copy paste the primers in the oligoanalyzer primer
windows and check the properties individually

The values of dG(ΔG (worst) in DNAstar), 3’ tail dG (Limit -10 to -12 kcal/mol) and dG(Limit -
6.0 kcal/mol) of self dimers are within the limits ,GC content < 60% and hence the primers
are a good choice.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 34

 • Check for the primer dimer stability by clicking on
Multiplex all icon in the software window

The values of dG (Limit -6.0 kcal/mol) of primer cross

dimers are within the limits and hence the primers are a
good choice.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 35

 Online primer designing

There are many online tools that aid primer design.

Among them are
•PrimerQuest™ Tool from the Integrated DNA
technologies (IDT),
•Primer design tool at NCBI etc

Dec 31, 2025 Molalegne Bitew (Ph.D.) 36

 CHAPTER I
section II

DESIGNING PRIMER FOR PCR, FURTHER CLONING

AND EXPRESSION IN THE PROKARYOTIC
EXPRESSION SYSTEM

Dec 31, 2025 Molalegne Bitew (Ph.D.) 37

 Prokaryotic Expression vectors

A Prokaryotic expression vector should contain a

ribosome binding site (RBS), a strong inducible promoter,
and a transcriptional terminator besides a selectable marker,
origin of replication and a multiple cloning site for the
insertion of target genes.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 38

 pET 32a+ Vector

Dec 31, 2025 Molalegne Bitew (Ph.D.) 39

Dec 31, 2025 Molalegne Bitew (Ph.D.) 40
 Part A: Steps in primer designing for partial expression of gene of
interest in prokaryotic expression system:

 Step 1: Initially design primers in DNAstar

 Step 2: Check the primers in Gene tool and Oligoanlyser : As

done in the previous section I

 Step 3: Check the size of the amplicon

Forward:- 5'-GGGCTCCAAACCTTCTACCAG-3' (position 3-23)

Reverse:- 5'-AGCCAGCGA TCAAGCCACTAC-3' would give an

amplicon of 812 bp.

The product is calculated as: Product length = (Position of Reverse

primer-Position of Forward primer) + 1 (here it is (814 -3) + 1= 812).

Dec 31, 2025 Molalegne Bitew (Ph.D.) 41

 Step 3 contd…

Select the sequence covered by Copy , paste and save the sequence
the primers

Dec 31, 2025 Molalegne Bitew (Ph.D.) 42

 Step 4: Check the reading frame

Select all and translate in Ist frame – stop codons present

goodies menu

Dec 31, 2025 Molalegne Bitew (Ph.D.) 43

 Step 4 contd…

Boxes will be useful

in interpreting step VI

2nd frame – no stop codons 3rd frame – stop codons present

Dec 31, 2025 Molalegne Bitew (Ph.D.) 44

 • Step 5 : Check for the absent Restriction enzyme sites

 In map draw, going to the file menu and opening the sequence
gives a restriction map
 In the map menu click on absent sites to get the list of absent
sites

Use map draw Open the sequence saved covered

by the primers

Dec 31, 2025 Molalegne Bitew (Ph.D.) 45

 Step 5 contd…

RE Map will be displayed

Select absent sites from the map
menu

Dec 31, 2025 Molalegne Bitew (Ph.D.) 46

 Step 5 contd..

Nco I – CCATGG
GGTACC

Hind III - AAGCTT

TTCGAA

List of absent sites

Dec 31, 2025 Molalegne Bitew (Ph.D.) 47

 Step 6 : Addition of the restriction sites at the 5’end of the primers
and adjusting the frame

The primers are added with the restriction sites at the 5’end of
the primers (NcoI and Hind III)

The Reading frame of GOI is start

ATG is in frame in the vector
from here- 2nd Reading frame
Nco I
Forward primer: 5’- CCATGGGGGTCCAAACCTTCTACCAG-3’
Translation M G A P N L L P
Correct Traslation of GOI G S K P S T
As indicated by the first 6 amino acids in
the 2nd frame of step III

Dec 31, 2025 Molalegne Bitew (Ph.D.) 48

 The Reading frame of GOI is start from
ATG is in frame in the vector here- 2nd Reading frame
Nco I
Forward primer: 5’- CCATGGNGGGCTCCAAACCTTCTACCAG-3’
Translation M X G S K P S T

Addition of one nucleotide will bring the GOI in to frame

Dec 31, 2025 Molalegne Bitew (Ph.D.) 49

  For the reverse primer 5'-AGCCAGCGATCAAGCCACTAC-3' take
the reverse compliment from the goodies menu of the Edit seq
and check the frame

Dec 31, 2025 Molalegne Bitew (Ph.D.) 50

Dec 31, 2025 Molalegne Bitew (Ph.D.) 51
 Step 7 : Additional 3-4 bases are to be added 5’ to the restriction
enzyme sequences for proper recognition and cutting of restriction
enzyme

Forward primer Reverse primer

Characteristics in Characteristics in
Oligoanalyzer Oligoanalyzer

Dec 31, 2025 Molalegne Bitew (Ph.D.) 52

 Multiplex
Characteristics in
Oligoanalyzer of both
the primers

Dec 31, 2025 Molalegne Bitew (Ph.D.) 53

 Step 8: A final check should be performed as below:

The sequence highlighted is trimmed The sequence highlighted is added

Dec 31, 2025 Molalegne Bitew (Ph.D.) 54

 Step 8….

Stop codon is due to TAA

translated at the end Stop codon in the vector
reverse primer sequence

AAT
5’GCAAGCTTAGCATCAAGCCACTAC3’

We have two options: Change the RE site or just change the 5’ A

to T and check all the parameters on Oligoanalyzer

Dec 31, 2025 Molalegne Bitew (Ph.D.) 55

 Check the reverse primer in oligoanalyzer for ΔG

Reverse primer(After change) in Multiplex all Oligoanalyzer

Oligoanalyzer

Dec 31, 2025 Molalegne Bitew (Ph.D.) 56

 Final Check

No stop codon in the middle

Change in A to T will
result in A after
translation and thereby
removes the stop codon

The final primers are:

Forward : 5’ GCCCATGGAGGGCTCCAAACCTTCTACCAG 3’
Reverse: 5’ GCAAGCTTTGCCAGCGATCAAGCCACTAC 3’

Dec 31, 2025 Molalegne Bitew (Ph.D.) 57

Part B: Steps in primer designing for full length expression of
gene of interest in prokaryotic vector system

Step 1: Initially try designing primers in DNAstar for amplifying

the full length of the gene of interest
(Alternatively, select the 5’ and 3’ ends (21 bases) in Gene tool
manually and put the sequences in the Oligoanalyzer)

Forward primer - Selecting 21 bases is showing a problem, primer hairpin. Removal

of ATG solves the problem. We can still proceed with ATG since we need to add RE
site at the 5’end of the primer and then check the characteristics.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 58

 Step 1…..

Stop codon not

included in the primer

Reverse primer- Selecting 21 bases leaving the stop codon TGA shows no problem.
We will proceed to add RE site at the 5’end of the primer and then check the
characteristics.
Primer sequences:-
Forward- 5’ ATGGGCTCCAAACCTTCTACC 3’
Reverse- 5’ TGTTCTTGTGGTGGCTCTCAT 3’

Dec 31, 2025 Molalegne Bitew (Ph.D.) 59

Step 2 : Identify the absent RE sites : The enzymes NcoI and HindIII
were found to be absent.
Step 3: Add of Restriction sites at the 5’ end of the primers and
adjust the frame in the vector of interest (pET 32a+).

Jimma University, JUCAVM

Dec 31, 2025 Molalegne Bitew (Ph.D.) 60
Step 7: Forward and reverse sequences are analyzed in oligoanalyzer
after addition of RE site and additional bases.

All chracteristics are within limits

Jimma University, JUCAVM

Dec 31, 2025 Molalegne Bitew (Ph.D.) 61

 Step 7…

Step 7: Forward and reverse sequences are analyzed in

oligoanalyzer after addition of RE site and additional bases.

All characteristics are within limits

Jimma University, JUCAVM

Dec 31, 2025 Molalegne Bitew (Ph.D.) 62

 Step 8 : Final Check is performed as in part A

Jimma University, JUCAVM

Dec 31, 2025 Molalegne Bitew (Ph.D.) 63

 CHAPTER I

Section III

DESIGNING PRIMER FOR PCR, FURTHER

CLONING AND EXPRESSION IN THE
EUKARYOTIC EXPRESSION SYSTEM

Dec 31, 2025 Molalegne Bitew (Ph.D.) 64

 CLONING AND EXPRESSION IN THE EUKARYOTIC
EXPRESSION SYSTEM
• Prokaryotic expression system suffers from some major
disadvantages like :
• [Link] in expressing large proteins (>50 kD)
• [Link] glycosylation or signal peptide removal
• [Link]’t handle S-S rich proteins and sometimes eukaryotic
proteins are toxic.
• A Eukaryotic expression vector should contain a strong
promoter for high-level expression, Poly A signal, two origins of
replication-one for replication and maintenance in prokaryotic
cells and another for episomal replication in eukaryotic cells;
selectable marker(s), and a multiple cloning site for the insertion
of target genes.
• For eukaryotic expression, the insert must contain a Kozak
translation initiation sequence and an ATG start codon for proper
initiation of translation.
Dec 31, 2025 Molalegne Bitew (Ph.D.) 65
 Steps in primer designing for full length expression of
gene of interest in Eukaryotic expression system:-

Step 1: Initially design primers in DNAstar

Step 2: Check the primers in Gene tool

Step 3: Copy, paste the primers in Oligoanalyzer

Step 4 : Choose two restriction sites (One to be added to the

forward primer and other to the reverse primer-for directional
cloning)

Dec 31, 2025 Molalegne Bitew (Ph.D.) 66

 Step 5 : The primers are added with the restriction sites at the
5’end of the Kozak sequence of the primers. Additional
2-4 bases are to be added 5’ to the restriction enzyme
sequences

Step 6 : A final check should be performed as in previous

sections

Dec 31, 2025 Molalegne Bitew (Ph.D.) 67

Ribosomal binding site
• This sequence on an mRNA molecule is recognized by the
ribosome as the translational start site, from which a protein is
coded by that mRNA molecule. The ribosome requires this
sequence, or a possible variation to initiate translation.

• The Kozak sequence is not to be confused with the ribosomal

binding site (RBS), that being either the 5' cap of a messenger
RNA or an Internal Ribosome Entry Site (IRES) for viruses.

• The Kozak consensus sequence, Kozak consensus or Kozak

sequence, is a sequence which occurs on eukaryotic mRNA and
has the consensus gccRccAUGG, where R is a purine (adenine or
guanine) three bases upstream of the start codon (AUG), which is
followed by another ‘G’ The Kozak consensus sequence plays a
major role in the initiation of the translation process.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 68

 Kozak contd….

• In vivo, this site is often not matched exactly on different mRNAs

and the amount of protein synthesized from a given mRNA is
dependent on the strength of the Kozak sequence.
• Some nucleotides in this sequence are more important than
others:
• the AUG is essential since it is the actual initiation codon
encoding a methionine amino acid at the N-terminus of the
protein.
• The A nucleotide of the "AUG" is referred to as number 1. For
a 'strong' consensus, the nucleotides at positions +4 (i.e. G in
the consensus) and -3 (i.e. either A or G in the consensus)
relative to the number 1 nucleotide must both match the
consensus (there is no number 0 position).

Dec 31, 2025 Molalegne Bitew (Ph.D.) 69

Bioinformatics tools sites

• An 'adequate' consensus has only 1 of these sites, while a 'weak'

consensus has neither. The cc at -1 and -2 are not as conserved,
but contribute to the overall strength. There is also evidence that
a G in the -6 position is important in the initiation of translation.

Dec 31, 2025 Molalegne Bitew (Ph.D.) 70