Evolution
[Link]/wiki/Image:DNA_double_helix_vertikal.PNG [Link]/wiki/Image:Charles_Darwin_1881.jpg
The Tree of Life
All living things share a common
ancestor.
We can draw a Tree of Life to
show how every species is related.
Evolution is the process by which
one species gives rise to another
and the Tree of Life grows
[Link]/wiki/Image:Phylogenetic_tree.svg
Evolution as Theory and Fact
Confusion sometimes arises as to
whether Evolution is a theory or a fact.
Actually it is both!
The theory of Evolution deals with how
Evolution happens. Our understanding
of this process is always changing.
Evolution is also a fact as there is a
huge amount of indisputable evidence
for its occurrence.
Rodins The Thinker
Talk Outline
Part 1: How was evolution discovered?
Discussion: Should Creationism and Evolution be
given equal time in science lessons?
Part 2: How does evolution work?
Practical: Natural Selection in the Peppered Moth
Part 3: What is the evidence for evolution?
Discovery (1) Fixed species
Michelangelos fresco on the ceiling
of the Sistine Chapel
[Link]/wiki/The_Creation_of_Adam
From Classical times until long after the Renaissance, species
were considered to be special creations, fixed for all time.
Discovery (2): Transmutation
Around 1800, scientists began to
wonder whether species could
change or transmute.
Lamarck thought that if an animal
acquired a characteristic during its
lifetime, it could pass it onto its
offspring.
Hence giraffes got their long necks
through generations of straining to
Jean Baptiste de Lamarck reach high branches.
[Link]/wiki/Image:Jean-baptiste_lamarck2.jpg
[Link]/wiki/Image:Giraffe_standing.jpg
Discovery (3): Fossils and Strata
[Link] [Link] [Link]
ImageWilliam_Smith.[Link] Geological_map_of_Great_Britain.jpg
William Smith, his geology map & some of his fossil specimens
At about the same time, geologists like William Smith were
mapping the rocks and fossils of Britain. He and others showed
that different species existed in the past compared with today.
Discovery (4): Darwins Voyage
From 1831-1836, a
young naturalist called
Charles Darwin toured
the world in HMS
Beagle.
He was dazzled by the
amazing diversity of
life and started to
wonder how it might
Voyage of the Beagle have originated
[Link]/wiki/Image:Charles_Darwin_by_G._Richmond.jpg
[Link]/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg
Discovery (5): Survival of the Fittest
In his Origin of Species, Natural Selection
published in 1859, Darwin explains adaption
proposed how one species
might give rise to another.
Where food was limited,
competition meant that only
the fittest would survive.
This would lead to the natural selection
of the best adapted individuals and
eventually the evolution of a new species.
Darwin in 1860
[Link]/wiki/Image:Darwin%27s_finches.jpeg
Discovery (6): Huxley v. Wilberforce
Darwins idea of
Evolution by Natural
Selection was met with
huge controversy.
A famous debate in
1860 pitted Bishop
Wilberforce against
Darwins bulldog,
Bishop Wilberforce v. T. H. Huxley Thomas Henry Huxley.
Evolutionists got the better of the debate, but few were convinced
by Darwins idea of Natural Selection.
[Link]/religion/galleries/spiritualhistory/images/[Link]
Discovery (7): Genetics
Mendel and his peas From 1856-63, a monk called Gregor
Mendel cultivated 29,000 pea plants
to investigate how evolution worked
i.e., how characteristics were passed
down the generations.
He figured out the basic principles of
genetics. He showed that offspring
received characteristics from both
parents, but only the dominant
characteristic trait was expressed.
Mendels work only came to light in
1900, long after his death
[Link]/wiki/Image:[Link]
[Link]/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg
Discovery (8): Making Sense
In the early 20th century, scientist started to
make sense of how evolution worked.
Building on Mendels genetics, studies
showed how characteristics in a population
could be selected by environmental
pressures.
This Modern Synthesis, as Julian Huxley
Julian Huxley
called it, brought Darwins Natural Selection
and the
back to the centre of evolutionary theory.
Modern Synthesis
[Link]/wiki/Image:[Link]
Discovery (9): Opposition
Despite the achieval of
scientific consensus on
evolution, some Christian
groups continued to
oppose the concept.
In 1925, the teaching of
evolution was outlawed
in Tennessee, USA,
resulting in the infamous
Scopes Monkey Trial
Outside the Scopes Trial
[Link]/fellows/vedantam/publications/2006.02.05/eden_and_evolution/
Discussion: Should Creationism and Evolution
be given equal time in science lessons?
[Link]/wp-content/uploads/
2008/01/stop_following_me_creationist.jpg
Mechanism (1): All in the Genes
The genetic make-up of
an organism is known as
its genotype.
An organisms genotype
and the environment in
which it lives determines
its total characteristic traits
i.e. its phenotype.
Genotype Phenotype
[Link]/wiki/Image:DNA_double_helix_vertikal.PNG
Mechanism (2): DNA
The double-helix
structure of DNA
was discovered
in 1953.
This showed how
genetic information
is transferred from
one cell to another
almost without error.
Watson and Crick and DNA
their model of DNA replication
[Link]/~kalju/chem110L/public/tutorial/images/[Link]
[Link]/wiki/DNA
Mechanism (3): Mutation
Types of mutation However, occasional
mutations or copying errors
can and do occur when
DNA is replicated.
Mutations may be caused
by radiation, viruses, or
Mutant fruitfly
carcinogens.
Mutations are rare and often have
damaging effects. Consequently organisms
have special enzymes whose job it is to
repair faulty DNA.
[Link]/wikipedia/commons/7/79/[Link] [Link]/[Link]
Mechanism (4): Variation
Nevertheless, some
mutations will persist and
increase genetic variation
within a population.
Variants of a particular
gene are known as alleles.
For example, the one of
the genes for hair colour
comprises brown/blonde
alleles.
[Link]/[Link]/weblog/comments/racial_variation_in_so
me_parts_of_the_skull_involved_in_chewing/
Mechanism (5): Natural Selection
Selection of dark gene Mutant alleles spread through a
population by sexual reproduction.
If an allele exerts a harmful effect,
it will reduce the ability of the
individual to reproduce and the
allele will probably be removed
from the population.
In contrast, mutants with favorable
effects are preferentially passed on
[Link]/wiki/Image:Mutation_and_selection_diagram.svg
Mechanism (6): Peppered Moth
Haldane and the peppered moth The Peppered Moth is an
example of Natural Selection
in action discovered by Haldane
During the Industrial Revolution
the trees on which the moth
rested became soot-covered.
This selected against the allele for pale
colour in the population (which were
poorly camouflaged from predators)
[Link]
[Link]/wiki/Image:[Link]
and selected for the dark colour allele.
[Link]/wiki/J._B._S._Haldane
Mechanism (7): Microevolution
The dog is another example of how
selection can change the frequency
of alleles in a population.
Dogs have been artificially selected
for certain characteristics for many
years, and different breeds have
different alleles.
All breeds of dog belong to the same
species, Canis lupus (the wolf) so this
is an example of Microevolution as no
Dogs are wolves
new species has resulted.
[Link]/image-files/[Link]
Mechanism (8): Macroevolution
However, if two populations of a
species become isolated from
one another for tens of thousands
of years, genetic difference may
become marked.
If the two populations can no-longer
Galapagos finches
interbreed, new species are born.
This is called Macroevolution.
Darwins Galapagos finches are
an example of this process in action.
[Link]/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
Mechanism (9): Speciation Today?
The mosquito was introduced to
the London Underground during
its construction around 1900.
It became infamous in the War
for attacking people sheltering
London Underground Mosquito
from the Blitz.
Studies indicate several genetic
differences from its above-ground
ancestors. Interbreeding between
populations is difficult suggesting
[Link]/wiki/Image:[Link]
that speciation may be occurring.
[Link]/wiki/Culex
Activity
Natural Selection in the Peppered Moth
[Link]
[Link]/wiki/Image:[Link]
Evidence (1): Biochemistry
The basic similarity of all living things suggests
that they evolved from a single common ancestor.
As we have already seen, all living things pass
on information from generation to generation
using the DNA molecule.
All living things also use a molecule
called ATP to carry
DNA for energy around the
Information organism. ATP for
Transfer Energy
Transfer
[Link]/wiki/Image:[Link]
Evidence (2): Similar Genes
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCA TGACTGTTGAACGA
GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
If evolution is true then we might also expect that closely
related organisms will be more similar to one another than more
distantly related organisms.
Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by 15%.
Evidence (3): Comparative Anatomy
Similar comparisons can be made
based on anatomical evidence.
The skeleton of humans and
gorillas are very similar suggesting
they shared a recent common
ancestor, but very different from the
more distantly related
woodlouse
yet all have a common
shared characteristic:
Human and Gorilla
bilateral symmetry Woodlouse
[Link]/wiki/Image:[Link]
Evidence (4): Homology
The pentadactyl limb
is ancestral to all
vertebrates
but modified for different uses [Link]/wiki/Image:Evolution_pl.png
Evidence (5): Vestigial Structures
As evolution progresses, some
structures get side-lined as they
are not longer of use. These
are known as vestigial structures.
The coccyx is a much reduced
version of an ancestral tail, which
was formerly adapted to aid
balance and climbing.
The coccyx is a vestigial tail Another vestigial structure in
humans is the appendix.
[Link]/wiki/Image:Illu_vertebral_column.jpg
Evidence (6): Fossil Record
[Link]
World Health Org. [Link]/wiki/Image:Eopraptor_sketch5.png
NASA
origins bacteria complex cells dinosaurs humans
The fossil record shows a sequence from simple bacteria to
more complicated organisms through time and provides the most
compelling evidence for evolution.
Evidence (7): Transitional fossils
Many fossils show a clear
transition from one species,
or group, to another.
Archaeopteryx was found
in Germany in 1861. It
share many characteristics
with both dinosaurs and
birds.
It provides good evidence
Archaeopteryx
that birds arose from
[Link]/wiki/Image:Archaeopteryx_lithographica_paris.JPG
dinosaur ancestors
Evidence (8): Geography
Geographic spread of
Marsupials organisms also tells of
their past evolution.
Marsupials occur in
two populations today
in the Americas and
Australia.
This shows the group
evolved before the
continents drifted apart
[Link]/evosite/lines/[Link]
[Link]/wiki/Image:Kangaroo_and_joey03.jpg
Evidence (9): Antibiotic resistance
Staphylococcus
We are all familiar with
the way that certain
bacteria can become
resistant to antibiotics
This is an example of natural selection in
action. The antibiotic acts as an
environmental pressure. It weeds out
those bacteria with low resistance and
only those with high resistance survive
to reproduce.
[Link]
[Link]/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg
Evolution
[Link]/wiki/Image:DNA_double_helix_vertikal.PNG [Link]/wiki/Image:Charles_Darwin_1881.jpg