Emily Buckhouse
Nitrogenous Bases
Nucleosides
Base linked to a 2-deoxy-D-ribose at 1 carbon
Nucleotides
Nucleosides with a phosphate at 5 carbon
Phosphodiester Bond
DNA Polymerase
Determining the Sequence of DNA
Methods:
1. Chain termination or dideoxy method
F. Sanger
2. Shotgun sequence method
3. 2nd generation sequence methods
Pyrosequencing
Dideoxy (Sanger) Method
4 Steps:
1. Denaturation
2. Primer attachment and extension of bases 3. Termination
4. Gel electrophoresis
Overview: Dideoxy (Sanger) Method
2 3
1 4
Gel electrophoresis
Dideoxy (Sanger) Method
ddNTP- 2,3dideoxynucleotide No 3 hydroxyl Terminates chain when incorporated Add enough so each ddNTP is randomly and completely incorporated at each base
Dideoxy Method
Run four separate reactions each with different ddNTPs Run on a gel in four separate lanes Read the gel from the bottom up
Automated Version of the Dideoxy Method
So Whats Wrong With It?
The dideoxy method is good only for 500-750bp reactions Expensive Takes a while The human genome is about 3 billion bp
Human Genome Project
Began in 1990 Why?
Human evolution Nature versus nurture Causes of disease
Shotgun Sequencing
Used to sequence whole genomes Steps: DNA is broken up randomly into smaller fragments Dideoxy method produces reads Look for overlap of reads
Sequence AGCATGCTGCAGTCATGCT------First Shotgun Sequence -------------------TAGGCTA AGCATG-------------------Second Shotgun Sequence ------CTGCAGTCATGCTTAGGCTA AGCATGCTGCAGTCATGCTTAGGCTA Reconstruction Strand
2nd Generation: Pyrosequencing
Sequencing by synthesis Advantages:
Accurate Parallel processing Easily automated Eliminates the need for labeled primers and
nucleotides No need for gel electrophoresis
Pyrosequencing
Basic idea:
Visible light is generated and is proportional to the
number of incorporated nucleotides 1pmol DNA = 6*1011 ATP = 6*109 photons at 560nm
DNA Polymerase I from [Link]. pyrophospate
From fireflies, oxidizes luciferin and generates light
Pyrosequencing
1st Method
Solid Phase Immobilized DNA 3 enzymes Wash step to remove nucleotides after each addition
Pyrosequencing
2nd Method
Liquid Phase 3 enzymes + apyrase (nucleotide degradation enzyme)
Eliminates need for washing step
In the well of a microtiter plate: primed DNA template 4 enzymes Nucleotides are added stepwise Nucleotide-degrading enzyme degrade previous nucleotides
Pyrosequencing Method:
Pyrosequencing Results:
Pyrosequencing Disadvantages
Smaller sequences Nonlinear light response after more than 5-6 identical nucleotides
Summary
DNA sequencing is a common procedure Dideoxy method
Chain termination method Best for small DNA segments
Whole genome shotgun sequencing
Sequence human genome Fragments larger DNA strand to manageable
chunks
Pyrosequencing
Sequence by synthesis Accurate and fast
References
Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000)
Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3rd ed. Pgs 337340.
Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. 74, 560-564.
Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3-11.
Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. 94, 5463-5467.
Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, 1135-1145
Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.
