UTA worksheet #2
Study session – week 2: Nucleic Acids & Central Dogma
Question 1: Structure of DNA and RNA
You’re working in the lab and need to determine the percentage of nucleotides in each sample. After calculating the
values, you go to print the data to add it to your lab notebook. Unfortunately, the lab printer is low on ink, and some
of the numbers in your table didn’t print clearly. Using what you know, fill in the missing information in the table
below:
Sample Adenine Thymine Cytosine Guanine Uracil dsDNA / ssDNA / dsRNA / ssRNA ?
A 10 dsDNA
B 15 ssRNA
C 20 30 20
D 14 36 0
E 18 18 0
Question 2: Review principle of transcription
True or False? If false, correct the statement to make it true.
A. In the process of transcription, the information in DNA is converted into a structure called rRNA. This structure
then moves into the cytoplasm, where it is read by mRNA to produce a protein.
B. During transcription, DNA polymerase transcribes the DNA template by adding new nucleotides to the 5ʹ end of
the newly synthesized strand while reading the template from 5ʹ to 3ʹ. A peptide bond connects each newly
added nucleotide to the growing strand.
C. In the process of transcription, the information in DNA is converted into a structure called tRNA. This structure
then moves into the extracellular space, where it is read by rRNA to produce a protein.
Question 3: DNA replication
What would happen to DNA replication if the 3’ OH group of the deoxyribose sugar was removed?
A. It would proceed as normal; only the 5’ phosphate is needed to connect the next nucleotide.
B. Replication would stop because the incoming nucleotide cannot form a phosphodiester bond without a 3’ OH
group on the existing strand.
C. It depends on the specific nitrogenous base. Replication would proceed if it was an A or G (purine), but not if it
was a C or T (pyrimidine).
D. Replication would not be able to proceed as the DNA can no longer ionize to form the sugar phosphate
backbone.
E. Replication would accelerate since the missing 3’ OH allows faster incorporation of nucleotides.
Question 4: DNA complementarity
Provide the complementary DNA sequence for the following strand. Indicate which end is 5’ and which end is 3’, and
label the phosphate and hydroxyl groups at each end. One of the groups is given to you.
*phosphate*- ATGCAGTCAGTAGTCATGCAATAA
Study session – week 2 Page 1 of 3
UTA worksheet #2
Question 5: Principle of the Central Dogma
A biotechnology company is developing a treatment for cystic fibrosis that delivers a healthy copy of the CFTR gene
into lung cells using viral DNA. After treatment, the cells begin producing the functional CFTR protein. Which of the
following would be the correct scenario for how this treatment satisfies the Central Dogma?
A. The virus inserts the CFTR protein directly into lung cells, bypassing RNA transcription.
B. The virus delivers DNA, which is transcribed to mRNA and then translated into the CFTR protein.
C. The virus delivers mRNA, which is reverse transcribed into DNA and incorporated into the host genome.
D. The virus provides functional ribosomes to lung cells so they can directly translate protein without the need for
mRNA or DNA.
Question 6: Base pairing in DNA
Explain why adenine (A) pairs specifically with thymine (T), and cytosine (C) pairs specifically with guanine (G), rather
than forming other possible base pairs. In your answer, discuss the role of hydrogen bonding in stabilizing the DNA
double helix.
Question 7: Exceptions to Central Dogma
Which of the following scenarios would NOT be an exception to the traditional Central Dogma information flow
from DNA → RNA → Protein?
A. A mutation in the DNA sequence that affects the function of the protein
B. Multiple proteins are made from a single DNA (gene) through the modification of mRNA (alternative splicing)
C. Retroviruses, which use enzymes to create double-stranded DNA sequences from single-stranded RNA
D. DNA sequences that code for rRNAs, a structural and functional component of ribosomes.
Question 8: deoxyribonucleotide triphosphates (dNTPs)
Describe the importance of using deoxyribonucleotide
triphosphates (dNTPs) when adding new nucleotides to
a DNA/RNA strand during DNA replication. Explain how
these dNTPs are incorporated into the strand, and why
deoxyribonucleotide monophosphates (dNMP) are not
used.
Question 9: Molecular interactions in DNA
Describe the types of molecular interactions that stabilize the double-stranded DNA helix (ex: covalent bonds, ionic
interactions, hydrogen bonds, hydrophobic interactions, and van der Waals forces). In comparison, is it energetically
easier to separate the two DNA strands or to cleave individual nucleotides from the DNA polymer backbone?
Study session – week 2 Page 2 of 3
UTA worksheet #2
Question 10: Thermophiles & DNA
Thermophilic bacteria are microorganisms able to survive at extreme high temperatures (above 100°C). What
characteristic of their DNA allows them to survive at these high temperatures?
A. Thermophilic bacteria have double stranded DNA while all other bacteria have single stranded DNA
B. Thermophilic bacteria have shorter DNA strands to reduce the risk of denaturation
C. Thermophilic bacteria have a higher proportion of G-C base-pair content in their DNA
D. Thermophilic bacteria have a higher proportion of A-T base pair content in their DNA
Provide reasoning for your answer above:
Question 11: Apply your knowledge
The template DNA sequence is: 5’ – ACTTAGGCTAACGTG – 3’
a) Write the complementary DNA strand produced during replication:
b) Write the sequence of the mRNA transcribed from the template DNA:
Question 12: Functions of nucleotides
You work at a lab that is focusing on studying nucleotides and their functions. You are trying to identify an unknown
nucleotide. In the cell, it serves as an energy source during protein synthesis and also plays a part in signaling
pathways. Additionally, the nucleotide consists of a double-ringed nitrogenous base. What nucleotide is it?
A. dATP B. GTP C. cAMP D. TTP
Question 13: DNA denaturation
a) Define the term “DNA denaturation”.
b) Consider two dsDNA molecules (shown below). When heated, which strand will break apart first?
DNA #1 DNA #2
3’-ATTCATTGCAAAT-5’ 3’-GCCGTTGGGCAG-5’
5’-TAAGTAACGTTTA-3’ 5’-CGGCAACCCGTC-3’
Answer:
Question 14: From DNA to mRNA
Given the template strand of a DNA sequence, 5’-ATGGCATTGCT-3’, which of the following is the resulting mRNA?
A. 3’-ATGGCATTGCT-5’ B. 3’-UACCGUAACGA-5’ C. 3’-AUGGCAUUCGU-5’ D. 5’-UACCGUAACGA-3’
Question 15: DNA structure
Stems, loops, and pseudoknots are characteristic features of nucleic acid folding. At what level of nucleic acid
structure do these features occur?
A. Primary B. Secondary C. Tertiary D. Quaternary
Study session – week 2 Page 3 of 3