0% found this document useful (0 votes)
3 views48 pages

Chapter 6

This chapter covers complex patterns of inheritance, including concepts such as incomplete dominance, codominance, and multiple alleles. It highlights the significance of the Human Genome Project and the ethical implications of genetic research, while also providing examples of genetic disorders like sickle cell anemia and familial hypercholesterolemia. Additionally, it introduces the use of Punnett squares for solving genetics problems and emphasizes the importance of collaboration in scientific research.

Uploaded by

quynh nguyen
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
3 views48 pages

Chapter 6

This chapter covers complex patterns of inheritance, including concepts such as incomplete dominance, codominance, and multiple alleles. It highlights the significance of the Human Genome Project and the ethical implications of genetic research, while also providing examples of genetic disorders like sickle cell anemia and familial hypercholesterolemia. Additionally, it introduces the use of Punnett squares for solving genetics problems and emphasizes the importance of collaboration in scientific research.

Uploaded by

quynh nguyen
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

CHAPTER Complex Patterns of Inheritance

6
Specific Expectations
In this chapter, you will learn how to . . .
• D1.1 analyze, on the basis of research,
some of the social and ethical
implications of research in genetics and
genomics (6.3)

• D1.2 evaluate, on the basis of research,


the importance of some recent
contributions to the knowledge,
techniques, and technologies related to
genetic processes (6.3)

• D 2.1 use appropriate terminology


related to genetic processes (6.1, 6.2, 6.3)

• D2.3 use the Punnett square method to


solve basic genetics problems involving
monohybrid crosses, incomplete
dominance, codominance, dihybrid
crosses, and sex-linked genes (6.1, 6.2)

• D3.3 explain the concepts of genotype,


phenotype, dominance, incomplete
dominance, codominance, recessiveness,
and sex linkage according to Mendelian
laws of inheritance (6.1, 6.2)

• D3.4 describe some genetic disorders


caused by chromosomal abnormalities
or other genetic mutations in terms of
chromosomes affected, physical effects,
and treatments (6.1, 6.2)

The inherited traits of an individual are the result of a complex


array of genetic interactions. As genetics research continues to
advance, we have a better understanding of these complexities.
A significant advancement is the Human Genome Project. In 2003,
a team of over 2000 researchers, working in laboratory groups around
the world, completed the Human Genome Project. For this project,
numerous images like the one shown here were analyzed. This photo
shows the products of chemical reactions that are used to identify
the nucleotide sequence of a piece of DNA. Scientists used these to
determine, base by base, the DNA sequence of the human genome.
Other goals of the Human Genome Project included identifying
all of the human genes and making them available for study. Because
such scientific goals have consequences for society, there are also
groups of researchers that explore and monitor the ethical and social
impacts of these scientific achievements.

240 MHR • Unit 2 Genetic Processes


Launch Activity

Assembling a Mini-Genome
The 46 chromosomes that make up our genome contain over
3 000 000 000 base pairs. Each chemical reaction that is used to determine
the sequence of DNA can only provide the sequence of a few hundred
bases at a time. Therefore, to determine the DNA sequence of the human
genome, scientists all over the world worked together to analyze millions
of DNA sequencing reactions. They then assembled the DNA sequence
of the human genome by piecing together the much smaller fragments of
sequences. In this activity, you will model how scientists did this.

output

ultraviolet light

gel detector computer


gel lanes

TATAAAACATTTTAAAAGC TAGTACCCAGTACCTTCTAGTTCCAAAGCCCAATGTTGTTCAC TATGGTTCACAATGGGACCA


140 150 160 170 180 190 200 210 220

The products of a DNA sequencing reaction are modified so they are visible
under ultraviolet light. They are then separated in each lane of a gel-like material.
The information in each lane is sent to a computer, which provides output
in the form of a printout of the sequence of bases in a piece of DNA. Recall
that nucleotides are often identified by their bases. For these data, red bands
represent thymines, green bands represent adenines, blue bands represent
cytosines, and black bands represent guanines.

Materials
• paper DNA fragments
• tape

Procedure
1. Obtain the sequence of DNA that you are to work with from
your teacher.
2. With your classmates, construct one continuous segment of
sequenced DNA from your individual fragments by matching
overlapping sections and taping them into place.

Questions
1. How did you decide how to match and link the fragments together?
2. How important was it to collaborate and discuss your results with
other class members in order to obtain the full sequence?
3. How important do you think it was for scientists to develop a
systematic and organized approach to sequencing the human genome?
How do you think computers played a role?

Chapter 6 Complex Patterns of Inheritance • MHR 241


SECTION
Beyond Mendel’s Observations of Inheritance
6.1
Key Terms Much of today’s genetics research uses sophisticated technologies to study cellular
processes at the level of individual molecules and atoms. In addition, international
incomplete dominance
research collaborations and multi-million-dollar budgets are now common. Think of
codominance
what a stark contrast this is to Mendel’s experiments. It is astounding that Mendel’s
heterozygous advantage basic and, at times, simple observations led him to infer patterns of inheritance that
continuous variation still form the basis of our current understanding of heredity.
polygenic trait As more sophisticated experimental technologies became available, scientists realized
that patterns of inheritance are more complicated than what Mendel proposed. Some
patterns result in phenotypes that are between dominant and recessive phenotypes.
Other patterns result in phenotypes that are created when both alleles for a trait are
equally expressed.

Incomplete Dominance
Incomplete dominance describes a condition in which neither of the two alleles for the
incomplete dominance
a condition in which same gene can completely conceal the presence of the other. As a result, a heterozygote
neither allele for a gene exhibits a phenotype that is somewhere between a dominant phenotype and a recessive
completely conceals the phenotype. One example is the flower colour of snapdragons (Antirrhinum majus).
presence of the other; it As you can see in Figure 6.1, a cross between a true-breeding red-flowered plant and
results in intermediate
expression of a trait a true-breeding white-flowered plant produces offspring with pink flowers in the
F1 generation. If the F1 plants are allowed to self-fertilize, the F2 generation will
include offspring with all three phenotypes—red, pink, and white. The Punnett square in
Figure 6.1 predicts that all three phenotypes will be observed in the F2 generation in a ratio
of 1:2:1 (red:pink:white), which is what is observed experimentally. In true Mendelian
inheritance, we would have predicted a phenotypic ratio of 3:1. Nevertheless, the alleles
for flower colour do segregate according to Mendel’s law of independent assortment.
When representing incomplete dominance, upper-case and lower-case letters are
not usually used to represent the alleles, since neither allele is dominant over the other.
One way to represent incomplete dominance is by using superscripts. In the example of
snapdragon flower colour, both alleles affect the colour of the flower, C. The two alleles
are represented as superscripts, R for red (CR), and W for white (CW). Lower-case
letters are only used to represent a recessive allele.
Figure 6.1 When red P generation F1 generation F2 generation
(C RC R) flowers and white
(C WC W) flowers of the gametes
snapdragon are crossed,
the resulting offspring have C RC R CR
self-fertilization
an intermediate phenotype, of F1 offspring CR CW
pink flowers (C RC W). In
the F2 generation, all three C RC W
CR
phenotypes are observed.
red C RC R C RC W

× CW

C RC W C WC W
C WC W CW
pink

white

242 MHR • Unit 2 Genetic Processes


Incomplete Dominance and Human Disease
There are many examples of genetic disorders in humans that exhibit incomplete
dominance. For example, there is a genetic disorder, called familial hyper-
cholesterolemia, that prevents tissues from removing low-density lipoproteins (LDL)
from the blood and causes very high levels of cholesterol in the bloodstream. In the
majority of cases, the disorder is due to a mutation in the LDLR gene. LDL particles
transport molecules like cholesterol throughout the body. The mutated version of the
LDLR gene no longer produces a protein that interacts with LDL particles and removes
them from the bloodstream. This disorder has an autosomal dominant inheritance
pattern. So, an individual only requires one allele of the mutated form of the gene to
show symptoms of the disorder. However, if the allele for the normal form of the gene
is present, symptoms of the disease will not be as severe. People who are homozygous
dominant for the trait have six times the normal amount of LDL in their blood and
may have a heart attack by the age of 2. Heterozygotes have about twice as much
cholesterol in their blood and may have a heart attack by the age of 35.
Scientists are now finding that identifying the patterns of inheritance for many
traits is not as straightforward as first thought. Today’s more accurate techniques
are showing that, in some cases, what had been identified as a dominant inheritance
pattern may actually be incomplete dominance. As a result, an individual who is
heterozygous for a trait is not exactly the same as an individual who is homozygous
dominant for the trait.

Codominance
Codominance is a situation in which both alleles are fully expressed. A roan animal is
codominance the
an excellent, visible example of codominance. A roan animal is a heterozygote in which condition in which
both the base colour and white are fully expressed. If you look closely at the individual both alleles for a trait
hairs on a roan animal, such as the cow in Figure 6.2, you will see a mixture of red are equally expressed
hairs and white hairs. One allele is expressed in the white hairs, and the other allele is in a heterozygote; both
alleles are dominant
expressed in the red hairs.

Figure 6.2 A roan cow is the product of a mating between a red cow and a white cow. The red
and white hairs may be present in patches, as shown here, or be completely intermingled.

Chapter 6 Complex Patterns of Inheritance • MHR 243


Sickle Cell Anemia
Sickle cell anemia is one of the most thoroughly studied genetic disorders. Although it
heterozygous
advantage a survival is often described as being the result of autosomal recessive inheritance, it is actually
benefit for individuals an example of codominance. Sickle cell anemia is caused by a specific form of the gene
who inherit two that directs the synthesis of hemoglobin. Hemoglobin carries oxygen in the blood.
different alleles for the The hemoglobin molecule that is made in individuals with the sickle cell allele leads
same trait
to a C-shaped (or sickled) red blood cell. These misshaped red blood cells, like the
one shown in Figure 6.3, do not transport oxygen effectively because they cannot pass
through small blood vessels. This leads to blockages and tissue damage.
The allele for normal hemoglobin is represented as Hb A, and the allele for sickle
cell hemoglobin is represented as HbS. As shown in Figure 6.4, individuals who are
homozygous (HbSHbS) have sickle cell anemia. Individuals who are heterozygous
(Hb AHbS) have some normal and some sickled red blood cells. These individuals are
said to have the sickle cell trait, but they rarely experience any symptoms. In fact,
having the sickle cell trait can be an advantage, because these heterozygotes are more
resistant to malaria. Malaria is a life-threatening disease caused by a parasite that
Figure 6.3 Normal red
is transmitted to humans through mosquito bites. The parasite infects the liver and
blood cells are flat and eventually the red blood cells. The sickling of red blood cells is thought to prevent the
disk-shaped. Sickle-shaped parasites from infecting the cells. Resistance to malaria is very beneficial in certain
cells are elongated and parts of Africa, where deadly epidemics can occur. The sickle cell trait is an example
“C” shaped.
of the principle of heterozygous advantage, which describes a situation in which
heterozygous individuals have an advantage over both homozygous dominant and
homozygous recessive individuals.

A S
Hb Hb

A A A A S
Hb Hb Hb Hb Hb

A A A S A S S S
Hb Hb Hb Hb Hb Hb Hb Hb
S A S S S
sickle cell sickle cell Hb Hb Hb Hb Hb
trait trait

sickle cell sickle cell sickle cell


normal
trait trait anemia

Figure 6.4 When a man and a woman are both heterozygous for the sickle cell
gene, there is a one in four chance that they will have a child with sickle cell anemia.

Learning Check

1. Distinguish between incomplete dominance and 4. The frequency of the appearance of the sickle cell
codominance. allele in human populations is much higher in
2. Why do geneticists use notations like CW and CR to Africa than in most other areas of the world. What
describe incomplete or codominant alleles instead of has been proposed to explain this observation?
using W and w or R and r ? 5. Provide two pieces of evidence that support the idea
3. A plant that produces white flowers is crossed with that some inheritance patterns are more complex
a plant that produces purple flowers. Describe the than those originally proposed by Mendel.
phenotype of the offspring if the inheritance pattern 6. Scientists first thought that sickle cell anemia was
for flower colour is inherited as an autosomal recessive allele. What led
a. incomplete dominance them to identify the true inheritance pattern of
b. codominance the disease?

244 MHR • Unit 2 Genetic Processes


Multiple Alleles
The traits you have studied so far have all been controlled by one gene with two alleles,
such as the flower colour in pea plants. Many traits in humans and other species are
the result of the interaction of more than two alleles for one gene. A gene with more
than two alleles is said to have multiple alleles. As you know, any individual has only
two alleles for each gene—one allele on each homologous chromosome. However, many
different alleles for a gene can exist within the population as a whole.
Possible alleles from female

Human Blood Groups lA or lB or i


Do you know what blood type you are? In humans, a single gene
determines a person’s ABO blood type. This gene determines what type
lA lAlA lAlB lAi
of an antigen protein, if any, is attached to the cell membrane of red blood

Possible alleles from male


cells. An antigen protein is a molecule that stimulates the body’s immune or
system. The gene is designated I, and it has three common alleles: IA, IB,
and i. As shown in Figure 6.5, the different combinations of the three alleles lB lAlB lBlB lBi
produce four different phenotypes, which are commonly called blood or
types A (IAIA homozygotes or IAi heterozygotes), B (IBIB homozygotes or
IBi heterozygotes), AB (IAIB heterozygotes), and O (ii homozygotes). The i lAi lBi ii
IA allele is responsible for the presence of an A antigen on the red blood
cells. The IB allele is responsible for the presence of the B antigen, and
the i allele results in no antigen. Of the three alleles that determine blood blood types A AB B O
type, one (i ) is recessive to the other two, and the other two (IA and IB)
are codominant. Figure 6.5 Different combinations
of the three I alleles result in four
different blood types: type A,
Rabbit Coat Colour
type B, type AB, and type O.
Another example of multiple alleles involves coat colour in rabbits, as shown in
Figure 6.6. The gene that controls coat colour in rabbits has four alleles: agouti
(C ), chinchilla (cch), Himalayan (ch), and albino (c). In that order, each allele
is dominant to all the alleles that follow. The order of dominance sequence can
be written as C > cch > ch > c, where the symbol > means is dominant to.

agouti Himalayan

chinchilla

albino

Figure 6.6 Rabbits have multiple alleles for coat colour, with four possible phenotypes.
Predict the possible genotypes for each rabbit.

Chapter 6 Complex Patterns of Inheritance • MHR 245


Clover Leaf Patterns
The pattern on the leaves of the clover plant is also controlled by multiple alleles. While
a single gene is responsible for clover leaf pattern, there are seven different alleles for
the pattern. Varying combinations of these result in 22 different patterns that can be
expressed in clover leaves. Patterns for the seven homozygous combinations of alleles
are shown in Figure 6.7.
Figure 6.7 There are seven
different alleles for clover
leaf pattern. v/v vl/vl vh/vh vf/vf vba/vba vb/vb vby/vby

Sample Problem

Using a Punnett Square to Analyze Inheritance of Multiple Alleles


Problem
If a man has type O blood and a woman has type B blood, what possible blood types
could their children have? If this couple has six children, all with type B blood, what
could you infer about the woman’s genotype?

What Is Required?
You are asked to determine all possible blood types of the children and the possible
genotype of the mother based on all the children having type B blood.

What Is Given?
The man has blood type O, the woman has blood type B.

Plan Your Strategy Act on Your Strategy


Determine the possible genotypes of Since the man has blood type O, his genotype must be ii.
the man and the woman. The woman has blood type B, so her genotype could be
either IBIB or IBi.
Make Punnett squares for all the mother
possible combinations of genotypes. IB IB
i IBi IBi
father
i IBi IBi

mother
IB i
i IBi ii
father
i IBi ii

List all the possible genotypes and The children could have genotype IBi, resulting in type B
phenotypes of the children. blood, or genotype ii, resulting in type O blood.

What could be the mother’s genotype The mother`s genotype is most likely IBIB.
based on the children being type B?

Check Your Solution


The only genotype that produces type O blood is ii. To have type B blood, the woman must
have at least one IB allele. Her second allele could be either IB or i. Since all of the children
had to receive an i allele from their father, they must have inherited an IB allele from their
mother. Since all of the children have type B blood, the mother is most likely IBIB.

246 MHR • Unit 2 Genetic Processes


Practice Problems

1. If a man has type AB blood and a woman has type 8. In one family, all three siblings have type B blood.
A blood, what possible blood types could their a. Use Punnett squares to show how two different
children have? sets of parent genotypes could produce this result.
2. A baby has blood type AB. If the baby’s mother b. Which of the two sets of potential parents in your
has blood type B, what blood type(s) could the answer to (a) is more likely to be the parents of
father have? these siblings? Explain why.
3. A couple just brought home their new baby from 9. In dogs, coat colour is determined by the interaction
the hospital. They begin to suspect that the hospital between three alleles. The allele AS produces a dark
switched babies, and the baby they brought home is coloured dog, a y produces a sandy coloured dog, and
not theirs. They check the hospital records, and find at produces a spotted dog. The order of dominance
that the man’s blood type is B, the woman’s blood is AS > a y > at. Determine the following from the
type is AB, and the baby’s blood type is O. Explain pedigree below.
why the parents are or are not justified in their a. the genotypes of the parents (I-1 and I-2)
concern about this baby. b. the probability of an offspring from the mating
4. Four children have the following blood types: A, B, between individuals II-2 and II-3 having spots
AB, and O. Could these children have the same two c. the possible genotypes of individual II-1
biological parents? Explain. Key
dark
5. Some of the offspring of a chinchilla rabbit and a I coloured
Himalayan rabbit are albino. What are the genotypes 1 2
sandy
of the parents? coloured
6. A chinchilla rabbit with genotype cchch is crossed II spotted
with a Himalayan rabbit with genotype chc. What 1 2 3
is the expected ratio of phenotypes among the 10. A dark coloured dog is mated with a sandy coloured
offspring of this cross? dog. The litter of puppies includes a dark puppy, a
7. Could a mating between a chinchilla rabbit and sandy puppy, and a spotted puppy. Use a Punnett
an albino rabbit produce a Himalayan rabbit? square to determine the possible genotypes of the
Explain your reasoning. Your answer should include offspring and the parents. Note: Use the information
reference to the genotypes and phenotypes of the about dog coat colour inheritance from question 9
parents and the offspring. to answer this question.

Environmental Effects on Complex Patterns of Inheritance


Environmental conditions often affect the expression of traits. For example, SuggestedInvestigation
some genes are influenced by temperature. The dark colour in Himalayan
Plan Your Own Investigation
rabbits, shown in Figure 6.8, is on the cooler parts of their bodies: the
6-A, Environmental
face, ears, tails, and feet. In these animals, dark colouring is the Influences on the
result of a gene that is only active below a certain temperature. Production of Chlorophyll
One way to study the effect of the environment on expression
of traits is to study genetically identical organisms placed
in different surroundings. For example, identical twins are
genetically identical. Differences in the activity of their
genes can be due to environmental effects.

Figure 6.8 The dark ears, nose, feet, and tails


of Himalayan rabbits are thought to be caused
by lower body temperature in these areas.

Chapter 6 Complex Patterns of Inheritance • MHR 247


Polygenic Inheritance
Mendel carefully selected plants that had very different heights so there would be
continuous variation
a range of variation in no question about phenotypes. However, there are traits that exhibit continuous
one trait resulting from variation. These are traits for which the phenotypes vary gradually from one extreme
the activity of many to another.
genes Some examples of traits that show continuous variation include height and skin
polygenic trait a trait colour in humans, ear length in corn, and kernel colour in wheat. Continuous traits
that is controlled by
more than one gene
cannot be placed into discrete categories because they vary over a continuum. For
example, height in humans varies over a wide range of values. People cannot be
categorized as only short or tall.
Traits that exhibit continuous variation are usually controlled by more than one
gene. For some traits this can involve several genes. Traits that are controlled by many
genes are called polygenic traits. A group of genes that all contribute to the same trait
is called a polygene. Each dominant allele contributes to the trait. Recessive alleles do
not contribute to the trait. For skin colour, the more dominant alleles a person has,
the darker their skin. The graph in Figure 6.9 shows that there are more intermediate
phenotypes than extreme phenotypes.
Skin Colour

AaBbCc
Frequency

AaBbcc aaBbCC aaBBCC


AabbCc AAbbCc AAbbCC
aaBbCc AabbCC AABBcc
Aabbcc AAbbcc AABbcc AaBbCC AaBBCC
aaBbcc aaBBcc aaBBCc AaBBCc AABbCC
aabbcc aabbCc aabbCC AaBBcc AABbCc AABBCc AABBCC
0 1 2 3 4 5 6

Number of Dominant Alleles

Figure 6.9 This graph shows possible shades of skin colour from three of the sets of alleles that
determine this trait.
Predict the effect of more gene pairs on the possible phenotypes.

Activity 6.1 Identifying a Polygenic Trait

A polygenic trait is one that is controlled by more than 2. Construct a data table to organize your data. Keep in
one gene and shows continuous variation. In this activity, mind that you will be measuring a particular trait and
you will choose one human trait that you hypothesize is recording the number of times that measurement
controlled by more than one gene and shows continuous of the trait occurs.
variation. You will then collect data from your classmates to
3. Collect your data from your classmates.
test your hypothesis.
4. Create a line graph of your data. Your graph should
Materials reflect the actual measurements you took and the
• ruler or measuring tape (if necessary) frequency of the values that you measured.
• graph paper
Questions
Procedure 1. Do your data support your hypothesis that the trait
1. In your group, choose one human trait that you think you selected is polygenic? Explain.
is polygenic. Make sure your choice is one for which
2. How could this activity be improved to provide a
data can be easily and respectfully collected from your
clearer picture of the inheritance pattern of the trait
classmates.
you selected?

248 MHR • Unit 2 Genetic Processes


STSE

Quirks &
Quarks
with BOB MCDONALD

THIS WEEK ON QUIRKS & QUARKS

Selecting for Genetic Defects Related Career


Human molecular geneticists
Most scientists agree that certain inherited Curiously, it does seem to. Individuals with study genetic processes in
traits are favoured when they improve the deafness mutation also had skin that humans, particularly how genes
chances for survival. But what if improved was marginally thicker than the skin of function in human disease.
chances for survival are due to a mutation people who do not have the mutation. These scientists are referred to as
associated with hereditary deafness? Bob Tests were conducted on the mutated “molecular” geneticists because
McDonald interviewed Dr. David Kelsell, skin cells to see whether the deafness they look at the structure
Professor of Human Molecular Genetics at mutation helped skin form a better barrier and function of genes at the
molecular level. For example,
Queen Mary College, University of London, against bacterial invasions, and whether the
they look for the effects of a
to discuss this question. affected skin cells healed differently. Results
genetic mutation by studying
showed that the thicker skin could offer the mutant protein that is
Good News and Bad News better protection and that healing could formed from it and how it affects
Scientists have known which gene is occur much more quickly. processes in the body.
associated with most cases of hereditary Therefore, while there is a risk of deafness
deafness since 1996. A specific mutation if two copies of the mutation are inherited,
in gene Cx26 (Connexin 26) is the culprit. one copy seems to provide better protection
People carrying one copy of the gene with against skin diseases. As the Quirks host said,
the deafness mutation have normal hearing, “How is it that one gene can affect two such
while people with two copies are deaf. different and seemingly unrelated things—
Because the deafness mutation in Cx26 is deafness and thickness of skin?” “This,” said
found in many human populations around Dr. Kelsell, “is one of the great mysteries.”
the world, Dr. Kelsell‘s team suspected it must
convey some kind of survival advantage.
Outer Ear Middle Ear Inner Ear The protein product of the Cx26 gene is needed
for movement of potassium ions between cells
in the cochlea of the inner ear. This movement
of ions is needed for proper hearing.

QU ES T I ONS

1. Is deafness due to a Cx26 mutation inherited by


an autosomal recessive or autosomal dominant
pattern? Explain your answer.
2. Explain why the deafness mutation of Cx26 is an
cochlea example of heterozygous advantage.

tympanic membrane 3. Use the Internet or print resources to find out more
(or eardrum) about the work of human molecular geneticists.
What essential skills would you need in order to
work in this field?

Chapter 6 Complex Patterns of Inheritance • MHR 249


Section 6.1 RE V IE W

Section Summary
• Incomplete dominance leads to the expression of an • Environmental conditions can influence the expression of
intermediate phenotype. In the case of codominance, certain traits.
both alleles are fully expressed. • Polygenic traits are controlled by more than one gene
• Although an individual has only two alleles for any and can usually be identified by continuous variation in
gene, multiple alleles for a gene may exist within the phenotype.
population.

Review Questions
1. K/U A white-flowered plant is crossed with a 6. T/I The following pedigree shows the inheritance
red-flowered plant. What is the likely mode of pattern of sickle cell anemia in a family. Known
inheritance if the offspring produced are carriers of the sickle cell gene are noted. However, not
a. plants with pink flowers? all individuals have been tested for the sickle cell allele.
b. plants with flowers that are red and white spotted? Key

2. K/U Describe a human genetic disorder that results


I normal
1 2 phenotype,
from incomplete dominance. Explain why it is but not
classified as incomplete dominance. tested

3. T/I In radishes, colour is controlled by two alleles


II sickle cell
1 2 3 4 trait (carrier)
that show incomplete dominance. When pure-breeding sickle cell
red radishes are crossed with pure-breeding white III anemia
1 phenotype
radishes, purple radishes are produced.
a. Provide the genotypes for the three colours of a. Determine the genotype of each individual in the
radishes. pedigree. If there are any you cannot be certain of,
b. What is the phenotypic ratio expected when two explain why.
purple radishes are crossed? b. Determine the probability that individuals II-3 and
4. T/I A farmer crosses a black rooster with a white II-4 will have another child with sickle cell anemia.
hen. Of the seven offspring, three are black, three are 7. T/I A chinchilla rabbit is crossed with a Himalayan
speckled black and white, and one is white. rabbit, producing an albino rabbit.
a. What can you infer about the inheritance patterns a. Determine the genotypes of the parents.
of the alleles for white and black feathers? b. Identify other phenotypes expected from this cross
b. Given the inheritance pattern you described in and give the predicted phenotypic ratios.
part (a), what are the expected genotypes and 8. A Your friend has bred her female albino rabbit
phenotypes of the offspring produced by a cross with her male Himalayan rabbit. “I’m hoping I’ll get
between a speckled hen and a black rooster? some agouti rabbits,” she says. What are her chances
5. C The colour of an organism is controlled by one of getting an agouti rabbit? Explain.
gene with two alleles: an allele that produces a blue 9. C “Human ABO blood grouping is an example
colour and an allele that produces a yellow colour. of the effects of multiple alleles, codominance, and
Using genetic notations, describe the differences in dominance/recessiveness.” Use a table or graphic
genotypes and phenotypes of the organisms produced organizer to explain this statement.
by crossing a true-breeding blue organism with a
10. A Siamese cats that spend their lives indoors tend
true-breeding yellow organism for the following three
to have lighter-coloured fur than Siamese cats that live
inheritance patterns. Use drawings in your answers.
outdoors. What genetic process could account for this
a. blue is dominant over yellow
change?
b. blue and yellow are incompletely dominant
11. K/U What evidence is there that skin colour in
c. blue and yellow are codominant
humans is a polygenic trait?

250 MHR • Unit 2 Genetic Processes


SECTION
Inheritance of Linked Genes
6.2
As you have learned, there is no apparent interaction between non-homologous Key Terms
chromosomes during meiosis. The movement of each pair of homologous chromosomes
linked genes
is independent of the movement of other pairs of homologous chromosomes. This agrees
sex-linked trait
with Mendel’s law of independent assortment. Recall that this law states that the alleles
for a gene segregate independently of the alleles for other genes during gamete formation.
However, Walter Sutton’s research showing that alleles segregate in the same way that
homologous chromosomes do implies a very important point: alleles on the same
chromosome do not assort independently. Therefore, they do not follow the Mendelian
inheritance patterns that have been discussed in this unit. It turns out that some genes
are inherited together. Therefore, some traits are often inherited together or are “linked.”

Linked Genes
In 1905, William Bateson and Reginald Punnett carried out the first study that showed
linked genes genes
the movement of alleles that are on the same chromosome. Using sweet peas, they that are on the same
tracked the inheritance pattern of two traits: flower colour and pollen shape. They chromosome and that
knew that purple flowers were dominant to white flowers, and that long pollen shape tend to be inherited
was dominant to round pollen shape. Their results are shown in Figure 6.10. All four together
phenotypes that are predicted using a Punnett square were present in the F2 generation.
However, there were far more of the phenotypes from the parental generation. This
suggested that the gametes produced by the parental generation, PL and pl, tended to
assort together rather than independently when producing the F2 offspring. Genes that
do not assort independently are often called linked genes.

Phenotype Genotype

Cross a plant with purple


flowers and long pollen to
×
PPLL × ppll
a plant with red flowers
and round pollen. purple flowers, Red flowers,
long pollen round pollen

Observe the phenotypes PpLl


of the F1 offspring.
purple flowers, purple flowers, purple flowers, purple flowers,
long pollen long pollen long pollen long pollen

Meiosis
Allow the F2 offspring
× PL and pl gametes—more frequent
to self-fertilize.
Pl and pL gametes—less frequent
purple flowers, purple flowers,
long pollen long pollen

Fertilization
Observe the phenotypes F2 offspring having phenotypes of
of the F2 offspring. purple flowers, long pollen or red
purple flowers, purple flowers, red flowers, red flowers, flowers, round pollen occurred more
long pollen round pollen long pollen round pollen frequently than expected from Mendel’s
15.6 : 1.0 : 1.4 : 4.5 law of independent assortment.

Figure 6.10 A dihybrid cross between two sweet pea plants does not
produce the expected phenotypic ratio of 9:3:3:1. These results support the
theory that alleles on the same chromosome do not assort independently.
Identify Provide the genotypes of the F2 offspring.

Chapter 6 Complex Patterns of Inheritance • MHR 251


Crossing Over and the Inheritance of Linked Genes
A chromosome may contain up to a few thousand genes. All of the genes on any one
chromosome are called a linkage group because they tend to be inherited together.
However, linked genes do not always stay linked—researchers have found that they
segregate on a regular basis. This is due to the process of crossing over, which you
learned about in Chapter 5. Recall that crossing over occurs in prophase I of meiosis,
when non-sister chromatids exchange pieces of chromosomes.
Suppose you are studying two genes that are on the same chromosome and,
therefore, linked. Crossing over between homologous chromosomes can occur. As
shown in Figure 6.11, this will result in the alleles of the linked genes no longer being
on the same chromosome. The alleles of the previously linked genes are now unlinked.
This means that they will migrate into different gametes. The result is that instead of
two types of gametes being produced, four different types of gametes will be produced
in differing proportions. There are fewer gametes with the recombined alleles because
crossing over is a random event and it occurs infrequently.

A a

B b
Figure 6.11 In most of the
gametes formed, there is no crossing over crossing over
during meiosis during meiosis
no crossing over—they
maintain the linkage of the
alleles. In a small minority
of gametes, crossing
over occurs and alleles of
previously linked genes A a a A
become unlinked.
Describe why alleles
of genes that are closer
together on a chromosome B b B b
3%
are more likely to remain 97% recombinant gametes
linked during meiosis.
four types of gametes in unequal proportions

Using Gene Linkage for Chromosome Mapping


Scientists have discovered that alleles for a given pair of linked genes will separate
with a predictable frequency and that this frequency is different for different pairs of
linked genes. The frequency depends on how close the alleles of the linked genes are
positioned on a chromosome. Crossing over occurs more frequently between alleles that
are far apart on a chromosome than between alleles that are close together. Therefore,
a given pair of linked genes will separate more frequently than the alleles for another
pair of linked genes if their alleles are farther apart on the chromosome. This process
of determining the relative locations of genes on chromosomes is called chromosome
mapping. These types of linkage studies are useful for mapping chromosomes in species
that reproduce rapidly and produce many offspring, such as plants and insects. But
chromosome mapping is not useful in mapping human chromosomes. Chromosome
mapping of humans only became possible when modern techniques that allow
scientists to directly see the chromosomes became available.

252 MHR • Unit 2 Genetic Processes


Learning Check

7. What are linked genes? 11. Some traits are described as being due to sex-linked
8. How are linked genes found experimentally? genes. Use your knowledge of chromosomes to
explain what this means.
9. What is chromosome mapping? How is gene linkage
used in chromosome mapping? 12. Many genetic tests are based on analyzing genes that
are linked to alleles that cause disease. Explain how
10. Suppose that two individuals with the genotype AaBb
testing for a linked gene could lead to an incorrect
are crossed, and the phenotypic ratio produced is
diagnosis.
about 3:1 (A_B_:aabb). Are the genes for the two
traits linked? Explain.

Sex-linked Inheritance
An American biologist named Thomas Hunt Morgan, shown in Figure 6.12, originally did
sex-linked trait
not accept Sutton’s chromosome theory of inheritance. In the early 1900s, Morgan chose a trait controlled by
to do research on the fruit fly, Drosophila melanogaster, to develop a new and alternative genes on the X or
theory. Morgan chose this organism because it is economical to maintain, reproduces the Y chromosome
rapidly, and has traits that are fairly easy to characterize. As Morgan collected data,
however, his results soon convinced him that Sutton’s theories were correct. Nevertheless,
Morgan’s meticulous research provided additional information about genetic inheritance.
In 1910, Morgan discovered an unusual white-eyed male among his fly population.
He crossed the white-eyed male with a normal red-eyed female. All the F1 generation
had red eyes. This seemed to indicate that normal red eyes are dominant to the
white-eye mutation. When Morgan crossed a male and female from the F1 generation,
however, the results surprised him. All the females of the F2 generation had red eyes,
half the F2 males had red eyes, and half the F2 males had white eyes. The discovery that
the gene for eye colour was connected to gender led Morgan to conclude that the gene Figure 6.12 (A) Drosophila
for eye colour is located on the X chromosome. melanogaster traits that are
Like humans, female fruit flies have two X chromosomes, while males have one often studied include eye
X chromosome and one Y chromosome. The fruit fly F1 data indicated that the colour and wing size and
shape. Males and females
white-eye phenotype is recessive, since it was masked in all of the offspring in that can be easily identified.
generation. How did white eyes reappear in only the male fruit flies in F2, but remain (B) Thomas Morgan’s
masked in the female flies? The answer lies in the sex-linked genes—the genes that are ground-breaking research
located on the X and Y chromosomes. into the genetics of fruit
flies was recognized
Traits that are controlled by genes on either the X or Y chromosome are called in 1933, when he was
sex-linked traits, because they are linked to the genes that determine sex. They are awarded the Nobel Prize in
identified by their different rates of appearance between males and females. physiology or medicine.

A B

male
female

Chapter 6 Complex Patterns of Inheritance • MHR 253


Sex-linked Genes
The X and Y chromosomes, although paired together during meiosis and for
karyotyping purposes, have very little homologous DNA. The X and Y chromosomes
in humans have only a few genes in common. The human X chromosome is estimated
to contain about 2000 genes, while the Y chromosome contains fewer than 100. The
most important genes are the sex-determination genes. For all other genes on the X
chromosome, females have two copies, while males have only one. This allows for the
difference in the expression of traits for genes that are found on the X chromosome,
which are often called X-linked genes. By comparison, only a few genes are known to
be Y-linked, because there are significantly fewer genes on the Y chromosome. When
considering sex-linked traits, the allele on the sex chromosome is shown as
a superscript to an X or a Y.

The Red and White Eyes of Fruit Flies


Red and white eyes were the first sex-linked trait explored by Morgan. The possible
genotypes and phenotypes in both males and females are listed in Table 6.1. XR
indicates red eyes, which is the dominant phenotype, and Xr indicates white eyes,
which is the recessive phenotype. Notice that female flies may be a carrier for the
white-eye phenotype. However, if the allele for white eyes is present in males, it will
always be expressed. This means that X-linked traits are exhibited more often in males.
Punnett squares can be used to predict the outcome of crosses that involve sex-linked
traits. Figure 6.13 represents some of the crosses that Morgan studied.
Table 6.1 Possible Genotypes and Phenotypes for Drosophila Eye Colour
Genotype Phenotype
XRXR Female with red eyes (homozygous dominant)
XR X r Female with red eyes (heterozygous, carrier for the white-eyed allele)
r r
XX Female with white eyes (homozygous recessive)
SuggestedInvestigation
XRY Male with red eyes
ThoughtLab Investigation r
XY Male with white eyes
6-B, Sex-Linked Crosses

red-eyed F1 female
female X RX r
X RX R
XR XR XR Xr

Xr XR

X RX r X RX r X RX R X RX r

white-eyed F1 male
Y Y
male X RY
X rY
X RY X RY X RY X rY

Figure 6.13 In Morgan’s experiment on tracking the inheritance pattern of a sex-linked trait,
the white-eye phenotype was passed from the father in the P generation through the daughter
in the F1 generation.
Predict the genotype and phenotype ratios of the offspring created by crossing a white-eyed
male and a heterozygous female.

254 MHR • Unit 2 Genetic Processes


Sex-linked Traits in Humans
Some examples of sex-linked traits in humans are listed in Table 6.2. As you can see,
many are genetic disorders. If a disorder is X-linked dominant, affected males pass the
allele only to daughters, who have a 100 percent chance of having the disorder. Females
can pass an X-linked dominant allele to both sons and daughters, all of whom will have
the disorder. Most sex-linked inherited traits in humans are X-linked recessive traits.
Therefore, while the male only needs to inherit one allele to be affected, the female
must inherit both alleles to be affected. Thus, X-linked recessive traits affect more males
than females in a family.
Table 6.2 Sex-linked Traits in Humans
Condition Inheritance Pattern Description
Red-green colour vision X-linked recessive Cannot distinguish between certain
deficiency (CVD) shades of red and green
Duchenne muscular X-linked recessive Progressive weakening of muscles and
dystrophy loss of coordination
Hemophilia X-linked recessive Cannot produce a necessary blood
clotting factor
Adrenoleukodystrophy X-linked recessive A build-up of fatty acids that causes
progressive brain damage and death
X-linked severe combined X-linked recessive Decreased immune response due to
immunodeficiency (SCID) low white blood cell counts
X-linked hypophosphatemia X-linked dominant Softening of bone, which leads to bone
deformity
Hairy ears Y-linked Hair grows on the outside of the ears

Colour Vision Deficiency: An X-linked Recessive Trait


In humans, there are inherited forms of colour vision deficiency (CVD). Individuals
affected by CVD have varying degrees of difficulty distinguishing between different
colours or shades of colours. One form, called red-green CVD, is an X-linked recessive
disorder. Individuals with red-green CVD have difficulty distinguishing between
shades of red and green. To track the inheritance patterns of sex-linked traits in
humans, pedigrees are often used. The inheritance pattern of red-green CVD in one
family is shown in Figure 6.14.

I XBXB XbY Key


XBXB = normal female
B b
X X = carrier female
XbXb = CVD female
X BY = normal male
B B b b b b
II X Y XX X BY XX X Y = CVD male

b
XY

III X BY XBXB XBXb XbY

Figure 6.14 An X-linked recessive trait like CVD will affect more males than females in a family.

Chapter 6 Complex Patterns of Inheritance • MHR 255


Hemophilia: A Common Sex-linked Trait in Humans
Hemophilia is a condition that affects the body’s ability to produce proteins involved
in blood clotting. People with hemophilia can suffer serious blood loss from simple
cuts and bruises. Hemophilia is an X-linked recessive trait that affects more than
3000 individuals in Canada.
Hemophilia is often referred to as the royal disease because it spread among the
royal families of Europe, through the descendents of Great Britain’s Queen Victoria,
shown in Figure 6.15. Queen Victoria was a carrier who passed the allele on to some of
her offspring. Arranged marriages among royalty of Europe were very common until
Figure 6.15 Great Britain’s the twentieth century. Pedigree analyses can trace the allele for hemophilia throughout
Queen Victoria was a carrier the royal families of Spain, Russia, and Prussia.
for hemophilia.

Sample Problem

Using Punnett Squares to Analyze Sex-linked Inheritance Patterns


Problem
Determine the probability that a woman who is a carrier for hemophilia and a man
without hemophilia will have a child with hemophilia.

What Is Required?
You need to determine the possible genotypes and phenotypes of the offspring to
determine if any of the children could have hemophilia.

What Is Given?
You know the phenotypes of the parents, and you know that the pattern of inheritance
is X-linked recessive.

Plan Your Strategy Act on Your Strategy


Assign letters to represent each allele Since the inheritance pattern is X-linked recessive,
for the trait, and then determine the • let Xh = allele for hemophilia
genotypes for the parents based on an • let XH = allele for normal blood clotting
X-linked recessive inheritance pattern. The female is a carrier, so her genotype is XHXh.
The male is unaffected, so his genotype is XHY.
Use a Punnett square to predict the female
genotypes of the offspring. XH Xh
XH
male
Y

Complete the Punnett square. female


XH Xh
XH XHXH XHXh
male
Y XHY XhY

Determine the predicted phenotypes There is a 25 percent chance of having a child with
of the offspring, and the probability of hemophilia (XhY). All other genotypes produce a child
producing a child with hemophilia. with normal blood clotting.

Check Your Solution


To check your solution, ensure that the genotypes of the parents accurately represent
the phenotypes, and that all possible combinations of gametes have been made.

256 MHR • Unit 2 Genetic Processes


Sample Problem

Determining Sex-linked Inheritance Patterns in a Pedigree


Problem
The pedigree on the right shows the inheritance of red-green
CVD in a family. Identify the genotype of each family I
1 2
member represented in the pedigree. How does the inheritance
pattern in the pedigree support X-linked inheritance?
II
What Is Required? 1 2 3 4
You need to determine the genotype of each individual and
describe the evidence for X-linked inheritance.
III
1 2 3 4
What Is Given?
You know that the pattern of inheritance is X-linked
recessive, and you have the phenotype of each of the
individuals (the pedigree).

Plan Your Strategy Act on Your Strategy


Assign letters to represent each allele. Identify possible • let Xc = allele for CVD
genotypes for each of the phenotypes based on an X-linked • let XC = allele for normal vision
recessive inheritance pattern. XCXC = unaffected female XCY = unaffected male
XCXc = female carrier XcY = male with CVD
XcXc = female with CVD
Assign all possible genotypes, according to the information
in the pedigree. I X cY ?
• At this point, you cannot be certain of the genotypes for 1 2
individuals I-1, II-1, and II-3. Since they are unaffected
females, the possible genotypes are X CX c and X CX C.
II ? C
X Y ? C
X Y

1 2 3 4

III XCY XCY XCY X cY

1 2 3 4

Complete the pedigree with genotypes that you can infer


based on the data in the pedigree. I X cY ?
• You know that individual II-3 must be X CX c to produce 1 2
a son who has CVD.
• Individual II-1 must be X CX c. The X chromosome she
received from her father is Xc and, since she is unaffected, II XCXc XCY XCXc XCY
she must have received X CX c from her mother. 1 2 3 4
• You cannot be certain of the genotype of I-2 because
both genotypes are possible (X CX c and X CX C), given the
genotypes of the offspring. X cY
III XCY XCY C
X Y

1 2 3 4

Describe how the inheritance pattern supports X-linked The allele for CVD is passed from the grandfather (I-1)
recessive inheritance. through his unaffected daughter (II-3) to her affected son
(III-4). This pattern is indicative of X-linked recessive
inheritance. As well, more males are affected than females,
which also indicates X-linked recessive inheritance.

Check Your Solution


To check the pedigree, ensure that all the offspring genotypes are possible given the
genotypes of the parents.

Chapter 6 Complex Patterns of Inheritance • MHR 257


Practice Problems

11. A woman who is a carrier for CVD and a man who b. Determine the genotypes of the flies described in
has CVD decide to have children. the F2 generation.
a. Determine the genotypes of these two people. c. What is the probability of producing tan offspring
b. What is the expected ratio of genotypes and from a yellow female and a tan male?
phenotypes among their children? 17. Given the pedigree below, determine whether
12. The mother and father of a boy who has CVD both the pattern of inheritance of this trait is X-linked
have normal colour vision. Use a Punnett square to recessive, X-linked dominant, or Y-linked dominant.
explain how this can occur. Explain your answer.
13. A woman with hemophilia and a man without
hemophilia decide to have children. What is the
I
1 2 3 4
probability that their sons will have hemophilia?
14. Nystagmus is a condition in which involuntary eye
movement leads to poor vision. This condition is
II
1 2
caused by an X-linked recessive allele. Suppose that
a man and woman, both with normal vision, have
two children. The boy is affected with nystagmus, III
1 2 3 4
and the girl is unaffected.
a. Determine the genotype of the parents. 18. In one breed of dog, a mutant gene that causes
b. Is it possible to determine the genotypes of the hearing impairment is found on the Y chromosome.
children? Why or why not? What are the possible phenotypes of offspring from
15. A woman has X-linked hypophosphatemia, which each of the following crosses?
affects bone development. She marries a man with a. a male dog whose father is hearing impaired and
normal bone structure. If the woman’s father also a female dog whose father is not hearing impaired
has normal bone structure, what is the probability b. a female dog whose father is hearing impaired and
that the woman and her husband will have a child a male dog whose father is not hearing impaired
with the disorder? 19. Suppose you have one homozygous dominant
16. A true-breeding tan-bodied female fruit fly is red-eyed female fly and one white-eyed male
crossed with a yellow-bodied male. All of the fly. What steps would you follow to produce a
offspring in F1 have tan bodies. In the F2 generation, white-eyed female fly?
all the females have tan bodies, 50 percent of the 20. The allele for short fingers is dominant to the allele
males have tan bodies, and 50 percent of the males for long fingers. What is the genotype of a male who
have yellow bodies. has CVD and long fingers? If all of his children have
a. Describe the pattern of inheritance for body normal vision and short fingers, what is the likely
colour in fruit flies. Explain your answer. genotype of the children’s mother?

Barr Bodies: Inactive X Chromosomes


Since females carry two X chromosomes and males only one, why is there no difference
in the expression of X-linked genes between males and females? The answer is that
every cell has only one functioning X chromosome. In every female cell, one of the
X chromosomes is inactive. The inactive X chromosome is condensed tightly into
a structure known as a Barr body. At an early stage of embryonic development, one
X chromosome in each cell is deactivated. Which X chromosome is deactivated can
vary among cells. One visible effect of one X chromosome being inactive is the calico,
or tortoiseshell, coat colour in cats, shown in Figure 6.16. In heterozygous females,
roughly 50 percent of the cells have an active X chromosome with the allele for black
Figure 6.16 In cats, the
alleles for black or orange
coat colour, and 50 percent of the cells have an active X chromosome with the allele for
coat are carried on the orange coat colour. This results in a tortoiseshell coat with patches of both black and
X chromosome. orange. The patches of white are the result of the interaction with a different gene.

258 MHR • Unit 2 Genetic Processes


Section 6.2 RE V IE W

Section Summary
• Alleles of different genes that are on the same • Sex-linked traits are expressed in different ratios by male
chromosome do not assort independently. These genes and female offspring because they are determined by the
are said to be linked and their associated traits tend to be segregation of X and Y chromosomes.
inherited together. • Although sex-linked genes are linked to the X and Y
chromosomes, Punnett squares can be used to predict
genotypes and phenotypes.

Review Questions
1. T/I Design an experimental procedure that you 9. A Explain how a girl with Turner syndrome could
could follow to determine whether two plant genes are have red-green CVD, even though both of her parents
linked. have normal vision.
2. K/U Describe how the process of crossing over 10. T/I The following pedigree was given to a group of
of non-sister chromatids can affect linked genes. students to analyze. They believe it indicates X-linked
3. K/U What experimental evidence would lead recessive inheritance. Do you agree or disagree?
scientists to suspect that two genes are linked? Explain your answer.
4. T/I A chromosome contains three genes, P, Q,
I
and R. The percentage of gametes produced that have 1 2
the genes separated due to crossing over is shown in
the table below.
II
Linked Genes 1 2 3 4 5 6
Gametes with
Genes Unlinked Genes (%)
P and Q 5 III
1 2 3 4 5 6
P and R 18
11. K/U How do pedigrees for autosomal recessive traits
Q and R 13
and X-linked recessive traits differ?
From these data, identify the gene pair with alleles 12. C A boy has Duchenne muscular dystrophy. His
that are closest together on the chromosome. Explain mother’s brother also has this disorder. The boy’s father
your answer. and his two younger sisters do not appear to be
5. C Draw a diagram that shows how crossing over affected by the disease. Draw a pedigree to illustrate
can cause linked genes to become unlinked. the inheritance of Duchenne muscular dystrophy in
6. K/U List two features of Drosophila melanogaster this family. What is the probability that his sisters are
that make this species a good choice for the study of carriers of the disease?
sex-linked inheritance. 13. K/U The symptoms associated with X-linked

7. T/I A woman with regular vision and a man with dominant diseases are often more severe in males.
regular vision have three children, one of whom Explain.
has CVD. 14. C Draw a sample pedigree to illustrate inheritance
a. What can you conclude about the genotypes of of hemophilia in a family. Make sure that your
the parents? pedigree reflects that particular inheritance pattern.
b. What sex is the child who has CVD? How do 15. A Some women are heterozygous for an X-linked
you know? genetic disorder that results in a non-uniform
8. K/U Describe the possible genotypes of the parents distribution of sweat glands on their skin. These
of a woman who has hemophilia. Explain your answer. women have patches of skin that lack sweat glands and
patches of skin that have sweat glands. How can the
Barr body cause this phenomenon?

Chapter 6 Complex Patterns of Inheritance • MHR 259


SECTION
The Future of Genetics Research
6.3
Key Terms Genetics research is continually changing and developing in response to new
discoveries. Many genetics researchers now focus on obtaining more and more detailed
bioinformatics
information. In addition to wanting to know the sequences of genes that are associated
genomics
with certain inherited traits, investigators want to know how those genes play a role
genetic profile in determining those particular traits. Looking for answers to these types of questions
has led to the development of more sophisticated technologies and equipment, and
has resulted in new scientific fields of study. In addition, many studies now require the
collaboration of scientists from very different disciplines, such as biology, chemistry,
physics, sociology, bioethics, and political science.

The Human Genome Project


In the opener for this chapter, you were introduced to the the Human Genome Project.
Determining the DNA sequence of the human genome is considered to be one of the
most pivotal contributions to science ever made. Nevertheless, achieving this scientific
Figure 6.17 The Human landmark depended on many discoveries that came before it. Figure 6.17 highlights only
Genome Project achieved
a small number of developments since Mendel’s work that formed the foundations of
many milestones and has
provided a springboard this project.
for decades of future An important component of the 13-year Human Genome Project was determining the
research. Nevertheless, DNA sequences of other organisms. This allows scientists to make comparisons between
this project would not have species and learn even more about important features of genomes. Overall, identifying
been possible without
several essential preceding the genome sequences of humans and many other organisms allows for a much more
discoveries—including comprehensive understanding of biological systems. This knowledge will have a wide
Mendel’s studies of pea range of applications in fields such as human health, agriculture, and the environment.
plants.
rediscovery
covery A as the hereditary
DNA here
of Mendel’s material is identified
identifie
work
ork

1865 1900
00 1913 1944 1953 1966

the first linear the structure the genetic code


Gregor Mendel map of genes of DNA
D is is identified
discovers
discove laws is produced
roduced determined
det
gene
of genetics

1990 1991 1992 1995 1996 1997

the Human first US genome US Equal Employment yeast


Genome Project centres established Opportunity Commission (Saccharomyces
is launched rapid-data-release issues policyy on cerevisiae) Escherichia coli
guidelines genetic discrimination
mination genome sequenced genome
ethical, legal, and established lace
in the workplace sequenced
social implications
(ELSI) program
founded

260 MHR • Unit 2 Genetic Processes


What’s in Our Genome?
In addition to determining the actual sequence of the nucleotides in the human genome,
scientists had to make sense of the sequence. Trying to make sense of the sequence
can be compared to reading a book written in a language nobody knows or understands.
Imagine the genome as words in a book written without capitalization, punctuation,
or breaks between words, sentences, or paragraphs. Also, suppose there are strings of
additional letters scattered randomly between and within sentences. Figure 6.18 shows
how a page from such a book might look. To understand what is written, you have to
decode the jumbled text. Similarly, scientists had to decode the sequence of our DNA
Figure 6.18 Decoding the
to learn about the human genome. When the Human Genome Project began, there DNA sequence of the human
was a great deal that was not known about our genome. For example, it was not known genome is like figuring out
how many genes humans actually had and how much of our DNA is part of those genes. where the punctuation and
After sequencing the entire human genome, scientists observed many things that capitalization must go to
understand what is written
surprised them. Some of these discoveries include the following: on this page.
• Only about 2 percent of the nucleotides in the human genome make up our genes
and code for all the proteins in the body.
• The estimated 25 000 total number of genes is much less than scientists predicted.
Previous estimates were between 80 000 and 140 000.
• Over 50 percent of our DNA consists of stretches of repeating sequences.
• There is very little genetic variation within our species. About 99.9 percent of the DNA
sequence is almost exactly the same in all people.
Having the sequence of the human genome only represents a starting point. It is
like being given the pages of an instruction manual for the human body. The next steps
involve figuring out how to interpret all of the information and use that to understand
how everything works together. Scientists agree that this process will take many more
years of research.

methods for determining the cystic fibrosis


sequence of DNA are developed gene is identified

Human
1972 1977 1983 1989 1990 Genome Project 2003

recombinant
re first human disease
DN
DNA technology gene—for Huntington
is developed disease—is mapped

1999 2000 2001 2002 2003

full-scale human free access to genome human genome


genome sequencing begins information established draft version sequences of mouse, rat, an
and sequence
of human rice genomes completed completed
sequence of first human fruit fly genome sequence ce
chromosome ((Drosophila melanogaster) published
(chromosome 22) genome sequenced
completed
mustard
s ard cress
sta
opsis thaliana)
op
(Arabidopsis
genome e sequenced

Chapter 6 Complex Patterns of Inheritance • MHR 261


The Development of Bioinformatics
In the Launch Activity at the beginning of this chapter, you simulated the work
bioinformatics a
field of study that required to piece together the sequence of a small fragment of DNA. Imagine
deals with using doing this work by hand for the over three billion base pairs of the human genome.
computer technology Sequencing the human genome and the genomes of other organisms generated
to create and analyze exceptionally large amounts of data that needed to be organized and shared among
large databases of
information labs around the world. A new field of study, called bioinformatics, arose from this need.
Bioinformatics is a branch of biology that deals with applying computer technology to
create and maintain databases of information that can be analyzed to better understand
biological processes.
Bioinformatics is a relatively new branch of biology. American chemist Margaret
Dayhoff, shown in Figure 6.19, is the founder of bioinformatics. Her work, which
began in the late 1940s, involved creating a computerized protein and DNA sequence
database—the first bioinformatics project. Today’s bioinformatics exists because of
simultaneous advances in three areas: techniques to sequence biological molecules such
as DNA and proteins, computer database software to sort and store massive amounts of
genetic information, and communication technology to share information around the
world efficiently. Today, there are many on-line genetics databases available that allow
easy access to vast amounts of genetic information by all members of the public—not
just scientific researchers.
Bioinformatics is just one of a number of newly developed fields, all of which
Figure 6.19 A chemist
named Margaret Dayhoff
involve using computers to study biological problems. For example, computational
is considered to be the biology involves developing mathematical models and computer simulations of
founder of bioinformatics. biological processes.

Activity 6.2 Accessing Genetic Information

In this activity, you will join the worldwide community 3. Spend some time looking at the different databases
of scientists who explore information stored in the many that are available from this site. What different types of
on-line databases that are available. information about a genetic disorder can be obtained
from them?
Materials
4. Choose three or four types of information that are
• computer with Internet access
available about the genetic disorder that you selected.
Procedure Questions
1. Choose one of the genetic disorders provided by your
1. Summarize the information you collected on the genetic
teacher.
disorder you investigated.
2. Use the Internet to access the website that you will be
2. Based on your experience with the on-line databases,
using. Your teacher will provide a demonstration to help
what was the most effective way of obtaining the
you get started.
information that you were looking for?

Learning Check

13. What were some achievements of the Human 16. Explain how bioinformatics contributed to the
Genome Project? Human Genome Project.
14. How much of the human genome is actually used to 17. Why was development of the Internet crucial for the
code for proteins? Human Genome Project?
15. List three types of technologies that contribute to 18. Describe an experiment that requires bioinformatics.
developing the tools used in bioinformatics.

262 MHR • Unit 2 Genetic Processes


Genomics: The Study of Genomes
Just as genetics is the study of genes, genomics is the study of genomes and how genes
genomics the study
work together to control phenotype, as illustrated in Figure 6.20. Although some traits of genomes and the
are determined by only one gene, most traits involve multiple genes. To understand complex interactions
how an individual gene produces a specific phenotype, researchers such as Mendel and of genes that result in
Morgan chose one gene and studied it and its phenotype across many individuals. A phenotypes
significant advantage that came from the Human Genome Project was the ability to
consider multiple genes and the genome as a whole. This allows scientists to study the
interactions among many genes and how they all contribute to a phenotype. Computer
technology and fields such as bioinformatics play a vital role in this by allowing
scientists to analyze large amounts of information from a variety of sources.
Although there is considered to be little variation in the sequence of the human
genome, it is important to keep in mind that the 0.1 percent difference represents
potential for variation in about three million nucleotides. Some of this variation is
associated with many diseases. Scientists believe that almost all human diseases have
a genetic component, either directly or indirectly. Comparing genome sequences has
been particularly useful in studying the genetic basis for many human diseases, such
as cancer. For example, bioinformatics and computational biology have been used to
compare the DNA sequences of certain regions of the genome in individuals affected by
a particular type of cancer with the DNA sequences of the same regions in those who
are not. Differences in DNA sequence indicate a potential genetic basis for the disease.
While this represents a good starting point for the study of the genetics of a disease,
scientists are discovering that many diseases are the result of a complex array of factors,
and studying them requires more elaborate methods.

C G T T C T C T A T T A A C A ...
G C A A G A G A T A A T T G T ...
three billion DNA base pairs
in the cell nucleus

phenotypes
are expressed
thousands of different proteins
are produced in trillions of cells

Figure 6.20 Genomics is the study of how an organism’s genome contributes to its phenotype.

Chapter 6 Complex Patterns of Inheritance • MHR 263


Linking Genetic Variations to Disease
In previous sections, you learned about diseases that are associated with a mutation
or mutations in a single gene, such as sickle cell anemia. Many other diseases, such as
cancer, stroke, heart disease, diabetes, and asthma, are influenced by a combination of
environmental and genetic factors.
Many scientists consider determining what variations in DNA sequence contribute
to different diseases to be one of the best opportunities to understand the complex
causes of many human diseases. The most common type of variation between people is
differences in individual nucleotides, as shown in Figure 6.21. For example, one person
may have a C at a certain location, while another person may have a T. This type of
genetic variation is called a single nucleotide polymorphism, or SNP (pronounced
“snip”). A SNP can act as a marker for a gene or be associated with a gene if it is
genetically linked to it. Recall that sequences of DNA are genetically linked when
they are physically close to each other on a chromosome and tend to be inherited
together. For example, if a SNP is common among people with high blood pressure,
that could provide a marker for the location of a gene that is involved in the disease.
However, there are almost 10 million different SNPs that commonly occur in the
human genome. Testing all of these is not feasible. Nevertheless, SNPs that are near
each other on a chromosome tend to be inherited together. These regions of genetically
linked variations are called haplotypes. Certain tag SNPs can uniquely identify these
haplotypes. Since there are far fewer of these types of SNPs, they can be used as a basis
for comparing genetic variations and identifying genes that influence the health of an
individual.
In 2002, an international group of researchers from Canada, the United States,
Japan, China, Nigeria, and the United Kingdom collectively began the International
HapMap Project. The major aim of this project is to develop a haplotype map
(HapMap) of the human genome, which represents a map of the variations in the
human genome. This can then be used by other scientists to identify the genetic basis
for many human diseases.

SNP SNP SNP

Chromosome 1 AACACGCCA . . . . T T CGGGT C . . . . AGT CGACCG . . . .


Chromosome 1 AACACGCCA . . . . T T CGAGT C . . . . AGT CAACCG . . . .
Chromosome 1 AACATGCCA . . . . T T CGGGT C . . . . AGT CAACCG . . . .
Chromosome 1 AACACGCCA . . . . T T CGGGT C . . . . AGT CGACCG . . . .

Haplotype map of the human genome

Figure 6.21 A haplotype map is constructed by identifying single nucleotide polymorphisms


(SNPs) among a number of individuals.

Beyond the Genome Sequence


Analysis of the data generated from the Human Genome Project will continue for many
decades. A significant part of that research involves more than working at the level of the
DNA sequence. For example, the field of proteomics began when scientists recognized
how important it is to understand the products of our genes—proteins. Based on the
term genome, the term proteome was developed to refer to all of the proteins in an
organism. Research studies in proteomics focus on studying the three-dimensional
shape of proteins and eventually determining the functions of all the cellular proteins.

264 MHR • Unit 2 Genetic Processes


Studying Gene Expression
Today, many scientists are studying what regulates the expression of genes. That is, they
look at what influences whether a particular protein is produced from a certain gene
and, if so, how much of the protein is made. An individual’s phenotype is the result
of which genes are active—are being expressed—and which genes are inactive, or not
being expressed. While all cells of an individual have the identical genetic material,
the same genes are not expressed in the same way in every type of cell. For example,
differences in gene activity can exist between healthy cells and cells of diseased tissue,
such as cells of cancerous tumours.
Scientists now realize that some factors that affect gene expression can be inherited,
but they are not due to changes in DNA sequence. Epigenetics is the study of how
changes in the inheritance of certain traits or phenotypes are based on changes
to gene function and not to changes in DNA sequence. Epigenetics differs from
evolution because there is no change to the DNA sequence of a gene and epigenetic
changes are not necessarily permanent. Epigenetic changes represent a response to an
environmental condition that may be reversed once that condition changes, or soon
after the change. The term epigenome refers to cellular material that is not part of the
genome but that influences whether a gene is “turned on” or “turned off.” Identifying
epigenetic factors is believed to be a next major frontier in biological sciences.

Studying Gene Expression Using Microarrays


A very important method that is used to study differences in gene activity is DNA
microarray technology. In this technique, DNA is placed as spots on a glass plate,
called a microarray plate. One slide can contain thousands of spots of DNA that
correspond to certain parts of a genome, and that contain different genes. Figure 6.22
shows an example of a microarray plate. This technique allows scientists to study the
activity of up to thousands of genes at a time, under particular conditions. Studying the
activity of so many genes at once tells scientists which genes are active or inactive under
certain conditions, and gives them information on how this activity is co-ordinated
among different genes.

Figure 6.22 DNA microarrays allow scientists to see the activity of genes
under certain conditions. The colour of each circle on a microarray plate like
this one corresponds to the activity of a gene in the DNA spot on the plate.

Chapter 6 Complex Patterns of Inheritance • MHR 265


Genetic Information: Public Benefits and Concerns
Some of the most important benefits of genetic research are in the area of human
genetic profile the
complete genotype of medicine. Figure 6.23 illustrates this link between genetics and medical treatment.
an individual, including Studying the human genome as a whole may make it possible to develop drugs that are
various mutations tailored to the expression of the genes associated with particular disorders, and to the
unique genome of a patient.
In the future, researchers hope to use established links between genetic variation
and risk of disease to provide better medical advice to patients. If the cost of DNA
sequencing continues to decrease, individuals may have access to their genetic
profile—their complete genotype, including all of the various mutations linked to
disease. Currently, doctors are only able to make generalized risk assessments based on
medical history. Armed with a genetic profile, however, genetic counsellors and doctors
will be able to provide more specific risk assessments, design individualized prevention
plans, and design genetically precise treatment programs.

What Can Happen to Information from a Genetic Profile?


Establishing genetic profiles for individuals, and making these profiles available to
health-care providers, also creates ethical concerns. For example,
• Could insurance companies deny coverage to people who have a genetic
predisposition for a particular disease?
• Could potential employers have access to an individual’s genetic profile and use it in
assessing whether to hire the person?
Figure 6.23 This altered • Should researchers be allowed to use the genetic profiles of individuals to help them
representation of the better understand the link between genome and phenotype?
caduceus—a common
symbol for medical The central issue in all of these ethical questions is who should have access to the
practice—illustrates the information in a genetic profile.
link between genetics and
treatment of disease. Ownership of Genetic Information
All the data gathered through the Human Genome Project is publicly available. Having
access to the data made it possible for scientists to share what they learned about
human genetics. In other areas of genetics research, however, the relationship between
public and private information is more complex.
In 2005, the National Geographic Society and the IBM company jointly launched
the Genographic Project. This project uses DNA samples provided by hundreds of
thousands of volunteers around the world to learn more about the migrations of
ancient peoples. Using high-tech genetics tools and computer facilities, DNA sequences
of the individuals are analyzed to better understand human genetic roots and how we
all “connect” at the level of our DNA.
Studies such as the Genographic Project can contribute valuable information to
researchers in many fields. But who owns the genetic information? For example, should
companies have the right to sell DNA information to other companies without the
permission of the people who provided the samples? Should companies that use DNA
in medical research be required to share the results of their work with the individuals
or communities whose genetic information was used?
Some people argue that genetic information is a natural resource that belongs
to everyone. Others believe that genetic information about a person belongs only to
that person. In addition, many think that if companies cannot earn a profit from their
research, there is little incentive for them to invest in genetic studies. In the world of
genetics research, where is the boundary between public and private property?

266 MHR • Unit 2 Genetic Processes


Section 6.3 RE V IE W

Section Summary
• The complete DNA sequence of the human genome was • There is still much to be learned from the data generated
determined as part of the Human Genome Project. from the Human Genome Project, particularly in
• The field of bioinformatics arose from the need to share identifying genes that are associated with human health.
and maintain the large quantities of data collected from • Current and future research in genomics may allow
genomic research. It also provides tools for analyzing scientists to tailor preventative and curative treatments
genomic data. for individual patients based on their specific genetic
profiles. However, ethical questions about who owns an
individual’s genetic information continue to be debated.

Review Questions
1. K/U The Human Genome Project involved 7. T/I Describe why you think the field of
sequencing the genomes of other organisms as well as bioinformatics was given that name. Provide a suitable
of humans. Provide two reasons for why this was done. alternative name for this field of science.
2. C In this section, the human genome was 8. K/U What is genomics? Describe the type of research
compared to a book. Illustrate how the parts of a that is involved and how it may help society.
book—pages, paragraphs, sentences, words, and 9. K/U What is the HapMap project? What is its main
letters—can be used to represent chromosomes, goal?
chromatids, genes, and nucleotides.
10. T/I Explain how epigenetics suggests that the traits
3. K/U Describe three things about the human genome we inherit may not be due only to the DNA we receive.
that scientists learned from the Human Genome
11. K/U Describe how DNA microarray technology is
Project.
used to study gene expression.
4. K/U Although the Human Genome Project is
12. C Determining a genetic profile can have its
complete, research based on its findings continues.
benefits and its risks. Use a table to list as many
Describe two areas of current research that developed
benefits and risks as you can.
from it.
13. C Should people be encouraged to have their
5. A The Human Genome Project cost billions of
genetic profiles determined, since this might prevent
dollars to complete. Do you think it was worth it?
them from developing certain illnesses? Justify your
Provide reasons that support your opinion.
answer using examples.
6. T/I The two pictures below show scientists
14. A Imagine that you have been hired by an
conducting genetic research in labs. The photo on the
international organization that establishes practices
left was taken in the 1980s, and the photo on the right
for scientists to follow when doing genetics research.
was taken in the 2000s. Describe how these photos
Your job is to develop a policy on the collection and
reflect the changes in genetic research that took place
ownership of genetic information.
over this time period.
a. What are some of the issues you should consider?
b. Based on the issues you listed, decide where you
stand on those issues and develop a policy that
reflects that stance.
c. Briefly summarize how your policy will balance
public and private interests.
15. C Write a paragraph expressing your opinion on
whether employers should have to provide a work
environment that suits a person’s genetic profile.

Chapter 6 Complex Patterns of Inheritance • MHR 267


Plan Your Own 6-A
INVESTIGATION
Skill Check


Initiating and Planning
Performing and Recording
Environmental Influences
✓ Analyzing and Interpreting on the Production of Chlorophyll
✓ Communicating Chlorophyll is the molecule that allows plants to capture light energy from the
Sun and use the energy to produce food in the form of sugars. Chlorophyll
Safety Precautions is also the pigment that gives leaves their green colour. Plants that produce
chlorophyll appear green. If the production of chlorophyll is “turned off,” the
plant will become pale yellow, or even white. The production of chlorophyll is
• Wash your hands when you have
under genetic control.
completed this investigation
Working in groups and using the materials provided, you will design and
Suggested Materials conduct an investigation to test the influence of light on the production of
chlorophyll. Your investigation must enable you to draw conclusions about each
• seeds (Brassica rapa, radish,
of the following.
or bean)
• What is the minimum duration of exposure to light required to turn on the
• labels
production of chlorophyll?
• paper towels
• Is the triggering event reversible? That is, does chlorophyll production start
• water and stop as environmental conditions change?
• shoe boxes
• petri dishes
• graduated cylinder
• light source

When chlorophyll is no longer present, a green plant will become pale yellow or even
Go to Organizing Data in a Table in white. This is similar to what happens to many trees during the autumn. In the spring
Appendix A for help with designing and summer, tree leaves appear green because chlorophyll is being produced. With
a table for data. the change in environmental conditions that accompanies autumn, chlorophyll is no
Go to Constructing Graphs in Appendix A longer produced and other pigments in the tree leaves become visible. This results in
for information about making graphs. the yellow, orange, and red “fall colours” of some trees.

268 MHR • Unit 2 Genetic Processes


Pre-Lab Questions Analyze and Interpret
1. Describe the genotype of the organisms you should use 1. Did your observations support or refute your
that will allow you to test the effect of the environment hypothesis? Explain.
on phenotype. 2. Did your investigation allow you to draw conclusions
2. What is the difference between qualitative and about the inheritance of the genes that are involved in
quantitative data? the production of chlorophyll? Why or why not?
3. Differentiate among independent, dependent, and 3. Identify the variables you considered when designing
controlled variables. your investigation. Explain why you needed to consider
each variable to obtain scientifically valid results.
Question
How does light influence the production of chlorophyll in Conclude and Communicate
germinating plants? 4. State your conclusions about the relationship between
exposure to light and the activity of the genes that are
Hypothesis involved in the production of chlorophyll.
Formulate a hypothesis to explain how light influences the
activity of the genes responsible for chlorophyll production. Extend Further
Use this hypothesis as the basis of your experimental design.
5. INQUIRY Could a different hypothesis be consistent
Plan and Conduct with the results of your investigation? How could you
1. With your group, brainstorm several methods you design an investigation to test this different hypothesis?
could use to test your hypothesis given the materials 6. RESEARCH What social benefit could come from
provided. As a group, select one method for your understanding the effect of light on chlorophyll
experimental design. production?
2. Identify the independent, dependent, and controlled
variables, and the type of data you will collect.
3. As you prepare your procedure, be sure to consider the
time required for each step.
4. Prepare the data table you will use to record your
observations. Decide what form (such as the type of
graph) you will use to present your results.
5. Review your procedure with your teacher. Do not
begin doing the investigation until your teacher has
approved your group’s procedure.
6. Record your observations in your table. Make notes
about any findings that do not fit in your data table.
Record any questions that come up as you conduct
your investigation.

Chapter 6 Complex Patterns of Inheritance • MHR 269


ThoughtLab 6-B
INVESTIGATION
Skill Check


Initiating and Planning
Performing and Recording
Sex-linked Crosses
Thomas Morgan used Drosophila melanogaster, the common fruit fly, extensively
✓ Analyzing and Interpreting
in his studies of sex-linked traits. In this investigation, you will model Morgan’s
✓ Communicating
experiments using Drosophila melanogaster and use your results to confirm
sex-linked inheritance for the trait you chose to study.
Materials
• data on crosses Pre-Lab Questions
1. How is a sex-linked recessive trait distinguished from an autosomal
recessive trait?
2. Describe the genotype of the P generation that could be used to model
Morgan’s studies of sex-linked genes in Drosophila.
3. What phenotype is expected in the F1 generation produced from the cross
described in question 2?

Question
How are sex-linked traits inherited in Drosophila melanogaster? How do actual
results compare with theoretical ratios?

Organize the Data


1. Choose one trait from the table below (eye colour, eye shape, or body
colour) to investigate.
Go to Organizing Data in a Table in Common Sex-linked Traits in Drosophila melanogaster
Appendix A for help with designing
a table for data. Trait Phenotype 1 Phenotype 2
Eye colour White Red
Eye shape Round Bar
Body colour Black Yellow

A B

Two forms of eye colour in fruit flies are white and red (A). Eye shape can be round (A) or appear as narrow bars (B).

270 MHR • Unit 2 Genetic Processes


Part I: The F1 Generation Conclude and Communicate
2. Determine the genotype of the flies use for the P 4. Describe the inheritance pattern for the trait you
generation. studied in this investigation.
3. Construct a table to record your results. 5. How does the actual phenotypic ratio you obtained
4. Use a computer simulation program or obtain results compare to the theoretical phenotypic ratio? Account
for the F1 generation from your teacher. Record the for any differences.
results in your table.
5. Before beginning Part II, complete the Analysis section Extend Further
of the investigation for Part I.
6. INQUIRY In this investigation, you tracked the
Part II: The F2 Generation inheritance pattern of one sex-linked trait. Design an
6. Determine the genotype of the flies for the F1 cross. investigation that would track the inheritance of one
7. Construct a table to record your results. of these traits and the autosomal trait of normal versus
vestigial wings. Describe the results you expect.
8. Use a computer simulation program or obtain results
for the F2 generation from your teacher. Record the 7. RESEARCH Drosophila melanogaster has been used
results in your table. extensively in genetics research. What other traits have
been studied in Drosophila? On which chromosomes
Analyze and Interpret are the genes for these traits located?
Part I
1. From the data you recorded on the appearance of the
flies in the F1 generation, which trait is dominant?
Explain your answer.
2. Given your response to question 1, form a hypothesis
about the phenotypic ratio that you will observe in the
F2 generation.
Part II
3. Calculate an actual phenotypic ratio of the F2
generation from your results.

A B

Two forms of body colour in fruit flies are black (A) and yellow (B).

Chapter 6 Complex Patterns of Inheritance • MHR 271


Chapter 6 SUMMARY

Section 6.1 Beyond Mendel’s Observations of Inheritance

Some patterns of inheritance are more complex KEY CONCEPTS


than those first proposed by Mendel. These include • Incomplete dominance leads to the expression of an
codominant and incomplete dominant inheritance intermediate phenotype. In the case of codominance,
patterns. In addition, for some traits multiple alleles both alleles are fully expressed.
for a gene can exist within the population. • Although an individual has only two alleles for any gene,
multiple alleles for a gene may exist within the population.
KEY TERMS
codominance incomplete dominance • Environmental conditions can influence the expression of
continuous variation polygenic trait certain traits.
heterozygous advantage • Polygenic traits are controlled by more than one gene
and can usually be identified by continuous variation in
phenotype.

Section 6.2 Inheritance of Linked Genes

Some traits are inherited together, due to linked genes. KEY CONCEPTS
Gene linkage includes sex-linked genes, which are on • Alleles of different genes that are on the same chromosome
the sex chromosomes. do not assort independently. These genes are said to be
linked and their associated traits tend to be inherited
KEY TERMS together.
linked genes sex-linked trait • Sex-linked traits are expressed in different ratios by male
and female offspring because they are determined by the
segregation of X and Y chromosomes.
• Although sex-linked genes are linked to the X and Y
chromosomes, Punnett squares can be used to predict
genotypes and phenotypes.

Section 6.3 The Future of Genetics Research

Current and future research in genetics involves KEY CONCEPTS


studying how phenotypes result from complex • The complete DNA sequence of the human genome was
interactions between genes and gene products. determined as part of the Human Genome Project.
• The field of bioinformatics arose from the need to share
KEY TERMS
and maintain the large quantities of data collected from
bioinformatics genomics
genomic research. It also provides tools for analyzing
genetic profile
genomic data.
• There is still much to be learned from the data generated
from the Human Genome Project, particularly in identifying
genes that are associated with human health.
• Current and future research in genomics may allow
scientists to tailor preventative and curative treatments for
individual patients based on their specific genetic profiles.
However, ethical questions about who owns an individual’s
genetic information continue to be debated.

272 MHR • Unit 2 Genetic Processes


Chapter 6 REVIEW

Knowledge and Understanding 5. The following pedigree follows the inheritance pattern
Select the letter of the best answer below. of sickle cell anemia in a family. What is the sex,
genotype, and phenotype of individual II-5?
1. The seed colour of a particular species of plant
is inherited through incomplete dominance. If a I
true-breeding plant with blue seeds is crossed with 1 2
a true-breeding plant with yellow seeds, what is the
expected seed colour of the offspring?
II
a. yellow 1 2 3 4 5
b. green
c. blue
d. yellow and blue spots
III
1 2 3 4 5
e. You cannot predict seed colour from the
a. unaffected female, HbAHbS
information given.
b. affected female, HbAHbS
2. Roan cows are the result of a codominant inheritance
c. unaffected male, HbSHbS
pattern. In roan cows, the allele for white hair and the
d. affected male, HbSHbS
allele for red hair are both expressed. Which of the
following is the most appropriate representation for e. unaffected male, HbAHbA
codominant alleles? 6. An X-linked dominant allele is inherited from a
a. Let W = allele for white hair, and let R = allele for heterozygous female by
red hair. a. all of her sons
b. Let W = allele for white hair, and let r = allele for b. half of her sons
red hair. c. all of her daughters
c. Let w = allele for white hair, and let R = allele for d. none of her daughters
red hair. e. all of her children
d. Let CW = allele for white hair, and let CR = allele for 7. Which of the following most accurately describes the
red hair. field of genomics?
e. Let Cw = allele for white hair, and let CR = allele for a. the study of haplotypes
red hair. b. the study of how DNA is copied
3. A man with blood type O and a woman with blood c. the study of how genes interact to produce a
type AB have a child. Which of the following are phenotype
possible blood type(s) for the child? d. the study of how genomes are formed
a. O only e. the study of the inheritance pattern of genes
b. AB only 8. How has DNA microarray technology revolutionized
c. A or B the study of gene activity?
d. A, B, or O a. Gene expression in cells can now be studied.
e. A, B, AB, or O b. The proteins produced by genes have been
4. Skin colour in humans ranges from very dark to very discovered.
light. Which of the following most likely describes how c. Many genes can be studied at the same time.
skin colour is inherited? d. The human genome has been completely sequenced.
a. principle of dominance e. All of the proteins produced in a cell can now be
b. incomplete dominance studied.
c. codominance
d. polygenic inheritance
e. environmental influence

Chapter 6 Complex Patterns of Inheritance • MHR 273


Chapter 6 REVIEW

Answer the questions below. 19. In foxes, a pair of alleles, CP and Cp, interact as follows:
9. A plant that produces white flowers is crossed with a • CPCP is lethal, usually during an embryonic stage
plant that produces red flowers. Describe the pattern • CPCp produces platinum-coloured fur
of inheritance if the flowers produced are • CpCp produces silver foxes.
a. pink Could a fox breeder establish a true-breeding variety
b. red and white spotted of platinum foxes? Explain.
c. all red 20. A man with type B blood and a woman with type
10. What is the predicted phenotypic ratio in the F2 AB blood have children. What blood types are possible
generation if two alleles are inherited by incomplete among their children? What would tell you that the
dominance? man is heterozygous for type B blood?
11. What is heterozygous advantage? Provide an example. 21. A woman with type AB blood has a child with the
same blood type. What are the possible genotypes of
12. Describe how multiple alleles influence inheritance of
the father?
a trait. Provide an example.
22. What could be a genetic reason for the black area of fur
13. Height is an example of a polygenic trait. What aspect
forming after a cold pack has been placed on the back
of height suggests this?
of this Himalayan rabbit?
14. What are linked genes? Explain why their inheritance
is not according to the law of independent assortment.
15. Parents who do not have symptoms of Duchenne
muscular dystrophy have a son with Duchenne
muscular dystrophy. Which parent has passed the
disease to their son? Explain your answer.
23. Explain why genes that are far apart on a single
16. What is a person’s genetic profile? What are some
chromosome may be inherited as though they are on
ethical issues concerning access to this information?
different chromosomes.
Thinking and Investigation 24. A horse breeder finds that one of his stallions has a
17. A man with straight hair has two children with a genetic defect that affects the production of sperm.
woman who has curly hair. One child has straight hair, The gene associated with this trait is located on the Y
and one has wavy hair. What pattern of inheritance for chromosome. What is the possibility that the stallion’s
hair type does this suggest? female offspring could pass on this trait to their sons?
18. Use the pedigree below to answer the following Explain.
questions. The letters in the symbols indicate the blood 25. Fruit flies can have normal wings or stunted wings.
type of each individual. In an investigation, you mate several normal-winged
a. Determine the blood types of individuals I-4 females with a male that has stunted wings. In the F1
and I-6. generations, only the males have stunted wings. What
b. Individual III-2 and a man with blood type AB have can you conclude from this investigation?
four children. Will any of these children have blood 26. Suppose that the first dihybrid crosses Mendel
type O? Explain. performed had involved traits controlled by closely
linked genes.
a. How would Mendel’s results have differed from the
I A AB B ? O ?
results he obtained for a dihybrid cross involving
1 2 3 4 5 6
non-linked genes?
b. What hypothesis might Mendel have developed to
II AB B A AB A O explain his results?
1 2 3 4 5 6 c. What investigation could Mendel have conducted to
test this hypothesis? What would he have observed?
III O O O A B
1 2 3 4 5

274 MHR • Unit 2 Genetic Processes


Communication Application
27. Rudy and Maria are expecting a baby. They have 35. A farmer wants to breed a variety of taller corn.
normal vision, but both of their fathers are colour a. How can the farmer use variation in the height of
vision deficient (CVD). Their mothers have normal the current corn plants to produce taller corn plants?
vision. b. Will the farmer’s work be most effective if height in
a. Draw a pedigree for their family. corn plants is determined by polygenic inheritance,
b. What is the probability that the baby will be a girl multiple alleles, or codominant alleles? Explain.
with CVD? c. The farmer finds that many of the tallest corn plants
c. What is the probability that the baby will be a boy are also very susceptible to a particular disease.
with normal vision? How could the farmer design an investigation to
28. The closer genes are together on a chromosome, the find out if the genes for height are linked to the
more likely they will assort together. Illustrate this genes that cause susceptibility to the disease?
concept with a model or diagram. d. If these genes are linked, what steps could the farmer
take to create a breed of corn that is taller and more
29. Variability and diversity of living organisms
disease-resistant than the current corn crop?
result from the distribution of genetic
materials during the process of meiosis. Mendel 36. Figure 6.17 provides a summary of some important
proposed the idea that all genes assort independently, discoveries in genetics research, including the Human
producing offspring with a variety of traits whose Genome Project.
distribution can be predicted mathematically. William a. Research one development or discovery that is
Bateson and Reginald Punnett found that not all genes in the figure, including an aspect of the Human
do assort independently. Develop a diagram that shows Genome Project. Choose a subject that you have not
independent assortment and how linked genes learned about in this unit.
contradict this theory. b. As part of your research, find out about at least one
30. Genetic and genomic research can have individual who is associated with the discovery or
social and environmental implications. invention.
Identify a potential scientific outcome of genomics c. Summarize your findings and develop a
research. Develop an illustration showing the possible presentation that you could present to the
social implications of achieving that outcome. class or another general audience. Make sure
31. In this chapter, DNA sequences in a genome are your presentation includes a discussion on
compared to letters strung together in a book. Develop the importance of the discovery in terms of its
another analogy for DNA, chromosomes, genes, and contribution to scientific research.
nucleotides. Illustrate your analogy with a diagram or 37. Genome Canada was established in 2000 to develop a
model. national program for financial support of genomic and
32. Use a graphic organizer to summarize the uses of proteomic research in Canada.
bioinformatics in genetics research. a. Choose a research project that is funded by Genome
Canada and that is listed on the Genome Canada
33. There are many benefits to genetics research, but there
website.
are also significant ethical concerns. Use a concept map
b. Write a brief description that summarizes what
to illustrate some of the benefits and concerns that are
the project is studying. Include the names of the
associated with the different genetics research topics
individuals associated with the project and at what
discussed in this chapter.
institution(s) they work.
34. Summarize your learning in this chapter using
c. Research Genome Canada’s GE3LS program. What
a graphic organizer. To help you, the Chapter 6 does this acronym stand for and what are the main
Summary lists the Key Terms and Key Concepts. Refer objectives of this program? Develop an argument for
to Using Graphic Organizers in Appendix A to help or against the importance of having such a program.
you decide which graphic organizer to use.

Chapter 6 Complex Patterns of Inheritance • MHR 275


Chapter 6 SELF-ASSESSMENT

Select the letter of the best answer below. Use the following information to answer questions 6 and 7.
1. K/U Incomplete dominance occurs when The gene that controls coat colour in rabbits has four alleles:
a. one allele masks the expression of the other allele agouti (C), chinchilla (cch), Himalayan (ch), and albino (c).
b. one trait is masked by the presence of another trait The order of dominance is C > cch > ch > c.
c. both alleles are expressed when the alleles occur 6. K/U What is the phenotype of a rabbit with the
together genotype cchc?
d. an intermediate phenotype is expressed when the a. agouti
alleles occur together b. chinchilla
e. an unpredictable phenotype is expressed when the c. chinchilla and albino mix
alleles occur together d. Himalayan
2. K/U Which of the following is an example of e. albino
codominance? 7. T/I If a rabbit with the phenotype cchch is crossed
a. A plant with green seeds is crossed with a plant with with an albino rabbit, what is the probability of
white seeds; the offspring produce white seeds. producing a Himalayan rabbit?
b. Individuals who are heterozygous for sickle cell a. 0 percent
disease produce both normal and sickle-shaped b. 25 percent
red blood cells. c. 50 percent
c. A red snapdragon crossed with a white snapdragon d. 75 percent
produces pink snapdragons. e. 100 percent
d. There are many genes that control eye colour.
8. K/U How can linked genes become “unlinked”?
e. A litter of kittens often display a wide variety of
a. During meiosis, they sort independently.
traits.
b. During crossing over, they are separated.
3. T/I A man who is homozygous for blood type A
c. During anaphase, they segregate to opposite poles
and a woman who is homozygous for blood type B
in the cell.
have a child. Which of the following could be the
d. During mutation, the genes are separated.
child’s genotype?
e. During DNA replication, the genes are rearranged.
a. IAi
b. IAIA 9. T/I Hemophilia is an X-linked recessive disorder.
If a female with hemophilia and a male without
c. IBi
hemophilia had children, what is the predicted
d. IBIB
percentage of children who would have hemophilia?
e. IAIB
a. 0 percent
4. K/U Which two terms are most relevant to the b. 25 percent
inheritance of human blood types?
c. 50 percent
a. incomplete dominance and codominance
d. 75 percent
b. codominance and multiple alleles
e. 100 percent
c. incomplete dominance and multiple alleles
10. K/U Which of the following statements about the
d. codominance and polygenic inheritance
Human Genome Project is false?
e. dominance and codominance
a. It involved sequencing the human genome.
5. K/U Traits that exhibit continuous variation are
b. It identified coding and non-coding sections of
usually DNA.
a. controlled by one gene c. It involved sequencing the genome of common
b. the result of codominance representative organisms.
c. dominant d. It identified genes in the human genome.
d. polygenic e. It determined the functions of the genes in the
e. affected by the environment human genome.

276 MHR • Unit 2 Genetic Processes


Use sentences and diagrams as appropriate to answer the 17. T/I The pedigree below illustrates the sex-linked
questions below. inheritance pattern of a trait in a family.
11. T/I In radishes, colour is controlled by two alleles,
one for red colour and one for white colour.
I
1 2
Inheritance of these alleles shows incomplete
dominance. The photographs below show the
phenotype for each possible colour: red, purple, and II
1 2 3 4 5 6
white. What phenotypic ratio would you expect from
crossing two heterozygous radish plants?
III
1 2 3 4 5 6

a. Explain how this pedigree shows sex-linked


inheritance. What type of sex-linked inheritance is
it? Explain.
b. From the pattern of inheritance you determined in
part (a), determine the genotype of II-2.
c. Based on your answer to part (a), determine the
12. T/I A student crosses a true-breeding plant that probability that individuals II-1 and II-2 would have
produces green seeds with a true-breeding plant that an affected child.
produces yellow seeds. Predict the possible offspring 18. C Duchenne muscular dystrophy affects many
when more males than females. Explain why and draw a
a. the allele for green seeds is dominant to the allele pedigree to illustrate its inheritance pattern.
for yellow seeds 19. K/U Explain why males cannot be carriers of an
b. the allele for green seeds is codominant with the X-linked trait.
allele for yellow seeds
20. K/U Explain how Barr bodies account for the patchy
c. the alleles for green and yellow seeds are
colours of female calico cats.
incompletely dominant
21. K/U Why did the Human Genome Project include
13. C Blood type ABO is determined by three alleles.
the sequencing of other organisms?
Draw a diagram that shows how blood type is
determined by a combination of the three alleles. 22. C “Decoding the human genome can be compared
to reading a book in a language that nobody knows or
14. A Investigating environmental effects on gene
understands.” Explain this statement using diagrams or
expression is an important aspect of genetics research
a graphic organizer.
on plant crops. Explain why, using an example of a trait
to illustrate your answer. 23. A What is genomics research? How can it be used
to improve human health?
15. C Draw a diagram that illustrates the concept of
linked alleles of genes. In your diagram, show how they 24. A What is bioinformatics? Describe a scientific
can become unlinked. study that uses bioinformatics.

16. C A female fruit fly that is homozygous dominant 25. A The human genome has long stretches of DNA
for red eyes is crossed with a white-eyed male fruit fly. that do not code for proteins. Describe how the
Use a Punnett square to predict the genotype(s) and variation between individuals in these regions can
phenotype(s) of their offspring. be useful to study.

Self-Check
If you missed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
question...
Review
6.1 6.1 6.1 6.1 6.1 6.1 6.1 6.2 6.2 6.3 6.1 6.1 6.1 6.1 6.2 6.2 6.2 6.2 6.2 6.2 6.3 6.3 6.3 6.3 6.3
section(s)...

Chapter 6 Complex Patterns of Inheritance • MHR 277


Unit 2 Project
An Issue to Analyze

Analyzing the Risks and Benefits of GMOs


For many years farmers have used reproductive technologies such as selective breeding to
produce the strongest and most profitable plants and animals possible. Now genetic engineering
allows scientists to manipulate genomes. All of the organisms shown below have been genetically
modified to become transgenic organisms. Recall that a genetically modified organism, or GMO,
is one whose genome has been altered. A transgenic organism is produced when this alteration
involves the insertion of a gene from another organism. The merits of producing such organisms
are continually debated. The long-term effects that GMOs have on humans who are exposed to
them, on the modified organisms themselves, and on the environment are not yet known.
Assume the role of a science writer who contributes to an on-line magazine that is a
forum for discussions on the impact of GMOs on society. Choose a GMO and research its
application(s). Analyze the benefits and risks associated with the use of this organism and develop
recommendations regarding its application(s).

What are the issues related to the use of genetically modified organisms, and do the benefits
outweigh the possible risks?

Initiate and Plan


1. Select one GMO and its application(s). Some options • organisms genetically modified to improve medical
for you to consider are treatment for humans (for example, plants or animals
• organisms genetically modified to be more resistant used in pharmaceutical production)
to disease • organisms genetically modified to provide alternative
• organisms genetically modified to be more resistant and/or higher yield food products for human
to very cold temperatures consumption
• organisms genetically modified to allow for • organisms genetically modified to improve
easier harvesting environmental conditions

Most canola plants grown in western This Enviropig™ has had a bacterial gene These GloFish® have had a gene from sea
Canada have had a bacterial gene inserted into its genome that enables it anemones inserted into their genomes
inserted into their genomes that makes to break down a phosphorus-containing that makes them glow in the dark.
them resistant to herbicides. compound in feed.

278 MHR • Unit 2 Genetic Processes


Perform and Record Analyze and Interpret
2. Research your chosen GMO. Focus your initial research 1. Prepare a risk-benefit analysis that outlines the risks
on the scientific technology associated with the and benefits associated with the development of the
development of the organism, and on the regulatory GMO and its application(s). Refer to Analyzing STSE
processes that must be followed. Issues in Appendix A for help with how to do
this analysis.
3. Consider the following questions to guide your
research: 2. Make recommendations about whether development
• What type of genetic modification have scientists and use of the GMO should continue as is, should
made to the organism? Does this modification stop, or requires stricter regulations. Support your
involve inserting a gene from another organism, to recommendations using specific examples from your
produce a transgenic organism? risk-benefit analysis.
• What government regulatory bodies are involved in Communicate Your Findings
reviewing the research, development, and use of the
3. Choose a form of communication to convey your
organism (for example, local municipal government,
recommendations that is appropriate for an on-line
provincial government, Health Canada, Environment
magazine (such as a web page, blog, podcast, or
Canada, U.S. Food and Drug Administration)?
Internet video).
• At what stage of research and development is
the genetic engineering of the organism and its
application(s)? Is research still at a preliminary Assessment Criteria
stage? Has research and development received some Once you complete your project, ask yourself these
kind of government approval? Has the organism questions. Did you…
or its products received government approval for
✓ K/U select an appropriate GMO?
commercial use?
✓ K/U describe the scientific and technical principles
4. Research the economic, political, societal, ethical, and related to the technology and the regulatory
environmental issues related to the application(s) of the processes that must be followed?
GMO that you have selected. ✓ A identify the economic, political, societal,
5. Consider the following questions to guide your research: ethical, and environmental issues related to
the technology?
• Who stands to benefit the most from the application(s)?
✓ A make recommendations based on specific
• What is the most significant benefit? examples from the risk-benefit analysis of whether
• What is the most significant risk to the environment use of the GMO should continue as is, be stopped, or
be under stricter regulations?
(if any), and to society as a whole?
✓ C organize your research using an appropriate
• What, if any, long-term benefits and risks have citizens
format and appropriate academic documentation?
or scientists identified regarding the use of this GMO?
✓ C select a format for your recommendations
• What are the sources of the information you have that is appropriate for the audience and purpose?
gathered? How trustworthy and credible are your
✓ C use scientific vocabulary appropriately?
sources? How do you know?

Unit 2 Project • MHR 279


UNIT
2 SUMMARY

Overall Expectations
In this unit you learned how to…
• Genetic and genomic research can have social and • evaluate the importance of some recent contributions to
environmental implications. our knowledge of genetic processes, and analyze social
• Variability and diversity of living organisms result from and ethical implications of genetic and genomic research
the distribution of genetic materials during the process • investigate genetic processes, including those that occur
of meiosis. during meiosis, and analyze data to solve basic genetic
problems involving monohybrid and dihybrid crosses
• demonstrate an understanding of concepts, processes,
and technologies related to the transmission of hereditary
characteristics

Chapter 4 Cell Division and Reproduction

KEY IDEAS • Errors during meiosis can result


• Chromosomes in human somatic cells are organized into in changes to the structure and
23 pairs. One pair is the sex chromosomes, and the other number of chromosomes.
22 pairs are the autosomes. • Modern technologies allow
• Meiosis produces haploid gametes from diploid parent scientists to manipulate the
cells. It leads to genetic variation in gametes through the genetic make-up of organisms.
independent assortment of chromosomes and crossing This has led to many benefits.
over of genetic material.

Chapter 5 Patterns of Inheritance

KEY IDEAS • Pedigrees provide information


• Mendel’s monohybrid and dihybrid cross experiments about the inheritance of genotypes
demonstrated the existence of dominant and recessive and phenotypes of individuals
forms of traits. across generations within a family.
• The combination of alleles in an individual is its genotype. • Karyotyping, fluorescence
The expression of the genotype in an individual is the in situ hybridization (FISH),
phenotype. A dominant phenotype is expressed when and gene testing are used to
a dominant allele is present. A recessive phenotype monitor chromosome structure,
requires two copies of the recessive allele. chromosome number, and
• Punnett squares are used to study the genotypes and disease-causing genes.
phenotypes of offspring.

Chapter 6 Complex Patterns of Inheritance

KEY IDEAS • The Human Genome Project


• Some patterns of inheritance are more complex than those determined the complete DNA
first proposed by Mendel. These include codominant and sequence of the human genome.
incomplete dominant inheritance patterns. In addition, for Many new research fields and
some traits multiple alleles of a gene exist in the population. methods have developed from
• Linked genes occur on the same chromosome and tend to this project.
be inherited together. However, crossing over can unlink • Current and future research in
these genes. genomics may allow scientists
• Sex-linked traits are expressed in different ratios by male to tailor medical treatments
and female offspring because they are governed by the for individual patients based on their genetic profiles.
segregation of X and Y chromosomes. However, ethical questions about who owns genetic
information continue to be debated.

280 MHR • Unit 2 Genetic Processes


UNI T
2 REVIEW

Knowledge and Understanding 5. Which of the following statements best describes an


Select the letter of the best answer below. individual whose genetic make-up is shown below?
1. Which phase of meiosis is shown in the illustration
below?

a. prophase I
b. prophase II
c. metaphase I
d. metaphase II a. The individual is a male with the correct number
e. interphase of chromosomes.
2. Which of the following statements best describes the b. The individual is a female with the correct number
difference between a daughter cell produced by mitosis of chromosomes.
and one produced by meiosis? c. The individual is a male with trisomy.
a. A cell produced by mitosis is genetically identical to d. The individual is a female with trisomy.
a cell produced by meiosis. e. The individual is a female with monosomy.
b. A cell produced by mitosis has half the DNA
6. Blue flowers (B) is dominant to white flowers (b).
content of a cell produced by meiosis.
A true-breeding plant with blue flowers is crossed with
c. A cell produced by meiosis has half the DNA a true-breeding plant with white flowers. Which of the
content of a cell produced by mitosis. following statements represents a result of this cross?
d. A cell produced by mitosis is genetically altered due a. The offspring all have the genotype Bb.
to crossing over, but a cell produced by meiosis is
b. The offspring are all homozygous recessive for blue
not.
flowers.
e. A cell produced by mitosis can produce an egg or
c. The offspring are all homozygous recessive for white
sperm cell, but a cell produced by meiosis cannot.
flowers.
3. Which of the following processes contributes to genetic d. The offspring all have the phenotype bb.
variation? e. The offspring are all homozygous dominant for blue
a. cloning flowers.
b. mitosis
7. What is the predicted phenotypic ratio of the offspring
c. crossing over from a dihybrid cross between two individuals that
d. interphase are heterozygous for both traits? Assume that the two
e. cytokinesis genes involved are not linked.
4. A cross is performed between two pea plants, one with a. 3:1
the genotype Tt, and the other with the genotype tt. If b. 9:3:3:1
250 offspring are produced, approximately how many c. 1:2:2:1
have the genotype Tt? d. 1:1:1:1
a. 0 e. 1:3
b. 63
c. 125
d. 180
e. 250

Unit 2 Review • MHR 281


UNIT
2 REVIEW

8. What is a key indicator of autosomal dominant 17. Mendel performed his ground-breaking genetic
inheritance? experiments using pea plants. List three characteristics
a. The trait is passed from father to son. of pea plants that helped Mendel obtain such conclusive
b. The trait is passed from father through an results, and thus allowed him to develop his theory
unaffected daughter to her sons. of inheritance.
c. The trait skips generations. 18. Describe what the terms dominant and recessive mean.
d. Two unaffected parents have an affected child. How are they used to describe the forms of a trait at
e. Two affected parents have an unaffected child. the genotype level and at the phenotype level?
9. Incomplete dominance is expected when 19. What are monohybrid and dihybrid crosses? How can
a. one allele prevents the expression of the other allele Punnett squares be used to represent these crosses?
b. the expression of one allele is masked by the 20. What is meant by the phrase autosomal recessive
presence of another allele inheritance? In your explanation, use an example of
c. an intermediate phenotype is expressed when the a genetic disorder that is inherited in this manner.
alleles occur together 21. Describe the chromosome theory of inheritance and
d. both phenotypes are expressed when the alleles the contribution that Walter Sutton’s research made to
occur together the development of this theory.
e. the phenotypes are expressed randomly when the 22. Describe three types of genetic tests that are done and
alleles occur together the information that each provides.
10. A man with blood type AB married a woman with 23. Why is sickle cell anemia an example of codominant
blood type B who carries an allele for blood type O. inheritance?
What are the possible blood types of their children?
24. Explain how a single gene may have multiple alleles.
a. O Include an example of a trait affected by multiple alleles
b. A and B in your explanation, and describe how multiple alleles
c. A and AB affect phenotypes.
d. B and AB 25. Colour vision deficiency (CVD) is a sex-linked trait.
e. A, B, and AB Explain why males cannot be carriers for CVD.
Answer the questions below. 26. Describe the role that bioinformatics played in the
11. What happens during each phase of interphase? Human Genome Project.
12. What is a karyotype and what is it used for? 27. Describe the similarities and differences between
mitosis and meiosis.
13. What are the important features that make
chromosomes homologous pairs? Why are 28. What is the difference between a gene and an allele?
homologous chromosomes not identical?
Thinking and Investigation
14. What are haploid and diploid cells? Where is each cell 29. Errors can occur during meiosis that result
type found?
in alterations to the number and structure of
15. What are the two essential outcomes of meiosis? chromosomes.
Identify the phases of meiosis where these outcomes a. Describe the different types of errors.
are achieved. b. What methods are used to detect and differentiate
16. The diploid cells of a fruit fly (Drosophila melanogaster) between these errors?
contain four chromosomes. 30. How do artificial insemination and embryo transfer
a. How many pairs of chromosomes does a diploid cell differ in terms of controlling genetic variation?
of a fruit fly contain?
31. Compare and contrast oogenesis and spermatogenesis.
b. How many chromosomes does a haploid cell of a
List their similarities and their differences.
fruit fly contain?
c. How many genetically distinct gametes can be
produced from a parent?

282 MHR • Unit 2 Genetic Processes


32. If black coat colour is dominant to white coat colour in 37. The pedigree below traces a genetic disorder in a
an animal, what is the family.
a. genotype of a homozygous black-coated animal?
b. genotype of a homozygous white-coated animal? I
1 2
c. genotype of a heterozygous animal?
d. genotypes of the gametes produced by each of the
animals in parts (a) to (c)? II
1 2 3
33. The following data were obtained from an initial cross
between a true-breeding round-seeded pea plant and a a. Do you think the disorder has an autosomal
true-breeding wrinkled-seeded pea plant. dominant or autosomal recessive inheritance
a. Based on the data, what are the dominant and pattern? Why?
recessive forms of seed shape? Explain your answer. b. Provide the genotypes and phenotypes for all
b. Do the data in the tables support the Mendelian ratio? individuals in this pedigree. Explain your answer.
Explain your answer, and any differences observed. If there is a genotype you cannot be sure of, explain
why.
Results for the F1 Generation
Trait Form Number of Offspring 38. In snapdragons, the alleles for flower colour display
Plants with round seeds 175 incomplete dominance.
Plants with wrinkled seeds 0 a. A red-flowered plant is crossed with a
white-flowered plant. What are the predicted
Results for the F2 Generation
genotypes and phenotypes of the offspring? Explain
Trait Form Number of Offspring your answer.
Plants with round seeds 154
b. An offspring produced from the mating in part
Plants with wrinkled seeds 49
(a) is crossed with a white-coloured snapdragon.
34. In humans, the allele for peaked hairline is dominant What are the predicted phenotypes and genotypes
to the allele for smooth hairline. Is it possible for two of the offspring? Include the phenotypic ratio of the
adults with peaked hairlines to have a child with a offspring.
smooth hairline? Explain. 39. From the following blood types, determine which baby
35. Copy and complete the table below in your notebook, belongs to which parents. Explain your answer.
given the information about pea plants in Table 5.1 and Baby 1 – blood type O
the following: Baby 2 – blood type B
T = tall plant G = green pod colour Mr. Jones – blood type A
Y = yellow seed colour Mrs. Jones – blood type A
Gamete Gamete Mr. Guttierez – blood type A
from Male from Female Genotype Phenotype Mrs. Guttierez – blood type AB
Parent Parent of Offspring of Offspring
40. Determine the probability of a hemophiliac child
TY tY
being born when neither the father nor the mother has
Gt gt
hemophilia, but the mother’s father has hemophilia. Is
Yg yg there any chance that their daughters will be affected?
36. In pea plants, the allele for purple flowers is dominant Why or why not?
to the allele for white flowers and the allele for tall 41. How do epigenetics and genetics differ? Provide two
plants is dominant to the allele for short plants. Two examples of investigations that illustrate the differences
pea plants that are heterozygous for both traits are between these fields of study.
crossed, producing 272 offspring.
a. Provide the genotype of each parent.
Communication
b. What are the genotypes of the gametes from each 42. Draw an illustration that shows the relationship
parent? between DNA, chromatin fibre, a chromosome, a gene,
an allele, and homologous chromosomes.
c. What is the expected number of offspring that are
short plants with white flowers?

Unit 2 Review • MHR 283


UNIT
2 REVIEW

43. Summarize the process of meiosis in graphic 51. Since Mendel performed his experiments with pea
form, illustrating the movement and number of plants, scientists have discovered that there are more
chromosomes in each cell. complex patterns of inheritance. Use examples and
44. Variability and diversity of living organisms diagrams to illustrate the differences among the
result from the distribution of genetic following mechanisms:
materials during the process of meiosis. Crossing over • dominance
and independent assortment play an important role in • incomplete dominance
genetic recombination. Draw labelled diagrams to • codominance
show how they provide genetic variation. • sex-linked inheritance
45. Genetic and genomic research can have 52. Draw a pedigree that could represent the inheritance
social and environmental implications. of hemophilia in a family. When drawing the pedigree,
Through genetic modification, some crop plants can ensure that you choose genotypes that will clearly
be engineered to be more resistant to disease. Many illustrate the pattern of inheritance for hemophilia.
organizations and citizen groups oppose the use of Provide a brief rationale for why the pedigree shows
these crops. Choose a crop plant that has been the correct inheritance pattern.
genetically modified to be more resistant to disease. 53. In this unit, you have learned how different fields of
Research the risks and benefits associated with this study are applied to provide a better understanding
technology. Illustrate these benefits and risks in a of genetic processes and human disease. For example,
pamphlet, poster, or graphic organizer. bioinformatics was essential for the success of the
46. Use a diagram to illustrate how transgenic organisms Human Genome Project. Develop an illustration
are created. using one or two examples of different fields of study
47. A Punnett square can be used to predict the possible or technologies that have worked together to provide
outcomes of a genetic cross. Explain graphically a more complete understanding of a genetic process.
how a Punnett square uses the laws of probability
Application
by diagramming a cross between two pea plants
heterozygous for height (given that the allele for tall 54. Type 1 diabetes is managed effectively with synthetic
plants is dominant to the allele for short plants). insulin produced by bacteria. Why do scientists
Predict the genotypic and phenotypic ratios for the continue to research this disease in hopes of finding
offspring based on the results of your Punnett square. other treatments or a cure?

48. Using Punnett squares, illustrate how someone could 55. What is the risk of relying on artificial insemination or
determine whether an organism with a dominant embryo transfer to produce the offspring in a herd of
phenotype is heterozygous for that trait. animals?

49. Assume you write a monthly blog for an on-line 56. Stem cell research has led to many ground-breaking
magazine that provides information to the general discoveries, as well as thought-provoking controversies.
public about various genetic disorders. You have been a. Describe some of the controversy surrounding stem
asked to write about Huntington disease. cell research and how new research has managed to
reduce the controversy.
a. Provide a description of the genetic abnormality
that causes Huntington disease and the inheritance b. Research a development in regenerative medicine
pattern of the disorder. Also include a brief that has come from stem cell research in Canada.
statement about the symptoms, diagnosis, and Describe what the research involved, as well as its
treatment options that are available. potential benefit to society.
b. Write a brief paragraph describing your opinion 57. Scientists believe that most human diseases involve
on whether genetic testing for Huntington disease a complex array of interactions between genetic and
should be mandatory for family members when environmental factors. Why is it not possible to follow
there is a family history of the disorder. Include a trait such as high blood pressure by performing
valid points to support your argument. a monohybrid cross, as done by Mendel with pea
plants? Be sure to include both scientific and ethical
50. Draw a diagram that illustrates gene linkage.
considerations in your answer.

284 MHR • Unit 2 Genetic Processes


58. Many breeds of dogs are known for a high incidence of 61. Many organisms undergo a heat shock response when
genetic disorders. German shepherd and Saint Bernard they are placed at higher temperatures than they
dogs, like the one shown below, are predisposed to normally live at. One part of this response involves
developing a crippling condition called hip dysplasia. increased expression of certain genes, which helps the
a. Why are purebred dogs more at risk for such organisms to cope with the higher temperature.
conditions than mixed breeds? a. Describe a technique that could be used to monitor
b. What advice would you give to dog breeders who this response in an organism.
want to maintain their dogs’ purebred pedigrees, b. Saccharomyces cerevisiea, shown below, is a type of
but also want their dogs to be as healthy as possible? yeast that undergoes a heat shock response. This
organism has been extensively used in genetics
studies. Research the use of Saccharomyces cerevisiea
in genetics studies. Provide a summary of why it is
such a useful organism for this type of research.

62. Bioinformatics has applications in many fields of study.


a. Research how bioinformatics is playing an
59. Cystic fibrosis is a genetic disorder that leads to the important role in cancer research.
build-up of thickened mucus in the lungs and other b. Identify a research group in Canada that is using
organs. Individuals affected by cystic fibrosis are more bioinformatics as part of its studies in cancer
susceptible to respiratory illnesses and must undergo research.
physical therapy regularly to manage the symptoms c. Summarize the information you gather and present
of the disease. your findings to the class, using a format of your
a. Describe the genetic basis of cystic fibrosis and its choice.
pattern of inheritance. 63. How can having your genetic profile determined
b. How can a genetic counsellor help affected pose both potential risks and benefits? How has this
individuals and their families? development of genetics research brought to light the
c. One hope for a cure for cystic fibrosis is gene need for new social and political policies?
therapy. Describe how gene therapy could be used
64. Our knowledge in the areas of genetics and genomics
to cure cystic fibrosis, and the obstacles that must be
has grown incredibly since 2000. Choosing one specific
overcome for gene therapy to provide that cure.
example, discuss how this research has increased our
60. Develop a plot for a movie or play that involves the use understanding of human health and disease.
of gene therapy. Ensure that the application is accurate
scientifically.

Unit 2 Review • MHR 285


UNIT
2 SELF-ASSESSMENT

Select the letter of the best answer below. 6. K/U A gene exists in two different forms, T and t.

1. K/U Below is a list of characteristics of chromosomes. Which allele(s) will be present in the gametes of a
Which combination of characteristics is the same for heterozygous individual?
each chromosome of a homologous pair? a. T d. Tt
I – same size IV – same gene location b. t e. TT or Tt or tt
II – same genes V – same mutations c. T or t
III – same alleles 7. T/I The allele for round seeds is dominant to the
a. I and II d. I, II, and IV allele for wrinkled seeds in pea plants. Two pea plants
b. I and III e. I, II, and V that are heterozygous for seed shape are crossed. What
c. I, II, and III is the probability of producing a plant with wrinkled
seeds?
2. K/U What is the difference between a karyotype for
a. 0 percent d. 75 percent
a normal male and a karyotype for a male with
trisomy 21? b. 25 percent e. 100 percent
a. A normal male has 20 chromosomes; a male with c. 50 percent
trisomy 21 has 21 chromosomes. 8. K/U In guinea pigs, black coat colour is dominant to

b. A normal male has one X chromosome and one brown coat colour, and short hair is dominant to long
Y chromosome; a male with trisomy 21 has two hair. How could you determine the genotype of a black
Y chromosomes. short-haired guinea pig?
c. A normal male has one X chromosome and one a. Perform a cross between it and a brown guinea pig
Y chromosome; a male with trisomy 21 has two with either hair length and examine the offspring.
X chromosomes. b. Perform a cross between it and a brown
d. A normal male has 46 chromosomes; a male with short-haired guinea pig and examine the offspring.
trisomy 21 has 47 chromosomes. c. Perform a cross between it and a brown long-haired
e. A normal male has 46 chromosomes; a male with guinea pig and examine the offspring.
trisomy 21 has 45 chromosomes. d. Perform a cross between it and a black short-haired
guinea pig and examine the offspring.
3. K/U Which of the following reproductive
technologies produces offspring that are the most e. The genotype cannot be determined.
similar genetically? 9. T/I Attached earlobes and albinism, a lack of skin
a. preimplantation genetic diagnosis pigment production, have autosomal recessive
b. in vitro fertilization inheritance patterns. Using the pedigree below,
c. artificial insemination determine the probability of individuals I-1 and I-2
having a child with albinism and unattached earlobes.
d. embryo transfer
Key
e. embryo splitting I
1 2 = albino
4. K/U What is the goal of therapeutic cloning?
a. to produce genetically identical organisms = attached
earlobes
b. to produce multiple copies of genes for mass II
production 1 2 3

c. to produce multiple copies of genes for further a. 6.25 percent d. 50 percent


research b. 12.5 percent e. 100 percent
d. to produce identical cells to treat disease c. 25 percent
e. to repopulate endangered species 10. K/U Which of the following will inherit an X-linked
5. K/U What term describes the form of a trait that allele from a heterozygous female?
seemed to disappear in Mendel’s crosses of a. only her sons
true-breeding pea plants? b. only her daughters
a. dominant d. heterozygous c. half of her sons
b. recessive e. sex-linked d. all of her daughters
c. homozygous e. one-quarter of her daughters

286 MHR • Unit 2 Genetic Processes


Use sentences and diagrams as appropriate to answer the 19. A Why is genetic testing usually not recommended
questions below. until after a genetic counsellor looks at a family
11. K/U Describe the two key outcomes of meiosis. pedigree?
12. T/I Errors that occur during meiosis are present in 20. C Gene therapy holds much promise for curing
all cells of the body, whereas errors that occur during a number of diseases, including diabetes and cystic
mitosis may occur in only a small number of cells. fibrosis. There are also a number of ethical issues
Explain why this occurs. related to gene therapy. Using a graphic organizer of
your choice, summarize the pros and cons associated
13. C Using labelled diagrams, illustrate how meiosis
with gene therapy. Refer to Using Graphic Organizers
contributes to genetic variation.
in Appendix A for help choosing a graphic organizer.
14. A Prenatal testing can be used to determine
21. C Using an organism with black hair and another
genetic abnormalities. Describe a genetic disorder in
organism with white hair as an example, illustrate the
terms of the source of the disorder, the chromosome(s)
difference between incomplete dominance and
affected, the associated symptoms, and any prevention,
codominance with a cross between these organisms.
diagnosis, or treatment options.
22. A Use your knowledge of blood types to match
15. A A variety of reproductive technologies,
the baby with the correct set of parents. Explain your
including cloning, artificial insemination, and in vitro
answer using Punnett squares.
fertilization, are used to control the genetic diversity of
farm animals or plant crops. Choose one method and Baby 1 – blood type A
describe how it is used in this manner. Baby 2 – blood type O
Mr. Rousseau – blood type AB
16. T/I In tomatoes, round shape is dominant to pear
shape. A student crossed a plant that had round Mrs. Rousseau – blood type B
tomatoes with a plant that had pear-shaped tomatoes Mr. Sakic – blood type A
and obtained the data below. What are the genotypes of Mrs. Sakic – blood type B
the plants that were crossed? Explain your answer. 23. T/I Duchenne muscular dystrophy is an example of
Results of a Tomato Plant Cross a sex-linked recessive trait found on the X chromosome.
Trait Forms Number of Offspring a. Write the genotypes of a female carrier, a normal
Pear-shaped tomatoes 33 male, and an affected male.
Round tomatoes 37 b. Determine the probability of a female carrier and
a normal male having an affected child.
17. T/I A long-haired cat and a short-haired cat have a
c. Is it possible for the parents in (b) to have an
litter of kittens. The litter has both short-haired and
affected daughter? Explain why or why not.
long-haired kittens. If the allele for short hair is
dominant to the allele for long hair, determine the 24. K/U How will the HapMap project help scientists

genotypes of the parents. Explain your answer. gain a better understanding of the genetic reasons for
different human diseases?
18. T/I In mice, the allele for black fur is dominant to
the allele for brown fur, and the allele for deafness is 25. K/U Describe the Human Genome Project and its
recessive to the allele for normal hearing. If a mouse achievements. How has the completion of this project
that is heterozygous for both traits is crossed with a been important for the advancement of genetics
homozygous black mouse carrying the deafness allele, research?
determine the probability of producing a deaf black
mouse.

Self-Check
If you missed
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
question...
Review 4.1, 4.2,
4.1 4.2 4.3 4.3 5.1 5.1 5.2 5.2 5.3 6.2 4.2 4.2 4.3 5.2 5.2 5.2 5.3 5.3 6.1 6.1 6.2 6.3 6.3
section(s)... 4.2 5.3

Unit 2 Self-Assessment • MHR 287

Common questions

Powered by AI

The ethics of genetic data ownership revolves around whether genetic information is personal property or a common resource. One perspective argues that genetic information should be owned solely by individuals, preserving privacy and autonomy. Conversely, others feel it is a shared resource, especially for benefits arising from collective research. Companies argue for data ownership to encourage investment by protecting commercialization rights, while critics advocate for transparency and consent in data use to prevent exploitation .

Bioinformatics plays a crucial role in organizing and analyzing large sets of genetic data, allowing a deeper understanding of genetic sequences. The field arose due to the need to manage the vast amounts of data generated during genome sequencing efforts, such as those from the Human Genome Project. Foundational steps leading to its development include advances in DNA sequencing technology, the establishment of data storage and software platforms, and improvements in communication technology for sharing data globally .

The Human Genome Project has significantly impacted fields beyond genetics by providing a blueprint for studying human biology and disease. It allows for improved understanding and research in medicine, agriculture, and environmental sciences. For example, by identifying genome sequences, scientists have developed targeted therapies for genetic disorders and enhanced crop resistance through genetic modifications. Furthermore, it supports personalized medicine approaches by understanding individual genetic makeup .

The percentage of unlinked genes in gametes can indicate the distance between genes on a chromosome. A lower percentage of recombination (unlinked genes) suggests that two genes are closer together. For genes P and Q, P and R, and Q and R, the lowest percentage of unlinked genes is 5% for P and Q. Therefore, genes P and Q are the closest pair on the chromosome .

Tortoiseshell coat color in cats is a result of X chromosome inactivation. In female cats that are heterozygous, approximately 50% of cells will express the allele for black coat color, and the other 50% will express the allele for orange coat color. This X-linked expression pattern provides the mixture of black and orange patches, as seen in tortoiseshell cats. White patches can occur due to the interaction with another gene .

Incomplete dominance occurs when a heterozygote exhibits a phenotype that is intermediate between the two homozygotes, different from complete dominance, where one allele completely masks another. In snapdragons, incomplete dominance is illustrated by red (RR), white (WW), and pink (RW) flowers. Crossing red and white snapdragons produces heterozygous offspring with pink flowers, showing that neither allele completely dominates .

Sequencing the human genome is only the first step; challenges remain in interpreting the vast amounts of data. Many genomic regions have unknown functions, and understanding gene regulation, epigenetics, and interactions among genes requires further research. Integrating sequencing with other biological data, such as proteomics and metabolomics, and improving computational models are necessary steps. Collaboration across disciplines and public engagement will help address these challenges and translate genomic data into practical applications .

The Human Genome Project revealed several unexpected findings: only about 2% of the human genome's nucleotides form genes coding for proteins; there are roughly 25,000 human genes, fewer than expected (initial estimates were 80,000 to 140,000); more than 50% of the genome comprises repeating sequences; and humans exhibit very little genetic variation, with 99.9% of DNA being nearly identical across all individuals .

Linked genes, those located close together on the same chromosome, can become unlinked through the process of crossing over during meiosis. During this process, homologous chromosomes exchange segments, leading to new allele combinations. Crossing over can separate linked genes, allowing them to assort independently into gametes .

A girl with Turner syndrome could have red-green color vision deficiency if she has a single X chromosome carrying the recessive allele for color vision deficiency. Turner syndrome involves having only one X chromosome (X0), so if the inherited X chromosome is from a color-deficient mother (carrier), she expresses this trait as there is no normal allele to mask it from a secondary X chromosome .

You might also like