0% found this document useful (0 votes)
20 views54 pages

Understanding DNA Computing Basics

DNA can store information extremely densely due to its structure. DNA computing seeks to leverage this capability by using DNA strands to represent and process information in massively parallel ways. In 1994, Leonard Adleman demonstrated how DNA could be used to solve a computational problem by representing a graph as DNA strands and using biochemical operations to generate and test random paths through the graph. This represented the first experimental implementation of a DNA computer and showed the potential of this approach for solving difficult problems.

Uploaded by

arya_accent
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
20 views54 pages

Understanding DNA Computing Basics

DNA can store information extremely densely due to its structure. DNA computing seeks to leverage this capability by using DNA strands to represent and process information in massively parallel ways. In 1994, Leonard Adleman demonstrated how DNA could be used to solve a computational problem by representing a graph as DNA strands and using biochemical operations to generate and test random paths through the graph. This represented the first experimental implementation of a DNA computer and showed the potential of this approach for solving difficult problems.

Uploaded by

arya_accent
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd

DNA COMPUTING

Presented by:-
Anupam Kumar
S-7,IT ‘A’
INTRODUCTION

What is DNA Computing?


 Around 1950 first idea (precursor Feynman)
 Technology seeks to capitalize on enormous informational capacity of DNA.

 Marriage of computer technology and Biology.

 First important experiment 1994: Leonard Adleman

 Massive parallelism.

DNA Computing 2
Introduction

 Ever wondered where we would find the new material


needed to build the next generation of
microprocessors????
HUMAN BODY (including yours!)…….DNA computing.
 “Computation using DNA” but not “computation on
DNA”
 Initiated in 1994 by an article written by Dr.
Adleman on solving HDPP using DNA.

Deepthi Bollu 3
Uniqueness of DNA

Why is DNA a Unique Computational Element???

 Extremely dense information storage.


 Enormous parallelism.
 Extraordinary energy efficiency.

Deepthi Bollu 4
Dense Information Storage
This image shows 1 gram of
DNA on a CD. The CD can hold
800 MB of data.

The 1 gram of DNA can hold


about 1x1014 MB of data.

The number of CDs required to


hold this amount of information,
lined up edge to edge, would
circle the Earth 375 times, and
would take 163,000 centuries to
listen to. Deepthi Bollu 5
How Dense is the Information Storage?

 with bases spaced at 0.35 nm along DNA, data


density is over a million Gbits/inch compared to 7
Gbits/inch in typical high performance HDD.
 Check this out………..

Deepthi Bollu 6
How enormous is the parallelism?

 A test tube of DNA can contain trillions of strands.


Each operation on a test tube of DNA is carried out
on all strands in the tube in parallel !
 Check this out……. We Typically use

Deepthi Bollu 7
How extraordinary is the energy efficiency?

 Adleman figured his computer was running


2 x 1019 operations per joule.

Deepthi Bollu 8
A Little More………

 Basic suite of operations: AND,OR,NOT & NOR


in CPU while cutting, linking, pasting, amplifying
and many others in DNA.

 Complementarity makes DNA unique. Ex: in


Error correction.

Deepthi Bollu 9
Biochemistry Basics
Extraction
 given a test tube T and a strand s, it is possible to extract all the strands in T that contain s as a subsequence, and to separate them from those that do not contain
it.

Spooling the DNA with a metal


hook or similar device

Precipitation of more DNA


strands in alcohol
Formation of DNA strands.
Deepthi Bollu 11
Annealing

The hydrogen bonding


between two
complimentary
sequences is weaker
than the one that links
nucleotides of the same
[Link] is possible to
pair(anneal) and
separate(melt) two
antiparallel and
complementary single
strands.
Curves represent single strands of DNA ogilonucleotides. The half arrow head represents the 3’ end
of the strand. The dotted lines indicate the hydrogen bonding joining the strands.
Deepthi Bollu 12
Polymerase Chain Reaction
PCR: One way to
amplify DNA.
PCR alternates
between two phases:
separate DNA into
single strands using
heat; convert into
double strands using
primer and
polymerase reaction.
PCR rapidly amplifies
a single DNA
molecule into billions
of molecules
Deepthi Bollu 13
Gel Electrophoresis

 Used to measure the length of a DNA molecule.


 Based on the fact that DNA molecules are –ve ly
charged.

Gel Electrophoresis
Deepthi Bollu 14
How to fish for known molecules?

 Annealing of complimentary strands can be used for


fishing out target molecules.
 Denature the double stranded molecules.
 The probe for s molecules would be s.
 We attach probe to a filter and pour the solution S through
it.
 We get double stranded molecules fixed to filter and the
solution S’ resulting from S by removing s molecules.
 Filter is then denatured and only target molecule remains.
 Adleman attached probes to magnetic beads.
Deepthi Bollu 15
Adleman’s solution of the Hamiltonian
Directed Path Problem(HDPP).

I believe things like DNA computing will eventually


lead the way to a “molecular revolution,” which
ultimately will have a very dramatic effect on the
world. – L. Adleman
The Problem

 A directed Graph G=(V,E)


 |V|=n, |E|=m and two distinguished vertices
Vin = s and Vout= t.
 Verify whether there is a path (s,v1,v2,….,t)
 which is a sequence of “one-way” edges that begins in Vin and Vout
 whose length (in [Link] edges) is n-1 and
(i.e. enters all vertices.)
 Whose vertices are all distinct
(i.e. enters every vertex exactly once.)

A CLASSIC NP-COMPLETE PROBLEM!!!


Deepthi Bollu 17
Example
What happens if 2 6
some edge ex:24 is
removed from the
graph??
s 4 t
What happens if
the designated
vertices are changed
to Vin = 2 and Vout
=4?? 3 5
A directed Graph. An st hamiltonian path is (s,2,4,6,3,5,t).Here Vin =s and Vout =t.

Deepthi Bollu 18
Why not brute force algorithm?

 Brute force algorithm is to


 Generate all possible paths with exactly n-1 edges

 Verify whether one of them obeys the problem constraints.

 Problem: How many paths can there be???


such paths could be (n-2)!

 So, what did Dr. Adleman use?


‘Generate and test’ strategy where number of random paths were
generated and tested.

Deepthi Bollu 19
Adleman’s Experiment

 makes use of the DNA molecules to solve HDPP.


 good thing about random path generation-each path can be generated
independent of all others bringing into picture-- “Parallelism” . On the
other hand adding “Probability” too.
 No. of Lab procedures grows linearly with the no. of vertices in the
graph.
 Linear no. of lab procedures is due to the fact that an exponential no. of
operations is done in parallel.
 At the heart, it is a brute force algorithm executing an exponential
number of operations.

Deepthi Bollu 20
Algorithm(non-deterministic)

[Link] Random paths


[Link] all paths created in step 1, keep only those that
start at s and end at t.
[Link] all remaining paths, keep only those that visit
exactly n vertices.
[Link] all remaining paths, keep only those that visit
each vertex at least once.
[Link] any path remains, return “yes”;otherwise, return
“no”.
Deepthi Bollu 21
Step [Link] Path Generation.

 Assumptions
 Random single stranded DNA sequences with 20 nucleotides are available.
 Generation of astronomical number of copies of short DNA strands is easy to do.

 Vertex representation
 Each vertex v in the graph is associated with a random 20-mer sequence of DNA
denoted by Sv. .
 For each such sequence obtain its complement Sv.
 Generate many copies of each Sv sequence in test tube T1.

Deepthi Bollu 22
For example, the sequences chosen to represent vertices 2,4 and 5 are
the following:

S2 = GTCACACTTCGGACTGACCT
S4 = TGTGCTATGGGAACTCAGCG
S5 = CACGTAAGACGGAGGAAAAA
5’ 20 mer 3’
The reverse complement of these sequences are:

S2 = AGGTCAGTCCGAAGTGTGAC
S4 = CGCTGAGTTCCCATAGCACA
S5 = TTTTTCCTCCGTCTTACGTG
Deepthi Bollu 23
Step1. Random Path Generation.

 Edge representation
 For each edge uv in the graph, the oligonucleotide Suv is created
that is 3’ 10-mer of Su followed by 5’ 10-mer of Sv
 If u=s then it is all of Su or if v=t then it is all of Sv. ([Link] edge
denoted by 20-mer while the edge that involves either s or t is a 30-
mer.)
 With this construction, Suv = Svu . (Preservation of Edge
Orientation.)
 Generate many copies of each Suv sequence in test tube T2

Deepthi Bollu 24
5’ S2 3’ 5’ S4 3’

Edge(2,4)

5’ S4 3’ 5’ S5 3’

Edge(4,5)

Deepthi Bollu 25
S2 = GTCACACTTCGGACTGACCT
S4 = TGTGCTATGGGAACTCAGCG
S5 = CACGTAAGACGGAGGAAAAA

S2 = AGGTCAGTCCGAAGTGTGAC
S4 = CGCTGAGTTCCCATAGCACA
S5 = TTTTTCCTCCGTCTTACGTG

So,we build edges (2,4) and (4,5) from the above sequences obtaining
them in the following manner:

(2,4) = GGACTGACCTTGTGCTATGG
(4,5) = GAACTCAGCGCACGTAAGAC

Deepthi Bollu 26
[Link] Path Generation

 Path Construction
 Pour T1 and T2 into T3.
 In T3 many ligase reactions will take place.

(Ligase Reaction or ligation: There is an enzyme


called Ligase, that causes concatenation of two
sequences in a unique strand.)

Deepthi Bollu 27
[Link] Path Generation

 By executing these 3 operations,we get many random paths for the


following reasons:
 Consider Su,Sv,Sw,Suv,Svw for u,v,w distinct vertices.
 10 base suffix of one Su sequence will bind to the 10 base prefix of
one Suv sequence. (one is complement of the other.)
 At the same time 10-base suffix of same sequence Suv binds to the
10-base prefix of one Sv sequence
 Sv 10-base suffix binds to the 10-base prefix of one Svw sequence.
 The final double strand thus obtained encodes (u,v,w) in G.

Deepthi Bollu 28
Examples of random paths formed

S2 S4 S6 S2 s S3
E24 E46 E62 E2s Es3

S6 S3 S5 t
E63 E35 E5t

s S2
Es2

Deepthi Bollu 29
Formation of Paths from Edges
and compliments of vertices

Edge uv Edge vw


Su Sv Sw

Deepthi Bollu 30
Finally the path (2,4,5) will be encoded by the following double strand.

5’ (2,4)
GTCACACTTCGGACTGACCTTGTGCTATGG……………
CAGTGTGAAGCCTGACTGGAACACGATACCCTTGAGTCGC

 S2 S4 

(4,5) 3’
……….. GAACTCAGCGCACGTAAGACGGAGGAAAAA
…..GTGCATTCTGCCTCCTTTTT
S5 

Deepthi Bollu 31
Step 2
“keep only those that start at s and end at t.”

 Product of step 1 was amplified by PCR using


primers Ss and St.
 By this, only those molecules encoding paths that
begin with vertex s and end with vertex t were
amplified.

Deepthi Bollu 32
Step 3
“keep only those that visit exactly n vertices”

 Product of step 2 is run on agarose gel and


the 140bp (since 7 vertices) band was
excised and soaked in doubly distilled H2O to
extract DNA.
 This product is PCR amplified and gel
purified several times to enhance its purity.

Deepthi Bollu 33
Step 3
“keep only those that visit exactly n vertices”

 DNA is negatively charged.


 Place DNA in a gel matrix at the negative end. (Gel
Electrophoresis)
 Longer strands will not go as far as the shorter
strands.
 In our example we want DNA that is 7 vertice times
20 base pairs, or 140 base pairs long.

Deepthi Bollu 34
Step 4
“keep only those that visit each vertex at least once”

 From the double stranded DNA product of step3,


generate single stranded DNA.
 Incubate the single stranded DNA with S2 conjugated
to the magnetic beads.
 Only single stranded DNA molecules that contained
the sequence S2 annealed to the bound S2 and were
retained
 Process is repeated successively with S4,S6,S3,S5
Deepthi Bollu 35
Step 4
“keep only those that visit each vertex at least once”

 Filter the DNA searching for one vertex at a


time.
 Do this by using a technique called Affinity
Purification. (think magnetic beads)
s 2 4 6 3 5 t

compliment Magnetic bead

Deepthi Bollu 36
Step 5:Obtaining the Answer

 Conduct a “graduated PCR” using a series of PCR


amplifications.
 Use primers for the start, s and the nth item in the
path.
 So to find where vertex 4 lies in the path you would
conduct a PCR using the primers from vertex s and
vertex 4.
 You would get a length of 60 base pairs.
 60 / 20 nucleotides in the path = 3rd vertex.

Deepthi Bollu 37
B. Graduated PCR of the product
A. Product of the ligation from step 3( 1 thru 6)
reaction (lane 1),
the molecular weight marker is in
PCR amplification of the lane 7.
product of the ligation
reaction ( 2 thru 5)
molecular weight marker in
base pairs (lane 6).

NOTE: These figures relate to the graph used


by Dr. Adleman.
Deepthi Bollu 38
C. Graduated PCR of the final product of the experiment, revealing the
Hamiltonian Paths ( 1 thru 6 ).
The molecular weight marker is in lane 7.

Deepthi Bollu 39
Discover magazine published
an article in comic strip format
about Leonard Adleman's
discovery of DNA computation.
Not only entertaining, but also
the most understandable
explanation of molecular
computation I have Ever seen.

Deepthi Bollu 40
Recap of HDPP

 1. Generate random paths through graph G. (Annealing and Ligation)


 2. Select paths that begin with Vin and terminate with Vout . (PCR with
selected primers)
 3. From step 2, select those paths with exactly n vertices. (Gel
purification)
 4. From step 3, select those paths that contain every vertex. (Magnetic
bead purification)
 5. If any paths exist from step 4, then there exists a Hamiltonian path.
(PCR)

Deepthi Bollu 41
DANGEROUS ERRORS
Danger of Errors possible
 Assuming that the operations used by Adleman model are
perfect is not true.
 Biological Operations performed during the algorithm are

susceptible to error
 Only that which happens within the boundaries of 3

dimensional world are counted…lot of probability


involved!

 Errors take place during the manipulation of DNA strands.


Most dangerous operations:
 The operation of Extraction

 Undesired annealings.

Deepthi Bollu 43
The operation of Extraction

 What would happen if a ‘good’ path were lost during


one of the extraction operations in step4?
-FALSE NEGATIVE!
-Adleman’s suggestion: to amplify the content
of the test tube.
 What if a ‘bad’ path is taken as if it were ‘good’?
-FALSE POSITIVE!!
-Less dangerous,because the solution could be
verified at the end of the computation.
Deepthi Bollu 44
Undesired Annealings
 Types of Undesired annealings-
 Partial Matches:A strand u could anneal with one that’s similar to ū, but it is
not the right one.
 Undesired matches between two shifted strands:
Ex:A strand vu could partially anneal with ūw.
 Finally,a strand could anneal with itself, losing its linear structure.
 How can the probability of all these undesired annealings be
decreased??
 with an opportune choice of strands used to encode the data of the problem.

Deepthi Bollu 45
LIMITATIONS
DNA Vs Electronic computers

 At Present,NOT competitive with the state-of-the-art


algorithms on electronic computers
 Only small instances of HDPP can be [Link]?..for n
vertices, we require 2^n molecules.
 Time consuming laboratory procedures.
 Good computer programs that can solve TSP for 100 vertices
in a matter of minutes.
 No universal method of data representation.

Deepthi Bollu 47
Size restrictions

 Adleman’s process to solve the traveling


salesman problem for 200 cities would
require an amount of DNA that weighed
more than the Earth.
 The computation time required to solve
problems with a DNA computer does not
grow exponentially, but amount of DNA
required DOES.

Deepthi Bollu 48
Error Restrictions

 DNA computing involves a relatively large


amount of error.
 As size of problem grows, probability of
receiving incorrect answer eventually
becomes greater than probability of receiving
correct answer

Deepthi Bollu 49
Hidden factors affecting complexity
 There may be hidden factors that affect the time and
space complexity of DNA algorithms with
underestimating complexity by as much as a
polynomial factor because:
 they allow arbitrary number of test tubes to be poured
together in a single operation.
 Unrealistic assessment of how reactant concentrations
scale with problem size.

Deepthi Bollu 50
Some more……….

 Different problems need different approaches.

 requires human assistance!

 DNA in vitro decays through time,so lab procedures should not take too
long.

 No efficient implementation has been produced for testing, verification and


general experimentation.

Deepthi Bollu 51
THE FUTURE!
 Algorithm used by Adleman for the traveling salesman problem was simple. As
technology becomes more refined, more efficient algorithms may be discovered.

 DNA Manipulation technology has rapidly improved in recent years, and future
advances may make DNA computers more efficient.

 The University of Wisconsin is experimenting with chip-based DNA computers.

 DNA computers are unlikely to feature word processing, emailing and solitaire
programs.

 Instead, their powerful computing power will be used for areas of encryption,
genetic programming, language systems, and algorithms or by airlines wanting to
map more efficient routes. Hence better applicable in only some promising areas.

Deepthi Bollu 52
THANK YOU!

It will take years to develop a practical,


workable DNA computer.

But…Let’s all hope that this DREAM comes


true!!!

Deepthi Bollu 53
References

 “Molecular computation of solutions to


combinatorial problems”- Leonard .M. Adleman
 “Introduction to computational molecular biology”
by joao setubal and joao meidans -Sections 9.1 and
9.3
 “DNA computing, new computing paradigms” by
[Link], [Link], [Link]-chapter 2

Deepthi Bollu 54

You might also like