0% found this document useful (0 votes)
14 views68 pages

Dynamic Programming: Fibonacci & More

The document discusses dynamic programming, focusing on Fibonacci numbers, rod-cutting, matrix chain multiplication, and longest common subsequence. It explains the concepts of optimal substructure and overlapping subproblems, and outlines two approaches to dynamic programming: top-down with memoization and bottom-up. The document also includes runtime analysis and examples for each problem type, illustrating how dynamic programming can optimize solutions.

Uploaded by

malihakhan1030
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
14 views68 pages

Dynamic Programming: Fibonacci & More

The document discusses dynamic programming, focusing on Fibonacci numbers, rod-cutting, matrix chain multiplication, and longest common subsequence. It explains the concepts of optimal substructure and overlapping subproblems, and outlines two approaches to dynamic programming: top-down with memoization and bottom-up. The document also includes runtime analysis and examples for each problem type, illustrating how dynamic programming can optimize solutions.

Uploaded by

malihakhan1030
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd

Dynamic Programming

Fibonacchi Numbers

• Write a program to find the nth fibonacchi number.


def Fibonacci(n):
if n == 0: return 0
if n == 1: return 1
return Fibonacci(n-1) + Fibonacci(n-2)

• Runtime analysis
What’s going on? That’s a lot
of repeated
Consider Fib(8) computation!
8

6 7

4 5 5 6

2 3 3 4 3 4 4 5

0 1 1 2 1 2 2 3 1 2 2 3 2 3 3 4

1 2 ……
0 1 0 1 0 1 1 2 0 1 0 1 0 1 1 2 1 2
0 1 0 1 0 1 0 1
Fibonacchi Numbers
• How to avoid repeated computations?
• Store already computed results

global fib[n] initialized to -1//NIL


def Fibonacci(n):
if n == 0: return 0
if n == 1: return 1
if fib[n] not computed:
fib[n] = Fibonacci(n-1) + Fibonacci(n-2)
return fib[n]
Fibonacchi Numbers
• How to avoid repeated computations?
• Start from smaller problems and proceed towards bigger ones.

def Fibonacci(n):
local fib[n+1]
fib[0] = 0
fib[1] = 1
for i -> 2 to n:
fib[i] = fib[i-1] + fib[i-2]
return fib[n]
What did we do?

Dynamic Programming!!!
Dynamic Programming
• It is an algorithm design paradigm
• like divide-and-conquer is an algorithm design paradigm.
• Usually, it is for solving optimization problems
• E.g., shortest path, minimum/maximum profit, longest
sequences
• (Fibonacci numbers aren’t an optimization problem, but they
are a good example of DP anyway…)
Elements of dynamic programming
1. Optimal Sub-structure Property
• Big problems break up into sub-problems.
• The solution to a problem can be expressed in terms of
solutions to smaller sub-problems.
• Fibonacci:
Elements of dynamic programming
2. Overlapping Sub-Problem Property
• The sub-problems overlap.
• Fibonacci:
• Both fib[i+1] and fib[i+2] directly use fib[i].
• And lots of different fib[i+x] indirectly use fib[i].
• This means that we can save time by solving a sub-
problem just once and storing the answer.
Elements of dynamic programming
1. Optimal substructure.
• Optimal solutions to sub-problems can be used to find the
optimal solution of the original problem.
2. Overlapping subproblems.
• The subproblems show up again and again

• Using these properties, we can design a dynamic programming


algorithm:
• Keep a table of solutions to the smaller problems.
• Use the solutions in the table to solve bigger problems.
• At the end we can use information we collected along the way
to find the solution to the whole thing.
Two ways to think about and/or
implement DP algorithms
• Top-down Approach with • Bottom-up Approach
Memoization
global fib[n] initialized to - def Fibonacci(n):
1//NIL local fib[n+1]
def Fibonacci(n): fib[0] = 0
if n == 0: return 0 fib[1] = 1
if n == 1: return 1 for i -> 2 to n:
if fib[n] not computed: fib[i] = Fibonacci(i-1)
fib[n] = Fibonacci(n-1) + Fibonacci(i-2)
+ Fibonacci(n-2) return fib[n]
return fib[n]
Top-down Approach
• Think of it like a recursive algorithm.
• To solve the big problem:
• Recurse to solve smaller problems
• Those recurse to solve smaller problems
• etc..

• The difference from divide and conquer:


• Keep track of what small problems you’ve already solved
to prevent re-solving the same problem twice.
• Aka, “memo-ization”
Top-down Approach
8

6 7

4 5 5 6

2 3 3 4 3 4 4 5

0 1 1 2 1 2 2 3 1 2 2 3 2 3 3 4

1 2 etc
0 1 0 1 1 2 0 1 0 1 1 2
0 1 0 1 1 2
0 1 0 1 0 1 130 1
Top-down Approach
Nodes Pruned
8

6 7

4 5 5 6

2 3 3 4 3 4 4 5

0 1 1 2 1 2 2 3 1 2 2 3 2 3 3 4

1 2 etc
0 1 0 1 1 2 0 1 0 1 1 2
0 1 0 1 1 2
0 1 0 1 0 1 140 1
Bottom-up Approach 8

7
• Solve the small problems first
• fill in fib[0],fib[1]
6
• Then bigger problems
• fill in fib[2] 5
•…
4
• Then bigger problems
• fill in fib[n-1] 3

• Then finally solve the real problem. 2

• fill in fib[n] 1

0
Rod-cutting Problem
• Given
• A rod of length n
• A table of prices for ,
• Determine the maximum revenue obtainable by cutting
up the rod and selling all the pieces.
• For example,
Rod-cutting Problem
Rod-cutting Problem
• An optimal solution involving k pieces,
• Each piece has length

• The optimal revenue,


Rod-cutting Problem
• Once an initial cut is made,
• The two resulting smaller pieces will be cut independently
• Smaller instance of the rod-cutting problem
• Optimal Sub-structure Property

• Different pieces can be cut into same length pieces (on not)
• Overlapping Sub-structure Property
Rod-cutting Problem
• Assuming an initial cut is made,

• Further assuming the initial cut is always the leftmost cut,


• A first piece followed by some decomposition of the remainder
• First piece is not further divided only the remaining is
decomposed
Rod-cutting Problem

Runtime
Rod-cutting Problem (Top-down
Approach)
Rod-cutting Problem (Bottom-up
Approach)

Runtime
Rod-cutting Problem (Bottom-up
Approach)
• Reconstruct the choices that led to the optimal solution

• Store the choices that lead to the optimal solution


• Store the optimal size i of the first piece to cut off when
solving a subproblem of size j
Rod-cutting Problem (Bottom-up
Approach)
Rod-cutting Problem (Bottom-up
Approach)
Matrix Chain Multiplication
• Given a chain of n matrices,
• Compute the product with standard multiplication algorithm
• Goal: Minimize the number of scalar multiplications

• Example,
• with dimensions 10 * 100, 100 * 5, 5 * 50
• perfoms a total of 7500 scalar multiplication
• perfoms a total of 75000 scalar multiplication
Matrix Chain Multiplication
• Parenthesizing resolves ambiguity in multiplication order
• Fully parenthesized chain of matrices
• Either a single matrix
• Or the product of two fully parenthesized matrix products,
surrounded by parentheses
• Example,
• can be parenthesized in 5 distinct ways.
• ,,,
Matrix Chain Multiplication
• Given a chain of n matrices,
• Matrix has dimensions
• Goal: Fully parenthesize the product to minimize the number
of scalar multiplications

• Note: determine the order of multiplication not the product


itself.
Matrix Chain Multiplication
• Fully parenthesized product
• Split the product into fully parenthesized subproducts

• Let, the first split occurs between kth and (k+1)st matrices

𝑛
• How many possible ways? Ω(2 )
Matrix Chain Multiplication
• Let, The minimum number of scalar multiplications needed
to compute the matrix

• We need to find
Matrix Chain Multiplication
• The optimal parenthesization
• Split the product between and for some value of

• We need to consider all such splits, i.e., all values of k


Matrix Chain Multiplication
• The optimal parenthesization
• Split the product between and for some value of

• We need to consider all such splits, i.e., all values of k

• How many such subproblems? 2


Θ (𝑛 )
Matrix Chain Multiplication
Matrix Chain Multiplication
Matrix Chain Multiplication
30 * 35 35 * 15 15 * 5 5 *10 10 * 20 20 * 25
j\i 1 2 3 4 5 6
1 0

2 15750 0 m[1, 3] = min(


• m[1,1] + m[2, 3] + 30*35*5 = 7875,
3 7875 2625 0 • m[1,2] + m[3, 3] + 30*15*5 = 18000,
)
4 4375 750 0

5 2500 1000 0

6 3500 5000 0
Matrix Chain Multiplication
30 * 35 35 * 15 15 * 5 5 *10 10 * 20 20 * 25
j\i 1 2 3 4 5 6
1 0

2 15750 0 m[2, 5] = min(


• m[2,2] + m[3, 5] + 35*15*20 = 13000,
3 7875 2625 0 • m[2,3] + m[4, 5] + 35*5*20 = 7125,
• m[2,4] + m[5, 5] + 35*10*20 = 11375
)
4 9375 4375 750 0

5 11875 7125 2500 1000 0

6 15125 10500 5375 3500 5000 0


Elements of dynamic programming
(Revisit)
1. Optimal substructure.
• Optimal solutions to sub-problems can be used to find
the optimal solution of the original problem.

2. Overlapping subproblems.
• The subproblems show up again and again
Optimal Substructure Property
• Solution to sub-problems are included in the optimal solution

• Rod-cutting
• Solution to smaller pieces are also part of the solution to the entire
rod

• Matrix Chain Multiplication


• Solution to and is exactly include in the solution to

• How to prove this?


• Cut-and-paste
Longest Common Subsequence
• A strand of DNA consists of a string of molecules called
bases
• Adenine, Cytosine, Guanine, and Thymine
• ACGT

• S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA
• S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA
Longest Common Subsequence
• A strand of DNA consists of a string of molecules called
bases
• Adenine, Cytosine, Guanine, and Thymine
• ACGT

• Given a sequence
• Another sequence is a subsequence of X
• If there exists a strictly increasing sequence indices of X such
that for all ,
Longest Common Subsequence
• A strand of DNA consists of a string of molecules called
bases
• Adenine, Cytosine, Guanine, and Thymine
• ACGT

• Given two sequences and


• A sequence Z is a common sub-sequence if Z is a subsequence of
both X and Y

• Goal: find a maximum-length common subsequence of X


and Y.
Longest Common Subsequence
• Need to consider all subsequences

• How many subsequences of X?


Longest Common Subsequence
• Given a sequence
• The prefix of is
Longest Common Subsequence
• Let = the length of an LCS of the sequences and
Longest Common Subsequence
Longest Common Subsequence
j 0 1 2 3 4 5 6
i B D C A B A
0 0 0 0 0 0 0 0
1 A 0 0 0 0 1
2 B 0
3 C 0
4 B 0
5 D 0
6 A 0
7 B 0
Longest Common Subsequence
j 0 1 2 3 4 5 6
i B D C A B A
0 0 0 0 0 0 0 0
1 A 0 0 0 0 1 1 1
2 B 0 1 1 1 1 2 2
3 C 0 1 1 2 2 2 2
4 B 0 1 1 2 2 3 3
5 D 0 1 2 2 2 3 3
6 A 0 1 2 2 3 3 4
7 B 0 1 2 2 3 4 4
Sequence Alignment
• How similar are two strings?
• ocurrance vs occurrence
Sequence Alignment
• Edit distance
• Gap penalty and mismatch penalty
• Cost is sum of all penalties
Sequence Alignment
• Given two sequences
• and
• An alignment is a set of ordered pairs such that each
character appears in at most one pair and there are no
crossings.
• Crossing: and cross if but
Sequence Alignment
• Given two sequences
• and

• The cost of an alignment M is,


Sequence Alignment
• Given two sequences
• and

• Goal: Find minimum cost alignment of the two sequences


Sequence Alignment
• Given two sequences
• and

• minimum cost of aligning and


Sequence Alignment
• minimum cost of aligning and
• Case 1: matches
• Pay mismatch for + min cost of aligning and
• +
Sequence Alignment
• minimum cost of aligning and
• Case 2: leaves unmatched
• Pay gap for + min cost of aligning and
• +
Sequence Alignment
• minimum cost of aligning and
• Case 3: leaves unmatched
• Pay gap for + min cost of aligning and
• +
Sequence Alignment
• minimum cost of aligning and
• Case 1: matches
• +

• Case 2: leaves unmatched


• +

• Case 3: leaves unmatched


• +
Sequence Alignment
• minimum cost of aligning and
Sequence Alignment
0-1 Knapsack Problem
• Given,
• n items where item has value
and weighs
• Value of a subset of items =
sum of values of individual
items.
• Knapsack has weight limit of
• Goal. Pack knapsack so as
to maximize total value of
items taken.
• Example, {1, 2, 5} yields 35$
while {3, 4} yields 40$.
0-1 Knapsack Problem
• = optimal value of knapsack problem with items ,
subject to weight limit
• Goal: Find
0-1 Knapsack Problem
• = optimal value of knapsack problem with items ,
subject to weight limit

• Case 1: Don’t pick item


• selects best of subject to weight limit

• Case 2: Pick item


• selects best of subject to weight limit
• Collect value
0-1 Knapsack Problem
• = optimal value of knapsack problem with items ,
subject to weight limit

• Case 1: Don’t pick item

• Case 2: Pick item


0-1 Knapsack Problem
• = optimal value of knapsack problem with items ,
subject to weight limit
0-1 Knapsack Problem
0-1 Knapsack Problem
Reference
• Dynamic Programming
• CLRS 4th Ed. Chapter 14 (14.1 – 14.4)
• KT Sections 6.4 (The Knapsack Problem), 6.6

You might also like