0

1
Contents

1 Historical Introduction ........................................................................................................................................ 6

2 Normal Chromosomes ....................................................................................................................................... 10

2.1 Introduction .......................................................................................................................................................... 10
2.2 Chromosome Number and Morphology .............................................................................................................. 10
2.2.1 Non-Banding Techniques .................................................................................................................................... 10
2.2.2 Banding Techniques ............................................................................................................................................. 11
2.2.3 X- and Y-Chromatin ............................................................................................................................................ 13
2.3 Chromosome Band Nomenclature ....................................................................................................................... 13
2.3.1 Identification and Definition of Chromosome Bands, Landmarks and Regions.................................................. 13
2.3.2 Designation of Regions, Bands and Subbands ..................................................................................................... 14
2.4 High-Resolution Banding .................................................................................................................................... 16
2.5 Variation in Heterochromatic Segments, Satellite Stalks and Satellites................................................................ 19
2.5.1 Variation in Length ............................................................................................................................................... 19
2.5.2 Variation in Number and Position ........................................................................................................................ 20
2.6 Euchromatic Variants ........................................................................................................................................... 20
2.6.1 Copy Number Variants and Structural Variants ................................................................................................... 20
2.6.2 Fragile Sites .......................................................................................................................................................... 21
.
3 Symbols and Abbreviated Terms ....................................................................................................................... 22

4 General Rules ....................................................................................................................................................... 27

4.1 Introduction ............................................................................................................................................................ 27
4.2 General Principles .................................................................................................................................................. 27
4.2.1 Chromosome Abnormality Description Rules ....................................................................................................... 29
4.3 Order of Cytogenomic Abnormalities .................................................................................................................... 31
4.4 Nomenclature Rules ............................................................................................................................................... 33
4.4.1 Spaces ..................................................................................................................................................................... 33
4.4.2 Identification of Homologous Chromosomes ........................................................................................................ 34
4.4.3 Number of Signals or Copies ................................................................................................................................. 34
4.4.4 Breakpoint Designation .......................................................................................................................................... 35
4.4.5 Nucleotide Position ................................................................................................................................................ 36
4.4.6 Gene Symbols ........................................................................................................................................................ 37
[Link] Gene Fusions .......................................................................................................................................................... 37
4.5 Clones, Mosaicism and Chimeras .......................................................................................................................... 37
4.5.1 Clones ..................................................................................................................................................................... 37
4.5.2 Mosaicism and Chimeras ....................................................................................................................................... 38
4.5.3 Nomenclature for Clones, Mosaics and Chimeras ................................................................................................. 38
4.6 Multiple Techniques .............................................................................................................................................. 41
4.7 ISCN Formats ........................................................................................................................................................ 42
4.7.1 Karyotype Format .................................................................................................................................................. 43
4.7.2 Microarray Format.................................................................................................................................................. 44

5 Karyotype ............................................................................................................................................................. 46
5.1 General Principles .................................................................................................................................................. 46
5.2 Normal Results ....................................................................................................................................................... 48
5.3 Numerical Abnormalities ....................................................................................................................................... 48
5.3.1 Sex Chromosome Numerical Abnormalities ......................................................................................................... 48
[Link] Constitutional ......................................................................................................................................................... 48
[Link] Neoplasia ................................................................................................................................................................ 49
5.3.2 Autosomal Numerical Abnormalities .................................................................................................................... 50
5.4 S tructural Abnormalities .......................................................................................................................................... 50
5.4.1 Specification of Chromosomes and Breakpoints ................................................................................................... 50
5.4.2 Karyotype Format for Designating Structural Chromosome Abnormalities ......................................................... 52
[Link] Short System (Karyotype Format) for Designating Structural Chromosome Abnormalities................................. 52
[Link] Detailed System (Karyotype Format) for Designating Structural Chromosome Abnormalitie ............................. 52
5.4.3 Derivative and Recombinant Chromosomes .......................................................................................................... 54
[Link] Derivative Chromosomes ....................................................................................................................................... 54
[Link]. Recombinant Chromosomes .................................................................................................................................. 56
5.5 Specification of Structural Rearrangements .......................................................................................................... 58
5.5.1 Additional Material of Unknown Origin ............................................................................................................... 58

2
5.5.2 Deletions ................................................................................................................................................................ 59
5.5.3 Derivative Chromosomes ....................................................................................................................................... 60
5.5.4 Dicentric Chromosomes.......................................................................................................................................... 67
5.5.5 Duplications ........................................................................................................................................................... 69
5.5.6 Fission .................................................................................................................................................................... 70
5.5.7 Fragile Sites ............................................................................................................................................................ 70
5.5.8 Homogeneously Staining Regions ......................................................................................................................... 70
5.5.9 Insertions ................................................................................................................................................................ 71
[Link] Insertions within a Chromosome ........................................................................................................................... 72
[Link] Insertions between Two Chromosomes ................................................................................................................. 72
[Link] Complex Insertions ................................................................................................................................................ 73
5.5.10 Inversions ............................................................................................................................................................... 74
5.5.11 Isochromosomes ..................................................................................................................................................... 74
5.5.12 Marker Chromosomes ............................................................................................................................................ 75
5.5.13 Neocentromeres ..................................................................................................................................................... 77
5.5.14 Quadruplications .................................................................................................................................................... 78
5.5.15 Recombinant Chromosomes .................................................................................................................................. 78
5.5.16 Ring Chromosomes ................................................................................................................................................ 79
[Link] Ring Chromosomes Derived from One Chromosome ........................................................................................... 79
[Link] Ring Chromosomes Derived from More than One Chromosome ......................................................................... 79
5.5.17 Telomeric Associations .......................................................................................................................................... 81
5.5.18 Translocations ........................................................................................................................................................ 82
[Link]. Reciprocal Translocations ...................................................................................................................................... 82
[Link].1 Two-Break Rearrangements .................................................................................................................................. 82
[Link].2 Three-Break Rearrangements ................................................................................................................................ 83
[Link].3 Four-Break and More Complex Rearrangements .................................................................................................. 84
[Link]. Whole-Arm Translocations .................................................................................................................................... 84
[Link]. Robertsonian Translocations .................................................................................................................................. 86
[Link]. Jumping Translocations ......................................................................................................................................... 87
5.5.19 Tricentric Chromosomes ........................................................................................................................................ 87
5.5.20 Triplications ........................................................................................................................................................... 87
5.6 Multiple Copies of Rearranged Chromosomes ...................................................................................................... 88
5.7 Ploidy Anomalies ................................................................................................................................................... 89

6 Neoplasia ............................................................................................................................................................... 91
6.1 Introduction ............................................................................................................................................................ 91
6.2 General Principles .................................................................................................................................................. 91
6.3 Clones and Subclones ............................................................................................................................................ 92
6.3.1 Clone Size .............................................................................................................................................................. 92
6.3.2 Order of Chromosome Abnormalities .................................................................................................................... 93
6.3.3 Order of Clones ...................................................................................................................................................... 94
[Link] Cytogenetically Related Clones ............................................................................................................................. 94
[Link] Cytogenetically Unrelated Clones ......................................................................................................................... 95
[Link] Mixed Cytogenetically Related and Unrelated Clones .......................................................................................... 96
6.3.4 Clonal Evolution .................................................................................................................................................... 97
6.3.5 Composite Karyotype .......................................................................................................................................... 103
6.3.6 Incomplete Karyotype .......................................................................................................................................... 107
6.3.7 Modal Number and Ploidy Levels ....................................................................................................................... 108
6.4 Constitutional Karyotype ..................................................................................................................................... 110
6.5 Counting Chromosome Abnormalities ................................................................................................................ 112

7 In situ Hybridization .......................................................................................................................................... 115

7.1 Introduction .......................................................................................................................................................... 115
7.1.1 General Principles and Rules ............................................................................................................................... 115
7.2 Prophase/Metaphase in situ Hybridization (ish) .................................................................................................. 116
7.2.1 Principles and Rules ............................................................................................................................................. 116
7.2.2 Normal Signal Pattern .......................................................................................................................................... 117
7.2.3 Abnormal Signal Pattern with a Single Probe ..................................................................................................... 118
7.2.4 Abnormal Signal Pattern with Multiple Probes ................................................................................................... 120
7.2.5 Use of Diminished (dim) and Enhanced (enh) in Metaphase in situ Hybridization ............................................ 125
7.2.6 Subtelomeric Metaphase in situ Hybridization .................................................................................................... 125
[Link] Normal Signal Pattern .......................................................................................................................................... 125
[Link] Abnormal Signal Pattern ...................................................................................................................................... 126
7.2.7 Multicolor Chromosome Painting ........................................................................................................................ 126
7.2.8 Partial Chromosome Painting .............................................................................................................................. 126
7.3 Interphase/Nuclear in situ Hybridization (nuc ish) .............................................................................................. 127
7.3.1 Principles and Rules ............................................................................................................................................. 127
7.3.2 Normal Interphase Signal Pattern ........................................................................................................................ 128
7.3.3 Abnormal Interphase Signal Pattern .................................................................................................................... 128
[Link] Order of Cell Lines and Clones in nuc ish ........................................................................................................... 129

3
7.3.4 Relative Position of Signals ................................................................................................................................. 131
[Link] Adjacent Probes ................................................................................................................................................... 132
[Link].1 Normal Result ...................................................................................................................................................... 132
[Link].2 Abnormal Result .................................................................................................................................................. 132
[Link] Dual-Fusion Probes .............................................................................................................................................. 133
[Link].1 Normal Signal Pattern .......................................................................................................................................... 133
[Link].2 Abnormal Signal Pattern ...................................................................................................................................... 133
[Link] Break-Apart Probes .............................................................................................................................................. 137
[Link].1 Normal Signal Pattern........................................................................................................................................... 138
[Link].2 Abnormal Signal Pattern ...................................................................................................................................... 139
[Link] Tricolor Probes ..................................................................................................................................................... 141
[Link].1 Single Chromosome Normal Signal Pattern ........................................................................................................ 141
[Link].2 Single Chromosome Abnormal Signal Pattern .................................................................................................... 141
[Link].3 Two or More Chromosomes Normal Signal Pattern ........................................................................................... 142
[Link].4 Two or More Chromosomes Abnormal Signal Pattern ....................................................................................... 143
7.4 Multiple Copies of the Same Gene in Neoplasia ................................................................................................. 143
7.5 Enumeration Probes ............................................................................................................................................. 145
7.6 Mosaic and Chimera Signal Pattern ..................................................................................................................... 145

8 Microarray .......................................................................................................................................................... 148

8.1 Introduction .......................................................................................................................................................... 148
8.1.1 General Principles ................................................................................................................................................ 148
8.2 Examples of Microarray Nomenclature ............................................................................................................... 149
8.2.1 Normal Results ..................................................................................................................................................... 149
8.2.2 Abnormal Copy Number Results ......................................................................................................................... 150
8.2.3 Inheritance ............................................................................................................................................................ 152
8.2.4 Multiple Techniques ............................................................................................................................................ 154
8.2.5 Mixed Cell Populations and Uncertain Copy Number ........................................................................................ 157
8.2.6 Nomenclature Specific to Single Nucleotide Polymorphism (SNP) Microarray ................................................ 160
8.2.7 Complex Array Results ........................................................................................................................................ 163
[Link] Chromoanagenesis ............................................................................................................................................... 165
[Link].1 Chromothripsis ..................................................................................................................................................... 167
[Link].2 Chromoanasynthesis ............................................................................................................................................ 168
8.3 Polar Bodies ......................................................................................................................................................... 168
8.3.1 Normal Polar Body Results .................................................................................................................................. 169
8.3.2 Abnormal Polar Bodies PB1 ................................................................................................................................ 169
8.3.3 Abnormal Aneuploidy PB2 .................................................................................................................................. 169
8.3.4 Abnormal Structural PB1 ..................................................................................................................................... 170
8.3.5 Abnormal Structural PB2 ..................................................................................................................................... 170

9 Genome Mapping ............................................................................................................................................... 171

9.1 Introduction .......................................................................................................................................................... 171
9.2 General Principles ................................................................................................................................................ 171
9.3 Nomenclature Rules ............................................................................................................................................. 172
9.4 Nomenclature Examples ...................................................................................................................................... 174
9.4.1 Normal Results ..................................................................................................................................................... 174
9.4.2 Abnormal Results ................................................................................................................................................. 174
[Link] Aneuploidy of Whole Chromosomes or Chromosome Arms .............................................................................. 174
[Link] Deletion ................................................................................................................................................................ 175
[Link] Duplication ........................................................................................................................................................... 178
[Link] Insertion ............................................................................................................................................................... 180
[Link].1 Intrachromosomal Insertion ................................................................................................................................. 180
[Link].2 Interchromosomal Insertion ................................................................................................................................. 181
[Link] Inversion and Translocation ................................................................................................................................. 182
[Link] Inheritance ............................................................................................................................................................ 186
[Link] Complex Genomes ............................................................................................................................................... 187
[Link].1 Chromoanagenesis ............................................................................................................................................... 189
[Link].1.1 Chromothripsis ..................................................................................................................................................... 190
[Link].1.2 Chromoanasynthesis ............................................................................................................................................ 190
[Link].1.3 Chromoplexy ........................................................................................................................................................ 190
[Link] Multiple Techniques ............................................................................................................................................ 191

10 Region-Specific Assays (RSA) ........................................................................................................................... 192

10.1 Introduction .......................................................................................................................................................... 192
10.2 RSA Nomenclature Specific Rules ...................................................................................................................... 192
10.2.1 Targeted Chromosome Analysis .......................................................................................................................... 193
10.2.2 Fusion Genes ........................................................................................................................................................ 194
10.2.3 Methylation Specific Analysis ............................................................................................................................. 194
10.3 RSA Nomenclature for Aneuploidy and Targeted Cytogenomic Analysis ......................................................... 195
10.3.1 Normal Results ..................................................................................................................................................... 195

4
10.3.2 Aneuploidy ........................................................................................................................................................... 196
10.3.3 Abnormal Structural ............................................................................................................................................. 198
10.4 RSA Nomenclature for Investigation of Partial Gain or Loss ............................................................................. 198
10.4.1 Normal Results ..................................................................................................................................................... 198
10.4.2 Abnormal Results ................................................................................................................................................. 199
10.5 RSA Nomenclature for Balanced Translocations or Fusion Genes ..................................................................... 201
10.5.1 Normal Results ..................................................................................................................................................... 201
10.5.2 Abnormal Results ................................................................................................................................................. 201
10.6 Repeat Expansion and Contraction Disorders ..................................................................................................... 202
10.6.1 Normal Results ..................................................................................................................................................... 202
10.6.2 Abnormal Results ................................................................................................................................................. 202
10.7 Methylation Disorders .......................................................................................................................................... 202
10.7.1 Normal Results ..................................................................................................................................................... 202
10.7.2 Abnormal Results ................................................................................................................................................. 203

11 Sequencing .......................................................................................................................................................... 205

11.1 Introduction .......................................................................................................................................................... 205
11.2 General Principles ................................................................................................................................................ 205
11.2.1 Sequence-Based Nomenclature Principles ........................................................................................................... 205
11.2.2 ISCN Principles .................................................................................................................................................... 206
11.2.3 HGVS Principles .................................................................................................................................................. 206
[Link] Breakpoint Description ........................................................................................................................................ 208
[Link] Structural Variant Description ............................................................................................................................. 208
11.3 Normal Results ..................................................................................................................................................... 209
11.4 Abnormal Results ................................................................................................................................................. 210
11.4.1 Aneuploidy ........................................................................................................................................................... 210
11.4.2 Large Structural and Copy Number Variation ..................................................................................................... 212
[Link] Deletion ................................................................................................................................................................ 212
[Link] Duplication and Triplication ................................................................................................................................ 218
[Link] Derivative Chromosome ...................................................................................................................................... 221
[Link] Ring Chromosome ............................................................................................................................................... 226
[Link] Insertion ............................................................................................................................................................... 226
[Link] Inversion ............................................................................................................................................................... 227
[Link] Translocation ........................................................................................................................................................ 228

12 Chromosome Breakage and Instability ........................................................................................................... 230

12.1 Chromatid Aberrations ........................................................................................................................................ 230
12.1.1 Non-Banded Preparations .................................................................................................................................... 230
12.1.2 Banded Preparations ............................................................................................................................................ 231
12.2 Chromosome Aberrations .................................................................................................................................... 231
12.2.1 Non-Banded Preparations .................................................................................................................................... 231
12.2.2 Banded Preparations ............................................................................................................................................ 232
12.3 Scoring of Aberrations ......................................................................................................................................... 232

13 References ........................................................................................................................................................... 233

14 Members of the ISCN Standing Committee .................................................................................................... 239

15 Appendix ............................................................................................................................................................. 241

15.1 Molecular Basis of Banding ................................................................................................................................. 241
15.2 Chromosome Banding .......................................................................................................................................... 241
15.3 Idiograms ............................................................................................................................................................. 242

5
1 Historical Introduction

Tjio and Levan (1956) reported the human chromosome number to be 46

1956:
on cultured human embryonic cells and not 48, as previously thought.
Ford and Hamerton (1956) confirmed the chromosome number on
1956:
testicular material.

The Denver Conference (First International Congress of Human Genetics)

1960: agreed on a karyotype nomenclature system and published “A Proposed
Standard System of Nomenclature of Human Mitotic Chromosomes.”
The London Conference (Second International Congress of Human
Genetics) gave the official sanction to the classification of the seven
1963:
groups of chromosomes by the letters A to G, as originally proposed
by Patau (1960).
The Chicago Conference (Third International Congress of Human
1966: Genetics) proposed a standard system of nomenclature for the provision
of shorthand descriptions of the human chromosome complement.
Torbjörn Caspersson and his colleagues published the first pictures of
1968: banded plant chromosomes stained with quinacrine dihydrochloride or
quinacrine mustard (Caspersson et al., 1968).

First human karyotype based on quinacrine fluorescence–banded

1970:
chromosomes (for a review of this work, see Caspersson et al., 1972).

The Paris Conference (Fourth International Congress of Human Genetics)

agreed upon a uniform system of human chromosome identification and
formed the first Cytogenetic Standing Committee (SC) (Chair: John
1971: Hamerton). The Paris Conference (1971) report provided a way in which
structural rearrangements and variants could be described in terms of their
band composition, and proposed a basic system for designating individual
chromosomes, chromosome regions, and bands.
The Paris Conference, 1971, Supplement (1975), was published, which
1975: included heteromorphic chromosomes of the Hominoidea, and
chromosome registers.
The Mexico City Conference (Fifth International Congress of Human
Genetics) elected an International Standing Committee on Human
1976: Cytogenetic Nomenclature (ISCN SC) with a mandate to propose ways in
which human chromosome nomenclature could be improved (Chair: Jan
Lindsten).

6
 The ISCN SC ceased labelling the reports geographically and unified the
conference reports of Denver, London, Chicago, and Paris into one
1977:
document entitled “An International System for Human Cytogenetic
Nomenclature (1978),” abbreviated as ISCN 1978.
The introduction of high-resolution banding (Dutrillaux, 1975; Yunis,
1976) demonstrated that a new nomenclature was required (Francke and
1978: Oliver, 1978; Viegas-Pequignot and Dutrillaux, 1978; Yunis et al., 1978).
A working group was established under the direction of Bernard
Dutrillaux.
At the Jerusalem Conference (Sixth International Congress of Human
Genetics), David Harnden was appointed Chair of the ISCN SC. “An
1981:
International System for Human Cytogenetic Nomenclature – High
Resolution Banding (1981)” known as ISCN 1981 was published.
A revision of the International System for Human Cytogenetic
1985: Nomenclature was prepared in 1984, and published as ISCN 1985, without
major revision except to correct errors and make minor amendments.

A new ISCN SC was elected at the Seventh Congress of Human Genetics

1986:
in Berlin (Chair: Uta Francke).

A subcommittee under the direction of Felix Mitelman produced a

nomenclature for cancer cytogenetics. The report of this subcommittee
was adopted by the ISCN SC and published as “ISCN 1991: Guidelines
1991:
for Cancer Cytogenetics.” A new ISCN SC was elected at the Eighth
International Congress of Human Genetics in Washington, DC (Chair:
Felix Mitelman).
The ISCN SC reviewed and updated the ISCN 1985 nomenclature in light
of developments in the field, including advances in the use of in
1995: situ hybridization techniques. All revisions and the guidelines for cancer
cytogenetics were incorporated into a single document, which was
published as ISCN 1995.
At the Ninth International Congress of Human Genetics in Rio de Janeiro,
1996: a new ISCN SC was elected (Chair: Patricia A. Jacobs). It was agreed no
further changes were needed to ISCN 1995.

The Tenth International Congress of Human Genetics was held in Vienna

2001:
and a new ISCN SC was elected (Chair: Niels Tommerup).

7
 Following a review of ISCN 1995, primary changes in ISCN
2005 included the addition of new idiograms at the 300- and 700-band
level that reflected the actual size and position of bands. The in
2005: situ hybridization nomenclature was modernized, simplified, and
expanded. New examples reflecting unique situations were added, and a
basic nomenclature for recording array comparative genomic
hybridization results was introduced (Chair: Lisa Shaffer).
ISCN 2009: The primary change in neoplasia (Chapter 11) was the
introduction of either idem or sl/sdl in the nomenclature to describe clonal
evolution. Nomenclature for in situ hybridization was further clarified and
2009: additional examples provided. The basic microarray nomenclature was
revised and expanded to accommodate all platform types, with more
examples provided. In addition, a nomenclature for multiplex ligation-
dependent probe amplification (MLPA) was introduced.

2012: Jean McGowan-Jordan was elected as the new Chair of the ISCN SC.

ISCN 2013: The primary changes to the new edition of ISCN included
additional nomenclature examples, inclusion of some definitions such as
chromothripsis and duplication, and the use of the genome build when
describing microarray results. The ISCN SC deleted Section 14.4 on
2013:
MLPA and introduced a new Chapter 15 for nomenclature that can be used
for any region-specific assay (RSA) such as quantitative fluorescence
polymerase chain reaction (QF-PCR), real-time polymerase chain reaction
(PCR), and beadbased multiplex techniques in addition to MLPA.
Various approaches to describing chromosome abnormalities
characterized by DNA sequencing were considered and discussed during
2014:
a special joint session with members of the Human Genome Variation
Society (HGVS) Sequence Variant Description Working Group.
The ISCN SC incorporated into ISCN 2016 a new chapter on sequence
nomenclature and new examples for microarray and region-specific
assays, including the requirement to incorporate the genome build in the
HGVS standard format whenever nucleotide numbers are specified.
2016: Changes in the main text compared to the previous edition were marked
in the margin, for the first time. The decision to modify the name of the
ISCN nomenclature scheme to reflect changes in technology under its
purview was made by the use of the term “Cytogenomic” replacing
“Cytogenetic.”

8
 ISCN 2020: Due to the increased use of technologies such as microarray
and sequencing that orientated chromosomes by nucleotide number from
pter to qter, the ISCN SC standardized this approach across all
technologies, including banded chromosomes. Standardization in the
positioning of sex chromosome abnormalities before those affecting
autosomes for all technologies was also made. It was decided to adopt a
nomenclature for inherited abnormalities that clarified whether the
2020: rearrangement is inherited intact or partially as a derivative. The ISCN SC
identified the need for specific nomenclature for the analysis of polar
bodies, and to improve the existing nomenclature based on sequencing
technology. For the first time, ISCN 2020 was made available online,
together with an ISCN Forum where the cytogenomic community could
submit ISCN queries or make suggestions for improvement to the
nomenclature. Following publication of ISCN 2020, Ros Hastings was
nominated as the Chair of the ISCN SC.
A new nomenclature for genome mapping (OGM) was created and
2023:
published (Moore et al., 2023).

The ISCN SC completed a major review of ISCN 2020 and eliminated

some of the inconsistencies between the different technologies’
nomenclature. Historic information not directly related to the
nomenclature was shortened. The meiotic chromosome chapter, fiber
fluorescence in situ hybridization (FISH) ISCN, reverse FISH ISCN, and
unnecessary repetition have been removed for the ISCN 2024 edition. The
chapters have been restructured so that the generic rules are now unified
in Chapter 4. More complex ISCN examples were added to the
2024: microarray, sequencing, and neoplasia chapters. Nomenclature for
targeted karyotype and microarrays, methylation-specific assays, as well
as expansion and contraction repeats has been added to the RSA Chapter
10. Each chapter was revised by two members of the ISCN SC before a
full review by the entire committee. The rules have been listed (a, b, c,
etc.) and examples have been numbered (i, ii, iii, etc.). OGM nomenclature
was also incorporated into ISCN 2024. Some of the ISCN examples do not
represent observed data but are provided to demonstrate the nomenclature
principles.

9
2 Normal Chromosomes

2.1 Introduction

Human chromosome nomenclature has evolved from meetings at international

conferences (Denver 1960, London 1963, Chicago 1966, Paris 1971, Paris 1975,
Stockholm 1977, Paris 1980, Memphis 1994, Vancouver 2004, Vancouver 2008, Seattle
2012, San Diego 2014, Gothenburg 2019 and Glasgow 2023). The present report, which
summarizes the current nomenclature, incorporates and supersedes all previous ISCN
recommendations.

2.2 Chromosome Number and Morphology

2.2.1 Non-Banding Techniques

In the construction of the karyogram1 the autosomes are numbered from 1 to 22 in order
of decreasing length (for historical reasons chromosome 21 is listed before chromosome
22, despite it being smaller). The sex chromosomes are referred to as X and Y.

When chromosomes are stained by methods that do not produce bands, they can be
arranged into seven readily distinguishable groups, defined as A to G, based on
descending order of size, and the ratio of the length of the short arm to the long arm with
respect to the centromere (London Conference, 1963). Satellites are not always visible
on all chromosomes in the D and G groups as the number and size of these structures
are variable. The following parameters were used to describe non-banded chromosomes:

• The length of each chromosome, expressed as a percentage of the total length of a

normal haploid set, i.e., the sum of the lengths of the 22 autosomes and of the X
chromosome;
• The arm ratio of the chromosomes, expressed as the length of the longer arm relative to
the shorter arm; and
• The centromeric index, expressed as the ratio of the length of the shorter arm to the
whole length of the chromosome. The latter two indices are, of course, related
algebraically.

10
 Group A (1–3) Large metacentric chromosomes distinguished from each other
by size and centromere position
Group B (4–5) Large submetacentric chromosomes
Group C (6–12, X) Medium-sized metacentric or submetacentric chromosomes.
The X chromosome resembles the longer chromosomes in this
group
Group D (13–15) Medium-sized acrocentric chromosomes with satellites
Group E (16–18) Relatively short metacentric or submetacentric chromosomes
Group F (19–20) Short metacentric chromosomes
Group G (21–22, Y) Short acrocentric chromosomes with satellites. The Y
chromosome has no satellites

The definition of metacentric, submetacentric, and acrocentric traditionally relates to the

ratio of the chromosome arms in unbanded preparations (Levan et al., 1964; Al-Aish,
1969).
1
The terms karyogram, karyotype, and idiogram have often been used indiscriminately.
The term karyogram should be applied to a systematized array of the chromosomes
prepared either by drawing, digitized imaging, or by photography, with the extension in
meaning that the chromosomes of a single cell can typify the chromosomes of an
individual or even a species. The term karyotype should be used to describe the normal
or abnormal, constitutional or acquired, chromosomal complement of an individual,
tissue or cell line. We recommend that the term idiogram be reserved for the
diagrammatic representation of a karyotype.

2.2.2 Banding Techniques

Numerous technical procedures have been reported that produce banding patterns on
metaphase chromosomes. The chromosomes are visualized as consisting of a continuous
series of light and dark bands, so that, by definition, there are no “interbands.” Bands
that stain darkly with one method may stain lightly with other methods. The methods
first published for demonstrating bands along the chromosomes are:

• Q-bands (Fig. 1): Caspersson et al. (1972)

• G-bands (Fig. 2): Seabright (1971)
• R-bands (Fig. 3): Dutrillaux and Lejeune (1971)

11
 Fig. 1. Q-banded human karyogram (courtesy of Dr. E. Magenis).

The banding techniques fall into two principal groups:

1. Those resulting in bands distributed along the length of the whole chromosome, such as
G-, Q-, and R-bands, including techniques that demonstrate patterns of DNA replication,
and
2. Those that stain specific chromosomal structures and hence give rise to a restricted
number of bands (Table 1). These include methods that reveal constitutive
heterochromatin (C-bands) (Fig. 4), telomeric bands (T-bands), and nucleolus
organizing regions (NORs). For the banding technique acronyms, refer to Table 2.
The patterns obtained with the various C-banding methods do not permit identification
of every chromosome in the somatic cell complement but can be used to identify specific
chromosomes (Table 1). The C-bands on chromosomes 1, 9, 16, and Y are
morphologically variable. The shortarm regions of the acrocentric chromosomes also
demonstrate variations in size and staining intensity of the Q-, G-, R-, C-, T- bands and
NOR staining. These variations are heritable benign features of the particular
chromosome.

12
 Fig. 2. G-banded human karyogram (courtesy of N.L. Chia).

2.2.3 X- and Y-Chromatin

Inactive X chromosomes, as well as the heterochromatic segment on the long arm of the
Y chromosome, appear as distinctive structures in interphase nuclei, for which the
terms X-chromatin (Barr body, sex chromatin, X-body) and Y-chromatin (Y-body),
respectively, should be used.

2.3 Chromosome Band Nomenclature

2.3.1 Identification and Definition of Chromosome Bands, Landmarks and Regions

Bands are defined as parts of a chromosome that are clearly distinguishable from their
adjacent segments by appearing darker or lighter with one or more banding techniques.
The bands are large structures of differing size, that may include hundreds of genes.
Landmarks are defined as consistent and distinct morphologic features important in
identifying the chromosome. Landmarks include the ends of the chromosome arms, the
centromere, and certain bands. (See Table 12 in Appendix)
Regions are defined as an area of a chromosome lying between two adjacent landmarks.

13
 Fig. 3. R-banded human karyogram (courtesy of Dr. M. Prieur).

The bands are allocated to various regions along the chromosome arms, and the regions
are delimited by specific landmarks. The bands and the regions are numbered
consecutively from the centromere outward along each chromosome arm.

2.3.2 Designation of Regions, Bands and Subbands

a. The symbols p and q are used to designate, respectively, the short and long arms of
each chromosome.
b. The centromere (cen) itself is designated 10; the part facing the short arm is p10, the
part facing the long arm is q10 (not shown in the idiograms in the Appendix). The two
regions adjacent to the centromere are labeled as 1 in each arm; the next, more distal
regions as 2, and so on. The heterochromatic regions adjacent to the centromere carry
band designations of 11, 11.1 or 11.11 depending on the level of resolution. A band used
as a landmark is considered as belonging entirely to the region distal to the landmark
and is accorded the band number of 1 in that region.
c. In designating a particular band, four items are required:
• The chromosome number

14
• The arm symbol
• The region number, and
• The band number within that region
• These items are given in order without spacing or punctuation. For example, 1p31
indicates chromosome 1, short arm, region 3, band 1.
d. Whenever an existing band is subdivided, a decimal point (.) is placed after the original
band designation and is followed by the number assigned to each subband.
e. The subbands are numbered sequentially from the centromere outward. For example, if
the original band 1p31 is subdivided into three equal or unequal subbands, the subbands
are labeled 1p31.1, 1p31.2, and 1p31.3, subband 1p31.1 being proximal and 1p31.3
distal to the centromere.
f. If a subband is subdivided, additional digits, but no further punctuation, are used; e.g.,
subband 1p31.1 might be further subdivided into 1p31.11, 1p31.12, etc. In principle a
band can be subdivided into any number of new bands at higher resolution.

15
 Table 1. Examples of heteromorphisms with various stainsa.

2.4 High-Resolution Banding

The nomenclature for high-resolution preparations of prophase and prometaphase

chromosomes described in ISCN 1981 is an extension of the nomenclature for the
banding patterns for metaphase chromosomes established at the Paris Conference
(1971) and in ISCN 1978.

16
Fig. 4. C-banded human karyogram. The chromosomes were not preidentified with other banding
techniques (courtesy of Dr. N. Mandahl).

17
Table 2. Examples of the banding technique acronyms. In the acronym, the first letter denotes the type of
banding, the second letter the general technique and the third letter the stain.

Q Q-bands
QF Q-bands by fluorescence
QFQ Q-bands by fluorescence using quinacrine
QFH Q-bands by fluorescence using Hoechst 33258
G G-bands
GT G-bands by trypsin
GTG G-bands by trypsin using Giemsa
GTL G-bands by trypsin using Leishman
GTW G-bands by trypsin using Wright
GAG G-bands by acetic saline using Giemsa
C C-bands
CB C-bands by barium hydroxide
CBG C-bands by barium hydroxide using Giemsa
R R-bands
RF R-bands by fluorescence
RFA R-bands by fluorescence using acridine orange
RH R-bands by heating
RHG R-bands by heating using Giemsa
RB R-bands by BrdU
RBG R-bands by BrdU using Giemsa
RBA R-bands by BrdU using acridine orange
DA-DAPI DAPI-bands by Distamycin A and 4ʹ,6-diamidino-2-phenylindole

High-resolution banding techniques can be applied to chromosomes in different stages

of the cell cycle, e.g., prophase, prometaphase, or interphase (by methods that induce
premature chromosome condensation). Furthermore, the number of discernible bands
depends not only on the state of condensation but also on the banding technique used.
The level of resolution is determined by the number of bands seen in a haploid set (22
autosomes plus either X or Y). The standard idiograms provide schematic
representations of chromosomes corresponding to approximately 300, 400, 550, 700 and
850 bands per haploid set (bphs) (see Chia, 2009; Francke, 1981, 1994 and Fig. 15 in
the Appendix). These resolution labels are not intended to convey the actual number of
bands, for example the 700 bphs is actually 759 bphs in males and 786 bphs in females
(Chia, 2009; Thomas Liehr, personal communication). Although larger numbers of
bands can be visualized, designating the idiograms as 550 to 850 bands is sufficient for
practical purposes.

The idiograms were designed differently for the applications of ISCN and Genome
Browsers resulting in some discrepancies. The 700-band level is the best fit to the
GRCh38 idiograms. However, two loci are more detailed in GRCh38 than in the ISCN:
6p24 and 9q34.1. On the other hand, the ISCN 850-band level is more detailed than
GRCh38 idiograms at five loci: 1q32, 2p21, 5q13.2, 6p22.3 and 6q21.
18
 In G-banded preparations, new subbands appear to arise by subdivision of darkly stained
Gbands on less extended chromosomes, while in R-staining preparations the dark R-
bands appear to split. Therefore, in assigning subband numbers, arbitrary decisions were
made for the purposes of nomenclature only and they should not be interpreted as
statements about chromosome physiology. Examples of G- and R-banded chromosomes
at successive stages of resolution are shown in the Appendix (see Fig. 16a, b). In
addition, G- and R-banded metaphase chromosomes at approximately the 550-band
level and their diagrammatic representation are illustrated in a detachable foldout on the
inside of the back cover.

2.5 Variation in Heterochromatic Segments, Satellite Stalks and Satellites

Variation refers to the differences in size or staining of chromosomal segments in the

population (see Wyandt and Tonk, 2008, and Table 1). The following sections outline a
means to describe these variations; however, to avoid misinterpretation, these benign
variants are not included in ISCN descriptions. Rather, they should be reserved for
report text descriptions in which the variation may be useful to distinguish between two
or more distinct cell lines or clones, e.g., chimerism or transplant. Note: it is essential
that a balanced or unbalanced rearrangement involving the satellites is excluded before
assuming this is a benign variant (described in Sections 2.2.2, 2.5.1 and 2.5.2).

2.5.1 Variation in Length

Variation in length of heterochromatic segments (h), stalks (stk) or satellites (s)

should be distinguished from increases or decreases in arm length as a result of other
structural alterations by placing a plus (+) or minus (–) sign after the
symbols h, stk or s following the appropriate chromosome and arm designation.

16qh+ Increase in length of the heterochromatin on the long arm of chromosome 16

Yqh– Decrease in length of the heterochromatin on the long arm of the Y

chromosome
21ps+ Increase in length of the satellite on the short arm of chromosome 21

22pstk+ Increase in length of the stalk on the short arm of chromosome 22

13cenh+pat Increase in length of the centromeric heterochromatin of the chromosome 13

inherited from the father
1qh–,13cenh+,22ps+ Decrease in length of the heterochromatin on the long arm of chromosome 1,
increase in length of the centromeric heterochromatin on chromosome 13, and
large satellites on chromosome 22
15cenh+mat,15ps+pat Increase in length of the centromeric heterochromatin on the chromosome 15
inherited from the mother and large satellites on the chromosome 15 inherited
from the father
14cenh+pstk+ps+ Increase in length of the centromeric heterochromatin, the stalk, and the size of
satellites on the same chromosome 14

19
2.5.2 Variation in Number and Position

The same nomenclature symbols as described above are used to describe variation in
position of heterochromatic segments, satellite stalks, and satellites and should not be
included in the ISCN but can be described in the text of the report.

22pvar Variable presentation of the short arm of chromosome 22

17ps Satellites on the short arm of chromosome 17
Yqs Satellites on the long arm of the Y chromosome
9phqh Heterochromatin in both the short and the long arms of chromosome 9
9ph Heterochromatin only in the short arm of chromosome 9
1q41h Heterochromatic segment in chromosome 1 at band 1q41

Duplicated chromosome structures are indicated by repeating the appropriate

designation:

21pss Double satellites on the short arm of chromosome 21

14pstkstk Double stalks on the short arm of chromosome 14

Likewise, the common population inversion variants (see Table 1) are specified by their
euchromatic breakpoints and should not be reported in the ISCN.

inv(9)(p12q13) Pericentric inversion on chromosome 9

inv(2)(p11.2q13) Pericentric inversion on chromosome 2
inv(Y)(p11.2q11.2)pat Pericentric inversion on the Y chromosome inherited from the father

2.6 Euchromatic Variants

There are several euchromatic duplications and deletions involving both G-positive and
G-negative bands that are phenotypically neutral (see Wyandt and Tonk, 2008; Behrend
et al., 2023). The most common euchromatic variants occur at 4p16, 8p23.1, 9p12, 9q12,
9q13, 15q11.2 and 16p11.2, but these must be distinguished from the clinically
significant (likely pathogenic/pathogenic) variants such as dup(8)(p23.1p23.1) and
del(15)(q11.2q11.2). Only clinically significant (likely pathogenic/ pathogenic)
euchromatic variants should be reported in the ISCN.

2.6.1 Copy Number Variants and Structural Variants

Benign and likely benign copy number variants (CNVs) and structural variants (SVs)
are NOT reported in the ISCN. However, if the CNV or SV is suggestive of a structural
rearrangement(s) at a chromosome level, then these should be reported, as there may be
reproductive implications. Followup studies may be required.

20
 Laboratories should report clinically significant variants in the ISCN according to the
laboratory policy and current guidelines.

2.6.2 Fragile Sites

Fragile sites (fra) associated with a specific disease or phenotype are referred to
in Section 5.5.7.

Fragile sites associated with specific chromosome bands can occur as normal variants
with no phenotypic consequences. These fragile sites are inherited in a co-dominant
Mendelian fashion and may result in chromosome abnormalities such as deletions,
multiradial figures, and acentric fragments. While there may be several different types
of fragile sites inducible by culturing cells in media containing different components,
all of these will be covered by a single nomenclature.

fra(10)(q25.2) A fragile site on chromosome 10 in 10q25.2

fra(10)(q22.1),fra(10)(q25.2) Two fragile sites on chromosome 10
fra(10)(q22.1),fra(10)(q25.2) Two fragile sites on different homologues
fra(10)(q25.2),fra(16)(q22.1) Two fragile sites on different chromosomes

21
3 Symbols and Abbreviated Terms

All symbols and abbreviated terms used in the description of chromosomes and
chromosome abnormalities are listed below. Section references are given within
parentheses for terms that are defined in greater detail in the text.

ace Acentric fragment (5.5.12, 12.2.1)

add Additional material of unknown origin (5.1, 5.5.1)
amp Denotes an amplified signal (4.5.3, 7.1.1, 7.4)
arr Microarray (4.4.5, 4.5.3, 8, 8.1.1, 8.3)
arrow (→ or –>) (1)
From – to, in detailed system ([Link])
b Break (12.1.1, 12.2.1)
bphs Bands per haploid set (2.4, 5.4.1, 6.1)
brackets, angle (< >) Surround the ploidy level (5.7, 6.3.7, 8.2.6)
brackets, square ([ ]) Surround number of cells, level of mosaicism or genome build
(4.2.1, 4.4.5, 4.5.3, 5.1, 6.2, 6.3.1, 6.3.5, 7.1.1, 7.3.1, 8.1.1, 9.3, 10.2, 11.2.2, 1
1.2.3)
c Constitutional anomaly (4.2.1, 5.1, 6.4)
caret (^) Denotes ‘or’ in HGVS nomenclature (11.2.3)
cen Centromere (2.3.2, [Link])
cha Chromoanasynthesis ([Link], [Link].2, [Link].1, [Link].1.2)
chi Chimera (4.5.2, 4.5.3, 5.1)
chr Chromosome (12.2.1)
chrb Chromosome break (12.2.1)
chre Chromosome exchange (12.2.1)
chrg Chromosome gap (12.2.1, 12.3)
cht Chromatid (8.3, 12.1.1, 12.1.2)
chtb Chromatid break (12.1.1, 12.3)
chte Chromatid exchange (12.1.1, 12.3)
chtg Chromatid gap (12.1.1, 12.3)
colon, single (:) Break, in detailed system ([Link], 5.5.2, 5.5.6)
colon, double (::) Break and reunion, in detailed system and for fusion genes
([Link], [Link], 7.1.1, 9.3, 10.2.2, [Link], [Link])
comma (,) Separates chromosome numbers, sex chromosomes, and chromosome
abnormalities
(4.2.1, 4.3, 4.4.5, 5.1, [Link], [Link], [Link], 6.2, 6.3.6, 7.3.1, 8.1.1, 9.3);

22
 Separates non-tandem duplication (7.2.1)
Separates probe designations (7.2.1, 7.3.1);
Separates thousand and million in nucleotide position in the short system
(4.4.5)
con Connected signals (7.3.1, 7.3.4, [Link])
cp Composite karyotype (6.2, 6.3.5)
cpx Chromoplexy ([Link], [Link].1, [Link].1.3)
cth Chromothripsis ([Link], [Link].1, [Link].1, [Link].1.1)
cx Complex rearrangements – used in neoplasia, microarray or sequencing
(8.2.7, [Link], [Link].1)
decimal point (.) Denotes subbands (2.3.2)
del Deletion (5.1, 5.5.2, 9.3, [Link], [Link], [Link], 12.1.2)
delins Sequence change with nucleotides of the reference sequence replaced by other
nucleotides ([Link])
der Derivative chromosome
(5.1, [Link], 5.4.3, [Link], 5.5.1, 5.5.2, 5.5.3, 5.5.5, 5.5.11, 5.5.12, 5.5.13, 5.5.
16.2, [Link], [Link], 9.3, [Link], 12.3)
dic Dicentric (5.4.1, 5.5.4, [Link], [Link], 12.3)
dim Diminished (7.2.5)
dinh Derived from chromosome abnormality of parental origin
(4.2.1, 4.6, 5.1, 8.2.3)
dmat Derived from chromosome abnormality of maternal origin
(4.2.1, 4.6, 5.1, 6.4, 8.2.3, [Link])
dmin Double minute (4.3, 5.5.3, 5.5.12, 12.2.1)
dn Designates a chromosome abnormality that has not been inherited (de novo)
(4.2.1, 8.2.3, [Link])
dpat Derived from chromosome abnormality of paternal origin
(4.2.1, 4.6, 5.1, 6.4, 8.2.3, [Link])
dup Duplication (5.1, [Link], 5.5.5, 9.3, [Link], [Link], [Link])
e Exchange (12.1.1, 12.1.2, 12.2.1)
end Endoreduplication (5.7)
enh Enhanced (7.2.5)
equal (=) Denotes a normal reference sequence in HGVS (11.2.3)
fis Fission, at the centromere (5.5.6)
fra Fragile site (2.6.2, 5.5.7)
g Gap (12.1.1, 12.2.1)
g. Genome with reference to the genomic sequence (11.2.3)
gom Gain of methylation (10.2.3)
GRCh Genome Reference Consortium human; human genome build or assembly
(4.4.5, 8.1.1, 9.3, 9.4, 11.2.3)
greater than (>) Greater than (5.5.12, 7.4)
h Heterochromatin, constitutive (2.5.1)

23
hmz Homozygous, homozygosity; used when one or two copies of a genome are
detected, but previous, known heterozygosity has been reduced to
homozygosity through a variety of mechanisms, e.g., loss of heterozygosity
(LOH) (8.2.6, 8.2.7)
hsr Homogeneously staining region (5.5.3, 5.5.8)
htz Heterozygous, heterozygosity (8.2.6)
hyphen (-) Hyphen, designation with a chromosome band at low resolution (5.4.1)
i Isochromosome (5.5.11)
idem Denotes the stemline karyotype in a subclone (6.2, 6.3.4)
ider Isoderivative chromosome (5.5.3)
idic Isodicentric chromosome (5.5.4, 5.5.11)
inc Incomplete karyotype (5.1, 6.2, 6.3.6,)
inh Inherited (4.2.1, 4.6, 5.1, 8.2.3, [Link])
ins Insertion (5.4.1, 5.5.1, 5.5.5, 5.5.9, [Link], [Link], 9.3, [Link]);
insertion of nucleotides ([Link], [Link])
inv Inversion ([Link], 5.5.10, 9.3, 12.1.2);
inverted in orientation relative to the reference sequence ([Link], [Link])
ish In situ hybridization; when used without a prefix applies to metaphase or
prometaphase chromosomes of dividing cells (7.1.1, 7.2, 7.2.1)
lom Loss of methylation (10.2.3)
mar Marker chromosome (4.3, [Link], 5.5.3, 5.5.12, 12.2.2, 12.3)
mat Maternal origin (4.2.1, 4.6, 5.1, 6.4, 8.2.3, [Link])
met Normal methylation pattern (10.2.3, 10.7)
min Minute acentric fragment (12.2.1, 12.3)
minus (–) sign Loss (5.1, [Link]);
Decrease in length (2.5.1, 5.1);
Locus absent from a specific chromosome (7.2.1, 9.3)
mos Mosaic (4.5.2, 4.5.3, 5.1)
mr Multiradial (12.1.1)
multiplication ( ×) sign Number of copies or signals (4.4.3, 7.2.1, 7.3.1, 10.2.1, 10.2.3);
Multiple copies of rearranged chromosomes (5.1, 5.5.12, 5.6);
Aberrant polyploidy clones in neoplasia (6.3.4, 6.3.7);
Multiple copies of a chromosome or chromosomal region
(4.4.3, 5.5.12, 5.6, 8.1.1)
neo Neocentromere (5.5.13)
nuc Nuclear or interphase (7.1.1, 7.3.1)
nuc ish Interphase fluorescent in situ hybridization (7.1.1, 7.3, 7.3.1)
ogm Genome Mapping (4.4.5, 4.5.3, 9)
or Alternative interpretation (4.2.1, 5.1, 5.4.1)
p Short arm of chromosome (2.3.2)
parentheses ( ) Surround structurally altered chromosomes and breakpoints
(4.4.3, 5.4.1, [Link], [Link], [Link], 5.5.3, 5.5.16);
Surround chromosome numbers, X, and Y, loci, probes, gene names in normal

24
 and abnormal results (7, 8, 9, 10);
Surround coordinates (or nucleotide positions) in abnormal result (8, 9, 10, 11)
pat Paternal origin (4.2.1, 4.6, 5.1, 6.4, 8.2.3, [Link])
PB1 1st polar body (8.3, 8.3.2, 8.3.4)
PB2 2nd polar body (8.3, 8.3.3, 8.3.5)
pcc Premature chromosome condensation (12.2.1)
pcd Premature centromere division (12.2.1)
pcp Partial chromosome paint (7.2.8)
period (.) Separates various techniques (4.6, 7.1.1, [Link], [Link], 11.2.2, 11.2.3)
Ph Philadelphia chromosome (5.5.3)
pipe (|) Denotes a modification in the DNA sequence (e.g., a state of change such as
methylation) (10.2.3)
plus sign, single (+) Additional normal or abnormal chromosomes
(2.5.1, 5.1, [Link], 5.5.12, [Link], [Link]);
Denotes an increase in length (2.5.1, 5.1);
Denotes a locus present on a specific chromosome (7.2.1, 9.3)
plus sign, double (++) Two tandem hybridization signals or hybridization regions on a specific
chromosome (7.2.1)
ps Satellited short arm of chromosome (2.5.1, 2.5.2)
psu Pseudo- (5.5.4)
pter Terminal end of the short arm of a chromosome ([Link])
pvz Pulverization (12.2.1)
q Long arm of chromosome (2.3.2)
qdp Quadruplication (5.5.14)
qr Quadriradial (12.1.1, 12.3)
qs Satellited long arm of chromosome (2.5.2)
qter Terminal end of the long arm of a chromosome ([Link])
question mark (?) Questionable identification of a chromosome or chromosome structure
(4.2.1, 4.5.3, 5.1, 5.4.1, 5.5.1, 5.5.3, [Link], [Link]);
Questionable identification of copy number or level of mosaicism
(4.5.3, 8.2.5, [Link].1.2)
Unknown nucleotide position ([Link], [Link])
r Ring chromosome; a defined structure with chromosome ends fused
(4.3, 5.5.3, 5.5.12, 5.5.16, [Link], [Link], 12.3)
rec Recombinant chromosome (5.4.3, [Link], 5.5.15)
rob Robertsonian translocation ([Link])
rsa Region-specific assay (4.4.5, 4.5.3, 10, 10.1, 10.2)
rsa-ms Methylation region-specific assay (10.2.3, 10.7)
s Satellite (2.5.1, 2.5.2)
sce Sister chromatid exchange (12.1.1)
sdl Sideline (6.2, 6.3.4)

25
semicolon (;) Separates altered chromosomes and breakpoints in structural rearrangements
involving more than one chromosome (4.2.1, 5.4.1, 5.5.3, 9.3, [Link]);
Separates probes on different derivative chromosomes (7.2.1)
sep Separated signals (7.3.1, 7.3.4, [Link])
seq Sequencing (4.4.5, 4.5.3, 11, 11.2.2)
sl Stemline (6.2, 6.3.4)
slant line, single (/) Separates cell lines, clones or contiguous probes (4.5.3, 5.1, 6.2, 7.1.1, 11.2.3)
slant line, double (//) Separates recipient and donor cell lines (4.5.3, 6.2, 7.6)
sseq Shallow next-generation sequencing (8.1.1, 8.3, 11.2.2)
stk Satellite stalk (2.5.1, 2.5.2)
subtel Subtelomeric region (7.2.6)
sup Additional (supernumerary) sequence not attached to other chromosomal
material ([Link])
t Translocation (5.5.18, 9.3, [Link], [Link])
tas Telomeric association (5.5.17)
ter Terminal (end of chromosome) or telomere ([Link], [Link])
tilde (∼) Denotes intervals and boundaries of a chromosome segment or number of
chromosomes, fragments, or markers or nucleotides
(4.2.1, 4.5.3, 5.1, 5.4.1, 9.3, [Link], [Link])
Denotes a range of number of copies of a chromosomal region when the exact
number cannot be determined (4.2.1, 4.5.3, 8.1.1)
tr Triradial (12.1.1, 12.3)
trc Tricentric chromosome (5.5.4, [Link], 5.5.19)
trp Triplication (5.5.20)
U Undisclosed normal sex complement (5.2)
underlining Used to distinguish homologous chromosomes
(4.4.2, 5.1, 5.5.3, [Link], 7.2.2)
underscore (_) Used to indicate range of nucleotide positions (4.4.5, 8.1.1, 9.3, [Link])
Chromosomal region between bands in ogm (instead of an arrow) ([Link])
umat Maternal uniparental disomy (8.2.3, 8.2.6)
upat Paternal uniparental disomy (8.2.3, 8.2.6)
VAF Variant allele frequency (4.5.3, 9, 9.3)
var Variant or variable region (2.5.2, 11.2.3)
wcp Whole chromosome paint (7.2.1, 7.2.7, 7.2.8)

(1)
Note: In ogm ISCN an underscore is used in the detailed system (karyotype format).

26
4 General Rules

4.1 Introduction

a. ISCN provides a unified nomenclature to describe the chromosome complement and

aberrations. This nomenclature is improved regularly for existing technologies and
expanded as new technological approaches are developed. Over time, redundancies and
inconsistencies between chapters have appeared, whilst rules have been dispersed
throughout different chapters in the ISCN. ISCN 2024 provides an overview of the
general rules applying to all technologies in Chapter 4. Terms and recommendations
related to specific technologies and applications are described in detail in the relevant
chapters.
b. Some of the examples in this and subsequent chapters do not represent observed
abnormalities but are provided to demonstrate the nomenclature principles.

4.2 General Principles

a. The current version of ISCN must always be used. As ISCN guidelines may differ
between versions, it is recommended that either the interpretive text or the test details
of the report include a statement on the version of ISCN used to write the nomenclature
description. This is particularly relevant for follow-up samples.
b. A summary of the general principles applicable to cytogenomic reporting of the various
methodologies is given in Table 3.

27
 Table 3. The following general principles are applicable to multiple chapters and techniques as indicated.

c. The same general rules for designating chromosome aberrations are followed in the
description of constitutional and neoplastic chromosome aberrations.
d. Abnormal findings and/or clinically significant results, based upon the laboratory’s
reporting protocols, must be included in the ISCN. Additionally, normal sex
chromosomes may be reported for the purpose of:
• clarity of the sex complement is required (see Sections 8.2.2, 8.2.3, [Link]);
• chimerism (Sections 4.5.3, 8.2.6);
• when part of a targeted assay (see Chapter 10).
e. Abnormal results are reported using two different formats, karyotype format and
microarray format (see Section 4.7). The karyotype format is described using either the
abbreviated, short, and detailed systems, while the microarray format is expressed using
either the abbreviated, short, and extended systems (see Section 4.7).

28
4.2.1 Chromosome Abnormality Description Rules

a. The number of chromosomes is specified first, followed by a comma (,), the sex
chromosome complement, followed by a comma and then the chromosome abnormality.
There are no spaces before or after a comma (see Section 4.4.1).
b. If a sex chromosome has a structural abnormality, the normal chromosome, if present,
is listed first.
c. The total number of analyzed metaphases is not specified in constitutional samples,
unless there is evidence of clinically significant mosaicism. The number of metaphases
must always be given in the karyotype of neoplastic samples, even when the result is
normal, or the abnormality is present in all metaphases.
d. Absolute cell numbers are given in square brackets ([ ]).
e. For neoplastic samples, constitutional chromosome anomalies are indicated by the
letter c immediately after the constitutional abnormality designation (see also Sections
5.1 and 6.4). When associated with the sex chromosomes, the letter c refers to the whole
sex complement (see Section [Link]).
i. 48,XX,+8,+21c[20]Karyotype of a neoplastic sample with acquired trisomy 8 in a
female individual with constitutional trisomy 21.
ii. 46,XXYc,–X[10]/47,XXYc[2]Karyotype of a neoplastic sample with acquired loss of
one X chromosome in ten metaphases in an individual with Klinefelter syndrome.
f. For clarity, rearrangements are written with breakpoints the first time they are listed in
the ISCN description. It is not necessary to repeat the breakpoints subsequently e.g.,
o constitutional: 47,XXX,t(11;22)(q23;q11.2)[10]/46,XX,t(11;22)[10]
neoplasia: 46,XX,t(9;22)(q34;q11.2)[10]/47,XX,t(9;22),+der(22)[10]
g. Inherited (inh) aberrations for which the parental origin has not been established or
disclosed may be indicated as 46,XX,t(5;6)(q34;q23)inh
• When it is known from which parent the aberration is inherited, the abbreviation
for maternal (mat) or paternal (pat) is used immediately following the designation of
the abnormality, e.g., 46,XX,t(5;6)(q34;q23)mat,inv(14)(q12q31)pat
• If only part of an aberration (e.g., one derivative chromosome from a parental balanced
translocation) has been inherited, the abbreviation dmat, dpat or dinh is used to
distinguish it from the complement in the
parent, e.g., 46,XX,der(5)t(5;6)(q34;q23)dmat,inv(14)(q12q31)pat
h. If it is known that the parents’ chromosomes are normal with respect to the abnormality,
the abnormality may be designated de
novo (dn), e.g., 46,XY,t(5;6)(q34;q23)mat,inv(14)(q12q31)dn
i. Alternative interpretations of an aberration are provided with the term or.
Note: there is a space before and after the term or (see Section 4.4.1).
. 46,XX,add(19)(p13.3 or q13.3)A female karyotype shows additional material of
unknown origin attached to either 19p13.3 or 19q13.3 (see Section 5.5.1).
i. 46,Y,del(X)(q22) or i(X)(p10)A male karyotype shows a deletion of the long arm of the
X chromosome with a breakpoint in Xq22 or an isochromosome of the short arm of the
X chromosome. Note: the different structural rearrangements give rise to karyotypically
similar abnormal X chromosomes.
ii. 46,XX,t(12;14)(q15;q24) or t(12;14)(q13;q22)The two alternative interpretations of the
t(12;14) give rise to karyotypically similar chromosomes in this female

29
 karyotype. Note: the breakpoints are in either of these two ISCN descriptions, which is
a different situation to t(12;14)(q13∼15;q22∼24), where the breakpoint localizations
are less certain and a variety of breakpoint combinations are possible (see example iv in
j below).
j. When there is uncertainty over the breakpoint localization or chromosome number,
a tilde (∼) is used to denote intervals and to express uncertainty about breakpoint
localizations and/or the range of chromosome numbers.
. 45∼48,XX,+8[cp10]The chromosome number is within the interval 45 to 48 in this
female karyotype of a neoplastic sample where the only clonal abnormality identified is
trisomy 8.
i. 46,XX,del(1)(q21∼24)A female karyotype shows an apparently terminal deletion of the
long arm of chromosome 1 and a breakpoint within the segment 1q21 to 1q24, i.e., the
breakpoint may be in band 1q21, 1q22, 1q23 or 1q24.
ii. 46,XY,dup(1)(p34∼32p22)A male karyotype shows duplication in the short arm of
chromosome 1; the distal breakpoint is in 1p34, 1p33 or 1p32 and the proximal
breakpoint is in band 1p22.
iii. 46,XX,t(3;12)(q27∼29;q13∼15)A female karyotype where both breakpoints in this
translocation are uncertain; in chromosome 3 the breakpoint may be in bands 3q27, 3q28
or 3q29 and in chromosome 12 in bands 12q13, 12q14 or 12q15.
iv. ogm[GRCh38]
t(6;7)(q21;q32.1)(108,976,886∼108,982,237;128,310,022∼128,316,239)Genome
mapping identified a reciprocal translocation between chromosomes 6 and 7. The
chromosomes and breakpoints are separated by a semicolon (;) as are the
nucleotides. Note: this nomenclature uses the short system (karyotype format)
(see Section 4.7) and the tilde (∼) demonstrates the region of uncertainty in the
breakpoints at the nucleotide level.
k. A question mark (?) indicates uncertain identification of a chromosome or
chromosome structure. It is placed either before the uncertain item, or it may replace a
chromosome, region, band or subband designation.
. 45,XX,–?21A female karyotype with a missing chromosome, likely to be chromosome
21.
i. 47,XX,+?8A female karyotype with an additional chromosome, likely to be
chromosome 8.
ii. 46,XY,?del(1)(p36.1)A male karyotype where the deletion is uncertain, but if present it
is a terminal deletion from chromosome 1, band p36.1 to 1pter.
iii. 46,XX,del(19)(?q)A female karyotype where there is a deletion, likely to be in the long
arm of chromosome 19.
iv. 46,XX,del(20)(q?)A female karyotype with a deletion in the long arm of chromosome
20, but neither the region nor the band can be identified.
v. 46,XX,del(1)(q?2)A female karyotype with a deletion in the long arm of chromosome
1, probably in region 1q2.
vi. 46,XY,del(1)(q?23)A male karyotype where it is uncertain whether the breakpoint in
the long arm of chromosome 1 is in region 1q2. If so, the breakpoint is in band 1q23.
vii. 46,XX,del(1)(q2?)A female karyotype with a deletion in the long arm of chromosome
1 in region 1q2, and it is not possible to determine the band within that region.

30
 viii. 46,XY,del(1)(q2?3)A male karyotype with a deletion in the long arm of chromosome 1
in region 1q2, probably in band 1q23.
ix. 46,XY,t(5;6)(q31.1;q22.?1)A male karyotype with a translocation between
chromosomes 5 and 6. The breakpoint in chromosome 5 is within 5q31.1 and the
breakpoint in the long arm of chromosome 6 is in the region of 6q22 and probably in
subband 6q22.1 but this is uncertain.
x. 46,XX,der(1)?t(1;3)(p22;q13)A female karyotype where the der(1) has probably
resulted from a t(1;3) with proposed breakpoints in bands 1p22 and 3q13.
xi. 46,XY,der(5)ins(5;?)(q32;?)A male karyotype with a derivative chromosome from an
insertion of unidentified chromosomal material into the long arm of chromosome 5 at
band 5q32.
xii. 46,XY,–5,+der(?)t(?;5)(?;q13)A male karyotype with loss of a chromosome 5 and gain
of a derivative chromosome of an unknown origin that is composed partly of
chromosome 5 long arm material. Note: the unknown chromosome (?) contains the
centromere and so is listed before chromosome 5 in the description of the translocation.
xiii. 46,[Link] X(DXZ1×2),der(7)ins(7;Y)(q3?;p11.?2p11.?2)(SRY+)In situ hybridization
using probes for the X chromosome pericentromeric alphoid repeat sequence and
the SRY gene shows a signal for the SRY probe in region 7q3 of one chromosome 7, and
the band cannot be determined. The breakpoints of the inserted Y chromosome segment
are uncertain but are possibly in Yp11.2, which contains the SRY gene. The DXZ1 signal
pattern is given as this is an XX male.

4.3 Order of Cytogenomic Abnormalities

a. For karyotype, the normal sex chromosomes are listed before any abnormality. When
there is an abnormal X chromosome in a male individual, the normal Y chromosome is
listed first. When clarity of the sex complement is required, the normal Y chromosome
may be listed in microarray and genome mapping, and it appears in the ISCN description
before the abnormal X chromosome (see example ii).
i. 46,Y,t(X;10)(q27;p13)A male constitutional karyotype. The normal Y chromosome is
listed before the translocation involving the X chromosome.
ii. ogm[GRCh38]
(Y)×1,Xq25(126023321×1,126228413_126535347×0,126556900×1)matGenome
mapping shows with an interstitial deletion of Xq25 involving loss of nucleotides
between 126,228,413 and 126,535,347 of maternal origin in a male. The normal Y
chromosome is described so the sex chromosome constitution is clear, i.e., the
individual is male and not a female with a single X chromosome. Note: to avoid
confusion, commas to separate millions and thousands are not used in the nucleotides in
the extended system (microarray format) (see Section 4.7).
b. Sex chromosome aberrations are specified first. (X chromosome abnormalities are
presented before those involving the Y chromosome), followed by abnormalities of the
autosomes listed in numerical order irrespective of the aberration type. Each
abnormality is separated by a comma (,).
i. 50,X,+X,–Y,+10,+14,+17,+21[5]Karyotype of a neoplastic sample in a male. The
numerical abnormality of the X chromosome is listed before that of the Y chromosome.

31
ii. 47,X,t(X;13)(q27;q12),inv(10)(p13q22),+21A female karyotype shows a reciprocal
translocation between the X chromosome at Xq27 and chromosome 13 at 13q12, an
inversion of chromosome 10 between 10p13 and 10q22 and trisomy 21. The sex
chromosome abnormality is presented first, followed by the autosomal abnormalities in
chromosome number order, irrespective of whether the aberrations are numerical or
structural.
iii. 47,Y,t(X;13)(q27;q12),inv(10)(p13q22),+21The same karyotype as in the previous
example in a male. The normal Y chromosome is listed before the abnormal X
chromosome.
iv. 46,t(X;18)(p11.1;q11.2),t(Y;1)(q11.2;p13)[10]Karyotype of a neoplastic sample in a
male. The abnormality involving the X chromosome is listed before that of the Y
chromosome.
v. 48,X,t(Y;12)(q11.21;p12),del(6)(q11),+8,t(9;22)(q34;q11.2),+17,–
21,+22[10]Karyotype of a neoplastic sample in a male. The translocation involving the
Y chromosome is presented first, followed by all autosomal abnormalities in
consecutive chromosome number order.
vi. arr[GRCh38]
Xp22.33(23,934_1,604,049)×3,9p24.3p23(56,537_9,401,480)×1Microarray shows an
apparently terminal gain of the X chromosome involving Xp22.3 and an interstitial loss
of chromosome 9 at 9p24.3 to 9p23. The abnormalities are given in chromosome order.
c. For each homologous chromosome, numerical abnormalities are listed before structural
changes and constitutional abnormalities are listed before the same acquired
abnormality.
i. 46,XY,+13,der(13;14)(q10;q10)A male karyotype in which the abnormalities are
presented in chromosome order (13 before 14) with the chromosome 13 numerical
abnormality before the structural abnormality.
ii. 46,XY,der(13;21)(q10;q10),+21A male karyotype in which the numerical abnormality
of chromosome 21 is listed after the structural abnormality of chromosome 13 and 21
following the chromosome order rule.
iii. 47,X,inv(X)(p21q26),+3,inv(3)(q21q26.2),–7,+10,–
20,del(20)(q11.2q13.1),+21[10]Karyotype of a neoplastic sample in a female shows
pericentric inversion of the X chromosome, gain of chromosome 3, an inversion 3,
monosomy 7, trisomy 10, monosomy 20, an interstitial deletion within the long arm of
chromosome 20, and trisomy 21. The normal X chromosome is listed first followed by
the abnormal X chromosome with an inversion. The extra chromosome 3 is presented
before the inversion of chromosome 3, and the monosomy 20 before the deletion of
chromosome 20. Note: the karyotype can also be written to show gain of the inverted
chromosome 3, and therefore trisomy is implied, i.e.,
47,X,inv(X)(p21q26),+inv(3)(q21q26.2),–7,+10,–20,del(20)(q11.2q13.1),+21[10]
iv. 50,XXYc,+X,+21c,+21[10]Karyotype of a neoplastic sample in a XXY male shows an
acquired gain of an X chromosome and acquired gain of chromosome 21, both are listed
after the respective constitutional gain.
d. Multiple structural changes of homologous chromosomes are presented in alphabetical
order according to the abbreviated term of the abnormality.
i. 50,XX,+1,+del(1)(p13),+dup(1)(q21q32),+inv(1)(p31q41),+8,r(10)(p12q25),–
21[10]Karyotype of a neoplastic sample in a female shows four abnormalities involving

32
 different chromosome 1 homologues, one aneuploidy and three different structural
abnormalities. The numerical change is presented first, followed by the structural
aberrations listed in alphabetical order, i.e., del, dup, inv.
e. Multiple changes within the same chromosome are presented
from pter to qter (irrespective of alphabetical order), consistent with the public
databases of current genome builds on UCSC or Ensembl Genome Browsers
([Link] or [Link]).
i. 46,XX,der(8)ins(8;?)(p23;?)del(8)(q22)A female karyotype shows two abnormalities
involving one chromosome 8 described using the short system (karyotype format).
Chromosome 8 is described as a derivative chromosome with the structural aberrations
listed from the distal short (p) arm to the distal long (q) arm, rather than in alphabetical
order, following the pter to qter rule. The ISCN description using the detailed system
(karyotype format) would be 46,XX,der(8)(8pter→8p23::?::8p23→8q22:) (see Section
4.7).
ii. arr[GRCh38]
8p23.3p23.1(176,814_7,691,960)×1,8p23.1p21.3(12,556,004_20,026,406)×3Microarr
ay shows an apparently terminal single copy loss of the short arm of chromosome 8
involving the segment 8p23.3 to 8p23.1 and an interstitial single copy gain of the
segment segment 8p23.1 to 8p21.3.
f. Unidentified structural rearrangements are given after the other numerical and structural
abnormalities in the following order: unidentified ring chromosomes (r), marker
chromosomes (mar), and double minutes (dmin). The number of double minutes is
not included in the chromosome count (see Section 5.5.12).
i. 52,XX,+7,+12,+13,+17,+r,+mar,12∼20dmin[10]A female karyotype with 52
chromosomes in a neoplastic sample. The ring chromosome (r) is listed before
the marker (mar) and the double minutes (dmin) are given after a marker
chromosome.
g. Derivative chromosomes whose centromere is unknown (see Section 5.5.3) are placed
after all identified abnormalities but before unidentified ring chromosomes, marker
chromosomes, and double minutes.
i. 52,XX,+12,+13,+17,+der(?)t(?;6)(?;q16),+r,+mar,5∼9dmin[10]A female karyotype
with 52 chromosomes in a neoplastic sample. Abnormalities are given in chromosome
order, and derivative chromosomes that can be partly identified are given before ring
chromosomes, marker chromosomes and double minutes of unknown origin.

4.4 Nomenclature Rules

4.4.1 Spaces

Spaces are not given in the ISCN description except for the following three scenarios:

a. A space is always present between the abbreviations for the technique used (+/–
genome build) and the result.
i. 46,[Link] 4p16.3(D4F26,WHS,D4S96)×2
ii. nuc ish (TP73×1,ANGPTL×2)[107/200]
iii. arr (X)×1

33
 iv. arr[GRCh38] 5q22.1q31.1(110,670,174_131,637,624)×3
v. ogm (X)×1[0.6]
vi. ogm[GRCh38] 22q11.2(18,730,698_21,689,521)×1
b. There is a space between two abbreviations when no period or a comma is present.
i. nuc ish (KAL1,D21S65)×2
ii. 47,XY,+mar dn[14]/46,XY[16]
iii. 45,XY,psu dic(14;21)(q31;q22.1)
c. A space is added before and after chi, con, mos, or, and sep.
i. nuc ish (MYH11,CBFB)×3(MYH11 con CBFB)×2[100/200]In situ hybridization of
200 nuclei shows colocalization of MYH11 and CBFB in 100 nuclei and a normal
hybridization signal pattern in 100 nuclei. The number of normal nuclei is inferred
from the denominator.
ii. 46,XY,add(1)(q42) or dup(1)(q42q44)An abnormal chromosome 1 in a male
individual has arisen by an unknown mechanism as shown by the use of add(1) or by a
duplication involving bands 1q42 to 1q44.

4.4.2 Identification of Homologous Chromosomes

a. To distinguish homologous chromosomes when both are involved in an abnormality

(numerical or structural), one of the numerals may be underlined (_).
i. 46,XY,t(5;8)(q23;q24),t(5;11)(p12;p11.1)A male karyotype with different
translocations involving both chromosome 5 homologues. Single underlining may be
used to distinguish between the homologues. As these are different homologues, the
t(5;8) is listed before the t(5;11) following the chromosome order rule, i.e., the partner
chromosome determines the numerical order.

4.4.3 Number of Signals or Copies

a. A multiplication (×) sign can be used to describe two or more copies of a structurally
rearranged chromosome. The number of copies (×2, ×3, etc.) should be placed after the
abnormality. The multiplication (×) sign should not be used to denote multiple copies
of normal chromosomes (see exception for targeted chromosome analysis in Section
10.2.1).
i. 47,XY,+5,del(5)(q13q33)×2[15]Karyotype of a neoplastic sample shows an interstitial
deletion of the long arm of two chromosome 5 homologues. The remaining chromosome
5 is apparently normal.
b. In in situ hybridization a multiplication (×) sign and the number of signals seen is
given outside the parentheses (( )) when the number of copies for each probe is the
same. If the copy number differs between probes within the same hybridization,
the multiplication (×) sign is given for each probe inside the parentheses.
i. nuc ish (RB1,D21S259/D21S341/D21S342)×2In situ hybridization shows two signals
for the RB1 probe and the D21S259/D21S341/D21S342 contig. The ×2 applies to all
probes and is given outside the parenthesis. Note: D21S259 could be given on its own
in the ISCN description and the other chromosome 21 contig probes must then be given
in the text of the report.

34
 ii. nuc ish (MYC×2,IGH×3)[90/200]In situ hybridization in a neoplastic sample using a
D8Z2/MYC/IGH probe set shows three signals for IGH probe and two signals for the
MYC probe. The multiplication (×) sign is associated individually with each
probe. Note: cell numbers must be given for neoplastic samples. The control probe,
D8Z2, need not be given as both MYC and control probes show a normal signal pattern
(see Chapter 7).
iii. 46,[Link] (X,13,18,21)×2Apparently normal female karyotype and normal copy
number of chromosomes X, 13, 18, and 21 using a regionspecific assay (e.g., QF-PCR).

4.4.4 Breakpoint Designation

a. The location of a breakpoint(s) is specified by the band in which that break has
occurred, e.g., 17p13.1
• If a break can be localized to a band and not a subband, then the band may be
specified, e.g., 17p13
• Likewise, if a breakpoint can be localized only to a region but not to a particular band,
then the region number may be specified, e.g., 17p1
b. In the detailed system (karyotype format) the aberrations are listed according to the
breakpoints of the derivative chromosome from pter to qter and are not separated by a
comma (see Section 4.7). If a rearrangement is confined to a single chromosome, the
chromosome number is not repeated in the band description. If more than one
chromosome is involved, the bands and chromosome ends are identified with the
appropriate chromosome numbers (see Section [Link]).
i. 46,XY,der(9)(pter→p23::p13→p23::p13→q22::q33→qter)A male karyotype shows a
derivative chromosome 9 from an intrachromosomal rearrangement. The chromosome
number is not repeated before each breakpoint because all the breakpoints are within
chromosome 9.
ii. 46,XY,der(7)(7pter→7q22::2q21→2qter)A male karyotype shows chromosomes 2 and
7 are involved in this derivative chromosome. The chromosome number is reported for
each breakpoint in the brackets.
c. A mixture of the short and detailed systems (karyotype format) can be used in the ISCN
description but are not intermixed to describe abnormalities of a single chromosome.
. 46,XX,der(2)t(2;5)(p23;q35),der(8)(22qter→22q12::8q22→8q13::8p22→8q13::8p22
→8p23::17q21→17qter)[10]Karyotype of a female neoplastic sample shows a
derivative chromosome 2 and a derivative chromosome 8. The derivative chromosome
2 is written using the short system (karyotype format) and is derived from a translocation
between 2p23 and 5q35. The derivative chromosome 8 is written using the detailed
system (karyotype format) and involves multiple rearrangements involving
chromosomes 8, 17, and 22, in addition to a pericentric inversion of chromosome 8
(see Section 5.5.10 for more examples involving inversions). Note: when using the
detailed system (karyotype format), derivative chromosomes are written
from pter to qter with respect to the orientation of the segment containing the
centromere.
d. For interstitial deletions or duplications where both breakpoints are within the same
chromosome band, both breakpoints are given when describing the aberration using the

35
 karyotype format but the breakpoint is only given once when using the microarray
format (see Table 4 and Section 4.7).

4.4.5 Nucleotide Position

a. The genomic coordinates that are used in cytogenomic nomenclature

for microarrays (arr), region-specific assays (rsa), genome mapping (ogm)
and sequencing (seq) are defined in the translation tables provided by NCBI
(hg38/GRCh38): [Link]
[Link]
b. When nucleotide coordinates are used to define an abnormal result, the genome
build (e.g., [GRCh38]) must be specified within the ISCN. The genome build follows
immediately after the technique with no space, as illustrated in Chapters 8–11. There is
a space between the genome build in square brackets [GRCh38] and the remainder
of the ISCN description.
c. The genome build is not included in the ISCN if the nucleotide coordinates are not
reported, e.g., when describing normal results or when using the abbreviated system
(microarray format) to describe whole chromosome aneuploidy (see Sections
4.7 and 8.2.2). The genome build should be provided in the report.
d. The nucleotide numbers are given either with or without commas to indicate thousands
and millions, but the use of commas (,) is recommended to improve
readability. Note: commas are not used in the extended system (microarray format)
since they confound the copy number (see Sections 4.7 and 8.1.1).
e. The span of abnormal nucleotides is separated by an underscore (_), in line with the
Human Genome Variation Society (HGVS) recommendations
([Link]/varnomen) for molecular genetic nomenclature.
f. Band designations of only the abnormal genomic regions are shown. Abnormal regions
of the sex chromosomes are listed first (X before Y) followed by autosomes, which are
listed from lowest to highest number chromosome. Note: conventional cytogenetic
banding assignments are those derived from banded chromosomes, while the
microarray/sequencing banding assignments are those derived from genome browsers.
These are not always concordant (see Section 2.4).
i. 46,X,der(Y)t(Y;20)(q11.23;q13.2).arr[GRCh38]
Yq11.23q12(24,741,599_57,191,562)×0,20q13.2q13.33(53,224,067_63,743,732)×3A
derivative Y chromosome from an unbalanced translocation involving Yq11.23 and
20q13.2 by conventional karyotype. There is no normal Y chromosome in this
individual. Microarray shows an apparently terminal loss of part of the long arm of the
Y chromosome and gain of an apparently terminal segment of the long arm of
chromosome 20. Note: when the abnormality involves one of the sex chromosomes, the
normal sex chromosome is listed first in the ISCN description followed by the abnormal
sex chromosome (see Sections 4.2.1 and 4.3).
g. In complex microarray or genome mapping results, as may be the case in neoplastic
studies, the laboratory may choose to display results using ISCN in a tabular form
instead of in a string (see Section 8.2.7, Tables 9, 10 and 11 for examples). The
information in the table must include the chromosomes and bands corresponding to the
abnormality, the type of abnormality (e.g., loss, gain, amplification, translocation,

36
 inversion or region of homozygosity), the genomic coordinates of the abnormality, and
the proportion of the sample with the abnormality where applicable. When the tabular
form is used the genome build is designated in the table.
h. A mixture of the abbreviated, short and extended systems (microarray format) and the
abbreviated, short and detailed systems (karyotype format) can be used in the ISCN
description but are not intermixed to describe a single abnormality (see examples
in Chapters 8, 9, 10 and 11).

4.4.6 Gene Symbols

a. Although gene symbols are usually italicized, they are not italicized in the ISCN
description.

[Link] Gene Fusions

a. The gene fusion definition has been harmonized between ISCN, the Human Genome
Organisation (HUGO) Gene Nomenclature Committee, Variant Interpretation for
Cancer Consortium (VICC) Gene Fusion Specification, and HGVS (Bruford et al.,
2021). Gene fusions occur when two or more genes join and result in a chimeric
transcript and/or a novel interaction between a rearranged regulatory element with the
expressed product of a partner gene (a regulatory fusion).
b. A double colon (::) is used in the ISCN description to identify fusion genes in rsa and
ogm nomenclature only.

4.5 Clones, Mosaicism and Chimeras

4.5.1 Clones

a. A clone is a cell population derived from a single progenitor.

b. When several cells have the same or a closely related abnormal chromosome
complement, the clonal origin may be inferred. A clone is therefore not necessarily
completely homogeneous.
• There must be at least two metaphases with the same chromosome gain or structural
rearrangement for the abnormality to be accepted as clonal.
• The same chromosome loss must occur in at least three metaphases to be accepted as
clonal. However, identical losses in two metaphases with the same clonal chromosome
gain or structural aberration(s) may also be considered clonal and included in the
nomenclature at the laboratory’s discretion.
iii. 46,XY,del(5)(q13q33),–7,+8[2]/46,XY[18]A neoplastic clone with an interstitial
deletion of 5q13 to 5q33, monosomy 7 and trisomy 8 in two metaphases. The monosomy
7 can be included in the ISCN description as both metaphases have the same structural
rearrangement and chromosome gain.
c. Clonality may need to be defined operationally. The criteria for acceptance will depend
on, e.g., the number of metaphases examined, the nature of the aberration involved, the
type of culture, and the time cells spend in vitro prior to harvest.

37
 d. Where in situ preparations are analyzed in neoplasia, the abnormality must meet the
above criteria and be from either different primary cultures, or from well-separated areas
or different cell colonies on the same culture.
e. When the same abnormal clone has been found in an initial and follow-up study, even
in a single metaphase, it should be reported in the karyotype.
. 46,XX,t(9;22)(q34;q11.2)[1]/46,XX[19]A neoplastic clone with a translocation
between chromosomes 9 and 22. The t(9;22) was seen in the initial sample.

4.5.2 Mosaicism and Chimerism

a. Mosaicism (mos) is the presence of two or more cell lines derived from the same
zygote.
• Mosaicism may occur pre- or post-zygotically.
b. Chimerism (chi) is the presence of two or more cell lines originating from different
zygotes.
• Chimerism may occur by fusion of gametes or embryos or may occur as a result of organ
or stem cell transplantation.
c. In microarray nomenclature mos is not used.
d. Where in situ preparations are analyzed in constitutional samples, the abnormality must
meet the following criteria and be from either different primary cultures, or from well-
separated areas or different cell colonies on the same culture:
• There must be at least two metaphases with the same chromosome gain or structural
rearrangement for the abnormality to be accepted as clonal.
• The same chromosome loss must occur in at least three metaphases to be accepted as
clonal. However, identical losses in two metaphases with the same clonal chromosome
gain or structural aberration(s) may also be considered clonal and included in the
nomenclature at the laboratory’s discretion.

4.5.3 Nomenclature for Clones, Mosaics and Chimeras

a. The karyotype designations of different clones or cell lines are separated by a slant
line (/). The exception is that karyotypes of chimeras due to stem cell transplantation
are separated by a double slant line (//).
b. Square brackets ([ ]), placed after the karyotype description, are used to designate the
absolute number of metaphases in each cell line or clone.
c. Multiple clones in neoplastic samples are given in order of size if they are unrelated and
in order of complexity if they are cytogenetically related.
d. Multiple cell lines with constitutional abnormalities are given according to their size;
the largest first, then the second largest, and so on. Likewise, the largest cell line in
chimeras is presented first and where discernable, in SNP microarray and genome
mapping.
e. The normal cell line is always listed last even if it is the largest.
i. mos 45,X[15]/47,XXX[10]/46,XX[23]Sex chromosome mosaicism in a female with the
largest abnormal cell line listed first and the normal cell line last.
f. The exception is chimerism from stem cell transplants where the donor cell line is listed
last.

38
 g. When the metaphase numbers are the same, the XX cell line is always listed before the
XY when neither shows an abnormality.
h. To distinguish between mosaic (mos) and chimeric (chi) cell lines, the respective
abbreviation may be used preceding the karyotype designation, with a space following
the abbreviation.
i. The use of mos or chi is optional. In most instances the abbreviation will be given only
in the initial ISCN description in a report, e.g., mos 45,X[10]/46,XX[10] and chi
46,XX[10]/46,XY[10]
i. 45,X[10]/46,XX[20]Mosaic karyotype with one cell line having one X chromosome in
ten metaphases and a second cell line with a normal diploid female pattern in 20
metaphases.
ii. chi 46,XY[25]/46,XX[10]An XY/XX chimera with the larger cell line listed first.
iii. 46,XX[5]//46,XY[25]Incomplete engraftment in a female recipient following stem cell
transplant with male donor cells.
j. In neoplasia, individual neoplastic clones and, if present, constitutional cell lines are
listed in the following order irrespective of clone size or complexity:
• abnormal clones with an acquired abnormality,
• cell lines with a constitutional abnormality,
• the normal cell line, if present.
iv. 45,XY,–21[5]/47,XY,+21c[10]/46,XY[10]Neoplastic sample with acquired loss of
chromosome 21 in an individual with mosaic Down syndrome.
v. 47,XY,t(8;14)(q11.2;q32),+21c[5]/47,XY,+21c[7]/46,XY[10]A neoplastic clone with a
translocation between chromosomes 8 and 14 in an individual with mosaic Down
syndrome.
k. When the number of abnormal metaphases in constitutional cell lines or neoplastic
unrelated clones is equivalent, or the complexity of clones in cytogenetically related
neoplastic clones is equivalent, their order in the ISCN description is determined by the
sequential application of the following rules (see also Section 6.3.3 for neoplasia
examples):
• Where abnormalities in different clones/cell lines involve chromosomes of a different
number, the chromosome order rule applies, X before Y, followed by autosomes in
increasing number, e.g.,
Constitutional cell lines: 47,XXX[25]/47,XX,+21[25]/46,XX[10]
Unrelated neoplastic clones: 47,XX,+8[25]/47,XX,+21[25]
Related neoplastic clones: 45,XY,–5,t(7;11)(p15;p15)[10]/45,XY,–
7,t(7;11)(p15;p15)[15]
• When the same chromosome is involved, gains are listed before losses before
structural change, e.g.,
Constitutional cell lines: 45,X[25]/46,X,i(X)(q10)[25]/46,XX[25]
Unrelated neoplastic clones: 47,XY,+5[25]/46,XY,del(5)(q13q33)[25]/46,XY[10]
Related neoplastic clones: 47,XX,t(9;22)(q34;q11.2),+19[5]/45,XX,t(9;22),–19[10]
• Structural abnormalities of the same number chromosome are
listed alphabetically, e.g.,
Constitutional cell lines: 46,X,del(X)(q13)[25]/46,X,i(X)(q10)[25]/46,XX[25]
Unrelated neoplastic clones: 46,XX,add(7)(q34)[10]/46,XX,del(7)(q22)[10]
Related neoplastic clones: 46,XX,del(7)(q22),+8[10]/46,XX,i(7)(q10),+8[12]

39
 • Where the same type of abnormality is detected on the same chromosome, the pter to
qter rule applies, e.g.,
Constitutional cell lines: 46,XY,del(5)(p15.31)[10]/46,XY,del(5)(p15.2)[10]
Unrelated neoplastic
clones: 46,XX,del(13)(q13q14)[10]/46,XX,del(13)(q14q22)[10]/46,XX[2]
Related neoplastic clones: 46,XY,del(5)(q13q31),–7[3]/46,XY,del(5)(q13),–7[17]
l. When a single abnormal metaphase is detected with one technique and confirmed by a
different method (e.g., in situ hybridization) and thus shown to be clonal, it is reported
in the ISCN description. When additional abnormalities are seen in a single metaphase,
but not proven to be present with another method, they should not be listed in the
nomenclature but, if appropriate, may be discussed in the interpretation.
. 46,XX,del(20)(q11.2q13.3)[1]/46,XX[19].nuc ish (D20S108)×1[40/200]A neoplastic
clone with an interstitial deletion of 20q11.2 to 20q13.3 seen in one metaphase and
confirmed by interphase in situ hybridization. Note: the abnormal in situ hybridization
interphase result must be above the laboratory reporting threshold.
i. 47,XX,+8[1]/46,XX[19].nuc ish (D8Z2)×1[30/200]Karyotype shows an additional
chromosome 8 in one metaphase and is confirmed as a mosaic trisomy 8 by interphase in
situ hybridization.
m. In chimerism secondary to stem cell transplant, the recipient clone(s) are listed first,
followed by the donor clone(s).
. 46,XY[3]//46,XX[17]Karyotype shows three metaphases from the male recipient and
17 metaphases from the female donor.
i. //46,XX[20]Karyotype shows that all 20 metaphases are derived from the female donor.
ii. 46,XY[20]//Karyotype shows that all 20 metaphases are derived from the male
recipient.
iii. 46,XY,t(9;22)(q34;q11.2)[4]//46,XX[16]Karyotype shows four male recipient
metaphases with a 9;22 translocation and 16 apparently normal female donor
metaphases.
iv. 46,XX[5]//45,XX,der(13;14)(q10;q10)c[15]Karyotype shows five metaphases from the
female recipient and 15 metaphases from the donor. The donor cells can be distinguished
by the presence of a constitutional Robertsonian translocation involving chromosomes
13 and 14.
n. If present in cytogenomic results (arr, ogm, rsa, seq), clonality/mosaicism must be
indicated in the ISCN description as follows (see Chapters 8–11):
• An estimate of the proportion of the sample with the abnormality, or the variant allele
frequency (VAF) of the abnormality is reported in square brackets ([ ]) immediately
following the abnormality.
• If it is not possible to determine the level of mosaicism, a question mark (?) may be
used in square brackets ([ ]) in place of the VAF or sample proportion.
• Alternatively where the level of mosaicism cannot be determined, a tilde (∼) may be
used to indicate a range of copy numbers.
• Amplification (amp) may be used when there are too many signals to allow
enumeration and the amplification meets the clinical criterion for gene amplification in
the disease under investigation.
• The abbreviation mos is not used in ISCN for molecular cytogenomic results.

40
 v. arr[GRCh38] 17p13.3∼p13.1(158,756_7,281,077)×1[0.7∼0.9]SNP microarray of a
neoplastic sample shows loss of a segment of the short arm of chromosome 17 with a
range of deletion breakpoints between 17p13.3 and 17p13.1, as indicated by
using tilde (∼) in the breakpoint designation. There is similarly a range in the proportion
of the sample within this region from 70% to 90%.
vi. arr[GRCh38] 7p11.2(54,290,345_55,087,100)amp[?]Microarray of a neoplastic sample
shows amplification (amp) of a region in 7p11.2. The exact copy number is too large
to be enumerated accurately by microarray and the proportion of the sample with the
amplification cannot be determined.
vii. ogm[GRCh38]
t(1;17)(p36.23;p13.3)(8,781,440;2,208,744)(RERE::SMG6)[VAF0.3],del(6)(q12q23.3
)(63,771,696_135,674,891)[0.5],del(12)(p13.1)(pter_12,722,843)[0.5]Genome
mapping shows a reciprocal translocation between chromosomes 1 and 17 resulting in
a RERE::SMG6 fusion gene with a VAF of 30%. There is an interstitial deletion of 6q
and an apparently terminal deletion of 12p, both losses are in 50% of this neoplastic
sample.

4.6 Multiple Techniques

a. Where multiple techniques are reported in the nomenclature, the karyotype (if
undertaken) is always listed first. The order of the subsequent techniques is at the
discretion of the laboratory. Subsequent techniques are separated by a period (.) to
designate the beginning of the next result. Alternatively, multiple techniques can be
listed on separate lines without a period (.).
b. If an alternative technique clarifies the karyotype and, in retrospect, the abnormality can
be visualized with banding, the karyotype may be amended to reflect this new
information.
c. If the abnormality is cryptic and cannot be visualized by banding, the abnormality
is not listed in the banded karyotype.
i. 46,XX,del(4)(q32q35).arr[GRCh38]
4q32.2q35.1(163,146,681_183,022,312)×[Link][GRCh38]
del(4)(q32.2q35.1)(163,146,681_183,022,312)
or
46,XX,del(4)(q32q35)
arr[GRCh38] 4q32.2q35.1(163,146,681_183,022,312)×1
ogm[GRCh38] del(4)(q32.2q35.1)(163,146,681_183,022,312)Karyotype shows a
large interstitial deletion in the long arm of chromosome 4 in a female. The
breakpoints are further delineated by microarray and genome mapping. Note: the
nucleotides are likely to be different for microarray and genome mapping platforms.
They are the same for this example as they are given only to demonstrate the
nomenclature.
ii. 46,[Link][GRCh38] 22q11.21(18,339,130_21,086,225)×[Link]
del(22)(q11.2q11.2)(TBX1-,SHANK3+)An interstitial deletion of the long arm of
chromosome 22, which is detected by chromosome microarray and confirmed by
metaphase in situ hybridization. The microdeletion is not visible in the karyotype and
is therefore not shown in the karyotype nomenclature.

41
 d. When the same structural abnormality is seen with different techniques or in different
clones/subclones/cell lines, breakpoints do not need to be repeated unless their use
clarifies or extends the breakpoints.
i. 46,XX,t(4;18)(q31.1;q21.1).ish t(4;18)(wcp4+,wcp18+;wcp18+,wcp4+)A female
karyotype with a reciprocal translocation 4;18 confirmed by in situ hybridization using
painting probes for chromosomes 4 and 18. Breakpoints of the translocation are not
repeated in the in situ hybridization result.
ii. 45,XY,der(7)t(7;15)(q36.2;q11.1),–[Link][GRCh38]
7q36.2q36.3(154,257,444_159,128,556)×[Link] der(7)t(7;15)(wcp7+,RP11–324E12–
,wcp15+)A male karyotype with a derivative chromosome 7 with one normal
chromosome 7 and one normal chromosome 15. Due to unbalanced segregation, the
derivative 15 is not present, hence the chromosome number of 45 and –15 in the
karyotype nomenclature. Breakpoints are not repeated in the in situ hybridization
result.
iii. 47,XX,inv(6)(p21q25),+12[17]/47,XX,inv(6),+mar[11]/46,XX[2].ish
der(8)(D8Z2+,MYC–)[10]A female karyotype of a neoplastic sample. The breakpoints
of the inv(6) are not repeated in the sideline. The marker is confirmed to be derived
from chromosome 8 by in situ hybridization.
e. When several techniques are used, the abbreviation mat, pat, inh, dmat,
dpat or dinh is given in the nomenclature of the technique where the inheritance was
first identified. The inheritance abbreviation is not given in the ISCN description of
subsequent technologies.
i. 46,XY,t(1;18)(p31;q22)[Link] t(1;18)(wcp18+,wcp1+;wcp18+,wcp1+)A paternally
inherited translocation between the short arm of chromosome 1 and the long arm of
chromosome 18, seen with karyotype and in situ hybridization in a male individual.
The abbreviation pat is only given once.
ii. 46,[Link] del(22)(q11.2q11.2)(TBX1–)matA maternally inherited interstitial deletion
of the proximal part of the long arm of chromosome 22 in this male sample. The
abbreviation mat is given in the in situ hybridization part of the ISCN description as
the del(22) is not visible on conventional karyotype.
iii. arr[GRCh38] 7q35(145,733,219_146,772,842)×[Link] del(7)(q35q35)(RP11–
79M8–)A maternally inherited interstitial loss in 7q35 detected by chromosome
microarray and confirmed by in situ hybridization. The abbreviation mat is associated
with the technique performed first.
iv. 46,XX,der(13)t(13;20)(q34;p13)[Link] der(13)(163C9–,dj1061L1+)An unbalanced
translocation between the distal long arm of chromosome 13 and the distal short arm
of chromosome 20, inherited from a balanced maternal t(13;20). The subtelomeric
region of 13q is deleted and replaced with the subtelomeric region of the chromosome
20 short arm.

4.7 ISCN Formats

a. The ISCN description uses two different formats depending on the technique used
and/or the structural information given by the assay:

42
 • Karyotype format based on chromosome bands, e.g., banded chromosome analysis
(i.e., conventional karyotype), in situ hybridization, genome mapping, region-specific
assays (RSA) and sequencing or
• Microarray format based on molecular cytogenomic techniques, e.g., microarray,
genome mapping, RSA, and sequencing.
b. The karyotype format is described using the abbreviated, short, and detailed systems,
while the microarray format is expressed using the abbreviated, short, and extended
systems.
c. For interstitial deletions or duplications where both breakpoints are within the same
chromosome band, both breakpoints are given when describing the aberration using
the karyotype format (see Section 4.7.1), but the breakpoint is only given once when
using the microarray format (see Table 4 and Section 4.7.2).

i. Interstitial deletion of chromosome 12.

• Karyotype: 46,XY,del(12)(q22q22)
• In situ hybridization: ish del(12)(q22q22)(RP11–917O5+,RP11–850P15–,RP11–
541G9+)
• Microarray: arr[GRCh38] 12q22(93,201,112_95,156,540)×1
• Sequencing:
▪ Karyotype format ISCN:
seq[GRCh38] del(12)(q22q22)
NC_000012.12:g.93201112_95156540del
▪ Microarray format ISCN:
seq[GRCh38] 12q22(93,201,112_95,156,540)×1
• Genome mapping:
▪ Karyotype format ISCN:
ogm[GRCh38] del(12)(q22q22)(93,201,112_95,156,540)
▪ Microarray format ISCN:
ogm[GRCh38] 12q22(93,201,112_95,156,540)×1
ii. Paracentric inversion of chromosome 12.
• In situ hybridization: ish inv(12)(q22)(RP11–490G8+)(q22)(RP11–850P15+)
• Sequencing:
▪ Karyotype format ISCN:
seq[GRCh38] inv(12)(q22q22)
NC_000012.12:g.93,201,112_95,156,540inv
• Genome mapping:
▪ Karyotype format ISCN:
ogm[GRCh38] inv(12)(q22q22)(93,201,112_95,156,540)

43
 Table 4. ISCN for breakpoints within a chromosome band for each technique

4.7.1 Karyotype Format

a. The karyotype format describes the abnormality using chromosome bands (short and
detailed systems).
• The abbreviated system defines each abnormality by only the chromosome number. It
is applicable for in situ hybridization of sex determination and whole chromosome
enumeration and targeted chromosome analysis.
▪ ish 7(D7Z1)×1[20]/7(D7Z1)×2[15] (see Chapter 7).
rsa (21)×3[25]/(21)×2[5] (see Chapter 10).
• The short system defines each abnormality by their breakpoints. However, with
genome mapping the short system includes the nucleotides without indicating the copy
number, i.e.,
▪ 46,XX,del(5)(q13) (see Chapter 5).
ish del(15)(q11.2q11.2)(SNRPN–,D15S10–) (see Chapter 7).
ogm[GRCh38] del(17)(q11.2q11.2)(29,069,481_30,273,120)[0.5] (see Chapter 9).
• The detailed system (karyotype format only) defines each abnormality in terms of its
band composition from pter to qter. However, with genome mapping the detailed
system includes the nucleotides without indicating the copy number, i.e.,
▪ 46,XX,del(5)(pter→q13:) (see Chapter 5).
46,[Link] del(15)(pter→q11.2::q12→qter)(D15S11+,SNRPN–,D15S10–,GABRB3+)
(see Chapter 7).
nuc ish (KMT2A)x2(5′KMT2A sep 3′KMT2A)×1[200] (see Chapter 7).
ogm[GRCh38]
der(2)(pter_p24.1::p12_p11.2::p24.1_p12::p11.2_qter)(pter_19,795,841∼19,799,854::
80,780,708_87,576,955::19,795,841∼19,799,854_80,780,709::87,576,956_qter)
(see Chapter 9).

4.7.2 Microarray Format

44
a. The microarray format describes the abnormality using nucleotides (short and
extended systems) and copy number. When describing normal results or whole
chromosome aneuploidy or chromosome arm aneuploidy the abbreviated system is
used that does not include the nucleotides. The abbreviations pter and qter are not
used in the ISCN microarray format.
b. The abbreviated system (microarray format only) describes the
abnormality/abnormalities with no breakpoints and no nucleotides, i.e.,
arr (X,1–22)×3 (see Chapter 8).
ogm (X,21)×3 (see Chapter 9).
seq (13)×3 (see Chapter 11).
c. The short system includes the breakpoints and nucleotides involved in the abnormality
and copy number, i.e.,
arr[GRCh38] 22q11.21(18,730,698_21,689,521)×1 (see Chapter 8).
ogm[GRCh38] 22q11.21(18,730,698_21,689,521)×1 (see Chapter 9).
seq[GRCh38] 10p15.3(49,086_2,944,634)×1dn (see Chapter 11).
d. The extended system (microarray format only) describes the abnormality in detail
including the flanking normal nucleotides, i.e.,
arr[GRCh38] 22q11.21(18889117×2,18929329_21111370×1,21116218×2)
(see Chapter 8).
ogm[GRCh38] 22q11.21(18855621×2,18858640_21290760×1,21294586×2)
(see Chapter 9).
seq[GRCh38] 10p15.3(46696_1737263×1,3067438×2)dn (see Chapter 11).

45
5 Karyotype

5.1 General Principles

a. For general rules that are also applicable to karyotype analysis, see Chapter 4.
b. Symbols and abbreviations used to designate chromosome abnormalities are listed
in Chapter 3.
c. In the description of a karyotype based on banded chromosomes, the total number of
chromosomes is listed first, followed by a comma (,), and then followed by the sex
chromosomes.
d. In the description of chromosome abnormalities, sex chromosome aberrations are given
first, and X before Y, followed by abnormalities of the autosomes listed in numerical
order. Each abnormality is separated by a comma (,) and listed in order, e.g.,
48,XY,+18,+21 (see a summary below and Section 4.3).
• Constitutional abnormalities are listed before acquired abnormalities of the same
chromosome.
• The normal sex chromosome is listed first in the ISCN description when the other sex
chromosome is abnormal (see Section 4.3).
• For each chromosome numerical abnormalities are given before structural changes.
Gains are given before losses and before structural abnormalities.
• Where abnormalities are on the same chromosome homologue they are given
in pter to qter order as they lie on the abnormal chromosome. The orientation of the
abnormal chromosome is determined by the segment with the centromere.
• Abnormalities on the same chromosome homologue involving the same chromosome
band are given in alphabetical order according to the abbreviated term of the
abnormality, e.g., additional material (add) before deletion (del); deletion
before derivative (der); derivative before duplication (dup) etc.
• Structural changes involving both homologous chromosomes are given in alphabetical
order according to the abbreviated term of the abnormality.
e. A normal diploid cell line, when present, is always listed last.
f. A plus (+) sign or a minus (–) sign may be used to indicate gain or loss of chromosomes
(see Section 5.3).
• The plus (+) sign or minus (–) sign is given before a structurally normal or abnormal
autosome to indicate autosomal aneuploidy in constitutional and in neoplastic samples.
• The plus (+) sign or minus (–) sign is given to describe acquired sex chromosome
aneuploidy in neoplastic samples.
• The plus (+) sign or minus (–) sign are not used to indicate constitutional numerical
sex chromosome abnormalities i.e., all sex chromosomes comprising the constitutional

46
 sex chromosome complement are given after the chromosome number, without
indicating copy gain or loss (see examples in Section 5.3.1).
g. In the situations described below, the plus (+) sign and the minus (–) sign may be used
in the interpretive comments but are NOT used in the ISCN description.
• To indicate an increase or decrease in the length of a chromosome arm (p or q)
the plus (+) or minus (–) signs may be placed after the arm abbreviation, e.g., 4p+, 5q–
in the text.
• For benign variable chromosome features (see Section 2.5.1), to indicate an increase or
decrease in arm length by placing a plus (+) or minus (–) sign after the appropriate
abbreviation, e.g., ps+. Heterochromatic variants are not included in the ISCN
description but may be included in the text (see Chapter 2).
h. The multiplication (×) sign can be used to describe multiple copies of a rearranged
chromosome but is not used to denote multiple copies of normal chromosomes
(see Sections 4.4.3 and 5.6).
i. To distinguish homologous chromosomes, one of the numerals may be underlined (_)
(see Section 4.4.2).
j. Uncertainty in chromosome, in band designation or in the type of aberration may be
indicated by a question mark (?) or a tilde (∼) (see Section 4.2.1). The term or is used
to indicate alternative interpretations of an aberration (see Section 4.2.1).
k. The number of metaphases examined is indicated in square brackets ([ ]), where there
is constitutional mosaicism and for all ISCN descriptions of neoplastic samples.
l. The karyotype designations of different clones or cell lines are separated by a slant
line (/) (see Section 4.5.3).
m. Mosaic (mos) cell lines originate from the same zygote and chimeric (chi) cell lines
originate from different zygotes (See Section 4.5). In constitutional
cases, mos or chi may precede the karyotype designation and are followed by a space
before the total chromosome number. The use of the abbreviations mos or chi is
optional.
n. To describe more than one cell line (see Sections 4.5.3 and 6.3.3) the following applies:
• Where there is an abnormality in more than one cell line, these are given according to
their size; the largest is given first and a normal cell line, if present is listed last, e.g.,
mos 45,X[15]/47,XXX[10]/46,XX[23].
• When the different cell lines are found in equal numbers, the order is determined by
the sequential application of the following rules:
▪ A numerical abnormality is listed first before a structural abnormality.
▪ Cell lines with gains of the same chromosome are given before cell lines with loss of
the same chromosome and losses are given before structural aberrations of the same
chromosome.
▪ When both cell lines have numerical abnormalities, alterations of sex chromosomes are
given first, followed by autosome number in chromosome order, e.g.,
47,XX,+X[25]/47,XX,+21[25].
• For rules to describe chimerism secondary to stem cell transplant see Section 4.5.3.
• To describe a constitutional chimera where the number of metaphases are different for
the cell lines, the largest cell line is listed first, e.g., chi 46,XY[25]/46,XX[10].
• To describe a constitutional chimera where cell lines are of equal numbers the XX cell
line is listed before the XY cell line, e.g., chi 46,XX[10]/46,XY[10].

47
 o. When it is known that a chromosome aberration is inherited, the term inh is used. When
the parent of origin is known, it can be designated maternal (mat) or paternal (pat). If
only part of a parental aberration is inherited, the abbreviation dmat, dpat or dinh is
used (see Section 4.2.1).
p. The same rules are followed to designate the type of chromosome aberrations in the
description of constitutional and acquired chromosome aberrations. Specific terms and
recommendations related to abnormalities seen in neoplasia are described in Chapter 6.
q. When an acquired abnormality is found in an individual with a constitutional
chromosome anomaly, the constitutional aberration is indicated by the
letter c immediately after the constitutional abnormality designation (see Sections
4.2.1, [Link] and 6.4).
r. In the interest of clarity, complex rearrangements necessitating descriptions using the
detailed system (karyotype format) should be written out in full the first time they are
used in the report. The short system (karyotype format) version may be used
subsequently.
s. The breakpoints of a rearranged chromosome(s) need not be repeated in any subsequent
description of the same rearrangement or derivative of it.
t. In neoplasia an incomplete karyotype (inc) is used when the chromosome quality is too
poor to allow complete chromosome analysis. The karyotype is thus likely to contain
unidentified structural or numerical changes in addition to the abnormalities listed
(see Section 6.3.6).

5.2 Normal Results

The normal karyotype is designated as follows:

i. 46,XXKaryotype shows an apparently normal female.

ii. 46,XYKaryotype shows an apparently normal male.
iii. 46,UKaryotype shows no evidence of an abnormality, and the sex chromosomes are
not disclosed (i.e., U replaces XX or XY).

5.3 Numerical Abnormalities

5.3.1 Sex Chromosome Numerical Abnormalities

[Link] Constitutional

i. 45,XKaryotype shows one X chromosome (Turner syndrome).

ii. 47,XXXConstitutional karyotype shows three X chromosomes.
iii. 47,XYYKaryotype shows one X chromosome and two Y chromosomes.
iv. 48,XXXYKaryotype shows three X chromosomes and one Y chromosome.
v. 45,X[13]/46,XY[17]Karyotype shows mosaicism with two cell lines. One X
chromosome is seen in 13 metaphases, and a normal diploid male pattern of one X
chromosome and one Y chromosome is seen in 17 metaphases.
vi. mos 47,XXY[10]/46,XY[20]A mosaic karyotype shows one cell line with two X
chromosomes and one Y chromosome in ten metaphases and a second cell line with a

48
 normal diploid male pattern of one X chromosome and one Y chromosome in 20
metaphases.
vii. 47,XXY[15]/45,X[15]A mosaic karyotype shows one cell line with two X
chromosomes and one Y chromosome in 15 metaphases, and a second cell line with
one X chromosome and no Y chromosome in 15 metaphases. Note: when the number
of metaphases is equal in each cell line, the cell line with an extra sex chromosome is
listed first following the rule gains before losses (see Sections 4.5.3 and 5.1).
viii. 45,X[25]/47,XXX[12]/46,XX[13]A mosaic karyotype shows two abnormal cell lines.
One cell line with one X chromosome in 25 metaphases, and a second cell line with
three copies of the X chromosome in 12 metaphases. Thirteen metaphases show a
normal female karyotype. Note: the largest abnormal cell line is listed first, and the
normal cell line is listed last.
ix. 47,XXX[25]/45,X[12]/46,XX[13]A mosaic karyotype shows two abnormal cell lines.
One cell line with three copies of the X chromosome in 25 metaphases, and a second
cell line with one X chromosome in 12 metaphases. Thirteen metaphases show a
normal female karyotype. Note: the largest abnormal cell line is listed first, and the
normal cell line is listed last.

[Link] Neoplasia

i. 46,Xc,+X[10]Karyotype shows an acquired clonal gain of one X chromosome in a

neoplastic sample of an individual with Turner syndrome. Note: the plus (+) sign is
given to designate the acquired clonal gain of a sex chromosome. For use of the letter
(c) to describe constitutional abnormalities in neoplastic samples see Sections
4.3 and 6.4.
ii. 45,X,–X[8]Karyotype shows an acquired clonal loss of one X chromosome in a
neoplastic sample in a female. Note: the minus (–) sign is given to designate the
acquired clonal loss of a sex chromosome in a neoplastic sample.
iii. 44,Xc,–X[10]Karyotype shows an acquired clonal loss of the X chromosome in a
neoplastic sample from a female individual with Turner syndrome.
iv. 45,X,–Y[20]/46,XY[5]Karyotype shows an acquired clonal loss of the Y chromosome
in 20 metaphases and a normal male karyotype in five metaphases in a neoplastic
sample.
v. 45,Y,–X[10]Karyotype shows an acquired clonal loss of the X chromosome in a
neoplastic sample.
vi. 47,XX,+X[10]Karyotype shows an acquired clonal gain of one X chromosome in a
neoplastic sample.
vii. 48,XY,+X,+Y[15]Karyotype shows an acquired clonal gain of one X chromosome and
one Y chromosome in a neoplastic sample.
viii. 48,XXYc,+X[5]Karyotype shows an acquired clonal gain of one X chromosome in a
neoplastic sample from an individual with Klinefelter syndrome. Note: the letter c for
the constitutional anomaly refers to the whole sex complement, i.e., in this example it
indicates that XXY is the constitutional sex complement.
ix. 46,XXYc,–X[20]Karyotype shows an acquired clonal loss of one X chromosome in a
neoplastic sample from an individual with Klinefelter syndrome. Note: an acquired

49
 abnormality is presented in relation to the constitutional karyotype (see Sections
4.3 and 6.4).
x. 47,XXX?c[10]Karyotype shows three X chromosomes in a neoplastic sample in a
female. Note: the question mark (?) indicates that it is unclear if the extra X is
constitutional or acquired (see Section 4.2.1).
xi. 46,Xc,+21[15]Karyotype of a neoplastic sample with an acquired clonal gain of
chromosome 21 in an individual with Turner syndrome.
xii. 48,XY,+X,+mar c[6]Karyotype of a neoplastic sample with an acquired clonal gain of
the X chromosome and a constitutional marker. For constitutional markers, there is a
space between mar and c (see Section 4.4.1).

5.3.2 Autosomal Numerical Abnormalities

i. 47,XX,+21The constitutional karyotype shows trisomy 21.

ii. 48,XX,+13,+21The constitutional karyotype shows trisomy 13 and trisomy 21.
iii. 45,XX,–22The constitutional karyotype shows monosomy 22.
iv. 46,XX,+8,–21The constitutional karyotype shows trisomy 8 and monosomy 21.
v. 48,XY,+21c,+21[10]Karyotype shows an acquired gain of chromosome 21 in a
neoplastic sample from an individual with Down syndrome.
vi. 46,XY,+21c,–21[10]Karyotype shows acquired loss of one chromosome 21 in a
neoplastic sample in an individual with Down syndrome. Note: +21 is listed before –
21 following the rule that a constitutional abnormality is listed before an acquired
abnormality of the same chromosome (see Sections 5.1 and 6.4).
vii. 47,XY,+8[15]/46,XY[5]Karyotype shows gain of chromosome 8 in 15 metaphases and
a normal male karyotype in five metaphases in a neoplastic sample.

5.4 Structural Abnormalities

5.4.1 Specification of Chromosomes and Breakpoints

a. In single chromosome rearrangements, the abbreviation identifying the type of

rearrangement is listed before the chromosome involved in the change. The
chromosome involved is specified within parentheses (( )) and is followed by the
breakpoint in a second set of parentheses (( )).
b. The location of a breakpoint(s) is specified by the band in which the break has
occurred. Where the breakpoint appears to be at the interface between two bands the
breakpoint is assigned to the higher of the two band numbers, i.e., the number of the
band more distal to the centromere.
c. A breakpoint may appear to be in either of two consecutive bands. A similar situation
may occur when breakpoints at or near an interface between two bands are studied
with different banding techniques. In this event, the breakpoint can be specified by
both band numbers separated by the term or, e.g., 1q23 or 1q24, indicating a break in
either band 1q23 or band 1q24 (see Section 4.2.1).
d. If a breakpoint can be localized to a region but not a particular band then it may be
specified giving only the region, e.g., 1p3. If the band but not subband is discernable

50
 then it may be given as, e.g., 1p34. If the subband is identifiable then it is specified in
the breakpoint description, e.g., 1p34.1
• Some bands at 300 bands per haploid set (bphs) do not resolve into separate bands
and are designated with a hyphen (-), e.g., 20q11.2–13.1
e. Alternatively, uncertainty of breakpoints may be indicated by a question
mark (?), e.g., 1p1? (see Section 4.2.1) or by a tilde (∼), e.g., 1p34∼p35 (see Section
4.2.1).
f. Breakpoint(s) of rearrangement(s) reported in the ISCN description may be at different
levels of resolution reflecting the banding resolution, and hence the precision of the
karyotype. The overall banding resolution is reported in accordance with the national
guidelines as applicable and not included in the ISCN description.
g. If two or more chromosomes are involved in a rearrangement, chromosome numbers
and breakpoint positions are separated by a semicolon (;).
h. If the rearrangement involves a single chromosome the breakpoints are not separated
by a semicolon (;), e.g., inv(2)(p23q11.2), del(4)(p15.3p16.1), r(18)(p11.2q23)
i. If one of the rearranged chromosomes is a sex chromosome, then it is listed first.
When both X and Y chromosomes are involved in a rearrangement, the X
chromosome is listed before the Y chromosome. Otherwise, the chromosome having
the lowest number is always specified first, e.g., t(X;3) (p22.1;p21.3) and
t(2;5)(p23;p13.3)
j. An exception to the rule (i) above is an interchromosomal insertion (ins) in which part
of one chromosome is inserted at a point of breakage in another chromosome.
The recipient chromosome is specified first, regardless of whether it is a sex
chromosome or an autosome with a number higher or lower than that of the donor
chromosome, e.g., ins(5;2)(p14;q22q32) and ins(3;X)(q21;p22.1p11.23) (see Section
5.5.9).
k. Normal chromosomes that are replaced by structurally altered chromosomes are not
recorded in the ISCN description as missing. In the description of karyotypes
containing dicentric chromosomes or derivative chromosomes resulting from whole-
arm translocations, the abnormal chromosomes by convention replace both normal
chromosomes involved in the formation of the dicentric chromosome or derivative
chromosome. Thus, in these situations the two missing chromosomes are not specified
(see Sections 5.5.4 and [Link]).
i. 46,XX,inv(3)(q21q26.2)[15]Karyotype of a neoplastic sample shows an inversion of
one chromosome 3 replacing one normal chromosome 3 homologue in a female. There
is no need to indicate that one chromosome 3 is missing, i.e., the karyotype
must not be written 46,XX,–3,+inv(3)(q21q26.2)[15]
ii. 46,Y,t(X;8)(p22.3;q24.1)Karyotype shows a balanced translocation between the X
chromosome and chromosome 8 in a male. Note: the normal sex chromosome, in this
example the Y chromosome, is listed first.
iii. 45,XX,dic(13;15)(q22;q24)Karyotype shows a translocation between chromosomes 13
and 15 involving bands 13q22 and 15q24 resulting in a dicentric (dic) chromosome in
a female. Note: it is apparent from the total chromosome number in the ISCN
description that the dicentric chromosome replaces the two normal chromosomes
(see Section 5.5.4).

51
 iv. 46,XY,der(1)t(1;3)(p22;q13.1)Karyotype shows an abnormal chromosome 1 that
results from an unbalanced segregation of a translocation between chromosomes 1 and
3 in a male. The der(1) replaces a normal chromosome 1 and there is no need to
indicate the missing normal chromosome. The description implies that the karyotype
contains one normal chromosome 1, a derivative chromosome 1 and two normal
chromosomes 3.
v. 46,XX,der(1)ins(1;?)(p22;?)Karyotype shows material of unknown origin is inserted
in chromosome 1 within band 1p22 in a female. The homologous chromosome 1 is
normal.
vi. 46,XY,–10,+der(17)t(10;17)(q22;p12)Karyotype shows an additional abnormal
chromosome 17 that is a derivative of a translocation involving chromosomes 10 and
17, and two normal chromosomes 17 in a male. In this situation the missing
chromosome 10 must be indicated.

5.4.2 Karyotype Format for Designating Structural Chromosome Abnormalities

a. There are two systems within the karyotype format for designating structural
abnormalities, the short system (karyotype format) and the detailed system (karyotype
format) (see Section 4.7).
b. The short and detailed systems (karyotype format) may be combined in the ISCN
description, but each derivative must be described using only a single system.
i. 46,XX,inv(9)(p23q22),der(11)(11pter→11q12::5q11.2→5q23::8q24.1→8qter)A
female karyotype with a pericentric inversion of chromosome 9 written with the short
system (karyotype format) and a derivative 11 written with the detailed system
(karyotype format). The abnormal chromosome 11 has resulted from a complex
translocation involving chromosomes 5, 8 and 11, t(5;8;11;5)(q23;q24.1;q12;q11.2)

[Link] Short System (Karyotype Format) for Designating Structural Chromosome Abnormalities

a. In the short system (karyotype format), structural abnormalities are defined by their
breakpoints. The breakpoints are specified within parentheses (()) immediately
following the abbreviation of the type of rearrangement and the chromosome(s)
involved. The breakpoints are identified by band designations and are listed in the same
order as the chromosomes.
b. Arrows are not used in the short system (karyotype format).
c. For very complex abnormalities, the short system (karyotype format) may lack clarity
compared to the detailed system (karyotype format), although the short system
(karyotype format) will provide information on all breakpoints involved in the
generation of an abnormal chromosome.

[Link] Detailed System (Karyotype Format) for Designating Structural Chromosome Abnormalities

a. Structurally altered chromosomes are defined by their band composition. The

conventions used in the short system (karyotype format) are maintained in the detailed
system (karyotype format), except in the detailed system (karyotype format) the

52
 description of the band composition of the rearranged chromosome(s) is specified in
the parentheses (()) with the breakpoints.
b. In the detailed system (karyotype format) the ISCN description starts at the end of the
short arm and proceeds to the end of the long arm (pter to qter), with the bands being
identified in the order in which they occur in the rearranged chromosome.
• The aberrations are listed according to the breakpoints of the rearranged chromosome
from pter to qter and not separated by a comma (,).
• If the rearrangement is confined to a single chromosome, the chromosome number is
not repeated in the band description.
▪ The terminal end of a single chromosome arm may be designated using the
abbreviation ter preceded by the arm designation, i.e., qter and pter
• If more than one chromosome is involved, the bands and/or terminal ends are
identified with the appropriate chromosome numbers (see Section 4.4.4).
▪ If the abnormality involves different chromosomes, then the chromosome number
precedes pter or qter, i.e., 3pter and 7qter
• When the breakpoint of the chromosome(s) is not at the terminal end then the
chromosome band designation should be used.
c. A single colon (:) is used to indicate a chromosome break and a double colon (::) to
indicate break and reunion. To avoid an unwieldy description, an arrow (→ or –>),
meaning from – to, is employed. The end of a chromosome arm may be designated
either by its band designation or by terminal (ter), preceded by the arm
designation, i.e., pter indicates the end of the short arm and qter the end of the long
arm. When it is necessary to indicate the centromere, the abbreviation cen can be
used.
d. A derivative chromosome (der) is described according to the number and orientation
of the chromosome providing the centromere.
e. The description of a derivative chromosome begins at the end of the chromosome
replacing the short arm of the original chromosome, even if the translocated segment is
from a long arm or a chromosome with a higher or lower chromosome number.
i. 46,XY,der(5)(qter→q13::q10→q13::p15→p13)[20]The karyotype of a neoplastic
sample with a structurally altered chromosome 5 in 20 metaphases in a male. There is a
deletion of 5pter to 5p15 and of 5p13 to 5p10 (5q10 is present). Note: the orientation of
the derivative chromosome 5 is determined by the segment 5q10 to 5q13 because it
contains the centromere. The ISCN description begins at 5qter because the segment
5qter to 5q13 replaces the chromosome 5 short arm.
ii. 46,XX,der(8)(10qter→10q11.2::7q11.2→7q32::8p21→8q22::3p12→3pter)The
karyotype shows a derivative chromosome 8 in a female. The derivative chromosome
consists of part of chromosomes 10, 7, 8 and 3. The derivative 8 is described
from pter to qter and is composed of 10qter to 10q11.2; a chromosome 7 segment from
7q11.2 to 7q32; a segment of chromosome 8 involving 8p21 to 8q22 including the
centromere, and a chromosome 3 segment from 3p12 to 3pter. Note: the orientation of
the derivative chromosome 8 is determined by the segment 8p21 to 8q22 that contains
the centromere. The ISCN description begins at 10qter to 10q11.2 because this is the
most distal part of the material replacing the chromosome 8 short arm.
f. Unbalanced segregation rearrangements will lead to at least one derivative chromosome,
and in these situations the use of the abbreviation der to describe the derivative

53
 chromosome is recommended. It will usually not be possible to adequately describe all
the complex rearrangements in the short system. The detailed system (karyotype format)
can be used to describe any abnormality. However, the karyotype must be described in
words to ensure complete clarity.

5.4.3 Derivative and Recombinant Chromosomes

a. Derivative (der) and recombinant (rec) chromosomes are structurally rearranged

chromosomes that result from different mechanisms.

[Link] Derivative Chromosomes

a. A derivative chromosome (der) is a structurally rearranged chromosome generated by

a de novo mechanism or by meiotic malsegregation of an inherited balanced anomaly.
It is characterized by:
• more than one rearrangement within a single chromosome, e.g., an inversion and a
deletion of the same chromosome, or deletions in both arms of a single chromosome, or
• rearrangements involving two or more chromosomes, e.g., the unbalanced product(s) of
a translocation, or
• an undetermined mechanism.
b. The term derivative chromosome (der) refers to the chromosome(s) that has an intact
centromere or neocentromere (for examples see Sections 5.5.3 and 5.5.13).
c. In the short system (karyotype format), the derivative chromosome is specified
in parentheses (()) followed by the aberrations involved in the generation of the
derivative chromosome. These are listed according to the breakpoints of the derivative
chromosome from pter and qter and not separated by a comma (,).
d. An abnormal chromosome, in which no part can be identified, is referred to as
a marker chromosome (mar) (see Section 5.5.12).
e. In the detailed system (karyotype format), the abbreviations designating the
abnormalities are omitted and only the band composition of the derivative
chromosome is specified.

As an illustration of how the derivative chromosomes can be written, a balanced

reciprocal translocation between chromosomes 2 and 5, 46,XX,t(2;5)(q21;q31) is
represented by the pachytene diagram in Figure 5. The derivative chromosomes from
this translocation are designated der(2) and der(5). Table 5 gives the possible
unbalanced gametes resulting from adjacent-1 and adjacent-2 segregation. The table
also shows four of the 12 possible 3:1 segregation products together with the
designations of the karyotypes resulting from the fertilization between each
unbalanced gametic type and a normal gamete. The karyotype designation needs to be
written in full only once in the ISCN description after that it may be described without
the breakpoints. A suggested abbreviation for the first designated karyotype in Table
5 is 46,XX,der(5)t(2;5)dmat

54
Fig 5. Pachytene diagram of a t(2;5)(q21;q31) reciprocal translocation heterozygote used to specify the
disjunctional possibilities and derivative chromosome combinations given in Table 5. Letters A, B, C, and
D designate chromosome ends (telomeres). For the sake of simplicity only those two of the four
chromatids that are involved in crossing-over (see Table 5) are indicated. Crosses mark the positions of
crossing-over.

55
 Table 5. Possible unbalanced gametes derived from segregation of a balanced reciprocal translocation of
maternal origin. The pachytene configuration is given in Figure 6.

[Link]. Recombinant Chromosomes

a. A recombinant chromosome (rec) is a structurally rearranged chromosome with a

new segmental composition resulting from meiotic crossing-over between a displaced
segment and its normally located counterpart in certain types of structural
heterozygotes, e.g., inversion or insertion heterozygotes.
b. rec is inferred from the parental karyotype and is not to be used in the description of
acquired chromosome abnormalities nor those resulting from malsegregation.
c. In a recombinant chromosome (rec) there is a duplication and deletion of material.
In the ISCN description the duplication (dup) is explicitly stated, and the deletion is
inferred. See Figure 6 for a diagrammatic representation of a parental
pericentric inversion (inv) of chromosome 2, 46,XX,inv(2)(p21q31)
d. The aberrations following the abbreviation rec are not separated by a comma (,):
i. 46,XX,rec(2)dup(2p)inv(2)(p21q31)dmatKaryotype describes the recombinant
chromosome 2 with a duplication from 2pter to 2p21 and a deletion from 2q31 to
2qter.

56
ii. 46,XX,rec(2)dup(2q)inv(2)(p21q31)dmatKaryotype describes the recombinant
chromosome 2 with a duplication from 2q31 to 2qter and a deletion from 2pter to
2p21.

Figure 6. Diagram of an inv(2)(p21q31)mat pericentric inversion heterozygote. Bands delimiting the

breakpoints (arrows on original) are shown as black boxes on the short arm and as hatched boxes on the
long arm. In the pachytene diagram, the cross indicates crossing-over within the inversion loop. For the
sake of simplicity only those two of the four chromatids that are involved in crossing-over and give rise
to the recombinant chromosomes are indicated.

57
5.5 Specification of Structural Rearrangements

The types of structural rearrangements are listed below in alphabetical order and
examples of constitutional and neoplastic structural rearrangement are given. The short
system (karyotype format) is provided first, and when appropriate, an alternative
detailed system (karyotype format) description is also provided.

5.5.1 Additional Material of Unknown Origin

a. The abbreviation add is used to indicate additional material of unknown origin that
replaces the terminal segment of the chromosome. The abbreviation is recommended
where the mechanism and origin of the segment cannot be ascertained.
b. Depending on the size of the additional material of unknown origin, it may result in no
change, or an increase or a decrease in the length of the chromosome. Designations
such as 1p+ or 1p– may be used in the text to describe such abnormal chromosomes
but is not used in the ISCN description (see Section 5.1).
i. 46,XX,add(19)(p13.3)
or
46,XX,add(19)(?::p13.3→qter)Karyotype shows additional material attached to band
19p13.3 and replacing 19pter to 19p13.3, but neither the origin of the extra segment
nor the type of rearrangement is known.
ii. 46,XY,add(12)(q13)
or
46,XY,add(12)(pter→q13::?)Karyotype shows additional material of unknown origin
replacing the segment 12q13 to 12qter
c. When additional material of unknown origin is attached to both arms of a chromosome
and/or replaces more than one segment in a chromosome, the abbreviation der is used
(see Section 5.5.3).
i. 46,XX,der(5)add(5)(p15.3)add(5)(q23)
or
46,XX,der(5)(?::p15.3→q23::?)Karyotype shows additional material of unknown
origin attached at band 5p15.3 in the short arm and replacing the segment 5p15.3 to
5pter. There is also additional material at band 5q23 that replaces the segment 5q23 to
5qter in the long arm.
d. The abbreviation, add, applies only to the terminal addition of unknown material and
its use is not appropriate for insertions. The abbreviation ins is used to describe
unknown material inserted into a chromosome arm and the question mark (?) is used
to describe the unknown segment (see Section 5.5.9).
i. 46,XX,der(5)ins(5;?)(q13;?)
or
46,XX,der(5)(pter→q13::?::q13→qter)Karyotype shows insertion of material of
58
 unknown origin into the long arm of chromosome 5 at band 5q13. For this
example der is used as the abbreviation add would imply that the unknown material
has replaced 5q13 to 5qter

5.5.2 Deletions

a. The abbreviation del is used to denote both terminal and interstitial deletions. A
deletion is a loss of a chromosome segment, the extent of which is apparent from the
description of the breakpoints. Note: designations such as 5q– or del(5q), that may be
useful abbreviations in the text, must not be used in the ISCN description (see
Section 5.1).
b. With an interstitial deletion where the two breaks occur within the same arm, the
breakpoints are specified from pter to qter. Terminal deletions are reported using a
single breakpoint.
i. 46,XX,del(5)(q13)
or
46,XX,del(5)(pter→q13:)Karyotype shows a terminal deletion with a break (:) in band
5q13. The remaining chromosome consists of the entire short arm of chromosome 5 and
the part of the long arm between the centromere and band 5q13. Note: the number of
metaphases must be given if this is a neoplastic sample.
ii. 46,XX,del(4)(p15.2)
or
46,XX,del(4)(:p15.2→qter)Karyotype shows a terminal deletion with a break (:) in
band 4p15.2. The remaining chromosome consists of the part of the short arm of
chromosome 4 between band 4p15.2 to the centromere, and then to the end of the entire
long arm.
iii. 46,XX,del(5)(q13q33)[20]
or
46,XX,del(5)(pter→q13::q33→qter)[20]Karyotype of a neoplastic sample with an
interstitial deletion of chromosome 5 involving the segment 5q13 to 5q33. The detailed
system (karyotype format) shows breakage and reunion (::) of 5q13 and 5q33.
iv. 46,XX,del(5)(q13q13)
or
46,XX,del(5)(pter→q13::q13→qter)Karyotype shows an interstitial deletion of a small
segment within band 5q13, i.e., both breakpoints are in band 5q13.
v. 46,XY,del(5)(q?)[20]Karyotype shows deletion of the long arm of chromosome 5 in a
neoplastic sample, but it is unclear whether it is a terminal or an interstitial deletion, and
the breakpoints are unknown.
vi. 46,Y,del(X)(p21p11.4)Karyotype shows interstitial deletion of the segment between
bands Xp21 and Xp11.4.
vii. 46,XY,del(20)(q11.2–13.1q13.3)Karyotype at 300 band resolution shows an interstitial
deletion with the proximal breakpoint in band 20q11.2–13.1 and distal breakpoint at
20q13.3. Note: metaphase numbers are given if this is a neoplastic sample.

59
 c. Multiple deletions of the same chromosome are expressed using the
abbreviation der (see Section 5.5.3).

5.5.3 Derivative Chromosomes

a. A derivative chromosome (der) is a structurally rearranged chromosome generated

either by a rearrangement involving two or more chromosomes or by multiple
aberrations within a single chromosome. The abbreviation always refers to
chromosome(s) with the intact centromere.
b. A derivative chromosome generated by more than one rearrangement within a
chromosome is specified in parentheses (()), followed by the ISCN description of the
abnormality. The rearrangements are given according to the breakpoints of the
derivative chromosome from pter to qter.
c. The detailed system (karyotype format) is more informative in the following examples.
i. 46,XY,der(9)del(9)(p12)del(9)(q31)
or
46,XY,der(9)(:p12→q31:)Karyotype shows a derivative chromosome 9 resulting from
terminal deletions in both the short and long arms with breakpoints in bands 9p12 and
9q31.
ii. 46,XY,der(9)inv(9)(p23p13)del(9)(q22q33)
or
46,XY,der(9)(pter→p23::p13→p23::p13→q22::q33→qter)Karyotype shows a
derivative chromosome 9 resulting from an inversion in the short arm with breakpoints
in 9p23 and 9p13, and an interstitial deletion of the long arm with breakpoints in 9q22
and 9q33.
d. A derivative chromosome resulting from one rearrangement involving two or more
chromosomes is specified in parentheses (()), followed by the description of the
abnormality.
i. 46,Y,der(X)t(X;8)(p22.3;q24.1)
or
46,Y,der(X)(8qter→8q24.1::Xp22.3→Xqter)A male karyotype with a derivative X
chromosome from a translocation between Xp22.3 and 8q24.1. Note: the normal sex
chromosome, in this example the Y chromosome, is listed first.
ii. 46,XX,der(1)t(1;3)(p22;q13.1)
or
46,XX,der(1)(3qter→3q13.1::1p22→1qter)Karyotype shows a derivative chromosome
1 from a translocation of the chromosome 3 segment 3q13.1 to 3qter to the short arm of
chromosome 1 at band 1p22. This results in an unbalanced karyotype with loss of the
segment 1pter to 1p22 and gain of 3q13.1 to 3qter. The der(1) replaces a normal
chromosome 1 and there is no need to indicate the missing chromosome (see Section
5.4.1). There are two normal chromosomes 3.

60
iii. 45,XY,der(1)t(1;3)(p22;q13.1),–3The derivative chromosome 1 (same as above)
replaces a normal chromosome 1, but there is only one normal chromosome 3, hence –
3 is given in the ISCN description. The der(3) resulting from the t(1;3) is presumed to
be lost, but this assumption is not stated in the karyotype.
iv. 47,XY,+der(4)t(4;11)(q21;q23),t(4;11)[10]Karyotype of a neoplastic sample shows a
balanced translocation between the long arms of chromosomes 4 and 11. There is an
additional copy of the derivative chromosome 4 from this translocation. The additional
derivative chromosome 4 is listed before the translocation following the chromosome
order rule (see Section 4.3). Note: the breakpoints do not need to be repeated because
the chromosome abnormalities are generated by the same rearrangement (see Sections
4.2.1, 5.1 and 5.6).
v. 46,XY,der(3)ins(16;3)(p12;p21p13)dmatKaryotype shows a derivative 3 from a
balanced maternal insertion of bands 3p21p13 into chromosome 16 at band 16p12.
There is one normal chromosome 3. The net imbalance in the proband is a loss of region
3p21p13. Note: correlation and interpretation of the clinical history must be made and
the ISCN description written in accordance with known parental rearrangements.
Therefore, 46,XY,del(3)(p21p13)dmat should not be used.
e. The term Philadelphia chromosome is a historical description of the derivative
chromosome 22 generated by the translocation t(9;22)(q34;q11.2). The
abbreviation Ph (formerly Ph1) may be used in text, but not in the ISCN description,
where der(22)t(9;22)(q34;q11.2) must be given. Similarly, the derivative chromosome
9 resulting from the t(9;22) is designated der(9)t(9;22)(q34;q11.2).
f. A derivative chromosome generated by more than one
rearrangement involving two or more chromosomes is specified in parentheses (()),
followed by all aberrations involved in the generation of the derivative chromosome.
The aberrations are listed from pter to qter of the derivative chromosome according to
the rules governing the order of chromosome anomalies (see Section 4.3) and are not
separated by commas (,).
i. 46,XX,der(1)t(1;3)(p32;q21)t(1;11)(q25;q13)
or
46,XX,der(1)(3qter→3q21::1p32→1q25::11q13→11qter)Karyotype shows a
derivative chromosome 1 generated by two unbalanced translocations. One unbalanced
translocation between chromosome 1 at 1p32 and chromosome 3 at 3q21, and a second
unbalanced translocation between the same chromosome 1 at 1q25 and chromosome 11
at 11q13.
ii. 46,XY,der(1)t(1;3)(p32;q21)t(3;7)(q28;q11.2)
or
46,XY,der(1)(7qter→7q11.2::3q28→3q21::1p32→1qter)Karyotype shows a derivative
chromosome 1 resulting from an unbalanced translocation between chromosome 1 at
1p32 and chromosome 3 at 3q21, and an unbalanced translocation between chromosome
3 at 3q28 and chromosome 7 at 7q11.2. The detailed system (karyotype format)
describes the derivative chromosome 1 from 7qter to 1qter as the aberrations are listed
from pter to qter, according to the orientation of the segment that contains the
centromere (see Sections 4.3 and [Link]).
iii. 46,XY,der(1)t(1;3)(p32;q21)dup(1)(q25q42)
or

61
 46,XY,der(1)(3qter→3q21::1p32→1q42::1q25→1qter)Karyotype shows a derivative
chromosome 1 resulting from an unbalanced translocation between chromosome 1 at
1p32 and chromosome 3 at 3q21; there is also duplication of the chromosome 1 long
arm segment from 1q25 to 1q42.
iv. 46,XY,der(9)del(9)(p12)t(9;13)(q34;q11)
or
46,XY,der(9)(:9p12→9q34::13q11→13qter)Karyotype shows a derivative
chromosome 9 generated by a terminal short arm deletion with the breakpoint at 9p12,
and by an unbalanced translocation with chromosome 13 at 13q11 and the long arm of
the same chromosome 9 at 9q34.
v. 46,XX,der(1)t(1;11)(p32;q13)t(1;3)(q25;q21)
or
46,XX,der(1)(11qter→11q13::1p32→1q25::3q21→3qter)Karyotype shows a
derivative chromosome 1 generated by two unbalanced translocations. One unbalanced
translocation between chromosome 1 at 1p32 and chromosome 11 at 11q13, and a
second unbalanced translocation between the same chromosome 1 at 1q25 and
chromosome 3 at 3q21. Note: the detailed system (karyotype format) describes the
derivative chromosome 1 from 11qter to 3qter as the aberrations are listed according to
the orientation of the segment that contains the centromere,
from pter to qter (see Sections 4.3 and [Link]).
vi. 47,XY,+der(8)r(8;17;1)(p23q13;q12q25;p36.3p32)
or
47,XY,+der(8)(::8p23→8q13::17q12→17q25::1p36.3→1p32::)Karyotype shows a
supernumerary ring chromosome determined to be a derivative chromosome 8 as it has
the chromosome 8 centromere. The ring is generated by breakage and joining of the
chromosome 1 segment from 1p36.3 to 1p32 to the chromosome 8 segment from 8p23
to 8q13 that is then joined to the chromosome 17 segment from 17q12 to 17q25. For
additional examples of ring chromosomes, see Section 5.5.16. Note: for ring
chromosomes, the chromosome that provides the centromere is listed first (see Section
[Link]).
vii. 46,XX,der(1)del(1)(p34p22)ins(1;17)(p34;q25q11.2)
or
46,XX,der(1)(1pter→1p34::17q25→17q11.2::1p22→1qter)Karyotype shows a
derivative chromosome 1 resulting from insertion of chromosome 17 from 17q25 to
17q11.2 between chromosome 1 bands 1p34 and 1p22. There is a deletion of 1p34 to
1p22. In such situations, when there are two breakpoints in the recipient chromosome,
the breakpoint closest to pter is listed as the point of insertion. The orientation of the
inserted segment relative to pter and qter of the derivative chromosome is reversed in
its new position.
viii. 46,XY,der(7)ins(7;?)(q22;?)t(2;7)(q21;q22)
or
46,XY,der(7)(7pter→7q22::?::2q21→2qter)Karyotype shows a derivative chromosome
7 in which material of unknown origin has replaced the segment 7q22 to 7qter, and the
segment 2q21 to 2qter from the long arm of chromosome 2 is attached to unidentified
chromosomal material. The breakpoint in the derivative chromosome is specified as the
point of insertion of the unknown material. Note: as the breakpoint on the chromosome

62
 7 is the same, 7q22, for the insertion and the translocation, the abnormalities are given
in alphabetical order, i.e., ins before t (see Section 5.1).
ix. 47,XX,t(6;9;22)(p21;q34;q11.2),+der(22)t(6;9;22)[15]Karyotype of a neoplastic
sample shows a three-way translocation between chromosomes 6, 9, and 22 with an
additional derivative chromosome 22 from this three-way translocation (see Section
4.2.1). The derivative chromosome refers to the rearrangement from which it is derived,
in this example it is t(6;9;22). Note: the derivative 22 is not described as a
der(22)t(9;22) as this would imply there is a second different translocation.
x. 46,XX,der(8)t(8;17)(p23;q21)inv(8)(p22q13)t(8;22)(q22;q12)
or
46,XX,der(8)(17qter→17q21::8p23→8p22::8q13→8p22::8q13→8q22::22q12→22qte
r)A female karyotype with a derivative chromosome 8 resulting from two translocations
and a pericentric inversion. One translocation involves the short arm of chromosome 8
with a breakpoint at 8p23 and the long arm of chromosome 17 at 17q21. The other
translocation involves the long arm of chromosome 8 with a breakpoint at 8q22 and the
long arm of chromosome 22 at 22q12. The pericentric inversion has breakpoints at 8p22
and 8q13. As the derivative 8 has no 8p telomere to follow the pter to qter description
rule, the pter region of the derivative chromosome replacing the normal 8p is described
first. In this example, the normal 8pter region is replaced by the 17qter region due to the
t(8;17) translocation.
xi. 46,XY,der(5)t(5;11)(p10;p10)t(5;8)(q31;q23),der(8)t(5;8),der(11)t(5;11)
or
46,XY,der(5)(11pter→11p10::5p10→5q31::8q23→8qter),der(8)(8pter→8q23::5q31
→5qter),der(11)(5pter→5p10::11p10→11qter)Karyotype with two different balanced
translocations involving the same chromosome 5 homologue: a whole-arm translocation
between the short arms of chromosomes 5 and 11 and one translocation between the
long arms of the same chromosome 5 and chromosome 8. Note: the abnormal
chromosome 5 is involved in two rearrangements, therefore it is designated as a
derivative chromosome. The other derivative chromosomes (der(8) and der(11)) are also
included in the ISCN description as the rearrangement is balanced.
g. An isoderivative chromosome, abbreviated to ider, designates an isochromosome
formation for one of the arms of a derivative chromosome. The breakpoints are assigned
to the centromeric bands p10 and q10 according to the morphology of the isoderivative
chromosome (see Section 5.5.11).
i. 46,XX,ider(22)(q10)t(9;22)(q34;q11.2)[20]
or
46,XX,ider(22)(9qter→9q34::22q11.2→22q10::22q10→22q11.2::9q34→9qter)[20]K
aryotype of a neoplastic sample shows an isochromosome for the long arm of the
derivative chromosome 22 from a t(9;22).
ii. 46,XY,ider(9)(p10)ins(9;12)(p13;q22q13)[12]
or
46,XY,ider(9)(9pter→9p13::12q22→12q13::9p13→9p10::9p10→9p13::12q13→
12q22::9p13→9pter)[12]Karyotype of a neoplastic sample shows an isochromosome
for the short arm of a derivative chromosome 9 resulting from an insertion of the
segment 12q13 to 12q22 at band 9p13. Band 12q22 is closer than band 12q13 to 9pter

63
 h. When a derivative chromosome is dicentric and contains one or more additional
abnormalities, the two centromere containing chromosomes are given
within parentheses (()), separated by a semicolon (;), followed by the specification of
the aberrations.
i. 45,XX,der(5;7)t(5;7)(q22;p13)t(3;7)(q21;q21)
or
45,XX,der(5;7)(5pter→5q22::7p13→7q21::3q21→3qter)Karyotype shows a dicentric
derivative chromosome with centromeres from chromosomes 5 and 7. Breakage and
reunion occurs at band 5q22 in the long arm of chromosome 5 and at band 7p13 in the
short arm of chromosome 7. In addition, the segment 3q21 to 3qter is translocated onto
the long arm of chromosome 7 at band 7q21. Note: in the detailed system (karyotype
format) the terminal end of a chromosome arm may be designated using the
abbreviation ter preceded by the arm designation, i.e., 3qter instead of 3q29 in this
example (see also example ii below).
ii. 45,XY,der(5;7)t(3;5)(q21;q22)t(3;7)(q29;p13)
or
45,XY,der(5;7)(5pter→5q22::3q21→3q29::7p13→7qter)Karyotype shows a dicentric
derivative chromosome with centromeres of chromosomes 5 and 7. An acentric
chromosome 3 segment (3q21→3q29) is inserted between the long arm of chromosome
5 and the short arm of chromosome 7. Note: when the terminal band of a chromosome
is involved in a breakpoint and the end of that chromosome is not the end of the
derivative chromosome, then the band designation should be used, e.g., 3q29 in this
example.
iii. 45,XY,der(5;7)t(3;5)(q21;q22)t(3;7)(q29;p13)del(7)(q32)
or
45,XY,der(5;7)(5pter→5q22::3q21→3q29::7p13→7q32:)The same dicentric
derivative chromosome as in the previous example but with an additional terminal
deletion of the long arm of chromosome 7 at band 7q32.
iv. 45,XX,der(8;8)(q10;q10)del(8)(q22)t(8;9)(q24.1;q12)
or
45,XX,der(8;8)(:8q22→8q10::8q10→8q24.1::9q12→9qter)Karyotype with a
derivative chromosome composed of the long arms of chromosome 8 with material from
chromosome 9 translocated to one arm of chromosome 8 at 8q24.1. There is a deletion
at 8q22 to 8qter in the other long arm. There are two normal chromosomes 9.
i. When the centromere of the derivative chromosome is not known, but more distal parts
of the chromosome can be recognized, the abnormal chromosome may be
designated der(?) (see Section 4.2.1). Where the chromosome containing the
centromere is known then that chromosome is described first (see example iv).
i. 47,XY,+der(?)t(?;9)(?;q22)
or
47,XY,+der(?)(?→cen→?::9q22→9qter)Karyotype shows translocation of 9q22 to
9qter onto a derivative chromosome of unknown origin that has the centromere.
ii. 47,XX,+der(?)t(?;9)(?;p13)ins(?;7)(?;q11.2q32)[20]
or
47,XX,+der(?)(9pter→9p13::?→cen→?::7q11.2→7q32::?)[20]Karyotype of a
neoplastic sample shows a derivative chromosome of unknown origin. The segment of

64
 chromosome 9 distal to band 9p13 translocated onto a centric segment of unknown
origin, and 7q11.2 to 7q32 is translocated onto the other end of this centric segment.
There is also additional material of unknown origin joined to 7q32 on the derivative
chromosome.
iii. 47,XX,+der(?)t(?;9)(?;p13)hsr(?)[20]
or
47,XX,+der(?)(9pter→9p13::?→cen→?::hsr→?)[20]Karyotype of a neoplastic sample
shows a derivative chromosome of unknown origin. The segment of chromosome 9
distal to band 9p13 translocated onto a centric segment of unknown origin and
a homogeneously staining region (hsr) is present on the other end of the centric
segment.
iv. 47,XY,+der(8)ins(8;?)(p22;?)t(8;9)(q24;q22)[10]
or
47,XY,+der(8)(8pter→8p22::?::8p22→8q24::9q22→9qter)[10]Karyotype in a
neoplastic sample shows a derivative chromosome 8 with an insertion of unknown
material in 8p22 and an unbalanced translocation between chromosome 8 at 8q24 and
chromosome 9 at 9q22. The chromosome 8 segment (8p22 to 8q24) has the centromere.
j. Derivative chromosomes whose centromeres are unknown should be placed after all
identified abnormalities but before unidentified ring chromosomes (r), marker
chromosomes (mar) and double minutes (dmin) (see Section
4.3), e.g., 50,XX,+X,+der(?)t(?;9)(?;q22),+r,+mar,>20dmin[20]
k. There is usually no need to indicate which homologue is involved in a derivative
chromosome because this will be apparent from the karyotype description. If both
homologues are involved, this will result in two derivative homologous chromosomes.
l. When homologous chromosomes cannot be distinguished within the ISCN description,
one of the numerals may be underlined (_). This may be helpful when the two
homologous chromosomes are involved in identical aberrations resulting in two
identical derivative chromosomes (see Section 4.4.2).
i. 46,XX,der(9)del(9)(p12)t(9;22)(q34;q11.2),der(9)t(9;12)(p13;q22)inv(9)(q13q22)[20]
or
46,XX,der(9)del(9)(p12)t(9;22)(q34;q11.2),der(9)t(9;12)(p13;q22)inv(9)(q13q22)[20]
Karyotype of a neoplastic sample shows two derivative chromosomes 9. One der(9) has
a terminal deletion of the short arm and a translocation with chromosome 22 involving
9q34 and 22q11.2. The other der(9) has a translocation between 9p13 and 12q22, and a
paracentric inversion in the long arm of chromosome 9. There are two normal
chromosomes 12, two normal chromosomes 22, but no normal chromosome 9.
ii. 46,XX,der(1)t(1;3)(p34.3;q21),der(1)t(1;3)(p34.3;q21)[15]Karyotype of a neoplastic
sample shows two homologous chromosomes 1, as identified by C-band polymorphism,
are involved in apparently identical translocations.
iii. 46,XX,der(1)t(1;3)(p34.3;q21)[20]/46,XX,der(1)t(1;3)(p34.3;q21)[10]Karyotype of a
neoplastic sample shows the two chromosome 1 homologues involved in apparently
identical translocations in different metaphases. The two abnormalities represent two
different cell lines; the homologous chromosomes 1 in each cell line are normal. The
two homologous chromosomes 1 are identified as being different by C-banding.
iv. 46,XX,der(1)t(1;1)(p31;q32)In this unbalanced translocation between both
chromosome 1 homologues, underlining can be used to distinguish between the two

65
 different derivatives. The detailed system (karyotype format) is recommended for a
clearer description of the rearrangement (see examples iv and v below that clarify the
two different derivatives from the balanced translocation where the homologue without
the centromere is underlined).
v. 46,XX,der(1)t(1;1)(p31;q32)
or
46,XX,der(1)(1pter→1q32::1p31→1pter)Same translocation as above in which the
underlined homologue has a break at 1q32. In this example the der(1) is not underlined.
The underlined homologue does not have the centromeric segment, i.e., has the
breakpoint at 1p31. Note: the chromosome number is given in the detailed system
(karyotype format) to show that both homologues are involved.
vi. 46,XX,der(1)t(1;1)(p31;q32)
or
46,XX,der(1)(1qter→1q32::1p31→1qter)The derivative chromosome 1 is not
underlined in this example and represents the homologue with a breakpoint in 1p31. The
underlined homologue does not have the centromeric segment, i.e., has the breakpoint
at 1q32. Note: the chromosome number is given in the detailed system (karyotype
format) to show that both homologues are involved.
m. Complex rearrangements may give rise to several derivative chromosomes. The
breakpoints in the derivative chromosomes generated by the same rearrangement need
not be repeated in the description of each individual derivative chromosome.
i. 47,XX,t(9;22)(q34;q11.2),+der(22)t(9;22)[10]Karyotype of a neoplastic sample shows
t(9;22) and an additional Ph chromosome. The breakpoints in the extra der(22) do not
need to be repeated.
ii. 46,XX,der(1)t(1;3)(p32;q21)inv(1)(p22q21)t(1;11)(q25;q13),der(3)t(1;3),der(11)t(1;11
)Karyotype shows a balanced complex rearrangement with three derivative
chromosomes. The breakpoints of the t(1;3) and the t(1;11), that both contribute to the
der(1), are not repeated in the description of der(3) and der(11).
iii. 47,XY,der(9)t(9;22)(q34;q11.2),+22,ider(22)(q10)t(9;22)[20]
or
47,XY,der(9)(9pter→9q34::22q11.2→22qter),+22,ider(22)(9qter→9q34::22q11.2→2
2q10::22q10→22q11.2::9q34→9qter)[20]Karyotype of a neoplastic sample shows a
derivative chromosome 9 and an isochromosome for the long arm of the derivative
chromosome 22 derived from a t(9;22). There are also two normal copies of
chromosome 22, hence the +22 in the ISCN description. Note: the breakpoints in the
short system (karyotype format) do not need to be repeated for the derivative
chromosome 22 as they were given in the description of the t(9;22) (see Section 4.2.1).
n. Complex karyotypes involving rearrangements between two or more derivative
chromosomes, or where derivative chromosomes are involved in new rearrangements
the detailed system (karyotype format) is preferred. It is acceptable to combine the short
system (karyotype format) (see Section [Link]) and the detailed system (karyotype
format) (see Section [Link]) for designating complex karyotypes.

66
5.5.4 Dicentric Chromosomes

a. The dicentric (dic) chromosome replaces two normal chromosomes. A dicentric

chromosome is counted as one chromosome, with the chromosome count becoming 45.
There is no need to indicate the missing chromosome(s) (cf., whole-arm and
Robertsonian translocations, Sections [Link] and [Link] respectively). Two
breakpoints are specified, and the centromeres are presumed to be derived from the two
chromosomes involved.
b. Isodicentric chromosomes (idic), involve a single breakpoint on sister chromatids and
a subsequent reunion, and the chromosome count is unchanged as the idic chromosome
replaces one of the normal homologues.
c. In rearrangements involving different chromosomes, the chromosomes are listed in
chromosome order, i.e., the sex chromosomes (X before Y) followed by the autosomes
in numerical order.
d. For isodicentrics that derive from a single chromosome, there is no need to repeat the
chromosome number in the detailed system (karyotype format) (see Sections
4.4.4 and [Link]).
e. Where a dicentric or tricentric derivative chromosome has no short arm segment, the
description starts at the end of the lowest chromosome number.
f. The term der may be used instead of dic, but the combination of der dic should never
be used.
i. 45,XX,dic(13;13)(q14;q32)
or
45,XX,dic(13;13)(13pter→13q14::13q32→13pter)Karyotype shows breakage and
reunion at bands 13q14 and 13q32 on the two homologous chromosomes 13 to form a
dicentric chromosome. There is no normal chromosome 13. Note: the pter to qter rule
applies and the chromosome number is given before pter and the breakpoint in the
ISCN description as different chromosome 13 homologues are involved.
ii. 45,XX,dic(13;15)(q22;q24)
or
45,XX,dic(13;15)(13pter→13q22::15q24→15pter)Karyotype shows a dicentric
chromosome with breakage and reunion at bands 13q22 and 15q24. The missing
chromosomes 13 and 15 are not indicated since they are replaced by the dicentric
chromosome. The karyotype contains one normal chromosome 13, one normal
chromosome 15, and the dic(13;15). The resulting net imbalance of this abnormality is
loss of the segments distal to 13q22 and 15q24.
iii. 46,XX,+13,dic(13;15)(q22;q24)Karyotype shows a dicentric chromosome with
breakage and reunion at bands 13q22 and 15q24 (same as above example) that replaces
one chromosome 13 and one chromosome 15. There are two normal chromosomes 13,
one normal chromosome 15 and the dic(13;15). The resulting net imbalance is partial
trisomy for the segment 13pter to 13q22 and loss of the segment 15q24 to 15qter.
iv. 45,XY,dic(14;21)(p11.2;p11.2)
or
45,XY,dic(14;21)(14qter→14p11.2::21p11.2→21qter)Karyotype shows a dicentric
chromosome with breakage and reunion at bands 14p11.2 and 21p11.2. The missing
chromosomes 14 and 21 are not indicated since they are replaced by the dicentric

67
 chromosome. The karyotype contains one normal chromosome 14, one normal
chromosome 21, and the dic(14;21). The resulting net imbalance of this abnormality is
loss of the segments distal to 14p11.2 and 21p11.2. For description of Robertsonian
translocations, see Section [Link].
v. 47,XY,+dic(17;?)(q22;?)
or
47,XY,+dic(17;?)(17pter→17q22::?)Karyotype shows a supernumerary dicentric
chromosome composed of one chromosome 17 with a break at band 17q22 and an
unknown chromosome with an intact centromere.
vi. 46,X,idic(Y)(q12)
or
46,X,idic(Y)(pter→q12::q12→pter)Karyotype shows breakage and reunion at band
Yq12 on sister chromatids to form an isodicentric Y chromosome. The resulting net
imbalance is loss of the segment Yq12 to Yqter and gain of Ypter to Yq12.
vii. 46,XX,idic(21)(q22.3)
or
46,XX,idic(21)(pter→q22.3::q22.3→pter)Karyotype shows breakage and reunion at
band 21q22.3 on sister chromatids to form an isodicentric chromosome 21, and one
normal chromosome 21, indicated by the 46 count. Even though there are effectively
three copies of the chromosome 21 long arm, the normal chromosome 21 is not
designated with a plus (+) sign.
viii. 47,XX,+idic(13)(q22)
or
47,XX,+idic(13)(pter→q22::q22→pter)Karyotype shows a supernumerary isodicentric
chromosome 13. There are two chromosomes 13 plus the idic(13).
ix. 47,XY,+dic(15;15)(q12;q12)
or
47,XY,+dic(15;15)(15pter→15q12::15q12→15pter)Karyotype shows a supernumerary
apparently dicentric chromosome 15. There are two chromosomes 15 and a dicentric
chromosome 15. This rearrangement has historically been referred to as inv
dup(15)(q12) and usually results from recombination between homologues, hence
dic(15;15)(q12;q12)(or psu dic, see below) is a more appropriate designation. Where a
mechanism based on the fusion between two sister chromatids is proven, the
abbreviation idic may be used: 47,XY,+idic(15)(q12) or
47,XY,+idic(15)(pter→q12::q12→pter). Note: the chromosome number is given
before pter and the breakpoint in the ISCN description as different chromosome 15
homologues are involved.
g. Complex dicentric chromosomes must be described as derivative chromosomes,
see Section 5.5.3.
h. A pseudodicentric chromosome is a dicentric structure in which only one centromere
is active. Such chromosomes use the abbreviation psu
dic (similarly, pseudotricentric, psu trc, etc.), and the segment with the presumptively
active centromere, based on the morphology in the majority of metaphases, is always
written first. If the active centromere cannot be determined, the lowest chromosome
number is written first.

68
 i. 45,XX,psu dic(15;13)(q12;q12)
or
45,XX,psu dic(15;13)(15pter→15q12::13q12→13pter)Karyotype shows one
chromosome 13 and one chromosome 15 are replaced with a pseudodicentric
chromosome. The karyotype contains one normal chromosome 13, one normal
chromosome 15, and the psu dic(15;13). The centromere of the chromosome stated
first, i.e., chromosome 15, is the active one. Note: if the active centromere is not
known the ISCN description would be 45,XX,psu dic(13;15)(q12;q12)
ii. 46,XX,psu idic(20)(q11.2)
or
46,XX,psu idic(20)(pter→q11.2::q11.2→pter)Karyotype shows one chromosome 20 is
replaced with a pseudoisodicentric chromosome, resulting in three copies of 20pter to
20q11.2. The psu idic(20) has one active centromere.

5.5.5 Duplications

a. Duplications (dup) are a gain of a chromosome segment at the original chromosome

location, i.e., in tandem. When a gain of a chromosome segment is found elsewhere in
the genome, der or ins is used depending on the type of rearrangement. The
orientation of the duplicated segment is indicated by the order of the bands
from pter to qter. Note: no arrow is used in the short system (karyotype format) to
indicate the orientation.
i. 46,XX,dup(1)(p34p31)
or
46,XX,dup(1)(pter→p31::p34→qter)Karyotype shows duplication of the segment
between bands 1p34 and 1p31 with no change in orientation.
ii. 46,XX,dup(1)(p31p34)
or
46,XX,dup(1)(pter→p31::p31→p34::p31→qter) or
dup(1)(pter→p34::p31→p34::p34→qter)Karyotype shows duplication of the segment
between bands 1p34 and 1p31 with reverse orientation of the duplicated
segment. Note: only the detailed (karyotype format) will clarify the location of the
duplicated segment.
iii. 46,XX,dup(1)(q22q25)
or
46,XX,dup(1)(pter→q25::q22→qter)Karyotype shows duplication of the segment
between bands 1q22 and 1q25 with no change in orientation.
iv. 46,XY,dup(1)(q25q22)
or
46,XY,dup(1)(pter→q25::q25→q22::q25→qter) or
dup(1)(pter→q22::q25→q22::q22→qter)Karyotype shows duplication of the segment
between bands 1q22 and 1q25 with reverse orientation of the duplicated
segment. Note: only the detailed system (karyotype format) will clarify the location of
the duplicated segment.

69
5.5.6 Fission

a. The abbreviation fis is used to denote centric fission.

i. 47,XY,–10,+fis(10)(p10),+fis(10)(q10)
or
47,XY,–10,+fis(10)(pter→p10:),+fis(10)(:q10→qter)Karyotype shows a break in the
centromere of chromosome 10 resulting in two derivative chromosomes composed of
the short and long arms, respectively. The breakpoints (:) are assigned to 10p10 and
10q10 according to the morphology of the derivative chromosomes.

5.5.7 Fragile Sites

a. Fragile sites (fra) may occur as normal variants (see Section 2.6.2), however for those
associated with specific diseases and/or phenotypic abnormalities, the following
nomenclature is used.
i. 46,X,fra(X)(q27.3)Karyotype shows a fragile site in subband Xq27.3 on one X
chromosome in a female.
ii. 46,Y,fra(X)(q27.3)Karyotype shows a fragile site in subband Xq27.3 on the X
chromosome in a male.
iii. 45,fra(X)(q27.3)Karyotype shows a fragile site in subband Xq27.3 on the X
chromosome in an individual with Turner syndrome.
iv. 47,XY,fra(X)(q27.3)Karyotype shows a fragile site in subband Xq27.3 on one X
chromosome in an individual with Klinefelter syndrome.
v. 46,XX,fra(11)(q23)Karyotype shows a fragile site in band 11q23 on one chromosome 11.

5.5.8 Homogeneously Staining Regions

a. The abbreviation hsr is used to describe the presence, but not the size, of
a homogeneously staining region in a chromosome arm, segment, or band.
b. hsr are frequently associated with gene amplification in a variety of neoplasms and
therefore the numbers of metaphases are given in the ISCN description.
i. 46,XX,hsr(1)(p22)[10]
or
46,XX,hsr(1)(pter→p22::hsr::p22→qter)[10]Karyotype shows a homogeneously
staining region in band 1p22 in a neoplastic sample.
ii. 46,XY,hsr(21)(q22)[10]
or
46,XY,hsr(21)(pter→q22::hsr::q22→qter)[10]Karyotype shows a homogeneously
staining region in band 21q22 in a neoplastic sample.
c. When a chromosome contains multiple hsr(s) or one hsr and another structural change,
it is by definition a derivative chromosome and should be designated accordingly
(see Section 5.5.3).

70
 i.46,XX,der(1)hsr(1)(p22)hsr(1)(q31)[10]
or
46,XX,der(1)(pter→p22::hsr::p22→q31::hsr::q31→qter)[10]Karyotype shows two
homogeneously staining regions in chromosome 1: one in band 1p22 in the short arm
and the other in band 1q31 in the long arm in a neoplastic sample.
d. When an hsr is associated with a deletion, the breakpoint is assigned to the band closest
to the telomere of the short arm.
i. 46,XY,der(1)del(1)(p33p21)hsr(1)(p33)[10]
or
46,XY,der(1)(pter→p33::hsr::p21→qter)[10]Karyotype of a neoplastic sample where
the segment between bands 1p33 and 1p21 is replaced by a homogeneously staining
region that may be smaller or larger than the deleted segment.
ii. 46,XX,der(2)del(2)(q21q31)hsr(2)(q21)[10]
or
46,XX,der(2)(pter→q21::hsr::q31→qter)[10]Karyotype of a neoplastic sample where
the segment between bands 2q21 and 2q31 is replaced by a homogeneously staining
region.
e. When a homogeneously staining region is located at the interface between segments of
different chromosomes involved in a rearrangement, the hsr is assigned to the
breakpoints in both chromosomes according to the ISCN description for structural
chromosome aberrations, i.e., the two chromosomes involved are presented in the first
parentheses and the breakpoints in the second.
i. 46,XX,der(1)ins(1;7)(q21;p21p11.2)hsr(1;7)(q21;p11.2)[10]
or
46,XX,der(1)(1pter→1q21::7p21→7p11.2::hsr::1q21→1qter)[10]Karyotype of a
neoplastic sample shows an insertion of the segment 7p21 to 7p11.2 in original
orientation into the long arm of chromosome 1 at band 1q21. The derivative
chromosome also contains an hsr at the interface between the recipient and donor
chromosomes. The hsr is located distal to the segment inserted from chromosome 7.
ii. 46,XX,der(1)ins(1;7)(q21;p11.2p21)hsr(1;7)(q21;p11.2)[10]
or
46,XX,der(1)(1pter→1q21::hsr::7p11.2→7p21::1q21→1qter)[10]Karyotype of a
neoplastic sample shows an insertion of the segment 7p21p11.2 in reverse orientation
into the long arm of chromosome 1 with breakage and reunion at band 1q21. The
derivative chromosome also contains an hsr at the interface between the recipient and
donor chromosomes. The hsr is located proximal to the segment inserted from
chromosome 7.

5.5.9 Insertions

a. Insertions are three-break rearrangements in which part of one chromosome is inserted

at a point of breakage in the same, or another chromosome.
b. An insertion (ins) is described with the recipient chromosome given first, followed by
the inserted segment. The orientation of the inserted segment is indicated by the order
of the bands of the inserted segment from pter to qter of the recipient chromosome. For
clarity, the use of the detailed system (karyotype format) may be used.

71
[Link] Insertions within a Chromosome

a. When an insertion (ins) within a single chromosome occurs, the breakpoint at which
the chromosome segment is inserted is specified first. The remaining breakpoints are
specified in the same way as in a two-break rearrangement, i.e., the breakpoint of the
inserted segment that is closest to pter is listed first.
i. 46,XX,ins(2)(p13q31q21)
or
46,XX,ins(2)(pter→p13::q31→q21::p13→q21::q31→qter)Karyotype shows the long
arm segment between bands 2q21 and [Link] inserted into the short arm at band 2p13.
The original orientation of the inserted segment relative to pter and qter is reversed in
its new position, i.e., band 2q31 is now closer to 2pter than band 2q21
ii. 46,XY,ins(2)(p13q21q31)
or
46,XY,ins(2)(pter→p13::q21→q31::p13→q21::q31→qter)The insertion is the same as
in the previous example except that the orientation of the bands within the segment is
maintained relative to pter and qter, i.e., band 2q21 of the inserted segment remains
closer to 2pter than band 2q31

[Link] Insertions between Two Chromosomes

a. Interchromosomal insertions (ins) are three-break rearrangements in which part of one

chromosome is inserted at a point of breakage in the same or another chromosome.
The recipient chromosome is specified first, regardless of whether it is a sex
chromosome or an autosome with a number higher or lower than that of the donor
chromosome. The donor chromosome is listed last, even if it is a sex chromosome.
b. The remaining breakpoints are specified in the same way as in a two-break
rearrangement, i.e., the breakpoint of the inserted segment that is closest to the pter of
the recipient chromosome is listed first.
i. 46,X,ins(5;X)(p14;q21q25)
or
46,X,ins(5;X)(5pter→5p14::Xq21→Xq25::5p14→5qter;Xpter→Xq21::Xq25→Xqter)
Karyotype shows an insertion of the segment Xq21 to Xq25 into the short arm of
chromosome 5 at 5p14. It is apparent from the order of the breakpoints that the segment
is inserted in the original orientation, pter to qter (see Section 5.5.9). The recipient
chromosome is listed first.
ii. 46,XX,ins(5;2)(p14;q32q22)
or
46,XX,ins(5;2)(5pter→5p14::2q32→2q22::5p14→5qter;2pter→2q22::2q32→2qter)K
aryotype shows an insertion of the segment 2q22 to 2q32 into the short arm of
chromosome 5 at 5p14. The original orientation of the inserted segment relative
to pter and qter is reversed in its new position, i.e., 2q32 is now closer to pter of the
recipient chromosome than 2q22. Note: the recipient chromosome is specified first.
iii. 46,XY,ins(5;2)(p14;q22q32)
or
46,XY,ins(5;2)(5pter→5p14::2q22→2q32::5p14→5qter;2pter→2q22::2q32→2qter)K

72
 aryotype shows breakage and reunion at the same bands as in the previous example
except that band 2q22 remains closer than band 2q32 to the pter of the recipient
chromosome.
iv. 46,XX,ins(5;2)(q31;p13p23)
or
46,XX,ins(5;2)(5pter→5q31::2p13→2p23::5q31→5qter;2pter→2p23::2p13→2qter)K
aryotype shows an insertion of bands 2p23 to 2p13 from chromosome 2 into band 5q31
with reversal of orientation relative to the terminal short arm of the recipient
chromosome 5.
v. 46,XX,ins(5;2)(q31;p23p13)
or
46,XX,ins(5;2)(5pter→5q31::2p23→2p13::5q31→5qter;2pter→2p23::2p13→2qter)K
aryotype shows an insertion of bands 2p23 to 2p13 from chromosome 2 into band 5q31
in a conserved orientation relative to pter of the recipient chromosome 5.
vi. 46,XY,der(5)ins(5;2)(q31;p23p13)dmatKaryotype shows a derivative chromosome 5
resulting from malsegregation of a balanced maternal insertion. There is one derivative
chromosome 5 containing the insertion of material from chromosome 2, one normal
chromosome 5, and two normal chromosomes 2. Note: although inherited from the
mother who has a balanced interchromosomal insertion, the rearranged chromosome is
not the result of a meiotic crossing-over but from malsegregation of the maternal
insertion, and the abbreviation der is used instead of rec (see Section 5.5.3).
vii. 46,X,der(X)ins(X;7)(p21;q22q21)Karyotype shows a derivative X chromosome
resulting from an insertion of the segment from 7q21 to 7q22 into band Xp21, with band
7q22 closer to Xpter than band 7q21. There are two normal chromosomes 7.

[Link] Complex Insertions

a. Where more than two chromosomes are involved in a complex reciprocal insertional
event, the chromosome listed first is the chromosome that is the sex chromosome or the
autosome with the lowest number, the chromosome that is listed next receives a
segment from the first chromosome, and the chromosome specified last donates a
segment to the first listed chromosome.
i. 46,XY,ins(5;6)(q13q23;q15q23)
or
46,XY,ins(5;6)(5pter→5q13::6q15→6q23::5q23→5qter;6pter→6q15::5q13→5q23::6
q23→ 6qter)Karyotype shows a balanced four-break reciprocal insertion involving two
chromosomes. The segment between bands 5q13 and 5q23 in chromosome 5 is inserted
into chromosome 6 between 6q15 and 6q23, and the chromosome 6 segment between
bands 6q15 and 6q23 is inserted into chromosome 5 between 5q13 and 5q23.
ii. 46,XX,ins(5;14;9)(q13q23;q24q21;p12p23)
or
46,XX,ins(5;14;9)(5pter→5q13::9p12→9p23::5q23→5qter;14pter→14q21::5q13→5q
23::14q24→14qter;9pter→9p23::14q24→14q21::9p12→9qter)Karyotype shows a
balanced six-break rearrangement with insertion of three interstitial segments. The
segment between bands 5q13 and 5q23 on chromosome 5 replaces the segment between
bands 14q21 and 14q24 on chromosome 14, the segment 14q21 to 14q24 replaces the

73
 segment between bands 9p12 and 9p23 on chromosome 9, and the segment 9p12 to 9p23
replaces the segment 5q13 to 5q23. The orientations of the segments in relation to the
centromere are apparent from the order of the bands. The segment 14q21 to 14q24 is
inverted.

5.5.10 Inversions

a. The abbreviation inv is used. Whether it is a paracentric or pericentric inversion is

apparent from the band designations. In all cases, the breakpoint closer to pter of the
inverted chromosome is specified first.
b. There is no semicolon between the band designations within the same chromosome.
i. 46,XX,inv(2)(p23p13)
or
46,XX,inv(2)(pter→p23::p13→p23::p13→qter)Karyotype shows
a paracentric inversion involving the short arm of chromosome 2 in which breakage
and reunion have occurred at bands 2p23 and 2p13.
ii. 46,XX,inv(3)(q21q26.2)
or
46,XX,inv(3)(pter→q21::q26.2→q21::q26.2→qter)Karyotype shows
a paracentric inversion involving the long arm of chromosome 3 in which breakage
and reunion have occurred at bands 3q21 and 3q26.2.
iii. 46,XY,inv(3)(p13q21)
or
46,XY,inv(3)(pter→p13::q21→p13::q21→qter)Karyotype shows
a pericentric inversion in which breakage and reunion have occurred at bands 3p13 and
3q21. The breakpoint in the short arm is specified first.
iv. 46,Y,inv(X)(p21q24)
or
46,Y,inv(X)(pter→p21::q24→p21::q24→qter)Karyotype shows
a pericentric inversion in which breakage and reunion have occurred at bands Xp21
and Xq24. The normal sex chromosome is listed before the inversion of the X
chromosome. The breakpoint in the short arm is specified first.

5.5.11 Isochromosomes

a. The abbreviation i (not iso) is used for isochromosomes and idic for isodicentric
chromosomes.
b. Isochromosomes are usually formed through a centric mis-division and result in
chromosome arms that are a mirror image of each other and genetically homozygous.
See also Section 5.5.4.
c. The breakpoints in isochromosomes are assigned to the centromeric bands p10 and q10.
The isochromosome designation is inferred from the banded chromosome morphology.

74
 d. When it is not proven that both arms are homozygous the abbreviation der is used
instead. However, for classical isochromosomes that are proven to be true
isochromosomes in most cases (e.g., i(9)(p10), i(12)(p10), i(18)(p10), i(X)(q10)), the
abbreviation i may be used.
e. Complex isochromosomes, including isoderivative chromosomes, are described as
derivative chromosomes, see Section 5.5.3.
i. 46,XX,i(17)(q10)
or
46,XX,i(17)(qter→q10::q10→qter)Karyotype shows an isochromosome for the entire
long arm of one chromosome 17 and consequently the breakpoint is assigned to 17q10.
There is one normal chromosome 17. The shorter designation i(17q) may be used in text
but not in the ISCN description to describe this isochromosome.
ii. 46,X,i(X)(q10)
or
46,X,i(X)(qter→q10::q10→qter)Karyotype shows one normal X chromosome and an
isochromosome for the long arm of one X chromosome. This is unbalanced as there is
a single copy of the short arm of the X chromosome and three copies of the long arm of
the X chromosome.
iii. 47,XY,i(X)(q10)A male karyotype showing an isochromosome of the long arm of the
X chromosome in addition to normal X and Y chromosomes.
iv. 46,XX,idic(17)(p11.2)
or
46,XX,idic(17)(qter→p11.2::p11.2→qter)Karyotype shows an isodicentric
chromosome composed of the long arms of chromosome 17 and the short arm material
between the centromeres and the breakpoints in 17p11.2.
v. 46,XX,i(21)(q10)Karyotype shows an isochromosome of the long arm of chromosome
21 has replaced one chromosome 21. There are two copies of the long arm of
chromosome 21 in the isochromosome and one normal copy of chromosome 21. Even
though there are effectively three copies of the long arm of chromosome 21, the normal
chromosome 21 is not designated with a plus (+) sign. Note: if homozygosity for the
long arm of chromosome 21 is not proven, an alternative description using
der(21)(q10;q10) should be used (see Section [Link]).
vi. 45,XX,–21,i(21)(q10)Karyotype shows an isochromosome of the long arm of
chromosome 21 has replaced one chromosome 21. The other chromosome 21 is lost.
There are two copies of the long arm of chromosome 21 in the isochromosome and no
normal copies of chromosome 21.
vii. 47,XX,+i(8)(q10)[10]
or
47,XX,+8,i(8)(q10)[10]Alternative descriptions of the same chromosome complement
with an isochromosome of the long arm of chromosome 8 in addition to two normal
chromosomes 8 in a neoplastic sample.

5.5.12 Marker Chromosomes

a. A marker chromosome (mar) is a structurally abnormal chromosome that cannot be

unambiguously identified or characterized by conventional banding cytogenetics.

75
 Numerous terms are used in the literature to describe markers, including
“supernumerary marker chromosomes (SMC)”, “extra structurally abnormal
chromosomes (ESAC)”, “supernumerary ring chromosomes (SRC)”, and “accessory
chromosomes (AC)”; see Liehr et al. (2004) for a review of these abnormalities.
b. The mar is placed in the karyotype after all identified chromosomes, unknown
derivative chromosomes, rings (r) and before double minutes (dmin), see Section 4.3.
c. In the description of a karyotype, the presence of a mar must be preceded by a plus (+)
sign. No attempt should be made to describe the morphology or size of markers in
karyotypes, i.e., min mar, A-size mar, acro mar, etc., should not be used. If such
information is relevant, it is described in words in the text of the report.
d. When several different marker chromosomes are clonally present, they may be indicated
by an Arabic number after the abbreviation mar, e.g., mar1, mar2, etc. It must be
stressed that mar1, mar2 etc., does not indicate a derivation of the marker from
chromosome 1, chromosome 2, and so on. Order of numbering for marker chromosomes
(i.e., that is mar1, mar2, mar3) is a laboratory choice, usually either based on frequency
or on size.
e. Multiple copies of the same marker are indicated by a multiplication (×) sign after
the mar designation, e.g., mar1×2 indicates two identical copies of marker 1; mar1×3
indicates three copies of marker 1.
f. Multiple different marker chromosomes are indicated by the appropriate
number before the mar abbreviation, e.g., 5mar.
i. 47,XX,+marKaryotype shows one supernumerary marker chromosome.
ii. 47,XX,t(12;16)(q13;p11.2),+mar[10]Karyotype of a neoplastic sample shows a
translocation between chromosomes 12 and 16 involving 12q13 and 16p11.2, and one
supernumerary marker chromosome in ten metaphases.
iii. 48,X,t(X;18)(p11.2;q11.2),+2mar[10]Karyotype of a neoplastic sample shows a
translocation between the X chromosome and chromosome 18 involving Xp11.2 and
18q11.2, and two different marker chromosomes in ten metaphases.
iv. 47,X,t(X;18)(p11.2;q11.2),+mar1[5]/48,X,t(X;18)(p11.2;q11.2),+mar1,+mar2[12]Sam
e example as above but one marker (mar2) is not present in all the metaphases in this
neoplastic sample. Note: the least complex clone is given first (see Section [Link]).
v. 47∼51,XY,t(11;22)(q24;q12),+1∼5mar[cp10]Karyotype of a neoplastic sample shows
a translocation involving chromosomes 11 and 22 and five additional marker
chromosomes, but not all metaphases contain all the markers.
vi. 48,XX,i(17)(q10),+mar1,+mar2[17]/51,XX,i(17)(q10),+mar1×3,+mar2,+mar3[13]Kar
yotype of a neoplastic sample shows two different marker chromosomes (mar1 and
mar2) in the clone with 48 chromosomes. The clone with 51 chromosomes has three
copies of mar1, one copy of mar2, and a third marker chromosome, mar3.
g. When any part of an abnormal chromosome can be recognized, even if the origin of the
centromere is unknown, this abnormal chromosome is referred to as a der and not as
a mar (see Section 5.5.3).
i. 47,XX,+der(?)t(?;15)(?;q22)The centromere of this abnormal chromosome is unknown
and hence it is designated der(?), but part of the chromosome is composed of the
chromosome 15 segment distal to band 15q22.
h. Double minutes (dmin) represent a special kind of acentric structure that is recorded
in the karyotype when present in more than one metaphase cell. Note: the dmin must

76
 not be included in the chromosome count, and the abbreviation is not preceded by
a plus (+) sign. In the ISCN description the abbreviation dmin follows any centric
marker. The number of dmin per cell is presented before the abbreviation either in
absolute numbers or as a mean or a range.
i. Where there are too many copies of double minutes (dmin) to enumerate, the greater
than (>) sign may be used to show the minimum number of copies present.
i. 49,XX,+3mar,3dmin[10]Karyotype of a neoplastic sample shows three marker
chromosomes and three dmin per cell.
ii. 49,XY,+3mar,∼14dmin[15]Karyotype of a neoplastic sample shows three marker
chromosomes and approximately 14 dmin per cell.
iii. 49,XX,+3mar,>50dmin[8]Karyotype of a neoplastic sample shows three marker
chromosomes and more than 50 dmin per cell.
iv. 49,XX,+3mar,9∼>50dmin[8]Karyotype of a neoplastic sample shows three marker
chromosomes and 9 to more than 50 dmin per cell.
j. Acentric fragments (ace) other than dmin, even if present in more than one cell, must
not be presented in the karyotype, and must be recorded in chromosome breakage
studies (see Chapter 12).

5.5.13 Neocentromeres

a. A neocentromere is a functional centromere that has arisen or is active within a region

not known to have a centromere. A chromosome with a neocentromere may be described
with the abbreviation neo or as a derivative chromosome (der) with the assumption that
a new centromere has arisen (or is activated) within the region(s) from which the
chromosome segment is derived.
b. A supernumerary marker chromosome containing a neocentromere may require the use
of the detailed (karyotype format) depending on the circumstance.
i. 47,XX,+der(3)(:q28→qter)
or
47,XX,+neo(3)(:q28→qter)Karyotype shows a supernumerary derivative chromosome
comprising the segment 3q28 to 3qter. This segment does not usually include a
centromere and has a neocentromere. In this example, either neo or der could be used.
The location of the neocentromere could be indicated by the abbreviation neo:
47,XX,+der(3)(:q28→neo→q28→qter). Note: the detailed system (karyotype format)
may provide more clarity in describing this chromosome.
ii. 47,XX,der(3)(:p11→q11:),+neo(3)(pter→p11::q11→q26→neo→q26→qter)Karyotyp
e shows that chromosome 3 is replaced by a derivative small chromosome containing
the chromosome 3 centromere and by a large chromosome composed of the remaining
part of chromosome 3 where a neocentromere is activated at 3q26.
iii. 47,XX,+neo(10)(qter→q25::q25→qter)
or
47,XX,+neo(10)(qter→q25::q25→q26→neo→q26→qter)
or
47,XX,+der(10)(qter→q25::q25→q26→neo→q26→qter)Karyotype shows a
supernumerary chromosome that is a duplication of the segments between bands 10q25

77
 and 10qter. This segment does not usually include a centromere and has a
neocentromere. The location of the neocentromere could be indicated as shown.

5.5.14 Quadruplications

a. The abbreviation qdp is used. It is not possible to indicate the orientation(s) of the
segment with the short system (karyotype format).
i. 46,XX,qdp(1)(q23q32)
or
46,XX,qdp(1)(pter→q32::q23→q32::q23→q32::q23→qter)Karyotype shows
quadruplication of the segment between bands 1q23 and 1q32.

5.5.15 Recombinant Chromosomes

a. A recombinant chromosome (rec) is a structurally rearranged chromosome with a new

segmental composition resulting from meiotic crossing-over between a displaced
segment and its normally located counterpart in certain types of structural
heterozygotes, i.e., these recombinant chromosomes arise during gametogenesis as
predictable consequences of crossing over in inversion or insertion heterozygotes
(see Section [Link]).
b. The abbreviation rec should not be used in the description of acquired chromosome
abnormalities, nor those resulting from malsegregation.
c. If parental karyotypes are unknown or a parental rearrangement has not been identified,
the abnormal chromosome should be designated as a der, not rec.
d. The recombinant chromosome is specified in parentheses immediately following the
abbreviation rec. The chromosome designation used indicates the origin of the
centromere of the specific recombinant chromosome.
i. 46,XX,rec(6)dup(6p)inv(6)(p22.2q25.2)dmat
or
46,XX,rec(6)(pter→q25.2::p22.2→pter)dmatKaryotype shows a recombinant
chromosome 6 with a duplication of the segment 6p22.2 to 6pter and a deletion of 6q25.2
to 6qter due to meiotic crossing-over of a maternal inversion of chromosome 6 involving
the segment 6p22.2 to 6q25.2.
ii. 46,XX,rec(21)del(21)ins(21)(p13q22.2q22.3)dpat
or
46,XX,rec(21)(pter→q22.2::p22.3→qter)dpatKaryotype shows a recombinant
chromosome 21 with a deletion of segment 21q22.2 to 21q22.3 due to a meiotic
crossing-over of a paternal intrachromosomal insertion of chromosome 21 involving the
insertion of bands 21q22.2 to 21q22.3 into 21p13.
iii. 46,XY,rec(1)dup(5q)ins(1;5)(q32;q11.2q22)dinh,der(5)ins(1;5)dinh
46,XY,rec(1)(1pter→1q32::5q11.2→5q22::5q22→5qter)dinh,der(5)(5pter→5q11.2::5
q22→qter)dinhKaryotype shows recombinant chromosomes 1 and 5 resulting in a
duplication of segment 5q22 to 5qter and deletion of the segment from 1q32 to 1qter
due to a meiotic crossing-over in a parent who carries an interchromosomal insertion of
the segment from 5q11.2 to 5q22 into band 1q32.

78
5.5.16 Ring Chromosomes

a. A ring chromosome (r), may be composed of one or several chromosomes.

• Where the origin of the centromere is known it is given in parentheses immediately after
the abbreviation r and followed by the breakpoints, e.g., 47,XX,+r(3)(p25q29)
• Where the centromere is known and the breakpoints cannot be identified but additional
studies confirm chromosome origin the identity of the ring chromosome can be given in
parentheses immediately after the abbreviation r, e.g., 47,XX,+r(3)
• If no part of the ring chromosome including the centromere is identified then it is given
without chromosome designation or breakpoints, e.g., 47,XY,+r

[Link] Ring Chromosomes Derived from One Chromosome

a. As in other rearrangements affecting a single chromosome, there is no semicolon

between the band designations.
i. 46,XX,r(7)(p15q31)
or
46,XX,r(7)(::p15→q31::)Karyotype shows a ring chromosome in which breakage and
reunion have occurred at bands 7p15 and 7q31. The segments distal to these breakpoints
are deleted.
ii. 46,XX,r(20)(p13q13.3)
or
46,XX,r(20)(::p13→q13.3::)Karyotype shows a ring chromosome in which breakage
and reunion have occurred at bands 20p13 and 20q13.3 is identified at 550 band
resolution with no discernable deletion of material at either breakpoint.

[Link] Ring Chromosomes Derived from More than One Chromosome

a. Ring chromosomes derived from more than one chromosome may contain one or several
centromeres.
b. Monocentric ring chromosomes are described as derivative (der) chromosomes
(see Section 5.5.3). The chromosome that provides the centromere is listed first. The
order and orientation of the remaining segment is apparent from the order of the
breakpoints.
i. 46,XX,der(1)r(1;3)(p36.1q23;q21q27)
or
46,XX,der(1)(::1p36.1→1q23::3q21→3q27::)Karyotype shows a ring chromosome
composed of chromosome 1 with breakpoints in 1p36.1 and 1q23, and the acentric
segment between bands 3q21 and 3q27 of chromosome 3.
ii. 46,XX,der(1)r(1;3)(p36.1q23;q27q21)
or
46,XX,der(1)(::1p36.1→1q23::3q27→3q21::)Karyotype shows a ring chromosome
with the same breakpoints as in the previous example, but the orientation of the acentric
segment of chromosome 3 is reversed.
iii. 46,XY,der(8)r(8;2)(p21.3q24.1;q23q33)
or

79
 46,XY,der(8)(::8p21.3→8q24.1::2q23→2q33::)Karyotype shows a ring chromosome
composed of part of chromosome 8 from 8p21.3 to 8q24.1 and an acentric fragment of
chromosome 2 long arm from bands 2q23 to 2q33. As the chromosome 8 segment
contains the centromere, it is listed before the acentric fragment from chromosome 2.
iv. 46,XX,der(1)r(1;?)(p36.1q23;?)
or
46,XX,der(1)(::1p36.1→1q23::?::)Karyotype shows a ring chromosome composed of
chromosome 1 with breakpoints in 1p36.1 and 1q23, and an unknown acentric segment.
c. If the centromere of the ring chromosome is not known, but segments from other
chromosomes contained in the ring are recognized, the ring is designated der(?).
i. 47,XX,+der(?)r(?;3;5)(?;q21q26.2;q13q33)
or
47,XX,+der(?)(::?→cen?→?::3q21→3q26.2::5q13→5q33::)Karyotype shows a ring
chromosome with two acentric segments, 3q21 to 3q26.2 and 5q13 to 5q33, and the
origin of the centromere is unknown.
d. Dicentric or tricentric ring chromosomes are designated by the
abbreviation r preceded by the triplet dic or trc.
e. In dicentric ring chromosomes (dic r), the sex chromosomes or the autosome with the
lowest number is specified first.
i. 47,XX,+dic r(1;3)(p36.1q32;p24q26.2)
or
47,XX,+dic r(1;3)(::1p36.1→1q32::3p24→3q26.2::)Karyotype shows a dicentric ring
chromosome composed of chromosomes 1 and 3 in which 1q32 is joined with 3p24 and
3q26.2 is joined with 1p36.1.
f. In tricentric ring chromosomes (trc r), the sex chromosomes or the autosome with the
lowest number is specified first. The orientation of the chromosomes will be apparent
from the order of the breakpoints.
i. 47,XX,+trc r(1;3;12)(p36.1q32;q26.3p24;p12q23)
or
47,XX,+trc r(1;3;12)(::1p36.1→1q32::3q26.3→3p24::12p12→12q23::)Karyotype
shows a tricentric ring chromosome in which 1q32 is joined to 3q26.3, 3p24 is joined to
12p12, and 12q23 is joined to 1p36.1.
g. When the origin of the ring chromosome is known, the description of the ring is placed
in the appropriate chromosome number order, e.g., 49,XX,+1,+3,r(7),+8
h. When the origin of the ring chromosome is not known, the presence of the ring (r)
abbreviation, preceded by a plus (+) sign, is indicated at the end of the karyotype, but
before any other marker chromosome (see Section 4.3), e.g., 50,XX,+1,+3,+8,+r and
50,XX,+1,+3,+8,+r+mar
i. Different ring chromosomes may be indicated by an Arabic number after the
abbreviation r, e.g., r1, r2, etc., whereas several copies of unidentified ring
chromosomes are indicated by the appropriate number before the ring chromosome
abbreviation, e.g., 5r. The order for numbering the different ring chromosomes is at the
discretion of the laboratory.
i. 48,XX,+r1,+r2[10]Karyotype of a neoplastic sample with two distinctly different
clonally occurring ring chromosomes. Note: the designations r1 and r2 do not indicate

80
 that the derivation is from chromosomes 1 and 2. When the origin of a ring chromosome
is known, the appropriate chromosome is placed in parentheses, e.g., r(1), r(2), etc.
ii. 51,XY,+5r[10]Karyotype shows a neoplastic sample with a total of five ring
chromosomes but it is not known if any of the rings are identical.

5.5.17 Telomeric Associations

a. The abbreviation tas is used to describe a telomeric association, which is typically a

single cell abnormality. However, it is only reported in the ISCN description if it is a
clonal abnormality.
b. In telomeric associations between two chromosomes, the sex chromosome or the
autosome with the lowest number is specified first.
c. When more than two chromosomes are involved, the end chromosome that is a sex
chromosome or has the lowest autosomal number, is specified first, followed by the
other chromosomes in the order they are associated with the chromosome listed first.
d. In the short system (karyotype format), the terminal bands of the chromosomes involved
in telomeric association(s) are given in the second parentheses; the orientation of the
chromosomes will be apparent from the order in which the breakpoints are listed.
e. Chromosomes involved in telomeric associations are counted as separate chromosomes,
as it is not proven that there is true chromosome fusion with terminal breakpoints.
i. 46,XX,tas(12;13)(q24.3;q34)
or
46,XX,tas(12;13)(12pter→12qter→13qter→13pter)Karyotype shows an association
between the telomeric regions of the long arms of chromosomes 12 and 13.
ii. 46,Y,tas(X;12;3)(q28;p13q24.3;q29)
or
46,Y,tas(X;12;3)(Xpter→Xqter→12pter→12qter→3qter→3pter)Karyotype shows an
association between the telomeric regions of the long arm of the X chromosome and the
short arm of chromosome 12, and between the telomeric regions of the long arm of
chromosome 12 and the long arm of chromosome 3.
iii. 46,X,tas(1;X;12;7)(p36.3;q28p22.3;p13q24.3;p22)
or
46,X,tas(1;X;12;7)(1qter→1pter→Xqter→Xpter→12pter→12qter→7pter→7qter)Kar
yotype shows an association between the telomeric regions of the short arm of
chromosome 1 and the long arm of the X chromosome, between the telomeric regions
of the short arm of the X chromosome and the short arm of chromosome 12, and between
the telomeric regions of the long arm of chromosome 12 and the short arm of
chromosome 7.

81
5.5.18 Translocations

[Link]. Reciprocal Translocations

a. Translocation (t) refers to the exchange of terminal segments of chromosomes. When

a translocation is balanced, there is no discernable gain or loss of chromosomal material.
b. The sex chromosome or the autosome with the lowest number is always specified first.
If both sex chromosomes are involved, the X chromosome is listed before the Y
chromosome.
c. To distinguish homologous chromosomes, one of the numerals may be underlined (_)
(see Sections 4.4.2 and [Link].2).

[Link].1 Two-Break Rearrangements

i. i.46,XY,t(2;5)(q21;q31)
or
46,XY,t(2;5)(2pter→2q21::5q31→5qter;5pter→5q31::2q21→2qter)Karyotype
shows a translocation between chromosomes 2 and 5 where the segment distal to 5q31
is translocated to chromosome 2 at 2q21 and the segment of chromosome 2 distal to
2q21 is translocated to chromosome 5 at 5q31.
ii. 46,XY,t(2;5)(p12;q31)
or
46,XY,t(2;5)(5qter→5q31::2p12→2qter;5pter→5q31::2p12→2pter)Karyotype
shows breakage and reunion have occurred at bands 2p12 and 5q31. The segments
distal to these bands are exchanged.
iii. 46,X,t(X;13)(q27;q12)
or
46,X,t(X;13)(Xpter→Xq27::13q12→13qter;13pter→13q12::Xq27→Xqter)Karyotyp
e shows breakage and reunion at bands Xq27 and 13q12. The segments distal to these
bands are exchanged. Since one of the chromosomes involved in the translocation is a
sex chromosome, it is designated first. Note: the correct designation is 46,X,t(X;13)
and not 46,XX,t(X;13). Similarly, an identical translocation in a male is designated
46,Y,t(X;13) and not 46,XY,t(X;13).
iv. 46,t(X;Y)(q22;q11.23)
or
46,t(X;Y)(Xpter→Xq22::Yq11.23→Yqter;Ypter→Yq11.23::Xq22→Xqter)Karyotyp
e shows a reciprocal translocation between an X chromosome and a Y chromosome
with breakpoints at bands Xq22 and Yq11.23.
v. 46,t(X;18)(p11.2;q11.2),t(Y;1)(q11.23;p31)
or
46,t(X;18)(18qter→18q11.2::Xp11.2→Xqter;18pter→18q11.2::Xp11.2→Xpter),t(Y;
1)(Ypter→Yq11.23::1p31→1pter;Yqter→Yq11.23::1p31→1qter)Karyotype shows
two reciprocal translocations, each involving one sex chromosome. Breakage and
reunion have occurred at bands Xp11.2 and 18q11.2 as well as at bands Yq11.23 and
1p31. Note: abnormalities of the X chromosome are listed before those of the Y
chromosome.

82
[Link].2 Three-Break Rearrangements

a. For balanced translocations involving three separate chromosomes, with one

breakpoint in each chromosome, the sex chromosome or autosome with the lowest
number is specified first. The chromosome listed next receives a segment from the first
chromosome, and the chromosome specified last donates a segment to the first listed
chromosome.
i. 46,XX,t(2;7;5)(p21;q22;q23)
or
46,XX,t(2;7;5)(5qter→5q23::2p21→2qter;7pter→7q22::2p21→2pter;5pter→
5q23::7q22→7qter)Karyotype shows a translocation of the segment of chromosome 2
from 2p21 to 2pter onto chromosome 7 at band 7q22, the segment on chromosome 7
from 7q22 to 7qter is translocated onto chromosome 5 at 5q23, and the segment of
chromosome 5 from 5q23 to 5qter is translocated onto chromosome 2 at 2p21.
ii. 46,X,t(X;22;1)(q24;q11.2;p33)
or
46,X,t(X;22;1)(Xpter→Xq24::1p33→1pter;22pter→22q11.2::Xq24→Xqter;22qter
→22q11.2::1p33→1qter)Karyotype shows that the segment on one X chromosome
distal to Xq24 is translocated onto chromosome 22 at band 22q11.2, the segment distal
to 22q11.2 is translocated onto chromosome 1 at band 1p33, and the segment distal to
1p33 is translocated onto the X chromosome at band Xq24.
iii. 46,XX,t(2;7;7)(q21;q22;p13)
or
46,XX,t(2;7;7)(2pter→2q21::7p13→7pter;7pter→7q22::2q21→2qter;7qter→7q22::7
p13→7qter)Karyotype shows that the segment on chromosome 2 distal to 2q21 is
translocated onto chromosome 7 at band 7q22, the segment on chromosome 7 distal to
7q22 is translocated onto the homologous chromosome 7 at band 7p13, and the
segment distal to 7p13 on the latter chromosome is translocated onto chromosome 2
at 2q21. Note: underlining is used only to emphasize that the chromosomes are
homologous.
iv. 46,XX,t(9;22;17)(q34;q11.2;q22)[10]
or
46,XX,t(9;22;17)(9pter→9q34::17q22→17qter;22pter→22q11.2::9q34→9qter;17pte
r→17q22::22q11.2→22qter)[10]Karyotype of a neoplastic sample shows that the
segment of chromosome 9 distal to 9q34 is translocated onto chromosome 22 at band
22q11.2, the segment of chromosome 22 distal to 22q11.2 is translocated onto
chromosome 17 at 17q22, and the segment of chromosome 17 distal to 17q22 is
translocated onto chromosome 9 at 9q34.
v. 46,Y,t(X;15;18)(p11.1;p11.1;q11.1)
or
46,Y,t(X;15;18)(18qter→18q11.1::Xp11.1→Xqter;Xpter→Xp11.1::15p11.1→15qter
;18pter→18q11.1::15p11.1→15pter)Karyotype shows that the segment of the X
chromosome distal to Xp11.1 is translocated onto chromosome 15 at band 15p11.1,
the segment of chromosome 15 distal to 15p11.1 is translocated onto chromosome 18
at 18q11.1, and the segment of chromosome 18 distal to 18q11.1 is translocated to
Xp11.1. The normal Y chromosome is listed before the abnormal X chromosome.

83
[Link].3 Four-Break and More Complex Rearrangements

a. The same rule as for three-break rearrangements is followed in four-break and more
complex balanced translocations for order and chromosome listing.
i. 46,XX,t(3;9;22;21)(p13;q34;q11.2;q21)[10]
or
46,XX,t(3;9;22;21)(21qter→21q21::3p13→3qter;9pter→9q34::3p13→3pter;22pter
→22q11.2::9q34→9qter;21pter→21q21::22q11.2→22qter)[10]Karyotype of a
neoplastic sample shows a four-break rearrangement where the segment of
chromosome 3 distal to 3p13 is translocated onto chromosome 9 at 9q34, the segment
of chromosome 9 distal to 9q34 is translocated onto chromosome 22 at 22q11.2, the
segment of chromosome 22 distal to 22q11.2 is translocated onto chromosome 21 at
21q21, and the segment of chromosome 21 distal to 21q21 is translocated onto
chromosome 3 at 3p13.
ii. 46,XX,t(3;9;9;22)(p13;q22;q34;q11.2)[10]
or
46,XX,t(3;9;9;22)(22qter→22q11.2::3p13→3qter;9pter→9q22::3p13→3pter;9pter→
9q34::9q22→9qter;22pter→22q11.2::9q34→9qter)[10]Karyotype of a neoplastic
sample shows a four-break rearrangement involving the two homologous
chromosomes 9. The segment on chromosome 3 distal to 3p13 is translocated onto
chromosome 9 at band 9q22, the segment on chromosome 9 distal to 9q22 is
translocated onto the homologous chromosome 9 at 9q34, the segment on the latter
chromosome 9 distal to 9q34 is translocated onto chromosome 22 at 22q11.2, and the
segment on chromosome 22 distal to 22q11.2 is translocated onto chromosome 3 at
3p13.
b. The derivative chromosomes produced by malsegregation of reciprocal
translocations and insertions are described using the conventions outlined in Section
5.5.3.

[Link]. Whole-Arm Translocations

a. Whole-arm translocations are described by assigning the breakpoints to the centromeric

bands p10 for short arm and q10 for long arm according to the morphology of the
abnormal chromosomes. The breakpoints are assigned to (p10;p10) when both short
arms are joined together, and (p10;q10) when a short arm of one chromosome and the
long arm of the second chromosome are joined together.
b. In balanced whole-arm translocations, the breakpoint in the chromosome that is a sex
chromosome or the autosome with the lowest number is assigned to p10.
i. 46,XY,t(1;3)(p10;q10)
or
46,XY,t(1;3)(1pter→1p10::3q10→3qter;3pter→3p10::1q10→1qter)Karyotype shows
a reciprocal whole-arm translocation in which the short arm of chromosome 1 is joined
at the centromere with the long arm of chromosome 3 and the long arm of chromosome
1 is joined to the short arm of chromosome 3.
ii. 46,XY,t(1;3)(p10;p10)
or

84
 46,XY,t(1;3)(1pter→1p10::3p10→3pter;1qter→1q10::3q10→3qter)Karyotype shows
a reciprocal whole-arm translocation in which the short arms of chromosomes 1 and 3
and the long arms of these chromosomes, respectively, are joined at the centromeres.
c. In the description of karyotypes containing derivative chromosomes resulting
from unbalanced whole-arm translocations (see Section 5.5.3), the derivative
chromosome (der) replaces the two normal chromosomes involved in the translocation.
The two missing normal chromosomes are not specified. The imbalance(s) can be
inferred from the karyotype designation.
i. 45,XX,der(1;3)(p10;q10)
or
45,XX,der(1;3)(1pter→1p10::3q10→3qter)Karyotype shows a derivative chromosome
consisting of the short arm of chromosome 1 and the long arm of chromosome 3. The
missing chromosomes 1 and 3 are not indicated since they are replaced by the derivative
chromosome. The karyotype contains one normal chromosome 1, one normal
chromosome 3, and the der(1;3). The resulting net imbalance of this abnormality is
monosomy for the long arm of chromosome 1 and monosomy for the short arm of
chromosome 3.
ii. 46,XX,+1,der(1;3)(p10;q10)Karyotype shows a derivative chromosome consisting of
the short arm of chromosome 1 and the long arm of chromosome 3 (same as above)
replaces one chromosome 1 and one chromosome 3. There are, however, two normal
chromosomes 1, i.e., an additional chromosome 1 in relation to the expected loss due to
the der(1;3). Consequently, this gain is indicated as +1. The karyotype contains two
normal chromosomes 1, one normal chromosome 3, and the der(1;3). The resulting net
imbalance is trisomy for 1p and monosomy for 3p.
iii. 46,XX,der(1;3)(p10;q10),+3Karyotype shows a derivative chromosome consisting of
the short arm of chromosome 1 and the long arm of chromosome 3 (same as above) has
replaced one chromosome 1 and one chromosome 3. There are, however, two normal
chromosomes 3, i.e., an additional chromosome 3 in relation to the expected loss due to
the der(1;3). Consequently, this gain is indicated as +3. The karyotype contains one
normal chromosome 1, two normal chromosomes 3, and the der(1;3). The resulting net
imbalance is monosomy for 1q and trisomy for 3q.
iv. 47,XX,+der(1;3)(p10;q10)Karyotype shows an extra derivative chromosome consisting
of the short arm of chromosome 1 and the long arm of chromosome 3 (same as above).
There are two normal chromosomes 1, two normal chromosomes 3, and the der(1;3).
The resulting net imbalance is trisomy for 1p and trisomy for 3q.
v. 44,XY,–1,der(1;3)(p10;q10)Karyotype shows a derivative chromosome consisting of
the short arm of chromosome 1 and the long arm of chromosome 3 (same as above) has
replaced one chromosome 1 and one chromosome 3. There is, however, no normal
chromosome 1, indicated as –1 in relation to the expected presence of one chromosome
1 due to the der(1;3). The karyotype contains no chromosome 1, one normal
chromosome 3, and the der(1;3). The resulting net imbalance is nullisomy for 1q,
monosomy for 1p, and monosomy for 3p.

85
[Link]. Robertsonian Translocations

a. Robertsonian translocations (rob) are constitutional whole-arm translocations of the

acrocentric chromosomes 13, 14 ,15, 21 and 22. The breakpoints mostly occur in the
short arms, resulting in dicentric chromosomes. Breaks may also occur in one short arm
and one long arm of the participating chromosomes, resulting in monocentric
rearrangements. Usually there is simultaneous loss of the remaining short arms.
b. Although either rob or der can adequately describe these whole-arm
translocations, der is the preferred designation. The abbreviation rob should not be
used in the description of acquired abnormalities.
i. 45,XX,der(13;21)(q10;q10)Karyotype shows that breakage and reunion have occurred
at band 13q10 and band 21q10 in the centromeres of chromosomes 13 and 21. The
derivative chromosome has replaced one chromosome 13 and one chromosome 21 and
there is no need to indicate the missing chromosomes. The karyotype contains one
normal chromosome 13, one normal chromosome 21, and the der(13;21). The resulting
net imbalance is loss of the short arms of chromosomes 13 and 21.
ii. 46,XX,der(13;21)(q10;q10),+21Karyotype shows a derivative chromosome consisting
of the long arm of chromosome 13 and the long arm of chromosome 21 (same as above)
has replaced one chromosome 13 and one chromosome 21. There are, however, two
normal chromosomes 21, i.e., an additional chromosome 21 in relation to the expected
loss due to the der(13;21). Consequently, this gain is indicated as +21. The karyotype
contains one normal chromosome 13, two normal chromosomes 21, and the der(13;21).
The resulting net imbalance is loss of the short arm of chromosome 13 and trisomy for
the long arm of chromosome 21.
iii. 46,XX,+13,der(13;21)(q10;q10)Karyotype shows a derivative chromosome consisting
of the long arm of chromosome 13 and the long arm of chromosome 21 (same as above)
has replaced one chromosome 13 and one chromosome 21. The karyotype contains two
normal chromosomes 13, one normal chromosome 21, and the der(13;21).
Consequently, this gain is indicated as +13. The resulting net imbalance is loss of the
short arm of chromosome 21 and trisomy for the long arm of chromosome 13.
c. If only a single chromosome is involved in the rearrangement, the extra chromosome is
indicated by the 46 chromosome count in the presence of a whole-arm rearrangement
and the addition of a normal chromosome.
i. 46,XX,+21,der(21;21)(q10;q10)Karyotype shows a derivative chromosome composed
of the long arms of chromosome 21. There are two copies of the long arm of
chromosome 21 in the derivative chromosome and one normal chromosome 21,
indicated by the 46 chromosomes count. The normal chromosome 21 is designated with
a plus (+) sign. Note: for an alternative description of this same rearrangement as an
isochromosome if homozygosity for the long arm of the rearranged chromosome is
proven, see Section 5.5.11.
d. If it is proven that the derivative chromosome resulting from a whole-arm translocation
is dicentric, i.e., the breakpoints are assigned to p11.2 or q11.2, the abbreviation dic is
used and the dicentric chromosome is described accordingly (see Section 5.5.4).

86
[Link]. Jumping Translocations

a. Jumping translocations are described with the ISCN description for translocations. The
cell lines/ clones are presented with the largest cell line/clone listed first. Cell
lines/clones of equal size are given according to Sections 4.5.3, 5.1 and [Link].
i. 46,XX,t(4;7)(q35;q11.2)[6]/46,XX,t(1;7)(p36.3;q11.2)[4]/46,XX,t(7;9)(q11.2;p24)[3]
Karyotype shows three clonal translocations involving band 7q11.2. The segment
7q11.2 to 7qter is translocated to bands 1p36.3, 4q35, and 9p24.
ii. 46,XX,+13,der(13;13)(q10;q10)[5]/45,XX,der(13;15)(q10;q10)[5]Karyotype shows a
clonal translocation where the chromosome 13 long arm is translocated either to a
chromosome 13 leading to trisomy 13 as there is one apparently normal chromosome
13 and one derivative chromosome 13 (with two copies of the long arm of chromosome
13), or on one chromosome 15 in a balanced state. Note: there is a reduction in the
chromosome number when the derivative chromosome replaces one chromosome 13
and one chromosome 15.

5.5.19 Tricentric Chromosomes

a. A tricentric (trc) chromosome has three centromeres.

b. In the description of a tricentric chromosome, if the sex chromosome centromere is
involved, it is given first followed by the autosomes in numerical order. For tricentric
chromosomes involving only autosomes, numerical order is followed (lowest to
highest).
c. The other chromosome segments are listed in the order they are attached to the
chromosome listed first. The orientation of the chromosomes will be apparent from the
order of the breakpoints specified in the second parentheses.
d. A tricentric chromosome is counted as one chromosome, with the normal chromosome
count then becoming 44. There is no need to indicate the missing normal chromosomes.
i. 44,XX,trc(4;12;9)(q31.2;q22p13;q34)
or
44,XX,trc(4;12;9)(4pter→4q31.2::12q22→12p13::9q34→9pter)Karyotype shows a
tricentric chromosome in which band 4q31.2 is joined to12q22 and 12p13 is joined to
9q34.

5.5.20 Triplications

a. The abbreviation trp is used. It is not possible to indicate the orientation(s) of the
segment in the short system (karyotype format), but this can be done with the detailed
system (karyotype format).
i. 46,XX,trp(1)(q21q32)
or
46,XX,trp(1)(pter→q32::q21→q32::q21→qter)Karyotype shows triplication of the
segment between bands 1q21 and 1q32, one of several possible orientations of the
triplications of this segment. Note: trp indicates that the three copies are tandem.
ii. 46,XX,trp(1)(q32q21)
or

87
 46,XX,trp(1)(pter→q32::q32→q21::q21→qter)Karyotype shows triplication of the
segment between bands 1q21 and 1q32 with one segment in an opposite orientation to
the above example.

5.6 Multiple Copies of Rearranged Chromosomes

a. The multiplication (×) sign can be used to describe multiple copies of a rearranged
chromosome but it is not used to denote multiple copies of normal chromosomes.
b. The number of copies (×2, ×3, etc.) is placed after the abnormality.
c. Extra copies of a rearranged chromosome, when present, do not require the breakpoints
to be repeated, i.e., they are specified the first time they appear in the karyotype (see
also Section 4.2.1).
i. 46,XX,del(6)(q13q23)×2[10]Karyotype of a neoplastic sample shows two
chromosomes 6 with an interstitial deletion of the long arm between 6q13 and 6q23, and
no normal chromosome 6. Since the two abnormal chromosomes replace the two normal
chromosomes, there is no need to indicate the missing normal chromosomes.
ii. 48,XY,+del(6)(q13q23)×2[10]
or
48,XY,+6,+6,del(6)(q13q23)×2[10]Karyotype of a neoplastic sample shows two
apparently normal chromosomes 6 plus two additional chromosomes 6 with an
interstitial deletion of the long arm between 6q13 and 6q23.
iii. 47,XX,del(6)(q13q23)×2,+del(6)[15]Karyotype of a neoplastic sample shows three
copies of chromosome 6 with an interstitial deletion of the long arm between 6q13 and
6q23, and no normal chromosomes 6, i.e., two of the deleted chromosomes replace the
two normal chromosomes 6. Note: in the ISCN description the supernumerary
chromosome 6 with an interstitial deletion is preceded by a plus (+) sign.
iv. 48,XX,del(6)(q13q23)×2,+7,+7[10]Karyotype of a neoplastic sample shows two
chromosomes 6 with an interstitial deletion of the long arm between 6q13 and 6q23.
There are no normal chromosomes 6; there is gain of two chromosomes 7.
v. 48,XX,t(8;14)(q24.1;q32),+der(14)t(8;14)×2[10]Karyotype of a neoplastic sample
shows a balanced translocation, t(8;14) plus two additional copies of the derivative
chromosome 14. There is one apparently normal chromosome 8, one apparently normal
chromosome 14 and there are three derivative chromosomes 14 from the t(8;14).
vi. 92,XXXX,t(8;14)(q24.1;q32)×2[10]Karyotype of a neoplastic sample shows a
tetraploid clone with two balanced translocations, t(8;14). The two derivative
chromosomes 8 and 14 replace two normal chromosomes 8 and 14. There are two
normal chromosomes 8 and 14.
vii. 94,XXYY,t(8;14)(q24.1;q32)×2,+der(14)t(8;14)×2[15]
or
94,XXYY,t(8;14)(q24.1;q32)×2,+14,+14,der(14)t(8;14)×2[15]Karyotype of a
neoplastic sample shows a hypertetraploid clone with two balanced translocations,
t(8;14) plus two additional copies of the derivative chromosome 14. There are two
normal chromosomes 8 and 14.
viii. 93,XXXX,t(8;14)(q24.1;q32)×2,der(14)t(8;14)×2,+der(14)t(8;14)[15]Karyotype of a
neoplastic sample shows a hypertetraploid clone with two balanced translocations,

88
 t(8;14) and three extra copies of the derivative chromosome 14, i.e., there are five
derivative chromosomes 14, and there is no normal chromosome 14.
ix. 94,XXYY,t(8;14)(q24.1;q32)×2,+14,der(14)t(8;14)×2,+der(14)t(8;14)[10]Karyotype
of a neoplastic sample shows a hypertetraploid clone with two balanced translocations,
t(8;14). There are six copies of chromosome 14: one chromosome 14 is apparently
normal and five are derivative chromosomes 14 from the t(8;14).
x. 47,XX,+8,i(8)(q10)×2[10]
or
47,XX,i(8)(q10),+i(8)[10]Karyotype of a neoplastic sample with an alternative
description of the same chromosome complement to describe two copies of an
isochromosome for the long arm of chromosome 8 and one normal chromosome 8.
xi. 49,XX,+1,+der(1)t(1;16)(p13;q13)×2,t(1;16)[10]A karyotype of a neoplastic sample
with two additional copies of a derivative chromosome 1, from a translocation involving
chromosomes 1 and 16. In this case, the numerical gain of chromosome 1 is listed first.
The derivative chromosome 1 with the breakpoint band designation is listed before the
translocation that is given without the band designation. Note: the alphabetical order
rule applies for the der and t abnormalities.

5.7 Ploidy Anomalies

a. All chromosome changes, whether constitutional or acquired, are expressed in relation

to the appropriate ploidy level (see Section 6.3.7), i.e.,
• In near-haploid cells (23 chromosomes) in relation to one chromosome of each type
(chromosome numbers up to 34).
• In near-diploid cells (46 chromosomes) in relation to two chromosomes of each type
(chromosome numbers 35–57).
• In near-triploid cells (69 chromosomes) in relation to three chromosomes of each type
(chromosome numbers 58–80).
• In near-tetraploid cells (92 chromosomes) in relation to four chromosomes of each type
(chromosome numbers 81–103), and so on.
v. 26,X,+4,+6,+21[12]The near-haploid karyotype shows two copies of chromosomes 4,
6, and 21, and a single copy of all other chromosomes in a neoplastic sample.
vi. 69,XXX,del(7)(p11.2)The triploid karyotype shows two normal chromosomes 7 and a
chromosome 7 with a terminal deletion of the short arm at 7p11.2.
vii. 70,XXX,+del(7)(p11.2)The near-triploid karyotype shows three normal chromosomes
7 and an additional, structurally abnormal chromosome 7 with a terminal deletion of the
short arm at 7p11.2.
viii. 71,XXX,+8,+10The near-triploid karyotype shows four copies of chromosomes 8 and
10, and three copies of all other chromosomes. Note: the number of metaphases is added
for a neoplastic sample.
ix. 69,XXY,del(7)(q22),inv(7)(p13q22),t(7;14)(p15;q11.1)The triploid karyotype shows
no normal chromosome 7. One chromosome 7 has a long arm deletion, one chromosome
7 has an inversion, and one chromosome 7 is involved in a balanced translocation with
chromosome 14. Note: there is comma (,) separating the chromosome 7 abnormalities
to indicate that the abnormalities are on different chromosome 7 homologues.

89
 x. 69,XXX,der(7)inv(7)(p13q22)del(7)(q22),t(7;14)(p15;q11.1)The triploid karyotype
shows one derivative chromosome 7 with an inversion involving the segment 7p13 to
7q22, and a terminal deletion at 7q22. Another chromosome 7 is involved in a reciprocal
translocation with chromosome 14, and there is one normal chromosome 7.
xi. 92,XXYY,del(7)(p11.2),t(7;14)(p15;q11.1)The tetraploid karyotype shows two normal
and two abnormal chromosomes 7: one chromosome 7 with a terminal deletion of the
short arm, and one chromosome 7 is involved in a balanced translocation with
chromosome 14. Note: underlining of one homologue is optional (see Section 4.4.2).
xii. 92,XXYY,del(7)(p11.2),del(7)(q22),del(7)(q34)The tetraploid karyotype shows one
normal chromosome 7 and three chromosomes 7 with different terminal deletions.
xiii. 89,XXYY,–1,–3,–5,+8,–21[5]The near-tetraploid male karyotype shows three copies of
chromosomes 1, 3, 5, and 21, five copies of chromosome 8, and four copies of all other
autosomes in a neoplastic sample.
b. In neoplasms, an appropriate and biologically meaningful ploidy level should be
selected for the description of the karyotype. The ploidy level (n, 2n, 3n, etc.) may be
given in angle brackets (< >) after the chromosome number (see Section 6.3.7).
. 76∼102<4n>,XXXX,…[15]The chromosome numbers vary between hypertriploidy
and hypertetraploidy. The symbol <4n> indicates that all neoplastic abnormalities are
expressed in relation to the tetraploid level.
i. 58<2n>,XY,+X,+4,+6,+8,+10,+11,+14,+14,+17,+18,+21,+21[10]Karyotype of a
neoplastic sample with near-triploidy, and the abnormalities are described in relation to
the diploid chromosome number. The chromosomes with three copies are listed as
additional.
c. Endoreduplication (end) is the replication of the chromosomes without chromatid
separation or cytokinesis (Fig. 7). Technologies such as SNP microarray may be helpful
in differentiating between endoreduplication and other mechanisms (e.g., aborted
mitosis and cell fusion) that may produce a similar copy number change.

Figure 7. Metaphase chromosomes in a cell which has undergone

endoreduplication (courtesy of Dr. N. Mandahl

90
6 Neoplasia

6.1 Introduction

This section defines terms and provides nomenclature for the description of
chromosome abnormalities in neoplasia. Unless otherwise indicated the examples in this
chapter are given at 400 bands per haploid set (bphs). See Section 10.3 for
nomenclature to describe targeted karyotype analysis and Chapters
7, 8, 9, 10 and 11 for molecular cytogenomic and sequencing assays.

6.2 General Principles

a. See Chapter 4 for general nomenclature rules applicable to neoplasia.

b. In the description of a karyotype the total number of chromosomes is given first in the
ISCN description, followed by a comma (,) followed by the sex chromosome
constitution. Autosomes are specified only if they are abnormal and are listed in
increasing number order.
c. The number of cells is given in square brackets ([ ]) for each abnormal clone and the
normal cell line, if present (see Section 5.1).
d. Only chromosome abnormalities with demonstrated clonality are reported in the ISCN
description (see Section 4.5).
• The location of a breakpoint is specified by the band in which the break has occurred
according to the banding resolution of the assay.
• When the same abnormality has been seen at a higher resolution in a previous sample,
then the higher resolution breakpoints may be reported in subsequent samples.
• Depending on the banding resolution, a breakpoint may appear to be in a band other
than that known to contain the gene involved in the rearrangement. Nevertheless, the
breakpoint listed in ISCN corresponds to the band/subband visualised by the banding
technique.
e. The normal cell line when present, is listed last in the nomenclature description.
f. Non-clonal abnormalities are not included in the ISCN description; however, they may
be discussed in the interpretative text.
g. The karyotype designation of each different clone and subclone is separated by a slant
line (/).
h. In chimerism secondary to stem cell transplant, the recipient cell line(s) are given
first, followed by the donor cell line(s). The recipient and donor cell line(s) are separated
by a double slant line (//) (see Section 4.5.3).
i. The stemline (sl) is the most basic clone of a neoplastic population, and deviating
subclones arising by clonal evolution are termed sidelines (sdl).

91
 j. idem (Latin = the same) can be used to describe sidelines and subclones in relation to
the first clone in the ISCN description. This term makes no assumption regarding the
stemline.
k. Where individual clones are not discernible because of the genomic heterogeneity of the
tumor, a composite karyotype (cp) is required.
l. Where chromosome quality is poor and/or there are insufficient metaphases to allow the
complete karyotype to be determined, an incomplete (inc) karyotype may be given.

6.3 Clones and Subclones

A clone is defined as a cell population derived from a single progenitor (see Section
4.5). It is not necessarily completely homogeneous because subclones may have evolved
during development and progression of the neoplasm.

a. Clonal chromosome abnormalities, including the number of metaphases analyzed, are

reported in the ISCN description. For nomenclature for the targeted scoring of additional
metaphases to establish clonality or assess clone size, see Section 10.3.
i. 46,XY,t(7;11)(p15;p15)[12]/46,XY[8]Chromosome analysis shows a clone with a
translocation between chromosomes 7 and 11 in twelve metaphases at 400 bphs. This
7;11 translocation in hematological neoplasms forms the NUP98::HOXA9 fusion gene.
The NUP98 and HOXA9 genes are located on 11p15.4 and 7p15.2, respectively,
although these subband are not apparent at 400 bphs.
b. When a cytogenetic abnormality has been reported in a previous study and then is found
in a single metaphase at follow-up, it should be reported in the ISCN.
i. 46,XX,t(9;22)(q34;q11.2)[1]/46,XX[19]Karyotype shows a single metaphase with an
isolated translocation between chromosomes 9 and 22 in a follow-up cytogenetic
analysis of a case with the same abnormal clone at initial presentation.
c. When a single abnormal metaphase is confirmed by a different method (e.g., FISH,
microarray, genome mapping), and thus shown to be clonal, it should be reported in the
karyotype (see Section 4.5.3).
i. 46,XX,del(20)(q11.2q13.3)[1]/46,XX[19].nuc ish
(D20S108×1,RH74808×2)[40/200]An interstitial deletion in the long arm of
chromosome 20 is present in a single metaphase from a neoplastic sample. FISH with a
20q12 probe, D20S108, and a control probe for 20q13.3, RH74808, confirmed the
deletion of 20q and the clonality of this abnormality.

6.3.1 Clone Size

i. 46,XX[20]An apparently normal female karyotype is identified in 20 metaphases in a

neoplastic sample. Note: the number of metaphases is given in square brackets ([ ]).
ii. 46,XX,t(8;21)(q22;q22)[23]A clone with a translocation between chromosomes 8
and 21 is identified in all 23 metaphases by cytogenetic analysis at 400bphs.
iii. 46,XX,t(9;22)(q34;q11.2)[18]/45,XX,der(7;9)(q10;q10)t(9;22),der(22)t(9;22)[2]
or
46,XX,t(9;22)(q34;q11.2)[18]/45,XX,der(7;9)(7qter→7q10::9q10→9q34::22q11.2→
22qter),der(22)(22pter→22q11.2::9q34→9qter)[2]

92
 or
46,XX,t(9;22)(q34;q11.2)[18]/45,XX,der(7;9)(7qter→7q10::9q10→9q34::22q11.2→
22qter),der(22)t(9;22)[2]A neoplastic sample shows eighteen metaphases with 46
chromosomes and a translocation between chromosomes 9 and 22 as the sole
cytogenetic abnormality. A subclone of two metaphases has 45 chromosomes and the
derivative chromosome 9 from the t(9;22) is further involved in a whole-arm
translocation with chromosome 7. The missing chromosomes 7 and 9 are not
indicated since they are replaced by the derivative chromosome, der(7;9). There is
loss of the short arms of chromosomes 7 and 9. Note: the breakpoints need not be
repeated when the same abnormality is described in additional clones/subclones.

b. The mainline is the most frequent chromosome constitution of a neoplastic cell

population. Mainline is a purely quantitative term to describe the largest clone and
does not necessarily indicate the most basic clone in terms of progression.
i. 46,XX,t(9;22)(q34;q11.2)[3]/47,XX,+8,t(9;22)[17]The clone with 47 chromosomes
and trisomy 8 represents the mainline in this karyotype, although it has most
probably evolved from the clone with 46 chromosomes. Note: the order of the
cytogenetically related clones is determined by their complexity (see Section
[Link]).
ii. 46,XX,der(2)t(2;5)(p23;q35)[10]/47,XX,+2,der(2)t(2;5)[16].nuc ish
(3′ALK×2,5′ALK×3)(3′ALK con 5′ALK)×2[135/200]/(3′ALK×1,5′ALK×2)(3′ALK
con 5′ALK)×1[65/200]The clone with 47 chromosomes represents the mainline in
this karyotype, although it has most probably evolved from the clone with 46
chromosomes. Rearrangement involving the ALK gene is confirmed by interphase
FISH analysis with a breakapart probe.
c. When the largest clones (two or more) are of equal size, a neoplasm will have more
than one mainline.
i. 45,XX,−7[10]/47,XX,+8[10]Karyotype shows two clones of equal size, each
representing the mainline. Monosomy 7 clone is listed before trisomy 8 clone
following the chromosome order rule. For rules concerning clone order when the
clones are unrelated see Section [Link]

6.3.2 Order of Chromosome Abnormalities

a. Clonal chromosome abnormalities are listed with sex chromosome abnormalities first,
and X before Y, followed by autosomes in order of lowest to highest number. The
normal sex chromosome is listed first in the ISCN description when the other sex
chromosome is abnormal (see Section 4.3).
i. 45,X,−Y,t(8;21)(q22;q22)[20]A translocation between chromosomes 8 and 21 is
identified in twenty metaphases by cytogenetic analysis at 400bphs. The 8;21
translocation in hematological neoplasms forms the RUNX1::RUNX1T1 fusion gene.
The RUNX1T1 gene is known to be located at 8q21.3. At 400bphs the breakpoint is at
the interface of 8q21.3 and 8q22. The breakpoint is designated as 8q22 as it is more
distal to the centromere (see Section 5.4.1).
ii. 46,XX,t(10;11)(p12;q14–22),del(13)(q12q22),i(17)(q10)[10]/46,XX[5]Karyotype
shows a translocation involving chromosomes 10 and 11, an interstitial deletion of

93
 chromosome 13 and an isochromosome of the long arm of chromosome 17 in ten
metaphases. At 300bphs 11q14 to 11q22 appear as the single band, 11q14–22. No
abnormality is detected in five metaphases. The normal cell line is listed last in the ISCN
description.
iii. 46,Y,i(X)(q10)[20]/46,XY[10]Karyotype of a neoplastic sample shows an
isochromosome of the long arm of the X chromosome in twenty metaphases and an
apparently normal male karyotype in ten metaphases. The normal Y chromosome is
given before the abnormal X chromosome in the ISCN description.

6.3.3 Order of Clones

[Link] Cytogenetically Related Clones

The order of cytogenetically related clones in the ISCN description is determined by the
sequential application of the following rules:

a. Cytogenetically related clones and subclones are written in order of

increasing complexity, irrespective of their size (see Section 4.5.3). Only
the number of aberrations and not the size of the altered genomic segment is considered
in the application of this rule (see Table 7).
i. 46,XY,inv(16)(p13.1q22)[10]/46,XY,del(7)(q21),inv(16)[5]Karyotype shows a
pericentromeric inversion of chromosome 16 as the sole abnormality in ten metaphases.
A subclone comprising of five metaphases shows the inv(16) and a terminal deletion of
7q. Note: the stemline, if present, is the least complex clone and is therefore listed first
in the ISCN description.
b. Where abnormalities in different clones with equal complexity involve chromosomes of
a different number, the chromosome order rule applies, X before Y, followed by
autosomes in increasing number.
i. 46,XY,t(1;19)(q23;p13.3),del(9)(p21)[10]/47,XY,t(1;19),+21[10]Two subclones
identified by karyotype contain a translocation between chromosomes 1 and 19. The
subclone with a terminal deletion of chromosome 9 is given before the subclone with
gain of chromosome 21 in the ISCN description. Note: the cytogenetically related
clones are of equal karyotypic complexity, therefore the chromosome order rule
applies.
c. Where abnormalities in different clones with equal complexity involve the same number
chromosome, the gain before loss, before structural change rule applies.
i. 47,XX,t(6;9)(p22;q34),+9[10]/45,XX,t(6;9),−9[10]Two subclones identified by
karyotype contain a translocation between chromosomes 6 and 9. The subclone with
gain of chromosome 9 is given before the subclone with loss of chromosome 9 in the
ISCN description. Note: the cytogenetically related clones are of equal karyotypic
complexity, and the abnormalities involve the same number chromosome, therefore
the gain before loss, before structural change rule applies.
d. Where structural abnormalities of the same number chromosome are present in different
clones with equal complexity, they are reported alphabetically. If structural
abnormalities involving the same chromosome are of the same type, then
the pter to qter rule applies.

94
 i. 45,XX,−5,add(7)(q34)[15]/45,XX,−5,t(7;8)(q22;q22)[15]Karyotype shows two
subclones with monosomy 5. One clone shows additional material of unknown origin
replacing the distal long arm of chromosome 7 from 7q34 and the other shows a
translocation involving chromosome 7 at 7q22 and chromosome 8 at 8q22. Since
chromosome 7 is involved in both clones then the alphabetical rule of abbreviations
applies. In this example add is listed before t.
ii. 47,XY,+8,del(17)(p13)[15]/47,XY,+8,del(17)(q21)[15]Karyotype shows two
subclones with trisomy 8. The subclone with a terminal deletion at 17p13 is given before
the subclone with a terminal deletion at 17q21 in the ISCN description. Note: the clones
are of equal karyotypic complexity, and the abnormalities are of the same type on the
same number chromosome, therefore the pter to qter rule applies.
iii. 48,XY,+8,+17[15]/47,XY,+8,del(17)(p13)[15]/47,XY,+8,del(17)(q21)[15]Karyotype
shows three subclones with trisomy 8 and abnormalities of chromosome 17. The
subclone with trisomy 17 is given first (gains before losses before structural change);
the subclone with a terminal deletion at 17p13 is given before the subclone with a
terminal deletion at 17q21 in the ISCN description (pter to qter rule applies).

[Link] Cytogenetically Unrelated Clones

The order of cytogenetically unrelated clones in the ISCN description is determined by

the sequential application of the following rules:

a. Cytogenetically unrelated abnormal clones are written in order of the size of the
clone with the largest clone first, followed by the next largest and so on (see Section
4.5).
i. 46,XX,t(3;9)(p13;p13)[14]/48,XX,+3,+9[11]/46,XX,t(1;6)(p11;p12)[9]/47,XX,t(6;10)
(q12;p15),+7[6]/45,X,−X[3]/46,XX,inv(6)(p22q23)[3]/46,XX[7]Karyotype shows six
apparently unrelated abnormal clones. They are given in the order of decreasing size,
irrespective of the type of abnormality or chromosome number involved. Only clones
of the same size are listed according to the chromosome order rule therefore the clone
with loss of the X chromosome is given before the clone with an inversion of
chromosome 6. The normal cell line is listed last.
b. Where abnormalities in different clones of equal size involve chromosomes of a
different number, the chromosome order rule applies; X before Y, followed by
autosomes in increasing number.
i. 47,XX,+8[10]/47,XX,+21[10]Karyotype shows two apparently unrelated clones of
equal size and complexity. The clone with trisomy 8 is given in the ISCN description
before that of the clone with trisomy 21 following the chromosome order rule.
c. Where abnormalities in different clones of equal size involve the same chromosome,
the gain before loss, before structural change rule applies.
i. 47,XY,+Y[20]/45,X,−Y[20]Karyotype shows two clones of equal size; one clone has Y
chromosome gain and the other has Y chromosome loss. The karyotypically unrelated
clones are of equal complexity and the abnormalities involve the same chromosome
therefore the gain before loss, before structural change rule applies.
ii. 47,XX,+8[10]/46,XX,t(8;21)(q22;q22)[10]Karyotype shows two apparently unrelated
clones of equal size. The clone with trisomy 8 is given in the ISCN description before

95
 the clone with a translocation between chromosomes 8 and 21 following the gain before
loss before structural change rule.
d. Where structural abnormalities of the same number chromosome are present in different
clones with equal complexity, they are reported alphabetically. If structural
abnormalities involving the same chromosome are of the same type, then
the pter to qter rule applies.
i. 46,XX,del(9)(q13q22)[10]/46,XX,t(9;22)(q34;q11.2)[10]Karyotype shows two
apparently unrelated clones of equal size. Each clone shows a structural change of
chromosome 9 so the alphabetical rule determines the order of the clones in the ISCN
description, del before t.
ii. 46,XY,del(9)(p13)[15]/46,XY,del(9)(q22)[15]Karyotype shows two apparently
unrelated clones of equal size. One clone shows a terminal deletion of the short arm of
chromosome 9, and the other shows a terminal deletion from the long arm of
chromosome 9. Therefore, the pter to qter rule determines the order of the clones in the
ISCN description.
iii. 46,XX,add(7)(q22)[15]/46,XX,t(7;9)(q22;p21)[15]Karyotype shows two apparently
unrelated clones of equal size. One clone shows additional material of unknown origin
replacing the distal long arm of chromosome 7 from 7q22 and the other shows a
translocation between chromosome 7 at 7q22 and chromosome 9 at 9p21. Since there is
a chromosome 7 abnormality in both clones then the alphabetical rule of abbreviations
applies. In this example add is listed before t.

[Link] Mixed Cytogenetically Related and Unrelated Clones

a. If a neoplasm contains both related and unrelated clones, the cytogenetically related
clones are presented according to the rules in Section [Link], followed by the unrelated
clones according to the rules in Section [Link].
i. 45,XY,−5[3]/44,XY,−5,−7[15]/45,XY,−10[15]/46,XY,del(11)(q23)[15]Karyotype
shows two cytogenetically related clones and two cytogenetically unrelated clones. The
cytogenetically related clones are given first in order of increasing complexity, followed
by the unrelated clones. Since the unrelated clones are the same size they are given in
chromosome order.
ii. 50,XX,t(2;6)(p22;q16),+5,+5,+8,+11[19]/51,sl,+8[7]/52,sdl1,+9[12]/46,XX,del(3)(q13
)[11]/47,XX,+7[6]/46,XX,t(1;3)(p22;p14)[4]
or
50,XX,t(2;6)(p22;q16),+5,+5,+8,+11[19]/51,idem,+8[7]/52,idem,+8,+9[12]/46,XX,del
(3)(q13)[11]/47,XX,+7[6]/46,XX,t(1;3)(p22;p14)[4]Karyotype shows three
cytogenetically related clones and three additional cytogenetically unrelated clones. The
cytogenetically related clones are given first in order of increasing complexity followed
by the three unrelated clones in order of decreasing frequency.
b. If a previously identified abnormality is found among other unrelated clones, it should
be given first, regardless of the number of metaphases in which it is identified.
i. 46,XY,t(9;22)(q34;q11.2)[6]/46,XY,t(1;3)(p22;p14)[14]The t(9;22)(q34;q11.2) is
identified at initial presentation. At follow-up the t(9;22) is persisting and an unrelated
clone involving t(1;3)(p22;p14) has emerged. Although the number of metaphases in

96
 the unrelated clone is larger, it is written after the previously identified clone in the ISCN
description.

6.3.4 Clonal Evolution

Where possible the nomenclature in this section should be used to describe subclones
so that clonal evolution is evident. In some neoplastic studies clonal evolution is not
linear and this may result in a mix of abnormal metaphases with clonal and nonclonal
changes. For these cases a composite karyotype can be used to describe the clonal
abnormalities (see Section 6.3.5).

a. The stemline (sl) is the most basic clone of a neoplastic cell population and is listed first
in the ISCN description. All additional deviating subclones are termed sidelines (sdl).
To describe the stemlines and sidelines, these abbreviations, or the term idem (Latin =
same), can be used. Note: it may be unclear whether the least complex clone in a
karyotype is the stemline or is, itself, an evolved subclone. In this case, idem is
preferred.
• If sl is used in the ISCN description, it indicates that the sideline contains the sex
chromosome complement and the karyotypic abnormalities of the stemline.
• sdl indicates that the subclone contains the sex chromosome complement and the
karyotypic abnormalities of the sideline.
• idem refers only to the karyotype of the clone listed first and replaces the sex
chromosome complement and the abnormalities of the first clone.
b. In neoplastic karyotypes where idem is used, the chromosome number of each subclone
is given and followed by the additional changes in the subclone in relation to the most
basic clone, that is given first.
c. The terms idem and sl must not be intermixed in the ISCN description.
d. If more than one stemline (sl) is present, as may occur in concomitant neoplasms, these
may be referred to as sl1, sl2, etc.
e. If more than one sideline (sdl) is present, these may be referred to as sdl1, sdl2, etc. For
each of these, several sub-sidelines may also exist. The use of sdl in this instance
reduces clarity and so idem is preferred.
f. The term sl or sdl multiplied by a number (×2, ×3, etc.) may be used to describe
aberrant polyploid clones. Alternatively, the term idem multiplied by a number
(×2, ×3, etc.,) may be used. Additional abnormalities in the polyploid clone may then
be indicated using conventional terminology.
i. 46,XY,t(8;21)(q22;q22)[26]/47,XY,t(8;21),+21[7]
or
46,XY,t(8;21)(q22;q22)[26]/47,idem,+21[7]
or
46,XY,t(8;21)(q22;q22)[26]/47,sl,+21[7]Karyotype shows a clone of twenty-six
metaphases with 46 chromosomes and a translocation between chromosomes 8 and 21
as the sole abnormality. A subclone of seven metaphases with 47 chromosomes and the
t(8;21), shows trisomy 21. Alternatively, idem or sl may be used to replace the sex
chromosome complement and abnormalities seen in the initial clone.

97
 ii. 46,XX,t(9;22)(q34;q11.2)[3]/47,sl,+8[17]/48,sdl1,+9[3]/49,sdl2,+11[12]
or
46,XX,t(9;22)(q34;q11.2)[3]/47,idem,+8[17]/48,idem,+8,+9[3]/49,idem,+8,+9,+11[12
]Karyotype shows a clone with 46 chromosomes representing the stemline (sl); the
three subclones with 47, 48 and 49 chromosomes are sidelines. In the subclone with 47
chromosomes and trisomy 8, sl indicates the sex chromosome complement and the
presence of the abnormal chromosomes seen in the stemline, i.e., XX and t(9;22)
(q34;q11.2). This subclone is sideline 1 (sdl1). In the subclone, sdl2, with 48
chromosomes and trisomy 9, sdl1 indicates the sex chromosome complement and the
presence of the abnormalities seen in the first sideline, i.e., XX,t(9;22)(q34;q11.2) and
trisomy 8, and so on. As an alternative, in each subclone the sex chromosome
complement and the translocation 9;22 are replaced by idem. The
terms idem and sl must not be intermixed in the ISCN description.
iii. 46,XX,t(8;21)(q22;q22)[12]/45,sl,−X[19]/46,sdl1,+8[5]/47,sdl2,+9[8]
or
46,XX,t(8;21)(q22;q22)[12]/45,idem,−X[19]/46,idem,−X,+8[5]/47,idem,−X,+8,+9[8]
The clone with t(8;21) as the sole abnormality is the most basic and hence represents
the stemline; the other subclones are listed in order of increasing karyotypic complexity
of the aberrations acquired during clonal evolution.
iv. 48,XX,t(12;16)(q13;p11.1),+17,+20[23]/49,sl,+6[8]/50,sdl,+7,−8,+9[4]
or
48,XX,t(12;16)(q13;p11.1),+17,+20[23]/49,idem,+6[8]/50,idem,+6,+7,−8,+9[4]Karyo
type shows a subclone with 49 chromosomes that has the abnormalities seen in the
stemline plus an extra chromosome 6. There is a subclone with 50 chromosomes that
has the abnormalities of the sideline and has also acquired trisomy 7, monosomy 8, and
trisomy 9.
v. 26,X,+4,+6,+21[3]/52,sl×2[13]
or
26,X,+4,+6,+21[3]/52,idem×2[13]Karyotype shows a near-haploid stemline with two
copies of chromosomes 4, 6, and 21, and a single copy of all other chromosomes. In the
subclone, doubling of the near-haploid clone (likely due to endoreduplication), is also
identified.
vi. 52,XX,+4,+4,+6,+6,+21,+21[9]/51,idem,−10[3]/46,XX[18]A subsequent sample of the
diagnostic example (v) (see above) shows cytogenetic relapse: nine metaphases have 52
chromosomes with the same chromosome complement as reported in the diagnostic
sample. A subclone showing clonal evolution comprises three metaphases with 51
chromosomes and loss of one chromosome 10. Eighteen metaphases show an apparently
normal female karyotype. The stemline (26,X,+4,+6,+21) seen in the diagnostic sample
is not detected. Note: only the term idem can be used in this ISCN description (and
not sl) since the diagnostic stemline is not present.
vii. 46,XY,t(9;22)(q34;q11.2)[3]/92,sl×2[5]/93,sdl,+8[2]
or
46,XY,t(9;22)(q34;q11.2)[3]/92,idem×2[5]/93,idem×2,+8[2]Karyotype shows a
stemline with a translocation between chromosomes 9 and 22 as the sole cytogenetic
abnormality. Two additional abnormal subclones are identified. One is tetraploid due to
doubling of the stemline. The other is near-tetraploid because of gain of chromosome 8

98
 in the tetraploid sideline. As an alternative, idem may be used, but all subclones refer
back to the stemline.
viii. 46,XY,t(9;22)(q34;q11.2)[3]/47,idem,+8[10]/47,idem,+19[3]/48,idem,+8,+der(22)t(9;
22)[4]Karyotype shows a stemline with a translocation between chromosomes 9 and 22
as the sole cytogenetic abnormality. Three abnormal subclones show clonal evolution.
The first subclone has trisomy 8 and the t(9;22) from the stemline, the second subclone
has trisomy 19 and the t(9;22) from the stemline, and the third subclone has an additional
derivative chromosome 22 and is probably derived from the 47,idem,+8[10] subclone.
The order of the first and second subclones in the ISCN description is determined by the
complexity and chromosome order rules. The third subclone is listed last as it is more
complex than the previous subclones. Note: the use of idem is preferred
as sl and sdl would reduce clarity.
ix. 45,XY,−7[5]/46,sl1,+8[6]/46,XY,t(9;22)(q34;q11.2)[3]/92,sl2×2[5]/93,sl2×2,+8[2]
or
45,XY,−7[5]/46,idem,+8[6]/46,XY,t(9;22)(q34;q11.2)[3]/92,XXYY,t(9;22)×2[5]/93,X
XYY,+8,t(9;22)×2[2]In a neoplasm with unrelated clones, there may be clonal evolution
arising from each unrelated stemline. In the above example, the first stemline, sl1, shows
monosomy 7 and the subclone derived from it showing trisomy 8. The second
stemline, sl2, shows t(9;22) and clonal evolution gives rise to the subclone showing
tetraploidy. Further clonal evolution is found in a sideline showing gain of chromosome
8, but to avoid confusion between sidelines of sl1 and sl2, the term sdl is not used when
referring to subclones of a second stemline. The alternative use of idem is shown for
comparison. Note: idem refers only to sl1.
x. 48,XX,t(12;16)(q13;p11.1),+17,+20[7]/96,sl×2,inv(3)(q21q26.2),t(3;6)(p25;q21)[19]
or
48,XX,t(12;16)(q13;p11.1),+17,+20[7]/96,idem×2,inv(3)(q21q26.2),t(3;6)(p25;q21)[1
9]Karyotype shows a mainline with 96 chromosomes representing doubling of the
hyperdiploid stemline, inversion of one chromosome 3 and an apparently balanced
reciprocal translocation between one other chromosome 3 homologue and chromosome
6 i.e., there are two normal chromosomes 3 and three normal chromosomes 6 in this
near-tetraploid subclone. Note: inv(3) is given before t(3;6) following the alphabetical
order rule.
xi. 53,XY,+1,+12,+14,t(14;18)(q32;q21),+15,+16,+18,+20[21]/53,sl,del(7)(q21)[9]
or
53,XY,+1,+12,+14,t(14;18)(q32;q21),+15,+16,+18,+20[21]/53,idem,del(7)(q21)[9]Ka
ryotype shows a stemline with a reciprocal translocation of chromosomes 14 and 18,
and trisomy of chromosomes 1, 12, 14, 15, 16, 18 and 20. A sideline shows the same
sex chromosome complement and chromosome abnormalities as the stemline, with an
additional (apparently terminal) deletion of the long arm of chromosome 7.
xii. 45,XY,t(1;6)(p34.1;q22),−3[13]/49,sl,+3,+del(7)(q11.2),+8,+9[22]
or
45,XY,t(1;6)(p34.1;q22),−3[13]/49,idem,+3,+del(7)(q11.2),+8,+9[22]Karyotype
shows four additional changes in the subclone with 49 chromosomes in relation to the
apparent stemline. It is possible that the two clones in this example arose through
divergent clonal evolution from an undetected stemline with 46,XY,t(1;6). In this
case idem may be more appropriate than sl. Note: the stemline has monosomy 3

99
 whereas the sideline has two normal chromosomes 3, i.e., the +3 in this situation does
not indicate that the clone has trisomy 3. Alternatively, the karyotype may be written in
full for clarity.
xiii. 45,XX,dic(9;20)(p13;q11.2)[11]/46,sl,+21[19]
or
45,XX,dic(9;20)(p13;q11.2)[11]/46,idem,+21[19]Karyotype shows a stemline with a
dicentric chromosome involving chromosome 9 with a breakpoint at band 9p13 and
chromosome 20 with a breakpoint at 20q11.2. The segments from 9pter to 9p13 and
from 20q11.2 to 20qter are not present. There is a subclone with gain of chromosome
21.
xiv. 47,XX,inv(6)(p21q25),+12,del(13)(q12q14)[17]/47,sl,−inv(6),+mar[11]
or
47,XX,inv(6)(p21q25),+12,del(13)(q12q14)[17]/47,idem,−inv(6),+mar[11]Chromoso
me analysis shows a stemline with an inversion of chromosome 6, trisomy 12 and an
interstitial deletion of the long arm of chromosome 13. The inversion of chromosome 6
is absent from the sideline and the breakpoints do not need to be repeated. It is possible
that these two clones arose through divergent clonal evolution from an undetected
stemline with trisomy 12 and interstitial deletion of the long arm of chromosome 13, in
which case the use of idem may be preferred. Note: there is monosomy 6 in the
sideline. Note: the karyotype may be written in full for clarity.
47,XX,inv(6)(p21q25),+12,del(13)(q12q14)[17]/47,XX,−6,+12,del(13)(q12q14),+mar
[11]
xv. 47,XX,inv(6)(p21q25),+12,del(13)(q12q14)[17]/48,sl,+6,−inv(6),+mar[11]
or
47,XX,inv(6)(p21q25),+12,del(13)(q12q14)[17]/48,idem,+6,−inv(6),+mar[11]Chromo
some analysis shows a stemline with an inversion of chromosome 6, trisomy 12 and an
interstitial deletion of the long arm of chromosome 13. There are two normal
chromosomes 6 in the sideline and the inversion of chromosome 6 is absent. Note: the
karyotype may be written in full for clarity
47,XX,inv(6)(p21q25),+12,del(13)(q12q14)[17]/48,XX,+12,del(13)(q12q14),+mar[11
].
xvi. 46,XY,−2,−9,add(10)(q26),del(20)(q11.2q13.3),+mar1,+mar2[15]/44,sl,add(3)(p12),−
5,+8,−add(10),−mar2[5]
or
46,XY,−2,−9,add(10)(q26),del(20)(q11.2q13.3),+mar1,+mar2[15]/44,idem,add(3)(p12
),−5,+8,−add(10),−mar2[5]Karyotype shows a subclone with 44 chromosomes that has
lost the abnormal chromosome 10 (with additional material at band 10q26) and one of
the marker chromosomes seen in the stemline. Note: there is monosomy 10 in the
subclone. There are three additional changes in the subclone; additional material of
unknown origin attached to 3p12, monosomy 5, and trisomy 8. Alternatively, the ISCN
could be written in full for
clarity:46,XY,−2,−9,add(10)(q26),del(20)(q11.2q13.3),+mar1,+mar2[15]/44,XY,−2,a
dd(3)(p12),−5,+8,−9,−10,–del(20),+mar1[5].

100
 Fig. 8. Divergent clonal evolution.

xvii. 46,XY,t(9;22)(q34;q11.2)[10]/45,idem,−Y[4]/47,idem,+8[4]/44,idem,−Y,−7[4]/45,id
em,−Y,i(17)(q10)[3]/48,idem,+8,+19[3]/48,idem,+8,+21[3]/45,idem,−Y,−7,+11[3]/4
5,idem,−Y,−7,+21[3]/45,idem,−Y,−7,+der(22)t(9;22)[3]/46,idem,−Y,i(17),+21[7]/49
,idem,+8,+19,+21[3]The karyotype of this example is represented diagrammatically
in Figure 8 and described above. The karyotype shows a stemline with 46
chromosomes and a t(9;22)(q34;q11.2). Clonal evolution has resulted in two unrelated
sidelines:
• a sideline with Y chromosome loss i.e., 45,X,−Y,t(9;22)
• a second sideline with trisomy 8 i.e., 47,XY,+8,t(9;22)

The −Y sideline then shows further clonal evolution that branches:

• one subclone shows monosomy 7 i.e., 44,X,−Y,−7,t(9;22)

• another subclone shows an isochromosome of the long arm of chromosome 17 i.e.,
45,X,−Y,t(9;22),i(17)(q10)

The monosomy 7 subclone (with t(9;22) and −Y) has three subclones:

• 45,X,−Y,−7,t(9;22),+11
• 45,X,−Y,−7,t(9;22),+21
• 45,X,−Y,−7,t(9;22),+der(22)t(9;22)

101
 The i(17q) subclone has a sub-subclone with trisomy 21:

• 46,X,−Y,t(9;22),i(17),+21

The sideline with +8 shows a divergent branch of clonal evolution. It has two
subclones:

• one subclone with gain of chromosome 19 i.e., 48,XY,+8,t(9;22),+19

• another subclone with gain of chromosome 21 i.e., 48,XY,+8,t(9;22),+21

One of these subclones shows further clonal evolution. It is possible that either the
subclone with +19 gained a chromosome 21 or the +21 clone gained a chromosome
19. This is represented by the dotted lines in Figure 8. The nomenclature description
does not make any assumption concerning the subclone/sub-subclone relationship but
rather describes each clone and subclone firstly following the chromosome order rule
(−Y before +8) and then by increasing order of complexity. Note: the description of
cell lines with divergent clonal evolution is not possible using sl and sdl. The
karyotype is described following the ISCN rules (see Section [Link]).

Fig. 9. Clonal evolution in cytogenetically unrelated stem lines.

102
 xviii. 46,XY,t(8;21)(q22;q22)[29]/47,idem,+9[3]/47,idem,+21[3]/46,idem,−7,+9[6]/45,idem
,−5,−7,+9[3]/47,XY,+8[15]/46,X,−Y,+8[3]/46,XY,−7,+8[9]/45,X,−Y,−5,+8[6]/46,X,−
Y,+8,del(9)(q22)[2]/46,XY,−7,+8,i(17)(q10)[3]/47,XY,−7,+8,+21[5]
or
46,XY,t(8;21)(q22;q22)[29]/47,sl1,+9[3]/47,sl1,+21[3]/46,sl1,−7,+9[6]/45,sl1,−5,−7,+
9[3]/47,XY,+8[15]/46,sl2,−Y[3]/46,sl2,−7[9]/45,sl2,−Y,−5[6]/46,sl2,−Y,del(9)(q22)[2
]/46,sl2,−7,i(17)(q10)[3]/47,sl2−7,+21[5]The karyotype of this example is represented
diagrammatically in Figure 9 and described above. The karyotype shows two unrelated
stemlines that each show clonal [Link] larger stemline is listed first followed by
the related sidelines applying the rules:
• sex chromosomes (X before Y) before autosomes,
• autosomes in order of increasing number,
• increasing order of complexity.

The smaller unrelated stemline (47,XY,+8) is given next followed by its related
sidelines, applying the same rules. Note: idem does not distinguish between the two
stem lines and so for clarity sl1 and sl2 may be used.

6.3.5 Composite Karyotype

a. In many instances, especially in solid tumors, there is karyotypic heterogeneity within

the neoplasm, but different metaphases nevertheless share some cytogenetic
characteristics.
b. Every effort should be made to describe the subclones so that clonal evolution is evident.
However, in some instances, a composite karyotype (cp) will have to be created. The
composite karyotype contains only clonally occurring abnormalities and gives the range
of chromosome numbers in the metaphases containing the clonal abnormalities. A
karyotype may show a mix of fully characterised clones and subclones, in addition to
subclone(s) being given as composite(s) (see Section 6.3.5).
c. The total number of metaphases in which the clonal changes are observed is given in [
] after the karyotype, preceded by cp. The abbreviation cp is not used to describe
obvious random loss in an otherwise normal result i.e., random losses or gains should
be interpreted as consistent with technical artifact and should not be included in
nomenclature. This is distinct from the composite karyotype (cp) where clonal changes
are identified in the context of non-clonal abnormalities.
d. It is not always apparent from a composite karyotype (cp) how many metaphases have
each abnormality. This information may be expressed by providing the number of
metaphases in square brackets ([ ]) after each abnormality.
i. 45∼48,XX,del(3)(p12)[2],−5[4],+8[2],+11[3][cp7]A composite karyotype is
constructed from analysis of seven metaphases, each with at least one of the
abnormalities listed. Two metaphases show a terminal deletion of the short arm of
chromosome 3 with a breakpoint in 3p12, four metaphases show monosomy 5, two
metaphases show trisomy 8, and three metaphases show trisomy 11. Some metaphases
show more than one of these abnormalities. Note: the sum of the clonal abnormalities

103
 indicates a chromosome count of 47 but metaphases with 45 and up to 48 chromosomes
are identified.
ii. 47∼55,XX,del(3)(p12),+i(6)(p10),del(7)(q11.2),+8,dup(11)(q13q25),+16,+17,der(18)t
(18;20)(q23;q11.1),+21,+21,+22[cp24]All of the abnormalities may not be present in a
single metaphase but each of the abnormalities in this cytogenetic analysis is present in
at least two metaphases. Note: some metaphases with 55 chromosomes show additional
non-clonal chromosome gains and losses.
iii. 63∼74(35,X,+X,+1,+6,+8,+10,+11,+14,+15,+18,+19,+21,+22)×2,−2,−5,−16[cp12]In
this composite karyotype of twelve metaphases, where the chromosome number ranges
between 63 and 74, each metaphase shows at least one of the listed abnormalities. There
is an apparent doubling of hypodiploid cells with further loss of chromosomes 2, 5 and
16 (see Section 6.3.7). Note: while the count falls within the near-triploid range, it is
reported relative to haploid in conjunction with supporting evidence from the result of
a previous diagnostic sample or from alternative methods e.g., SNP microarray.
iv. 69∼73,XXY,+Y,+1,−4,−13,del(17)(p11.2),+21,+21,+22[cp10]/46,XY[10]A
composite karyotype in a male shows near-triploidy with gain of a Y chromosome,
aneuploidy of several autosomes (chromosomes 1, 4, 13, 21 and 22), and an apparently
terminal deletion of 17p. Note: in males all sex chromosome deviation is expressed in
relation to XXY in triploid neoplasms (see Section 6.3.7).
e. In a composite karyotype the sum of the aberrations listed may indicate a higher or
lower chromosomes number than that actually seen.
i. 48,XX,+7,+9
48,XX,+7,+11
48,XX,+9,+11
48,XX,+9,+13
48,XX,+13,+21

The composite karyotype of these five metaphases is:

48,XX,+7,+9,+11,+13[cp5]
or
48,XX,+7[2],+9[3],+11[2],+13[2][cp5]The chromosome number of the five metaphases
containing a clonal abnormality is 48, which is given as the chromosome number of the
composite karyotype, although the sum total of all the clonal changes indicates a
chromosomes number of 50. Note: a metaphase with 50 chromosomes is not present.
ii. 42,XX,−2,−16,−21,−22
45,XX,−7,+9,−20
46,XX,−7,+8,−12,+13
43,XX,−7,−18,−20
46,XX,−7,+8
The composite karyotype of these five metaphases is:

43∼46,XX,−7,+8[cp4]
or
43∼46,XX,−7[4],+8[2][cp4]Note: the metaphase with 42 chromosomes is not included
because the abnormalities are due to random loss and are not part of the clone.

104
iii. 51,XY,+1,−7,+8,t(9;22)(q34;q11.2),+11,+13,+19,+der(22)t(9;22)
51,XY,+1,+5,−7,+8,t(9;22)(q34;q11.2),+11,+19,+der(22)t(9;22)
51,XY,+1,+5,−7,+8,t(9;22)(q34;q11.2),+13,+19,+der(22)t(9;22)
52,XY,+1,+5,−7,+8,t(9;22)(q34;q11.2),+11,+13,+19,+der(22)t(9;22)
46,XY,t(9;22)(q34;q11.2)[5]

The composite karyotype of these metaphases is:

46,XY,t(9;22)(q34;q11.2)[5]/51∼52,sl,+1,+5,−7,+8,+11,+13,+19,+der(22)t(9;22)[cp4]
or
46,XY,t(9;22)(q34;q11.2)[5]/51∼52,idem,+1,+5,−7,+8,+11,+13,+19,+der(22)t(9;22)[c
p4]
or
46,XY,t(9;22)(q34;q11.2)[5]/51∼52,idem,+1,+5[3],−7,+8,+11[3],+13[3],+19,+der(22)
t(9;22) [cp4]Karyotype shows a stemline with a 9;22 translocation. Multiple metaphases
are found with gain and loss of chromosomes, likely due to clonal evolution. As not all
aberrations are present in all metaphases, these metaphases are combined into a
composite karyotype. Note: the stemline shows the t(9;22) and the subclone is shown
using a composite karyotype.
iv. 25,XY,−1,−1,−2,−2,inv(3)(q21q26.2),−7,+8,−9,−9,−10,–
11,−11,−12,−12,−13,−14,−15,−16, −17,−18,−20,−20,−22,–22
45,XY,inv(3)(q21q26.2),−7,+8,−19
46,XY,inv(3)(q21q26.2),−7,+8
45,XY,inv(3)(q21q26.2),−7
46,XY,inv(3)(q21q26.2),−7,+21
44,XY,−3,inv(3)(q21q26.2),−7
46,XY,inv(3)(q21q26.2),−7,+14
47,XY,inv(3)(q21q26.2),+8
47,XY,inv(3)(q21q26.2),+8,+14,−21
47,XY,inv(3)(q21q26.2),+14
46,XY,inv(3)(q21q26.2)

The composite karyotype of the ten near-diploid metaphases is:

44∼47,XY,inv(3)(q21q26.2),−7,+8,+14[cp10]All metaphases analyzed show an
inversion of chromosome 3. Nine metaphases also show gain or loss of various
chromosomes, likely due to clonal evolution. Not all aberrations are present in all
metaphases, therefore, ten metaphases are combined into a composite
karyotype. Note: the metaphase with 25 chromosomes, shows random loss of several
chromosomes and is excluded from the composite karyotype since it does not contribute
to establishing the clonality of the abnormalities and its chromosome number would
alter the ploidy level erroneously.
v. 48,X,i(X)(q10),+8,+9
47,XX,+9,del(17)(p13)
47,X,i(X)(q10),+11
47,X,i(X)(q10),+9,del(17)(p13)
47,X,i(X)(q10),+8
48,XX,+8,+9

105
 The composite karyotype of these six metaphases is:
47∼48,XX,i(X)(q10),+8,+9,del(17)(p13)[cp6]
or
47∼48,XX,i(X)(q10)[4],+8[3],+9[4],del(17)(p13)[2][cp6]Two metaphases show two
normal sex chromosomes (XX) that are given in the composite karyotype and the
abnormality affecting an X chromosome is also given since it is seen in four
metaphases. Note: there is no metaphase with three X chromosomes.
vi. 45,X,−X
45,X,−X,del(16)(q24)
46,X,−X,del(16)(q24),+21
46,X,−X,+21
44,X,−X,−7
46,XX

The composite karyotype of these six metaphases is:

44∼46,X,−X,del(16)(q24),+21[cp5]/46,XX[1]The abnormality of the sex chromosome
complement in the neoplastic sample is indicated in the composite karyotype. Loss of
chromosome 7 in the metaphase with 44,X,−X,−7, is not clonal and therefore is not
included in the composite karyotype. Note: additional chromosome analysis (if
possible) is appropriate to exclude monosomy 7.
f. A composite karyotype may contain such seemingly paradoxical abnormalities as loss
and gain of the same chromosome. For example, if the following six metaphases are
karyotyped:
i. 45,XX,−15,del(17)(p11.2)
46,XX,+7,−15,del(17)(p11.2)
46,XX,+12,−15
47,XX,+7
47,XX,+15,del(17)(p11.2)
48,XX,+12,+15

The composite karyotype of these six metaphases is:

45∼48,XX,+7,+12,+15,−15,del(17)(p11.2)[cp6]
or
45∼48,XX,+7[2],+12[2],+15[2],−15[3],del(17)(p11.2)[3][cp6]Trisomy 15 and
monosomy 15 are both clonal changes, present in two and three metaphases,
respectively. If there are both gains and losses of the same chromosome, gains are listed
before the losses in the ISCN (see Section 4.5.3).

Notified in the ISCN 2024. Full details can be found in the published Erratum and the
ISCN online has been corrected.

106
6.3.6 Incomplete Karyotype

a. When chromosome quality is poor and/or metaphases are scarce, it may be necessary to
create an incomplete (inc) karyotype (see Section 5.1).
b. The use of this term is limited to rare instances when one or more abnormalities can be
identified, but it is uncertain whether the remaining chromosomes are morphologically
normal. The karyotype may contain unidentified structural or numerical changes in
addition to the abnormalities listed.
c. The abbreviation inc is placed at the end of the nomenclature description, after the
description of identifiable abnormalities, and is preceded by a comma (,).
i. 46,XX,del(1)(q21),inc[4]A neoplastic sample where it has only been possible to identify
a clonally occurring deletion of the long arm of chromosome 1, but analysis is
incomplete. Without the abbreviation inc, the del(1)(q21) would be the sole anomaly
present in this neoplasm.
ii. 46,XX,der(19)t(1;19)(q23;p13),inc[4]The chromosomes in this example could be
counted however, the banding and morphology are too poor to allow complete analysis.
A derivative chromosome 19 from a translocation between chromosomes 1 and 19 is
identified. Use of inc indicates that this may not be the sole clonal abnormality in this
neoplastic sample.
iii. 53∼57,XY,+1,+3,+6,t(9;22)(q34;q11.2),+21,+3mar,inc[cp10]This abnormal neoplastic
sample has, in addition to the abnormalities presented that include three marker
chromosomes, other changes that could not be identified. The abbreviation cp indicates
a composite karyotype from 10 cells (see Section 6.3.5).
iv. 45∼47,XY,–5,inc[cp2]/46,XY[19].nuc ish (D5S721/D5S23,CSF1R)×1[25/200]A
single metaphase with 45,XY,−5 and a single metaphase with the karyotype
47,XY,−5,+17,+18 are identified, although the presence of additional clonal changes
could not be excluded. FISH confirmed the monosomy 5 cell line but interphase FISH
for chromosomes 17 and 18 failed to achieve a result. The trisomies of chromosomes 17
and 18 have not been confirmed and therefore cannot be reported. Whether this sample
is reported or additional testing is undertaken to confirm the finding is at the discretion
of the laboratory.
v. 31<2n>,XY,−1,−2,inv(3)(q21q26.2),−7,+8,−9,−9,−10,−12,−13,−14,−15,−16,−17,−18,
−21,−21,−22
45,XY,inv(3)(q21q26.2),−7,+8,−9
Taken together these two metaphases can be reported as:
31∼45,XY,inv(3)(q21q26.2),−7,+8,–9,inc[cp2]Only two metaphases are found on
karyotype; both show an inversion of chromosome 3, monosomy 7, trisomy 8 and
monosomy 9. There are fourteen other chromosome losses in one of the metaphases.
Not all aberrations are present in both metaphases, therefore these metaphases are
combined into an incomplete karyotype. Note: it is necessary to include the metaphase
with 31 chromosomes in the karyotype, even though it shows probable random loss of
several chromosomes, because it establishes clonality of the abnormalities in the other
metaphase. The interpretative comment should include a statement concerning the lack
of accuracy of the chromosome number. The monosomies of chromosome 7 and 9 are
included according to the rule that two metaphases with identical losses of one or more
chromosomes and the same structural abnormality may be considered clonal

107
 (see Section 4.5.1). They may be discussed in the interpretive text at the discretion of
the laboratory. Confirmatory investigations could also be considered before reporting
this case.

6.3.7 Modal Number and Ploidy Levels

a. The modal number is the most common chromosome number in a neoplastic cell
population.
b. The modal number may be expressed as a range between two chromosome numbers.
c. Modal numbers are given in either the haploid (n), diploid (2n), triploid (3n) or tetraploid
(4n) range. When the chromosome number is not equal to a multiple of the haploid
number, it may be expressed as near-haploid (n±), hypohaploid (n−), hyperhaploid (n+),
near-diploid (2n±), hypodiploid (2n−), hyperdiploid (2n+), near-triploid (3n±),
hypotriploid (3n−), hypertriploid (3n+), near-tetraploid (4n±), hypotetraploid (4n−),
hypertetraploid (4n+), and so on (see Table 6).

Table 6. Ploidy levels, including ranges of chromosome numbers constituting each level.

d. Each range is determined as n±n/2, with n/2 defined operationally as 11 chromosomes.

e. The ploidy level is expressed within angle brackets (< >) e.g.,
58<2n>,XX,+X,+8,+11,+14,+17,+18,+18,+19,+20,+21,+21,+22[10]
f. Ploidy levels are recommended but exceptions may be made if biologically significant
or clinically relevant in the specific disease.
i. 81<3n>,XXX,+X,+X,+X,+X,+X,+1,+1,+3,+3,+14,+14,+14,−15,+21[10]A neoplasm
in a female shows 81 chromosomes but is reported relative to triploid since most
chromosomes are trisomic and this is biologically significant for the disease in question,
even though the count is in the near-tetraploid range.
ii. 58<2n>,XY,+X,+4,+6,+8,+9,+10,+14,+14,+17,+18,+21,+21[20]A neoplastic sample
in the hypotriploid range is reported relative to a diploid chromosome number, which is
biologically significant in this particular disease.
g. Pseudodiploid, pseudotriploid, etc., are used to describe a karyotype that has the number
of chromosomes equal to a multiple of the haploid number (euploid) but is abnormal
because of the presence of acquired numerical and/or structural aberrations.

108
 i. 46,XX,−5,+8[10]A neoplastic sample with a pseudodiploid karyotype of 46
chromosomes with monosomy 5 and trisomy 8.
ii. 69<3n>,XXY,−5,−7,+10,+17[8]A neoplastic sample with a pseudotriploid karyotype of
69 chromosomes with loss of chromosomes 5 and 7 and tetrasomy of chromosomes 10
and 17.

d. Doubling of a clone may occur e.g., by endoreduplication. Doubled hyperhaploid clones

leading to masked hypodiploidy may be the largest clones at diagnosis. Classification
of masked hypodiploidy is clinically challenging and can impact patient management.
Additional chromosome abnormalities can arise after chromosome doubling. To clarify
the true ploidy of masked hypodiploid karyotypes, the stemline can be noted in the ISCN
description immediately following the chromosomes number of the masked hypodiploid
clone. Additional testing must be performed to provide supporting evidence of the
stemline.
e. The description of sex chromosome abnormalities poses a special problem in male
neoplasms with uneven ploidy levels (haploid, triploid, pentaploid, etc.) because the
expected sex chromosome constitution cannot be deduced. For example, the sex
chromosome constitution of a triploid neoplasm might theoretically be XXY or XYY.
By convention, in males all sex chromosome deviation should be expressed in relation
to X in haploid neoplasms, to XXY in triploid neoplasms, to XXXYY in pentaploid
neoplasms, and so on.
i. 25,X,+Y,+21[1]/50,XY,+X,+Y,+21,+21[19]
or
25,X,+Y,+21[1]/50(25,X,+Y,+21)×2[19]Karyotype shows one metaphase with a
hyperhaploid karyotype and nineteen metaphases with an apparently hyperdiploid
karyotype resulting from a doubling of the hyperhaploid clone. Note: the single near-
haploid metaphase is included in the report since its clonality is demonstrated by the
presence of doubled near-haploid metaphases (see Section 6.3).
ii. 50(25,X,+X,+21)×2[9]/46,XX[11]An apparently hyperdiploid clone comprised of nine
metaphases arose from the doubling of a hyperhaploid clone. Eleven metaphases show
an apparently normal female karyotype. Note: doubling of the hyperhaploid clone is
only reported as 50(25,X,+X,+21)×2 with supporting evidence from an alternative
method e.g., FISH shows the near-haploid stemline, SNP microarray shows
homozygosity of disomic chromosomes, or a hyperhaploid clone in a previous analysis.
iii. 55,XX,+X,+X,+6,+10,+10,+18,+18,der(18)t(18;19)(q21;p11∼12)x2,+21,+21[7]/46,X
Y[13]
or
55(27,X,+X,+10,+der(18)t(18;19)(q21;p11∼12),+21)×2,+6[7]/46,XY[13]An
apparently hyperdiploid clone arises from the doubling of a hyperhaploid clone, and
there is gain of an additional chromosome 6 after the doubling. The sex chromosome
constitution of neoplastic cells may not reflect the sex chromosome complement of the
individual’s normal cells. In this example the hyperhaploid clone contains the X
chromosome (the Y chromosome is lost in the formation of the hyperhaploid clone) and
has gained another copy of the X chromosome. The apparently normal male karyotype
is present in thirteen metaphases. Note: notation for the doubling of a hyperhaploid

109
 clone can only be used when it is supported by the results obtained from alternative
methods, or from a previous analysis.
iv. 68,XY,−X[10]Karyotype of a neoplasm in a male shows triploidy with loss of a sex
chromosome in all ten metaphases obtained for analysis.
v. 26,X,+Y,t(6;14)(q13;q32),+14,+21[6]/27,idem,+18[2]/52,idem×2[9]/46,XY[4]
or
26,X,+Y,t(6;14)(q13;q32),+14,+21[6]/27,idem,+18[2]/52(26,X,+Y,t(6;14),+14,+21)×2
[9]/46,XY[4]
or
26,X,+Y,t(6;14)(q13;q32),+14,+21[6]/27,sl,+18[2]/52,sl×2[9]/46,XY[4]The stemline
is represented by six hyperhaploid metaphases. A subclone of two metaphases exhibits
an additional chromosome 18. Nine metaphases show an apparently hyperdiploid clone
arising from the doubling of the hyper-haploid stemline. No abnormality is detected in
four metaphases.
vi. 32,−X,+Y,+3,+5,+7,+9,+11,+15,+18,+19,+21[16]/46,XY[14]Karyotype of a neoplastic
sample shows hyperhaploidy with additional copies of chromosomes 3, 5, 7, 9, 11, 15,
18, 19 and 21 relative to the haploid set in 16 metaphases. Fourteen metaphases show
an apparently normal male karyotype. Note: the sex chromosome complement is
described as −X and +Y following the convention that sex chromosomes are expressed
in relation to X in haploid neoplasms.

6.4 Constitutional Karyotype

a. The same clonality criteria (see Section 6.3) apply to metaphases containing the
constitutional karyotype as to metaphases containing acquired chromosome
abnormalities.
b. A normal diploid clone, when present, is listed last.
c. A constitutional abnormality may be indicated by the letter c after the abnormality
designation. Note: when the inheritance is known the c is replaced by the relevant
abbreviation mat, pat, dmat, or dpat.
d. In the description of the karyotype, the constitutional and acquired anomalies are listed
in chromosomes number order (see Section 4.3).
e. A clone with only a constitutional abnormality is listed last (as it is the normal clone for
that individual).
f. If the karyotype includes a constitutional and an acquired gain of the same chromosome,
the constitutional gain is listed first.
i. 47,XXYc[5]/46,XY[15] or 47,XY,+X[5]/46,XY[15]Karyotype of a neoplastic sample
in a male with either constitutional mosaicism for an extra X chromosome or acquired
gain of one X chromosome. In this example or is used to describe the alternative options
when further studies are not possible, or have not yet been undertaken.
ii. 48,XX,+8,+21c[20]Karyotype of a neoplastic sample with a constitutional trisomy 21
and an acquired trisomy 8.
iii. 47,X,t(X;18)(p11.1;q11.1),+21c[20]Karyotype of a neoplastic sample with a
constitutional trisomy 21 and an acquired t(X;18).
iv. 47,XXYc,t(9;22)(q34;q11.2)[20]Karyotype of a neoplastic sample with a constitutional
XXY sex chromosome complement and an acquired t(9;22).

110
 v. 48,XY,+8,inv(10)(p12q22)mat,+21[20]Karyotype of a neoplastic sample with a
constitutional, maternally inherited inversion of chromosome 10 and acquired trisomies
8 and 21. Note: when the inheritance is known, mat or pat takes the place of the c.
vi. 47,XX,del(5)(q15),+mar c[20]Karyotype of a neoplastic sample with a constitutional
marker chromosome of unknown origin and an acquired deletion of the long arm of one
chromosome 5. For constitutional markers, there is a space
between mar and c (see Section 4.4.1).
vii. 48,XY,+8,+21c[3]/49,idem,+9[5]/47,XY,+21c[12]Karyotype of a neoplastic sample
with a constitutional trisomy 21 and acquired trisomies 8 and 9. The clone with only the
constitutional trisomy 21 is listed last irrespective of the size of this clone.
viii. 47,XX,t(2;13)(q37;q14),der(14;21)(q10;q10)c,+18,+mar[3]/45,XX,der(14;21)c[17]An
individual with a constitutional Robertsonian translocation between chromosomes 14
and 21 shows two cell lines by cytogenetic analysis. The neoplastic clone shows an
acquired t(2;13), trisomy 18 and an unidentified marker chromosome in addition to the
constitutional der(14;21). The constitutional cell line with the der(14;21) is listed last.
g. To describe acquired abnormalities affecting one of the chromosomes of a pair that is
involved in a constitutional abnormality, the constitutional aberration must always be
given, even if none of the neoplastic metaphases have this particular aberration. Thus,
an acquired abnormality is always presented in relation to the constitutional karyotype.
i. 46,XXYc,−X[20]Neoplastic sample from a patient with Klinefelter syndrome with an
acquired loss of one X chromosome.
ii. 46,XX,+21c,−21[20]Karyotype of a patient with a constitutional trisomy 21 and the
acquired abnormality in the neoplastic metaphases is a loss of one chromosome 21.
iii. 45,Xc,t(X;18)(p11.1;q11.1)[20]Neoplastic sample from a patient with Turner syndrome
(45,X) shows an acquired t(X;18), i.e., the only X chromosomes is involved in the
translocation and consequently there is no normal X chromosome in the neoplastic
metaphases. Note: in a female with a normal sex chromosome constitution and acquired
t(X;18), the karyotype would be: 46,X,t(X;18)(p11.1;q11.1)[20].
iv. 46,XX,der(9)t(9;11)(p22;q23)t(11;12)(p13;q22)c,der(11)t(9;11)t(11;12)c,der(12)t(11;1
2)c[20]A female patient with a known constitutional t(11;12)(p13;q22) shows an
acquired t(9;11) that is a recurrent rearrangement in Acute Myeloid Leukemia. The
derivative chromosome 11 involved in the t(11;12)c is also involved in the t(9;11)
abnormality. The resulting karyotype, with both constitutional and acquired aberrations,
should list each aberrant chromosome as a derivative. The abbreviation, c, is used to
show that each derivative chromosome has a component of the constitutional
translocation.
v. 44,X,−Y,der(13;14)(q10;q10)c[5]/45,XY,der(11)t(11;14)(q13;q32),der(13;14)(q10;q1
0)c t(11;14)[5]/45,XY,der(13;14)(q10;q10)c[5]Male patient with a constitutional
Robertsonian der(13;14)(q10;q10) shows loss of the Y chromosome in five metaphases.
There is also a t(11;14) in a neoplastic clone. The derivative chromosome 14 involved
in the der(13;14)c is described as der(13;14)(q10;q10)c t(11;14). Note: there is a space
between c and t(11;14).
vi. 46,XY,t(2;15)(q21;q26.1)mat,der(6)t(6;17)(q23;q21),der(7;12)(p10;q10),+mar[cp3]/4
6,XY,t(2;15)mat[7]//46,XX,t(2;15)c[10]A male recipient of an allogeneic stem cell
transplant from his mother has a known constitutional t(2;15)(q21;q26.1) and shows a
composite karyotype composed of three metaphases, with a der(6)t(6;17), der(7;12) and

111
 a marker chromosome. Seven metaphases contain only the constitutional t(2;15) without
acquired clonal abnormalities. Note: the ten metaphases from the female donor also
exhibit a constitutional t(2;5).

6.5 Counting Chromosome Abnormalities

The recommended method for counting chromosome abnormalities is outlined below

and in Tables 7 and 8.

a. Only acquired clonal abnormalities are counted. Constitutional abnormalities are not
counted.
b. Where multiple clones are present, each independent abnormality is counted only once.
c. Disease-specific definitions, as described in Chun et al. (2010), Grimwade et al.
(2010), Baliakas et al. (2019) and Haase et al. (2019), are used for cytogenomic
prognostic risk assessment. To determine cytogenetic complexity in a specific
disease, it is mandatory to count chromosome abnormalities in the same manner
as described in the corresponding study on which the prognostic system was based.
d. Two approaches have been employed to deal with more than one clone: counting the
total number of distinct chromosomal abnormalities in the entire sample or counting
clonal chromosomal abnormalities in metaphases with the highest number of
abnormalities. They have been adopted in different studies for risk stratification. The
former method has the advantage of accounting for heterogeneity of the tumor genome
and is applicable in cases of composite karyotype. Consequently, this approach has been
applied in Table 7.

112
Table 7. Counting chromosome abnormalities.

113
Table 8. Example karyotypes with abnormality count.

114
7 In situ Hybridization

7.1 Introduction

Fluorescence in situ hybridization (FISH) is a targeted method to investigate whole

chromosomes, chromosome regions, and/or gene regions for the presence or absence of
numerical and/or structural abnormality. The history of developments in FISH
technology is well documented (Cremer et al., 1986; Landegent et al., 1987; Lichter et
al., 1988; Lichter et al., 1990; Pinkel et al., 1988; Trask, 1991; Wiegant et al.,
1993; Guan et al., 1994; Liehr et al., 2006). The application of FISH probes to free,
linearly extended chromatin fibers (fiber FISH) increased the resolution of FISH
interphase mapping to ≤1 kb (Wiegant et al., 1992; Parra and Windle, 1993). Fiber FISH
is not commonly used in the diagnostic setting and the nomenclature is not included in
ISCN 2024; however, the nomenclature remains available in ISCN 2020.

7.1.1 General Principles and Rules

These rules apply to metaphase and interphase in situ hybridization (ISH).

a. In situ hybridization is performed on preparations of metaphase chromosomes (ish)

or interphase nuclei (nuc ish):
• The abbreviation ish is followed by a space, the chromosome and/or abbreviation for
the type of abnormality or band location and then the metaphase in situ hybridization
results (see Section 7.2.1).
• The abbreviation nuc ish is followed by a space, and then the interphase in
situ hybridization results (see Section 7.3.1).
• If the conventional karyotype or another technique precedes the in situ hybridization
result in the ISCN description, then the result of this technique is followed by
a period (.) before ish or nuc ish.
b. In situ hybridization probes are given in the ISCN description in capital letters and are
described in the nomenclature using one of the following identifiers (listed below in
order of preference):
• STS marker name, i.e., D-number, or BAC clone name.
• Gene symbol, designated according to either the UCSC or Ensembl Genome Browsers
([Link]/ and [Link]/) or HUGO-approved nomenclature
([Link]
• Probe manufacturer’s name for the region or loci/locus.
Examples of each of these are provided within this chapter.
c. Gene names for probes are not italicized in the ISCN description but the corresponding
gene loci are italicized in the report text.
d. Probes are listed in the ISCN description in chromosome order, i.e.,

115
 • Probes on sex chromosomes are given before those on autosomes (and X before Y).
• Probes on lower number autosomes are given before those on higher number autosomes.
Where there are two or more derivative chromosomes on metaphase in
situ hybridization the derivative with the lowest number is listed first and the probes are
given pter to qter.
• Probes on the same chromosome are written in the order from pter to qter as they
appear on the chromosome being described.
e. When contig probes are used each locus may be separated by a single slant line (/) in
the ISCN description. Alternatively, a single probe within the contig may be given in
the nomenclature with the complete contig composition described in the report text.
f. Fusion genes are not described using a double colon (::) in the in situ hybridization
ISCN description. However, they are described in the interpretive comment using
a double colon (::) (e.g., BCR::ABL1) (Bruford et al., 2021) while probe cocktails are
described using a slant line (e.g., ABL1/BCR).
g. Cell numbers are given in square brackets ([ ]) for all neoplastic samples and to
describe constitutional mosaicism/chimerism.
h. Inclusion of the control probe, when present, is optional in the ISCN description if it has
a normal signal pattern but inclusion is mandatory if the control probe has an abnormal
signal pattern. Its inclusion is preferred where it provides additional information, e.g.,
for sex determination.
i. Amplification (amp) can be used when there are too many signals to allow
enumeration or where the number of signals or the ratio compared to the control meets
the clinical criterion for gene amplification in the disease under investigation.

7.2 Prophase/Metaphase in situ Hybridization (ish)

7.2.1 Principles and Rules

a. Observations on normal metaphase chromosomes are expressed by the

abbreviation ish followed by a space, then the chromosome number, chromosome arm,
region, band, or subband location of the locus or loci tested. This is followed in
parentheses by the designation of the probe(s) and their signal patterns as described in
the examples below. The chromosome band description in this chapter is based on the
GRCh38 for in-house probes and as stated by the manufacturer for commercial probes.
b. Clones/cell lines in metaphase in situ hybridization are given largest to smallest and the
normal cell line is listed last e.g., 47,XX,+12[20].ish
del(17)(p13p13)(TP53)[17]/del(17)(p13p13)(TP53–),del(17)(p13p13)(TP53–
)[12]/17p13(TP53)×2[13] (see Section 4.5.3).

a. In sex determination and whole chromosome enumeration the abbreviated system

(karyotype format) is used in which only the chromosome number is given in the ISCN
description, e.g., ish X(DXZ1)×1[20]/X(DXZ1)×2[10] and ish
8(D8Z2)×3[5]/8(D8Z2)×2[5].
b. When reporting normal metaphase results (see Sections 7.2.2, [Link]), including
neoplasia (see Section 7.2.2), and in whole chromosome aneusomy (see Section 7.5).

116
 • A multiplication (×) sign and the number of signals seen is given outside the
parenthesis when the number of signals is the same for all probes.
• The multiplication (×) sign and the number of signals is given inside the parentheses
when the copy number differs between probes on the same hybridization (see Section
7.2.2).
c. When reporting abnormal metaphase results in situ hybridization observations on the
structurally abnormal metaphase chromosome(s) are expressed using the
abbreviation ish followed by a space and then the abbreviation of the type of structural
abnormality, followed in separate parentheses by the chromosome(s), the breakpoint(s),
the probes used, and their signal patterns.
• The presence (+) or absence (–) of a locus is given within the same parentheses as the
probe in the description of abnormal ish (see Section 7.2.3).
• When the number of signals on an abnormal chromosome can be counted, it may be
indicated by multiple plus (+) signs. Tandem duplication is designated by a double
plus (++) sign. Non-tandem duplication is shown with a comma (,) separating the
probes (see Sections 7.2.3 and 7.2.4).
d. In metaphase in situ hybridization probes in multiple hybridizations are reported in a
single set of parentheses, described in the pter to qter orientation of the centromeric
segment of the chromosome being studied.
e. Breakpoints need not be given in the ish nomenclature unless their inclusion clarifies or
refines the breakpoints given in the conventional karyotype. If in situ hybridization
further clarifies the karyotype and, in retrospect, the abnormality can be visualized with
banding, the karyotype may be rewritten to reflect this new information. If the
abnormality is cryptic and cannot be visualized by banding, the abnormality should not
be listed in the banded karyotype.
f. Probes on different chromosomes involved in a structural rearrangement are separated
using a semicolon (;).
g. Whole chromosome paints (wcp) are listed in the pter to qter orientation of the
chromosome being studied, e.g., ish
t(2;17)(q32;q24)(wcp2+,AC005181+,wcp17+;wcp17+,AC005181+,wcp2+)
h. If whole chromosome paints are used with telomeric and subtelomeric probes, the
telomeric probe is designated as the most terminal, followed by the whole chromosome
paint and then the subtelomeric probe when writing the nomenclature description
from pter to qter.

7.2.2 Normal Signal Pattern

i. ish 17p11.2(RAI1)×2 Metaphase in situ hybridization shows a normal signal number

for the RAI1 locus specific probe on chromosome 17.
ii. 46,[Link] X(DXZ1×2,SRY×0)Karyotype shows no abnormality in a female.
Metaphase in situ hybridization confirms the sex chromosome complement. Probes for
the X centromere and the SRY gene are used, and SRY is not detected. Where the
clinical question is whether SRY is present or not, it is appropriate to indicate the status
in the nomenclature. Note: the band location of SRY is not given in the ISCN
description because the Y chromosome is not present.

117
 iii. 46,[Link] X(DXZ1)×1,Y(SRY,DYZ3)×1Karyotype shows no abnormality in a male.
Metaphase in situ hybridization confirms the sex chromosome complement. Note: the
band locations are not given on the X and Y chromosomes in the abbreviated system
(karyotype format) when the assay is used for enumeration of the sex chromosome
complement.
iv. 46,[Link] 4p16.3(NSD2/D4S166)×2Karyotype shows no abnormality in the father of
a child with der(4)t(4;11)(p16.3;p15). Metaphase in situ hybridization shows no
abnormality with a probe for the critical region of Wolf-Hirschorn syndrome
(NSD2/D4S166 probe) and a control probe, CTC-963K6. Note: the result for the
control probe need not be given where the result is normal.
v. 46,[Link] 22q11.2(D22S75)×2 Karyotype shows no abnormality in a male.
Metaphase in situ hybridization using a probe in the 22q11.2 deletion syndrome region
(D22S75) shows a normal hybridization pattern. The control probe is not given.
vi. 46,[Link] 17p11.2(RAI1)×2,21q22.13(D21S259/D21S341/D21S342)×2Karyotype
shows no abnormality in a female. Probes for the RAI1 gene on chromosome 17 and
the Down syndrome critical region on chromosome 21 are both present in the normal
copy number (two copies) by in situ hybridization. All loci of the contig probe are
listed in this example.
vii. 46,[Link] 13(D13Z1/D21Z1)×2,21(D13Z1/D21Z1)×2Karyotype shows no
abnormality in a male. In situ hybridization with probes for the alpha satellites of
chromosomes 13/21 shows a normal pattern. Note: in situ hybridization testing cannot
differentiate the alpha satellite regions of chromosomes 13 and 21 because of sequence
homology.
viii. ish 13(D13S319,LAMP1)×2[10]In situ hybridization shows no evidence of loss of
D13S319 and LAMP1 probes on chromosome 13 in a neoplastic sample.
ix. 46,XX[20].ish
13q14(D13S319)×2[10],14q32(IGH)×2[10],16q23(MAF)×2[10]Karyotype of a
neoplastic sample shows no abnormality in a female with a normal in
situ hybridization pattern for the D13S319, IGH and MAF probes on metaphase
chromosomes.

7.2.3 Abnormal Signal Pattern with a Single Probe

In the following metaphase in situ hybridization examples either the clinically relevant
probe or the informative control probe has an abnormal signal pattern.

i. 46,[Link] del(7)(q11.23q11.23)(ELN–,D7S486/D7S522+) Karyotype shows no

abnormality in a female. An interstitial deletion in the Williams syndrome region of
chromosome 7 is shown by in situ hybridization using a probe for the elastin gene
(ELN). The control probe is given confirming that this is an interstitial, rather than a
terminal deletion.
ii. 46,[Link] del(22)(q11.2q11.2)(D22S75–,ARSA+) Karyotype shows no abnormality
in a female. An interstitial deletion within the 22q11.2 deletion syndrome critical
region on chromosome 22 is shown by in situ hybridization using a probe for D22S75.
The control probe ARSA shows a normal signal pattern, confirming that this is an
interstitial, rather than a terminal deletion.

118
 iii. ish del(22)(q11.2q11.2)(N25–,ARSA+)Karyotype has not been performed. An
interstitial deletion in the 22q11.2 deletion syndrome critical region on chromosome
22 is shown by in situ hybridization using a probe for N25. The control probe shows a
normal signal pattern, confirming that this is an interstitial, rather than a terminal
deletion.
iv. ish del(22)(q13.13q13.3 or q13.3)(D22S75+,ARSA–)In situ hybridization using a
probe to the ARSA gene shows loss of distal 22q. In this situation, the D22S75 probe
is the control probe and is given as it helps to define the extent of the deletion. Further
testing may be required to establish whether the deletion is terminal or interstitial.
v. 46,XX,ins(2)(p13q21q31).ish ins(2)(wcp2+) Karyotype shows an intrachromosomal
insertion on chromosome 2 in a female. The long arm segment of chromosome 2 from
2q21 to 2q31 is inserted into the short arm of the same chromosome at band 2p13. The
chromosome 2 origin of the inserted segment is confirmed by metaphase in
situ hybridization using chromosome 2 whole chromosome paint.
vi. 46,[Link] der(X)t(X;Y)(p22.?3;p11.?2)(SRY+,DXZ1+)Karyotype shows no
abnormality in a female. Metaphase in situ hybridization shows a cryptic unbalanced
translocation between the short arms of the X and Y chromosomes with translocation
of the SRY probe to Xp22, most likely at Xp22.3. The probable breakpoints are given
in the in situ hybridization ISCN description since the translocation is cryptic on
karyotype. Note: the der(X)t(X;Y)(p22.3;p11.2) is a known recurrent rearrangement.
vii. 46,[Link] der(X)ins(X;Y)(p22.?3;p11.?2p11.?2)(SRY+,DXZ1+) or
der(X)t(X;Y)(p22.?3;p11.?2)(SRY+,DXZ1+)The same example as above, however,
the distinction between a translocation or insertion as a mechanism has not been made.
viii. 46,[Link] der(7)ins(7;Y)(q22;p11.?2p11.?2)(SRY+)Karyotype shows no abnormality
in a female. In situ hybridization shows that the SRY probe is present on one
chromosome 7, in band 7q22, by DAPI banding analysis. As the rearrangement is
cryptic, the subbands of the inserted Y chromosome material could not be elucidated
by metaphase in situ hybridization alone and further testing would be
required, e.g., microarray.
ix. 46,XX,t(2;17)(q32;q24)[20].ish
t(2;17)(q32;q24.3)(AC005181+;AC005181+)[20]Karyotype of a neoplastic sample
shows a translocation involving chromosomes 2 and 17 in a female. Metaphase in
situ hybridization shows that the translocation disrupts 17q24.3, corresponding to
BAC clone AC005181, resulting in a probe signal on both derivative
chromosomes. Note: the in situ hybridization further clarifies the 17q breakpoint
although this is not visible on G-banding.
x. 47,XY,+[Link] der(8)(D8Z2+) Karyotype shows a supernumerary marker
chromosome in a male. Metaphase in situ hybridization, using an alpha satellite probe
for chromosome 8, shows that the marker is derived, at least in part, from chromosome
8. Breakpoints could not be determined, and the composition of the derivative
chromosome could not be elucidated fully.
xi. 46,[Link] dup(17)(p11.2p11.2)(RAI1++) An apparently normal male karyotype.
Metaphase in situ hybridization shows a tandem duplication of the region containing
the RAI1 gene on chromosome 17. There is one probe signal in the homologous
chromosome 17, not indicated in the ISCN description.

119
 xii. 46,XX[20].ish inv(21)(q11.2q22.1)(q11.2)(RUNX1+)(q22.1)(RUNX1–)[5]An
apparently normal female karyotype in a neoplastic sample. In situ hybridization
shows a cryptic inversion of the segment 21q11.2 to 21q22.1 using a probe for
the RUNX1 gene. Note: the inversion breakpoints are given in separate parentheses to
clarify the inversion.
xiii. ish del(22)(q11.2q11.2)(D22S75–,ARSA+) ,del(22)(q11.2q11.2)(D22S75–
,ARSA+) Karyotype has not been performed. Metaphase in situ hybridization with a
probe for the D22S75 locus shows an interstitial deletion within the 22q11.2 deletion
syndrome critical region in both chromosomes 22. Note: the presence of the control
probe determines that the losses are interstitial. It is optional to use underlining (_) to
differentiate between the two homologues.
xiv. 47,XX,+[Link] mar(Acro-p+)Karyotype shows a supernumerary marker
chromosome in a female. In situ hybridization using the Acro-p probe shows that the
marker chromosome has a single acrocentric short arm region derived from an
acrocentric chromosome of unknown origin.
xv. 47,XY,+[Link] mar(Acro-p+,Acro-p+)Karyotype shows a male karyotype with a
supernumerary marker chromosome. In situ hybridization using the Acro-p probe
shows a probe signal on both ends of the marker chromosome. The marker
chromosome is bisatellited and derived from an acrocentric chromosome(s) of
unknown origin.
xvi. 46,XY,ins(5;2)(p14;q22q32).ish ins(5;2)(wcp2+;wcp2+)Karyotype shows a balanced
direct insertion of a chromosome 2 segment into the short arm of chromosome 5.
Metaphase in situ hybridization using chromosome 2 whole chromosome paint
confirmed the presence of the chromosome 2 segment.
xvii. 46,XY,ins(5;2)(p14;q32q22).ish der(5)ins(5;2)(wcp2+)Karyotype shows an inverted
insertion of a chromosome 2 segment into the short arm of chromosome 5.
Metaphase in situ hybridization using chromosome 2 whole chromosome paint
confirmed the presence of the chromosome 2 segment inserted into the short arm of
chromosome 5.
xviii. 46,XX,add(4)(q31).ish der(4)dup(4)(q31q3?4)(wcp4+) add(4)(q3?4)(wcp4–
) Karyotype shows material of unknown origin replacing distal chromosome 4 from
band 4q31 to 4qter. In situ hybridization using a whole chromosome paint 4 shows that
the proximal part of the additional material is derived from chromosome 4.
Conventional karyotype review in conjunction with the in situ hybridization result
suggests a duplication of the bands 4q31 to probably 4q34. However, there is
additional material distal to the duplication which does not hybridize with whole
chromosome 4 paint and is therefore of unknown origin. Note: the karyotype could be
rewritten to reflect the in situ hybridization information.

7.2.4 Abnormal Signal Pattern with Multiple Probes

i. 46,X,+[Link] r(X)(wcpX+,DXZ1+) Karyotype shows a female with a single X

chromosome, and a ring chromosome of unknown origin. The ring chromosome is
shown to be derived from the X chromosome by in situ hybridization using a whole X
chromosome paint and an alpha satellite probe, DXZ1. The breakpoints of the ring
could not be determined.

120
 ii. 46,XX,dup(5)(p15.3p14).ish
dup(5)(wcp5+,D5S721/D5S23+,D5S721/D5S23+)Karyotype shows a duplication in
the short arm of chromosome 5 from 5p15.3 to 5p14 in a female. Metaphase in
situ hybridization shows a non-tandem duplication where one of the D5S721/D5S23+
probe signals is present near the telomere and the other is more centromeric. As the
duplication is non-tandem the probes are separated by a comma in the ISCN
description. There is one signal on the homologous chromosome 5, not indicated in
the ISCN description.
iii. 46,XX,del(15)(q11.2q13).ish del(15)(SNRPN–,D15S10–) Karyotype shows an
interstitial deletion of chromosome 15 involving the segment 15q11.2 to 15q13. In
situ hybridization using the SNRPN and D15S10 probes confirms deletion of the
Prader-Willi/Angelman region.
iv. 46,[Link] del(15)(q11.2q11.2)(SNRPN–,D15S10–) Karyotype shows no abnormality
in a male. In situ hybridization using SNRPN and D15S10 probes shows microdeletion
within the Prader-Willi/Angelman region of chromosome 15.
v. 47,XX,+[Link] add(16)(p?)(wcp16–,D16Z2+,wcp16+) Karyotype shows a
supernumerary marker chromosome in a female. The chromosome 16 whole
chromosome paint and the chromosome 16 alpha satellite probe (D16Z2) show that
the marker is derived in part from chromosome 16. Additional material of unknown
origin is present in the marker.
vi. 47,XY,+[Link] der(17)(wcp17+,D17Z1+) Karyotype shows a supernumerary marker
chromosome in a male. The chromosome 17 whole chromosome paint and a
chromosome 17 specific alpha satellite probe (D17Z1) show that the marker is derived
from chromosome 17.
vii. 46,XX[20].ish ins(15;17)(q24.1;q21q21)(PML+,RARA+;RARA+)[5]Karyotype of a
neoplastic sample shows no abnormality in a female. A cryptic insertion of the segment
17q21 from the long arm of chromosome 17 into the 15q24.1 band of the long arm of
chromosome 15 is shown using in situ hybridization with the dual-color, dual-fusion
PML/RARA probe set. The breakpoint on chromosome 17 is within the RARA probe
resulting in a signal on the derivative chromosome 15 and on the derivative
chromosome 17.
viii. 46,XX[20].ish
t(12;21)(p13.2;q22.1)(RUNX1+,ETV6+;RUNX1+,ETV6+)[5]Karyotype of a
neoplastic sample shows no abnormality in a female. Metaphase in situ hybridization
with the dual-color, dual-fusion ETV6/RUNX1 probe set shows
an ETV6::RUNX1 gene fusion from a cryptic reciprocal translocation between
chromosomes 12 and 21.
ix. 47,XY,+der(4)t(4;11)(q21;q23),t(4;11)[20].ish
der(4)(3′KMT2A+),t(4;11)(3′KMT2A+;5′KMT2A+,3′KMT2A–)[5]Karyotype of a
neoplastic sample shows a male karyotype with a t(4;11) plus an extra copy of the
der(4). In situ hybridization with a dual-color, break-apart KMT2A probe shows a
3′KMT2A probe signal on both copies of the der(4), and a 5′KMT2A probe signal on
the derivative chromosome 11 of the t(4;11).
x. 46,XX,inv(16)(p13.1q22)[20].ish
inv(16)(p13.1)(CBFB+,MYH11+)(q22)(CBFB+,MYH11+)[5]Karyotype of a
neoplastic sample shows an inversion of chromosome 16 in a female. The pericentric

121
 inversion between bands 16p13.1 and 16q22 is confirmed by dual-color, dual-fusion in
situ hybridization probes for the MYH11 and CBFB genes.
xi. 46,XY,t(9;22)(q34;q11.2)[20].ish t(9;22)(ABL1−;BCR+,ABL1+)[5]Karyotype of a
neoplastic sample shows a translocation between chromosomes 9 and 22 in a male. A
dual-color, single-fusion ABL1/BCR in situ hybridization probe set shows that the
ABL1 probe signal is lost from the derivative chromosome 9 and is present on the
derivative chromosome 22 distal to the BCR probe signal.
xii. 47,XY,t(9;22)(q34;q11.2),+der(22)t(9;22)[20].ish
t(9;22)(ABL1−;BCR+,ABL1+),der(22)(BCR+,ABL1+)[5]Karyotype of a neoplastic
sample shows a translocation between chromosomes 9 and 22 and an extra copy of the
der(22) in a male. A dual-color, single-fusion ABL1/BCR in situ hybridization probe
set shows that the ABL1 probe signal is missing from the derivative chromosome 9
and is present on both derivative chromosomes 22 distal to the BCR probe signal.
xiii. 46,XX,t(9;22)(q34;q11.2)[10].ish
t(9;22)(ABL1+,BCR+;BCR+,ABL1+)[5]Karyotype of a neoplastic sample shows a
translocation between chromosomes 9 and 22 in a female. A dual-color, dual-fusion
ABL1/BCR probe set shows one signal for the ABL1 probe and one signal for the
BCR probe on each derivative chromosome by in situ hybridization.
xiv. 46,XX,t(9;22)(q34;q11.2)[20].ish der(9)t(9;22)del(9)(q34q34) (ABL1–
,BCR+),der(22)t(9;22)(BCR+,ABL1+)[5]Karyotype of a neoplastic sample shows a
translocation between chromosomes 9 and 22 in a female. A dual-color, dual-fusion
ABL1/BCR in situ hybridization probe set shows loss of the ABL1 probe signal from
the derivative 9 that is not detected by chromosome analysis.
xv. 46,XX,t(9;22)(q34;q11.2)[20].ish der(9)t(9;22)del(9)(q34q34)(ASS1–,ABL1–
,BCR+),der(22)t(9;22)(BCR+,ABL1+)[5]Karyotype of a neoplastic sample shows a
translocation between chromosomes 9 and 22 in a female. A tricolor dual-fusion ASS1,
ABL1, and BCR probe set shows loss of the ASS1 and ABL1 probe signals from the
derivative 9 by in situ hybridization, that is not detected by chromosome analysis.
xvi. 47,XX,t(9;22;10)(q34;q11.2;q22),+der(22)t(9;22;10)[20].ish
der(9)t(9;22;10)del(9)(q34q34)(ABL1–),der(10)t(9;22;10)del(22)(q11.2q11.2)(BCR–
),der(22)t(9;22;10)×2(BCR+,ABL1+)[5]A female karyotype shows a three-way
translocation between chromosomes 9, 22 and 10, and an additional copy of the
derivative chromosome 22 in a neoplastic sample. In situ hybridization with a dual-
color, dual-fusion ABL1/BCR probe set shows a conjoined BCR and ABL1 signal on
both copies of the derivative chromosome 22, with loss of an ABL1 probe signal from
the derivative chromosome 9 and a BCR probe signal from the derivative chromosome
10. The individual derivative chromosomes are listed in the ISCN description as there
is a deletion on the der(9) with loss of the ABL1 probe signal. Note: there are two
copies of the derivative chromosome 22 with identical in situ hybridization results.
xvii. 46,XX,t(9;22;10)(q34;q11.2;q22)[21].ish
der(9)t(9;22;10)del(9)(q34q34)(wcp9+,ABL1–
,wcp10+),der(10)t(9;22;10)del(22)(q11.2q11.2)(wcp10+,BCR–
,wcp22+),der(22)t(9;22;10)(wcp22+,BCR+,ABL1+,wcp9+)[10]Same example as
above but with whole chromosome paints included in the ISCN description.
xviii. 46,X,?i(Y)(p10).ish idic(Y)(q11.?21)(SRY+,DYZ3+,DYZ1–,DYZ3+,SRY+) A male
karyotype shows a presumed isochromosome for the short arm of the Y

122
 chromosome. In situ hybridization shows a probable breakpoint in Yq11.21 as there
are two signals for the SRY probe, and the Y chromosome centromere (DYZ3) but no
Yq12 alpha satellite (DYZ1) signal. Note: the rearrangement is demonstrated to be an
isodicentric Y chromosome by in situ hybridization. The karyotype could be altered to
reflect the structure as identified by in situ hybridization.
xix. 46,XX,t(2;17)(q32;q24)[20].ish t(2;17)(q32;q24.3)(RP11–76G4+;RP11–
134J16+,RP11–76G4–)[20]Karyotype of a neoplastic sample shows a translocation
between the long arms of chromosomes 2 and 17 in a female. The breakpoint is located
between the BAC clones RP11–134J16 at 17q24.3 and RP11–76G4 at 17q25.1. The
translocation results in RP11–76G4 moving to chromosome 2, with retention of RP11–
134J16 on chromosome 17 as shown by in situ hybridization.
xx. 45,XY,der(14;21)(q10;q10).ish
dic(14;21)(p11.2;p11.2)(D14Z1/D22Z1+;D13Z1/D21Z1+) Karyotype shows a
Robertsonian translocation involving chromosomes 14 and 21 in a male. The
translocation is shown to be dicentric by C-banding and in situ hybridization. The
breakpoints are given in the ish ISCN description as they are more accurate than those
obtained by banding.
xxi. 47,XY,+[Link] der(17)add(17)(p11.2)del(17)(q1?1.2)(wcp17–
,wcp17+,CMT1A+,D17Z1+) Karyotype shows a supernumerary marker chromosome
in a male. The marker is identified by metaphase in situ hybridization to be derived
from the short arm of chromosome 17 using whole chromosome paint 17 and probes
for the CMT1A gene and D17Z1. Additional material of unknown origin has replaced
the segment distal to 17p11.2 and there is a loss of the long arm segment distal to
region 17q1 probably 17q11.2.
xxii. 46,[Link] del(15)(q11.2q12)(D15S11+,SNRPN–,D15S10–,GABRB3+) Karyotype
shows no abnormality in a male. In situ hybridization using probes for D15S11,
SNRPN, D15S10 and GABRB3 shows an interstitial microdeletion of chromosome 15
defined by loss of the SNRPN and D15S10 probes, and retention of the D15S11 and
GABRB3 probes.
xxiii. 46,X,r(X)(p22.3q22).ish r(X)(KAL1+,DXZ1+,XIST+,DXZ4–) Karyotype shows a
ring X chromosome and metaphase in situ hybridization confirms that it includes the
KAL1 probe (ANOS1 gene) on the X chromosome short arm, the X alpha satellite
DXZ1 probe and the XIST probe on the X chromosome long arm. It does not include
DXZ4 at Xq23. The breakpoints in the ISCN description are obtained using
information from in situ hybridization and review of the G-banded chromosome
structure.
xxiv. 47,XX,+[Link] der(18)t(18;19)(wcp18+,D18Z1+,wcp19+) Karyotype shows a
supernumerary marker chromosome in a female. In situ hybridization using whole
chromosome paints for chromosomes 18 and 19, and an 18 alpha satellite probe
(D18Z1), shows that the marker is derived from chromosome 18 (including the
centromere) and from chromosome 19.
xxv. 47,XY,+dic(15;15)(q11.1;q11.1).ish dic(15;15)(D15Z1+,D15Z4+,SNRPN–;SNRPN–
,D15Z4+,D15Z1+)Karyotype shows a supernumerary dicentric chromosome 15 in a
male. The dicentric chromosome 15 shows a signal for the probes D15Z1 and D15Z4
on each chromosome arm by metaphase in situ hybridization but lacks the SNRPN
probe. Note: a short arm polymorphism of one chromosome 15 differentiates the

123
 homologues and demonstrates the abnormality is a dicentric chromosome (formed
from two chromosomes) rather than an isodicentric chromosome (formed from a sister
chromatid exchange).
xxvi. 46,XX,del(13)(q12q14)[20].ish 4p16.3(FGFR3)×2[10],del(13)(D13S319–
)[10],14q32(IGH)×2[10]Karyotype of a neoplastic sample shows an interstitial 13q
deletion in a female. In situ hybridization probes for the IGH::FGFR3 rearrangement
show a normal signal pattern. The LAMP1 control probe in 13q34 is not reported
because it adds no information additional to the karyotype and the D13S319 in
situ hybridization results.
xxvii. 46,[Link] t(4;11)(p16.3;p15)(dj908H22+,CTC-36P21–,WHS+,D4Z1+;CTC-
36P21+,dj908H22–)Karyotype shows no abnormality in a female. A cryptic reciprocal
translocation between chromosomes 4 and 11 is identified by in situ hybridization. The
derivative chromosome 4 shows presence of the 11p subtelomere probe (dj908H22)
signal, loss of the 4p subtelomere probe (CTC-36P21) signal, presence of the signal
for the Wolf-Hirschhorn syndrome critical region (WHS) and the presence of the
chromosome 4 alpha satellite probe signal (D4Z1). The derivative chromosome 11
shows presence of the chromosome 4p subtelomere (CTC-36P21) signal, and loss of
the 11p subtelomere probe (dj908H22) signal.
xxviii. 46,[Link] der(4)t(4;11)(p16.3;p15)(dj908H22+,CTC-36P21–
,WHS+,D4Z1+)dmatKaryotype of a child who has inherited a normal chromosome 4,
two normal chromosomes 11 and the derivative chromosome 4 of the maternal cryptic
balanced translocation described in the example above. The in situ hybridization
results of the der(4) are the same as der(4) of the mother. For explanation of
inheritance nomenclature see Section 4.2.1.
xxix. 46,XX,add(4)(p16.3).ish dup(4)(wcp4+,RP11–1076P8+,WHS+,RP11–
1076P8+,WHS+) Karyotype shows additional material of unknown origin attached at
band 4p16.3 in a female. In situ hybridization using a whole chromosome paint 4,
shows that the extra chromatin is derived from chromosome 4. The additional material
is determined to be a duplication involving 4p16.3 by in situ hybridization. The
duplicated segment is in the original orientation. The duplicated chromosome contains
two copies of the region covered by the RP11–1076P8 BAC probe at 4p16.3, and a
probe for the Wolf-Hirschhorn syndrome critical region in the original orientation
relative to 4pter. Note: the order of probes is given according to their relative
position pter to qter on the derivative chromosome.
xxx. 46,XX,add(4)(p16.3).ish dup(4)(wcp4+,RP11–1076P8+,WHS+,WHS+,RP11–
1076P8+) Karyotype shows extra material replacing the distal short arm of one
chromosome 4 from 4p16.3 in a female. In situ hybridization using a whole
chromosome paint 4 shows that the extra chromatin is derived from chromosome 4.
The additional material is determined to be an inverted duplication involving 4p16.3
by in situ hybridization. The duplicated chromosome contains two copies of the region
covered by the RP11–1076P8 BAC probe and a probe for the Wolf-Hirschhorn
syndrome critical region. The duplicated region is in the reverse orientation relative to
4pter.
xxxi. 46,XX,t(6;11)(q23;q22).ish t(6;11)(RP4–609N19+,RP11–226I21–,RP11–
469N6+;RP11–652O18+,RP11–469N6–,RP11–226I21+)Karyotype shows a
reciprocal translocation between chromosome 6 and chromosome 11 in a female. In

124
 situ hybridization using subtelomeric probes shows a translocation of the chromosome
11 long arm subtelomeric probe, RP11–469N6, to the long arm of chromosome 6, and
of the chromosome 6 long arm subtelomeric probe, RP11–226I21, to the long arm of
chromosome 11. The positions of the subtelomeric probe for the chromosome 6 short
arm, RP4–609N19, and the subtelomeric probe for the chromosome 11 short arm,
RP11–652O18, are unchanged.
xxxii. 46,XX,t(14;18)(q32;q21)[20].ish
t(14;18)(IGH+,BCL2+;BCL2+,IGH+)[20]/der(14)t(14;18)del(14)(q32)(IGH–
,BCL2–),der(18)t(14;18)(BCL2+,IGH+)[10]Karyotype of a neoplastic sample with a
translocation involving chromosomes 14 and 18 at bands 14q32 and 18q21.
Metaphase in situ hybridization shows two clones. A balanced translocation between
chromosomes 14 and 18 present in 20 metaphases and a second clone with deletion of
the derivative chromosome 14 in a further ten metaphases.

7.2.5 Use of Diminished (dim) and Enhanced (enh) in Metaphase in situ Hybridization

i. 46,[Link] 17p11.2(RAI1)enhKaryotype shows no abnormality in a female. An

enhanced signal is observed at band 17p11.2 by metaphase in situ hybridization using
the RAI1 probe. The probe signal appears larger on one chromosome 17 compared to
the probe signal on the homologous chromosome 17.
ii. 46,X,del(X)(p11.4p11.2).ish del(X)(p11.4p11.22)(RP11–265P11,RP1–
112K5)dim Karyotype shows deletion of the short arm of the X chromosome in a
female. The in situ hybridization signals of BAC clones RP11–265P11 (Xp11.4) and
RP1–112K5 (Xp11.22) are consistently less intense on the deleted X chromosome than
on the normal homologue, indicating that part of each probe region is deleted and
therefore identifying the proximal and distal breakpoints respectively. Note: the
karyotype breakpoints have not been changed due to the lower level of resolution of
the banded chromosomes.

7.2.6 Subtelomeric Metaphase in situ Hybridization

Subtelomeric in situ hybridization may be performed in panels so that the 41 unique

chromosome ends are hybridized simultaneously.

[Link] Normal Signal Pattern

A normal result using a subtelomeric in situ hybridization panel is given using the
short system (karyotype format), for example:

i. ish (subtel41)×2 Metaphase in situ hybridization shows a normal result with probes to
the 41 subtelomeric regions.
ii. ish 1p36.33(CEB108/T7)×2,4p16.3(GS10K2/T7)×2Targeted metaphase in
situ hybridization shows two copies of the subtelomeric regions of 1p and 4p
representing a normal finding in a relative of a translocation carrier.
iii.

125
[Link] Abnormal Signal Pattern

i. ish t(13;20)(q34;p13)(163C9–,dj1061L1+;163C9+,dj1061L1–)Metaphase in
situ hybridization confirms a balanced translocation between the distal long arm of
chromosome 13 and the distal short arm of chromosome 20 using the 13q subtelomere
probe, 163C9, and the 20p subtelomere probe, dj1061L1.

i. ish der(13)t(13;20)(q34;p13)(163C9–,dj1061L1+) Metaphase in situ hybridization

confirms an unbalanced translocation between the distal long arm of chromosome 13
and the distal short arm of chromosome 20. The subtelomeric region of 13q (163C9
probe) is deleted and replaced with the subtelomeric region of 20p (dj1061L1 probe).
ii. 46,XY,rec(4)dup(4p)inv(4)(p16.1q34)[Link] rec(4)dup(4p)(D4S3359+,D4S2930–
,D4S3359+)Karyotype shows a recombinant chromosome 4 derived from a maternal
pericentric inversion of chromosome 4. Metaphase in situ hybridization confirms the
recombinant chromosome 4. There is a duplication of 4pter to 4p16.1 seen with the
D4S3359 probe, and a deletion from 4q35 to 4qter seen with the D4S2930 probe. For
explanation of the inheritance nomenclature see Section 4.2.1.

7.2.7 Multicolor Chromosome Painting

Multicolor FISH banding and 24 color karyotyping are techniques used to paint
chromosomes with a distinct color or spectrum of colors. They can be used as a tool to
clarify the G-banded analysis. The karyotype can be rewritten based on the knowledge
gained from the results of these techniques. The use of these techniques should be
stated in the report. Nomenclature for wcp (see Sections 7.2.1, 7.2.3 and 7.2.4) may be
used.

7.2.8 Partial Chromosome Painting

Probes that are band specific or arm specific can be used as partial chromosome
paints (pcp). The nomenclature is similar to that of wcp (see Sections
7.2.1, 7.2.3 and 7.2.4).

i. 46,XX,?dup(18)(p11.3p11.2).ish dup(18)(pcp18p+) Karyotype shows a suspected

tandem duplication on 18p that is confirmed by in situ hybridization using a partial
chromosome paint for 18p.
ii. 46,XY,inv(8)(p21q13).ish inv(8)(pcp8p+,pcp8p+) Karyotype shows an inversion of
chromosome 8 that is confirmed by in situ hybridization using a partial chromosome
paint for 8p.
iii. 46,X,r(X)(p22.1q13).ish r(X)(pcpXp+,DXZ1+,pcpXq+,XIST+)Karyotype with a
ring X chromosome that is confirmed by in situ hybridization using partial
chromosome paints for Xp and Xq to consist of short and long arm material of the X
chromosome. The X chromosome pericentromeric region is identified by DXZ1 and
the presence of XIST is confirmed by use of the gene probe.

126
7.3 Interphase/Nuclear in situ Hybridization (nuc ish)

7.3.1 Principles and Rules

a. Interphase in situ hybridization (nuc ish) includes the number of signals and their
positions relative to each other.
b. See also Section 7.1.1 for general rules and principles that also apply for nuc ish.
c. In ISCN 2024 the chromosome band location is not included in the nuc ish ISCN
description as the physical chromosome location cannot be seen in interphase nuclei as
there are no chromosome bands.
d. To indicate the number of signals in interphase nuclei, the abbreviation nuc ish is
followed by a space and then the probe designation in parentheses, a multiplication (×)
sign, and the number of signals seen.
e. If probes for two or more loci are used in the same hybridization, they follow one another
in a single set of parentheses, separated by a comma (,), and a multiplication (×) sign
outside the parenthesis if the copy number is the same for all probes, and inside the
parenthesis when the number of signals differs between probes.
f. Results from different hybridizations are presented in separate sets of parentheses even
if all show a normal signal pattern.
g. The probes from the same chromosome number are listed from pter to qter according
to their normal chromosome location, and are separated by a comma (,).
h. For a single locus with probes at the 5′ and 3′ end of a gene, the probes should be listed
as they reside on the normal chromosome from pter to qter and separated by
a comma (,). The chromosome order of 5′ and 3′ probes may need to be verified from
the manufacturers’ data sheet.
i. Separation of colocalized or adjacent probes is indicated by the abbreviation (sep).
Probes that become connected (conjoined) because of genomic rearrangement are
indicated using the abbreviation (con).
j. The double colon (::) is not used in the nuc ish ISCN description to indicate fusion
gene formation.
k. The number of nuclei analyzed is given in square brackets ([ ]) after the ISCN
description in all neoplastic studies and in mosaic constitutional studies and is not given
where non-mosaic results are observed in constitutional studies.
l. When normal and abnormal nuclei are found, the number of abnormal nuclei is listed
over the total number of nuclei analyzed (the denominator) for each abnormal probe.
Normal nuclei are not listed as it is implied that they are the remainder of the total. The
exception to this rule is in the determination of the sex chromosome complement of an
individual where the normal cell line is listed last. In this situation the total number of
nuclei reported is equal to the denominator (see Section [Link]).
m. Caveats of techniques, for example the semi-quantitative nature of interphase in
situ hybridization in tissue sections or the design of a particular probe, are not indicated
in the nomenclature and should be stated in the interpretive text of the report.

127
7.3.2 Normal Interphase Signal Pattern

i. nuc ish (D21S259/D21S341/D21S342)×2 Interphase in situ hybridization shows two

signals for the D21S259/D21S341/D21S342 probe.
ii. 46,XY[20].nuc ish (TP53)×2[200]Karyotype shows no abnormality in 20 metaphases
in a neoplastic sample in a male. Interphase in situ hybridization shows a normal
hybridization pattern in 200 nuclei using a probe for the TP53 gene.
iii. nuc ish (ANOS1,D21S65)×2Interphase in situ hybridization shows two signals for
the ANOS1 gene, using the ANOS1 probe and two signals for D21S65.
iv. nuc ish (ABL1,BCR)×2[200]Interphase in situ hybridization shows two signals for
each of ABL1 and BCR genes in 200 nuclei in a neoplastic sample.
v. 46,XY[20].ish 9q34(ABL1)×2 ,22q11.2(BCR)×2[20].nuc ish
(ABL1,BCR)×2[100],(TP53)×2[200]Karyotype of a neoplastic sample shows no
abnormality in 20 metaphases in a male. A normal in situ hybridization pattern is
present in 20 metaphases and 100 nuclei using probes for the ABL1 and BCR genes
and in 200 interphase nuclei using a probe for the TP53 gene.
vi. nuc ish (D17Z1,ERBB2)×2[100]Interphase in situ hybridization shows two signals for
the centromere 17 probe, D17Z1, and two signals for ERBB2 (HER2), in 100 nuclei in
a neoplastic sample.
vii. nuc ish (ETV6×2,RUNX1×3c)[200]Interphase in situ hybridization with a dual-color,
dual-fusion ETV6/RUNX1 probe does not show rearrangement
of ETV6 and RUNX1 in 200 nuclei in a neoplastic sample from an individual with
constitutional trisomy 21.
viii. nuc ish (ATM,TP53)×2[200],(D12Z3,D13S319,LAMP1)×2[200]Interphase in
situ hybridization shows normal signal patterns in hybridizations with different probe
sets in a neoplastic sample. Note: the hybridizations are listed in separate sets of
parentheses even when equal numbers of nuclei are scored, and the signal patterns are
the same. Reporting of the LAMP1 control probe is optional but may be preferred in
neoplastic studies to confirm chromosome copy number.

7.3.3 Abnormal Interphase Signal Pattern

i. nuc ish (D21S65)×3 Interphase in situ hybridization shows three signals for the
21q22.12 probe, D21S65.
ii. nuc ish (DXZ1×3,SRY×0) Interphase in situ hybridization shows three signals for
DXZ1 in all nuclei. The SRY probe signal pattern is given as this is clinically relevant
for sex determination.
iii. nuc ish (D20Z1×2,D20S108×1)[100/200]Interphase in situ hybridization shows one
signal for D20S108, normally located at 20q12, and two signals for the pericentromeric
D20Z1 probe signal in 100 nuclei of 200 scored in a neoplastic sample.
iv. nuc ish (D21S65,D21S64)×3Interphase in situ hybridization shows three signals for
the 21q22.12 probe, D21S65, and three signals for D21S64 at 21q22.13.
v. nuc ish (D13S319×0,LAMP1×2)[50/200]Interphase in situ hybridization of a
neoplastic sample shows homozygous deletion of the 13q14.2 probe, D13S319, in 50
of 200 nuclei. A normal signal pattern is observed in 150 interphase nuclei. The control
probe at 13q34 (LAMP1) is shown to confirm chromosome 13 copy number.

128
 vi. nuc ish (STS,KAL1,DXZ1)×1Interphase in situ hybridization shows one copy of each
probe signal, listed as they appear on the normal X chromosome, pter to qter.
vii. nuc ish
(TP73×1,ANGPTL×2)[107/200],(ZNF443×2,GLTSCR1×1)[105/200]Interphase in
situ hybridization shows one signal with the 1p36.32 probe, TP73, and two signals
with the 1q25.2 probe, ANGPTL, in 107 nuclei. A second hybridization shows two
signals with the 19p13.2 probe, ZNF443, and one signal with the 19q13.33
(BICRA gene) probe, GLTSCR1, in 105 interphase nuclei. Thus, the neoplastic
specimen shows loss of both 1p and 19q.
viii. nuc ish (ATM,TP53)×2[100],(D12Z3×3,D13S319×2,LAMP1×2)[50/100]Two
separate in situ hybridizations are performed on a neoplastic sample. In the first, there
is a normal hybridization pattern with two signals for each of the ATM and TP53
probes in all 100 nuclei. In the second hybridization, there are three signals for the
D12Z3 probe and two signals each for the probes for D13S319 and LAMP1 in 50 of
100 nuclei. It is not critical to include the control probe (LAMP1) in the ISCN
description, but it is included here to confirm chromosome 13 copy number.
ix. nuc ish (ATM×1,TP53×2)[100/200],(D12Z3×3,D13S319×2,LAMP1×2)[50/200]Two
separate in situ hybridizations are performed on a neoplastic sample. In the first, loss
of one ATM signal is observed in 100 nuclei. The 100 remaining nuclei show a normal
signal pattern. In the second hybridization, there is gain of a signal for D12Z3 in 50
nuclei. A normal signal pattern is shown in 150 interphase nuclei. Note: D13S319,
LAMP1 and TP53 probes each show a normal hybridization pattern in 200 nuclei. The
LAMP1 control probe is included in the ISCN description as it is informative regarding
chromosome 13 copy number.
x. nuc ish
(DXZ1×1,DYZ3×1,D18Z1×2),(RB1×2,D21S259/D21S341/D21S342×3)[60/150]Int
erphase in situ hybridization in a male showed two copies of chromosomes 13 and 18
plus mosaicism for trisomy 21. Note: cells numbers are not given for the X, Y and 18
probe set as the three probes show a normal signal pattern.

[Link] Order of Cell Lines and Clones in nuc ish

a. Abnormal cell lines and clones detected by in situ hybridization are listed from largest
to smallest number of nuclei. The exception is that the normal cell line is listed last
when it is given to show the sex chromosome complement.
b. Where two or more abnormal cell lines/clones are present in equal numbers their order
of listing is determined by the following rules (shown in order of application):
• Where the abnormality in different cell lines/clones involves probes on different
chromosomes then the chromosome order rule applies (X before Y) followed by
autosomes in increasing number.
• Where the abnormality in different cell lines/clones involves the same probe on the same
chromosome then the gain before loss before structural change rule applies.
• Where the same type of abnormality in different cell lines/clones involves different
probes on the same chromosome then the pter to qter rule applies.
• Where different abnormal signal patterns are present in an equal number of nuclei for
the same probe set, the least complex cell line/clone is described first.

129
 v. nuc ish
(DXZ1×1,DYZ3×0)[12/50]/(DXZ1×1,DYZ3×2)[6/50]/(DXZ1,DYZ3)×1[32/50]Interp
hase in situ hybridization shows a single DXZ1 signal in 12 nuclei, and six nuclei show
one DXZ1 and two DYZ3 signals. There is one signal for each of DXZ1 and DYZ3 in
32 nuclei. Note: for sex chromosome mosaicism, an exception is made to include the
cell line with the normal complement (XY), and this cell line is listed last. The sum of
the numerators is equal to the denominator in this example because the results of the
normal cell line are included.
vi. nuc ish (D5S630,EGR1)×1[100/200]/(D5S630×2,EGR1×1)[50/200]Interphase in
situ hybridization shows two clones in a neoplastic sample: a concomitant loss of the
EGR1 signal and the D5S630 control probe (5p15) signal in 100 interphase nuclei,
consistent with monosomy 5, and loss of only the EGR1 signal, consistent with a
deletion of 5q, in 50 nuclei. A normal signal pattern for these probes is present in 50
nuclei. Note: the larger clone is listed first even though it likely evolved from the
smaller clone.
vii. nuc ish (D5S630×2,EGR1×1)[150/250]/(D5S630,EGR1)×1[100/250]Interphase in
situ hybridization of a neoplastic sample shows a signal pattern that is consistent with
deletion of 5q in 150 interphase nuclei, and a signal pattern consistent with monosomy
5 in 100 nuclei. There are no nuclei with a normal signal pattern. Note: the larger clone
is listed first.
viii. nuc ish (D5S630,EGR1)×1[50/200]/(D5S630×2,EGR1×1)[50/200]Interphase in
situ hybridization of a neoplastic sample shows equal numbers of interphase nuclei
with signal patterns indicating loss of D5S630 at 5p15.31 and loss of EGR1 at 5q31.2
in one clone and loss of EGR1 only in the second clone. There is insufficient information
regarding chromosome structure to indicate whether the first clone represents a deletion
in both chromosome arms, or whether it represents monosomy 5. A normal signal
pattern is present in the remaining 100 nuclei. Note: since the number of cells are equal,
the clone with the altered probe pattern closest to pter is listed first.
ix. nuc ish
(D5S630×2,EGR1×3)[50/200]/(D5S630,EGR1)×1[50/200]/(D5S630×2,EGR1×1)[50/
200]Interphase in situ hybridization of a neoplastic sample shows three clones of equal
size: 50 nuclei with gain of EGR1 at 5q31.2, and 50 nuclei with loss of D5S630
(5p15.31) and loss of EGR1. Fifty nuclei with loss of EGR1, and 50 nuclei show a
normal signal pattern. There is insufficient structural information to determine whether
the chromosome losses shown by in situ hybridization are simple deletions or more
complex chromosome rearrangements. Note: the clone with EGR1 gain is given before
the clones with EGR1 loss. Following the pter to qter rule, the clone with loss of
D5S630 and EGR1 is given next, followed by the clone with loss of only EGR1.
x. nuc ish (ATM×1,TP53×2)[100/200]/(ATM×2,TP53×1)[100/200]Interphase in
situ hybridization of a neoplastic sample shows two clones of equal size. Each has a
single abnormal probe pattern. In this case the clone with loss of ATM is listed before
that with loss of TP53 because they are listed in chromosome order for the abnormal
probes.
xi. nuc ish
(D13S319×1,LAMP1×2)[55/200]/(D13S319×2,LAMP1×1)[55/200]Interphase in
situ hybridization in this neoplastic sample shows two clones of equal size. The signal

130
 pattern in one clone is consistent with an interstitial loss within 13q14.3
(D13S319×1,LAMP1×2) and in the other clone, the signal pattern is consistent with an
apparently terminal deletion involving 13q34 (D13S319×2,LAMP1×1). A normal
signal pattern is present in 90 nuclei. Note: where two clones of equal size have the
same number of abnormal patterns affecting the same chromosome then the clone with
the abnormality closest to pter is listed before the clone with abnormality of a more
distal probe.
xii. nuc ish
(D13S319×0,LAMP1×2)[100/200]/(D13S319×1,LAMP1×2)[50/200]Homozygous
deletion of D13S319 at 13q14.3 is detected in 100 of 200 nuclei by interphase in
situ hybridization of a neoplastic sample. A heterozygous deletion is seen in 50 nuclei
and the remaining 50 nuclei show a normal signal pattern. Note: the larger clone is given
first, even though the smaller clone in this example is likely to represent the stem line.
The result of the control probe, LAMP1, is given to demonstrate that the first clone
represents homozygous interstitial deletion rather than nullisomy for chromosome 13.
xiii. nuc ish (D13S319×1,LAMP1×2)[100/200]/(D13S319×0,LAMP1×2)[100/200]In
situ hybridization shows two clones of equal size in a neoplastic sample. Heterozygous
deletion of D13S319 at 13q14.3 is detected in 100 nuclei and a homozygous deletion is
also seen in 100 nuclei. There are no nuclei with a normal signal pattern. Note: different
signal patterns are present in an equal number of nuclei for the same probe set, both
represent loss and so the least complex clone is given first.

7.3.4 Relative Position of Signals

a. To indicate relative signal positions in the interphase nucleus, the result is given in two
sets of parentheses, one following immediately after the other.
b. The total number of signals is given in the first set of parentheses and the relative
position of the signals to one another using (con) and (sep) is given in the second set of
parentheses.

131
[Link] Adjacent Probes

[Link].1 Normal Result

i. nuc ish (KAL1,STS)×2This is a normal result for in situ hybridization in a female. The
hybridization signals for the KAL1 probe (ANOS1) and STS probe signals are
normally adjacent because of close physical association of the respective loci
(ANOS1 and STS) on the X chromosome. There is a normal signal pattern of two
signals for each probe in a female.

[Link].2 Abnormal Result

i. nuc ish (KAL1,STS)×2(KAL1 sep STS)×1Interphase in situ hybridization shows two

signals for each probe. One KAL1 probe signal (ANOS1 gene) and one STS probe
signal are separated, presumably by chromosomal rearrangement and the other signals
show the normal juxtaposition.

132
[Link] Dual-Fusion Probes

[Link].1 Normal Signal Pattern

i. nuc ish (ABL1,BCR)×2[200]No abnormality is detected by interphase in

situ hybridization with a dual-color, dual-fusion ABL1/BCR probe set in a neoplastic
sample. The ABL1 and BCR genes reside on two separate chromosomes and
rearrangement is not apparent in 200 nuclei. The expected copy number for each (×2)
is given. Note: the ABL1 probe is listed before the BCR probe because they are listed
in chromosome order.

[Link].2 Abnormal Signal Pattern

i. nuc ish (ABL1,BCR)×3(ABL1 con BCR)×2[200]Interphase in situ hybridization of a

neoplastic sample using a dual-color, dual-fusion ABL1/BCR probe set shows an
abnormal pattern in 200 nuclei. There are three signals for each probe. There are two
conjoined ABL1 and BCR probe signals, consistent with a reciprocal translocation
between chromosomes 9 and 22 and formation of the BCR::ABL1 fusion gene and the
reciprocal ABL1::BCR. Note: signals associated with BCR::ABL1 and ABL1::BCR are
indistinguishable using this probe set.

133
ii. nuc ish (ABL1,BCR)×3(BCR con ABL1 con BCR)×1[100]Interphase in
situ hybridization of a neoplastic sample using a dual-color, dual-fusion ABL1/BCR
probe set shows an atypical rearrangement resulting one conjoined BCR/ABL1/BCR
signal in 100 nuclei. This signal pattern could occur if 3′ABL1 is inserted into BCR. RT-
PCR for the BCR::ABL1 chimeric transcript is recommended. There are also two
isolated ABL1 probe signals and one isolated BCR probe signal.

iii. nuc ish (ABL1,BCR)×2(ABL1 con BCR)×1[100]Interphase in situ hybridization of a

neoplastic sample using a dual-color, dual-fusion ABL1/BCR probe set shows one
conjoined ABL1 and BCR signal, most likely representing the BCR::ABL1 fusion
gene, one isolated ABL1 signal and one isolated BCR signal. This hybridization
pattern is consistent with loss of, most likely, the reciprocal ABL1::BCR fusion signal
in 100 nuclei.
iv. nuc ish (ABL1×2,BCR×3)(ABL1 con BCR)×1[100]Interphase in situ hybridization of
a neoplastic sample using a dual-color, dual-fusion ABL1/BCR probe set shows one
conjoined ABL1 and BCR probe signal. There is also one isolated ABL1 probe signal
and there are two isolated BCR probe signals. This result is consistent
with BCR::ABL1 fusion gene formation and loss of the ABL1 gene from one
chromosome, most likely the der(9)t(9;22).
v. nuc ish (ABL1,BCR)×4(ABL1 con BCR)×3[200]Interphase in situ hybridization of a
neoplastic sample using a dual-color, dual-fusion ABL1/BCR probe set shows three
conjoined ABL1 and BCR probe signals in 200 nuclei.

134
vi. nuc ish (IGH ×3,BCL2 ×2,BCL2amp)(IGH con BCL2)×1(IGH con
BCL2amp)×1[200]Interphase in situ hybridization of a neoplastic sample using a
dual-color, dual-fusion IGH/BCL2 probe set shows three IGH probe signals and two
BCL2 probe signals. There is also an amplified signal for the BCL2 probe in 200
nuclei. One IGH probe signal is conjoined with an amplified BCL2 probe signal. One
IGH and one non-amplified BCL2 signal are conjoined.

vii. nuc ish (IGH ×3,BCL2 ×2,BCL2amp)(IGH con BCL2)×2[180]Interphase in

situ hybridization of a neoplastic sample using a dual-color, dual-fusion IGH/BCL2
probe set shows an amplified BCL2 probe signal that is not conjoined with an IGH
probe signal. Two conjoined IGH and BCL2 probe signals and one additional IGH
probe signal are also present.

135
viii. nuc ish (PAX7×1,PAX7amp,FOXO1×1,FOXO1amp)(PAX7 con
FOXO1)amp[100]Interphase in situ hybridization of 100 nuclei of a neoplastic sample
using a dual-color, dual-fusion PAX7/FOXO1 probe set shows one normal signal for
the PAX7 and FOXO1 probes. There are also multiple copies of conjoined PAX7 and
FOXO1 probe signals that are too numerous to count.

ix. nuc ish (3′BCL6×2,5′BCL6×1)(3′BCL6 con

5′BCL6)×1[77/100],(MYC)×3[80/100],(MYC×2∼3,IGH×2∼4)[100],(3′BCL2×2∼3,
5′BCL2×2)(3′BCL2 con 5′BCL2)×1[78/100]Interphase in situ hybridization of a
neoplastic sample shows two signals for 3′BCL6 and one signal for 5′BCL6. One
3′BCL6 probe signal and one 5′BCL6 probe signal are conjoined leaving one isolated
3′BCL6 probe signal. The isolated 3′BCL6 probe signal may be evidence of an
interstitial deletion or unbalanced rearrangement involving the BCL6 gene. There are
three MYC probe signals identified using both a single break-apart MYC probe and a
dual-color, dual-fusion MYC/IGH probe set. The IGH probe shows two to four signals.
There is one normal BCL2 probe signal (with 3′ and 5′ components connected), one to
two isolated 3′BCL2 probe signals and one isolated 5′BCL2 probe signal. Note: ranges
of signal number may be given to simplify otherwise complex results, e.g.,
(MYC×2∼3,IGH×2∼4) can be given to indicate the signal patterns (MYC×2,IGH×3),
(MYC×2,IGH×4), (MYC×3,IGH×2), (MYC,IGH)×3 and (MYC×3,IGH×4).
Similarly, (3′BCL2×2∼3,5′BCL2×2)(3′BCL2 con 5′BCL2)×1 indicates that nuclei
have a single fusion and either two or three copies of 3′BCL2.
x. nuc ish (MYH11,CBFB)×3(MYH11 con CBFB)×2[100/200]Interphase in
situ hybridization of a neoplastic sample using a dual-color, dual-fusion
MYH11/CBFB probe set shows two conjoined MYH11 and CBFB signals in 100 of
200 interphase nuclei. The signal pattern shows no abnormality in the remaining 100
nuclei.
xi. nuc ish (ABL2)×2[200],(PDGFRB)×2[200],(ABL1,BCR)×3(ABL1 con
BCR)×2[120/330]/(ABL1,BCR)×4(ABL1 con
BCR)×3[120/330],(KMT2A)×2[200],(ETV6,RUNX1)×2[240],(IGH)×3[90/200],(TC
F3)×2[150]Interphase in situ hybridization of a neoplastic sample using multiple
probes and probe sets. The dual-color, dual-fusion ABL1/BCR probe set shows
conjoined ABL1 and BCR signals that are consistent with BCR::ABL1 fusion gene
formation in 120 interphase nuclei. A further 120 interphase nuclei in the same

136
 hybridization show gain of conjoined ABL1 and BCR signals, and 90 nuclei show a
normal signal pattern for the ABL1 and BCR probes. There is also gain of an IGH
signal in 90 of 200 nuclei scored. All other probes show a normal signal
pattern. Note: probes are listed in chromosome order and where different abnormal
signal patterns are present in an equal number of nuclei for the same probe set the least
complex clone is described first.
xii. 46,XY[20].ish 13q14(DLEU)×2 [10],13q34(LAMP1)×2 [10],14q32(IGH)×2
[6],16q23(MAF)×2 [6].nuc ish (DLEU×1,LAMP1×2)[17/200],(IGH,MAF)×3(IGH
con MAF)×2[15/200]Karyotype of a neoplastic sample shows no abnormality.
Metaphase in situ hybridization shows a normal result for two probes on chromosome
13 (DLEU and LAMP1) and a normal result for the dual-color, dual-fusion IGH/MAF
probe set. Interphase in situ hybridization identified a small clone with an interstitial
13q deletion involving 13q14, and a clone of similar size with conjoining of IGH and
MAF probe signals. Note: metaphases of the neoplastic clone(s) are not observed, and
the clones are identified only by interphase in situ hybridization.

[Link] Break-Apart Probes

a. The normal signal pattern for break-apart probes is given using the probe designation
without indicating the 5′ and 3′ components. For these probes the normal situation is
the presence of two fusion signals.
b. For abnormal results, the total number of probe signals is given in the first set of
parentheses and the relative position of the 5′ and 3′ signals to one another using (sep)
and (con) is given in the second set of parentheses.

137
[Link].1 Normal Signal Pattern

i. nuc ish (KMT2A)×2[200]Interphase in situ hybridization of a neoplastic sample with

a dual color break-apart KMT2A probe shows two KMT2A probe fusion signals in
200 interphase nuclei, no disruption of the KMT2A gene is detected. Note: the probe
designation, without indicating the 5′ and 3′ components, is recommended in the
normal setting even though it is acknowledged that the break-apart probes consist of a
5′ and a 3′ region.

ii. nuc ish (CBFB)×2[200]Interphase in situ hybridization of a neoplastic sample with a

dual color break-apart CBFB probe shows two CBFB probe fusion signals in 200
nuclei, no disruption of the CBFB gene is detected.

138
[Link].2 Abnormal Signal Pattern

Abnormal nuclei show separation of the two signal components of break-apart probes.

i. nuc ish (KMT2A)×2(5′KMT2A sep 3′KMT2A)×1 [200]Interphase in

situ hybridization of 200 nuclei in a neoplastic sample with a dual color break-apart
KMT2A probe shows two KMT2A probe signals. There is one intact
5′KMT2A/3′KMT2A probe signal and one signal has separated into the 5′KMT2A
probe and the 3′KMT2A probe components, presumably because of a translocation
involving the KMT2A gene. Note: that 5′ and 3′ probes are given for an abnormal
result.

ii. nuc ish (5′KMT2A×2,3′KMT2A×1)(5′KMT2A con 3′KMT2A)×1[180]Interphase in

situ hybridization of 180 nuclei in a neoplastic sample shows two 5′KMT2A probe
signals and one 3′KMT2A probe signal. There is one intact 5′KMT2A/3′KMT2A
signal and one isolated 5′KMT2A signal presumably because of a deletion involving
3′KMT2A or because there is a translocation resulting in 5′KMT2A-3′ partner gene,
with loss of the reciprocal derivative chromosome.
iii. nuc ish (3′ALK×2,5′ALK×1)(3′ALK con 5′ALK)×1[65/100]Interphase in
situ hybridization of a neoplastic sample with a dual color break-apart ALK probe
shows one intact 3′ALK/5′ALK probe signal and an isolated 3′ALK probe signal.
These abnormalities are detected in 65 of 100 interphase nuclei. No abnormality is
detected in 35 nuclei. Note: the probe components are listed
from pter to qter according to their position on the normal chromosome 2.
iv. nuc ish (3′IGH×0,5′IGH×2)[145/200]Interphase in situ hybridization of a neoplastic
sample with a dual color break-apart IGH probe shows two signals for the 5′IGH probe
and no signals for the 3′IGH probe, listed as they appear pter to qter on the normal
chromosome 14. This abnormality is detected in 145 of 200 interphase nuclei. No
abnormality is detected in 55 nuclei. Note: the relative position of the 3′ and 5′
components of the probe cannot be given since no 3′IGH probe signal is present.

139
 v. nuc ish (3′DDIT3×2,5′DDIT3×1,5′DDIT3amp)×1(3′DDIT3 con
5′DDIT3)×1(3′DDIT3 con 5′DDIT3amp)×1[192/200]Interphase in situ hybridization
of a neoplastic sample with a dual-color break-apart DDIT3 probe shows an
abnormal DDIT3 signal pattern with amplification of the 5′DDIT3 probe signal in 192
of 200 nuclei, i.e., there are two signals for the 3′DDIT3 probe, one single signal for
the 5′DDIT3 probe and an amplified 5′DDIT3 probe signal. There is normal
colocalization of one of the 3′DDIT3 probe signals and the single 5′DDIT3 probe
signal. There is also colocalization of a of 3′DDIT3 probe signal with the amplified
5′DDIT3 probe signal. No abnormality is detected in eight nuclei. Note: the 3′DDIT3
probe is listed before the 5′DDIT3 probe because it lies closer to pter on the normal
chromosome.

vi. nuc ish (3′IGH×2,5′IGH×3)(3′IGH con 5′IGH)×1[210/250]Interphase in

situ hybridization of a neoplastic sample with a dual-color break-apart IGH probe
shows an IGH rearrangement with an extra 5′IGH signal using the IGH break-apart
probe in 210 of 250 nuclei. No abnormality is detected in 40 nuclei. Note: the probe
components are listed from pter to qter as they would lie on the normal chromosome
14.
vii. nuc ish (CBFB)×2(5′CBFB sep 3′CBFB)×1[198]Interphase in situ hybridization of a
neoplastic sample with a dual-color break-apart CBFB probe shows two CBFB probe
signals, but one has separated into the 5′CBFB probe and 3′CBFB probe, presumably
because of an inversion or translocation. This signal pattern is present in all 198 nuclei
examined.
viii. nuc ish
(CDKN2C×2,CKS1B×3)[90/100],(FGFR3×2,IGH×3)[93/100],(MYC)×2[100],(CCN
D1×2,IGH×3)[85/100],(ATM,TP53)×2[100],(IGH)×2(3′IGH sep
5′IGH)×1[95/100],(IGH,MAF)×3(IGH con
MAF)×2[87/100],(IGH×3,MAFB×2)[91/100]Interphase in situ hybridization of a
neoplastic sample shows gain of 1q21.3 (CKS1B locus specific probe) in 90 nuclei
and conjoined IGH/MAF probe signals with an IGH/MAF dual-color, dual-fusion
probe in 87 nuclei. The IGH dual-color break-apart probe shows separate 3′IGH and
5′IGH signals in 95 nuclei. An additional IGH probe signal is seen with the
IGH/FGFR3, IGH/CCND1 and IGH/MAFB dual-color, dual-fusion probes. The
CDKN2C, MYC, ATM and TP53 probes show a normal signal pattern.

140
[Link] Tricolor Probes

[Link].1 Single Chromosome Normal Signal Pattern

i. nuc ish (FIP1L1,CHIC2,PDGFRA)×2[200]Interphase in situ hybridization of a

neoplastic sample with a tricolor deletion/translocation probe set shows two FIP1L1,
CHIC2, PDGFRA probe fusion signals in all 200 interphase nuclei, no disruption of
the CHIC2 gene is detected.

[Link].2 Single Chromosome Abnormal Signal Pattern

i. nuc ish(GOLIM4×1,MECOM×2,MYNN×2)[55/200]Interphase in situ hybridization

of a neoplastic sample with a tricolor deletion/translocation probe set shows deletion
of a proximal region of the long arm of one chromosome 3 including the GOLIM4 gene
in 55 of 200 nuclei. There are two MECOM and two MYNN probe signals. No
abnormality is detected in 145 nuclei.
ii. nuc ish (GOLIM4×2,MECOM×3,MYNN×2)(GOLIM4/MECOM sep
MECOM/MYNN)×1[35/100]Interphase in situ hybridization of a neoplastic sample
with a tricolor deletion/translocation probe set shows one intact set of adjacent
GOLIM4, MECOM, and MYNN probe signals in 35 of 100 nuclei. Due to a
rearrangement with a breakpoint within the MECOM gene, there is also one GOLIM4
signal connected to one MECOM signal that is separated from a MECOM signal
connected to a MYNN signal. No abnormality is detected in 65 nuclei.

141
 iii. nuc ish (FIP1L1×2,CHIC2×1,PDGFRA×2)(FIP1L1 con
PDGFRA)×1[150/200]Interphase in situ hybridization of a neoplastic sample with a
tricolor deletion/translocation probe set shows one intact set of FIP1L1, CHIC2, and
PDGFRA probe signals, and interstitial deletion including the CHIC2 gene resulting
in one conjoined FIP1L1 and PDGFRA probe signal in 150 of 200 nuclei. This result
is consistent with formation of the FIP1L1::PDGFRA fusion gene. No abnormality is
detected in 50 nuclei.

iv. nuc ish (FIP1L1,CHIC2,PDGFRA)×2(FIP1L1/CHIC2 sep

PDGFRA)×1[150/200]Interphase in situ hybridization of a neoplastic sample with a
tricolor deletion/translocation probe set shows one intact set of FIP1L1, CHIC2, and
PDGFRA probe signals, along with one PDGFRA signal that has become separated
from the FIP1L1/CHIC2 probe signal by a translocation at 4q12, in 150 of 200 nuclei.
No abnormality is detected in 50 nuclei.

[Link].3 Two or More Chromosomes Normal Signal Pattern

i. nuc ish (ASS1,ABL1,BCR)×2[100]Interphase in situ hybridization of a neoplastic

sample shows a normal signal pattern with a tricolor ASS1/ABL1/BCR deletion, dual-
fusion probe set in 100 nuclei. Note: relative positions of signals are not provided for
a normal result.

142
[Link].4 Two or More Chromosomes Abnormal Signal Pattern

i. nuc ish (ASS1×2,ABL1×3,BCR×3)(ASS1/ABL1 con

BCR)×1(ABL1conBCR)×1[90/100] Interphase in situ hybridization of a neoplastic
sample with a tricolor ASS1/ABL1/BCR deletion, dual-fusion probe set shows a
conjoined BCR and ABL1 signal. There is one normal ASS1/ABL1 signal and one
normal BCR signal. The rearranged signals are one ASS1/ABL1/BCR conjoined
signal consistent with the ABL1::BCR reciprocal fusion gene; and one BCR/ABL1
conjoined signal consistent with the BCR::ABL1 fusion gene. The abnormal signal
pattern is seen in 90 nuclei and no abnormality is detected in ten nuclei.

ii. nuc ish (D8Z2×2,MYC×3,IGH×3)(MYC con

IGH)×2[100/200],(IGH×3,BCL2×2)[100/200]Interphase in situ hybridization of a
neoplastic sample using a tricolor, dual-fusion IGH/MYC and D8Z2 probe set shows
two D8Z2 signals and two conjoined MYC and IGH signals in 100 of 200 nuclei scored.
In a separate hybridization with a dual-color, dual-fusion IGH/BCL2 probe set, three
IGH probe signals and two BCL2 probe signals are seen in 100 nuclei of 200 nuclei
scored. Taken together these hybridization signal patterns are consistent with
an IGH::MYC rearrangement and the BCL2 gene is unrearranged. Note: the D8Z2
control probe is given as it confirms chromosome 8 copy number.

7.4 Multiple Copies of the Same Gene in Neoplasia

a. When the signals can be counted, the number of signals should be listed in the ISCN
description.
b. Where there are too many probe signals to enumerate the exact copy number,
the greater than (>) sign may be used to show the minimum number of copies present.
c. When the signals are too numerous to score amp may be used if it is clinically relevant
and meets the counting criteria.
i. ish dmin(MYCN)×3∼15[20]Metaphase in situ hybridization of 20 nuclei of a neoplastic
sample shows double minutes involving MYCN, in three to 15 copies per metaphase.

143
 ii. ish 8q24(MYC)×>25[5]/8q24(MYC)×2[10]
or
ish 8q24(MYC)amp[5]/8q24(MYC)×2[10]Metaphase in situ hybridization shows gain
of multiple MYC probe signals in five metaphases of a neoplastic sample, and a
normal signal pattern in ten metaphases. The signals could not always be enumerated,
but there are more than 25 MYC probe signals in the abnormal metaphases.
Alternatively, amp may be used to describe the high-level gain of MYC probe signals.
iii. ish ider(21)(q10)dup(21)(q22q22)(RUNX1++,RUNX1++)[5]Metaphase in
situ hybridization confirms an isoderivative chromosome 21 with duplication of 21q22
identified in a neoplastic sample. There are two signals for the RUNX1 probe in each
arm of the isoderivative chromosome. Note: a comma between the two probes in the
ISCN description indicates that they are non-tandem (see Section 7.2.1).
iv. ish ider(21)(q10)add(21)(q11.2)(RUNX1amp,RUNX1amp)[3]An isochromosome
derived from chromosome 21 with additional uncharacterized material in a neoplastic
sample. Metaphase in situ hybridization shows an increase in RUNX1 probe signals
fulfilling the clinical definition of RUNX1 amplification. There is amplification
of RUNX1 on each chromosome arm.
v. ish der(21)(RUNX1)amp[4]Metaphase in situ hybridization shows that a derivative
chromosome 21 in a neoplastic sample has an increase in RUNX1 probe signals so
numerous that they cannot be quantified in the four metaphases analyzed.
vi. nuc ish (MYCN)×12∼>20[200]Interphase in situ hybridization of a neoplastic sample
shows 12 to more than 20 MYCN probe signals in 200 nuclei. A control probe, D2Z1,
is also used and its inclusion is optional in the ISCN description as the MYCN probe is
informative.
vii. nuc ish (MYCN)amp[200]Interphase in situ hybridization of a neoplastic sample shows
several MYCN probe signals too large to be quantified. A control probe, D2Z1, is also
used, but is not included in the ISCN description as the MYCN probe signal pattern is
informative.
viii. nuc ish (D17Z1,ERBB2)×4∼5[100/200]Interphase in situ hybridization of a neoplastic
sample shows four to five signals for the D17Z1 and ERBB2 probes in 100 of 200 nuclei.
The control probe is given in the ISCN description as it confirms polysomy for
chromosome 17. No abnormality is detected in 100 nuclei.
ix. nuc ish (D17Z1×2,ERBB2×10∼20)[100/200]Interphase in situ hybridization of a
neoplastic sample shows ten to 20 ERBB2 probe signals in 100 nuclei and two signals
for the alpha satellite 17 probe, D17Z1. The control probe is given in the ISCN
description as it confirms there are only two copies of chromosome 17. No abnormality
is detected in 100 nuclei.
x. nuc ish (D17Z1×2∼3,ERBB2amp)[100/200]/(D17Z1,ERBB2)×3[20/200]Interphase in
situ hybridization of a neoplastic sample shows copy gain of D17Z1 and amplification
of ERBB2 probe signals. In addition, three signals each for both D17Z1 and ERBB2 are
seen in 20 nuclei and two signals for each observed in 80 nuclei.
xi. nuc ish (D17Z1,ERBB2)amp[156/200]/(D17Z1,ERBB2)×4[20/200]Interphase in
situ hybridization of a neoplastic sample shows signal amplification of the D17Z1 and
ERBB2 probes. Four D17Z1 and ERBB2 probe signals are observed in 20 nuclei and
the remaining 24 nuclei show the normal two signals for each probe.

144
7.5 Enumeration Probes

For enumeration probes the abbreviated system (karyotype format) is used

(see Section 4.7).

i. ish 8(D8Z2)×3[20]/8(D8Z2)×2[30]Metaphase in situ hybridization in a prenatal

sample shows three signals for the chromosome 8 pericentromeric alpha satellite
probe, D8Z2, in 20 metaphases and two signals for this probe in 30 metaphases. These
results are consistent with mosaic trisomy chromosome 8.
ii. ish 8(D8Z2)×3[25]/8(D8Z2)×2[25].nuc ish (D8Z2)×3[52/100]In situ hybridization
shows three D8Z2 probe signals in 25 metaphases and two D8Z2 probe signals in
another 25 metaphases; interphase in situ hybridization confirms the presence of an
extra D8Z2 probe signal in 52 of 100 nuclei of this neoplastic specimen. These results
are consistent with a clone with trisomy 8.
iii. 45,X[3]/46,XY[12].ish
X(DXZ1×1,SRY×0)[32]/X(DXZ1)×1,Y(SRY)×1[68]Karyotype shows two cell lines
in a male: one cell line with 45,X and the other with an apparently normal male
karyotype. For determining the sex chromosome complement, it is appropriate to
indicate the status of SRY in both cell lines. The cell line with a single X chromosome
is confirmed by metaphase in situ hybridization to have no signals for SRY. The 46,XY
cell line is confirmed to have a single X chromosome and one appropriately
located SRY gene on the Y chromosome. A multiplication (×) sign is used instead
of plus (+) sign as this is a normal signal pattern for the single X
chromosome. Note: the normal cell line is listed last.
iv. nuc ish (DXZ1×2,DYZ3×1,D18Z1×3),(RB1,D21S259/D21S341/D21S342)×3
or
nuc ish (DXZ1×2,DYZ3×1,D18Z1×3),(RB1,D21S259)×3Interphase in
situ hybridization shows two probe signals for the X chromosome, one probe signal
for the Y chromosome, and three probe signals for chromosomes 13, 18 and 21. This
finding is consistent with a triploid result, 69,XXY. Note: the chromosome 21 probe
contig shows each probe listed, separated by slant lines in the first example. In the
second example a description of the other chromosome 21 contig probes must be
given in the text of the report.

7.6 Mosaic and Chimera Signal Pattern

For general rules concerning reporting mosaicism and chimerism and for an
explanation of the use of double slant line (//) in chimeras, see Section 4.5.3.

i. nuc ish (DXZ1)×2[400]//Interphase in situ hybridization shows 400 nuclei all

representing the female recipient post sex-mismatched stem cell transplant. No donor
nuclei are detected.
ii. //nuc ish (DXZ1,DYZ3)×1[400]Interphase in situ hybridization shows 400 nuclei all
representing the male donor post sex-mismatched allogeneic stem cell transplant. No
recipient nuclei are detected.

145
 iii. nuc ish (DXZ1)×2[50]//(DXZ1,DYZ3)×1[350]Interphase in situ hybridization using
X and Y alpha satellite probes shows 50 recipient XX nuclei and 350 donor XY nuclei
post sex-mismatched allogeneic stem cell transplant.
iv. nuc ish (DXZ1)×2[50]/(DXZ1×1,DYZ3×0)[10]//(DXZ1,DYZ3)×1[300] or
(DXZ1)×2[50]//(DXZ1,DYZ3)×1[300]/(DXZ1×1,DYZ3×0)[10]Interphase in
situ hybridization using X and Y alpha satellite probes shows 50 recipient XX nuclei
and 300 donor XY nuclei post sex-mismatched allogeneic stem cell transplant. Ten
nuclei with a single X chromosome are detected. The origin of the single X
chromosome cell line is unknown and could be derived from either the recipient XX
(shown in the first option) or donor XY (shown in the second option) cell line. Note:
the smallest cell line is listed last for recipient and donor.
v. mos 46,X,+r[15]/45,X[10].ish r(X)(wcpX+,DXZ1+)[10]Karyotype shows two cell
lines in a female: one with 46 chromosomes including a small ring chromosome and
another cell line with 45,X. Metaphase in situ hybridization using the whole X
chromosome paint and the X alpha satellite probe, shows that the ring chromosome is
derived from the X chromosome.
vi. 46,X,+[Link] r(X)(wcpX+,DXZ1+)[15]/r(X)(wcpX+,DXZ1+,DXZ1+)[10]Karyotype
shows a cell line with a single X chromosome and a small ring chromosome.
Metaphase in situ hybridization with a whole X chromosome paint shows that the ring
is derived from the X chromosome. Probe DXZ1, for the X alpha satellite, shows the
ring to be monocentric in some metaphases and dicentric in other metaphases. Note: if
the non-tandem duplication of the DXZ1+ signal pattern is due to dynamic mosaicism
then it is not reported in the ISCN description.
vii. ish del(14)(q21.2q21.2)(RP11–453F20–)dn[6]/14q21.2(RP11–
453F20)×2[4]Metaphase in situ hybridization using a locus specific probe, RP11–
453F20 confirms a de novo cryptic deletion within band 14q21.2 in six of the ten
metaphases. This deletion had originally been identified by microarray.
viii. ish del(14)(q21.2q21.2)(RP11–453F20–)dn[16]/dup(14)(14q21.2q21.2)(RP11–
453F20++)mat[4]Metaphase in situ hybridization using a locus specific probe,
RP11–453F20 confirms a de novo cryptic deletion within band 14q21.2 in 16 of 20
metaphases, and a duplication within band 14q21.2, inherited from the mother, in
four of the 20 metaphases. The abnormality of this subband has previously been
identified by microarray.
ix. 47,XX,+mar[10]/46,XX[20].ish
der(15)(:p11.2→q11.2:)(D15S11+,SNRPN+,D15S10–,GABRB3–
)[5]/15q11.2q12(D15S11,SNRPN,D15S10,GABRB3)×2[20]Karyotype shows
mosaicism for a marker chromosome of unknown origin in a female. Metaphase in
situ hybridization identifies the marker as an abnormal chromosome 15 that includes
the region defined by probes for D15S11 (15q11.2) and the SNRPN (15q11.2) gene.
x. ish
21(D21S259/D21S341/D21S342)×3[20]/21(D21S259/D21S341/D21S342)×2[30]Me
taphase in situ hybridization using a locus specific probe contig for chromosome 21,
shows mosaicism in a female with three chromosomes 21, each with a single copy of
the Down syndrome critical region in 20 of 50 metaphases analyzed. All loci of the
contig probe are listed in this example. Note: if all three signals for

146
 D21S259/D21S341/D21S342 are present on a single chromosome 21 the result will
be ish der(21)(q22.13)(D21S259/D21S341/D21S342+++).
xi. nuc ish chi (DXZ1,DYZ3)×1[32/50]/(DXZ1)×2[18/50]Interphase in
situ hybridization shows one copy of the X chromosome and one copy of the Y
chromosome in 32 of 50 nuclei, and 18 nuclei with two copies of the X chromosome.
This is consistent with a XY/XX chimera although further studies are needed for
confirmation. The larger of the cell lines is listed first.
xii. ish chi X(DXZ1)×2[5]/X(DXZ1)×1,Y(SRY)×1[5]Metaphase in situ hybridization
using probes for DXZ1 and SRY in a chimeric individual shows two cell lines in five
metaphases each, one cell line with two X chromosomes and the other with one X
and one Y chromosome. The cell lines are given in chromosome order.
xiii. nuc ish
(DXZ1×2,DYZ3×1,D18Z1×2)[150/200],(RB1×2,D21S270/D21S1425/D21S341×3)I
nterphase in situ hybridization shows a signal pattern consistent with an XXY sex
chromosome complement in 150 of 200 nuclei and the remaining 50 nuclei show a
signal pattern consistent with an XY sex chromosome complement. All nuclei scored
show a normal result for RB1 and D18Z1 and are non-mosaic for trisomy
21. Note: cell numbers are not given for a non-mosaic constitutional interphase
result.
xiv. mos 47,XY,+21[10]/46,XY[5].ish
21(D21S259/D21S341/D21S342)×3[15]/21(D21S259/D21S341/D21S342)×2[5].nuc
ish (D21S259/D21S341/D21S342)×3[35/50]Karyotype, metaphase in
situ hybridization and interphase in situ hybridization show mosaic trisomy 21 in a
male. The normal cell line is not given but is apparent from the denominator of the
interphase (nuc ish) result.
xv. mos 45,X[7]/47,XYY[5]/46,XY[8].ish
X(DXZ1×1,SRY×0)[10]/X(DXZ1)×1,Y(SRY)×2[8]/X(DXZ1)×1,Y(SRY)×1[12].nu
c ish
(DXZ1×1,DYZ3×0)[12/50]/(DXZ1×1,DYZ3×2)[6/50]/(DXZ1,DYZ3)×1[32/50]Kar
yotype shows three cell lines: a cell line with 45,X, a cell line with one X
chromosome and two copies of the Y chromosome, and the remaining 12 metaphases
with a normal male karyotype. The normal cell line is given last in the
karyotype, ish and nuc ish nomenclature, and the abnormal cell lines are listed with
the largest first.

147
8 Microarray

8.1 Introduction

Chromosomal microarray is a genome-wide investigation for the detection of copy

number change. In platforms that are supplemented with single nucleotide
polymorphism (SNP) probes, zygosity and some forms of ploidy can be determined.
Most microarray platforms cover only nonrepetitive regions. As such, the acrocentric
short arms, centromeric and telomeric regions, and regions of heterochromatin are not
detected by microarray.

Positional structural chromosome information is not provided by this technology and

elucidation of the nature of the underlying rearrangement by alternative methods such
as conventional karyotype or FISH may be required.

8.1.1 General Principles

a. For general cytogenomic rules that are also applicable to microarray, see Chapter 4. For
targeted microarray result nomenclature, see Chapter 10.
b. If no abnormality is detected by microarray, the results are expressed beginning
with arr to designate microarray, then a space followed by the opening parenthesis. Sex
chromosomes are listed first, followed by a comma (,), before the autosomes and the
closing parenthesis. This is followed by the multiplication (×) sign and the copy
number. The genome build is only given if the nucleotide coordinates are reported
(see Sections 4.4.5 and 8.2.1).
c. An abnormal result in which nucleotide coordinates are given, is expressed beginning
with arr to designate microarray, no space, the specified genome
build (e.g., [GRCh38] referring to the Genome Reference Consortium Human Build 38
assembly) in square brackets ([ ]), then a space followed by chromosome band and
nucleotides. Only the abnormal genomic regions are described.
• The aberrations of sex chromosomes are listed first, followed by autosomes which are
listed from lowest to highest number chromosome.
• The nucleotides are listed within parentheses from pter to qter with an underscore (_),
to indicate the segment between the listed nucleotides. This is followed by
the multiplication (×) sign and copy number of the aberration.
• Multiple aberrations are each separated by a comma (,). The nomenclature for reporting
abnormal results is detailed in Section 4.4.
• The normal sex chromosome complement is generally not given in the ISCN description
for an autosomal abnormality, although if it is clinically relevant it should be included
in the interpretive text.

148
 • When describing abnormalities involving sex chromosomes, the normal sex
chromosome may be given for clarity.
d. For interstitial deletions or duplications where both breakpoints are within the same
chromosome band, the breakpoint band is given only once in the ISCN description.
e. To indicate a mixed cell population, the proportion of cells with the aberration can be
estimated from the fractional copy number and included in square brackets ([ ])
following the copy number. Alternatively, the range of copy numbers can be indicated
using a tilde (∼).
f. When mixed cell populations can be distinguished for constitutional and unrelated
clones, the largest cell line/clone is listed first. For related clones in neoplasia, the least
complex clone is listed first.
g. In neoplastic samples the proportion of the sample with each abnormality is given
in square brackets ([ ]) when the abnormality is detected at less than 100% of the
sample. When the abnormality is apparently present in 100% of the sample, then it is
optional to include [1.0].
h. The proportion of the sample with an abnormality is estimated from the profile and is
not adjusted for the tumor load.
i. Three systems are used in the microarray format (see Section 4.7.2):
• The abbreviated system describes the abnormality/abnormalities without using the
genome build and nucleotides.
• The short system includes the genome build, chromosome bands and nucleotides within
the abnormality.
• The extended system describes the span of the nucleotides within the abnormality and
the normal flanking nucleotides. Commas are not used in the nucleotides in the extended
system.
j. In the abbreviated system, the result is expressed as arr followed by a space, then the
nomenclature of the abnormal result within parenthesis. The nomenclature rules are
given in Section 4.7.2.
k. Gains and losses are reported relative to the normalized ploidy, and it may not be
possible to distinguish between a one copy gain in a high proportion of the sample and
a two copy gain in a low proportion of the sample. Similarly, it may be necessary to use
a different method to determine the ploidy and/or mosaicism of a sample, e.g., to discern
tetraploidy from diploidy, and/or triplication from duplication.
l. The descriptive narrative, or interpretive comment in the report must indicate the
platform used and the resolution. For targeted microarray analysis, see Chapter 10.
m. If shallow genome sequencing is undertaken, the term sseq is used instead of arr.
n. Some of the ISCN examples in this chapter do not represent observed data but are
provided to demonstrate the nomenclature principles.

8.2 Examples of Microarray Nomenclature

8.2.1 Normal Results

i. arr (X,1–22)×2Microarray analysis shows no abnormality in a female profile.

ii. arr (X,Y)×1,(1–22)×2Microarray analysis shows no abnormality in a male profile.

149
 iii. arr (1–22)×2Microarray analysis shows no abnormality in the sample and the sex
chromosomes are undisclosed.
iv. 46,[Link] (1–22)×2The karyotype and microarray analysis show no abnormality. The
sex chromosomes are undisclosed.

8.2.2 Abnormal Copy Number Results

Structural chromosome information is not provided by this technology and elucidation

of the nature of the rearrangement by alternative methods such as conventional
karyotype or FISH may be necessary.

i. arr (X)×2,(Y)×1Microarray analysis shows a male profile with two copies of an X

chromosome and one Y chromosome. This finding is consistent with Klinefelter
syndrome.
ii. arr (X)×1,(Y)×2Microarray analysis shows a male profile with a single X
chromosome and gain of a Y chromosome. The normal X chromosome is given in
the ISCN description for clarity.
iii. arr (X)×2,(Y)×1,(1–22)×3SNP microarray analysis is consistent with triploidy,
69,XXY.
iv. arr (X,1–22)×3SNP microarray analysis is consistent with triploidy, 69,XXX.
v. arr (X,18)×3Microarray analysis in a female is consistent with a single copy gain of
chromosomes X and 18. Note: where more than one chromosome is involved, these
are separated by a comma (,).
vi. sseq (X,18)×3Shallow genome sequencing in a female is consistent with a single
copy gain of chromosomes X and 18.
vii. arr (8,21)×3Microarray analysis is consistent with a single copy gain of
chromosomes 8 and 21.
viii. arr (16q)×3Microarray analysis shows a single copy gain of the entire long arm of
chromosome 16.
ix. arr (18)×3
or
arr[GRCh38] 18p11.32q23(102,328_79,093,443)×3Microarray analysis shows a
single copy gain of the entire chromosome 18, consistent with trisomy 18.
x. arr (21)×3
or
arr[GRCh38] 21q11.2q22.3(13,531,865_46,914,745)×3Microarray analysis shows a
single copy gain of the entire long arm of chromosome 21. Note: most microarrays
do not cover the repetitive short arm sequences of the acrocentric chromosomes and
the short arm is therefore not reported in the nomenclature. Chromosome analysis is
needed to determine whether this is a translocation type trisomy or nondisjunction
trisomy of chromosome 21.
xi. arr (X,1–19,21,22)×3SNP microarray analysis is consistent with a near-triploidy in a
female with two copies of chromosome 20.
xii. arr[GRCh38] 15q11.1q13.2(20,366,669_30,226,235)×4Microarray analysis shows a
two copy gain of proximal long arm of chromosome 15, resulting in tetrasomy of
15q11.1 to 15q13.2. Distinguishing a supernumerary marker chromosome or an

150
 interchromosomal insertion from a triplication of this region requires conventional
karyotyping or metaphase FISH.
xiii. arr[GRCh38] Xq28(155,708,407_156,005,042)×1 or
Yq12(56,894,927_57,191,562)×1Microarray analysis shows a single copy loss of the
pseudoautosomal region (PAR2) that is found at either Xq28 or Yq12. It cannot be
determined if the loss is from the X chromosome or the Y chromosome in a male.
FISH or chromosome analysis is required to confirm the location of loss.
xiv. arr[GRCh38] Xp22.33 or Yp11.31p11.2(559,968_917,321)×3Microarray analysis of
a male with a single copy gain within the pseudoautosomal region (PAR1) of either
Xp or Yp. Note: in GRCh38 the nucleotide positions are identical for this region on
both X and Y chromosomes.
xv. arr[GRCh38] (X)×2,Yp11.32p11.2(11,091_3,295,603)×1Microarray analysis shows
the presence of a single copy of a segment of the short arm of the Y chromosome,
with no detectable loss from the two X chromosomes nor autosomes. FISH or
chromosome analysis is required to confirm the structural nature of the gain that
includes SRY. Note: the normal sex chromosomes are given in the nomenclature for
sex determination.
xvi. arr[GRCh38]
Yq11.23(24,741,599_24,873,358)×0,20q13.2q13.33(53,224,067_63,743,732)×3Micr
oarray analysis shows a male profile with an interstitial loss within Y chromosome at
band Yq11.23 and a gain of the distal long arm of chromosome 20 involving bands
20q13.2 to 20q13.33.
xvii. arr[GRCh38]
1p36.33p36.32(827,048_3,736,354)×3,1q41q44(221,649,655_247,175,095)×1Micro
array analysis shows an apparently terminal gain of part of the short arm of
chromosome 1 and an apparently terminal loss of part of the long arm of
chromosome 1. This result may indicate a duplication/deletion recombinant
chromosome derived from a parental inversion. Further testing is needed to establish
the structural nature of the rearrangement. Note: microarray shows gain and loss of
the most distal microarray markers of 1p36.33 and 1q44 respectively, and are
presumed to be terminal.
xviii. arr[GRCh38]
20q13.13q13.33(51,001,876_64,323,572)×1,22q13.32q13.33(48,533,211_50,776,66
9)×3Microarray analysis shows an apparently terminal single copy loss of part of the
long arm of chromosome 20 and an apparently terminal single copy gain of part of
the long arm of chromosome 22 as covered by the microarray. This finding may
represent the inheritance of an unbalanced derivative chromosome from a parental
translocation and chromosome analysis of both parents is indicated.
xix. arr[GRCh38] 4q32.2q35.1(163,146,681_183,022,312)×1
or
arr[GRCh38]
4q32.2q35.1(163002425×2,163146681_183022312×1,184322231×2)Microarray
analysis shows an interstitial loss within the long arm of chromosome 4 from bands
4q32.2 to 4q35.1. The extended system shows the flanking nucleotides that do not
show a copy number loss. This defines the maximum and minimum deleted region.
Commas are not used in the nucleotides in the extended system. Note: in the

151
 extended system of nomenclature, the copy number and multiplication (×) sign are
designated for the nucleotides within the parentheses.
xx. arr[GRCh38] 11p12(37,741,458_39,209,912)×3
or
arr[GRCh38] 11p12(37003221×2,37741458_39209912×3,39752007×2)Microarray
analysis shows a single copy gain involving the short arm of chromosome 11 within
band 11p12. The gain is approximately 1.47 Mb in size. The extended system shows
the next neighboring proximal and distal nucleotides with normal copy number. This
defines the maximum and minimum region of the duplication. Commas are not used
in the extended ISCN description.
xxi. arr[GRCh38] 6q21q25.1(113,900,000_149,100,000)×1,(21)×3Microarray analysis
shows interstitial loss in the long arm of chromosome 6 involving bands 6q21 to
6q25.1 and a single copy gain (trisomy) of chromosome 21.
xxii. arr[GRCh38]
9p24.3p13.1(204,166_38,756,057)×1,18q21.33q22.1(63,877,984_64,683,663)×1,21q
11.2q21.1(13,600,026_20,175,986)×3Microarray analysis shows three abnormalities:
a single copy loss within the short arm of chromosome 9, an interstitial loss of a
segment of the long arm of chromosome 18 and gain of part of the long arm of
chromosome 21. Note: chromosomes are listed in numerical order, regardless of
whether they show a gain or loss.
xxiii. arr[GRCh38]
14q31.1(82,695,844_82,855,387)×1,14q32.33(105,643,093_106,109,395)×3Microarr
ay analysis shows two separate interstitial deletions involving chromosome 14 in
bands 14q31.1 and 14q32.33. Note: the abnormalities are shown from pter to qter,
regardless of whether they are gains or losses.
xxiv. arr[GRCh38]
18p11.32p11.21(102,328_15,079,388)×1,18q22.3q23(69,172,132_79,093,443)×1Mi
croarray analysis shows an apparently terminal single copy loss of the short arm of
chromosome 18 and an apparently terminal single copy loss of the long arm of
chromosome 18. This most likely indicates a ring chromosome 18, although FISH or
chromosome analysis is indicated for confirmation.

8.2.3 Inheritance

When known, the parental origin of the abnormality may follow the copy number (×1,
×3, etc.). There is no space between the copy number and the inheritance abbreviation
(dn, mat, pat, inh, dmat, dpat, dinh, umat, upat).

i. arr[GRCh38] Xq25(126,228,413_126,535,347)×0matMicroarray analysis in a male

with an interstitial loss of the long arm of the X chromosome within band Xq25. This
deletion is inherited from the mother.
ii. arr[GRCh38] Xq25(126,228,413_126,535,347)×1matSame abnormality as the above
example in a female.
iii. arr[GRCh38] Xp22.31(6,467,202_8,091,950)×0matMicroarray analysis in a male
with an interstitial loss of the short arm of the X chromosome within band Xp22.31
that is inherited from the mother.

152
 iv. arr[GRCh38] (Y)×1,Xp11.22(53,215,290_53,986,534)×2matMicroarray analysis in a
male with a gain of the short arm of the X chromosome within band Xp11.22 that is
inherited from the mother. Note: the normal Y chromosome is given for clarity of the
sex chromosome complement.
v. arr[GRCh38] Xp11.22(53,215,290_53,986,534)×3matMicroarray analysis in a female
with a gain of the short arm of the X chromosome within band Xp11.22 that is inherited
from the mother.
vi. arr[GRCh38] 4q32.2q35.1(163,146,681_183,022,312)×1dnMicroarray analysis
shows an interstitial loss of the long arm of chromosome 4 involving bands 4q32.2 to
4q35.1. The heterozygous loss is apparently de novo in origin.
vii. arr[GRCh38] 17p11.2(16,512,256_20,405,113)×3dnMicroarray analysis shows a
single copy gain of the short arm of chromosome 17 within band 17p11.2. The gain is
at least 3.89 Mb in size and is apparently de novo in origin.
viii. arr[GRCh38]
4q28.2(128,184,801_129,319,376)×3mat,16p11.2(29,581,254_30,066,186)×3patMic
roarray analysis shows a gain of a segment of the long arm of chromosome 4 within
band 4q28.2 that is inherited from the mother, and a gain of a segment of the short arm
of chromosome 16 within band 16p11.2 that is inherited from the father.
ix. arr[GRCh38]
9p24.3(1,310,386_1,709,409)×1mat,9p22.3p22.2(16,455,330_16,763,471)×1dn,18q2
1.33q22.1(62,747,805_67,920,791)×1dnMicroarray analysis shows three
abnormalities: an interstitial single copy loss within 9p24.3 is determined, by parental
studies, to be of maternal origin. The single copy loss of 9p22.3 to 9p22.2 and a single
copy loss of 18q21.33 to 18q22.1 are both apparently de novo. Note: the inheritance
of each is listed after the specific gain or loss and the two abnormalities on
chromosome 9 are listed from pter to qter.
x. arr[GRCh38]
16p12.1p11.2(28,475,372_29,662,636)×3pat,16p11.2(29,662,635_30,188,030)×4mat
patMicroarray analysis shows a single copy gain of 16p12.1 to 16p11.2 inherited from
the father and a two copy gain within 16p11.2 inherited from both the mother and
father.
Father: arr[GRCh38] 16p12.1p11.2(28,475,372_30,188,030)×3
Mother: arr[GRCh38] 16p11.2(29,662,635_30,188,030)×3
xi. arr[GRCh38] 22q11.21(18,929,329_21,111,370)×4mat patMicroarray analysis shows
a gain of two copies of part of the long arm of chromosome 22 within band 22q11.21.
One gain is inherited from the mother and the other is inherited from the father, i.e.,
the individual has inherited the abnormality from each parent.
xii. arr[GRCh38] 22q11.21(18,929,329_21,111,370)×6dinhMicroarray analysis shows
gain of four copies of the part of the long arm of chromosome 22 within band 22q11.21.
The parental origin of the duplications cannot be specified where both parents are
duplication carriers, as there are multiple recombinant and segregation possibilities
that could account for the six copies.
xiii. arr[GRCh38]
10q26.13q26.3(122,454,932_133,620,799)×3dmat,14q32.12q32.33(94,042,298_106,
874,940)×1dmat,22q11.21(20,363,826_21,107,318)×3Microarray analysis shows an
apparently terminal gain of the long arm of chromosome 10 of bands 10q26.13 to

153
 10q26.3 and an apparently terminal loss of the long arm of chromosome 14 of bands
14q32.12 to 14q32.33 that are determined to be derived from a known maternal
translocation. Microarray testing of both parents is required to determine the origin of
the gain on chromosome 22.

8.2.4 Multiple Techniques

For the rules on describing nomenclature where multiple techniques are applied,
see Section 4.6.

i. 47,XX,del(6)(q14q16),+21c[20].arr[GRCh38]
6q14.1q16.3(78,848,613_104,293,334)×1,(21)×3cThe karyotype and microarray of a
neoplastic sample shows a deletion in the long arm of chromosome 6 in 100% of the
sample tested in a patient with constitutional trisomy 21 (Down syndrome). Note: it is
optional to include the indication of clonality. If included it would be written as:
47,XX,del(6)(q14q16),+21c[20].arr[GRCh38]
6q14.1q16.3(78,848,613_104,293,334)×1[1.0],(21)×3c
ii. 46,X,der(Y)t(Y;20)(q11.23;q13.2).arr[GRCh38]
Yq11.23q12(24,741,599_57,191,562)×0,20q13.2q13.33(53,224,067_63,743,732)×3
Microarray analysis shows an apparently terminal loss of part of the long arm of the Y
chromosome and an apparently terminal gain of part of the long arm of chromosome
20. This is consistent with the finding by conventional karyotype of a derivative Y
chromosome from an unbalanced translocation involving chromosomes Y and
20. Note: the sex chromosome abnormality is listed first. There is no normal Y
chromosome in this individual.
iii. 46,XY,der(20) t(Y;20) (q11.23;q13.2).arr[GRCh38]
Yq11.23q12(24,741,599_57,191,562)×2,20q13.2q13.33(53,224,067_63,743,732)
×1Microarray analysis shows an apparently terminal gain of the part of the long arm
of the Y chromosome and an apparently terminal loss of part of the long arm of
chromosome 20. This is consistent with the finding by conventional karyotype, of a
derivative chromosome 20 resulting from an unbalanced translocation involving
chromosomes Yq11.23 and 20q13.2. Note: the sex chromosome abnormality is listed
first. There is a normal Y chromosome in addition to the derivative chromosome 20
in this individual.
iv. 46,[Link][GRCh38]
Xp22.31(6,923,924_7,253,485)×3,5q14.3(88,018,766_89,063,989)×1The karyotype
shows a normal female. Microarray analysis shows a single copy gain of part of the
short arm of the X chromosome and a single copy interstitial loss of part of the long
arm of chromosome 5. Note: the sex chromosome abnormality is listed first.
v. 46,XY,r(14)(p13q32).arr(X,Y)×1,(1–22)×2The karyotype shows a ring chromosome
14, with breakpoints in the short arm at 14p13 and in the distal long arm at 14q32.
Microarray shows a male profile and no abnormality is detected. Note: most
microarrays do not cover the short arm of acrocentric chromosomes or telomeric
regions of chromosomes. This is shown by the normal microarray nomenclature in
this example.

154
 vi. 46,XY,der(8)(:p21.2→p23.1::p23.1→qter).arr[GRCh38]
8p23.3p23.1(214,984_7,149,893)×1,8p23.1p21.2(12,625,585_23,768,948)×3The
karyotype shows an inverted duplication of the short arm of chromosome 8 for the
segment 8p23.1 to 8p21.2. There is a known loss of the short arm telomere associated
with this recurrent rearrangement and it is often derived from a paracentric inversion
of chromosome 8 involving bands 8p23.1 to 8p21.2. Microarray confirms the deletion
of the distal short arm of chromosome 8 involving the segment 8p23.3 to 8p23.1 and
a gain of the segment 8p23.1 to 8p21.2.
vii. 46,XY,t(2;10)(q23;p15).ish t(2;10)(306F7+;306F7−).arr[GRCh38]
2q22.3q24.1(146,608,141_157,717,565)×1The karyotype shows an apparently
balanced translocation between the long arm of chromosome 2 at 2q23 and the short
arm of chromosome 10 at 10p15. Subtelomere FISH shows the chromosome 10p
subtelomere located on the derivative chromosome 2 and absent from the derivative
chromosome 10. Microarray shows an interstitial deletion in the long arm of
chromosome 2 that aligns with the translocation breakpoint on chromosome
2. Note: the microarray refines the breakpoint on chromosome 2, but as this is not
evident in hindsight in the conventional karyotype preparations at 400bphs, the
conventional karyotype breakpoints are not revised.
viii. 46,X,der(Y)t(X;Y)(p22.33;q11.221).arr[GRCh38]
Xp22.33(10,001_15,937,465)×2,Yq11.221q11.23(14,027,925_25,031,382)×0The
karyotype and microarray analysis show a male profile with a single copy gain of part
of the short arm of the X chromosome and loss of part of the long arm of the Y
chromosome, resulting from an unbalanced translocation involving Xp and Yq.
ix. ish der(X)t(X;Y)(p22.33;p11.2)(DXZ1+,SRY+).arr[GRCh38]
Xp22.33(251,879_2,746,231)×1,Yp11.32p11.2(11,091_3,295,603)×1Microarray
analysis is interpreted in the context of metaphase FISH. An unbalanced
translocation derived from a rearrangement between the short arms of the X and Y
chromosomes is detected. This has resulted in loss of distal Xp and gain of the short
arm of the Y chromosome involving PAR1 including SRY.
x. 46,[Link] der(X)(qter→q28::p22.32→qter)(EST Cdy
16c07+,DXYS129−,SHOX−,DXZ1+,EST Cdy 16c07+).arr[GRCh38]
Xp22.33p22.32(253,119_4,759,611)×1,Xq28(155,285,628_156,005,042)×3An
apparently normal female karyotype. However, subtelomere FISH shows gain of the
Xq subtelomere, present on both ends of the derivative X chromosome, and loss of
the Xp subtelomere. SNP microarray shows a female profile with a derivative X
chromosome with terminal deletion of Xp22.32 and duplication of Xq28. The
deletion of Xp includes the SHOX gene. Note: the order is written relative to the
orientation of the segment containing the centromere.
xi. 46,[Link] der(X)(qter→q28::p22.32→qter)(EST Cdy
16c07+,DXYS129−,SHOX−,DXZ1+,EST Cdy 16c07+).arr[GRCh38]
Xp22.33p22.32(253,119_4,759,611)×0mat,Xq28(155,285,628_156,005,042)×2matT
he derivative X chromosome described in the previous example is inherited in a male
fetus.
xii. 47,XY,+[Link][GRCh38] 1p13.1p11.2(117,053,799_121,604,818)×3dnMicroarray
analysis shows a single copy gain of the short arm of chromosome 1, spanning
approximately 4.6 Mb and likely identifying the marker chromosome. Most

155
 microarray platforms will not detect the pericentromeric alpha-satellite DNA and the
centromeric bands are rarely included in the nomenclature of rings and markers.
FISH is required to confirm the involvement of the centromere. An amended result
after FISH analysis could be written as:
47,XY,+[Link][GRCh38] 1p13.1p11.2(117,053,799_121,604,818)×[Link]
r(1)(p13.1q1?1)(D1Z1+)
or
47,XY,+r
arr[GRCh38] 1p13.1p11.2(117,053,799_121,604,818)×3dn
ish r(1)(p13.1q1?1)(D1Z1+)
xiii. 47,XY,+mar [Link][GRCh38]
1p12p11.2(117,596,421_121,013,236)×3,15q25.1q26.3(78,932,946_100,201,136)×3
Microarray analysis shows two apparently de novo aberrations: a single copy gain of
part of the short arm of chromosome 1 and a single copy gain of part of the long arm
of chromosome 15. This could represent a marker comprised of material from
chromosomes 1 and 15, and FISH is needed for confirmation.
xiv. 46,[Link][GRCh38]
3p12.2(80,395,073_83,498,191)×3inh,12p12.1(23,543,231_23,699,047)×1dnNormal
female karyotype with an inherited gain of chromosome 3 within 3p12.2 by microarray
analysis, an apparently de novo interstitial loss of part of the short arm of chromosome
12 within band 12p12.1.
xv. arr[GRCh38]
8q23.1q24.3(105,171,556_146,201,911)×3,15q26.2q26.3(96,062,102_100,201,136)×
1Microarray analysis shows a single copy gain of the long arm of chromosome 8
involving 8q23.1 to 8q24.3 and a single copy loss of the long arm of chromosome 15
involving 15q26.2 to 15q26.3. Terminal gain and loss may be indicative of an
unbalanced translocation. However, microarray does not provide positional
information. Following subsequent chromosome analysis, FISH analysis and
determination of maternal inheritance, the nomenclature can be written as follows:
46,XY,der(15)t(8;15)(q23.1;q26.2)[Link][GRCh38]
8q23.1q24.3(105,171,556_146,201,911)×3,15q26.2q26.3
(96,062,102_100,201,136)×[Link] der(15) t(8;15) (RP11–1143I12+,RP11–14C10−)
or
46,XY,der(15)t(8;15) (q23.1;q26.2)dmat
arr[GRCh38]
8q23.1q24.3(105,171,556_146,201,911)×3,15q26.2q26.3(96,062,102_100,201,136)×
1
ish der(15) t(8;15)(RP11–1143I12+,RP11–14C10−)
Note: karyotyping detected the balanced rearrangement in the mother, thus dmat is
placed after the karyotype in the nomenclature in this example (see Section 4.6).
xvi. 46,XY,rec(18)dup(18q)inv(18)(p11.32q21)[Link][GRCh38]
18p11.32(102,328_2,326,882)×1, 18q21.31q23(56,296,522_76,093,443)×3The
karyotype shows an abnormal chromosome 18 that is interpreted in the context of a
microarray and a paternal karyotype. Microarray analysis shows loss of part of the
short arm of chromosome 18 and gain of part of the long arm of chromosome 18.
Karyotype analysis of the individual’s father demonstrated a balanced pericentric

156
 inversion. Thus, this example is a duplication/deletion recombinant chromosome
derived from an inversion in the father.
xvii. 47,XX,+[Link][GRCh38]
21q11.2q21.1(13,461,349_17,308,947)×4,21q22.3(46,222,759_46,914,885)×3Micro
array analysis shows a two copy gain of 21q11.2 to 21q21.1 and a single copy gain of
21q22.3, indicating that the marker chromosome is the result of a complex
rearrangement involving two different segments of chromosome 21. This results in
tetrasomy for part of a proximal region of the long arm of chromosome 21 and
trisomy for a more distal part of the long arm of chromosome 21.
xviii. 47,XX,+mar[18]/46,XX[9].arr[GRCh38]
21q11.2q22.3(13,461,349_46,914,885)×3[0.8]Microarray analysis of a neoplastic
sample shows a gain of 21q11.2 to 21q22.3 is present in 80% of the sample and
likely represents the marker chromosome.
xix. 47,XY,+mar1[12]/48,XY,+mar1,+mar2[8].ish
mar1(D7Z1+)[10],mar2(D20Z1+)[5].arr[GRCh38]
7q11.21(62,510,570_65,410,986)×3[1.0],20p11.23q13.12(18,998,717_41,675,280)×
3[0.4]The karyotype shows two cell lines. One cell line has one marker (mar1) and
one cell line has two different markers (mar1 and mar2). Mar1 is present in all cells.
FISH shows mar1 is derived from chromosome 7 and mar2 is derived from
chromosome 20. The origin and level of mosaicism for both markers is confirmed by
microarray.
xx. 46,XX,t(14;18)(q32;q21.1)[1]/46,idem,r(7)(p13q32)[8]/46,XX[1].arr[GRCh38]
7p22.3p13(43,376_44,487,561)×1[0.8],7q32.3q36.3(131,973,640_159,327,017)×1[0.
8]Microarray of a neoplastic sample shows apparently terminal deletions of the short
and long arms of chromosome 7, consistent with the ring chromosome 7 observed by
karyotyping. A balanced translocation involving chromosomes 14 and 18 seen on the
karyotype is not detected by microarray.
xxi. 46,X,der(X)(Xpter→Xq27::4p16.1→4pter),der(4)(Xqter→Xq27::4p15.3→4q12::13
q31→13qter),der(11)(11pter→11q25::4q13.1→4q26:),der(13)(13pter→13q31::4qter
→4q27::11q25→11qter). arr[GRCh38]
4p16.1p15.32(7,143,522_16,904,765)×1,4q31.1(139,194,590_140,075,273)×1,11q22
.1q22.2(101,653,515_102,364,410)×1The karyotype shows a complex rearrangement
involving chromosomes X, 4, 11 and 13. The microarray analysis shows segments of
copy number loss on chromosomes 4 and 11.

8.2.5 Mixed Cell Populations and Uncertain Copy Number

i. arr (X)×1[0.6]
or
arr[GRCh38] Xp22.33q28(168,546_155,233,730)×1[0.6]Microarray analysis shows
a single copy loss of the X chromosome in approximately 60% of the sample in a
female.
ii. arr (X)×1∼3
or
arr[GRCh38] Xp22.33q28(168,546_155,233,730)×1∼3Microarray analysis of a
female shows loss of the X chromosome in a proportion of cells that is

157
 undetermined. Note: microarray cannot differentiate between 45,X/46,XX cell lines
and 45,X/47,XXX cell lines. FISH or karyotype is indicated.
iii. arr (X)×1,(Y)×0[0.6]
or
arr (X)×1,(Y)×0∼1Microarray analysis shows loss of the Y chromosome in 60% of
the sample in a phenotypic male. Note: the limitation of microarray is that it cannot
differentiate between 45,X/46,XY cell lines or 45,X/47,XYY cell lines. FISH or
karyotype is indicated.
iv. arr[GRCh38] (X)×1[0.8],Xq26.2q28(133,301,245_152,723,000)×1Microarray
analysis in a female shows 80% of the sample has only one apparently normal X
chromosome, while the remaining 20% contains a normal X chromosome and an X
chromosome with a deletion of Xq26.2 to Xq28. This equates to heterozygous loss of
Xq26.2 to Xq28 in 100% of the sample.
v. arr[GRCh38]
1p36.11p35.3(25,889,422_28,493,687)×3mat,11p12p11.12(41,444,865_49,146,935)
×1dn[0.5]Microarray analysis shows inheritance of a maternal single copy gain
within chromosome 1 involving the segment 1p36.11 to 1p35.3 and mosaicism for a
single copy loss within chromosome 11 involving the segment 11p12 to 11p11.12.
The loss within chromosome 11 is of apparently de novo origin.
vi. arr[GRCh38]
Xp22.33p11.23(701_48,643,784)×1[0.8],Xp11.23q21.1(48,645,844_77,165,813)×1[
0.2],Xq21.1q28(77,173,853_155,270,560)×1[0.8]Microarray analysis in a female
shows mosaicism for loss of the terminal short arm of the X chromosome at Xp22.33
to Xp11.23 and the terminal long arm at Xq21.1 to Xq28 in 80% of the sample. A
single copy loss for the segment Xp11.23 to Xq21.1 is detected in approximately
20% of the sample. This finding is suggestive of a mosaic ring X chromosome with
both 45,X and 46,XX cell lines. FISH or chromosome analysis is needed to
determine the structural nature of the abnormality.
vii. arr[GRCh38] (X,1–7,9–
12)×1,13q12.11q14.2(19,438,807_48,800,573)×1,13q14.2(48,986,461_49,176,936)×
0,13q14.2q34(49,176,999_115,095,706)×1,(15–20,22)×1Microarray analysis of a
neoplastic sample shows a near haploid genome and single copies of the X
chromosome and chromosomes 1 to 7, 9 to 12, 15 to 20 and 22. The result for
chromosome 13 shows a region of single copy loss and a region within 13q14.2 with
a mixture of biallelic loss and single copy loss. Chromosomes 8, 14, and 21 are
present in two copies. Note: microarray cannot determine whether the two
heterozygous deletions occur in cis or in trans.
viii. ish mos del(2)(q11.2q13)(RP11–478D22–)[10]/2q12.1(RP11–
478D22)×2[20].arr[GRCh38] 2q11.2q13(100,982,729_112,106,760)×1[0.4]FISH
and microarray analyses show a mosaic deletion in the long arm of chromosome 2.
By microarray, approximately 40% of the sample has the deletion.
ix. 47,XY,+mar[5]/46,XY[20].ish der(2)(p11.2q13) (RP11–478D22+)[5]/2q12.1(RP11–
478D22)×2[25].arr[GRCh38] 2p11.2q13(90,982,729_112,106,760)×3[0.2]FISH and
karyotype analyses demonstrate a mosaic marker chromosome derived from
chromosome 2. By microarray approximately 20% of the sample has three copies of
chromosome 2p11.2 to 2q13.

158
 x. arr[GRCh38] (5,6)×3[0.3],7q34(138,904,207_140,533,785)×>2[?]SNP microarray
analysis of a neoplastic sample shows three copies of chromosomes 5 and 6 in 30%
of the sample. There is a cell line with gain of a region within 7q34, but the copy
number is uncertain. There is allelic imbalance demonstrated in the B allele
frequency (BAF) plot for this region, but it is not possible to determine the copy
number precisely. Note: a question mark within square brackets ([?]) is used to
indicate that the proportion of the sample tested that has the gain, is unknown. Where
clinically relevant, copy number should be confirmed by another method.
xi. arr[GRCh38] 7p11.2(54,290,345_55,087,100)amp[?]Microarray analysis of a
neoplastic sample shows amplification of a region in 7p11.2. The exact copy number
is too large to be enumerated accurately by microarray. Note: a question
mark within square brackets ([?]) is used to indicate that the proportion of the
sample tested that has the amplification, is unknown.
xii. arr[GRCh38]
2p24.3(15,911,477_15,976,076)amp[?],(8)×3[0.8],(21)×4[0.8]Microarray analysis of
a neoplastic sample shows amplification of 2p24.3 including the MYCN gene, the
proportion of cells with the amplification is unknown. One additional copy of
chromosome 8 and two additional copies of chromosome 21 are present in 80% of
the sample. Note: alternative methods are required to determine if there is evidence
of clonal evolution. This is a limitation of microarray technology.
xiii. arr[GRCh38]
11q22.3q23.2(104,669,588_113,439,979)×1[0.3],13q14.13q14.3(46,290,874_51,390,
298)×1[0.8]Microarray analysis of a neoplastic sample shows a deletion in the long
arm of chromosome 11 of 11q22.3 to 11q23.2 in approximately 30% of the sample
and a deletion in the long arm of chromosome 13 of 13q14.13 to 13q14.3, in
approximately 80% of the sample.
xiv. arr[GRCh38] 12p13.33p11.1(84,917_34,382,567)×2∼4Microarray analysis shows a
two copy gain of the short arm of chromosome 12, resulting in tetrasomy 12p.
Although this result likely indicates mosaicism for an additional isochromosome of
the short arm of chromosome 12 such as those found in Pallister-Killian syndrome,
FISH or chromosome analysis is needed for confirmation. The tilde (∼) is used to
indicate that the number of copies of this region varies from two to four.
xv. arr[GRCh38]
13q14.2(49,913,857_49,938,728)×1[0.9],13q14.2q14.3(49,957,631_50,801,835)×0[0
.9],13q14.3(50,805,629_51,137,300)×1[0.9]
or
arr[GRCh38]
13q14.2(49,913,857_49,938,728)×1∼2,13q14.2q14.3(49,957,631_50,801,835)×0∼2,
13q14.3(50,805,629_51,137,300)×1∼2Microarray analysis of a neoplastic sample
shows three contiguous deletions in the long arm of chromosome 13 resulting in a
region of homozygous loss with flanking regions of heterozygous
loss. Note: microarray cannot determine whether the heterozygous deletions and the
smaller biallelic deletion occur in the same or different clone. The deletions are listed
from pter to qter.
xvi. arr[GRCh38]
9p24.3p21.3(133,828_21,975,007)×1[0.8],9p21.3(21,976,403_22,003,224)×0[0.8],9

159
 p21.3p12(22,004,154_39,158,239)×1[0.8],9q21.11q34.3(68,358,779_138,394,717)×
3[0.8]Microarray analysis of a neoplastic sample shows heterozygous loss of part of
the short arm of chromosome 9, biallelic loss of 9p21.3 including part of
the CDKN2A and CDKN2B genes and gain of part of the long arm of chromosome 9
involving 9q21.11 to 9q34.3. The clonal population with the copy number changes
constitutes 80% of the sample.

8.2.6 Nomenclature Specific to Single Nucleotide Polymorphism (SNP) Microarray

SNP microarray platforms can detect regions of homozygosity that may represent
ancestral homozygosity, parental consanguinity, uniparental disomy, and in neoplastic
disease, regions of acquired loss of heterozygosity.

a. The zygosity of chromosomal regions may be defined as heterozygous (htz)

or homozygous (hmz).
b. SNP microarrays can be used to detect abnormalities relative to genome ploidy and
given using the symbols, <n>, <2n>, <3n>, etc.
c. Uniparental disomy where the parental origin has been determined can be designated
by umat or upat.
i. arr (X,1–22)×2hmzComplete hydatidiform mole that represents a monospermic
fertilization of an empty ovum. There is no maternal complement.
ii. arr (X,1–22)×2hmz htzComplete hydatidiform mole represents a dispermic fertilization
of an empty ovum with both sperm carrying an X chromosome. There is no maternal
complement. Note: in this abbreviated system (microarray format) of
nomenclature, hmz htz indicates that there are alternating stretches of homozygosity
and heterozygosity across the stated chromosomes. The hmz is given
before htz following the alphabetical order rule.
iii. arr (X,Y)×1,(1–22)×2hmz htzComplete hydatidiform mole represents a dispermic
fertilization of an empty ovum with one sperm carrying an X chromosome and the other
carrying a Y chromosome. There is no maternal complement.
iv. arr <4n>(7)×3[0.9]SNP microarray of a neoplastic sample shows loss of one copy of
chromosome 7 relative to the tetraploid genome in 90% of cells.
v. arr chi (X,1–22)×2[0.7]/(X,1–22)×2[0.3]SNP microarray shows a pattern consistent
with an XX/XX chimera where the haplotypes are different. The largest cell line is listed
first. Note: this is consistent with a tetragametic chimera.
vi. arr chi (X,1–22)×2hmz[0.6]/(X,Y)×1,(1–22)×2[0.4]SNP microarray shows a pattern
consistent with an XX/XY chimera where there is homozygosity of the XX cell line.
The largest cell line (60%) is given first. Note: this is consistent with an androgenetic
or parthenogenetic chimera.
vii. arr chi (X,Y)×1[0.7],(18)×3[0.7]/(X,1–22)×2[0.3]SNP microarray analysis shows a
pattern consistent with an XY/XX chimera. A male complement in 70% and a female
complement in 30% of the sample is observed. An additional copy of chromosome 18
is also detected in 70% of the sample, presumably in the male complement, although
confirmation of this finding is required. Note: the normal female cell line and sex
chromosome complement are indicated for clarity. A prenatal karyotype confirmed the
presence of trisomy 18 in the male cell line.

160
viii. arr (X,Y)×1(1–22)×2[0.4]//(X,1–22)×2[0.6]SNP microarray analysis of a male recipient
after transplantation with a female donor. Note: the recipient is given first.
ix. arr[GRCh38] 11q13.4q21(74,685,586_94,929,516)×2hmzSNP microarray analysis
shows homozygosity in the long arm of chromosome 11 involving the segment 11q13.4
to 11q21 that is approximately 20.2 Mb in size.
x. arr[GRCh38] 15q24.3q26.1(77,800,856_91,327,974)×2hmz
upat,16p11.2(28,848,540_29,033,424)×1matSNP microarray analysis shows a
segment of homozygosity of approximately 13.5 Mb on chromosome 15 involving
15q24.3 to 15q26.1 and a single copy loss in chromosome 16 within 16p11.2 of
approximately 0.18 Mb. Comparison of the SNP genotypes between the patient and
both parents, shows paternal uniparental disomy for the segment of homozygosity on
chromosome 15 and maternal inheritence of the 16p11.2 deletion.
xi. arr (15q,21q)×2hmz upat
or
arr[GRCh38] 15q11.2q26.3(23,123,715_101,888,908)×2hmz
upat,21q11.21q22.3(14,595,263_48,084,819)×2hmz upatSNP microarray analysis
shows homozygosity for the entire long arms of chromosomes 15 and 21. Comparison
of the SNP genotypes between the patient and both parents, shows paternal uniparental
isodisomy for both of the regions of homozygosity. Note: the multiple regions of
homozygosity may be grouped within a parenthesis: arr[GRCh38]
(15q11.2q26.3(23,123,715_101,888,908),21q11.21q22.3(14,595,263_48,084,819))×2h
mz upat
xii. arr (7)×2htz umatSNP microarray of the proband and both parents with comparison of
SNP genotypes shows uniparental maternal heterodisomy of chromosome 7.
xiii. arr (7)×2hmz htz umatSNP microarray of the proband and both parents with comparison
of SNP genotypes, shows alternating segments of maternal isodisomy and maternal
heterodisomy for chromosome 7.
xiv. arr[GRCh38]
1p33(47,231,951_47,312,561)×1,9p24.3p21.3(14,326_21,826,388)×2hmz,9p21.3(21,8
27,193_21,993,275)×0,9p21.3p13.2(21,994,102_36,530,622)×2hmz,(17q)×3SNP
microarray shows loss of chromosome 1 within band 1p33, regions of copy neutral loss
of heterozygosity in bands 9p24.3 to 9p21.3 and 9p21.3 to 9p13.2, a biallelic deletion
within band 9p21.3 including CDKN2A and a gain of the long arm of chromosome 17.
xv. arr[GRCh38] 11p15.5p15.4(2,265,338_6,275,434)×2hmz
c,19q13.33q13.43(49,759,500_58,586,384)×2hmzSNP microarray analysis of a
neoplastic sample is consistent with a constitutional region of homozygosity on the
short arm of chromosome 11 and an acquired loss of heterozygosity of the long arm of
chromosome 19. The clonal population is 100% of the sample. Note: the region of
homozygosity on chromosome 11 is shown to be biparental.
xvi. arr[GRCh38]
1p36.33p36.31(632,287_5,983,870)×3hmz,1p36.31p36.13(5,984,115_17,694,600)×2h
mzSNP microarray analysis shows duplication of chromosome 1 at 1p36.33 to 1p36.31.
There is a region of homozygosity involving the segment 1p36.33 to 1p36.13 that
includes the duplicated segment 1p36.33 to 1p36.31 as shown by the B allele frequency
(BAF) pattern.

161
xvii. arr[GRCh38] 2q33.1q37.1(197,557,641_230,542,167)×1,(12)×3,(22)×[Link] ish
(IGH,BCL2)×3(IGH con BCL2)×2[200]Microarray analysis of a neoplastic sample
shows deletion of chromosome 2, involving the segment 2q33.1 to 2q37.1, trisomy 12
and loss of heterozygosity for chromosome 22. The clonal population is 100% of the B-
cell enriched sample. Interphase FISH shows IGH::BCL2 fusion.
xviii. arr (X,3,7,9q,13–17,19,20,22)×1[1.0]SNP microarray analysis indicates a near-haploid
profile in a neoplastic sample from a female. Chromosomes 1, 2, 4 to 6, 8, 9p, 10 to 12,
18, and 21 show a heterozygous state, representing the normal copy number and
therefore are not specified. Whereas chromosomes X, 3, 7, 13 to 17,19, 20, 22 and 9q
show one copy compared to the heterozygous state. Based on only SNP microarray data,
it is not always possible to determine whether this concerns a near-haploid complement
or a mixture of near-haploid and doubled near-haploid complements. Note: the near-
haploid complement represents 100% of the sample.
xix. arr (X)×2hmz,(1,2)×4,(3)×2hmz,(4–6)×4,(7)×2hmz,(8,9p)×4,(9q)×2hmz,(10–
12)×4,(13–17)×2 hmz,(18)×4,(19,20)×2hmz,(21)×4,(22)×2hmzSNP microarray results
from a neoplastic sample indicate that all chromosomes are abnormal compared to
normal diploidy, either by abnormal copy number or loss of heterozygosity. The clonal
population is 100% of the sample. This finding may represent doubling of the near-
haploid clone in the example above.
xx. arr (X,Y)×1∼2[0.3],(1–13)×2hmz[0.3],(14)×2∼4[0.3],(16–
20)×2hmz[0.3],(21)×2∼4[0.3],(22)×2hmz[0.3]SNP microarray analysis of a neoplastic
sample shows a doubled near-haploid complement in a male. Chromosomes X, Y, 14
and 21 show copy number gain in 30% of the sample. In addition, there is
homozygosity for chromosomes 1 to 13, 16 to 20, and 22 present in 30% of the
sample.
xxi. arr[GRCh38]
12q11∼q13.13(37,482,598_51,172,567)×2hmz[0.2∼0.3],12q13.13q24.33(51,172,758
_133,201,059)×2hmz[0.3]SNP microarray analysis of a neoplastic sample shows the
region of chromosome 12 between 12q11 and 12q13.13 displays mosaic copy neutral
loss of heterozygosity (CN-LOH), and there is gradual increase in separation of the B
allele frequency heterozygous plot indicating that there are numerous subclones with
slightly differing breakpoints. The tilde (∼) between the chromosomal breakpoints
indicates a range to demonstrate these multiple subclone breakpoints. The proporton of
the clones, as calculated from the BAF, ranges from approximately 20–30% of the
sample. The contiguous region from 12q13.13 to 12q24.33 displays CN-LOH in
approximatley 30% of the sample with no discernible subclonal variation.
xxii. arr[GRCh38]
17p13.3∼p13.1(158,756_7,281,077)×1[0.7∼0.9],17p13.1p11.2(7,281,162_17,542,789
)×1[0.9]SNP microarray analysis of a neoplastic sample demonstrates loss of a segment
of the short arm of chromosome 17 with a range of deletion breakpoints between
17p13.3 and 17p13.1, as indicated by the use of tilde (∼) in the breakpoint designation.
There is a change in the clonal population across this region from 70% to 90% of the
sample. Deletion of the region between 17p13.1 and 17p11.2 appears as a single event
with no detectable subclonal variation.
xxiii. arr[GRCh38]
17p13.3∼p13.1(158,756_7,281,077)×1∼2,17p13.1p11.2(7,281,162_17,542,789)×1∼2

162
 The same microarray profile as given directly above, but the precise proportion of cells
in the subclones is unknown in this neoplastic sample.
xxiv. arr[GRCh38]
13q14.13q14.2(45,815,660_49,850,541)×2hmz[0.4],13q14.2q14.3(49,864,100_51,118
,038)×0[0.40],13q14.3q34(51,118,412_114,338,054)×2hmz[0.40]SNP microarray
analysis of a neoplastic sample shows loss of heterozygosity for most of the long arm
of chromosome 13 in a clonal population of 40% of the sample. A deletion within the
homozygous region results in a biallelic loss.
xxv. arr[GRCh38]
13q14.13q14.2(45,815,660_49,850,541)×2hmz[?],13q14.2q14.3(49,864,100_51,118,0
38)×0∼2,13q14.3q34(51,118,412_114,338,054)×2hmz[?]SNP microarray analysis of a
neoplastic sample where the proportion of the population with the abnormalities
involving 13q14.3 to 13q34 could not be determined.
xxvi. arr[GRCh38]
1p33(47,234,490_47,297,731)×1,7p14.1(38,254,348_38,331,733)×0,9p24.3p21.3(192,
128_21,816,759)×2hmz,9p21.3(21,818,110_21,993,965)×0,9p21.3p21.1(21,994,102_
33,103,874)×2hmz,10q22.1q26.3(69,872,653_133,613,032)×2hmzSNP microarray in a
neoplastic sample shows heterozygous loss within the short arm of chromosome 1
within band 1p33 and biallelic loss within band 7p14.1. There are segments of copy
neutral loss of heterozygosity in bands 9p24.3 to 9p21.3 and 9p21.3 to 9p21.1 and a
biallelic deletion within band 9p21.3 that includes CDKN2A. In addition, there is CN-
LOH of chromosome 10 between 10q22.1 to 10q26.3. STIL::TAL1 fusion in 1p33 and
the TRG rearrangement in 7p14.1 can be confirmed using alternative methods.
xxvii. arr <2n>(X,4,6,8,10,11)×3[0.3],(14)×4[0.3],(17,18)×3[0.3],(21)×4[0.3]A near triploid
microarray profile for a neoplastic sample with the following banded karyotype:
58<2n>,XX,+X,+4,+6,+8,+10,+11,+14,+14,+17,+18,+21,+21[5]/46,XX[15]
Since it is biologically relevant in this case, the abnormal microarray profile is described
relative to the diploid genome and the clonal population is present in 30% of the sample.
xxviii. arr[GRCh38] 15q11.1q14(19,794,748_38,740,478)×2htz
umat,15q14q22.2(38,957,053_59,002,774)×2hmz
umat,15q22.2q26.3(59,003,816_101,349,386)×2htz umatSNP microarray analysis
shows chromosomes 15 with heterozygous contributions of the maternal genome
flanking a segment of homozygous contribution of the maternal genome. Both
maternal uniparental heterodisomy and isodisomy are present for chromosome 15 and
there are no paternal copies of chromosome 15.

8.2.7 Complex Array Results

a. The abbreviation cx for complex chromosome rearrangement is used where there

are numerous rearrangements across the entire genome or within a region of a
chromosome, or numerous copy number gains and/or losses and/or loss of
heterozygosity (LOH)/absence of heterozygosity (AOH), within a chromosome region.
b. The complex (cx) abbreviation is used where the definition of chromothripsis or
chromoanasynthesis is not met.
i. arr (X,1–22)cxMicroarray analysis shows multiple complex rearrangements across the
entire genome in a female.

163
 ii. arr (1–22)cxMicroarray analysis shows multiple complex rearrangements in
chromosomes 1 to 22. The sex chromosomes appear normal and are therefore not
shown.
iii. arr (X,Y,1–22)cxMicroarray analysis shows multiple complex rearrangements across
the entire genome in a male.
iv. arr <4n>(X,1–22)cxMicroarray analysis of a neoplastic sample shows a highly complex
tetraploid genome with multiple aberrations involving many chromosomes and
chromosomal regions.
v. arr[GRCh38] 3p26.3q12.1(19,817_98,667,822)cx[0.5]Microarray analysis of a
neoplastic sample shows a complex pattern of copy number changes in the long arm of
chromosome 3 in approximately 50% of the sample.
vi. arr[GRCh38] 1p13.3∼q44(108,110,616_244,524,345)×1cxMicroarray analysis in a
neoplastic sample shows multiple deletions in a chromosomal region on chromosome 1
between bands 1p13.3 to 1q44. Note: the number of deletions does not meet the
definition of chromothripsis.
vii. arr[GRCh38] 5q23.2(122,370,756_123,372,153)×3,(7q)×5∼6,(17)cxMicroarray
analysis of a medulloblastoma sample with gain of chromosome 5 at 5q23.2 including
the SNCAIP gene, high copy gain of the long arm of chromosome 7
including CDK6 and multiple aberrations of chromosome 17.
viii. arr[GRCh38]
(3)cx,(8p)×1[0.8],11q22.3∼q24.1(103,435,986_121,769,727)×1[0.5],13q14.12q21.31(
45,111,555_61,907,840)×1[0.3],17p13.3p11.2(150,208_17,289,901)×1[0.8]Microarra
y analysis of a neoplastic sample shows multiple aberrations of chromosome 3 plus
deletions of 8p, 11q, 13q and 17p. The proportion of abnormalities is different amongst
the sample population, i.e., deletion of the short arm of chromosome 8 at 80%, deletion
of 11q22.3 to 11q24.2 at 50%, 13q14.1 to 13q21.31 at 30% and 17p13.3 to 17p11.21 at
80%. Note: it is a limitation of microarray that it cannot determine whether the
abnormalities are in the same or different clones.
c. In complex array results, as may be the case in neoplastic samples, the laboratory may
choose to display results in table form instead of in an ISCN description. The
information in the table must include the chromosomes and bands corresponding to the
variant, the type of variant (loss, gain, amplification or region of homozygosity), the
designated genome build and the genomic coordinates of the variant. An example table
is given below (Table 9). The inclusion of a table does not replace the written
description/interpretive comment.
i. arr[GRCh38]
2p25.3p13.3(12,770_51,077,428)×2∼3,6p21.1p12.1(44,186,302_57,106,710)×1∼2,6q
14.1q23.3(79,737,355_137,811,379)×1∼2,9p22.1p21.1(19,701,167_29,655,000)×1∼2
,10q26.13q26.3(125,607,675_133,612,882)×2∼3,11q21q24.1(93,957,093_123,939,04
8)×1,13q14.2q14.3(49,885,788_50,932,461)×1,22q12.1q13.33(27,370,796_50,759,33
8)×2∼3
or
arr (2,6,9,10,11,13,22)cxMicroarray analysis of a neoplastic sample shows a highly
complex molecular profile with mosaicism for gains and losses involving chromosomes
2, 6, 9, 10, 11, 13 and 22 with apparently 100% clonality. Each may be designated in

164
 the ISCN description or as a complex karyotype (cx), with a description in the
interpretation. Alternatively, the aberrations may be presented in a table.
ii.

Table 9. Tabulation of a highly complex microarray result.

[Link] Chromoanagenesis

Complex genome rearrangements grouped under

chromoanagenesis, i.e., chromoanasynthesis (cha), chromoplexy (cpx),
and chromothripsis (cth), may be challenging to differentiate as multiple overlapping
genome instability and repair mechanisms may be present in an individual sample.
Illustrations of these highly complex events are described in Figure 10. The mechanism
for chromoplexy is shown in Figure 10 for comparison although it is not detected by
microarray technology.

165
Fig. 10. Characteristics of chromothripsis, chromoplexy, and chromoanasynthesis-derived structural
variants. a In chromothripsis, a chromosome in a micronucleus can undergo massive DNA damage and
result in multiple double-strand breaks (DSBs, depicted with dashed black lines). When the micronucleus
is re-incorporated into the nucleus during mitosis, the DSBs undergo repair through Non-Homologous
End Joining (c-NHEJ), where chromosome segments are randomly stitched back together, lost, or become
double minutes. Functionally relevant segments could become double minutes and undergo amplification,
as has been observed in MYC and other oncogene-containing segments in various cancer cases (Stephens
et al., 2011; Rausch et al., 2012; Cheng et al., 2016). b In chromoplexy, different DSBs can be repaired
with or without DNA loss at the breakpoints and be arranged into various derivative configurations, as
shown here by the rearrangements of example derivative chromosomes A, B, and C. Chromoplexy is
illustrated here for side-by-side comparisons with chromothripsis and chromoanasynthesis, and
nomenclature for chromoplexy is illustrated in Chapter 9. c In chromoanasynthesis, a normal
chromosome can undergo DNA segment re-synthesis (dashed lines to show template switches and solid
arrows to show replication) mediated by replication processes such as fork-stalling and template
switching (FoSTeS) and microhomology-mediated break-induced replication (MMBIR). These
mechanisms lead to templated insertions that exhibit higher copy-number and may be arranged in
different orientations (depicted in light grey and darker grey with black arrows signifying inverted
sequence orientation). Notice the chromoanasynthesis chromosome has a copy-number profile exhibiting
intercalating duplication-normal-duplication copy-number states, as seen in previous studies (Liu et al.,
2011). Note: this figure and legend were adapted from Zepeda-Mendoza and Morton (2019).

166
[Link].1 Chromothripsis

Chromothripsis (cth) is a single catastrophic event by which multiple rearrangements

originate through random shattering and reshuffling of clustered chromosome regions
and reassembly is primarily by classical non-homologous end joining (c-NHEJ). This
is observed by the formation of derivative chromosomes with multiple and complex
rearrangements and in microarray, regions of alternating copy number states between
one and two copies (Zepeda-Mendoza and Morton, 2019; Lin et al., 2023; Xue and
Durocher, 2023).

i. arr (1p)cthMicroarray analysis (abbreviated system, microarray format) shows

multiple alternating changes (disomy and losses within the region) in the short arm of
chromosome 1. Only the short arm of chromosome 1 is involved.
ii. arr (1,13)cthMicroarray analysis (abbreviated system, microarray format) shows
chromothripsis involving chromosomes 1 and 13.
iii. arr[GRCh38] (1)cth,6q25.1q27(149,100,000_170,899,992)×1,(13)cthMicroarray
analysis of a neoplastic sample shows chromothripsis of chromosomes 1 and 13, loss
of chromosome 6 within bands 6q25.1 to 6q27. The clonal population is 100% of the
sample.
iv. arr[GRCh38] 2p24.3p21(13,057,600_46,159,159)cth[0.9]Microarray analysis shows
chromothripsis occurring within the region 2p24.3 to 2p21. The clonal population is
approximately 90% of the sample.
v. arr[GRCh38]
(2)cth[1.0],13q13.1(31,916,090_32,275,782)×1∼2,13q14.11q14.3(39,748,868_53,28
4,167)×1[1.0],13q31.3(92,010,808_93,313,573)×1[1.0]Microarray analysis of a
neoplastic sample shows chromothripsis of chromosome 2 and multiple deletions of
chromosome 13, where the clonal population of the 13q13.1 deletion is approximately
100% of the sample.
vi. arr[GRCh38]
21q11.2q22.11(13,004,599_30,731,780)×2∼4,21q22.11q22.3(30,801,359_42,723,27
1)amp[?],21q22.3(42,782,774_46,709,983)×1∼2Microarray analysis of a neoplastic
sample with a previously identified intrachromosomal amplification of chromosome
21 (iAMP21). There are fluctuations of copy number gain between bands 21q11.2 to
21q22.11, amplification between bands 21q22.11 to 21q22.3 including RUNX1 and an
apparently terminal single copy loss involving 21q22.3. Note: the copy number profile
of iAMP21 is consistent with the breakage-fusion-bridge cycle followed by
chromothripsis. Due to the complexity of copy number change the size of the clonal
population of subclones cannot be determined.

167
[Link].2 Chromoanasynthesis

Chromoanasynthesis (cha) is a phenomenon whereby multiple combinations of

structural variants including deletions, duplications, triplications, inversions, and
translocations are generated without the clustered breakpoints of chromothripsis. This
occurs through errors in DNA replication, namely fork stalling and template switching
(FoSTeS) and microhomology-mediated break-induced replication (MMBIR) (Zepeda-
Mendoza and Morton, 2019).

i. arr (6)chaMicroarray analysis shows multiple changes of copy number of chromosome

6.
ii. arr[GRCh38] 17p13.3q11.2(1,304,173_29,909,627)cha[0.5]Microarray analysis
shows multiple changes of copy number, affecting most of the short arm of
chromosome 17. Chromoanasynthesis is evident in approximately 50% of the sample.

8.3 Polar Bodies

First and second polar bodies as well as the secondary and the fertilized oocyte are the
result of meiotic division (reduction division) and normally do not contain
chromosomes, but one or two chromatids (the same is true for secondary and tertiary
spermatozoa). This section describes nomenclature for chromatid loss and gain in polar
bodies or respective oocytes identified by the cytogenomic techniques
of microarray (arr) and shallow genome sequencing (sseq).

a. If shallow genome sequencing is used, replace arr with sseq for normal and abnormal
results.
b. As the resolution of shallow genome sequencing is approximately 5-10 Mb, the normal
result can be described, acknowledging limitations of the technique.
c. Following meiosis 1, the first polar body (PB1) consists of two chromatids, usually
from a single chromosome for chromosomes X and 1–22.
d. At fertilization, meiosis 2 is completed forming the second polar body (PB2) which
consists of only one chromatid for X and 1–22.
e. When describing normal or abnormal PB results, the term chromatid (cht) is used.
f. PB1 nomenclature is given in relation to a normal haploid set of two chromatids for
X,1–22.
g. PB2 nomenclature is given in relation to the number of chromatids where the normal
haploid set is one chromatid for X,1–22.
h. These terms however, are also appropriate to describe the respective oocytes. It should
also be noted that although both polar bodies are analyzed, the deduced result of the
oocyte is needed to make a diagnosis (i.e., whether or not the oocyte is chromosomally
normal so it can be fertilized for further development into an embryo).
i. Polar bodies 1 and 2 have different numbers of chromatids, and the microarray/sseq
profiles regarding copy number are interpreted accordingly.

168
8.3.1 Normal Polar Body Results

Polar body 1

i. arr cht(X,1–22)×2Microarray analysis shows 23 chromatids relative to a haploid set of

two chromatids.
ii. sseq cht(X,1–22)×2Shallow genome sequencing shows 23 chromatids relative to a
haploid set of two chromatids.

Polar body 2

i. arr cht(X,1–22)×1Microarray analysis shows 23 chromatids relative to a haploid set of

one chromatid.
ii. sseq cht(X,1–22)×1Shallow genome sequencing shows 23 chromatids relative to a
haploid set of one chromatid.

8.3.2 Abnormal Polar Bodies PB1

The normal copy number is ×2 (two chromatids) for PB1.

i. arr cht(X)×1Microarray analysis shows loss of one X chromatid relative to a haploid

set of two chromatids.
ii. arr cht(X)×1,cht(5)×0Microarray analysis shows loss of one X chromatid and loss of
both chromatids 5 relative to a haploid set of two chromatids.
iii. arr cht(8,19)×3Microarray analysis shows gain of one chromatid 8 and a gain of one
chromatid 19 relative to a haploid set of two chromatids. There are three chromatids
in total for each aneuploidy. Parentheses can be used to group abnormalities of the
same copy number.
iv. arr cht(4)×0,cht(17)×4,cht(18)×0,cht(22)×3Microarray analysis shows loss of both
chromatids 4 and 18, gain of two chromatids 17, and gain of one chromatid 22 relative
to a haploid set of two chromatids.
v. arr cht(4,14)×0,cht(17)×4,cht(22)×3Microarray profile shows loss of both chromatids
4 and 14, gain of two chromatids 17, and gain of one chromatid 22 relative to a haploid
set of two chromatids.

8.3.3 Abnormal Aneuploidy PB2

The normal copy number is ×1 (one chromatid) for PB2.

169
 i. arr cht(X)×0Microarray analysis shows loss of the X chromatid relative to a haploid
set of one chromatid.
ii. arr cht(13)×2,cht(21)×0Microarray analysis shows gain of one chromatid 13 and loss
of one chromatid 21 relative to a haploid set of one chromatid.
iii. arr cht(13,18,21)×2Microarray analysis shows gains of one chromatid each for 13, 18
and 21 relative to a haploid set of one chromatid.
iv. arr cht(13)×2,cht(14,18)×0,cht(21)×2Microarray analysis shows gains of one
chromatid each for 13 and 21, and loss of chromatids 14 and 18 relative to a haploid
set of one chromatid.

8.3.4 Abnormal Structural PB1

i. arr[GRCh38]
cht1p36.3p12(1,059,622_119,772,865)×1,cht1q12q44(143,822,876_248,903,579)×3,
cht(21)×4Microarray analysis shows loss of the chromatid region 1p36.3 to 1p12, gain
of the chromatid region 1q12 to 1q44, and gain of two chromatids for 21 relative to a
haploid set of two chromatids.
ii. arr[GRCh38]
cht7p22.3q33(576,616_137,975,092)×0dmat,cht13q12.11q31.1(19,238,580_80,007,3
19)×4dmatMicroarray analysis shows loss of two chromatids for region 7p22.3 to 7q33
and gain of two chromatids for region 13q12.11 to 13q31.1 relative to a haploid set of
two chromatids. The mother has a balanced reciprocal translocation,
46,XX,t(7;13)(q33;q31.1).
iii. arr[GRCh38] cht8p23.3q11.21(175,733_49,909,509)×3,cht(21)×0Microarray
analysis shows gain of part of one chromatid for region 8p23.3 to 8q11.21 and loss of
two chromatids for 21 relative to a haploid set of two chromatids.

8.3.5 Abnormal Structural PB2

i. arr[GRCh38]
cht1p36.3p12(1,059,622_119,772,865)×2,cht1q12q44(143,822,876_248,903,579)×0,
cht(21)×0Microarray analysis shows gain of chromatid region 1p36.3 to 1p12, loss of
chromatid region 1q12 to 1q44, and loss of chromatid 21 relative to a haploid set of
one chromatid.
ii. arr[GRCh38]
cht7p22.3q33(576,616_137,975,092)×3,cht13q12.11q31.1(576,616_137,975,092)×0,
cht13q31.1q34(576,616_137,975,092)×2Microarray analysis shows gain of two
chromatid regions for 7p22.3 to 7q33, loss of chromatid region 13q12.11 to 13q31.1
and gain of chromatid region 13q31.1 to 13q34 relative to a haploid set of one
chromatid.
iii. arr[GRCh38] cht8p23.3q11.21(175,733_49,909,509)×0,cht(21)×3Microarray
analysis shows loss of chromatid region 8p23.3 to 8q11.21 and gain of two chromatids
for 21 relative to a haploid set of one chromatid.

170
9 Genome Mapping

9.1 Introduction

In addition to detection of both balanced and unbalanced structural variation, genome

mapping can detect copy number changes analogous to chromosomal microarray
analysis (Levy et al., 2022; Smith et al., 2022; Iqbal et al., 2023; Sahajpal et al., 2023).
The nomenclature for genome mapping (Moore et al., 2023) uses elements of karyotype,
microarray and region-specific nomenclature to describe the observed structural and
copy number variation.

The ISCN description of genome mapping results does not indicate the platform used
(i.e., optical or electronic genome mapping), the labelling strategy (e.g., DLE-1), the
type of genome assembly (e.g., rare variant, de novo, or guided), the version of
bioinformatic pipeline, and whether any custom filter settings are in use, therefore these
must form part of the descriptive narrative in the report. If classification is performed
via a filtered list of genes, the genes may be indicated in the interpretative section of the
report or by a statement indicating that the list is available upon request.

9.2 General Principles

a. The nucleotides listed are not necessarily those of the actual breakpoint, but rather
indicate the extent of the fragment as determined by the position(s) of the labelled DNA
motif within the variant region and closest to the chromosomal breakpoint(s). For this
reason, the enzyme labelling strategy must be stated in the techniques section of the
report.
b. The principles of genome mapping nomenclature are the same for constitutional and
neoplastic samples.
c. Only results that are abnormal, based upon the laboratory’s reporting procedures, are
included in the ISCN description. The exception is that normal sex chromosomes may
be reported for the purpose of sex determination.
d. Assessment of copy number in genome mapping can be difficult because the technology
does not sample single cells but rather assesses DNA from many cells. Note: gains and
losses are reported relative to the normalised ploidy. It may not be possible to distinguish
between a one copy gain in a high proportion of the sample and a two copy gain in a
low proportion of the sample.

171
 Even when enrichment strategies have been performed in neoplastic samples the
proportion of the sample with an abnormality given in the ISCN description may not be
representative of the true level of the abnormality in the neoplasm, e.g., an abnormality
in 80% of tumor cells would be in only 40% of the clinical sample if the tumor load is
50%. This is a limitation of the test.
e. The proportion of abnormality within the sample cannot be used to determine subclone
composition using this technology.
f. The gene fusion definition has been harmonized between ISCN, the Human Genome
Organisation (HUGO) Gene Nomenclature Committee, Variant Interpretation for
Cancer Consortium (VICC) Gene Fusion Specification, and Human Genome Variation
Society (HGVS). Gene fusions occur when two or more genes join and result in a
chimeric transcript and/or a novel interaction between a rearranged regulatory element
with the expressed product of a partner gene (a regulatory fusion) (see Section [Link]).

9.3 Nomenclature Rules

a. For general cytogenomic rules that are also applicable to genome mapping see Chapter
4.
b. For nomenclature to describe targeted genome mapping see Section 10.6.
c. There is a space after the technique, ogm or ogm[GRCh38], and before the rest of the
ISCN description of the result (see Section 4.4.1).
d. Results are reported in a single line of nomenclature. However, complex results can be
presented in a table for clarity (see Tables 10 and 11).
e. Regardless of whether there is a structural abnormality or a copy number gain or loss,
the aberrations are listed in numerical order from lowest to highest numbered
chromosome. The sex chromosome abnormalities are listed first with the X before the
Y unless only the X chromosome is abnormal, then the normal Y is listed first
(see Section 4.3).
f. The band designations and aberrant nucleotides are listed from pter to qter (as
determined by the orientation of the region containing the centromere), consistent with
the public databases of current genome builds on UCSC or Ensembl genome browsers
([Link] or [Link]).
g. Genome mapping nomenclature uses the karyotype format and the microarray format.
The karyotype format ISCN is used when the structural nature of the abnormality is
apparent. It is possible to use both formats within the ISCN description although, for
each chromosome, the nomenclature must consistently use either one format or the
other. Within the nomenclature formats different systems are used (see Section 4.7):
• The abbreviated system (microarray format) is used for aneuploidy and
chromoanagenesis where only the chromosome is given and no nucleotides. Copy
number is given for aneuploidy but not for chromoanagenesis.
• The short system (karyotype format) defines the structural abnormality by the
chromosome breakpoints and nucleotides. Copy number is not included.
• The short system (microarray format) defines abnormalities by the chromosome
breakpoints and nucleotides. Copy number is included.
• The detailed system (karyotype format) describes abnormal chromosomes in their
entirety from pter to qter. In this system, when describing a derivative (der)

172
 chromosome, it is not necessary to use the terms del, dup, ins, inv or t because the
structure is apparent from the nucleotide coordinate sequence. Copy number is not
included.
• The extended system (microarray format) includes the span of the nucleotides involved
in the abnormality as well as the flanking uninvolved nucleotides. Commas are not used
in the nucleotides. Copy number is included.
h. Commas (,) in nucleotide numbers are optional but improve readability. It is
recommended not to include commas in the extended form where the maximal and
minimal extent of the copy number variant (CNV) is given (see Section 4.4.5).
i. An underscore (_) indicates that the gain, loss, or inversion encompasses the segment
between the listed nucleotides. A tilde (∼) between two nucleotide coordinates indicates
uncertainty of the breakpoint.
j. A semicolon (;) separates nucleotides that are aberrant due to translocation in the short
system (karyotype format) and a double colon (::) separates the nucleotides to indicate
breakage and reunion in the detailed system (karyotype format). It is also used to
indicate breakage and reunion of chromosomes where it is uncertain if the change is
intrachromosomal or interchromosomal (see Section [Link]).
k. To indicate a mixed cell population, the proportion of cells in the sample with the copy
number variant (CNV) is estimated from the fractional copy number and is included
in square brackets ([ ]) following the copy number.
l. When mixed cell populations can be distinguished for constitutional and unrelated
clones, the largest cell line/clone is listed first. For related clones in neoplasia, the least
complex clone is listed first.
m. For structural changes, the variant allele frequency (VAF) may be included after the
abnormality in square brackets ([ ]) and annotated VAF to distinguish it from the
proportion of the sample calculated using the fractional copy number, e.g., [VAF0.2].
Alternatively, it may be included in the text description within the report or in the tabular
form. Note: for neoplastic samples the VAF in the sample may not represent the level
of abnormality in the tumor.
n. Listing of gene(s) is not mandatory in the genome mapping nomenclature but when
given, the gene(s) listed are not italicised. Only those participating in fusion gene
formation (whether resulting in chimeric gene products or involving regulatory
elements) or that are investigated by targeted assays, are reported (see Sections
[Link] and [Link]). Genes involved in fusion gene formation are separated by a double
colon (::), while all others are separated by a comma (,) (Bruford et al., 2021).
o. In karyotype format nomenclature the gene(s) is indicated in parentheses (( ))
immediately after the abnormality and before the square brackets ([ ]) indicating the
proportion of the sample or VAF. Loss or gain of critical genes is indicated by
a minus (−) or plus (+) sign after the gene symbol in the karyotype format (see Section
[Link]) and the double colon (::) indicates gene fusion. In microarray format
nomenclature the gene(s) is indicated in parentheses (( )) immediately after the
abnormality and before the copy number. The minus (−) and plus (+) signs are not used
in the microarray format. For intragenic deletion or duplication no gene symbol is used
in the ISCN description as the entire gene is not involved, but it may be appropriate to
name the gene in the text of the report (see Section [Link]). Genes of no known clinical
significance to the referral type and those not involved in structural change are not listed.

173
 p. If genome mapping further clarifies the karyotype and, in retrospect, the abnormality
can be visualized with banding, the karyotype may be amended to reflect this new
genome mapping information. If the abnormality is cryptic and cannot be visualized by
banding, the abnormality is not listed in the banded karyotype. Conversely, if genome
mapping does not confirm a change visible by karyotype then the karyotypic
abnormality may still be reported if a further review of the karyotype confirms its
presence (see Section 4.6).
q. Genome mapping analysis can demonstrate a relative gain or loss of DNA although
analysis by another technique may be necessary to report ploidy. Genome mapping does
not always allow discrimination between homologous chromosomes.

9.4 Nomenclature Examples

All examples below use genome build GRCh38. The genome build must be stated if
nucleotide coordinates are present in the nomenclature, but is not required if only whole
chromosome, or chromosome arm aneuploidy is reported without nucleotide
coordinates.

9.4.1 Normal Results

If no clinically significant abnormality is detected using genome mapping the sex

chromosomes are given first and are separated from the autosomes. There is a space
between ogm and the opening parenthesis.

i. ogm (X,1–22)×2Genome mapping in a female with no abnormality detected.

ii. ogm (X,Y)×1,(1–22)×2Genome mapping in a male with no abnormality detected.
iii. ogm (1–22)×2Genome mapping with no abnormality detected and the sex is not
disclosed.
iv. 46,[Link] (1–22)×2Karyotype and genome mapping show no abnormality and the sex
chromosomes are undisclosed.

9.4.2 Abnormal Results

Some of the examples in this chapter do not represent observed genome mapping data
but are provided to demonstrate nomenclature principles (i.e., the nucleotide coordinates
may not be the same as would be obtained from experimental data).

[Link] Aneuploidy of Whole Chromosomes or Chromosome Arms

i. ogm (X)×1[0.6]Genome mapping shows loss of the X chromosome in 60% of the

sample in a female. Note: the abbreviated system (microarray format) of nomenclature
is used in the description of whole chromosome aneuploidy.
ii. ogm (X)×0[0.5],(Y)×1Genome mapping shows loss of the X chromosome in 50% of
the neoplastic sample in a male.
iii. ogm (X,21)×3Genome mapping shows three copies of chromosomes X and 21.

174
 iv. ogm (21,22)×3[0.2]Genome mapping shows three copies of chromosomes 21 and 22
in approximately 20% of a neoplastic sample.
v. ogm (X)×1Genome mapping shows the presence of a single X chromosome and is
consistent with 45,X in a constitutional sample.
vi. ogm (X)×1,(Y)×0[0.8]Genome mapping shows the presence of a single X
chromosome and is consistent with acquired loss of the Y chromosome in 80% of a
neoplastic sample. Note: inclusion of the X chromosome is optional in neoplasia.
vii. ogm (X)×2,(Y)×1Genome mapping shows the presence of two X chromosomes and
one Y chromosome, consistent with an XXY chromosome complement in a
constitutional sample.
viii. ogm (X)×1,(Y)×2Genome mapping shows gain of the Y chromosome in a male,
consistent with an XYY sex chromosome complement.
ix. ogm (X)×2[0.5],(Y)×1,(8,21)×3[0.5]Genome mapping shows gain of chromosomes
X, 8 and 21 in approximately 50% of this neoplastic sample in a male. The normal Y
chromosome is given so it is clear that this is a male with gain of an X chromosome.
x. ogm (17p)×1[0.7],(17q)×3[0.7]Genome mapping shows loss of the entire short arm of
chromosome 17 and gain of the entire long arm of chromosome 17 in approximately
70% of a neoplastic sample.

[Link] Deletion

The abbreviation (del) is used to denote both terminal and interstitial deletions and is
used when the chromosomal structure can be ascertained. Alternatively, the microarray
format may be used by indicating the copy number (e.g., ×1). If using the karyotype
format, deletions within a chromosome band are given with the band listed twice,
whereas the band is listed only once in the microarray format (see Table 4 in Section
4.7). Schematic representation of an interstitial deletion identified by genome mapping
is shown in Figure 11. A comment may be made in the text of the report to discuss the
size variation between the actual deletion and the deletion reported in the ISCN
description.

Fig. 11. Schematic representation of an interstitial deletion identified by genome mapping (Courtesy of Dr. H. Barseghyan). The
reference map breakpoints 1 and 10 are listed in the ISCN however, these labels are aligned to sample map locations A and B, with
a total distance between them of 4 kb, indicating that the actual deletion size is equal to 6 kb (difference between reference and
sample maps). In general, it is not necessary to include this remnant DNA in the genome mapping nomenclature, but a comment
may be made in the text of the report to explain the discrepancy between the ISCN breakpoints and the actual size of the deletion
when required. *Variable size refers to the deletion specific distance between points A and B.

175
 i. ogm[GRCh38] 17q11.2(30,273,120_32,477,675)×1[0.5]
or
ogm[GRCh38] del(17)(q11.2q11.2)(30,273,120_32,477,675)[0.5]Genome mapping
shows an interstitial deletion of 2.2 Mb within 17q11.2 in approximately 50% of the
neoplastic sample. The loss includes the NF1 gene. Note: inclusion of the NF1 gene
in the ISCN description is not mandatory, but if included, it is placed
in parentheses (( )) immediately before the square brackets ([ ]) containing the
proportion of the abnormality in the sample, e.g.,ogm[GRCh38]
17q11.2(30,273,120_32,477,675)(NF1)×1[0.5]orogm[GRCh38]
del(17)(q11.2q11.2)(30,273,120_32,477,675)(NF1−)[0.5]
ii. ogm[GRCh38] 11q14.1q22.3(80,488,887_108,177,359)×1
or
ogm[GRCh38] del(11)(q14.1q22.3)(80,488,887_108,177,359)Genome mapping
shows an interstitial deletion between bands 11q14.1 and 11q22.3 involving
nucleotides 80,488,887 to 108,177,359. The actual size of the deletion is 27,684 kb,
whereas the size obtained from the two adjacent fluorescent label positions is 27,688
kb as there is 4 kb of residual DNA between the fluorescent label positions.
See Figure 11 for a diagrammatic explanation.
iii. ogm[GRCh38] 22q11.21(18,858,640_21,290,760)×1
or
ogm[GRCh38] 22q11.21(18855621×2,18858640_21290760×1,21294586×2)
or
ogm[GRCh38] del(22)(q11.21q11.21)(18,858,640_21,290,760)Genome mapping
shows a 2.4 Mb interstitial deletion within 22q11.21. The expanded system
(microarray format) shows that the next neighboring proximal nucleotide that does
not show a loss is 3 kb away and the next neighboring distal nucleotide that does not
indicate that a loss is 3.8 kb away from the alteration. Note: demarcating commas are
not used in the nucleotide coordinates in the expanded system as the nucleotide
coordinates and copy number designation become confused.
iv. ogm[GRCh38] 17p13.3p13.1(66,653_8,010,821)×1[0.7]
or
ogm[GRCh38] del(17)(p13.1)(pter_8,010,821)[0.7]Genome mapping shows an
apparently terminal deletion of chromosome 17 with the breakpoint in 17p13.1 at
nucleotide 8,010,821. The deletion is present in 70% of this neoplastic sample.
v. ogm[GRCh38] Xq25(126,228,413_126,535,347)×0mat
or
ogm[GRCh38] Xq25(126225312×1,126228413_126535347×0,126538250×1)mat
or
ogm[GRCh38] del(X)(q25q25)(126,228,413_126,535,347)matGenome mapping
shows an interstitial deletion of Xq25 involving loss of nucleotides between
126,228,413 and 126,535,347 of maternal origin in a male. If the normal Y
chromosome is not given in the ISCN, then the report text must indicate the sex. The
second option demonstrates the expanded system (microarray format) showing the
maximal extent of the deletion. Note: for further explanation of the nomenclature for
inheritance refer to Section [Link].

176
 vi. ogm[GRCh38] 6q21q25.1(113,900,000_149,100,000)×1[0.5],(21)×3c
or
ogm[GRCh38] del(6)(q21q25.1)(113,900,000_149,100,000)[0.5],(21)×3cGenome
mapping of a neoplastic sample shows an interstitial loss in the long arm of
chromosome 6 from 6q21 to 6q25.1 in 50% of the sample. There is a single copy
gain (trisomy) of chromosome 21 that is constitutional. Note: copy number loss due
to structural abnormality may be presented in a microarray format nomenclature (×1)
or karyotype format nomenclature (del). Whole chromosome aneuploidy is reported
using the (abbreviated system) microarray format.
vii. ogm[GRCh38]
del(13)(q14.2q14.3)(50,121,221_52,453,910)[0.4],del(13)(q14.3q14.3)(50,502,914_5
1,002,914)[0.2]Genome mapping shows two overlapping interstitial deletions
involving the long arm of chromosome 13 in a CLL sample. There is a larger deletion
of 13q14.2 to 13q14.3 involving loss of approximately 2.3 Mb from one chromosome
13 in approximately 40% of the sample and a smaller deletion of approximately 500
kb within 13q14.3 of the other homologue in approximately 20% of the sample. For
clarity single underlining (_) may be used to distinguish homologous chromosomes
in the short system (karyotype format).
viii. ogm[GRCh38]
13q14.2q14.3(50,121,221_50,502,913)×1[0.4],13q14.3(50,502,914_51,002,914)×1[0
.6],13q14.3(51,002,939_52,453,910)×1[0.4]Genome mapping shows the same
interstitial deletions involving the long arm of chromosome 13 as seen in the previous
example. The homologues could not be distinguished, and so the three segments are
listed from pter to qter using the short system (microarray format). Note: in the
microarray format description of the deletion within 13q14.3, the band is not repeated
(see Table 4).
ix. ogm[GRCh38]
Xq24q28(118,930,414_155,233,098)×2[0.3],1p32.3(51,400,687_51,477,088)×1[0.3],
(1q)×3[0.3],(5,7,9,19)×3[0.5]Genome mapping of a neoplastic sample from a male
shows gain of Xq24 to Xq28 in 30% of the sample; an interstitial deletion of part of
the short arm of chromosome 1 in 30% of the sample; gain of the entire long arm of
chromosome 1 in 30% of the sample, and trisomies of chromosomes 5, 7, 9 and 19 in
50% of the sample. Note: it is a limitation of genome mapping that it cannot determine
whether the abnormalities are in the same or different clones.

The above example could be written in tabular form (Table 10).

177
 Table 10. Example of genome mapping results written in tabular form.

x. ogm[GRCh38] 5q14.3q35.1(88,421,659_170,088,529)×1[0.9],(17)×1[0.3]
or
ogm[GRCh38]
del(5)(q14.3q35.1)(88,421,659_170,088,529)[0.9],(17)×1[0.3]Genome mapping of a
neoplastic specimen shows an interstitial deletion of chromosome 5 from 5q14.3 to
5q35.1 in 90% of the sample and monosomy 17 in 30% of the sample.
xi. ogm[GRCh38]
9p21.3(21,150,533_21,671,683)×1[0.4],9p21.3(21,671,699_22,142,918)×0[0.6],9p2
1.3(22,143,009_22,277,637)×1[0.4].nuc ish (CDKN2A)×0[110/200]Genome
mapping of a neoplastic sample shows interstitial deletion of both chromosome 9
homologues at 9p21.3, and the result is confirmed by in situ hybridization using a
probe for CDKN2A. There are two segments of heterozygous loss that are present in
40% of the sample and one segment of homozygous loss in 60% of the sample. There
is insufficient structural information to determine the extent of deletion on each
homologue, therefore the segments of loss are listed as three distinct segments using
the short system (microarray format).
xii. ogm[GRCh38]
del(9)(p21.3p21.3)(21,150,533_22,277,637)[0.4],del(9)(p21.3p21.3)(21,671,684_22,
142,918)[0.2].nuc ish (CDKN2A)×0[40/200]Genome mapping of a neoplastic sample
shows interstitial deletion of both chromosome 9 homologues at 9p21.3, and the result
is confirmed by in situ hybridization using the probe for CDKN2A. One homologue
showed an interstitial deletion in 40% of the sample while the other showed an
interstitial deletion in 20%. For clarity single underlining may be used to distinguish
between homologous chromosomes.

[Link] Duplication

The abbreviation (dup) is used for duplications. Alternatively, the microarray format
may be used by indicating the copy number (e.g., ×3).

i. ogm[GRCh38] 6q21q25.1(113,900,000_149,100,000)×3
or
ogm[GRCh38] dup(6)(q21q25.1)(113,900,000_149,100,000)Genome mapping

178
 analysis shows duplication in the long arm of chromosome 6 from 6q21 to 6q25.1.
The original orientation of the duplicated sequence is maintained. In this example the
short system (microarray format) is shown first followed by the alternative short
system (karyotype format). The position of the duplication is indicated in neither
format, but it is assumed that it is a tandem duplication. Note: copy number changes
may be presented either using microarray format (×3) or karyotype format (dup).
ii. ogm[GRCh38]
der(6)(pter_q25.1::q21_qter)(pter_149,100,000::113,900,000_qter)Genome mapping
analysis shows duplication in the long arm of chromosome 6 from 6q21 to 6q25.1.
Breakage and reunion of the chromosome is indicated by the double colon (::). The
original orientation of the duplicated sequence is maintained, and this is indicated by
the order of the nucleotide coordinates in the detailed system (karyotype format)
nomenclature. Note: this is described as a derivative (der) chromosome in the
detailed system.
iii. ogm[GRCh38]
der(6)(pter_q25.1::q25.1_q21::q25.1_qter)(pter_149,099,000::149,100,000_113,900,
000::149,100,001_qter)Genome mapping analysis shows duplication in the long arm
of chromosome 6 from 6q21 to 6q25.1 at the distal breakpoint (6q25.1). The
orientation of the duplicated sequence is inverted, as indicated by the order of the
nucleotide coordinates in the detailed system (karyotype format)
nomenclature. Note: this is described as a derivative (der) chromosome in the
detailed system.
iv. ogm[GRCh38]
der(6)(pter_q21::q25.1_q21::q21_qter)(pter_113,900,000::149,100,000_113,900,000
::113,900,001_qter)Genome mapping analysis shows duplication in the long arm of
chromosome 6 from 6q21 to 6q25.1 at the proximal breakpoint (6q21). The orientation
of the duplicated sequence is inverted, as indicated by the order of the nucleotide
coordinates in the detailed system (karyotype format) nomenclature.
v. arr[GRCh38]
Xq22.2(103,757,477_103,848,705)×3,Xq22.2(103,958,437_104,059,021)×[Link][G
RCh38]
der(X)dup(X)(q22.2q22.2)(103,849,669_103,757,512)dup(X)(q22.2q22.2)(103,958,9
81_104,060,016)Microarray analysis shows two regions of gain in the long arm of
the X chromosome. Genome mapping confirms the duplications, shows that they
are in cis and that the more proximal duplication is in an inverted orientation. The
genome mapping ISCN is written in short system (karyotype format). Note: the order
of the nucleotide coordinates shows the orientation and location of the inverted
segment.
vi. ogm[GRCh38] 11q23.3(118,341,120_118,349,783)×3[0.6]
or
ogm[GRCh38] dup(11)(q23.3q23.3)(118,341,120_118,349,783)[0.6]Genome
mapping shows intragenic duplication of part of KMT2A within 11q23.3 in 60% of a
neoplastic sample. This represents a simple canonical KMT2A partial tandem
duplication. KMT2A is not listed in the ISCN description because only part of the
gene is duplicated (see Section 9.3).

179
 vii. ogm[GRCh38] 11q23.3(118,341,120_118,526,842)(KMT2A)×3[0.6]
or
ogm[GRCh38]
dup(11)(q23.3q23.3)(118,341,120_118,526,842)(KMT2A++)[0.6]Genome mapping
shows duplication of the KMT2A gene within 11q23.3 in 60% of a neoplastic
sample. Note: the first option uses the short system (microarray format) and does not
provide structural information. It shows that there are three copies of KMT2A in 60%
of the sample. The second option uses the short system (karyotype format) and shows
that there are two copies of KMT2A on one of the chromosome 11 homologues.

[Link] Insertion

The orientation of the insertion (ins) is indicated by the order of the bands and the
nucleotide coordinates of the inserted region when the detailed system (karyotype
format) of nomenclature is used. Insertions, for which the identity of the inserted
material is unknown, are described by use of the abbreviations ins and question
mark (?) and making use of a tilde (∼) to reflect uncertainty of the breakpoint
localization at the point of the insertion. As demonstrated in Figure 12, a 6 kb segment
of unknown DNA is inserted between 1∼4 kb of the reference. If the size of the unknown
insertion is not provided in the report text, it is not possible for the reader of the
nomenclature to know the size of the inserted material

Fig. 12. Schematic representation of a chromosomal insertion identified by genome mapping (courtesy
of Dr. H. Barseghyan). * Variable size refers to the insertion specific distance between points A and B.

[Link].1 Intrachromosomal Insertion

i. ogm[GRCh38]
ins(2)(p24.1p12p11.2)(19,795,841∼19,799,854::80,780,708_87,576,955)
or
ogm[GRCh38]
der(2)(pter_p24.1::p12_p11.2::p24.1_p12::p11.2_qter)(pter_19,795,841∼19,799,854:
:80,780,708_87,576,955::19,795,841∼19,799,854_80,780,707::87,576,956_qter)Gen
ome mapping shows that the short arm segment of approximately 6.8 Mb between
bands 2p12 and 2p11.2 is inserted into the short arm at band 2p24.1 within a 4 kb

180
 region. The original orientation of the inserted segment is maintained. The first option
uses the short system (karyotype format) nomenclature and the second uses the
detailed system (karyotype format). Note: the nucleotides at the insertion point are
separated from the inserted nucleotides by a double colon (::) even though the
insertion is intrachromosomal. To describe the chromosome using the detailed system,
it is described as a derivative (der) chromosome.
ii. ogm[GRCh38]
ins(2)(p24.1p11.2p12)(19,795,841∼19,799,854::87,576,955_80,780,708)
or
ogm[GRCh38]
der(2)(pter_p24.1::p11.2_p12::p24.1_p12::p11.2_qter)(pter_19,795,841∼19,799,854:
:87,576,955_80,780,708::19,795,841∼19,799,854_80,780,707::87,576,956_qter)Sam
e insertion example as above, except that the orientation of the bands within the
segment have been reversed in their new position, i.e., band 2p11.2 is now closer than
band 2p12 to 2pter.
iii. ogm[GRCh38]
der(2)(pter_p24.1::p11.2_p12::p11.2_p12::p24.1_p12::p11.2_qter)(pter_19,795,841
∼19,799,854::87,576,955_80,780,708::87,576,955_80,780,708::19,795,841∼19,799,
854_80,780,708::87,576,955_qter)Same insertion example as above with the inserted
segment in an inverted orientation. The inserted segment is duplicated.

[Link].2 Interchromosomal Insertion

i. ogm[GRCh38] der(2)ins(2;?)(q35;?)(219,823,156∼219,844,642;?)Genome mapping

shows that approximately 45.5 kb of material of unknown origin is inserted into the
long arm of chromosome 2 at band 2q35 within a 21.5 kb region. Note: the inserted
segment may be unknown either because of substantial rearrangement or because it is
composed of repetitive sequence.
ii. ogm[GRCh38]
ins(18;13)(q12.2;q22.2q13.3)(37,636,503∼37,640,279;77,743,263_35,366,781)Geno
me mapping shows an insertion of bands 13q13.3 to 13q22.2, from nucleotides
35,366,781 to 77,743,263, into band 18q12.2, between nucleotides 37,636,503 and
37,640,279, in an inverted orientation.
iii. ogm[GRCh38]
ins(X;7)(p21.1;q21.11q22.3)(36,850,248∼36,855,273;77,950,039_107,500,419)Gen
ome mapping shows an insertion of bands 7q21.11 to 7q22.3, involving nucleotides
77,950,039 to 107,500,419, into Xp21.1 between nucleotides 36,850,248 and
36,855,273. In the derivative X chromosome, band 7q21.11 is closer to Xpter and band
7q22.3 is closer to the chromosome X centromere.
iv. ogm[GRCh38]
der(X)ins(X;7)(p21.1;q22.3q21.11)(36,850,248∼36,855,273;107,500,419_77,950,03
9)Genome mapping shows a derivative X chromosome resulting from a duplication of
a segment from 7q21.11 to 7q22.3 that is inserted into Xp21.1. In the derivative X the
band 7q22.3 is closer to Xpter and band 7q21.11 is closer to X centromere. There are
two normal copies of chromosome 7.

181
 v. ogm[GRCh38]
der(17)dup(17)(p13.3p13.3)(2,252,518_2,372,750)ins(17;3)(p13.3;q29q29)(2,372,75
0∼2,376,439;197,617,365_197,768,658)Genome mapping shows a derivative
chromosome 17 resulting from two rearrangements. There is a duplication within
17p13.3 from nucleotide 2,252,518 to 2,372,750 and an insertion of an additional copy
of the region within 3q29, from nucleotides 197,617,365 to 197,768,658, into band
17p13.3. The orientation of the inserted segment from chromosome 3, relative to pter
and qter, is maintained.
vi. ogm[GRCh38]
der(4)del(4)(q22.2q22.2)(93,645,428_93,651,467)ins(4;15)(q22.2q22.2;q25.1q26.3)(
93,651,468∼93,652,173;80,402,705_98,589,048)Genome mapping shows a
derivative chromosome 4 resulting from an interstitial deletion within 4q22.2
involving nucleotides 93,645,428 to 93,651,467; an insertion of a duplicated region
from 15q25.1 to 15q26.3 of nucleotides 80,402,705 to 98,589,048, into chromosome
4 within 4q22.2 between nucleotides 93,651,468 and 93,652,173. The inserted
segment from chromosome 15 is in the same orientation relative to pter of the recipient
chromosome. There is one derivative chromosome 4 with both an interstitial deletion
within 4q22.2 and an insertion from chromosome 15, one normal chromosome 4, and
two normal chromosomes 15.

[Link] Inversion and Translocation

a. The same rules apply to genome mapping as are applied to karyotype descriptions of
translocations however, the nucleotide coordinates at the chromosome breakpoints are
indicated and the formation of fusion genes or the involvement of other significant
genes may be indicated.
b. In the case of gene fusions that alter regulation (e.g., IGH::MYC) the regulatory
element (reported first in the ISCN description) and regulated element are given even
if the break occurs outside the gene region.
c. Fusion genes that form a chimeric transcript are reported with the 5′ gene first,
followed by the 3′ gene.
d. It can be difficult to discriminate between homologous chromosomes in genome
mapping, and inversions may appear identical to translocations between homologues.
Examples viii and ix demonstrate the specific nomenclature to deal with this issue.
e. Genome mapping may call a reciprocal translocation with a region of uncertainty, or
displacement of the breakpoint on the two hybrid maps. This region of uncertainty can
be indicated by use of the tilde (∼).
i. ogm[GRCh38]
t(6;7)(q21;q32.1)(108,985,886∼108,982,237;128,310,022∼128,313,239)Genome
mapping shows a reciprocal translocation between chromosomes 6 and 7. The
chromosomes and breakpoints are separated by a semicolon (;) as are the
nucleotides. Note: the use of a tilde (∼) to demonstrate the region of uncertainty of
the breakpoints.
ii. ogm[GRCh38]
t(3;12)(q26.2;p13.2)(169,465,210∼169,466,001;11,801,652∼11,804,643)(MECOM::
ETV6)[VAF0.3]Genome mapping analysis of a neoplastic sample shows a

182
 translocation between 3q26.2 (between nucleotides 169,465,210 and 169,466,001) and
12p13.2 (between nucleotides 11,801,652 and 11,804,643) resulting in fusion of
the MECOM gene cluster and ETV6. The translocation is present at a VAF of 30%.

If the above example is confirmed by interphase triple color fluorescence in

situ hybridization then the result would be:

iii. ogm[GRCh38]
t(3;12)(q26.2;p13.2)(169,465,210∼169,466,001;11,801,652∼11,804,643)(MECOM::
ETV6)[VAF0.3].nuc ish (GOLIM4×2,MECOM×3,MYNN×2)(GOLIM4/MECOM
sep MECOM/MYNN)×1[150/200],(ETV6)×2(5′ETV6 sep 3′ETV6)×1[145/200]
or
ogm[GRCh38]
t(3;12)(q26.2;p13.2)(169,465,210∼169,466,001;11,801,652∼11,804,643)(MECOM::
ETV6)[VAF0.3]
nuc ish (GOLIM4×2,MECOM×3,MYNN×2)(GOLIM4/MECOM sep
MECOM/MYNN)×1[150/200],(ETV6)×2(5′ETV6 sep 3′ETV6)×1[145/200]Note:
genome mapping and ISH nomenclature may be presented in either order, separated
by a period (.), or onseparate lines without a period.
iv. ogm[GRCh38]
t(6;12;21)(q24.3;p13.2;q22.12)(146,851,704∼146,853,248;11,869,907∼11,870,531;
34,923,303∼34,925,677)(ETV6::RUNX1)[VAF0.4]Genome mapping analysis of a
neoplastic sample showed a three-way translocation between 6q24.3 (between
nucleotides 146,851,704 and 146,853,248), 12p13.2 (between nucleotides 11,869,907
and 11,870,531) and 21q22.12 (between nucleotides 34,923,303 and 34,925,677)
resulting in fusion of the ETV6 gene and RUNX1. The VAF may be reported in ([ ]) or
be indicated in the interpretive text of the report.
v. ogm[GRCh38]
7p12.2(50,325,186_50,390,021)×1[0.8],t(9;22)(q34.12;q11.23)(130,840,573∼130,84
1,562;23,246,875∼23,249,247)(BCR::ABL1)[VAF0.45]
or
ogm[GRCh38]
del(7)(p12.2p12.2)(50,325,186_50,390,021)[0.8],t(9;22)(q34.12;q11.23)(130,840,57
3∼130,841,562;23,246,875∼23,249,247)(BCR::ABL1)[VAF0.45]Genome mapping
shows a 65 kb interstitial deletion within band 7p12.2 in approximately 80% of the
sample. This deletion includes part of the IKZF1 gene. The translocation t(9;22) that
results in a BCR::ABL1 fusion gene is also present and its VAF should be indicated in
the ISCN description, the text of the report or in a table (see Table 11). In the first
ISCN description the chromosome 7 deletion is given using the short system
(microarray format) and the translocation between chromosomes 9 and 22 is given
using the short system (karyotype format). In the alternative description both
abnormalities are given using short system (karyotype format). Note: genes with
intragenic deletions are not included in the ISCN description (see Section 9.3).

183
 Table 11. Example of genome mapping results written in tabular form.

vi. ogm[GRCh38]
del(6)(q21q21)(106,685,000_108,976,886),t(6;7)(q21;q32.1)(108,979,887∼108,982,2
37;128,310,022∼128,312,239)Genome mapping shows an interstitial deletion within
6q21 and a reciprocal translocation between chromosomes 6 and 7. It is unclear whether
the deletion is in the same chromosome 6 homologue that is involved in the translocation
with chromosome 7.
If the deletion is on the same chromosome 6 homologue near the translocation
breakpoint, this would change the ISCN description to der(6) and the abnormalities
would be listed pter to qter.
If the deletion involves the other chromosome 6 homologue then the abnormalities are
given in alphabetical order.
Note: when it is uncertain whether abnormalities occur in cis or in trans, the
nomenclature is written as if the abnormalities are in trans.
vii. ogm[GRCh38]
t(1;17)(p36.23;p13.3)(8,781,440∼8,783,345;2,208,744∼2,208,947)(RERE::SMG6)[V
AF0.3],del(6)(q12q23.3)(63,771,696_135,674,891)[0.5],del(12)(p13.2)(pter_12,722,8
43)[0.5]Genome mapping of a neoplastic sample shows a reciprocal translocation
between chromosomes 1 and 17 resulting in a RERE::SMG6 fusion gene. The VAF of
the RERE::SMG6 fusion gene is 30%. There is an interstitial deletion of 6q in 50% of
this neoplastic sample. There is also an apparently terminal deletion of 12p (from 12pter
to 12p13.2) including the ETV6 gene, in 50% of the sample.
viii. ogm[GRCh38]
inv(16)(p13.11q22.1)(15,724,261∼15,727,746_67,088,684∼67,091,199) or
t(16;16)(p13.11;q22.1)(15,724,261∼15,727,746;67,088,684∼67,091,199)(CBFB::MY
H11) [VAF0.35]
or
ogm[GRCh38]
16::16(p13.11::q22.1)(15,724,261∼15,727,746::67,088,684∼67,091,199)(CBFB::MY
H11)[VAF0.35]Genome mapping shows the recurrent inv(16) or t(16;16) in this

184
 neoplastic sample, but the mechanism is not apparent because the technology does not
allow the homologous chromosomes 16 to be distinguished. Nomenclature for this
special case of either inversion or translocation is provided by use of the double
colon (::), i.e., 16::16, to indicate breakage and rejoining without showing the
mechanism.
ix. ogm[GRCh38]
inv(13)(q12.12q14.11)(23,515,291∼23,516,483_44,050,358∼44,051,942) or
t(13;13)(q12.12;q14.11)(23,515,291∼23,516,483;44,050,358∼44,051,942)
or
ogm[GRCh38]
13::13(q12.12::q14.11)(23,515,291∼23,516,483::44,050,358∼44,051,942)Genome
mapping shows a paracentric inversion or translocation involving the long arm of
chromosome 13, but the mechanism is not apparent because the technology has not
allowed the homologous chromosomes 13 to be distinguished. Nomenclature for this
special case of either inversion or translocation is provided by use of the double
colon (::) to indicate breakage and rejoining without showing the mechanism.
x. ogm[GRCh38]
inv(18)(q12.1q12.2)(33,122,379∼33,123,311_37,636,503∼37,640,279)Genome
mapping shows an inversion of chromosome 18 for which the chromosomal structure is
apparent or is demonstrated by another technique.
xi. 46,XX,–12,+[Link][GRCh38]
der(12)del(12)(p13.1p12.2)(14,574,829_20,872,573)inv(12)(p12.2q21.31)(20,872,784
_84,975,818)del(12)(q21.31q23.3)(84,976,892_105,462,170)The karyotype shows a
marker chromosome and genome mapping suggests that the marker is an abnormal
chromosome 12 resulting from a pericentric inversion of chromosome 12 with deletions
at both breakpoints. The derivative chromosome 12 is described in this example using
the short system (karyotype format) nomenclature. Note: the abnormalities of the
der(12) are given pter to qter.
xii. ogm[GRCh38]
dup(12)(pterp13.2)(pter_11,752,836),der(18)(18pter_18q12.1)(18pter_33,122,379∼33
,123,311)::(18q12.2_18q12.1)(37,640,279∼37,636,503_33,123,311∼33,122,379)::(18
q12.2::13q22.3_13q13.3)(37,636,504∼37,640,279::77,743,263_35,366,781)::(18q12.2
_18qter)(37,636,504∼37,640,279_18qter)Genome mapping shows an abnormal
chromosome 12 with duplication of 12pter to 12p13.2, described in this example using
the short system (karyotype format) nomenclature. An abnormal chromosome 18 is
described in this example using the detailed system (karyotype format). The abnormal
chromosome 18 has an inversion of 18q12.1 to 18q12.2 and an insertion of 13q13.3 to
13q22.2 at the distal 18q12.2 breakpoint. The inserted chromosome 13 segment is in an
inverted orientation relative to pter of the recipient chromosome 18.
xiii. ogm[GRCh38] r(8)(p23.1q24.3)(::9,689,003_141,892,587::)Genome mapping shows a
ring chromosome 8. Structural chromosome information is known.
xiv. ogm[GRCh38]
8pterp23.1(pter_9,689,003)×1,8::8(p23.1::q24.3)(9,689,564::141,891,598),8q24.3qter
(141,892,587_qter)×1Same example as above but without structural information.

185
 xv. ogm[GRCh38]
r(18)(p11.31q23)(::3,995,832∼3,993,827_77,086,852∼77,089,748::)Genome mapping
shows a ring chromosome 18. Structural chromosome information is known.
xvi. ogm[GRCh38]
18pterp11.31(pter_3,995,832∼3,993,827)×1,18::18(p11.31::q23)(3,995,832∼3,993,82
7::77,086,852∼77,089,748),18q23qter(77,086,852∼77,089,748_qter)×1Genome
mapping shows the same abnormality as the above example but without structural
information. The uncertainty of the breakpoints is indicated by the tilde (∼).

[Link] Inheritance

The parental origin of the abnormality, if known, follows the copy number
(×1, ×3, etc.). There is no space between the copy number and the abbreviation for
inheritance (dn, mat, dmat, pat, dpat, inh) or if the abbreviation for inheritance
follows a parenthesis.

i. ogm[GRCh38] Xq25(126,228,413_126,535,347)×0mat
or
ogm[GRCh38]
Xq25(126,231,505×1,126,228,413_126,535,347×0,126,537,900×1)matGenome
mapping shows interstitial loss of the long arm of the X chromosome at band Xq25
in a male. The size of the fragment containing the hemizygous loss is at least 306.9
kb. The next neighboring proximal nucleotide that does not show a loss is
approximately 3 kb away and the next neighboring distal nucleotide that does not
show a loss is approximately 2.5 kb away from the deletion. This interstitial deletion
is inherited from the mother.
ii. ogm[GRCh38]
+der(22)t(11;22)(q23.3;q11.21)(116,696,681;17,400,001)dmatGenome mapping
shows a supernumerary derivative chromosome 22 from a t(11;22) that is inherited
from the mother who is shown to carry a balanced t(11;22) translocation.
iii. ogm[GRCh38] t(11;22)(q23.3;q11.21)(116,696,681;17,400,001)Genome mapping of
the mother of the above example who carries a balanced t(11;22) translocation.
iv. ogm[GRCh38] 11q23.3qter(114,600,001_qter)×1dn,(21)×3dpatGenome mapping
shows two abnormalities: a de novo apparently terminal deletion of part of the long
arm of chromosome 11; and a trisomy of chromosome 21 that is known to be
translocation-type trisomy 21 inherited from a previously identified Robertsonian
translocation in the father. Note: Robertsonian translocations, e.g., der(14;21) are not
detectable by genome mapping.
v. ogm[GRCh38] 11q23.3qter(114,600,001_qter)×1dn,(21)×3dnGenome mapping
shows two de novo abnormalities: an apparently terminal deletion of part of the long
arm of chromosome 11 and trisomy 21.
vi. ogm[GRCh38]
der(X)ins(X;7)(p21.1;q21.11q22.3)(36,849,611∼36,850,248;77,950,039_107,500,41
9)dmatGenome mapping shows a derivative X chromosome resulting from an
insertion of the segment from 7q21.11q22.3 into Xp21.1. On the abnormal X
chromosome, band 7q21.11 is closer to Xpter and band 7q22.3 is closer to X

186
 centromere. There are two normal copies of chromosome 7. This is inherited from
the balanced ins(X;7) in the mother. The sex chromosome constitution of the
offspring is not given.

[Link] Complex Genomes

The abbreviation (cx) for complex chromosome rearrangement is used for multiple
complex rearrangements across the entire genome or within a region of the genome.

a. For a complex result, the sex chromosomes and autosomes are included in the same
parenthesis.
i. ogm (1–22)cxGenome mapping shows multiple complex rearrangements in
chromosomes 1 through 22. The sex chromosomes appear normal and are therefore not
shown. Note: this example is using the abbreviated system (microarray format).
ii. ogm (X,1–22)cxGenome mapping shows multiple complex rearrangements across the
entire genome in a female. Note: this example is using the abbreviated system
(microarray format).
iii. ogm (X,Y,1–22)cxGenome mapping shows multiple complex rearrangements across
the entire genome in a male.
iv. ogm[GRCh38] 3p26.3q12.1(61,495_98,386,666)cx[0.5]Genome mapping shows a
complex pattern of chromosomal copy number changes in the short arm and proximal
long arm of chromosome 3. It is seen in approximately 50% of the sample.
v. ogm[GRCh38]
(X,8,12)cx[?],t(12;20)(p13.2;q13.33)(11,930,948;62,644,813)(ETV6::PRPF6)[VAF0.
4],(19,20)cx[?]Genome mapping shows complex abnormalities involving chromosomes
X, 8, 12, 19 and 20. The proportion of the sample with these abnormalities could not be
determined. There is a translocation between chromosomes 12 and 20 that results in the
formation of an ETV6::PRPF6 fusion gene at a VAF of 40%.
vi. ogm[GRCh38]
der(9)(9pter_9q34.3)(pter_136,394,716)::(5q34_5q35.1)(168,693,009_170,930,711)::(
5q22.1_5q31.1)(110,670,173_131,637,622)::(5q35.1_5q35.3)(172,659,120_180,698,8
01)Genome mapping shows a derivative chromosome 9 in which the 9q34.3 to 9qter
segment is replaced by three segments from chromosome 5 that are in a different order
but are in the original orientation relative to pter of the der(9).
vii. 46,X,add(X)(p11.4)[16]/45,X[4].arr[GRCh38]
Xp22.33p11.4(14,482_39,595,755)×1[0.2],Xp11.4q28(40,920,409_155,232,907)×1[1.
0],11q12.3q25(63,578,458_134,868,407)×3[0.8].ogm[GRCh38]
der(X)t(X;11)(p11.4;q12.3)(40,920,409;63,578,469)[0.8]/(X)×1[0.2]Karyotype
analysis shows two different cell lines in a neoplastic sample: four metaphases with only
one X chromosome and sixteen metaphases with one normal X chromosome and another
X chromosome with additional material of unknown origin replacing Xpter to Xp11.4.
Microarray analysis shows an apparently terminal deletion of the short arm of the X
chromosome and gain of 11q12.3 to 11q25. Genome mapping shows that there is a
derivative X chromosome from a t(X;11) in 80% of the sample. The der(X)t(X;11)

187
 results in loss of Xpter to Xp11.4 and gain of 11q12.3 to 11qter in 80% of the sample.
The remaining 20% of the sample has only one intact X chromosome, i.e., it is apparent
that one copy of Xpter to Xp11.4 is present in 20% of the sample and one copy of Xp11.4
to Xqter is present in 100% of the sample. The clones can be discerned in the genome
mapping data because the karyotype is known. Note: the data are presented in the order
in which the analyses are performed. The karyotype result is listed first but the
microarray and genome mapping data may be listed in either order. The largest clone is
listed first (see Sections 4.5.3 and 9.3).
viii. ogm[GRCh38]
der(3)(18qter_18q22.1)(18qter_64,508,657∼64,495,812)::(18q22.1_q22.1)(64,599,39
3_64,508,657)::(18q21.2_18q21.31)(52,655,298∼52,663,250_58,108,577∼58,142,571
)::(6q24.1_6q22.31)(141,757,829∼141,750,150_122,094,992∼122,080,291)::(18q12.2
_18q21.2)(37,501,271∼37,515,201_52,655,298∼52,663,250)::(6q24.2_6q24.1)(143,1
85,339∼143,182,042_141,757,829∼141,750,150)::(3p14.2_3qter)(61,475,372∼61,480
,748_qter),der(6)(6pter_6q22.31)(pter_122,080,291∼122,094,992)::(18q22.1_18q21.3
1)(64,508,657∼64,495,812_58,142,571∼58,108,577)::(3p14.2_3pter)(60,003,285∼60,
000,939_pter),der(18)(18pter_18q12.2)(pter_37,501,271∼37,515,201)::(3p14.2_3p14.
2)(61,480,748∼61,475,372_60,032,856∼60,009,391)::(6q24.2_6qter)(143,182,042∼1
43,185,339_qter)Genome mapping shows complex rearrangements involving
chromosomes 3, 6 and 18. Most of the short arm of the derivative chromosome 3 is
replaced by rearranged sections of the chromosome 18 long arm (including a duplication
within 18q22.1) and part of the chromosome 6 long arm. Part of the long arm of the
derivative chromosome 6 is replaced by part of the long arm of chromosome 18 and part
of the chromosome 3 short arm. The derivative chromosome 18 distal to q12.2 is
replaced by material from the short arm of chromosome 3 and the long arm of
chromosome 6. Note: for clarity in complex cytogenomic ISCN descriptions the
karyotype format is used. Terms such as dup and inv are not employed in the
description of a derivative chromosome using the detailed system (karyotype format)
nomenclature. Structural changes such as dup and inv, are apparent from the nucleotide
coordinates of the translocated segments that are written as they are
oriented pter to qter on the derivative chromosome. The pter to qter orientation is
determined by the orientation of the segment containing the centromere. A schematic
diagram of the rearrangements is shown in Figure 13.

188
 Fig. 13. Schematic diagram of complex rearrangements of chromosomes 3, 6 and 18 (courtesy of Uwe
Heinrich).

[Link].1 Chromoanagenesis

Complex genome rearrangements grouped

under chromoanagenesis, i.e., chromoanasynthesis (cha), chromothripsis (cth)
and chromoplexy (cpx), may be challenging to differentiate as multiple overlapping
genome instability and repair mechanisms may be present in an individual sample.
See Figure 10 for illustrations of these highly complex events that are described below
by the simplified nomenclature. Note: genome mapping may not always differentiate

189
 between chromothripsis and chromoanasynthesis; in this case, the term complex (cx)
may be used with clarification provided in the interpretation.

[Link].1.1 Chromothripsis

Chromothripsis (cth) is a phenomenon by which multiple rearrangements originate

through random shattering and reshuffling of clustered chromosome regions in a single
catastrophic event (see Section [Link]).

i. ogm (2p)cthGenome mapping shows multiple alternating copy number changes in the
short arm of chromosome 2 that are consistent with chromothripsis.
ii. ogm (5,8)cth[?]Genome mapping shows chromothripsis in chromosome 5 and
chromosome 8. The proportion of the neoplastic sample with chromothripsis could not
be determined as indicated by a question mark in square brackets ([?]).
iii. ogm[GRCh38] (5)cth,6q25.1q27(149,100,000_170,899,992)×1,(8)cth
or
ogm[GRCh38] (5)cth,del(6)(q25.1q27)(149,100,000_170,899,992),(8)cthGenome
mapping shows chromothripsis of chromosomes 5 and 8 with a concomitant loss of
part of the long arm of one chromosome 6 from 6q25.1 to 6q27.
iv. ogm[GRCh38] 2p24.3p21(13,197,725_46,386,298)cth[0.9]Genome mapping shows
chromothripsis occurring within the region 2p24.3 to 2p21 in approximately 90% of
the neoplastic sample.

[Link].1.2 Chromoanasynthesis

Chromoanasynthesis (cha) is a phenomenon by which multiple combinations of

structural variants resulting in copy number changes (commonly duplications) (see
Section [Link]).

i. ogm (3)chaGenome mapping analysis shows multiple changes of copy number,

consistent with chromoanasynthesis involving chromosome 3.
ii. ogm[GRCh38] 17p13.3q11.2(1,207,467_28,236,645)cha[?]Genome mapping
analysis shows multiple changes of copy number involving most of the short arm of
chromosome 17. Note: it is not possible to determine the size of the clone with
chromothripsis of chromosome 17, so the proportion of the sample bearing this
abnormality is given as a question mark in square brackets ([?]).

[Link].1.3 Chromoplexy

Chromoplexy (cpx) is a phenomenon where derivative chromosomes are generated

by the chimeric joining of DNA segments from two or more chromosomes.
Chromosome reassembly is predicted to occur by c-NHEJ or alternative end joining
(Alt-EJ) repair (Zepeda-Mendoza and Morton, 2019) (see Fig. 10).

i. ogm (1,2,3,4)cpxA four-way chromoplexy event between chromosomes 1, 2, 3, and 4

described using the abbreviated system (microarray format) of [Link]

190
 also Section [Link] for an example of the detailed system (microarray format) of
nomenclature that can also be applied to describe chromoplexy.

[Link] Multiple Techniques

Where multiple techniques are used, the karyotype is reported first, if performed, and
other techniques may be reported in any order, e.g., they may be presented in the order
in which they are performed. The ISCN description for each subsequent technique is
preceded by a period (.).

i. 47,XY,+mar [Link][GRCh38] 1p12p11.2(117,596,421_121,013,236)×3Karyotype

analysis detected a de novo marker. Genome analysis shows a single copy de
novo gain of the short arm of chromosome 1 from bands 1p12 to 1p11.2, spanning
approximately 3.4 Mb, likely identifying the marker chromosome. Genome mapping
will not detect the heterochromatin near the centromeres and so the centromeric bands
are rarely included in the nomenclature of rings and markers after genome mapping
analysis. The centromere is probably included in the aberration and could be confirmed
by in situ hybridization. An amended result after in situ hybridization analysis would
be written as given in example ii.
ii. 47,XY,+mar [Link] der(1)(D1Z1+).ogm[GRCh38]
1p12p11.2(117,596,421_121,013,236)×3Unidentified de novo marker chromosome
is detected by karyotype analysis and confirmed to be of chromosome 1 origin by in
situ hybridization. Genome mapping identified gain of a segment of the chromosome
1 short arm from 1p12 to 1p11.2 but did not identify the centromere or the
pericentromeric heterochromatin on the chromosome 1 long arm.

191
10 Region-Specific Assays (RSA)

10.1 Introduction

Region-specific assays (rsa) are used to quantify the number of copies or structural
rearrangement(s) of a chromosome and/or chromosomal region. They are applicable
only to diagnostic tests and encompass several diagnostic technologies, i.e.,

• Multiplex ligation-dependent probe amplification (MLPA)

• Quantitative fluorescent PCR (QF-PCR)
• Real-time quantitative PCR (qPCR)
• Non-invasive prenatal diagnosis (NIPD). Note: rsa nomenclature must not be used for
screening technologies, e.g., screening by NIPT (non-invasive prenatal testing)
• Bead-based assays
• Targeted microarrays that are limited to a number of regions that can be reasonably
listed in the nomenclature
• Masked or targeted genome mapping
• Targeted chromosome analysis (sometimes referred to as scoring) for a chromosome
abnormality where a full karyotype is not performed.

10.2 RSA Nomenclature Specific Rules

a. For general cytogenomic rules that are also applicable to this chapter see Chapter 4.
b. Region-specific assays (rsa) is a generic nomenclature for targeted assays other than
FISH and describes the normal and/or abnormal results for the chromosomes/regions
tested.
c. It is essential that the written report includes details of the specific targeted RSA
cytogenomic technique undertaken as well as the resolution and limitations of the test.
d. The rsa nomenclature can be written in the abbreviated, short, detailed or extended
systems depending on whether the results are given in a karyotype format or the
microarray format (see Section 4.7). The karyotype format uses the short and detailed
systems while the microarray format uses the abbreviated, short and extended systems.
• The abbreviated system (karyotype and microarray formats) describes the
abnormality/abnormalities with no breakpoints and no nucleotides, e.g., rsa (21)×3 or
rsa (X,Y)×1,(13,18)×2,(21)×3 (Section 10.3.2) or rsa (5,7)×2[20] (Section 10.3.1).
• The short system includes the breakpoints (karyotype format) or nucleotides
(microarray format) involved in the abnormality, e.g., rsa (21)×1,i(21)(q10)×1
(see Section 10.3.3) and rsa[GRCh38] 22q11.21 (18,891,533_21,111,169)×2

192
 (see Section 10.4.1). In some instances, the use of the short system, and not the
abbreviated system, will be essential to give clarity for an unbalanced result.
• The detailed system (karyotype format only) defines each abnormal chromosome in
terms of its band composition from pter to qter.
• The extended system (microarray format only) describes the abnormality in detail
including the flanking normal nucleotides, without any commas, e.g., rsa[GRCh38]
22q11.21(18889117×2,18891533_21111169×1,21116218×2).
e. With targeted tests, limited chromosomes/regions/loci are analyzed and the normal state
for the other chromosomes/regions/loci tested can either be included in the ISCN or the
report description. The decision whether to list the normal loci in the assay in the ISCN
is at the discretion of the laboratory, although in some instances the inclusion of the
normal results adds clarity to the result. If the normal results are not given in the ISCN,
then the normal state of the other chromosomes/regions/ loci tested within the
assay MUST be stated in the report description.
f. Where a manufacturers’ kit is used, the kit number and version must be given in either
the ISCN (see Sections 10.3.1 and 10.4) or the report text as applicable.
g. The name of the MLPA kit can be used in the ISCN description if the genomic
coordinates are not known; however, greater precision is achieved by providing
nucleotide numbers. The span of nucleotides is separated by an underscore (see Section
4.4.5). Commas in nucleotide numbers are optional.
h. There is a space after rsa or rsa[GRCh38] (see Sections 4.4.1 and 4.4.5).
i. The genome build is given when nucleotides are reported (see Section 4.4.5).
j. If the genome build is not given in the nomenclature, e.g., for chromosome aneuploidy,
the reference sequence or kit is given in the written description of the report.
k. To indicate a mixed cell population
• For targeted chromosome analysis, the absolute cell numbers for each cell line are given
in square brackets ([ ]).
• For cytogenomic techniques, the proportion of cells within the sample with the
abnormality can be estimated and included in square brackets ([ ]) following the copy
number. If the proportion of abnormal cells cannot be estimated, the copy number range
may be given (see Section 4.5.3).
• The abbreviation mos is NOT used in rsa nomenclature.
l. Results are listed in ascending numerical chromosome order, with the sex chromosomes
listed first (see Section 4.3).
m. Chromosomes with the same copy number can be included in the same parentheses but
the chromosome order rule must be followed (see Section 4.3 for chromosome order
rules).
n. Loci and genes are listed in chromosomal order and, within a chromosome,
from pter to qter (see Section 4.3).
o. Some of the ISCN examples in this chapter do not represent observed data but are
provided to demonstrate the nomenclature principles.

10.2.1 Targeted Chromosome Analysis

a. The abbreviated system (karyotype format) describes only the targeted chromosome(s)
complement.

193
 b. The number of chromosomes is indicated by a multiplication (×) sign followed by the
number of copies present.
c. The short system describes the structural abnormality including the breakpoints. The
inclusion of the non-rearranged homologues is optional unless there is loss or gain when
their inclusion is essential, i.e.,
• For balanced structural chromosome complements where the homologues are
apparently normal the abbreviated or short system can be used. However, if the non-
rearranged homologue is lost, then the short system of the nomenclature is used with the
number of normal homologues described as zero, e.g., rsa (21)×0,i(21)(q10)×1 and rsa
(8)×1,t(8;21)(q22;q22)×1,(21)×0[20] when there is no normal chromosome 21.
• Unbalanced chromosome complements are always described in the short system where
the normal chromosomes are also listed in the ISCN, e.g., rsa (21)×1,i(21)(q10)×1
(see Section 10.3.3).
d. When a targeted screen is undertaken in combination with a full karyotype, the inclusion
of the rsa ISCN description is optional if it does not add any additional information, i.e.,
If the karyotype is 46,XX,t(9;22)(q34;q11.2)[4]/46,XX[18], and it is optional to include
rsa t(9;22)(q34;q11.2)×1[30]/(9,22)×2[10].
e. Absolute cell numbers are given in square brackets ([ ]) in targeted chromosome
analysis for neoplastic samples and to indicate mixed cell populations in both
constitutional and neoplastic samples.

10.2.2 Fusion Genes

a. Evidence of a fusion or juxtaposition of genes is indicated by a double

colon (::), e.g., BCR::ABL1.
b. In gene fusions, only the chimeric genes or those that alter the regulation of the gene is
given in the ISCN description, e.g., BCR::ABL1 or IGH::CCND1, respectively. The
reciprocal gene fusion is only given if both products are known to be
oncogenic/expressed.
c. If two or more different gene fusions are present, they are listed in the chromosomal
order of the clinically relevant fusion gene.
d. When it is unknown which is the active oncogenic transcript, then the fusion is described
according to the numerical order of the chromosomes, and from pter to qter.

10.2.3 Methylation Specific Analysis

a. Methylation specific MLPA (MS-MLPA) can detect copy number variation as well as
the methylation pattern.
b. Both the copy number and methylation status must be given in the ISCN.
c. The technique abbreviation used is rsa-ms.
d. A normal methylation pattern is represented by met.
e. If the methylation pattern is abnormal, then lom is used to describe the absence of
methylation and gom for gain of methylation.
f. The methylation nomenclature follows HGVS nomenclature (Monk et al., 2018) unless
this contradicts the generic ISCN rules (see notes below under 10.2.3).

194
 g. The copy number is indicated by a multiplication (×) sign followed by the number of
copies present (×), e.g., ×1 or ×2.
h. The pipe character (|) is used to indicate that there is a modification of the sequence
not a sequence variant, i.e., indicates a change of methylation status, e.g., rsa-ms
11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-DMR)|lom,(H19/IGF2:IG-DMR)met
i. If the copy number and methylation specific region are within the same breakpoint, then
the breakpoint is not repeated for the methylation part of the ISCN, e.g., rsa-
ms[GRCh38] 11p15.5(1,995,605_2,004,583)×3(KCNQ1OT1:TSS-
DMR)met,(H19/IGF2:IG-DMR)|gom
j. Different CpG positions within the imprinted differentially methylated regions (DMRs)
may be examined and the level of mosaicism may be different for each CpG position. If
all the CpG islands show loss of methylation, it is optional whether the level of
mosaicism is reported. If the mosaicism is reported, then it is recommended that the
methylation status is described as an average percentage of all CpGs analyzed, i.e.,
[0.25]. Note: in HGVS curled parentheses ({}), i.e., are used for the average
percentage, and square brackets ([ ]) are used for alleles.
k. If only some of the individual CpG islands show loss of methylation, then these may be
specified individually (see Monk et al., 2018) at the discretion of the laboratory.
l. If multiple methylation alleles are examined, these are separated by a comma. Note: in
HGVS a semicolon (;) is used for different alleles and a comma (,) is used to separate
different transcripts of the same allele (see Monk et al., 2018).

10.3 RSA Nomenclature for Aneuploidy and Targeted Cytogenomic Analysis

10.3.1 Normal Results

i. 46,[Link] (X,13,18,21)×2Apparently normal female karyotype and normal copy

number of chromosomes X, 13, 18 and 21 using a region-specific assay such as QF-
PCR or MLPA.
ii. rsa (X,Y)×1,(13,18,21)×2Normal copy number of chromosomes X, Y, 13, 18 and 21
in a male using a region-specific assay such as QF-PCR or MLPA.
iii. rsa (11,22)×2Targeted microarray or targeted chromosome analysis for chromosomes
11 and 22 to exclude an unbalanced translocation in the offspring where one of the
parents carries a t(11;22)(q23.3;q11.2) or alternatively for targeted chromosome
analysis to exclude a balanced translocation in a family member.
iv. rsa (5,7)×2[20]Targeted chromosome analysis for chromosomes 5 and 7 in a neoplastic
sample in 20 metaphases.
v. rsa (14,21)×2Targeted chromosome analysis for chromosomes 14 and 21 to exclude
the presence of a der(14;21)(q10;q10).
vi. rsa (15,17)×2[30]Targeted chromosome analysis in a neoplastic sample for
chromosomes 15 and 17 did not detect the presence of a t(15;17)(q22;q21.1) in 30
metaphases.
vii. 46,XX,t(9;22)(q34;q11.2)[2]/46,XX[18].rsa (9,22)×2[30]A low-level t(9;22)
neoplastic clone detected in 2 out of 50 metaphases on combined full karyotyping and
scoring. The targeted chromosome analysis (scoring) for only chromosomes 9 and 22
did not detect a t(9;22)(q34;q11.2) in 30 metaphases. The text of the report gives the
limitations of each analysis.

195
 viii. rsa (X,1-22)(P070-B3)×2Targeted MLPA analysis for all the subtelomere probes using
the kit P070 version B3 showed a normal copy number in a female.
ix. rsa (X,Y)(P070-B3)×1,(1-22)(P070-B3)×2Targeted MLPA analysis for all
subtelomere probes using the kit P070 version B3 showed a normal copy number in a
male.

10.3.2 Aneuploidy

For the abbreviated system (karyotype and microarray formats) of the rsa
nomenclature, the abnormal aneuploid nomenclature is the same for MLPA, QF-PCR,
targeted microarray, or targeted chromosome analysis.

i. rsa (21)×3Targeted chromosome analysis using the karyotype format confirms a non-
disjunction trisomy 21 (i.e., excludes a Robertsonian translocation) following a
positive trisomy 21 result on [Link]-PCR & MLPA analysis using the microarray
format shows an abnormal copy number result for chromosome 21 indicating a gain
for the chromosome (trisomy). The normal disomic state for the other chromosomes
tested must be given in the written description of the report. Note: for clarity, the
apparently normal disomic states for the sex chromosomes (male) and chromosomes
13 and 18, which were also tested, may be included in the abbreviated system
nomenclature, i.e., rsa (X,Y)×1,(13,18)×2,(21)×3 or rsa (X,13,18)×2,(21)×[Link]
microarray analysis using the microarray format confirms trisomy 21 following a
positive trisomy 21 result on NIPT; no other chromosome profiles were
analyzed. Note: the abnormal nucleotides may also be included in the short system
(microarray format) nomenclature, i.e., rsa[GRCh38]
21q11.2q22.3(13,531,865_46,914,745)×3. If all chromosomes had been analyzed, the
nomenclature would be arr (21)×3 (abbreviated system, micorarray format) or
arr[GRCh38] 21q11.2q22.3(13,531,865_46,914,745)×3 (short system, microarray
format) (see Section 8.2.2).
ii. rsa (13)×3Targeted chromosome analysis using the karyotype format confirms a non-
disjunction trisomy 13 (i.e., excludes a Robertsonian translocation) following a
positive trisomy 13 result on [Link]-PCR & MLPA analysis using the microarray
format shows an abnormal copy number result for chromosome 13 indicating a gain
for the chromosome (trisomy). The normal disomic state for the other chromosomes
tested must be given in the written description of the report. Note: for clarity, the
apparently normal disomic states for the sex chromosomes (female) and chromosomes
18 and 21, which were also tested, may be included in the abbreviated system
nomenclature, i.e., rsa (X)×2,(13)×3,(18,21)×[Link] microarray analysis using
the microarray format confirms trisomy 13 following a positive trisomy 13 result on
NIPT; no other chromosome profiles were analyzed. Note: the abnormal nucleotides
may also be included using the short system (microarray format) in the
nomenclature, i.e., rsa[GRCh38] 13q12.11q34 (19,606,120_114,341,521)×3. If all
chromosomes had been analyzed the nomenclature would be arr (13)×3 or using the
short system (microarray format) arr[GRCh38] 13q12.11q34
(19,606,120_114,341,521)×3.

196
 iii. rsa (X)×2,(Y)×1,(13)×2,(18)×3,(21)×2
or
rsa (X)×2,(Y)×1,(18)×3Abnormal copy number result for chromosomes X and 18
showing an additional X chromosome in a male and gain of chromosome 18
(trisomy) using a region-specific assay, e.g., QF-PCR or MLPA. Note: if the normal
disomic state for chromosomes 13 and 21 is not included in the ISCN, then
it must be stated in the written description of the report.
iv. rsa (X)×2,(Y)×1,(13,18)×2,(21)×3
or
rsa (X)×2,(Y)×1,(21)×3Abnormal copy number result showing an additional X
chromosome in a male and gain of chromosome 21 (trisomy) using a region-specific
assay, e.g., QF-PCR or MLPA. Note: if the normal disomic state for chromosomes
13 and 18 is not included in the ISCN, then it must be stated in the written
description of the report.
v. rsa (X)×1,(13,18,21)×2
or
rsa (X)×1Abnormal copy number showing a loss of one sex chromosome, consistent
with monosomy X using a region-specific assay, e.g., QF-PCR. Note: for clarity, the
normal disomic states for chromosomes 13, 18, and 21 may be included in the
nomenclature. Also in a prenatal sample it is optional whether (Y)×0 is
included. Note: if the normal disomic state is not included in the ISCN, then
it must be stated in the written description of the report.
vi. rsa (X)×2,(Y)×1,(13,18,21)×3Abnormal copy number showing an additional X
chromosome plus gain of chromosomes 13, 18, and 21 (three copies) in a male using
a region-specific assay, e.g., QF-PCR. This result may be indicative of triploidy.
vii. rsa (21)×1[0.5]
or
rsa 21q11.2q22.3(13,531,865_46,914,745)×1[0.5]Targeted microarray analysis for
chromosome 21 showing mosaic loss of this chromosome following an inconclusive
QF-PCR result for chromosome 21. No other chromosome profiles were analyzed.
viii. rsa (X)×2,(Y)×1,(21)×3Targeted chromosome analysis for the sex complement and
chromosome 21 following an abnormal NIPT test that showed an XXY sex
complement and trisomy 21. A Robertsonian translocation involving chromosome 21
was excluded. No other chromosomes were analyzed.
ix. rsa (21)×3[25]/(21)×2[5]Targeted chromosome analysis for chromosome 21 showing
mosaicism for trisomy 21. No other chromosomes were analyzed. Note: if the largest
cell line was (21)×2[25], the normal cells are listed last, i.e., rsa (21)×3[5]/(21)×2[25].
x. rsa (X,13,18)×2,(21)×2∼3Abnormal copy number result for chromosome 21 showing
two to three copies for the chromosome 21 (mosaic trisomy) in a female using a region-
specific assay, e.g., QF-PCR or MLPA. For chromosomes X, 13 and 18 a normal
disomic state is evident. Note: if the ISCN is written as rsa (21)×2∼3, then the normal
disomic results for chromosomes X, 13 and 21 must be stated in the written text of the
report.
xi. rsa (X,13)×2,(18)×3[0.6],(21)×2
or
rsa (18)×3[0.6]Abnormal copy number result for chromosome 18 showing

197
 mosaicism for chromosome 18 (mosaic trisomy) in a female. Approximately 60% of
the cells have this gain using a region-specific assay, e.g., QF-PCR or MLPA. For
chromosomes X, 13 and 21 a normal disomic state is evident. Note: if the ISCN is
written as rsa (18)×3[0.6] then the normal disomic results for chromosomes X, 13
and 21 must be stated in the written text of the report.
xii. rsa (X,13,18,21)hmzAbnormal copy number for chromosomes X, 13, 18 and 21 using
a region-specific assay, e.g., QF-PCR or MLPA, consistent with a diploid mole where
all signals are homozygous and copy number cannot be determined. Note: pat cannot
be added as the region-specific assay does not prove this.
xiii. rsa (X,Y)×1,(13,18,21)×2htzAbnormal result for chromosomes X, Y, 13, 18 and 21
showing heterodisomy using a region-specific assay, e.g., QF-PCR or MLPA,
consistent with a male hydatidiform mole (complete mole) resulting from two different
sperm.

10.3.3 Abnormal Structural

i. rsa der(14;21)(q10;q10)×1Targeted chromosome analysis for a der(14;21)(q10;q10)

showed a balanced der(14;21) carrier result in the parent of a trisomy 21 child. It is
optional whether the normal chromosomes 14 and 21 are listed, i.e., rsa
(14)×1,der(14;21)(q10;q10)×1,(21)×1.
ii. rsa (14)×1,der(14;21)(q10;q10)×1,(21)×2Targeted chromosome analysis for a
der(14;21)(q10;q10) showed trisomy 21 with a der(14;21). The two normal copies of
chromosome 21 must be listed for full comprehension of the unbalanced result.
iii. rsa (21)×0,i(21)(q10)×1Targeted chromosome analysis for chromosome 21. The lack
of a normal chromosome 21 must be listed for full comprehension of this balanced
result.
iv. rsa (21)×1,i(21)(q10)×1Targeted chromosome analysis for chromosome 21. Trisomy
21 with an isochromosome 21. The normal chromosome 21 must be listed for full
comprehension of the unbalanced result.
v. rsa inv(8)(p22q12.1)×1Targeted chromosome analysis of parental blood for an
inv(8)(p22q12.1) seen in the fetus.
vi. rsa t(9;22)(q34;q11.2)×1[10]/(9,22)×2[20]Targeted chromosome analysis for a
t(9;22)(q34;q11.2) in a neoplastic sample. The cell numbers are given for neoplastic
samples.
vii. rsa t(6;16)(p22.1;q22.1)×1matTargeted chromosome analysis for a
t(6;16)(p22.1;q22.1). As the t(6;16) is known to be inherited from the mother mat is
included.

10.4 RSA Nomenclature for Investigation of Partial Gain or Loss

10.4.1 Normal Results

i. rsa (kit name with version)×2A normal result for all probes within the MLPA kit. The
name of the kit can be inserted within the parentheses when all the probes are
apparently normal.
ii. rsa 22q11.2(kit name with version or nucleotides)×2A normal result for a specific
probe using a targeted analysis, e.g., MLPA or targeted microarray.

198
 iii. rsa (22q11.2)×2Targeted microarray analysis specifically for 22q11.2.
iv. rsa[GRCh38] 22q11.21(18,891,533_21,111,169)×2Targeted microarray analysis
shows normal copy number for the 22q11.2 deletion syndrome critical region.

10.4.2 Abnormal Results

i. rsa 22q11.2(kit name with version)×1Abnormal copy number result showing a loss of
22q11.2 using an MLPA kit. The name of the kit can be inserted in the parentheses.
ii. rsa (22q11.2)×1
or
rsa[GRCh38] 22q11.21(18,891,533_21,111,169)×1
or
rsa[GRCh38] 22q11.21(18889117×2,18891533_21111169×1,21116218×2)Targeted
microarray analysis specifically for the 22q11.2 deletion syndrome region showing a
loss of one copy. No other regions within chromosome 22 were analyzed. The three
alternatives are given for the abbreviated, short, and extended systems (microarray
format).
iii. rsa[GRCh38] Xp21.1(32,448,538_32,472,228)×1
or
rsa[GRCh38] Xp21.1(32441314×2,32448538_32472228×1,32484970×2)Abnormal
copy number result showing loss within the DMD gene by targeted microarray in a
female. The extended system (microarray format) nomenclature shows that the next
neighboring nucleotides that do not show a loss are 7,224 and 12,742 nucleotides
away from the alteration.
iv. rsa[GRCh38] Xp21.2p21.1(31,037,731_33,457,670)×1Relative haplotype dosage
using NIPD showed an abnormal copy number result for Xp21.2 to Xp21.1 involving
a 2.4 Mb loss within the DMD gene.
v. rsa[GRCh38] 1p36.33p36.32(849,466_2,432,509)×1Targeted microarray analysis
showed a single copy loss of the short arm of chromosome 1 at 1p36.33 to [Link]
rsa 1p36.33(P070-B3)×1Targeted MLPA (kit P070-B3) showed a single copy loss of
the short arm of chromosome 1 at 1p36.33. The kit number is given as the nucleotide
coordinates are not known.
vi. rsa 20q13.3(P070-B3)×1,22q13.3(P070-B3)×1Targeted MLPA (kit P070-B3) showed
a subtelomeric loss of both 20q13.3 and 22q13.3. The kit number is given as the
nucleotide coordinates are not known.
vii. arr[GRCh38] 8p23.1(8,479,797_11,897,580)×[Link][GRCh38]
8p23.1(11,676,959_11,760,002)×1
or the ISCN can be listed on separate lines without the period (.)arr[GRCh38]
8p23.1(8,479,797_11,897,580)×1
rsa[GRCh38] 8p23.1(11,676,959_11,760,002)×1Microarray analysis shows an
interstitial deletion of 8p at subband 8p23.1. A region-specific assay, e.g., PCR,
targeting the GATA4 gene confirmed loss of this region but could not further
delineate the extent of the 8p deletion.
viii. rsa[GRCh38] 4q32.2q35.1(163,146,681_183,022,312)×1Abnormal copy number
result for 4q32.2 to 4q35.1 showing a single copy loss using a region-specific
assay, e.g., targeted microarray.

199
 ix. rsa 13q14.2(RB1,DLEU2)×1,13q34(LAMP1)×3Abnormal result in a neoplastic
sample showing a loss of the RB1 and DLEU2 genes and gain of the LAMP1 gene
using a region-specific assay such as MLPA (P377-A3). Genes are listed
from pter to qter.
x. rsa 13q14.2(RB1×1,DLEU2×3),13q34(LAMP1)×2Abnormal result in a neoplastic
sample showing a loss of the RB1 gene plus gain of DLEU2 gene using a region-
specific assay such as MLPA kit (P377-A3). The LAMP1 result is normal. Loci and
genes are listed from pter to qter within the same chromosome.
xi. rsa 13q14.2(D13S319)×1,13q34(LAMP1)×1,17p13.1(TP53)×1Abnormal result in a
neoplastic sample showing a loss of the marker D13S319 plus the LAMP1 gene and
loss of the TP53 gene using a region-specific assay such as MLPA kit (P377-A3). Loci
and genes are listed in chromosomal order.
xii. rsa 15q12(GABRB3)×1,16p11.2(LAT)×3Abnormal copy number result showing a
loss of the GABRB3 gene and gain of the LAT gene using a region-specific assay such
as MLPA kits (P036-E3 and P070-B3).
xiii. rsa 15q11.2(UBE3A)×1,15q12(GABRB3)×3Abnormal copy number result showing a
loss of the UBE3A gene and a gain of the GABRB3 gene and using a region-specific
assay such as MLPA kit (P336-B1).
xiv. rsa 22q11.2(P250-B2)×1Targeted MLPA kit (P250-B2) showed an interstitial loss of
22q11.2.
xv. rsa 22q11.21(HIRA)×1matAbnormal copy number result showing interstitial loss of
22q11.21, inherited from the mother, using a region-specific assay targeting
the HIRA gene such as targeted microarray or MLPA kit (P250-B2).
xvi. rsa
22q11.21(MICAL3x1,HIRAx1,MED15×2,HIC2×1),22q13.33(ARSA)×1Abnormal
copy number result showing a loss within 22q11.21 and 22q13.33 using a region-
specific assay such as an MLPA-HD kit. Genes MICAL3, HIRA, HIC2,
and ARSA show a loss. MED15 has a normal copy number. The genes are listed
from pter to qter within the same chromosome region according to the genome build.
The normal copy number for MED15 is given as this clarifies the extent of the
abnormality.
xvii. rsa 22q11.21(MICAL3,HIRA,MED15,HIC2)×1,22q13.33(ARSA)×1Abnormal copy
number result showing two separate losses within 22q11.21 and 22q13.33 using a
region-specific assay such as an MLPA-HD kit.
Genes MICAL3, HIRA, MED15, HIC2 and ARSA show a loss. The genes are listed
from pter to qter within the same chromosome region.
xviii. rsa
22q11.21(CLDN5,GP1BB)×1,22q11.21(SNAP29,PPIL2)×2,22q11.22q11.23(RTDR
1)×1Abnormal copy number result showing a partial loss within 22q11 using a region-
specific assay targeting several loci such as an MLPA-HD kit. The proximal
(CLDN5 and GP1BB) and distal (RTDR1) regions genes are only
deleted. SNAP29 and PPIL2 have a normal copy number.

200
10.5 RSA Nomenclature for Balanced Translocations or Fusion Genes
10.5.1 Normal Results

i. rsa (FIP1L1,CHIC2,PDGFRA,PDGFRB,PCM1,FGFR1,JAK2,ETV6)×2A normal

result using genome mapping as a region-specific analysis for a panel of genes that are
disrupted in myeloid and lymphoid neoplasia with eosinophilia. There is
no ETV6::PDGFRB fusion.
ii. rsa (ABL1,BCR)×2Normal result using a region-specific assay (e.g., targeted
sequencing) that shows no evidence of a BCR::ABL1 fusion or juxtaposition.

10.5.2 Abnormal Results

i. rsa (BCR::ABL1)×1Abnormal result using a region-specific assay (e.g., targeted

sequencing) that shows evidence of a BCR::ABL1 fusion or juxtaposition. Only the
active oncogenic gene fusion is given in the ISCN (see Section 10.2.2).
ii. rsa (IGH::MMSET)×1[0.45],(IGH::FGFR3)×1[0.45]Abnormal result using a region-
specific assay (e.g., targeted sequencing) that shows evidence of a fusion or
juxtaposition of IGH and MMSET in addition to a fusion between IGH and FGFR3 in
a myeloma. The IGH::MMSET rearrangement is present in 45% of the sample. Both
rearrangements are given in the nomenclature as both have altered regulation.
iii. rsa (BCR::ABL1)×2[0.9]Abnormal result using a region-specific assay (e.g., targeted
sequencing) that shows evidence of a fusion or juxtaposition of ABL1 and BCR. There
are two copies of the BCR::ABL1 fusion indicating gain of this region.
The BCR::ABL1 rearrangement is present in 90% of the
sample. Note: the ABL1::BCR reciprocal chimeric gene is not reported in the
nomenclature as it is known to lack clinical significance.
iv. rsa (ETV6::PDGFRB)×1[0.30]An abnormal result using genome mapping as a region-
specific analysis (e.g., targeted sequencing) showing an ETV6::PDGFRB fusion or
juxtaposition in 30% of the DNA sample. No other fusions or abnormalities for all
other regions analyzed. Note: the PDGFRB::ETV6 reciprocal chimeric gene is not
reported in the nomenclature as it is known to lack clinical significance.
v. rsa (KMT2A::AFF1)×1[0.75]Abnormal result using a region-specific assay (e.g.,
targeted sequencing) that shows evidence of a fusion or juxtaposition
of KMT2A and AFF1 in a pediatric ALL in 75% of the DNA sample.
vi. arr[GRCh38] (8)×3,9q34.12(130,700,664_130,806,532)×[Link]
(CBFB::MYH11)×1,(BCR::ABL1)×1Abnormal microarray result showing a gain of
chromosome 8 and loss within chromosome band 9q34.12 involving nucleotides
130,700,664 to 130,806,532. In addition, evidence of two fusions or juxtapositions
were identified (CBFB::MYH11 and BCR::ABL1) with region-specific assay (e.g.,
targeted sequencing). Note: the ISCN band 9q34.1 is given in more detail in
GRCh38, i.e., 9q34.12 (see Section 2.4). The CBFB::MYH11 fusion gene is listed first
as the fusion is on chromosome 16 while the active fusion gene for BCR::ABL1 is
located on chromosome 22.

201
10.6 Repeat Expansion and Contraction Disorders
10.6.1 Normal Results

i. rsa (4q35)×2Targeted genome mapping showed no abnormality of the 4q35 region

which encompasses the FSHD1 gene.

10.6.2 Abnormal Results

i. rsa del(4)(q35)(D4Z4)×5,4qATargeted genome mapping of a patient with a family

history of FSH Muscular Dystrophy showing a reduced number (<10) of repeats at
D4Z4 and the permissive 4qA allele.
ii. rsa del(4)(q35)(D4Z4)×4[?],4qATargeted genome mapping analysis of a patient with
a family history of FSH Muscular Dystrophy showing a mosaic deletion, with a
reduced number (<10) of D4Z4 repeats on the permissive 4qA allele. The proportion
of the sample with this deletion could not be determined as indicated by the question
mark in square brackets ([?])
iii. rsa Xq27.3(FMR1-CGG)×∼550Targeted genome mapping of a patient with a family
history of Fragile X syndrome, showing an expansion of CGG repeats in the 5′
untranslated region of the FMR1 gene on the X chromosome, with an estimate of 550
CGG repeats, which is in the full expansion range.
iv. rsa 19q13.32(DMPK-CTG)×∼1,000Targeted genome mapping of a patient with a
family history of myotonic dystrophy type I, showing an expansion of CTG repeats in
the 3′ untranslated region of the DMPK gene on chromosome 19, with an estimate of
1,000 CTG repeats, which is in the full expansion range.

10.7 Methylation Disorders

10.7.1 Normal Results

i. rsa-ms (ME034)×2(ME034)metNormal result for the multi locus imprinting kit

(ME034) including 6q24.2, 7q32.2, 11p15.5p15.4, 14q32.2, 15q11.2q13.1, 19q13.43
and 20q13.32 imprinted regions.
ii. rsa-ms 7p12.2(ME032)×2(GRB10:alt-TSS-DMR)met,7q32.2(ME032)×2(MEST:alt-
TSS-DMR)metNormal copy number and methylation result for 7p12.2 and 7q32.2
using a methylation specific kit (ME032) and a targeted analysis for chromosome 7
imprinting only.
iii. rsa-ms 14q32.2(ME032)×2(MEG3:TSS-DMR)metNormal copy number and
methylation result for 14q32.2 using a methylation specific kit (ME032) and a targeted
analysis for chromosome 14 imprinting only.
iv. rsa-ms 7p12.2(ME032)×2(GRB10:alt-TSS-DMR)met,7q32.2(ME032)×2(MEST:alt-
TSS-DMR)met,14q32.2(ME032)×2(MEG3:TSS-DMR)metNormal copy number and
methylation result for 7p12.2, 7q32.2 and 14q32.2 using a methylation specific kit
(ME032).
v. rsa-ms 11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-DMR,H19/IGF2:IG-
DMR)metNormal copy number and methylation result for 11p15.5p15.4 using a
methylation specific kit (ME030) and a targeted analysis. If the copy number and

202
 methylation specific region are in the same chromosome location, they are not
repeated.
vi. rsa-ms 15q11.2q13.1(ME028)×2(MAGEL2:TSS-DMR,SNURF:TSS-
DMR)metNormal copy number and methylation result for 15q11.2q13.1 region using
a methylation specific kit (ME028) including MAGEL2 and SNRPN differentially
methylated regions.

10.7.2 Abnormal Results

i. rsa-ms 11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-DMR)met,(H19/IGF2:IG-
DMR)|gomAbnormal result using a methylation region-specific assay (ME030) that
shows two copies of the 11p15.5p15.4 region and gain of methylation in the H19 DMR
(differential methylation of imprinting control regions) that is consistent with
Beckwith-Wiedemann syndrome. It is optional whether the level of mosaicism is given
for H19 DMR, e.g., rsa-ms 11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-
DMR)met,(H19/IGF2:IG-DMR)|gom[0.5].
ii. rsa-ms 11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-DMR)|lom,(H19/IGF2:IG-
DMR)metAbnormal result using a methylation region-specific assay (ME030) that
shows two copies of the 11p15.5p15.4 region and loss of methylation in
the KCNQ1OT1 DMR (differential methylation of imprinting control regions), which
is consistent with Beckwith-Wiedemann syndrome. It is optional whether the level of
mosaicism is given for KCNQ1OT1 DMR, e.g., rsa-ms
11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-DMR)|lom[0.6](H19/IGF2:IG-
DMR)met
iii. rsa-ms 11p15.5p15.4(ME030)×2(KCNQ1OT1:TSS-DMR)|lom,(H19/IGF2:IG-
DMR)|gomAbnormal result using a methylation region-specific assay (ME030) that
shows two copies of the 11p15.5p15.4 region and loss of methylation in
the KCNQ1OT1 DMR and gain of methylation in the H19 DMR that is consistent with
Beckwith-Wiedemann syndrome. It is optional whether the level of mosaicism is given
for H19/IGF2:IG-DMR and KCNQ1OT1:TSS-DMR, e.g., rsa-ms
11p15.5p15.4(ME030)×2(H19/IGF2:IG-DMR)|gom[0.5],(KCNQ1OT1:TSS-
DMR)|lom[0.4].
iv. rsa-ms[GRCh38] 11p15.5(1,995,605_2,004,583)×3(KCNQ1OT1:TSS-
DMR)met,(H19/IGF2:IG-DMR)|gomAbnormal result using a methylation region-
specific assay (ME030) that shows three copies of H19 in the 11p15.5 region
(duplication) between nucleotides 1,995,605 and 2,004,583. The methylation pattern
shows a gain of methylation for H19 DMR that is consistent with Beckwith-
Wiedemann syndrome through a possible paternal duplication of 11p15.5.
v. rsa-ms[GRCh38] 15q11.2q13.1(23,566,578_28,032,024)×1(MAGEL2:TSS-
DMR,SNURF:TSS-DMR)|lom
or
rsa-ms[GRCh38] 15q11.2q13.1(23,566,578_28,032,024)×1(SNURF:TSS-
DMR)|lomAbnormal result using a methylation region-specific assay (ME028) that
shows one copy of
the MKRN3, MAGEL2, NDN, SNRPN, UBE3A, ATP10A, GABRB3, OCA2 genes in
the 15q11.2q13.1 region (between nucleotides 23,566,578 and 28,032,024), with

203
 absence of methylation of MAGEL2 and SNRPN CpG islands, which is consistent with
Angelman syndrome.
vi. rsa-ms 15q11.2q13.1(ME028)×2(MAGEL2:TSS-DMR,SNURF:TSS-DMR)|gom
or
rsa-ms 15q11.2q13.1(ME028)×2(SNURF:TSS-DMR)|gomAbnormal result using a
methylation region-specific assay (ME028) that shows two copies of all targeted genes
in the 15q11.2q13.1 region, with both alleles of MAGEL2 and SNRPN methylated.
There is no normal paternal methylation pattern for 15q11.2q13.1. This is consistent
with Prader-Willi syndrome.
vii. rsa-ms 15q11.2q13.1(ME028)×2(MAGEL2:TSS-DMR,SNURF:TSS-DMR)|lom
or
rsa-ms 15q11.2q13.1(ME028)×2(SNURF:TSS-DMR)|lomAbnormal result using a
methylation region-specific assay (ME028) that shows two copies for all targeted
genes. Both alleles of MAGEL2 and SNRPN are unmethylated, i.e., there is no normal
maternal methylation pattern for 15q11.2q13.1. This is consistent with Angelman
syndrome.
viii. rsa-ms 7p12.2(ME032)×2(GRB10:alt-TSS-
DMR)|gom,7q32.2(ME032)×2(MEST:alt-TSS-DMR)|gomAbnormal result using a
methylation region-specific assay (ME032) that shows two methylated copies of the
7p12.2 and 7q32.2 regions (maternal uniparental disomy or an abnormal methylation
pattern on the paternal allele), consistent with Silver-Russell syndrome. Targeted
analysis of MEG3:TSS-DMR on chromosome 14 was not analyzed with the (ME032)
kit and therefore is not included in the ISCN.
ix. rsa-ms 7p12.2(ME032)×2(GRB10:alt-TSS-
DMR)|gom,7q32.2(ME032)×2(MEST:alt-TSS-
DMR)|gom,14q32.2(ME032)x2(MEG3:TSS-DMR)metAbnormal result using a
methylation region-specific assay (ME032) that shows two methylated copies of the
7p12.2 and 7q32.2 regions (maternal uniparental disomy or an abnormal methylation
pattern on the paternal allele), consistent with Silver-Russell syndrome. Normal
methylation pattern for chromosome 14.
x. rsa-ms 11p15.5(ME034)×2(H19/IGF2:IG-
DMR)|lom,14q32.2(ME034)×2(MEG3:TSS-DMR)|lomAbnormal result using a
multi-locus methylation region-specific assay (ME034) that shows normal copy
number at both loci in 11p15.5 and 14q32.2. There is also an abnormal methylation
pattern for H19 and MEG3 with loss of methylation that may be indicative of a multi-
locus imprinting disorder (MLID).

204
11 Sequencing
11.1 Introduction

Historically, ISCN has covered the description of numerical and structural chromosome
changes detected using a variety of traditional and molecular cytogenetic techniques,
while the Human Genome Variation Society ([Link] den
Dunnen et al., 2016) covered the description of changes at the nucleotide level. Both
ISCN and HGVS have developed methods to describe variants detected by microarrays,
PCR, MLPA, and other technologies used to detect copy number variation (CNV).
Given the increased use of sequencing technologies to characterize chromosomal
abnormalities (Schluth-Bolard et al., 2013; Ordulu et al., 2014; Newman et al., 2015),
the method of combining the ISCN description of chromosome rearrangements with
HGVS nucleotide variant descriptions, developed jointly between the ISCN and HGVS,
was initially introduced in ISCN 2016. Sequencing technologies, including Sanger
sequencing, next generation short-read and long-read sequencing, or other sequence-
based techniques can use this nomenclature to describe copy number and/or structural
variants. These techniques are quite broad in scope and resolution; they can be targeted
to one region (e.g., single gene or exon), many regions (e.g., amplicon or capture-based
gene panels), or genome wide. Depending on the bioinformatic algorithms used, a
structural variant detected from next generation sequence data may have a precise
breakpoint and structural location information, such as the insertional location and
orientation of a duplication. On the other hand, copy number variants may be detected
using read depth-based algorithms, which detect copy number as a relative value to
control(s) with neither precise breakpoints nor additional structural information, similar
to how copy number is detected from microarray technologies. Regardless of approach,
uncertainty may be present, with a known uncertainty range (e.g., between two
hybridization baits or within a repeated element such as a LINE) or as an approximate
breakpoint without a defined range (e.g., detected using a read depth caller from low
coverage genome sequencing).

11.2 General Principles

11.2.1 Sequence-Based Nomenclature Principles

a. The nomenclature should be as precise as possible for the technologies and

bioinformatic algorithms used.

205
 b. ISCN and HGVS nomenclature can be used together to describe a structural or copy
number variant. When both the ISCN and HGVS nomenclature are described, the ISCN
line of the description appears first.
c. When details of the chromosomal structure are derived from sequencing techniques,
both the ISCN description of chromosome aberrations and the HGVS nucleotide variant
descriptions should be included for clarity and completeness.
d. When only relative copy number state is determined, and neither the precise breakpoints
nor structural information is known, either the ISCN microarray format or HGVS
nomenclature can be used alone.
e. When only breakpoint information is available without the information sufficient to
describe the nature of the structural rearrangements, HGVS standards should be used
alone (examples are not detailed in this publication, see den Dunnen et al.
(2016) and [Link]

11.2.2 ISCN Principles

a. The ISCN line of the description begins with seq to indicate that the aberration is
characterized by sequence-based technology. It must include the genome build
in square brackets ([ ]) after seq if the nomenclature includes nucleotide coordinates.
If shallow sequencing is performed, sseq should be used in the ISCN description of the
variation (see Section 8.1.1).
b. For description of structural or copy number variation when both the ISCN and HGVS
are used, the ISCN uses the karyotype format nomenclature (see Section
4.7 and Chapter 5). Where several abnormalities are described in the ISCN, a mixture
of the short and detailed systems within the karyotype format nomenclature can be used,
as different levels of information may be known for each of the described aberrations.
c. For description of copy number variations where structural information and exact
breakpoints are not detected (e.g., relative copy number detection from exome
sequencing), the ISCN should use the microarray format nomenclature (see Section
4.7 and Chapter 8).
d. When chromosome analysis is performed, this is presented first and a period (.)
precedes the sequencing nomenclature (.seq). For other techniques the results may be
presented in any order, although this is usually the order in which they are performed.
e. Sex chromosomes are not given, with the exceptions of (a) if a variant involving a sex
chromosome is reported or (b) if the sex chromosome complement is informative or
required for interpretation of the result. Otherwise, the sex chromosome complement
may be indicated in the written description without being explicitly stated in the
nomenclature.

11.2.3 HGVS Principles

a. The combined nomenclature uses the existing HGVS standards for the HGVS line (see
below, den Dunnen et al., 2016 and [Link] along with
additional recommendations outlined below for the description of an aberration.

206
b. HGVS nomenclature was developed to describe variants. Chromosomes or
chromosomal segments that do not contain variants are not described using HGVS
nomenclature, unless to indicate sex chromosome complement.
c. Each line details the reference sequence(s) used, the genomic coordinates, and the type
of variation(s) involved. Variants affecting different chromosomes are described on a
separate line.
d. The segment containing the centromere is the reference for the derivative
chromosome(s). The orientation of the derivative chromosome is the same as the
reference chromosome segment that includes the centromere. A derivative chromosome
is described from pter to qter, regardless of the origin of the sequences. This would
mean that the new pter of a derivative chromosome could be the original qter of
another chromosome.
e. Multiple variants within the same homologue are described from pter to qter of the
derivative chromosome, anchored in the positive strand.
f. As in ISCN, aberrations affecting sex chromosomes are listed first (X then Y) followed
by those affecting autosomes in ascending numbers.
g. A specific reference for each chromosome is given, rather than the general genome
build reference (e.g., NC_000023.11 for the NCBI RefSeq version for Homo sapiens X
chromosome, build GRCh38). The chromosome is given before the period (.), with the
X chromosome as 23 and the Y chromosome as 24. The number following the period (.)
indicates the specific version of the chromosome reference sequence.
h. A letter prefix indicates the type of reference sequence used. For linear
genomic reference sequence g is used, followed by a period (.).
i. The genomic reference sequence contains undefined nucleotides (Ns) at the start and
end of the chromosome making the use of specific nucleotide positions for these sites
problematic. The beginning and end of a chromosome are therefore represented
as pter and qter.
j. When the chromosome structure associated with a gain is not known (e.g., insertional
location), gains can be indicated using the copy number in square brackets ([ ]) at the
end of the nomenclature description, with [2] indicating one additional copy observed
of a particular chromosome or chromosome region compared to the reference, [3]
indicating two additional copies, etc.
k. To describe variants (var), HGVS uses the following allele format:
• g.[var1];[var2] in the two different alleles (in trans).
• g.[var1;var2] to describe different variants in one allele (in cis).
• g.var1(;)var2 if the phase of the alleles is not known or uncertain.
l. If mosaicism/clonal change is present, the variant(s) are separated by a single slant
line (/). The normal reference sequence, if present, is always described first and is
followed by an equal symbol (=).
m. To indicate sex chromosome complement, the HGVS allele format can be used; adding
NC_000023.11:g.[pter_qter=] indicates the presence of a normal X chromosome, and
NC_000024.10:g.[pter_qter=] the presence of a normal Y chromosome.
n. For variants within the pseudoautosomal regions where there is uncertainty whether the
X or Y chromosome is involved, a caret (^) should be used between the two possible
variants.

207
[Link] Breakpoint Description

a. An underscore (_) indicates a range of nucleotides, e.g., g.123_456del indicates a

deletion of nucleotides 123 to 456.
• When the breakpoints have not been determined at the precise nucleotide level, variants
are described with the ranges of uncertainty given in parentheses (()), using the format
g.(A_B)_(C_D). In this format A_D represents the maximal and B_C the minimal extent
of the rearrangement.
• Unknown nucleotide positions are indicated using a question
mark (?), e.g., g.(?_B)_(C_?)del when the minimal range of a deletion is known, but
not the maximal range.
• For terminal (ter) copy number changes involving an unknown position in the direction
of the telomere, the format (pter)_B or C_(qter) is used.
b. To determine the location of the breakpoint, the general HGVS rule of maintaining the
longest un-changed sequence applies (HGVS 3′rule) (see Section [Link]).
• In runs of identical nucleotides, the most 3′nucleotide in the run is designated as
variant, e.g., g.4del (not g.2del nor g.3del) describes the change CTTTA to CTTA (see
also Section [Link]).
c. A double colon (::) is used to designate breakpoint junctions in HGVS, e.g., a ring
chromosome. It is also used in the detailed system (karyotype format) (see Sections
[Link], 9.3 and 10.2.2).

[Link] Structural Variant Description

The type of structural variation is indicated following the nucleotide breakpoint

positions except for insertions where it precedes the nucleotides:

a. del – indicates a deletion. If the deletion is homozygous (e.g., found on both

chromosomes), both chromosomes should be described using the HGVS allele format
(e.g., g.[123_456del];[123_456del]).
b. dup – exclusively indicates a tandem, direct duplication. If the duplicated sequence
is not directly in tandem, e.g., separated by one or more nucleotides, inverted, and/or
inserted elsewhere in the genome, ins (for insertion) is used instead.
c. inv – indicates an inverted sequence (e.g., g.123_456inv).
d. ins – indicates an insertion of a sequence (e.g., insAAGTAC) that is not a tandem
duplication. When the inserted sequence is long, the sequence can be replaced by
referring to a reference sequence and specifying the inserted nucleotides
(e.g., ins[NG_012232.1:g.4566_8781]). This insertion can be balanced or involve
duplicated material from elsewhere in the genome. A balanced insertion (transposition)
would have a corresponding del nomenclature, indicating the genomic sequences are no
longer present in situ.
e. delins – indicates deletion and insertion, i.e., a sequence change where nucleotides
are replaced by other nucleotides (e.g., balanced or unbalanced translocations where
genomic material is being replaced by sequence from a different chromosomal location).

208
 f. sup – indicates a supernumerary sequence, i.e., the presence of an additional
sequence that is not attached to other chromosomal material (i.e., trisomy,
supernumerary marker or ring chromosome).
g. Application of the 3′ rule to chromosome rearrangements:

A translocation joins chromosome 2 and chromosome 18 (seq[GRCh38] nomenclature

line above in bold). According to the chromosome 2 and chromosome 18 reference
sequences, there are two options to align the breakpoints (dashed and solid vertical
lines). The 3′ rule determines that, starting with the lowest chromosome number
involved (here chromosome 2), the sequence should be aligned as far 3′ as possible,
aligning with the solid vertical line. The correct description of the rearrangement is
therefore:

seq[GRCh38] t(2;18)(p25.3;p11.32)

NC_000002.12:g.pter_8delins[NC_000018.10:g.pter_8]

NC_000018.10:g.pter_8delins[NC_000002.12:g.pter_8]

Note: a 5′ alignment would give an incorrect result:

NC_000002.12:g.pter_5delins[NC_000018.10:g.pter_5] and
NC_000018.10:g.pter_5delins[NC_000002.12:g.pter_5]

11.3 Normal Results

i. seq (X,1–22)×2Sequencing reveals two copies of the X chromosome and all autosomes
with no apparent abnormality detected in a female. As with the microarray
nomenclature, the specific genome build is not necessary when describing a normal
copy number profile. HGVS nomenclature describes variants in relation to the
reference sequence and is not used in this context.
ii. seq (X,Y)×1,(1–22)×2Sequencing reveals one copy of the X and Y chromosomes, and
two copies of the autosomes with no apparent abnormality detected in a male. HGVS
nomenclature describes variants in relation to the reference sequence and is not used
in this context.
iii. seq (1–22)×2Sequencing reveals two copies of all autosomes with no apparent
abnormality detected, and the sex chromosome complement is normal but undisclosed.

209
 HGVS nomenclature describes variants in relation to the reference sequence and is not
used in this context.

11.4 Abnormal Results

11.4.1 Aneuploidy

i. seq (X)×1
or
NC_000023.11:g.pter_qterdel^NC_000024.10:g.pter_qterdelSequencing reveals a
single X chromosome, and no other sex chromosomes are present in this individual.
The result is given using the abbreviated system (microarray format) nomenclature,
the specific genome build is not necessary when describing an aneuploidy. The
HGVS nomenclature describes the deletion of an X or Y chromosome, as the missing
chromosome is unknown (in HGVS ‘or’ is represented by a caret (^)).
ii. seq (13)×3
or
NC_000013.11:g.(pter)_(qter)[2]Sequencing shows a gain of chromosome 13
sequences. The result is given using the abbreviated system (microarray format)
nomenclature. No structural information is detected regarding whether the trisomy is
associated with a Robertsonian translocation or any other type of structural
rearrangement. The HGVS nomenclature indicates that, compared to the reference
sequence, there is one additional copy [2] of chromosome 13 sequences
detected. Note: dup or sup are not used in the nomenclature because the nature of
the abnormality is not known. Since ISCN and HGVS nomenclature indicate similar
information, either can be used.
iii. 47,XY,+[Link] (13)×3
or
NC_000013.11:g.(pter)_(qter)supChromosome analysis and sequencing shows gain
of chromosome 13. The HGVS nomenclature indicates there is one additional copy
of chromosome 13 (sup) compared to the reference sequence. ISCN description and
HGVS nomenclature lines both indicate that the additional copy number is associated
with a supernumerary chromosome 13, confirmed by the karyotype. Note: ISCN
describes the chromosome abnormality and excludes a Robertsonian translocation
while HGVS implies it is a gain of a supernumerary chromosome 13 but does not
provide any additional information.
iv. seq[GRCh38] 18p11.32p11.21(158,684_14,853,925)×4
or
seq (18p)×4
or
NC_000018.10:g.(pter_158684)_(14853925_?)[3]Sequencing shows four copies of
the short arm of chromosome 18. No structural information is determined, and it is
unknown if the additional copies of 18p are associated with an abnormal
chromosome (e.g., supernumerary isochromosome 18p) or present in tandem. The
ISCN microarray format is applied and either the short system or abbreviated system
can be used to describe the variant. The HGVS describes this finding as the detection
of two additional copies [3] of chromosome 18 sequence located between positions

210
 158,684 and 14,853,925. Note: dup or sup are not used in this circumstance because
the nature of the abnormality is not known. Since ISCN and HGVS nomenclature
indicate similar information, either can be used.
v. seq (X)×3
or
NC_000023.11:g.[pter_qter[2]];[pter_qter=]Sequencing shows three copies of the X
chromosome using the abbreviated system (microarray format). There are no copies
of the Y chromosome, suggesting that this individual’s sex chromosome complement
is XXX. The HGVS nomenclature indicates that, compared to the reference
sequence, there is one additional copy [2] of all X chromosome sequences detected.
The HGVS allele format used indicates that one normal copy of an X chromosome is
also detected, giving a total of three X chromosomes. Note: sup is not used in this
circumstance because the nature of the abnormality is not known. Since ISCN and
HGVS nomenclature indicate similar information, either can be used.
vi. 47,[Link] (X)×3
or
NC_000023.11:g.[pter_qter=];[pter_qter=];[pter_qtersup]Chromosome analysis and
sequencing data show three copies of the X chromosome, associated with a 47,XXX
karyotype. HGVS nomenclature indicates that compared to the reference sequence,
three X chromosome sequences are detected, two normal (=) and one additional copy
(sup). Since ISCN and HGVS nomenclature indicate similar information, either can
be used.
vii. seq (X)×2,(Y)×1
or
[NC_000023.11:g.pter_qter[2]];[NC_000024.10:g.pter_qter=]Sequencing shows two
copies of all X chromosome sequences, and one copy of all Y chromosome
sequences. The copy number status of both the X and Y are explicitly given using the
abbreviated system (microarray format) to clarify the sex chromosome complement
of this individual. HGVS nomenclature indicates that, compared to the reference
sequence, one additional copy [2] of all X chromosome sequences is detected with
one copy of all Y chromosome sequences (NC_000024.10:g.pter_qter=). Since ISCN
and HGVS nomenclature indicate similar information, either can be used.
viii. seq (X)×1,(Y)×2
or
[NC_000023.11:g.pter_qter=];[NC_000024.11:g.pter_qter[2]]Sequencing shows one
copy of all X chromosome sequences, and two copies of all Y chromosome
sequences. The copy number state of both X and Y are given using the abbreviated
system (microarray format) to clarify the sex chromosome complement of this
individual. HGVS nomenclature indicates that, compared to a reference sequence, a
normal copy of the X chromosome sequences is detected
(NC_000023.11:g.pter_qter=) and an additional copy [2] of all Y chromosome
sequences is detected. Note: sup is not used in this circumstance because the nature
of the Y chromosome abnormality is not known. Since ISCN and HGVS
nomenclature indicate similar information, either can be used.
ix. seq (X)×1[0.6]
or

211
 NC_000023.11:g.[pter_qter=];[pter_qter=/del]Sequencing shows mosaicism for
single copy loss of the X chromosome in 60% of the DNA sample, described using
the abbreviated system (microarray format). The normal state is implied to be XX in
this individual. HGVS nomenclature indicates there is one X chromosome (=)
present in the sample, with a mosaic loss of the second X chromosome (=/del) in a
proportion of the sample. The mosaicism percentage is not indicated in the HGVS
nomenclature. Since the ISCN line is more informative this can be used in isolation
without the HGVS nomenclature. Note: the limitation of sequencing is that it cannot
always differentiate between X/XX or X/XXX.

11.4.2 Large Structural and Copy Number Variation

[Link] Deletion

i. seq[GRCh38] del(10)(p15.3)dn
NC_000010.11:g.(pter)_2944337delSequencing shows an apparently terminal
deletion of the short arm of chromosome 10. The ISCN short system (karyotype
format) describes a de novo terminal deletion with a breakpoint in 10p15.3. The
short system (karyotype format) is used to indicate that no additional structural
variation is associated with this terminal deletion. The breakpoints for the deletion
are indicated in the HGVS line of the nomenclature. The deletion involves 10pter to
nucleotide 2,944,337. In this case, since the ISCN and HGVS nomenclature lines
give different information, both should be used to describe the variant.
ii. seq[GRCh38] 10p15.3(46,696_1,737,263)×1dn
or
NC_000010.11:g.(pter_46696)_(1737263_?)delSequencing shows an apparently
terminal deletion of the short arm of chromosome 10. The ISCN short system
(microarray format) describes a de novo terminal deletion with a breakpoint in
10p15.3 using a relative copy number detection methodology (e.g., exome
sequencing) where neither the precise breakpoint nor structural information are
determined. The deletion involves the region 46,696 to 1,737,263 and the
uncertainty range is not specified. Note: this deletion is likely terminal, but the
nomenclature describes only the region of the chromosome that is assayed for copy
number, similar to microarray format nomenclature. The HGVS nomenclature
indicates that the deletion is likely terminal, with the use of pter for the 5′
breakpoint, and the use of a question mark (?) for the undefined 3′ breakpoint.
While ISCN and HGVS nomenclature indicate similar genomic information, only
ISCN conveys the inheritance information and is therefore recommended.
iii. seq[GRCh38] 10p15.3(46696_1737263×1,3067438×2)dn
or
NC_000010.11:g.(pter_46696)_(1737263_3067438)delSequencing shows an
apparently terminal deletion of the short arm of chromosome 10. The ISCN
extended system (microarray format) describes a de novo terminal deletion with a
breakpoint in 10p15.3 using a relative copy number detection methodology from a
targeted capture assay (e.g., exome sequencing), where neither the precise
breakpoint nor structural information is detected. The apparently terminal deletion
involves the most distal targeted region assayed (46,696). The uncertainty region

212
 for the proximal breakpoint corresponds to the region between the end of the
deleted region (1,737,263) and the next neighboring region assayed that shows a
normal copy number (30,067,438). Note: delimiting commas are not used in the
extended system (microarray format). While ISCN and HGVS nomenclature
indicate similar genomic information, only ISCN conveys the inheritance
information and is therefore recommended.
iv. seq[GRCh38] 22q11.21(18,891,533_21,111,169)×1pat
or
NC_000022.10:g.(?_18891533)_(21111169_?)delSequencing shows an interstitial
deletion within the long arm of chromosome 22. The ISCN short system
(microarray format) describes a paternally inherited deletion within 22q11.2,
consistent with the recurrent 22q11.2 deletion syndrome (low copy number repeats
LCR-A to LCR-D). Neither the precise deletion breakpoint nor structural
information is detected and the uncertainty region is not determined due to
limitations of the assay. While ISCN and HGVS nomenclature indicate similar
genomic information, only ISCN conveys the inheritance information and is
therefore recommended.
v. seq[GRCh38] 22q11.21(18164049×2,18891533_21111169×1,21443266×2)pat
or
NC_000022.10:g.(18164049_18891533)_(21111169_21443266)delSequencing
shows an interstitial deletion within the long arm of chromosome 22. The ISCN
extended system (microarray format) describes a paternally inherited deletion
within 22q11.2, consistent with the recurrent 22q11.2 deletion syndrome (low copy
number repeats LCR-A to LCR-D). The precise breakpoint is not detected as the
breakpoints appear to fall within repetitive regions of the genome. The uncertainty
region for the proximal breakpoint corresponds to segmental duplication regions
between 18,164,049 and 18,891,533, with the distal breakpoint between 21,111,169
and 21,443,266. Note: delimiting commas are not used in the extended system.
While ISCN and HGVS nomenclature indicate similar genomic information, only
ISCN conveys the inheritance information and is therefore recommended.
vi. seq[GRCh38] X,del(X)(q21.31q22.1)
NC_000023.11:g.89555676_100352080delSequencing shows an interstitial
deletion within the long arm of the X chromosome in an XX individual. The ISCN
short system (karyotype format) describes a heterozygous deletion within the long
arm of the X chromosome from band Xq21.31 to Xq22.1. The normal X is
indicated in the ISCN line to clarify the sex chromosome complement. The use of
the short system indicates that the deletion is interstitial and is not associated with
any other structural rearrangements. The HGVS line indicates that the deletion
includes the segment from nucleotide 89,555,676 to nucleotide 100,352,080, with
nucleotides 89,555,675 to 100,352,081 now joined. Since the breakpoint and
structural information are known for this deletion, both the ISCN and HGVS
nomenclature are required.
vii. seq[GRCh38] Xq21.31q22.1(91,435,563_100,342,090)×1
or
NC_000023.11:g.[pter_qter=];[(?_91435563)_(100342090_?)del]Sequencing
shows an interstitial deletion within the long arm of the X chromosome. The ISCN

213
 short system (microarray format) describes a heterozygous interstitial deletion
within the long arm of the X chromosome from band Xq21.31 to Xq22.1 where
neither the precise breakpoint nor related structural information is determined. The
minimal deletion includes the segment from nucleotide 91,435,563 to nucleotide
100,342,090, and the uncertainty region is not defined. This deletion is inferred to
be present in an XX individual. The HGVS description indicates that the extent of
the deleted region is not known with the use of question marks (?). To indicate
that a deletion is seen in the heterozygous state in an XX individual, the normal sex
chromosome is given using the HGVS allele format (see Section 11.2.3). Since
ISCN and HGVS nomenclature indicate similar information, either can be used.
viii. seq[GRCh38] Xq21.31q22.1(88754300×2,91435563_100342090×1,100402866×2)
or
NC_000023.11:g.[pter_qter=];[(88754300_91435563)_(100342090_100402866)del
]Sequencing shows an interstitial deletion within the long arm of the X
chromosome in an XX individual. The ISCN extended system (microarray format)
describes a heterozygous interstitial deletion within the long arm of the X
chromosome from band Xq21.31 to Xq22.1 where neither the precise breakpoint
nor related structural information is determined. The minimal deletion includes the
segment from nucleotide 91,435,563 to nucleotide 100,342,090. The extended
system indicates the neighboring proximal and distal regions that show normal
copy number (two copies). As the extended system indicates that the normal copy is
two for the X chromosome, and the Y chromosome is not present, this individual
can be inferred to have two X chromosomes, one with a deletion. The HGVS
nomenclature indicates that there is an interstitial deletion of the X chromosome
with the 5′ breakpoints between 88,754,300 and 91,435,563 and the 3′ breakpoints
between 100,342,090 and 100,402,866. To indicate that a deletion is seen in the
heterozygous state in an XX individual, the normal sex chromosome is indicated by
using the HGVS allele format. Since ISCN and HGVS nomenclature indicate
similar information, either can be used.
ix. seq[GRCh38] Y,del(X)(q21.31q22.1)
NC_000023.11:g.89555676_100352080delSequencing shows an interstitial
deletion within the long arm of the X chromosome in an XY individual. The ISCN
short system (karyotype format) describes a hemizygous interstitial deletion within
the long arm of the X chromosome from band Xq21.31 to Xq22.1. The normal Y is
indicated in the ISCN line to clarify the sex chromosome complement. The use of
the short system indicates that the deletion is interstitial and is not associated with
other structural rearrangements. The HGVS line of the nomenclature indicates that
the deletion includes the segment from nucleotide 89,555,676 to nucleotide
100,352,080, with nucleotides 89,555,675 to 100,352,081 now joined. Since the
breakpoint and structural information are known for this deletion, both the ISCN
and HGVS nomenclature lines are required.
x. seq[GRCh38] (Y)×1,Xq21.31q22.1(91,435,563_100,342,090)×0
or
[NC_000023.11:g.(?_91435563)_(100342090_?)del];[NC_000024.10:g.pter_qter=]
Sequencing shows an interstitial deletion within the long arm of the X chromosome
in an XY individual. The ISCN uses the abbreviated system (microarray format) for

214
 the Y chromosome and the short system (microarray format) for the hemizygous
deletion from band Xq21.31 to Xq22.1 where neither the precise breakpoint nor
related structural information is detected. The minimal deletion includes the
segment from nucleotide 91,435,563 to nucleotide 100,342,090, and the uncertainty
region is not defined. The normal Y chromosome is indicated to clarify the sex
chromosome complement to show that this deletion is not found in the homozygous
state in an XX individual, nor is found to be present on the single X chromosome in
an individual with 45,X. The HGVS nomenclature uses a question mark (?) to
indicate that the extent of the X chromosome deletion is unknown. The presence of
one copy of a normal Y chromosome using the HGVS allele format is given to
indicate X chromosome deletion is hemizygous. Since ISCN and HGVS
nomenclature indicate similar information, either can be used.
xi. seq[GRCh38]
(Y)×1,Xq21.31q22.1(88754300×1,91435563_100342090×0,100402866×1)
or
[NC_000023.11:g.(88754300_91435563)_(100342090_100402866)del];[NC_0000
24.10:g.pter_qter=]Sequencing shows an interstitial deletion within the long arm of
the X chromosome in an XY individual. The ISCN extended system (microarray
format) describes a hemizygous deletion from band Xq21.31 to Xq22.1 where
neither the precise breakpoint nor related structural information is determined. The
deletion includes the segment from nucleotide 91,435,563 to nucleotide
100,342,090. The extended system (microarray format) indicates the neighboring
proximal (88,754,300) and distal (100,402,866) targeted regions that show normal
copy number (one copy). The normal Y is indicated to clarify the sex chromosome
complement. The HGVS nomenclature indicates that there is an interstitial deletion
of the X chromosome with the 5′ breakpoint between 88,754,300 and 91,435,563
and the 3′ breakpoint between 100,342,090 and 100,402,866. To indicate the
zygosity of the deletion, the HGVS allele format is used. Since ISCN and HGVS
nomenclature indicate similar information, either can be used.
xii. seq[GRCh38] del(X)(q21.31q22.1),del(X)(q21.31q22.1)
NC_000023.11:g.[89555676_100352080del];[89555676_100352080del]Sequencin
g shows identical interstitial deletions within the long arms of both X chromosomes
in an XX individual. The ISCN short system (karyotype format) description
indicates that no additional structural rearrangements are associated with the
interstitial deletions. Alternatively, the ISCN description could be written:
seq[GRCh38] del(X) (q21.31q22.1)×2. The HGVS line of the nomenclature
indicates identical interstitial deletions within the long arms of both X
chromosomes from band Xq21.31 to band Xq22.1 involving the region from
nucleotide 89,555,676 to nucleotide 100,352,080. In the HGVS description each
allele is described between square brackets ([89555676_100352080del]), separated
by a semicolon (;) to indicate the variants are in trans (different chromosomes).
Since both the breakpoint and structural information are known for these deletions,
both the ISCN and HGVS nomenclature lines are required.
xiii. seq[GRCh38] Xq21.31q22.1(88754300×2,91435563_100342090×0,100402866×2)
or
NC_000023.11:g.[(88754300_91435563)_(100342090_100402866)del];[(8875430

215
 0_91435563)_(100342090_100402866)del]Sequencing shows identical interstitial
deletions within the long arms of both X chromosomes. The ISCN extended system
(microarray format) describes the homozygous deletion from band Xq21.31 to
Xq22.1, where neither the precise breakpoint nor structural information is
determined. The homozygous deletion includes the segment from nucleotide
91,435,563 to nucleotide 100,342,090. The extended system (microarray format)
shows the neighboring proximal and distal targeted regions with normal copy
number (two copies), indicating this homozygous deletion ′ 3 is observed in an XX
individual. HGVS nomenclature describes each allele between square brackets ([
]), separated by a semicolon (;) to indicate the variants are in trans. Since ISCN
and HGVS nomenclature indicate similar information, either can be used.
xiv. seq[GRCh38] del(X)(q21.31q22.1),del(X)(q21.31q22.1)
NC_000023.11:g.[89555674_100352088del];[90111276_99878726del]Sequencing
shows different interstitial deletions within the long arms of both X chromosomes.
The ISCN short system (karyotype format) indicates that an XX individual has both
X chromosomes deleted from band Xq21.31 to band Xq22.1; however, the HGVS
nomenclature shows that these deletions are not identical and are associated with
compound heterozygous interstitial deletions (in trans) within the long arms of both
X chromosomes. The deletions include the segment from nucleotide 89,555,674 to
100,352,088 on one homologue, and from nucleotide 90,111,276 to 99,878,726 on
the other homologue. In the HGVS nomenclature each allele is described
between square brackets ([ ]), separated by a semicolon (;) to indicate the variants
are in trans. Since the breakpoint and structural information are known for these
deletions, both the ISCN and HGVS nomenclature lines are required.
xv. seq[GRCh38] del(X)(p22.3p22.3) or del(Y)(p11.31p11.2)
NC_000023.11:g.320651_666265del^NC_000024.10:g.320651_666265delSequenc
ing shows a deletion within the pseudoautosomal region 1 (PAR1) of chromosomes
X or Y in an XY individual. The ISCN short system (karyotype format) describes
an interstitial deletion as either a hemizygous interstitial deletion within the short
arm of the X chromosome within band Xp22.3, or with a hemizygous interstitial
deletion within the short arm of the Y chromosome within band Yp11.31 to
Yp11.2. The HGVS nomenclature describes the deletion in either the X or (^) Y
chromosome and includes the segment from nucleotide 320,651 to nucleotide
666,265. Since the breakpoint and structural information are known for these
deletions, both the ISCN and HGVS nomenclature lines are required.
xvi. seq[GRCh38] 12q21.32(88,534,851_88,545,966)×0mat pat
or
NC_000012.12:g.[(?_88534851)_(88545966_?)del];[(?_88534851)_(88545966_?)d
el]Sequencing shows an intragenic homozygous deletion within the long arm of
chromosome 12. The ISCN short system (microarray format) indicates an
intragenic, homozygous loss is located in the KITLG gene within band 12q21.32.
Neither the precise breakpoint nor structural information are detected. The
homozygous deletion includes the segment between nucleotides 88,534,851, and
88,545,966, and the uncertainty range is not specified. Both parents are known
heterozygous carriers of this deletion. The HGVS nomenclature describes each
allele between square brackets ([ ]), separated by a semicolon (;) to indicate the

216
 variants are in trans. While ISCN and HGVS nomenclature indicate similar
genomic information, only ISCN conveys the inheritance information and is
therefore recommended.
xvii. seq[GRCh38] 12q21.32(88530089×2,88534851_88545966×0,88580216×2)mat pat
or
NC_000012.12:g.[(88530089_88534851)_(88545966_88580216)del];[(88530089_
88534851)_(88545966_88580216)del]Sequencing shows a homozygous deletion
within the long arm of chromosome 12. The ISCN extended system (microarray
format) indicates that an intragenic, homozygous loss is located in the KITLG gene
within band 12q21.31. Neither the precise breakpoint nor structural information is
detected, and the breakpoint uncertainty range is specified. The homozygous
deletion includes the segment between nucleotides 88,530,089 to 88,534,851 and
88,545,966 to 88,580,216. The extended system indicates that the neighboring
proximal and distal targeted regions show normal copy number (two copies). Both
parents are known heterozygous carriers of this deletion. The HGVS nomenclature
describes each allele between square brackets ([ ]) separated by a semicolon (;) to
indicate that the variants are in trans. While ISCN and HGVS nomenclature
indicate similar genomic information, only ISCN conveys the inheritance
information and is therefore recommended.
xviii. seq[GRCh38]
1p22.3(86092388×2,86112508_86915211×1,86993002×2)dn,1q31.3q32.1(193249
904×2,196228171_200650737×1,200658989×2)dn,2q33.1q34(201145490×2,20114
8901_208572138×1,209653108×2)dn
or
NC_000001.11:g.[(86092388_86112508)_(86915211_86993002)del](;)[(19324990
4_196228171)_(200650737_200658989)del]
NC_000002.12:g.(201145490_201148901)_(208572138_209653108)delSequencin
g shows multiple deletions involving the short and long arm of chromosome 1 and
the long arm of chromosome 2. The ISCN extended system (microarray format)
describes three de novo interstitial losses where the precise breakpoint nor structural
information is determined. These three heterozygous deletions include a loss of
approximately 800 kb in 1p22.3, a loss of approximately 4.4 Mb in 1q31.3 to
1q32.1, and a loss of approximately 7.4 Mb in 2q33.1 to 2q34. As no precise
breakpoints or structural information is obtained from this analysis, it cannot be
determined if these findings are associated with a larger structural rearrangement,
such as a translocation or pericentric inversion. The HGVS nomenclature describes
the deletions involving chromosome 1 on a single line, with the use
of semicolon (;) to indicate that is it not known if the two deletions are in cis (same
chromosome) or in trans (different chromosomes). The deletion involving
chromosome 2 is described on a separate line. While ISCN and HGVS
nomenclature indicate similar genomic information, only ISCN conveys the
inheritance information and is therefore recommended.

217
[Link] Duplication and Triplication

i. seq[GRCh38] dup(18)(q23q23)
NC_000018.10:g.79670244_79724961dupSequencing shows an interstitial
duplication within the long arm of chromosome 18. The ISCN short system
(karyotype format) nomenclature describes a tandem duplication of sequences within
chromosome 18q23. As the duplication is within a single chromosome band, the
ISCN cannot distinguish the orientation of the duplicated material. The HGVS line
indicates the 54.7 kb tandem duplication within chromosome 18 involves nucleotides
79,670,244 to 79,724,961. Note: in HGVS dup can only be used when the duplicated
sequence is in the same orientation as the reference sequence. Since the ISCN and
HGVS nomenclature lines give different information, both should be used to describe
the variant.
ii. seq[GRCh38] dup(18)(q23q23)
NC_000018.10:g.79670243_79670244ins79670244_79724961invSequencing shows
an interstitial duplication within the long arm of chromosome 18. As above, there is a
54.7 kb duplication within chromosome band 18q23, and the ISCN short system
(karyotype format) cannot distinguish the orientation of the duplicated sequences.
The HGVS nomenclature indicates that, compared to the reference sequence, the
genomic region 79,670,244 to 79,724,961 is inserted in an inverted orientation
between nucleotides 79,670,243 and 79,670,244 (i.e., proximal to the reference
copy). Since the ISCN and HGVS nomenclature lines give different information,
both should be used to describe the variant.
iii. seq[GRCh38] dup(18)(q23q23)
NC_000018.10:g.79724961_79724962ins79670244_79724961invSequencing shows
an interstitial duplication within the long arm of chromosome 18. As above, there is a
54.7 kb duplication within chromosome band 18q23, and the ISCN short system
(karyotype format) cannot distinguish the orientation of the duplicated sequences.
The HGVS description indicates the genomic region 79,670,244 to 79,724,961 is
inserted in an inverted orientation between nucleotides 79,724,961 and 79,724,962
(i.e., distal to the reference copy). Since the ISCN and HGVS nomenclature lines
give different information, both should be used to describe the variant.
iv. seq[GRCh38] 18q23(79,679,933_79,718,031)×3
or
NC_000018.10:g.(?_79679933)_(79718031_?)[2]Sequencing shows a single copy
gain of an interstitial segment of the long arm of chromosome 18. The ISCN short
system (microarray format) indicates a gain (three copies) of a part of chromosome
band 18q23; however, the methodology could not determine the insertion location or
orientation of the gain. The gain includes the segment from nucleotide 79,679,933 to
nucleotide 79,718,031, and the uncertainty region is not specified. The HGVS line
describes an additional copy [2] of the reference sequence of chromosome 18
between 79,679,933 to nucleotide 79,718,031. Note: dup, sup, and delins can
neither be used nor assumed, as the insertional location and orientation of the
duplicated sequences has implications on classification, interpretation, and
recurrence risk. Since ISCN and HGVS nomenclature indicate similar information
regarding the variants, either can be used.

218
 v. seq[GRCh38] 18q23(79527592×2,79679933_79718031×3,79728892×2)
or
NC_000018.10:g.(79527592_79679933)_(79718031_79728892)[2]Sequencing
shows an interstitial single copy gain within the long arm of chromosome 18. The
ISCN extended system (microarray format) indicates a gain (three copies) within
chromosome band 18q23; however, the methodology could not determine the
insertion location or orientation of the gain. The gain includes the segment from
nucleotide 79,679,933 to nucleotide 79,718,031. The extended system indicates the
neighboring proximal and distal targeted regions that show normal copy number (two
copies). The HGVS nomenclature indicates that, compared to the reference sequence,
there is an additional copy [2] of the chromosome 18 sequence between nucleotides
79,527,592 to 79,679,933 and 79,718,031 to 79,728,892. Note:
dup, sup and delins can neither be used nor assumed, as the insertional location and
orientation of the duplicated sequences has implications on classification,
interpretation, and recurrence risk. Since ISCN and HGVS nomenclature indicate
similar information regarding the variants, either can be used.
vi. seq[GRCh38] 16p11.2(29,604,826_30,188,489)×3
or
NC_000016.10:g.(?_29604826)_(30188489_?)[2]Sequencing shows an interstitial
gain within the short arm of chromosome 16. The ISCN short system (microarray
format) indicates a gain (three copies) of material from chromosome band 16p11.2
that is consistent with the proximal recurrent duplication of 16p11.2 (breakpoints
BP4-BP5); however, the insertion location or orientation of the gain could not be
determined as the breakpoints fall within segmental duplications. The gain
duplication includes the segment from nucleotides 29,604,826 to 30,188,489 and the
uncertainty region is not specified. The HGVS nomenclature describes that,
compared to the reference sequence, there is an extra copy [2] of the chromosome 16
sequence. Note: dup, sup and delins can neither be used nor assumed since the
insertional location and orientation of the duplicated sequences has implications on
classification, interpretation, and recurrence risk. Since ISCN and HGVS
nomenclature indicate similar information regarding the variants, either can be used.
vii. seq[GRCh38] 16p11.2(29410365×2,29604826_30188489×3,30335398×2)
or
NC_000016.10:g.(29410365_29604826)_(30188489_30335398)[2]Sequencing
shows an interstitial gain within the short arm of chromosome 16. The ISCN
extended system (microarray format) indicates a gain of 16p11.2 that is consistent
with the proximal recurrent duplication of 16p11.2 (breakpoint BP4-BP5); however,
the insertion location or orientation of the gain could not be determined as the
breakpoints fall within segmental duplications. The gain includes the segment from
nucleotide between 29,410,365 to 29,604,826 and 30,188,489 to 30,335,398. The
HGVS nomenclature describes that, compared to the reference sequence, there is an
additional copy [2] of the chromosome 16 sequence. Note: dup, sup and delins can
neither be used nor assumed since the insertional location and orientation of the
duplicated sequences has implications on classification, interpretation, and
recurrence risk. Since ISCN and HGVS nomenclature indicate similar information
regarding the variants, either can be used.

219
viii. 47,XY,+dic(15;15)(q13;q13).seq[GRCh38]
15q11.2q13.1(22572598_28318712×4,28724458×2)
or
NC_000015.10:g.[(pter_22572598)_(28318712_28724458);(pter_22572598)_(28318
712_28724458)inv]supSequencing data and chromosome analysis show two
additional copies of the proximal long arm of chromosome 15 associated with a
supernumerary dicentric chromosome as indicated by both ISCN short system
(karyotype format) and extended system (microarray format). The precise breakpoint
and structural information are not determined by the sequencing data; however, the
karyotype data show the nature of the extra copies of this region are associated with a
dicentric supernumerary chromosome, composed of inverted copies of 15pter to
15q13.1. The region of four copies detected by sequencing includes the segment
from nucleotide 22,572,598 to 28,318,712 in bands 15q11.2 to 15q13.1; however, the
proximal breakpoint is not known as it involves the most proximal region assayed for
copy number, while the distal breakpoint occurs in the segmental duplication region
between 28,318,712 and 28,724,458. The HGVS nomenclature line describes a
supernumerary chromosome composed of two copies of the short arm of
chromosome 15 ((pter_22572598)_(28318712_28724458)) where, compared to the
reference sequence, one is in a normal orientation, and one is in an inverted
orientation. The use of sup indicates that this finding is associated with a
supernumerary chromosome, as confirmed by the karyotype. Since ISCN gives more
information on the structure of the abnormality, the inclusion of the HGVS line is
optional.
ix. seq[GRCh38] der(11)(pter→q22.3::q22.3→q14.3::q14.3→qter)
NC_000011.10:g.106009182_106009183ins[91466078_106007033inv;91448961_10
6009182]Sequencing shows a complex gain within the long arm of chromosome 11.
The ISCN detailed system (karyotype format) indicates a complex finding, with two
additional copies of 11q14.3 to 11q22.3 on the same chromosome 11 homologue,
with the middle copy in an inverted orientation. The HGVS line indicates that the
derivative chromosome involves additional copies of 11q material with two different
sizes: one additional copy of a 14.541 Mb region involving nucleotides 91,466,078 to
106,007,033 which is inserted in an inverted orientation after position 106,009,182,
followed by an additional copy of a 14.56 Mb region involving nucleotides
91,448,961 to 106,009,182. Since the ISCN and HGVS nomenclature lines give
different information, both should be used to describe the variant.
x. seq[GRCh38]
11q14.3(91,448,700_91,465,000)×3,11q14.3q22.3(91,465,500_106,007,000)×4,11q2
2.3(106,008,600_106,019,700)×3
or
NC_000011.10:g.(?_91448700)_(91465000_91465500)[2](;)(91465500_106007000)
[3](;)(106007000_106008600)_(106019700_?)[2]Sequencing shows multiple copy
number gains within the long arm of chromosome 11. The ISCN short system
(microarray format) indicates a 14.5 Mb region of four copies of sequence from
chromosome bands 11q14.3 to 11q22.3, with two smaller regions of three copies of
adjacent sequence involving a 16.3 kb gain in 11q14.3, and an 11.1 kb gain in
11q22.3. The methodology used could not determine the exact breakpoints, nor the

220
 insertion location or orientation of the regions of copy number gain. The HGVS line
describes, compared to the reference sequence, the detection of one additional
copy [2] of the sequence from 91,448,700 to 91,465,000, two additional copies [3] of
the sequence from 91,465,500 to 106,007,000, and one additional copy [2] of the
sequence from 106,008,600 to 106,019,700. The insertional locations and
orientations are not known for these gains, as indicated by the semicolon (;) to
indicate that it is not known whether the gains are in cis (same chromosome) or in
trans (different chromosomes). Since ISCN and HGVS nomenclature indicate similar
information regarding the variants, either can be used.

[Link] Derivative Chromosome

The following examples describe copy number alterations that are associated with
structural rearrangements. If multiple copy number alterations are detected without
any structural information, the nomenclature can be written similar to the microarray
format nomenclature, with the copy number alterations listed in chromosomal
numerical order. For complex findings, including chromothripsis,
chromoanasynthesis, or other complexities that would result in a prohibitive number
of abnormalities to describe in one nomenclature line, the microarray format for
complex findings may be used (see Section 8.2.7 for examples).

i. seq[GRCh38] der(2)t(2;11)(p25.1;p15.2)
NC_000002.12:g.pter_8247756delins[NC_000011.10:g.pter_15825272]Sequencing
shows an apparently terminal deletion of the short arm of chromosome 2 and an
apparently terminal gain of the short arm of chromosome 11 associated with an
unbalanced translocation. The ISCN short system (karyotype format) describes the
derivative chromosome 2 with breakpoints in 2p25.1 and 11p15.2. The breakpoints
of the translocation are described in the HGVS line of the nomenclature and occur at
2p25.1 (between nucleotides 8,247,756 and 8,247,757) and 11p15.2 (between
nucleotides 15,825,272 and 15,825,273). The delins after the chromosome 2
breakpoints indicates that, compared to the reference sequence, the terminal region
from chromosome 2 (2pter to 2p25.1) is deleted and is replaced by the terminal
segment of chromosome 11 (11pter to 11p15.2). The HGVS line of the nomenclature
does not explicitly state that this sequence from chromosome 11 is a gain, but the
gain is implied since there is no derivative 11 described. Since the ISCN and HGVS
nomenclature lines give different information, both should be used to describe the
variant.
ii. seq[GRCh38]
2p25.3p25.1(45,440_7,044,179)×1,11p15.5p15.2(197,297_15,247,208)×3
or
NC_000002.12:g.(pter_45440)_(7044179_?)del
NC_000011.10:g.(pter_197297)_(158247208_?)[2]Sequencing shows an apparently
terminal deletion of the short arm of chromosome 2 and an apparently terminal gain
of the short arm of chromosome 11. The ISCN short system (microarray format)
describes an apparently terminal deletion of the short arm of chromosome 2 with a
breakpoint in 2p25.1 using a relative copy-number detection methodology

221
 (e.g., exome sequencing), where the precise breakpoints nor structural information is
determined. The deletion involves the first assayed region on the short arm of
chromosome 2 (45,440) to 7,044,179. The copy number gain involves the first
assayed region of the short arm of chromosome 11 (197,297) to 15,247,208. The
uncertainty region of both copy number changes are not indicated. Note: the deletion
and gain are likely terminal, but the nomenclature describes only the region of the
chromosome that is assayed for copy number, similar to array nomenclature. The
HGVS line describes two variants: an apparently terminal deletion of chromosome 2
sequences, and an additional copy of chromosome 11 sequences. Since no structural
information is obtained from the sequencing data, the insertional location of the 11p
sequences is unknown, and each copy number variant is described on a different line
as it is not confirmed if they are structurally related. Note:
dup, sup and delins cannot be used in this circumstance, and it should not be
assumed since the insertional location and orientation of the duplicated sequences
have implications on classification, interpretation, and recurrence risk. Since ISCN
and HGVS nomenclature indicate similar information regarding the variants, either
can be used.
iii. seq[GRCh38] der(5)t(5;10)(p13.3;q21.3)
NC_000005.10:g.pter_29658442delins[NC_000010.11:g.67539995_qterinv]Sequenc
ing shows an apparently terminal deletion of the short arm of chromosome 5 and an
apparently terminal gain of the long arm of 10 associated with an unbalanced
translocation. The ISCN short system (karyotype format) nomenclature describes a
derivative chromosome 5 from an unbalanced translocation between 5p13.3 and
10q21.3. The HGVS line of the nomenclature describes the deletion of chromosome
5 sequences from pter to nucleotide 29,658,442, which are replaced by chromosome
10 sequences from nucleotides 67,539,995 to qter. Compared to the reference
sequence, the orientation of chromosome 10 sequence is inverted; inv is used to
indicate the change in orientation. Since the ISCN and HGVS nomenclature lines
give different information, both should be used to describe the variant.
iv. seq[GRCh38] der(2)t(2;13)(q37.2;q31.1)
NC_000002.12:g.235100310_qterdelins[NC_000013.11:g.85862019_qter]Sequencin
g shows an apparently terminal deletion of the long arm of chromosome 2 and an
apparently terminal gain of the long arm of chromosome 13. The ISCN short system
(karyotype format) describes a derivative chromosome 2 from an unbalanced
translocation between 2q37.2 and 13q31.1. The HGVS line describes the terminal
deletion of chromosome 2 sequence from nucleotide 235,100,310 to qter, which is
replaced by terminal chromosome 13 sequence from nucleotides 85,862,019 to qter.
Since the ISCN and HGVS nomenclature lines give different information, both
should be used to describe the variant.
v. seq[GRCh38] der(9)t(9;10)(q34.3;p15.3)
NC_000009.12:g.137175878_qterdelins[NC_000010.11:g.pter_2944334inv]Sequenc
ing shows an apparently terminal deletion of the long arm of chromosome 9 and an
apparently terminal gain of the short arm of chromosome 10 associated with an
unbalanced chromosome. The ISCN short system (karyotype format) describes a
derivative chromosome 9 from an unbalanced translocation between 9q34.3 and
10p15.3. The HGVS line describes the absence of the sequences from nucleotide

222
 137,175,878 to the qter of chromosome 9, which is replaced by nucleotides from pter
to 2,944,334 from chromosome 10. The inv is used since, compared to the reference
sequence, the orientation of the chromosome 10 sequences is inverted. Since the
ISCN and HGVS lines give different information, both should be used to describe the
variant.
vi. seq[GRCh38] der(3)(3pter→3q25.32::8q24.21→8qter)
NC_000003.12:g.158573187_qterdelins[NC_000008.11:g.(128534000_128546000)
_qter]Sequencing shows an apparently terminal deletion of the long arm of
chromosome 3 and an apparently terminal gain of the long arm of chromosome 8
associated with an unbalanced translocation. The ISCN detailed system (karyotype
format) describes a derivative chromosome 3 from a translocation between 3q25.32
and 8q24.21. The breakpoint in chromosome 3 is between nucleotides 158,573,186
and 158,573,187, while the breakpoint in chromosome 8 is uncertain (as shown by
the parentheses) and between nucleotides 128,534,000 and 128,546,000. Since the
ISCN and HGVS lines give different information, both should be used to describe the
variant.
vii. seq[GRCh38] XX,der(4)ins(4;X)(q28.3;q22.1q21.31)
NC_000004.12:g.134850793_134850794ins[NC_000023.11:g.(89555676_89556012
)_(100351998_100352080)inv]Sequencing shows gain of an interstitial region of the
long arm of the X chromosome, which is inserted into the long arm of chromosome
4. The ISCN short system (karyotype format) describes a derivative chromosome 4,
with an additional inverted copy of Xq21.31 to Xq22.1 inserted into 4q28.3.
Sequence data indicates the site of the insertion in chromosome 4 is between
134,850,793 to 134,850,794. The duplicated X chromosome sequences have
uncertain breakpoints, between 89,555,676 to 89,556,012 and 100,351,998 to
100,352,080. This duplicated region of the X chromosome is inserted in an inverted
orientation relative to the X chromosome reference sequence. In the ISCN
description the sex chromosome complement is indicated, as it may help to interpret
the clinical significance and clarify the copy number involving the duplicated region
of the X chromosome. Since the ISCN and HGVS nomenclature lines give different
information, both should be used to describe the variant.
viii. seq[GRCh38]
der(6)(6pter→6q14.1::21q22.12→21qter),der(12)(6qter→6q23.2::12p13.2→12qter),
der(21)(21pter→21q22.12::12p13.2→12pter)
NC_000006.11:g.78952474_qterdelins[NC_000021.8:g.35039585_qter]
NC_000012.11:g.pter_11878386delins[NC_000006.11:g.132514527_qterinv]
NC_000021.8:g.35042090_qterdelins[NC_000012.11:g.pter_11878495inv]Sequenci
ng shows a complex rearrangement between chromosomes 6, 12, and 21 resulting in
three derivative chromosomes. The ISCN detailed system (karyotype format)
describes each derivative chromosome from pter to qter, with multiple breakpoints
in 6q14.1, 6q23.2, 12p13.2, and 21q22.12. Sequencing reveals deletions at the
breakpoints of each derivative chromosome, thus the use of the short system
(karyotype format) is inappropriate. The HGVS description indicates that, compared
to the reference sequence, there are deletions of 53 Mb on chromosome 6
(nucleotides 78,952,474 to 132,514,526), 109 bp on chromosome 12 (nucleotides
11,878,386 to 11,878,494), and a copy number of 2.5 kb on chromosome 21

223
 (nucleotides 35,039,585 to 35,042,089). The copy number alterations are indicated
by the differences between the corresponding deleted regions (e.g., 78,952,474 to
qter for the deleted region of chromosome 6) and inserted regions (e.g., 132,514,527
to qter for the inserted region of chromosome 6). Since the ISCN and HGVS
nomenclature lines give different information, both should be used to describe the
variant.
ix. seq[GRCh38]
der(6)t(6;13)(q14.3;q31.1),der(13)t(6;13)(q14.3;q31.1)inv(6)(q14.3q14.3)del(6)(q14.
3q14.3)del(6)(q14.3q16.1)
NC_000006.12:g.85897871_qterdelins[A;NC_000013.11:g.80659609_qter]
NC_000013.11:g.80659607_qterdelins[NC_000006.12:g.[85897899_85900540inv;8
5900541_86488291;93909933_qter]]Sequencing shows a complex rearrangement
between chromosomes 6 and 13. The ISCN short system (karyotype format)
describes two derivative chromosomes. The derivative 6 involves a translocation
between 6q14.3 and 13q31.1. A single base pair (A) inserted at the breakpoint
between nucleotide position 85,897,871 at 6q14.3 and position 80,659,609 at
13q31.1. The derivative 13 is more complicated with a translocation at 6q14.3, and
with an inversion and deletion within the chromosome 6 sequence that are
translocated to the derivative chromosome 13. The chromosome 6 sequences now
located on the derivative 13 involve a 2.6 kb inversion within 6q14.3 (85,897,899 to
85,900,540) and a 7.4 Mb deletion (86,488,292 to 93,909,932) of chromosome
6q14.3 to 6q16.1. In addition to the large chromosome 6 deletion, there is a 2 bp
deletion of chromosome 13 sequences (80,659,607 to 80,659,608) and a 28 bp
deletion (85,897,871 to 85,897,898) of chromosome 6 sequences at the breakpoints.
Since the ISCN and HGVS nomenclature lines give different information, both
should be used to describe the variant.
x. seq[GRCh38] der(5)ins(5;?)(q22.1;?)
NC_00005.10:g.112173754_112173755insN[696]Sequencing shows an insertion of
sequence with unknown origin into the long arm of chromosome 5. The ISCN short
system (karyotype format) describes the insertion of unknown sequences indicated
by a question mark (?) into the long arm of chromosome 5 at band 5q22.1. The
HGVS line describes the insertion of 696 nucleotides that are not specified
(insN[696]) into chromosome 5 between nucleotides 112,173,754 and 112,173,755.
Since the ISCN and HGVS nomenclature lines give different information, both
should be used to describe the variant.
xi. seq[GRCh38]
Xp22.33p22.31(276,356_6,383,977)×1,Xp22.31q28(7,050,341_156,010,409)×2,Yp1
1.32p11.2(276,356_9,547,294)×1,Yp11.2q12(10,266,944_56,961,317)×0
or
NC_000023.11:g.(pter_276356)_(6383977_7050341)=(;)(6383977_7050341)_(1560
10409_qter)[2]
NC_000024.10:g.(9547294_10266944)_(56961317_qter)delg.?_?ins[NC_000024.10
:g.(pter_276356)_(9547294_10266944)]Sequencing data from a targeted assay
(e.g. exome sequencing) show the presence of two copies of the X chromosome and
a non-centromeric fragment of the Y chromosome in a male. One of the X
chromosomes has an apparently terminal deletion of the short arm involving the

224
 pseudoautosomal region and additional material from the X-specific region of
Xp22.33 to Xp22.31. The insertional location of the fragment of the Y chromosome
is not known and should not be assumed in the nomenclature. The ISCN short system
(microarray format) describes copy number findings involving the X and Y
chromosomes. One copy of the distal end of the short arm of the X chromosome
from 276,356 to 6,383,977 is present, with two copies for the remainder of the X
chromosome (7,050,341 to 156,010,409). There is also one copy of the distal end of
the short arm of the Y chromosome that includes the SRY gene (276,356 to
9,547,294); the rest of the Y chromosome, including the centromere, is absent
(10,266,944 to 56,961,317). The HGVS nomenclature describes the presence of an
additional copy of the X chromosome sequences and loss of the Y chromosome
sequences compared to the male reference. The nature of this additional copy of X
sequences, involving the region between 6,383,977 to 7,050,341 and 156,010,409 to
the qter is not known as indicated by the use of the allele format for unknown
phase ((;)). The Y chromosome is described as a deletion of the majority of the Y,
from between 9,547,294 to 10,266,944 to between 56,961,317 and the qter. Since the
fragment of the Y chromosome is lacking a centromere, it is described as an insertion
into the genome at an unknown location indicated by g.?_?ins. Follow-up testing
using routine chromosome analysis, FISH, genome mapping, or sequencing across
the breakpoints is essential to confirm any structural alterations associated with these
copy number findings, such as 46,X,der(X)t(X;Y)(p22.31;p11.2). Since ISCN and
HGVS nomenclature indicate similar information regarding the variants, either can
be used.
xii. seq[GRCh38]
14q31.3q32.33(82692819×2,85528649_104180813×3,104244199×2),14q32.33(1057
71415×2,105837032_106881350×1)
or
NC_000014.9:g.(82692819_85528649)_(104180813_104244199)[3](;)(105771415_
105837032)_(106881350_pter)delSequencing shows an interstitial gain and an
apparently terminal deletion within the long arm of chromosome 14. The ISCN
extended system (microarray format) describes two imbalances in chromosome 14:
an interstitial gain of approximately 18.7 Mb of 14q31.3q32.33 from 85,528,649 to
104,180,813 and an apparently terminal loss of approximately 1.0 Mb of 14q32.33
from 105,837,032 to 106,881,350. A normal copy number (two copies) is found for
the region of approximately 1.5 Mb between these two imbalances (104,244,199 to
105,771,415). The insertional location and orientation of the gain is not known, nor if
the deletion and gain involve the same homologue. Follow-up testing such as routine
chromosome analysis or FISH is essential to confirm the structural nature of the
imbalance. The HGVS nomenclature describes the gain of the chromosome 14
sequences and the terminal deletion with unknown phase using
a semicolon in parenthesis ((;)). Since ISCN and HGVS nomenclature indicate
similar information regarding the variants, either can be used.

225
[Link] Ring Chromosome

i. seq[GRCh38] r(8)(p23.2q24.3)
NC_000008.11:g.(pter)_3300105del::139535561_(qter)delSequencing shows
terminal deletions of the short and long arm of chromosome 8 associated with a ring
chromosome. The combination of the ISCN short system (karyotype format) and of
the HGVS nomenclature describes a ring chromosome derived from chromosome 8
with breakpoints at band 8p23.2 and 8q24.3 joining nucleotide 3,300,106 to
nucleotide 139,535,560. Since the ISCN and HGVS nomenclature lines give
different information, both should be used to describe the variant. If the structural
information is not known, this finding should be described as two terminal deletions
with unknown phase using either the ISCN array format (see Section [Link]) or the
HGVS allele format, NC_000008.11:g.(pter)_3300105del(;)139535561_(qter)del
(see Section [Link]).
ii. 47,XY,+[Link][GRCh38] +r(8)(p23.2q24.3)
NC_000008.11:g.3300106::139535560supSequencing shows a gain of the
centromeric region of chromosome 8, clarifying the identity of a supernumerary
marker chromosome identified by G-banding. The ISCN short system (karyotype
format) indicates the copy number gain involves chromosome 8 from 8p23.2 to
8q24.3. HGVS nomenclature indicates the breakpoints at nucleotide 3,300,106 is
now joined to nucleotide 139,535,560 using a double colon (::). If the structural
information is not known from the karyotype, this supernumerary ring chromosome
should be described as a duplication
NC_000008.11:g.(?_3300106)_(139535560_?)[2] (see Section [Link]). Since the
ISCN and HGVS nomenclature lines give different information, both should be used
to describe the variant.

The following sections describe balanced chromosomal alterations, with no

associated copy number changes (see Sections [Link], [Link] and [Link]). All
examples use a combination of both ISCN and HGVS. The ISCN karyotype format
nomenclature, either short or detailed system, is used to describe the structural
finding, with the HGVS nomenclature line indicating the breakpoint details.

[Link] Insertion

i. seq[GRCh38] X,ins(4;X)(q28.3;q21.31q22.1)
NC_000023.11:g.89555676_100352080del
NC_000004.12:g.134850793_134850794ins[NC_000023.11:g.89555676_10035208
0]Sequencing shows a balanced insertion of an interstitial region of the long arm of
the X chromosome into the long arm of chromosome 4. The combination of the
ISCN short system (karyotype format) and of the HGVS nomenclature describe a
balanced interchromosomal insertion of X chromosome long arm sequences
(nucleotides 89,555,676 to 100,352,080) into the long arm of chromosome 4
(between nucleotides 134,850,793 and 134,850,794) in an XX individual. The
inserted sequence from the X chromosome is in the same orientation as the reference
sequence. The sex chromosome complement is indicated as the sex chromosome

226
 complement can help to interpret the clinical significance and clarify the zygosity of
the X chromosome abnormality. Since the ISCN and HGVS nomenclature lines give
different information, both should be used to describe the variant.
ii. seq[GRCh38] X,ins(4;X)(q28.3;q22.1q21.31)
NC_000023.11:g.89555676_100352080del
NC_000004.12:g.134850793_134850794ins[NC_000023.11:g.89555676_10035208
0inv]Sequencing shows a balanced insertion of an interstitial region of the long arm
of X chromosome into the long arm of chromosome 4. The combination of the ISCN
short system (karyotype format) and of the HGVS nomenclature describes a balanced
interchromosomal insertion of the X chromosome long arm sequences (nucleotides
89,555,676 to 100,352,080) into the long arm of chromosome 4 (between nucleotides
134,850,793 and 134,850,794) in an XX individual. The inserted sequence from the
X chromosome is inverted in orientation relative to the reference sequence. The sex
chromosome complement is indicated in the ISCN line, as the sex chromosome
complement can help to interpret the clinical significance and clarify the zygosity of
the X chromosome abnormality. Since the ISCN and HGVS nomenclature lines give
different information, both should be used to describe the variant.
iii. seq[GRCh38] ins(3)(pter→q23::q24→q26.32::q24→q23::q26.32→qter)
NC_000003.10:g.[139122717_146206645del;177128243_177128245delins[1391227
17_146206645inv;AA]]Sequencing shows a balanced intrachromosomal insertion
within the long arm of chromosome 3. The combination of the ISCN detailed system
(karyotype format) and HGVS nomenclature describe an intrachromosomal balanced
insertion involving a 7.1 Mb region within 3q23q24 (139,122,717 to 146,206,645)
inserted into 3q26.32 (between positions 177,128,243 and 177,128,245) in an
inverted orientation. There is a single base deletion (177,128,244), and an insertion
of two bases (AA) at the insertion breakpoint. Since the ISCN and HGVS
nomenclature lines give different information, both should be used to describe the
variant.

[Link] Inversion

i. seq[GRCh38] inv(6)(pter→p25.3::q16.1→p25.3::q16.1→qter)
NC_000006.12:g.[776788_93191545inv;93191546T>C]Sequencing shows a
pericentric inversion of chromosome 6. The combination of the ISCN detailed
system (karyotype format) and of the HGVS nomenclature indicates the inversion
involves 776,788 to 93,191,545 with a T to C nucleotide substitution at the
breakpoint (nucleotide 93,191,546). Since the ISCN and HGVS nomenclature lines
give different information, both should be used to describe the variant.
ii. seq[GRCh38] inv(2)(pter→p22.3::q31.1→p22.3::q31.1→qter)dn
NC_000002.12:g.[32310435_32310710del;32310711_171827243inv;171827243_17
1827244insG]Sequencing shows a pericentric inversion of chromosome 2. The
combination of the ISCN detailed system (karyotype format) and of the HGVS
nomenclature describe a de novo pericentric inversion in chromosome 2 (nucleotides
32,310,711 to 171,827,243) with a 276 bp deletion (nucleotides 32,310,435 to
32,310,710) at the short arm breakpoint and a single base pair insertion (G) at the

227
 long arm breakpoint. Since the ISCN and HGVS nomenclature lines give different
information, both should be used to describe the variant.
iii. seq[GRCh38] inv(2)(p22.3q31.1)mat
NC_000002.12:g.[32310435_32310710delinsG;32310711_171827243inv]Sequencin
g shows a pericentric inversion of chromosome 2. The combination of the ISCN
short system (karyotype format) and of the HGVS nomenclature describe a
maternally inherited pericentric inversion in chromosome 2 (nucleotides 32,310,711
to 171,827,243) with a 276 bp deletion (nucleotides 32,310,435 to 32,310,710) and a
single base pair insertion (G) at the short arm breakpoint. Since the ISCN and HGVS
nomenclature lines give different information, both should be used to describe the
variant.
iv. seq[GRCh38] inv(6)(p22.3p21.2)
NC_000006.12:g.[20271801_39524349inv;39524350A>C]Sequencing shows a
paracentric inversion within the short arm of chromosome 6. The combination of the
ISCN short system (karyotype format) and of the HGVS nomenclature describe a
paracentric inversion in the short arm of chromosome 6 (nucleotides 20,271,801 to
39,524,349) with a single nucleotide substitution at the breakpoint (39,524,350 A to
C). Since the ISCN and HGVS nomenclature lines give different information, both
should be used to describe the variant.

[Link] Translocation

Translocations that appear balanced karyotypically may show imbalances at the

breakpoint(s) by sequencing. The following examples show a combination of the
ISCN karyotype format (short system or detailed system) and of the HGVS
nomenclature to describe the gross structural change to chromosomes as the result of
a translocation that is identified by sequencing.

i. 46,XX,t(2;11)(p24;p15).seq[GRCh38] t(2;11)(p25.1;p15.2)
NC_000002.12:g.pter_8247756delins[NC_000011.10:g.pter_15825272]
NC_000011.10:g.pter_15825272delins[NC_000002.12:g.pter_8247756]Chromosom
e analysis and sequencing data show a translocation between the short arms of
chromosomes 2 and 11. The karyotype breakpoints, at bands 2p24 and 11p15, are
further defined by sequencing to be bands 2p25.1 and 11p15.2. The translocation
involves the joining of the chromosome 11 nucleotide 15,825,272 to the chromosome
2 nucleotide 8,247,757 on the derivative chromosome 2, and the joining of the
chromosome 2 nucleotide 8,247,756 to the chromosome 11 nucleotide 15,825,273 on
the derivative chromosome 11. Since the ISCN and HGVS nomenclature lines give
different information, both should be used to describe the variant.
ii. seq[GRCh38] t(2;11)(q31.1;q22.3)
NC_000002.12:g.174500009_qterdelins[NC_000011.10:g.108111987_qter]
NC_000011.10:g.108111982_qterdelins[NC_000002.12:g.174500009_qter]Sequenci
ng shows a translocation between the long arms of chromosomes 2 and 11. The
translocation involves the joining of chromosome 11 nucleotide 108,111,987 to the
chromosome 2 nucleotide 174,500,008 on the derivative chromosome 2, and the
joining of the chromosome 2 nucleotide 174,500,009 to the chromosome 11

228
 nucleotide 108,111,981 on the derivative chromosome 11. There is a 5 bp deletion of
chromosome 11 sequence as evident from the nucleotide numbers given for the two
chromosome 11 breakpoints (from 108,111,982 to 108,111,986). Since the ISCN and
HGVS nomenclature lines give different information, both should be used to describe
the variant.
iii. seq[GRCh38] t(12;21)(p13.2;q22.12)
NC_000012.12:g.pter_11874853delins[NC_000021.9:g.34953708_qterinv]
NC_000021.9:g.34953108_qterdelins[NC_000012.12:g.pter_11873172inv]Sequenci
ng shows a translocation between the short arm of chromosome 12 and the long arm
of chromosome 21. There is a 1.68 kb deletion of chromosome 12 sequence evident
from the nucleotide numbers given for the two chromosome 12 breakpoints (from
11,873,173 to 11,874,853), and a 600 bp deletion of chromosome 21 sequence
evident from the nucleotide numbers given for the two chromosome 21 breakpoints
(from 34,953,108 to 34,953,707). Since the ISCN and HGVS nomenclature lines
give different information, both should be used to describe the variant.
iv. seq[GRCh38]
t(3;14)(14qter→14q12::3p22.2→3qter;14pter→14q12::3p22.2→3pter)
NC_000003.12:g.pter_36969141delins[NC_000014.9:g.29745314_qterinv;CATTTG
TTCAAATTTAGTTCAAATGA]
[NC_000003.12:g.pter_36969141inv]Sequencing shows a translocation between the
short arm of chromosome 3 at 36,969,141 and the long arm of chromosome 14 at
29,745,314 with insertion of non-templated sequence
(CATTTGTTCAAATTTAGTTCAAATGA) at the breakpoint on the derivative
chromosome 3. Since the ISCN and HGVS nomenclature lines give different
information, both should be used to describe the variant.
v. seq[GRCh38] t(9;9)(9qter→9q31.1::9p21.2→9qter;9pter→9q31.1::9p21.2→9qter)
NC_000009.12:g.[pter_26393001delins102425452_qterinv];[102425452_qterdelinsp
ter_26393001inv]Sequencing shows a translocation between homologous
chromosomes with breakpoints at 9p21.2 and 9q31.1. The different chromosome 9
homologues are indicated by the underline of the second chromosome 9 in the ISCN
line. The translocation involves the joining of the short arm of the first chromosome
9 at 26,393,002 to the second chromosome 9 long arm at 102,425,452 and the long
arm of the second chromosome 9 at nucleotide 102,425,451 to the short arm of the
first chromosome 9 at nucleotide 26,393,001. The HGVS nomenclature uses the
allele format to indicate that these findings are found in trans, indicating that both
chromosome 9s are abnormal. Since the ISCN and HGVS nomenclature lines give
different information, both should be used to describe the variant.

229
12 Chromosome Breakage and Instability
This chapter provides a nomenclature for the chromatid and chromosome aberrations
that may be observed in, for example, constitutional chromosome breakage syndromes
or following clastogenic exposure.

Since many aberrations of this kind are scored on unbanded material, recommendations
are given first for non-banded preparations and then for banded preparations.

12.1 Chromatid Aberrations

12.1.1 Non-Banded Preparations

a. A chromatid (cht) aberration involves only one chromatid in a chromosome at a given

locus.
b. A chromatid gap (chtg) is a non-staining region (achromatic lesion) of a single
chromatid in which there is minimal misalignment of the chromatid.
c. A chromatid break (chtb) is a discontinuity of a single chromatid in which there is a
clear misalignment of one of the chromatids.
d. A chromatid exchange (chte) is the result of two or more chromatid lesions and the
subsequent rearrangement of chromatid material. Exchanges may be between
chromatids of different chromosomes (interchanges) or between or within chromatids
of one chromosome (intrachanges).
e. In the case of interchanges, it will generally be sufficient to indicate the configuration
as:
• triradial (tr) when there are three arms to the pattern,
• quadriradial (qr) when there are four, or
• multiradial (mr) when there are more than four arms to the pattern.
f. The number of centromeres may be indicated within parentheses (1 cen, 2 cen, etc.).
g. When necessary, exchanges may be classified in more detail:
• Asymmetrical exchanges inevitably result in the formation of an acentric fragment,
whereas symmetrical exchanges do not. In asymmetrical exchanges, the incompleteness
may be proximal when the broken ends nearest the centromere are not rejoined or distal
when the ends farthest from the centromere are not rejoined.
• In complete exchanges, all broken ends are rejoined, but this does not occur
in incomplete exchanges.
• Intra-arm events include duplications, deletions, paracentric inversions, and
isochromatid breaks showing sister reunion.
• It should be noted that these terms are descriptive only and do not imply knowledge of
the origin of the aberrations.
h. Sister chromatid exchange, detectable only by special staining methods, results from
the interchange of homologous segments between two chromatids of one chromosome.
The abbreviation sce can be used to describe this event.

230
12.1.2 Banded Preparations

Some chromatid aberrations can be defined more precisely or can be recognized with
certainty only in banded preparations.

a. There is a space between two abbreviations, but there is no space between the last
abbreviation and the parentheses.
b. A chromatid deletion (cht del) is the absence of a banded sequence from only one of
the two chromatids of a single chromosome.
c. A chromatid inversion (cht inv) is the reversal of a banded sequence of only one of
the two chromatids of a single chromosome.
d. Both cht del and cht inv are subclasses of chromatid exchanges (chte).
e. Where it is desired to specify the location of a chromatid aberration, the appropriate
abbreviation can be followed by the band designation.

i. chtg(4)(q25) Chromatid gap in chromosome 4 at band 4q25.

ii. chtb(4)(q25) Chromatid break in chromosome 4 at band 4q25.

iii. chte(4;10)(q25;q22) Chromatid exchange involving chromosomes 4 and 10 at bands 4q25 and
10q22.
iv. cht del(1)(q12q25) Chromatid deletion in chromosome 1 with loss of the segment between bands
1q12 and 1q25.
v. cht inv(1)(q12q25) Chromatid inversion in chromosome 1 with reversal of the segment between
bands 1q12 and 1q25.
vi. sce(4)(q25q33) Sister chromatid exchanges in chromosome 4 at bands 4q25 and 4q33.

12.2 Chromosome Aberrations

12.2.1 Non-Banded Preparations

a. A chromosome (chr) aberration involves both chromatids of a single chromosome at

the same locus.
b. A chromosome gap (chrg) is a non-staining region (achromatic lesion) at the same
locus in both chromatids of a single chromosome in which there is minimal
misalignment of the chromatids. The term chromosome gap is synonymous
with isolocus gap and isochromatid gap.
c. A chromosome break (chrb) is a discontinuity at the same locus in both chromatids of
a single chromosome, giving rise to an acentric fragment and an abnormal monocentric
chromosome. This fragment is therefore a particular type of acentric fragment (ace),
and chrb should be used only when the morphology indicates that the fragment is the
result of a single event. The term chromosome break is synonymous with isolocus
break and isochromatid break.

231
 d. A chromosome exchange (chre) is the result of two or more chromosome lesions and
the subsequent relocation of both chromatids of a single chromosome to a new position
on the same or on another chromosome. It may be symmetrical (e.g., reciprocal
translocation) or asymmetrical (e.g., dicentric formation).
e. A minute (min) is an acentric fragment smaller than the width of a single chromatid. It
may be single or double. In the special situation, when double minutes are present
clonally in tumor cells, the abbreviation dmin is used; see Sections 5.5.3 and 5.5.12.
f. Pulverization (pvz) indicates a situation where a cell contains both chromatid and/or
chromosome gaps and breaks that are not normally associated with exchanges and are
present in such numbers that they cannot be enumerated. Occasionally, one or more
chromosomes in a cell are pulverized while the remaining chromosomes are of normal
morphology; e.g., pvz(1) is a pulverized chromosome 1.
g. Premature chromosome condensation (pcc) occurs when an interphase nucleus is
induced to enter mitosis prematurely. A pcc may involve a G1 or a G2 nucleus. The
chromatin of S-phase nuclei undergoing pcc often appears to be pulverized.
h. The term premature centromere division (pcd) may be used to describe premature
separation of centromeres in metaphase. The pcd may affect one or more chromosomes
in a fraction of the cells.

12.2.2 Banded Preparations

a. When banded preparations allow adequate identification of chromosome segments or

chromosome aberrations, the nomenclature described in ISCN 2024 can be used. When
not, the observations can be described in words.
b. A marker chromosome (mar) is a structurally rearranged chromosome in which no
part can be identified by chromosome banding methods (see Section 5.5.12).

12.3 Scoring of Aberrations

a. The main types of aberrations scored

are chtg, chtb, chte, chrg, chrb, ace, min, r, dic, tr, qr, der, and mar, and reports
should, where possible, give the data under these headings. It is recognized, however,
that aberrations are frequently grouped to give adequate numbers, e.g., for statistical
analysis. When this is done, it should be indicated how the groupings relate to the
aberrations listed above, e.g.:

• Chromatid aberrations: chtg, chtb, chte

• Fragments (= deletions): chrb, ace, min

• Asymmetric aberrations: ace, dic, r

b. The data should not be presented as deduced breakages per cell but in such a manner
that it is possible to calculate the number of aberrations per cell.

232
13 References

Al-Aish MS: Human chromosome morphology. I. Studies on normal chromosome

characterization, classification and karyotyping. Can J Genet Cytol 11:370–381 (1969).

Baliakas P, Jeromin S, Iskas M, Puiggros A, Plevova K, Nguyen-Khac F, Davis Z,

Rigolin GM, Visentin A, Xochelli A, et al: Cytogenetic complexity in chronic
lymphocytic leukemia: definitions, associations, and clinical impact. Blood 133:1205–
1216 (2019).

Behrend C, Karimzad Hagh J, Mehdipour P, Schott H, Schwanitz G: Human

Chromosome Atlas: Introduction to Diagnostics of Structural Aberrations (2nd ed.,
Springer International Publishing, Cham 2023).

Bruford EA, Antonescu CR, Carroll AJ, Chinnaiyan A, Cree IA, Cross NCP, Dalgleish
R, Gale RP, Harrison CJ, Hastings RJ, Huret J-L, Johansson B, Le Beau M, Mecucci C,
Mertens F, Verhaak R, Mitelman F: HUGO Gene Nomenclature Committee (HGNC)
recommendations for the designation of gene fusions. Leukemia 35:3040–3043 (2021).

Caspersson T, Farber S, Foley GE, Kudynoski J, Modest EJ, Simonsson E, Wagh U,

Zech L: Chemical differentiation along metaphase chromosomes. Exp Cell Res 49:219–
222 (1968).

Caspersson T, Lomakka G, Zech L: The 24 fluorescence patterns of human metaphase

chromosomes – distinguishing characters and variability. Hereditas 67:89–102 (1971).

Cheng C, Zhou Y, Li H, Xiong T, Li S, Bi Y, Kong P, Wang F, Cui H, Li Y, et al:

Whole-genome sequencing reveals diverse models of structural variations in esophageal
squamous cell carcinoma. Am J Hum Genet 98:256–274 (2016).

Chia NL: A comprehensive set of idiograms representing all interpretive levels of

resolution: ISCN (2009). Cytogenet Genome Res 125:162–164 (2009).

Chicago Conference (1966): Standardization in Human Cytogenetics. Birth Defects:

Original Article Series, Vol 2, No 2 (The National Foundation, New York 1966).

Chun K, Hagemeijer A, Iqbal A, Slovak ML: Implementation of standardized

international karyotype scoring practices is needed to provide uniform and systematic
evaluation for patients with myelodysplastic syndrome using IPSS criteria: An

233
International Working Group on MDS Cytogenetics Study. Leukemia Res 34:160–165
(2010).

Cremer T, Landegent J, Bruckner A, Scholl HP, Schardin M, Hager HD, Devilee P,

Pearson P, van der Ploeg M: Detection of chromosome aberrations in the human
interphase nucleus by visualization of specific target DNAs with radioactive and non-
radioactive in situ hybridization techniques: diagnosis of trisomy 18 with probe L1.84.
Hum Genet 74:346–352 (1986).

den Dunnen JT, Dalgleish R, Maglott DR, Hart RK, Greenblatt MS, McGowan-Jordan
J, Roux AF, Smith T, Antonarakis SE, Taschner PE: HGVS recommendations for the
description of sequence variants: 2016 update. Hum Mutat 37:564–569 (2016).

Denver Conference (1960): A proposed standard system of nomenclature of human

mitotic chromosomes. Lancet i:1063–1065 (1960).

Dutrillaux B: Obtention simultanée de plusieurs marquages chromosomiques sur les

mêmes préparations, après traitement par le BrdU. Humangenetik 30:297–306 (1975).

Dutrillaux J, Lejeune CR: A new technic of analysis of the human karyotype. Acad Sci
Hebd Seances Acad Sci D 272:2638–2640 (1971).

Ford CE, Hamerton JL: The chromosomes of man. Nature 178:1020–1023 (1956).

Francke U: High-resolution ideograms of trypsin-Giemsa banded human chromosomes.

Cytogenet Cell Genet 31:24–32 (1981).

Francke U: Digitized and differentially shaded human chromosome ideograms for

genomic applications. Cytogenet Cell Genet 65:206–218 (1994).

Francke U, Oliver N: Quantitative analysis of high-resolution trypsin-Giemsa bands on

human prometaphase chromosomes. Hum Genet 45:137–165 (1978).

Grimwade D, Hills RK, Moorman AV, Walker H, Chatters S, Goldstone AH, Wheatley
K, Harrison CJ, Burnett AK, National Cancer Research Institute Adult Leukaemia
Working Group: Refinement of cytogenetic classification in acute myeloid leukemia:
determination of prognostic significance of rare recurring chromosomal abnormalities
among 5876 younger adult patients treated in the United Kingdom Medical Research
Council trials. Blood 116:345–365 (2010).

Guan XY, Meltzer PS, Trent JM: Rapid generation of whole chromosome painting
probes (WCPs) by chromosome microdissection. Genomics 22:101–107 (1994).

Haase D, Stevenson KE, Neuberg D, Maciejewski JP, Nazha A, Sekeres MA, Ebert BL,
Garcia-Manero G, Haferlach C, Haferlach T, et al: TP53 mutation status divides

234
myelodysplastic syndromes with complex karyotypes into distinct prognostic
subgroups. Leukemia 33:1747–1758 (2019).

ISCN (1978): An International System for Human Cytogenetic Nomenclature. Birth

Defects: Original Article Series, Vol 14, No 8 (The National Foundation, New York
1978); also in Cytogenet Cell Genet 21:309–404 (1978).

ISCN (1981): An International System for Human Cytogenetic Nomenclature – High

Resolution Banding. Birth Defects: Original Article Series, Vol 17, No 5 (March of
Dimes Birth Defects Foundation, New York 1981); also in Cytogenet Cell Genet 31:1–
23 (1981).

ISCN (1985): An International System for Human Cytogenetic Nomenclature, Harnden

DG, Klinger HP (eds), Birth Defects: Original Article Series, Vol 21, No 1 (March of
Dimes Birth Defects Foundation, New York 1985).

ISCN (1991): Guidelines for Cancer Cytogenetics, Supplement to An International

System for Human Cytogenetic Nomenclature, Mitelman F (ed), (S Karger, Basel
1991).

ISCN (1995): An International System for Human Cytogenetic Nomenclature,

Mitelman F (ed), (S Karger, Basel 1995).

ISCN (2005): An International System for Human Cytogenetic Nomenclature, Shaffer

LG, Tommerup N (eds), (S Karger, Basel 2005).

ISCN (2009): An International System for Human Cytogenetic Nomenclature, Shaffer

LG, Slovak ML, Campbell LJ (eds), (S Karger, Basel 2009).

ISCN (2013): An International System for Human Cytogenetic Nomenclature, Shaffer

LG, McGowan-Jordan J, Schmid M (eds), (S Karger, Basel 2012).

ISCN (2016): An International System for Human Cytogenomic Nomenclature,

McGowan-Jordan J, Simons A, Schmid M (eds), (Karger, Basel 2016); also in
Cytogenet Genome Res 149:1–140 (2016).

ISCN (2020): An International System for Human Cytogenomic Nomenclature,

McGowan-Jordan J, Moore S, Hastings RJ (eds), (S Karger, Basel 2020).

Iqbal MA, Broeckel U, Levy B, Skinner S, Sahajpal NS, Rodriguez V, Stence A,

Awayda K, Scharer G, Skinner C, et al: Multisite Assessment of Optical Genome
Mapping for Analysis of Structural Variants in Constitutional Postnatal Cases. J Mol
Diagn 25:175–188 (2023).

235
Landegent JE, Jansen in de Wal N, Dirks RW, Baao F, van der Ploeg M: Use of whole
cosmid cloned genomic sequences for chromosomal localization by non-radioactive in
situ hybridization. Hum Genet 77:366–370 (1987).

Levan A, Frega K, Sandberg AA: Nomenclature for centromeric position on

chromosomes. Hereditas 52:201–220 (1964).

Levy B, Baughn LB, Akkari Y, Chartrand S, LaBarge B, Claxton D, Lennon AP, Cujar
C, Kolhe R, Kroeger K, et al: Optical Genome Mapping in Acute Myeloid Leukemia:
A Multicenter Evaluation. Blood Adv 7:1297–1307 (2022).

Lichter P, Cremer T, Borden J, Manuelidis L, Ward DC: Delineation of individual

human chromosomes in metaphase and interphase cells by in situ suppression
hybridization using recombinant DNA libraries. Hum Genet 80:224–234 (1988).

Lichter P, Tang CJ, Call K, Hermanson G, Evans GA, Housman D, Ward DC: High-
resolution mapping of human chromosome 11 by in situ hybridization with cosmid
clones. Science 247:64–69 (1990).

Liehr T, Claussen U, Starke H: Small supernumerary marker chromosomes (sSMC) in

humans. Cytogenet Genome Res 107:55–67 (2004).

Liehr T, Starke H, Heller A, Kosyakova N, Mrasek K, Gross M, Karst C, Steinhaeuser

U, Hunstig F, Fickelscher I, et al: Multicolor fluorescence in situ hybridization (FISH)
applied to FISH-banding. Cytogenet Genome Res 114:240–244 (2006).

Lin YF, Hu Q, Mazzagatti A, Valle-Inclán JE, Maurais EG, Dahiya R, Guyer A, Sanders
JT, Engel JL, Nguyen G, et al: Mitotic clustering of pulverized chromosomes from
micronuclei. Nature 618:1041–1048 (2023).

Liu P, Erez A, Nagamani SC, Dhar SU, Kolodziejska KE, Dharmadhikari AV, Cooper
ML, Wiszniewska J, Zhang F, Withers MA, et al: Chromosome catastrophes involve
replication mechanisms generating complex genomic rearrangements. Cell 146:889–
903 (2011).

London Conference on the Normal Human Karyotype. Cytogenetics 2:264–268 (1963).

Magenis RE, Barton SJ: Delineation of human prometaphase paracentromeric regions

using sequential GTG- and C-banding. Cytogenet Cell Genet 45:132–140 (1987).

Monk D, Morales J, den Dunnen JT, Russo S, Court F, Prawitt D, Eggermann T, Beygo
J, Buiting K, Tümer Z, the Nomenclature Group of the European Network for Human
Congenital Imprinting Disorders: Recommendations for a nomenclature system for
reporting methylation aberrations in imprinted domains. Epigenetics 13:117–121
(2018).

236
Moore S, McGowan-Jordan J, Smith AC, Rack K, Koehler U, Stevens-Kroef M,
Barseghyan H, Kanagal-Shamanna R, Hastings R: Genome Mapping Nomenclature.
Cytogenet Genome Res 163(5–6):236–246 (2023).

Newman S, Hermetz KE, Weckselblatt B, Rudd K: Next-generation sequencing of

duplication CNVs reveals that most are tandem and some create fusion genes at
breakpoints. Am J Hum Genet 96:208–220 (2015).

Ordulu Z, Wong KE, Currall BB, Ivanov AR, Pereira SA, Gusella JF, Talkowski ME,
Morton CC: Describing sequencing results of structural chromosome rearrangements
with a suggested next-generation cytogenetic nomenclature. Am J Hum Genet 94:1–15
(2014).

Paris Conference (1971): Standardization in Human Cytogenetics. Birth Defects:

Original Article Series, Vol 8, No 7 (The National Foundation, New York 1972); also
in Cytogenetics 11:313–362 (1972).

Paris Conference (1971), Supplement (1975): Standardization in Human Cytogenetics.

Birth Defects: Original Article Series, Vol 11, No 9 (The National Foundation, New
York 1975); also in Cytogenet Cell Genet 15:201–238 (1975).

Parra I, Windle B: High resolution visual mapping of stretched DNA by fluorescent

hybridization. Nat Genet 5:17–21 (1993).

Patau K: The identification of individual chromosomes, especially in man. Am J Hum

Genet 12:250–276 (1960).

Pinkel D, Landegent J, Collins C, Fuscoe J, Segraves R, Lucas J, Gray JW:

Fluorescence in situ hybridization with human chromosome-specific libraries: detection
of trisomy 21 and translocations of chromosome 4. Proc Natl Acad Sci USA 85:9138–
9142 (1988).

Rausch T, Jones DT, Zapatka M, Stϋtz AM, Zichner T, Weischenfeldt J, Jäger N, Remke
M, Shih D, Northcott PA, et al: Genome sequencing of pediatric medulloblastoma links
catastrophic DNA rearrangements with TP53 mutations. Cell 148:59–71 (2012).

Sahajpal NS, Mondal AK, Fee T, Hilton B, Layman L, Hastie AR, Chaubey K, DuPont
BR, Kolhe R: Clinical Validation and Diagnostic Utility of Optical Genome Mapping
in Prenatal Diagnostic Testing. J Mol Diagn 25:234–246 (2023).

Schluth-Bolard C, Labalme A, Cordier M-P, Till M, Nadeau G, Tevissen H, Lesda G,

Boutry-Kryza N, Rossignol S, Rocas D, et al: Breakpoint mapping by next generation
sequencing reveals causative gene disruption in patients carrying apparently balanced
chromosome rearrangements with intellectual deficiency and/or congenital
malformations. J Med Genet 50:144–150 (2013).

237
Seabright M: A rapid banding technique for human chromosomes. Lancet 298:971–972
(1971).

Smith AC, Neveling K, Kanagal-Shamanna R: Optical genome mapping for structural

variation analysis in hematologic malignancies. Am J Hematol 97:975–982 (2022).

Stephens PJ, Greenman CD, Fu B, Yang F, Bignell GR, Mudie LJ, Pleasance ED, Lau
KW, Beare D, Stebbings LA, et al: Massive genomic rearrangement acquired in a single
catastrophic event during cancer development. Cell 144:27–40 (2011).

Tjio JH, Levan A: The chromosome number of man. Hereditas 42:1–16 (1956).

Trask BJ: Fluorescence in situ hybridization: applications in cytogenetics and gene

mapping. Trends Genet 7:149–154 (1991).

Viegas-Pequignot E, Dutrillaux B: Une méthode simple pour obtenir des prophases et

des prometaphases. Ann Genet 21:122–125 (1978).

Wiegant J, Kalle W, Mullenders L, Brookes S, Hoovers JM, Dauwerse JG, van Ommen
GJ, Raap AK: High-resolution in situ hybridization using DNA halo preparations. Hum
Mol Genet 1:587–591 (1992).

Wiegant J, Wiesmeijer CC, Hoovers JM, Schuuring E, d’Azzo A, Vrolijk J, Tanke HJ,
Raap AK: Multiple and sensitive fluorescence in situ hybridization with rhodamine-,
fluorescein-, and coumarin-labeled DNAs. Cytogenet Cell Genet 63:73–76 (1993).

Wyandt HE, Tonk VS (eds): Atlas of Human Chromosome Heteromorphisms (Springer,

New York 2008).

Xue Y, Durocher D: A mitotic glue for shattered chromosomes. Nature 618:909–910

(2023).

Yunis JJ: High resolution of human chromosomes. Science 191:1268–1270 (1976).

Yunis JJ, Sawyer JR, Ball DW: The characterization of high-resolution G-banded
chromosomes of man. Chromosoma 67:293–307 (1978).

Zepeda-Mendoza CJ, Morton CC: The iceberg under water: Unexplored complexity of
chromoanagenesis in congenital disorders. Am J Hum Genet 104(4):565–577 (2019).

238
14 Members of the ISCN Standing Committee

Nicole L. Chia School of Biomedical Sciences, Faculty of Health

(Deputy Chair elect) Queensland University of Technology (QUT)
Diagnostic Genomics, Healius Pathology
Brisbane, QLD, Australia
Laura K. Conlin Division of Genomic Diagnostics
Department of Pathology and Laboratory Medicine
Children’s Hospital of Philadelphia
Philadelphia, PA, USA
Johan T. den Dunnen * Human Genetics and Clinical Genetics
Leiden University Medical Center
Leiden, The Netherlands
Jean-Michel Dupont Cytogénétique constitutionnelle Pré et Post Natale, Service de Médecine
Génomique des Maladies de Système et d’Organe
APHP. Centre-Université Paris Cité
Paris, France
Rosalind J. Hastings GenQA, Women’s Centre, John Radcliffe Hospital
(Chair) Oxford University Hospitals NHS Foundation Trust
Oxford, UK
Jin-Yeong Han Department of Laboratory Medicine
Dong-A University College of Medicine
Busan, Republic of Korea

Jean McGowan-Jordan Department of Genetics, CHEO and Department of

Pathology and Laboratory Medicine, University of Ottawa
Ottawa, ON, Canada
Myungshin Kim Department of Laboratory Medicine, College of Medicine,
The Catholic University of Korea
Seoul, Republic of Korea

Sarah Moore Genetics and Molecular Pathology, SA Pathology,

(Deputy Chair) SA Genomics Health Alliance
Adelaide, SA, Australia
Cynthia C. Morton Departments of Obstetrics and Gynecology and of Pathology, Brigham
and Women’s Hospital, Harvard Medical School, Boston
and Broad Institute of MIT and Harvard, Cambridge, MA, USA
and Manchester Centre for Audiology and Deafness,
University of Manchester
Manchester, UK

239
* Chair HUGO HGVS Variant Nomenclature Committee (HVNC)

Acknowledgements

The Committee gratefully acknowledges Dorathe Schindelholz, Karger, for her copy
editing. David Betts, Dublin, Ireland, Dr. Berna Beverloo, Rotterdam, The Netherlands,
and Melody Tabiner, Oxford, UK for proofreading the document. Finally, the ISCN
committee thanks members of the cytogenomics community and OGM user group for
their suggestions, examples and images.

Statement of Ethics

As a set of recommendations this publication is exempt from ethical committee

approval.

Conflict of Interest Statement

The authors have no conflicts of interest to declare.

Funding Sources

The 2023 Committee meeting and ISCN (2024) publication were made possible by
generous contributions from Karger Publishers.

Author Contributions

Dr. Rosalind Hastings collected suggestions from the cytogenomics community,

collated all the recommendations of the Standing Committee and edited all chapters. Dr.
Rosalind Hastings reorganized Chapters 1, 2, 3, 10, and the Appendix, plus
amended Chapters 12, 13, and 14. Dr. Rosalind Hastings, Sarah Moore and Dr. Nicole
Chia provided critical review of and contributed ideas and content for all the other
chapters. Prof. Jean-Michel Dupont reorganized Chapters 4 and 5 and provided critical
review of Chapters 2 and 10. Prof. Jean McGowen-Jordan critically reviewed Chapters
4 and 5. Profs. Myungshin Kim and Jin-Yeong Han provided critical review of, and
additional examples for Chapter 6. Prof. Myungshin Kim also reviewed Chapter 10.
Sarah Moore and Dr. Nicole Chia provided critical review of, and additional examples
for Chapter 7. Dr. Nicole Chia and Prof. Cynthia Morton provided critical review of,
and additional examples for Chapter 8. Sarah Moore, Dr. Ros Hastings, Prof. Jean
McGowan-Jordan also developed the Genomic mapping nomenclature (Chapter 9) with
input from the OGM user group. Dr. Laura Conlin provided critical review of, and
additional examples for Chapter 11, as well as contributing additional examples
to Chapters 7 and 8. As an ISCN Standing Committee member and Chair of HUGO
HGVS Variant Nomenclature Committee (HVNC), Prof. Johan den Dunnen contributed
to the revision of the HGVS within Chapter 11.

240
15 Appendix

15.1 Molecular Basis of Banding

Chromosome bands reflect the functional organization of the genome that regulates
DNA replication, repair, transcription, and genetic recombination. The molecular basis
of banding methods is known to involve nucleotide base composition, associated
proteins, and genome functional organization. In general, Giemsa-positive bands (G-
dark bands, R-light bands) are AT-rich, late replicating, and gene poor; whereas,
Giemsa-negative bands (G-light bands, R-dark bands) are CG-rich, early replicating,
and relatively gene rich. Note: if fluorescent R- or G-banding is used, then the dark and
light bands may be different.

Centromeric DNA and pericentromeric heterochromatin, composed of α-repetitive

DNA and various families of repetitive satellite DNA, are easily detected by C-banding.
The telomere is composed of 5 to 20kb of tandem hexanucleotide minisatellite repeat
units, TTAGGG, and stains darkly by T-banding. The 18S and 28S ribosomal RNA
genes are clustered together in large arrays containing about 40 copies of each gene.
These are located on the acrocentric short arms, at the nucleolar organizer regions or
NORs, and are detected by silver staining.

15.2 Chromosome Banding

The original banding pattern was described in the Paris Conference (1971) report and
was based on the patterns observed in different metaphase cells stained with either the
Q-, G-, or R-banding technique (Fig. 14). The banding patterns obtained with these
staining methods agreed sufficiently to allow the construction of a single idiogram
representative of all three techniques. The bands were designated on the basis of their
midpoints and not by their margins. Intensity was taken into consideration in
determining which bands should serve as landmarks on each chromosome in order to
divide the chromosome into natural, easily recognizable morphologic regions. A list of
bands serving as landmarks that were used in constructing this diagram is provided
in Table 12.

The idiograms showing the G-banding patterns for normal human chromosomes at five
different levels of resolution are shown in Figure 15. The corresponding G- and R-
banded chromosomes are for approximately the same resolution in Figures 16a and 16b.

241
15.3 Idiograms

242
Fig 14. Diagrammatic representation of human chromosome bands as observed with the
Q-, G-, and R- banding methods; centromeric regions are representative of Q-staining
method only (Paris Conference, 1971).

243
Table 12. Bands identified as landmarks that divide the chromosomes into cytogenetically defined
regions. The omission of an entire chromosome or chromosome arm indicates that either both arms or the
arm in question consists of only one region, delimited by the centromere and the end of the chromosome
arm.

244
245
246
247
248
249
250
251
252
253
254
255
256
257
Fig 15. Idiograms of G-banding patterns for normal human chromosomes at five different levels of resolution. From the left,
chromosomes in each group represent a haploid karyotype of approximately 300-, 400-, 550-, 700-, and 850-band levels. The dark
G-bands correspond to bright Q-bands, with the exception of the variable regions. The numbering of R-banded chromosomes is
exactly the same, with a reversal of light and dark bands. While the band numbers reflect GTG bands, the relative widths and
staining intensities of euchromatic bands may vary with resolution and banding method (Francke, 1981, 1994; Chia, 2009). The
original idiograms of the Y chromosome are according to observations of Magenis and Barton (1987). The 400-, 550-, and 850-
band idiograms correspond to the ISCN (1995) nomenclature. The 300- and 700-band idiograms were provided by N.L. Chia (Chia,
2009). Two types of non-euchromatic regions are indicated by different cross-hatching patterns, one involving the pericentromeric
heterochromatin regions on all chromosomes and the other involving the variable regions 1q12, 3q11.2, 9q12, 16q11.2, 19p12,
19q12, Yq12, and the short arms of all acrocentric chromosomes. Bands can be seen within the variable regions, in particular in
1q12, 9q12 and Yq12, but since they are variable they have not been detailed in the idiograms.

258
259
Fig 16. a G-banded chromosomes arranged in increasing order of resolution from approximately the
500- to the 900-band levels. (Courtesy of Dr. E. Magenis.)

260
261
Fig 16. b R-banded chromosomes arranged in increasing order of resolution from approximately the
400- to the 850-band levels. (Courtesy of Dr. E. Magenis.)

262