0% found this document useful (0 votes)
9 views35 pages

Yeast Translation Initiation Methods

This chapter details methods for reconstituting eukaryotic translation initiation using purified components from Saccharomyces cerevisiae. It covers large-scale lysis of yeast cells, purification of ribosomal subunits, and various assays to characterize the initiation process. The goal is to provide a comprehensive approach that bridges biochemical studies and yeast genetics to enhance understanding of translation initiation mechanisms.

Uploaded by

neelamdabassen15
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
9 views35 pages

Yeast Translation Initiation Methods

This chapter details methods for reconstituting eukaryotic translation initiation using purified components from Saccharomyces cerevisiae. It covers large-scale lysis of yeast cells, purification of ribosomal subunits, and various assays to characterize the initiation process. The goal is to provide a comprehensive approach that bridges biochemical studies and yeast genetics to enhance understanding of translation initiation mechanisms.

Uploaded by

neelamdabassen15
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

C H A P T E R S I X

Reconstitution of Yeast
Translation Initiation
Michael G. Acker, Sarah E. Kolitz, Sarah F. Mitchell,
Jagpreet S. Nanda, and Jon R. Lorsch

Contents
1. Introduction 112
2. Large-Scale Lysis of S. cerevisiae Cells 114
3. Purification of 40S and 60S Ribosomal Subunits from S. cerevisiae 115
3.1. Culturing and storage of cells 115
3.2. Purification of 80S ribosomes 116
3.3. Gradient preparation 116
3.4. Separation of 80S ribosomes into 40S and 60S subunits 117
4. Ribosome Quality Analysis (Identity Gel) 118
4.1. Extracting ribosomal RNA 119
4.2. Gel analysis 119
5. Purification of His-Tagged eIF2 from S. cerevisiae 120
6. Purification of His-Tagged eIF3 from S. cerevisiae 122
7. Overexpression and Purification of Yeast eIF1, eIF1A, and eIF5
from E. coli 124
8. Overexpression and Purification of Yeast eIF1A in E. coli 125
9. Overexpression and Purification of Yeast eIF5B in E. coli 127
10. Purification of Yeast Methionyl-tRNA Synthetase (YMETRS) from
S. cerevisiae 128
11. RNA Synthesis and Purification 129
11.1. Gel purification of transcription products 130
11.2. Yeast initiator tRNA 130
12. Charging tRNAMet i with Methionine 131
12.1. Limiting charging reaction 132
12.2. Stoichiometric charging reaction 133
13. Filter Binding Assay to Monitor Ternary Complex Formation 134

Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine,
Baltimore, Maryland

Methods in Enzymology, Volume 430 # 2007 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(07)30006-2 All rights reserved.

111
112 Michael G. Acker et al.

14. Benchtop eIF2 GTPase Assay 135


14.1. Gel preparation 135
14.2. Experimental setup 136
14.3. Separation of GTPg[32P] and 32Pi 136
15. 43S/80S Complex Gel Shift Assay 137
15.1. Preparing an acrylamide gel for the 43S/80S gel shift assay 137
15.2. Preparing 43S gel shift reactions 139
15.3. Preparing 80S gel shift reactions 140
15.4. Running 43S/80S gels 140
15.5. Disassembly and analysis of gels 141
15.6. Testing 40S ribosomes 141
16. Solutions 142
Acknowledgments 143
References 144

Abstract
To facilitate the mechanistic dissection of eukaryotic translation initiation we
have reconstituted the steps of this process using purified Saccharomyces
cerevisiae components. This system provides a bridge between biochemical
studies in vitro and powerful yeast genetic techniques, and complements
existing reconstituted mammalian translation systems (Benne and Hershey,
1978; Pestova and Hellen, 2000; Pestova et al., 1998; Trachsel et al., 1977).
The following describes methods for synthesizing and purifying the compo-
nents of the yeast initiation system and assays useful for its characterization.

1. Introduction
Eukaryotic translation initiation is an extremely complex process that
requires at least 12 initiation factors (versus three factors in bacteria) to
position an initiator methionyl-tRNAiMet in the P-site of the ribosome,
base-paired to the correct AUG codon of the mRNA to be translated.
Decades of work have elucidated many details of this process, leading to the
current model of eukaryotic initiation (Fig. 6.1; reviewed in Kapp and
Lorsch, 2004b; Pestova et al., 2001, 2007). Briefly, eukaryotic initiation
factor (eIF) 2 forms a ternary complex (TC) with GTP and methionyl-
tRNAiMet that brings the methionyl-tRNAiMet onto the 40S ribosomal
subunit with the help of eIF1, eIF1A, and eIF3. The resulting 43S complex
is thought to bind to the 50 -end of an mRNA, near the 7-methylguanosine
cap, and scan in the 30 direction in search of the AUG start codon. eIF2,
with the aid of the GTPase-activating protein eIF5, is able to partially
hydrolyze GTP to GDP  Pi prior to start codon recognition, but is unable
to release the bound Pi. Recognition of the start codon causes a conforma-
tional change in the pre-initiation complex that results in release of eIF1
Reconstitution of Yeast Translation Initiation 113

5
5 5
Met
GTP 2 Met
GTP 2 GDP•Pi GTP 2Met
1A 1A 1A
1 1 AUG 1
AUG
40S 40S
40S
43S initiation Scanning complex
complex

5
GDP 2 5 5
1 Pi
Met
GDP 2Met GDP•Pi GTP 2Met
1A 1A 1A
1
AUG AUG AUG
40S 40S 40S

Post phosphate release Start codon recognition

60S

5B

60S
Met

AUG
40S

80S initiation complex

Figure 6.1 Schematic of the current model of the steps of translation initiation in the
reconstituted yeast system. For clarity, factors are not shown to scale. A ternary complex
(TC) formed by eIF2, methionyl-tRNAMet i , and GTP binds tightly to the GTPase-acti-
vating protein, eIF5. With the help of two small initiation factors, eIF1 and eIF1A, TC
binds to the 40S ribosomal subunit, forming the 43S complex. This complex can then
bind to and, in vivo, scan along mRNA in search of the start codon. During this time
eIF2, with the assistance of eIF5, is able to hydrolyze GTP; Pi cannot be released at this
stage, however, it creates an equilibrium between GTP and GDP  Pi. Once the start
codon has been located, a conformational change takes place, reducing the affinity of
the complex for eIF1 and leading to the dissociation of this factor. After eIF1 has disso-
ciated, phosphate is released, causing GTP hydrolysis to become irreversible, and com-
mitting the complex to initiating at the chosen codon. eIF2  GDP is then released from
the [Link] 60S ribosomal subunit joins the 40S subunit in a step facilitated by the
GTPase eIF5B. This step results in an 80S initiation complex with Met-tRNAiMet in
the P-site, base paired to the start codon of the mRNA, ready to begin the elongation
phase of translation.

from its binding site on the 40S subunit. Release of eIF1 triggers rapid Pi release
from eIF2  GDP  Pi, making GTP hydrolysis irreversible and allowing down-
stream events in the pathway to take place. Recognition of the start codon is also
thought to result in an additional conformational change that prevents further
scanning of the mRNA. A second GTPase, eIF5B, promotes 60S ribosomal
114 Michael G. Acker et al.

subunit joining to the 40S  mRNA  methionyl-tRNAMet i complex. GTP


hydrolysis by eIF5B reduces the affinity of the factor for the 80S initiation
complex and dissociation of eIF5B results in a translationally competent 80S
ribosome.
In vitro reconstitution has provided an invaluable tool for investigating
the mechanism of translation initiation. The ability to monitor individual
steps of the pathway, while at the same time controlling both the compo-
nent concentrations and their structures, has enabled measurement of many
of the kinetic and thermodynamic parameters at the heart of the process.
Although mammalian reconstituted systems have existed for nearly 3 dec-
ades (Benne and Hershey, 1978; Pestova and Hellen, 2000; Pestova et al.,
1998; Trachsel et al., 1977) and have provided great insight into the work-
ings of the initiation machinery, the creation of a yeast reconstituted initia-
tion system has greatly facilitated the coupling of the awesome power of
yeast genetics (widely known as APOG) to the benefits of in vitro reconsti-
tution, the awesome power of biophysical chemistry (not so widely known
as APOBPC) (Algire et al., 2002).
In this chapter, we describe in detail methods developed for reconstituting
yeast translation initiation. Several assays useful for checking the activity of the
reagents are also presented. The current minimal system uses an unstructured,
model mRNA (mRNA(AUG)), obviating the need for factors involved in
cap binding, mRNA recruitment, and mRNA remodeling, allowing core
steps in the initiation pathway to be isolated and studied. Consequently,
purification and characterization of these factors is not discussed. The incor-
poration of these factors and the steps that they mediate is an ongoing goal of
our lab, and will hopefully be discussed in a future chapter.
Note: The compositions of all buffers, solutions, and gels referred to in
the following sections are given at the end of the chapter in the Solutions
section.

2. Large-Scale Lysis of S. cerevisiae Cells


Reconstitution of translation initiation requires the synthesis and
purification of a large number of components on a relatively large scale.
The only way to increase the yield of some components is to increase the
culture size, often to >12 liters. This creates a problem in the speed and
efficiency with which the yeast cultures can be lysed. Goode has described a
protocol for large-scale lysis of Saccharomyces cerevisiae using liquid nitrogen
and a Waring blender (see [Link]
html for details; Goode, 2002). This method allows relatively rapid and
efficient lysis of large amounts of yeast cells, while at the same time mini-
mizing sample degradation by stabilizing the lysate as a frozen powder.
Reconstitution of Yeast Translation Initiation 115

Here, we summarize this protocol, which is used in a number of purifica-


tion schemes presented in this chapter.
Pellet the washed cells in a single bottle and determine the pellet weight.
Using a vol equal to 0.33 the weight of the pellet (1 ml ¼ 1 g) resuspend the
pellet in the appropriate lysis buffer or ddH2O. Slowly drip the cell suspen-
sion into a bucket of liquid N2 using a 25 ml pipette to create frozen cell
droplets. Carefully scoop the frozen droplets into a plastic bottle, cap loosely,
and store at 80 until all the liquid N2 has evaporated, then cap tightly.
Dry a Waring blender canister overnight in an oven or the fume hood.
Any residual water in the turning mechanism will freeze upon addition of
liquid N2, causing the propeller to lock in place, which can burn out the
motor. For safety, set up the blender apparatus in the fume hood or behind a
radiation shield to deflect liquid N2 spray, and wear safety goggles and cryo
gloves. Briefly cool the canister by blending a small amount of liquid N2. Fill
the canister no more than half-full with frozen cell pellets (30 to 150 g).
Overfilling can cause yeast lysate to spray from the canister. Add liquid N2 to
the level of the cell pellets and, holding the canister lid in place, turn the
blender on high and blend until the liquid N2 evaporates, about 15 to 30 s.
This will be marked by a change in the pitch of the blender sound. (Note: If
yeast powder is expelled from the lid vents, stop and wait until the liquid N2
level has decreased to the level of the pellets and begin again.) Tap down
the powder and again add liquid N2 to the canister to just above the level
of the powder. Repeat the process at least 4 times for the best lysis. Transfer
the powder into a 1 liter bottle using a funnel and a spatula. Add lysis buffer to
the desired final volume. Shake the bottle vigorously until all the cells have
been completely resuspended. You can run warm water over the bottle to
help thaw the cells. (Important: Remember to open the cap occasionally
until all the N2 gas has escaped.)

3. Purification of 40S and 60S Ribosomal


Subunits from S. cerevisiae
3.1. Culturing and storage of cells
Streak out a plate of YAS2488 cells (MATa leu2-3 112 his4-539 trp1 ura3-52
cup1::LEU2/PGK1pG/MFA2pG [Algire et al., 2002]). The stock plate should
be no more than 2 wk old. Starting with cells from older stock plates results in
decreased ribosome yield.
Inoculate 36 liters of YPD media in twenty-four 2800 ml baffled flasks
with 5 ml from a 150 ml saturated overnight culture per flask. Incubate at
30 , shaking at 250 rpm until the culture reaches an OD600 of 1.0  0.1.
This should take approximately 7 to 8 h.
116 Michael G. Acker et al.

3.2. Purification of 80S ribosomes


Lyse cells by the Waring blender method. The final volume of thawed
lysate/buffer should be 375 ml. Transfer the thawed lysate into 16 SS-34
tubes. Clarify the lysate by centrifugation in a Sorvall SS-34 rotor at
13,000 rpm for 30 min. Chill eight 50 ml conicals and 16 clean 26.3 ml
polycarbonate tubes (with caps) (Beckman 355618) on ice. Aliquot 2.5 ml
of sucrose cushion into each polycarbonate tube. When the clarification
spin is finished, immediately transfer the supernatant to the chilled conicals
using a 10 ml serological pipette, avoiding the lipid layer at the top.
Carefully layer 22.5 ml of clarified lysate onto each of the 16 sucrose
cushions. Balance the tubes and caps with lysis buffer. Centrifuge the
tubes in a Beckman Type 70Ti ultracentrifuge rotor at 60,000 rpm for
106 min to pellet the 80S ribosome. During this spin, prepare the sucrose
gradients; see Gradient Preparation.
Immediately upon completion of the ultracentrifuge spin, remove and
discard the supernatant with a 10 ml serological pipette. Try to remove as
much of the floating, white lipid layer as possible with the liquid, being very
careful not to contaminate the ribosomal pellet with lipids. The pellets
should be as clear as glass at this point. Add 2 ml of high salt wash buffer to
each tube. Resuspend each pellet with a P1000 and pool together in a 50 ml
conical. Rinse all the tubes with an additional 2 ml of high salt wash buffer
and add to the 50 ml conical. Bring the vol up to 36 ml with high salt wash
buffer. Place the 50 ml conical in a beaker filled with ice and stir at a
moderate speed with a micro-stir bar for 1 h. During this incubation, prepare
12 TLA 100.3 tubes by placing 250 ml of sucrose cushion in the bottom of
each and chilling on ice. Pellet the 80S ribosomes by layering the salt wash
(3 ml per tube) onto the sucrose cushions, balancing carefully, and spinning
at 100,000 rpm for 30 min at 4 in the TLA 100.3 rotor in a table-top
ultracentrifuge.
Resuspend all 12 pellets in 3 ml (total) subunit separation buffer and rinse
the tubes with an additional 1 ml. Transfer the ribosome solution to micro-
centrifuge tubes and spin for 30 s at 14,000 rpm to remove any debris. Transfer
the ribosome solution into a chilled 15 ml conical. Measure the OD260 of 1 ml
of the ribosome solution in 1 ml of water and store the samples on ice.

3.3. Gradient preparation


Aliquot 10 ml of 5% sucrose gradient solution into each of twelve 25 
89 mm, polyallomer tubes (Beckman 326823). Use a 25 ml serological
pipette to slowly layer 20 ml of 20% sucrose gradient solution underneath
the 5% layer in each tube. Top off the tubes with 5%, being careful not to
mix the two layers. The meniscus should rise above the top of the tube. Cap
the tubes with a rolling motion, inserting the end of the cap with the hole in
Reconstitution of Yeast Translation Initiation 117

it last to avoid air bubbles. Use the Gradient Master (BioComp Instruments,
Inc.) to mix the gradients with the following settings: time ¼ 1:21, angle ¼
76 , speed ¼ 20. Be sure to start with a level platform.

3.4. Separation of 80S ribosomes into 40S and 60S subunits


Make a fresh 200 ml solution of 100 mM puromycin in ddH2O. Dilute the
ribosomes in subunit separation buffer to 100 to 150 ODs per ml (i.e., if you
get an OD of 0.5 at 260 nm for 1 ml in 1 ml of ddH2O, you currently have
500 OD per ml, dilute by approximately five-fold). Add the puromycin to the
80S solution to a final concentration of 1 mM. Incubate on ice for 15 min,
then at 37 for 10 min. Gently remove 1 ml of liquid from the top of each
gradient without disturbing the gradient, and layer 1 ml of ribosome solution
onto the top of each. Balance the tubes with subunit separation buffer.
Centrifuge the gradients at 28,000 rpm in a Beckman SW28 rotor for 7.5 h
at 4 .
Prepare a gradient pump, setting the detector sensitivity to 2.0 and the
recorder speed to 60 cm/h. Fill the syringe on the pump with Fluorinert
F-40 (Sigma), attach an 18-gauge needle to the end of the syringe hose, and
remove any bubbles. Upon completion of the spin, attach a gradient to the
UV detector and insert the syringe into the bottom of the gradient tube
with the pump running at a very slow flow rate. Increase the flow rate to
6 ml/min. Adjust the offset on the chart recorder as necessary.
The first peak contains bulk mRNA. Collect the entire 40S peak (the
second large peak to come off) and the front 0.75 of the 60S peak (the third
large peak, usually larger than the 40S peak) in separate conical tubes on ice
(Fig. 6.2). Concentrate the 40S and 60S fractions with Amicon Ultra
(Millipore) concentrators (100K MWCO) until the volume is <1 ml. The
60S will take longer than the 40S because they contain a higher concentra-
tion of sucrose. Exchange the buffer by diluting the concentrate to 15 ml
with ribosome sucrose storage buffer and centrifuge again. Repeat the
buffer exchange until the KCl concentration is lower than 20 mM. Mix
the concentrate by pipetting and carefully transfer it to a clean, chilled
microfuge tube. Determine the concentrations by diluting 1 ml in 1 ml
ddH2O and measuring the OD260 and using extinction coefficients of
40S ¼ 2  107 M1cm1; 60S ¼ 4  107 M1cm1. Aliquot the subunits
into convenient amounts to minimize freeze-thawing over the use of the
prep. Flash-freeze in liquid N2 and store at 80 .
Notes:
1. It is imperative that the yeast cell cultures be grown to an OD600 very
close to 1.0, as growth to higher ODs results in a significant reduction
in ribosome yield and quality. We have not yet, however, attempted
culturing yeast cells in a fermentor, which may allow for increased
density of cell growth without significant effects on the ribosomes.
118 Michael G. Acker et al.

100
60 S

80
40 S
mRNA 60
40
20
0

Figure 6.2 Absorbance trace of 5 to 20% sucrose gradients after ultracentrifugation of


separated ribosomal subunits. The gradients are analyzed by following the absorbance
at 260 nm. From the top of the gradient (left side of the graph): free mRNA is at the top
of the gradient. 40S subunits are in the middle of the gradient. The transition from the
40S to the 60S peaks is discarded to maintain the purity of the samples. The 60S peak is
closest to the bottom of the gradient. Only the first 0.75 of the 60S peak is collected to
avoid the unseparated 80S ribosomes that pellet to the bottom of the tube.

2. Heparin is a vital component of the lysis and high salt wash buffers, serving
to inhibit and remove contaminating RNases (Algire et al., 2002).
3. The concentration of Mg2þ is critical in all steps of ribosome purifica-
tion. For instance, a two-fold change in Mg2þ concentration in 10
Ribo Buffer A can reduce the ribosome yield by 50% or more.
4. When resuspending ribosome pellets, a delicate hand is recommended.
Try not to introduce bubbles.
5. Between lysing the cells and loading the gradients, all work should be
performed in the cold room, if possible.

4. Ribosome Quality Analysis (Identity Gel)


Analyzing a sample of the rRNA on a denaturing polyacrylamide gel
enables visualization of the extent of rRNA cleavage, which we have found
directly correlates with the activity of the ribosomal subunits. Figure 6.3
depicts rRNA samples from two separate ribosomal subunit preps. Notice
Reconstitution of Yeast Translation Initiation 119

A B
40S 60S 40S 60S

28S rRNA 28S rRNA


18S rRNA
18S rRNA

Figure 6.3 Ribosomal RNA identity gel. Ribosomal RNA was extracted from 40S
and 60S ribosomal subunits and 2 mg of each sample were loaded onto a denaturing 12%
polyacrylamide gel. (A) RNA extracted from active 40S and 60S ribosomal subunits.
Full-length 18S and 28S ribosomal RNAs are indicated by arrows. 5S and 5.8S RNAs are
not shown. (B) RNA extracted from inactive 40S and 60S ribosomal subunits. Notice
the significant degradation of both 18S and 28S rRNA.

the extensive degradation of the 18S rRNA in the sample on the right,
which resulted in poor 40S subunit activity.

4.1. Extracting ribosomal RNA


Add 2 ml of ribosome sample (40S, 60S, or 80S from stocks of 10 mM) to
98 ml ddH2O. Add 400 ml ribosome extract buffer to the sample and extract
three times with 500 ml neutral buffered phenol followed by one extraction
with 500 ml chloroform. Ethanol precipitate the rRNA and resuspend the
pellet in 10 ml ddH2O. Quantitate the amount of rRNA extracted and store
the sample on ice.

4.2. Gel analysis


Use two 20  30 cm glass plates (one notched) and 1.5 mm spacers. Analyze
using an 8 M urea, 5% acrylamide/bisacrylamide (29:1), TBE gel. Dilute 2-mg
rRNA into 10 ml ddH2O and add 2 ml RNA loading dye (90% formamide,
120 Michael G. Acker et al.

0.02% bromophenol blue). Run the gel at 20 to 25 W for 2 h. Disassemble the


apparatus, leaving the gel attached to one of the two plates. Stain the gel with
methylene blue (0.04% in 0.5 M sodium acetate, pH 5.0) for 10 min and
destain with water. The gel can be placed on Whatman paper and dried for
permanent storage, or imaged and discarded.
Note: The gel is fragile. Minimize tearing by cutting the gel in half
horizontally and discarding the bottom half, and staining and destaining
while the gel is attached to the plate.

5. Purification of His-Tagged eIF2 from


S. cerevisiae
eIF2 is overexpressed in S. cerevisiae strain GP3511 containing a high-
copy plasmid expressing all three subunits of eIF2. eIF2g is His-tagged at the
C-terminus and serves as the sole copy of eIF2g in this strain (Erickson and
Hannig, 1996; Pavitt et al., 1998).
From a glycerol stock, streak a sample of eIF2 yeast cells on a YPD plate
and grow at 30 for 2 days. Inoculate twelve 1.5-l cultures of YPD media in
2800 ml baffled flasks with 750 ml from an overnight culture per flask and
grow overnight (about 16 h) at 30 with shaking at 250 rpm. Spin down,
store, and blend lyse cells, adding 200 ml eIF2 lysis buffer with the standard
mix of protease inhibitors (see Solutions). Clarify the lysate by centrifuga-
tion in a Sorvall SS-34 rotor at 13,000 rpm for 30 min at 4 . Transfer the
supernatant to a beaker and place the beaker in an ice bucket on a stir plate
in the cold room. While stirring, gradually add solid ammonium sulfate to
75% saturation (48.3 g ammonium sulfate/100 ml of lysate) and stir about
1 h. Spin the slurry at 15,000 rpm for 1 h in an SS-34 rotor at 4 . During
this spin set up in series two HiTrap Chelating columns (Amersham), freshly
regenerated with 100 mM NiSO4, on an FPLC.
Remove the supernatant and resuspend the pellet in 200 ml of eIF2
NCLB-20. Filter the solution first through 5 mm then 0.8 mm filters and
load it onto the equilibrated nickel columns at a flow rate of 3 ml/min.
Wash the columns with NCLB-20 and elute with NCEB-250 (the wash
and elution can be done at 5 ml/min). Pool the eluted fractions and carefully
dilute to 100 mM KCl (approximately five-fold) with 20 mM HEPES(pH 7.6)
and 2 mM DTT by slowly adding the dilution buffer to the eIF2 solution,
mixing frequently to avoid precipitation. Load the diluted sample onto an
equilibrated HiTrap Heparin column (Amersham). Wash with eIF2 LSB and
elute with a 60 ml linear gradient from 0 to 100% eIF2 HSB (0.1 to 1 M KCl).
Analyze the fractions by SDS-PAGE using 12% polyacrylamide. The a, b, and
g subunits of eIF2 have molecular masses of 34.7, 31.6, and 57.9 kDa,
respectively. eIF2 is usually the largest peak in the middle. On the example
trace, eIF2 eluted in fractions 63 to 77 (Fig. 6.4).
Reconstitution of Yeast Translation Initiation 121

Fractions
28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88 91 94 97 100 104 106 107 108
100.0% Buffer B
0.90 450.0
90.0
0.80 % low salt buffer 400.0
80.0
0.70 350.0
70.0 eIF2 peak
0.60 (Fractions 63−77) 300.0
60.0

0.50 250.0
50.0

0.40 200.0
40.0

0.30 Conductance 150.0


30.0

0.20 20.0 100.0

0.10 10.0 50.0

0.0
AU 00:25:00 00:30:00 00:35:00 00:40:00 mS/cm
Hr : min : s

Figure 6.4 FPLC absorbance trace of eIF2 elution from heparin column. eIF2 elutes as
the middle of three peaks from a HiTrap Heparin column, beginning at 0.5 M KCl.

Pool the appropriate fractions and dilute the sample to 100 mM KCl
with 20 mM Hepes (pH 7.6), and 2 mM DTT. Load the sample onto an
equilibrated HiTrap Q HP column (Amersham). Wash and elute the
column as for the earlier heparin step, and analyze the fractions by SDS-
PAGE (Fig. 6.5). Pool the appropriate fractions and dialyze twice against
2 liters of eIF2 storage buffer. Concentrate if necessary, flash-freeze in liquid
N2, and store at 80 .
Notes:
1. eIF5 (45.3 kDa) binds to eIF2 and is a common contaminant in eIF2
purification. It is important to remove as much eIF5 as possible when
selecting fractions from each column. Err on the side of lower eIF2 yield
and higher purity.
2. A second dialysis step is used to eliminate as much GDP as possible. eIF2
binds GDP with a 20-fold higher affinity than GTP (Table 6.1; Kapp and
Lorsch, 2004a), and excess GDP will interfere with ternary complex
formation. We do not recommend the use of EDTA to sequester Mg2þ
and eliminate GDP, as eIF2 contains two zinc finger domains and EDTA
could sequester the Zn2þ, disrupting the protein’s structure. Impor-
tantly, addition of Zn2þ to experiments measuring both ternary complex
formation and binding to 40S ribosomes showed no effect on either step,
suggesting the zinc-finger domains in our eIF2 are intact.
3. When analyzing eIF2 by SDS-PAGE, continue to run the gel once the
dye front has migrated out of the gel. Because the a and b subunits are
similar in size, they are difficult to separate during electrophoresis.
122 Michael G. Acker et al.

eIF1A- Nickel
eIF1A- Intein

eIF1 eIF2 eIF3 eIF5 eIF5B

204 kDa
Tif32p
80 kDa 113 kDa 123 kDa
g Nip1p 93 kDa 50 kDa
Prt1p 80 kDa
49 kDa eIF5 50 kDa
28.8 kDa a 35.5 kDa
b
20.7 kDa 35 kDa Tif34p 40 kDa
Tif35p 35.5 kDa

Figure 6.5 SDS-PAGE of purified yeast initiation factors. eIFs 1,1A, 2, 3, 5, and 5B were
purified as described, and analyzed by SDS-PAGE. Proteins were visualized with
Coomassie blue stain. Individual subunits are identified for multisubunit factors (eIFs
2 and 3).The positions of relevant molecular weight markers are included forcomparison.

4. The activity of eIF2 can be determined by measuring the factor’s ability


to bind GDP (Kapp and Lorsch, 2004a). In general we find our purified
eIF2 to be 50% active, with most preps approaching 90% activity or
better using GDP binding as a benchmark.

6. Purification of His-Tagged eIF3


from S. cerevisiae
From a glycerol stock, streak a sample of eIF3 yeast cells (LPY201
[Phan et al., 1998]) on a YPD plate and grow at 30 for 2 days. Inoculate
twelve 1.5 liter cultures of YPD media in 2800 ml baffled flasks with 1.5 ml
of a 50 ml overnight starter culture per flask and grow overnight (16 h) at
30 with shaking at 250 rpm. Place cultures on ice and store at 4 for 1 h.
Spin down and blend lyse cells as described, adding 200 ml zinc column
loading buffer (ZCLB) to the powdered lysate. Clarify the lysate by centri-
fugation in a Sorvall SS-34 rotor at 13,000 rpm for 30 min at 4 . During this
spin set up a HiTrap chelating column (Amersham) freshly regenerated with
100 mM ZnSO4 and equilibrate on an FPLC.
Pool the supernatant and filter first through 5 mm then 0.8 mm filters. Load the
lysate onto the zinc column at a flow rate of 3 ml/min. Wash the columns with
ZCLB and elute with ZCEB at 5 ml/min. Analyze the fractions by SDS-PAGE
using 10% polyacrylamide. Pool the appropriate fractions and concentrate to
5 ml using an Amicon Ultra (Millipore) concentrator (10-K MWCO) if
necessary. Apply the sample to an 120 ml Superose 12 gel filtration column
Reconstitution of Yeast Translation Initiation 123

Table 6.1 Summarizes the apparent equilibrium dissociation constant (Kd) values for
interactions between components of the yeast translation initiation apparatus

Complex Kd(nM)
eIF2 þ GDPa
20  5
eIF2 þ GTP 1700  1000

eIF2 tRNAi þ GTP 3800  800

eIF2 Met-tRNAi þ GTP 200  15
eIF2 þ Met-tRNAi 115  17

eIF2 GTP þ Met-tRNAi 10  2

eIF2 GDP þ Met-tRNAi 180  20

eIF2 GTP þ unacylated tRNAi 130  15

eIF2 GDP þ unacylated tRNAi 140  15
eIF5 þ eIF2 GDP  23  9

eIF5 þ eIF2 GTP Met-tRNAi  23  5

eIF5 þ 43S mRNA(AUG) 1
 
eIF1 1A 40S þ TCb 54  15
  
eIF1 1A 40S mRNA(AUG) þ TC 1
  
eIF1 1A 40S TC þ mRNA(AUG) 2
 
eIF1 eIF1A 40S þ mRNA(AUG) 2200  900
eIF1 þ 40S 16  2
eIF1 þ eIF1A 40S  1.7  0.2

eIF1 þ eIF1A 40S mRNA(AUG)  6.8  0.3
eIF1 þ eIF1A 40S TC   1.4  0.7
 
eIF1 þ eIF1A 40S mRNA(AUG) TC  53  6
eIF1A þ 40S 49  6
eIF1A þ eIF1 40S  6.1  0.8
 
eIF1A þ eIF1 40S mRNA(AUG) TC  1
a
‘þ’signifies the affinity between interacting molecules or complexes.
b
TC: ternary complex (eIF2  GTP  Met-tRNAi).

equilibrated in enzyme storage buffer and elute with enzyme storage buffer.
Analyze the fractions by SDS-PAGE as earlier (Fig. 6.5). Pool the appropriate
fractions and determine the protein concentration (the molecular mass of eIF3 is
361.3 kDa). Concentrate if necessary, flash-freeze in liquid N2, and store at 80 .
Notes:
1. eIF3 is part of the multifactor complex (MFC) including eIF1, eIF2, and
eIF5. eIF5 often copurifies with and contaminates eIF3 (Phan et al.,
1998). eIF5 contamination is very difficult to remove from the eIF3
prep and even small amounts will affect eIF2 GTPase assays because
eIF5 is such a strong GAP.
2. Although addition of eIF3 results in only modest effects on ternary
complex binding to 40S subunits in our system, these effects are
124 Michael G. Acker et al.

consistent with those observed in vivo (Jivotovskaya et al., 2006; Valasek


et al., 2004). The purified eIF3 is active based on its ability to bind 40S
ribosomal subunits, producing a supershift in a 43S native gel assay; its
binding to eIF1 and eIF5; and its ability to rescue prt1-1 mutant yeast
translation extracts (Algire et al., 2002).

7. Overexpression and Purification of Yeast


eIF1, eIF1A, and eIF5 from E. coli
The following protocol for purification and labeling of the single
polypeptide initiation factors eIF1, eIF1A, and eIF5 makes use of the
IMPACT system from New England Biolabs. The genes for each initiation
factor were cloned into the expression vector pTYB2, which results in
expression of a fusion protein composed of the desired eIF, a fragment of the
yeast self-cleavable intein, and a chitin-binding domain protein. The chitin-
binding domain is a high affinity tag that allows for stringent on-column
washing of the fusion protein. The intein fragment, with the help of DTT,
catalyzes on-column cleavage of the fusion protein at the point of eIF
fusion, releasing the initiation factor from the column.
Freshly transform the plasmid pTYB2 (NEB) containing the desired gene
into competent BL21 (DE3) CodonPlus cells (Stratagene) and grow overnight
at 37 on LB plates supplemented with 50 mg/ml carbenicillin. Inoculate 1.5
liter of LB supplemented with 50 mg/ml carbenicillin and 34 mg/ml chloram-
phenicol to a starting OD600 of 0.015 with a 5 ml overnight culture and grow
to an OD600 of 0.6. Induce protein expression by adding IPTG to 0.3 mM,
transfer the culture to 16 , and grow overnight with shaking at 250 rpm.
Pellet the cells and resuspend in 30 ml of intein lysis buffer. Lyse the cells
using a French pressure cell, passing the sample at least twice to ensure a
thorough lysis. Clarify the lysate by centrifugation in a Sorvall SS-34 rotor
for 30 min at 13,000 rpm at 4 . Equilibrate 1 ml of chitin resin (NEB) with
20 ml intein lysis buffer by gravity flow. Apply the clarified lysate directly to
the resin and incubate at 4 with gentle shaking for 1 h. Drain the lysate by
gravity flow and wash the resin with 60 ml intein wash buffer. Raise the pH
and lower the salt concentration by washing the column with 20 ml of
intein cleavage buffer (without DTT) and drain the column.
For unlabeled protein purification: Add DTT to a final concentration of
75 mM to the remaining intein cleavage buffer and add 3 ml to the column,
allowing the buffer to flow through until about 2 ml remain above the
surface of the resin. Stop the buffer flow, mix the buffer and beads to evenly
distribute the DTT, and seal both ends with parafilm to prevent leaks.
Incubate overnight at room temperature for optimal cleavage.
Reconstitution of Yeast Translation Initiation 125

For fluorescently labeled protein purification (Maag and Lorsch, 2003;


Muir et al., 1998; Scheibner et al., 2003): (These steps should be carried out
in low light to avoid photobleaching during the labeling procedure.) To the
remaining intein cleavage buffer, add sodium 2 mercaptoethanesulfonate
(MESNA) to a final concentration of 200 mM. Add 0.5 ml intein cleavage
buffer with MESNA to the column and allow the column to drain. Cap the
column bottom to stop the buffer flow and add 0.5 ml of 1 mM Cys-Lys-
fluorophore in intein cleavage buffer with 200 mM MESNA to the resin
and allow to enter the column. Bring the liquid level of the column just
above the resin surface by adding intein cleavage buffer with MESNA
(0.5 ml) and mix the buffer and resin by pipetting. Seal both ends of the
column with parafilm to prevent leaks. Incubate overnight at room tem-
perature for optimal cleavage/labeling. To avoid photobleaching, shield the
column from all light by storing it in a dark cabinet or box or wrapping it in
aluminum foil.
Uncap the column and collect the flow-through containing the cleaved
protein. Rinse the column with 2 ml aliquots of cleavage buffer, collect-
ing the flow-through each time until a 10 ml sample of the flow-through
shows no significant protein in a Bradford assay.
For eIF1, eIF1A, and eIF5: Pool the appropriate fractions and dilute the
sample to 100 mM KCl with 20 mM Hepes  KOH (pH 7.6), 10%
glycerol and 2 mM DTT. Load the sample onto an equilibrated HiTrap
Heparin column (Amersham). Elute with a 60 ml linear gradient from
0 to 100% HSB (0.1 to 1 M KCl). Analyze the eluted fractions by SDS-
PAGE using 15% (for eIF1) or 12% (for eIF1A, eIF5) polyacrylamide
(Fig. 6.5). eIF1 elutes at 0.6 M KCl, eIF1A at 0.35 M KCl, and eIF5 at
0.45 M KCl.
For eIF5 only: As an additional purification step, load the sample on a HiTrap
Q HP column (Amersham), using the same buffers and gradient conditions
as for the heparin column. Analyze the eluted fractions by SDS-PAGE using
12% polyacrylamide (Fig. 6.5). eIF5 elutes at 0.45 M KCl.
Pool the appropriate fractions and dialyze overnight against 2 liters of enzyme
storage buffer. Determine the protein concentration (molecular masses:
eIF1, 12,312 Da; eIF1A, 17,435 Da; eIF5, 45,261 Da). Concentrate if
necessary, flash-freeze in liquid N2, and store at 80 .

8. Overexpression and Purification of Yeast


eIF1A in E. coli
Proteins expressed from pTYB2 and purified using the IMPACT
system have an extra glycine residue on their C-termini. Likewise, fluores-
cent labeling of the target protein results in the addition of at least a
126 Michael G. Acker et al.

dipeptide (Cys-Lys) coupled to a fluorophore. These additions can be


detrimental if the C-terminus of a protein is important for its function.
For example, the C-terminus of eIF5B interacts with the extreme
C-terminus of eIF1A (Choi et al., 2000; Marintchev et al., 2003; Olsen
et al., 2003), influencing the subunit joining activity of eIF5B (Acker et al.,
2006). For these factors, a purification scheme resulting in a native
C-terminus is required. The following purification scheme results in
eIF1A containing a wild-type C-terminus and an additional N-terminal
Gly-His dipeptide.
Freshly transform the plasmid pMGA-HisTEV1A (containing TIF11
[eIF1A] downstream of and in frame with a sequence encoding a His6 tag
and TEV protease recognition site) into competent BL21 (DE3) CodonPlus
cells and grow overnight at 37 on LB plates supplemented with 30 mg/ml
kanamycin. Inoculate 1.5 liters of LB supplemented with 30 mg/ml kana-
mycin and 34 mg/ml chloramphenicol to a starting OD600 of 0.015 with a
5 ml overnight culture and grow to an OD600 of 0.6. Induce protein
expression by adding IPTG to 1 mM, and grow for 4 h more at 37 with
shaking at 250 rpm.
Substituting eIF1A NCLB-20 (supplemented with one complete
EDTA-free protease inhibitor cocktail tablet [Roche]) for intein lysis buffer,
pellet and lyse the cells, and clarify the lysate as for an intein preparation. Set
up a 5 ml HiTrap Chelating column (Amersham) freshly regenerated with
100 mM NiSO4 on an FPLC.
Filter the lysate first through 5 mm then 0.8 mm filters and load it onto the
equilibrated nickel column at a flow rate of 3 ml/min. Wash the column with
eIF1A NCLB-20 and elute with eIF1A NCEB-250 at 5 ml/min. Pool the
desired fractions and dilute to 100 mM KCl (approximately five-fold) with 20
mM Hepes  KOH (pH 7.6), and 10 mM 2 mercaptoethanol. Equilibrate a
HiTrap Heparin column with LSB. Load the diluted sample onto the equili-
brated heparin column. Wash with LSB and elute with a 60 ml linear gradient
from 0 to 100% HSB (0.1 to 1 M KCl). Analyze the fractions by SDS-PAGE
using 12% polyacrylamide. eIF1A elutes as two partially overlapping peaks
beginning at 0.35 M KCl. (Control experiments show that eIF1A samples
from each peak behave identically in our assays and run indistinguishably on
SDS-PAGE.) Pool the desired fractions and measure the concentration of
eIF1A. Add 50 mg His-tagged TEV protease per mg of target protein and
incubate overnight at room temperature with gentle agitation. The TEV
protease can be added directly to the pooled fractions.
The following morning, add solid imidazole to the TEV-treated sample
to 20 mM. The addition of imidazole prevents nonspecific binding of
protein to the column and allows the desired protein to elute entirely in
the flow-through. Completely dissolve the solid imidazole and filter the
sample through a 0.45 mm syringe filter. Reequilibrate the nickel-chelated
HiTrap column and load the sample at 3 ml/min, being careful to collect
Reconstitution of Yeast Translation Initiation 127

the flow-through, as it contains the TEV-cleaved eIF1A lacking the His-tag.


Wash the column with eIF1A NCLB-20 and elute with eIF1A NCEB-250.
Analyze the fractions by SDS-PAGE using 12% polyacrylamide (Fig. 5). Be
sure to run multiple samples of the flow-through, as well as a sample of the
peak eluted with high imidazole to verify the separation of uncleaved eIF1A
and His-tagged TEV protease from the cleaved eIF1A. Pool the appropriate
fractions and dialyze overnight against 2 liters of enzyme storage buffer.
Determine the protein concentration. Concentrate if necessary, flash-freeze
in liquid N2, and store at 80 .

9. Overexpression and Purification of Yeast


eIF5B in E. coli
As mentioned previously, the C-terminus of eIF5B plays a significant
role in translation initiation. Full-length eIF5B has proven difficult to clone
and overexpress, and N-terminally truncated eIF5B behaves as wild-type
eIF5B in vivo. Based on these data, we make use of an N-terminal truncation
of eIF5B, replacing the first 396 amino acids with a His6 tag followed by a
TEV protease recognition sequence.
Transform the plasmid pMGA-HisTEV5B (containing fun12 [DN396-
eIF5B] downstream of and in frame with a sequence encoding a His6 tag
and TEV protease recognition site) into competent BL21 (DE3) CodonPlus
cells and grow overnight at 37 on LB plates supplemented with 30 mg/ml
kanamycin. Inoculate 1.5 liters of LB supplemented with 30 mg/ml kana-
mycin and 34 mg/ml chloramphenicol to a starting OD600 of 0.015 with a
5 ml overnight culture and grow to an OD600 of 0.6. Induce protein
expression by adding IPTG to 1 mM, and grow for 4 h more at 37 with
shaking at 250 rpm.
Pellet the cells and resuspend in 70 ml Buffer B-20 (Guillon et al., 2005)
supplemented with two complete EDTA-free protease inhibitor cocktail
tablets (Roche). Divide the suspension into two 35 ml samples and lyse the
cells using a French pressure cell, passing each sample at least twice to ensure
a thorough lysis. Clarify the lysate by centrifugation in a Sorvall SS-34 rotor
at 13,000 rpm for 30 min at 4 . Set up a 5 ml HiTrap Chelating column
(Amersham) freshly regenerated with 100 mM NiSO4 on an FPLC.
Filter the lysate first through 5 mm then 0.8-mm filters and load it onto
the equilibrated nickel column at a flow rate of 3 ml/min. Wash the column
with Buffer B-20 and elute with Buffer B-250 at 5 ml/min. Pool the eluted
fractions and dilute to 100 mM KCl (approximately five-fold) with Buffer
A. Load the diluted sample onto an equilibrated HiTrap Q HP column.
Wash with 100 mM NaCl Buffer A and elute with an 80 ml linear gradient
from 100 mM to 500 mM NaCl in Buffer A. Analyze the eluted fractions
128 Michael G. Acker et al.

by SDS-PAGE using 12% polyacrylamide. eIF5B elutes as one peak at


0.2 M NaCl. Pool the desired fractions and estimate the concentration
of eIF5B as for eIF1A. Add 15 mg His-tagged TEV protease per mg of target
protein and incubate overnight at room temperature with gentle agitation.
The TEV protease can be added directly to the pooled fractions.
Prepare the protease reaction for chromatography as in the eIF1A prepa-
ration. Separate the cleaved eIF5B peptide from the uncleaved protein and
His-tagged TEV protease using a nickel column as earlier, replacing eIF1A
NCLB-20 with Buffer B-20 and eIF1A NCEB-250 with Buffer B-250.
Analyze the eluted fractions by SDS-PAGE as for eIF1A. Pool the appropri-
ate fractions and concentrate to 5 ml with an Amicon Ultra (Millipore)
concentrator (10,000 MWCO). Apply the sample to an 120 ml Superose
12 gel filtration column equilibrated in enzyme storage buffer and elute with
120 ml of enzyme storage buffer. Analyze the eluted fractions by SDS-PAGE
(Fig. 6.5). Pool the appropriate fractions and measure the protein concentra-
tion (DN396-eIF5B molecular mass is 67.6 kDa). Concentrate if necessary,
flash-freeze in liquid N2, and store at 80 .

10. Purification of Yeast Methionyl-tRNA


Synthetase (YMETRS) from S. cerevisiae
A GST-yMetRS fusion protein is constitutively expressed in S. cerevi-
siae from a plasmid containing a TRP selectable marker (gift of Franco
Fasiolo) (Kapp et al., 2006). From a glycerol stock, streak out cells on a
SC-Trp plate and grow at 30 for 2 days. Inoculate 18 liters of SC-Trp media
in twelve 2800 ml baffled flasks with 37.5 ml per flask from a 500 ml
overnight culture and grow to OD600  1.5 at 30 with shaking at 250 rpm.
Spin down and blend lyse cells, adding 220 ml PBS buffer with the
standard protease inhibitors to the powdered lysate. Clarify the lysate by
centrifugation in a Sorvall SS-34 rotor at 13,000 rpm for 30 min at 4 .
Filter the supernatant through 5 mm then 0.8 mm filters. Pass the lysate over
a 5 ml GSTrap column (Amersham) equilibrated in PBS buffer at a rate of
3 ml/min. Wash the column with PBS buffer and elute with 10 mM
reduced glutathione in 50 mM Tris (pH 8.0). Analyze the fractions by
SDS-PAGE using 10% polyacrylamide and pool the appropriate fractions
(GST-yMetRS migrates at 110 kDa). Dialyze the purified GST-yMetRS
overnight against 2 liters of yMetRS storage buffer. Concentrate the
protein to a vol of 2 ml using an Amicon Ultra (Millipore) concentrator
(10-K MWCO) and aliquot to minimize freeze-thawing. Flash-freeze in
liquid N2 and store at 80 . To assay the activity of the synthetase, set up
small-scale (30 ml) limiting methionine tRNA charging reactions diluting
the GST-yMetRS to final concentrations of 1:10, 1:20, 1:50, and 1:100
(see Charging tRNAiMet with Methionine).
Reconstitution of Yeast Translation Initiation 129

Notes:
1. Additional purification is not necessary, but can be performed by apply-
ing the protein to a HiTrap Q HP ion-exchange column and following
the protocol for eIF5 purification.
2. Synthetase activity is not significantly altered by the GST tag.

11. RNA Synthesis and Purification


T7 polymerase run-off transcription is used to synthesize most RNAs.
mRNA or tRNA can be transcribed using either a single-stranded, syn-
thetic DNA oligonucleotide or linearized plasmid template. If a synthetic
DNA template is used, it must include a double-stranded T7 polymerase
binding site. This is created using a ‘‘clamp’’ oligonucleotide complemen-
tary to the T7 site on the template. For the poly(UC) 43mer with an AUG
codon in the center (mRNA(AUG)) the template sequence is:
50 GAGAGAGAGAGAGAGAGAGAGCATAGAGAGAGAGAGAG-
ATTCCTATAGTGAGTCGTATTACATATGCGTGTTACC30 .
The T7 polymerase promoter region (plus the first two encoded bases) is
shown in bold and the clamp oligo sequence is complementary to this
region. Plasmid templates must also include a T7 polymerase binding site
but do not require use of a clamp because they are already double-stranded.
We use the high copy pUC19 plasmid. Plasmids are linearized using a
restriction site at the end of the template region so that the polymerase
will run off the end of the DNA. Purification of the synthetic template by
denaturing PAGE (as for RNA purification below) often improves results.
Transcription Reaction
1 Transcription Buffer
5 mM DTT
2.5 mM (each) NTP
1 mM clamp oligo if necessary
1 mM oligo template or 0.08 to 0.3 mg/ml plasmid template
T7 Polymerase
We purify the polymerase ourselves and change the concentration in the
reaction to compensate for variations in the activity of our preparations.
Incubate the reaction at 37 for at least 3 h and as long as overnight. If the
reaction is working well a white precipitate should form (Mg2þ  PPi).
When the reaction is complete, centrifuge the tube for several min in a
tabletop, swinging bucket centrifuge at 6000 rpm, and remove the super-
natant from the white solid. Extract the supernatant twice with neutral
buffered phenol and once with chloroform. Bring the solution to 0.3 M
sodium acetate (pH 5.0), and ethanol precipitate the RNA. Rinse the pellets
130 Michael G. Acker et al.

with 70% ethanol and allow them to dry overnight. Resuspend in ddH2O,
using as little as is necessary. If it is difficult to resuspend, add a small amount
of 100 mM EDTA (100 ml or less per ml). Aim to resuspend the pellet in a
volume 15% of the original reaction.

11.1. Gel purification of transcription products


To remove any truncated products, gel purify the RNA. One large gel
(20  30  0.15 cm) can generally be used to purify the RNA from a 10 ml
transcription reaction. Prepare and pour an 8 M urea, 12% 19:1 acrylamide:
bisacrylamide RNA purification gel with 1 TBE. For transcriptions over
5 ml, insert the comb upside down, so that the teeth are pointing out of the
gel. This will create one large well and not waste any space.
Add 2 RNA loading dye (90% formamide, 0.02% bromophenol blue)
to the sample. Load the sample onto the gel and run at 25 W until the dye
band has run 0.75 of the way down the gel; this will take several h because
of the high salt concentration in the sample. Monitor the voltage while the
gel is running and be sure that the gel does not get too hot to touch. If
overheating is a problem, the gel can be run in a cold room.
Disassemble the plates and wrap the gel in plastic wrap. Lay the gel over a
TLC plate with fluorescent indicator wrapped in plastic wrap and shadow
the RNA using a handheld, shortwave UV lamp. Remember to wear UV-
absorbing glasses. The desired product is usually the major band. It is not
uncommon to see a ladder of aborted products below the major product as
well as n þ 1 and n þ 2 bands above it. The DNA template can sometimes
be seen near the top of the gel. Outline the proper band with a marker on
the plastic wrap. Remove the TLC plate from under the gel before excising
the band with a razor. Place the gel in a 50 ml conical tube and use a 1 ml
serological pipette or a glass rod to crush the gel. Cover the gel with a
generous amount of 0.3 M sodium acetate (pH 5.0). For a band that crosses
an entire gel, 40 ml is usually sufficient. Parafilm the cap and rotate the tube
at room temperature overnight to extract the RNA.
Remove as much liquid as possible from the gel using 0.45 mm syringe
filters, taking care not to push hard enough to eject or break the filter (eye
protection is recommended). Ethanol precipitate the solution and resuspend
the dry pellets in ddH2O. If the solution appears cloudy, extract with neutral
buffered phenol and then chloroform to remove the insoluble material and
reethanol precipitate the RNA using 0.3 M sodium acetate (pH 5.0). For a
50 ml transcription of a 43 mer approximately 200 ml of 500 mM RNA
should be obtained.

11.2. Yeast initiator tRNA


The hammerhead yeast initiator tRNA construct consists of a T7 promoter
followed by the hammerhead ribozyme and initiator tRNA sequences, cloned
between the SmaI and BamHI sites in the pUC19 plasmid. A BstNI site
introduced at the 30 end of the tRNA allows digestion to yield a CCA end.
Reconstitution of Yeast Translation Initiation 131

50 TGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGG
GGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGG
TTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATT
CGAGCTCGGTACCCCCAATTAAGCTTCCTGGTAGCGCCG
CTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCC
TGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGG
TACCGTTTCGTCCTCACGGACTCATCAGAGCGCCTATAGTG
AGTCGTATTAAGGGGGATCCTCTAGAGTCGACCTGCAGGC
ATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTG
TGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCC
GGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAG
CTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCC
AGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGC
CAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTT30
(The orientation is reversed. Underlined: T7 promoter; Italic: hammer-
head ribozyme; Bold: tRNA)
This construct permits transcription beginning at a G rather than the A at
which the tRNA itself begins, resulting in approximately five-fold better
transcription. The hammerhead ribozyme will cleave itself from the tRNA
after transcription, leaving the native tRNA (Fechter et al., 1998).
Before transcription, digest the plasmid template with BstN1 for 2 h at 60 .
Extract the digest twice with neutral buffered phenol and once with chloro-
form, and ethanol precipitate using 0.3 M sodium acetate (pH 5.0). Resuspend
in ddH2O. Assemble the transcription reaction as described previously with a
final concentration of at least 0.08 mg/ml of digested DNA. After transcribing
the RNA, incubate for 1 h at 65 to allow the hammerhead ribozyme to
cleave itself from the tRNA. Extract twice with neutral buffered phenol and
once with chloroform, and ethanol precipitate using 0.3 M sodium acetate
(pH 5.0). Gel purify the transcript as described. Two major bands will
normally be observed; the upper band is the tRNA and the lower band the
hammerhead ribozyme. Extract the RNA from the gel as described.

12. Charging tRNAiMet with Methionine


Translation initiation requires methionyl-tRNAiMet, which must be
synthesized in vitro from purified tRNAiMet and methionine by the yeast
methionyl-tRNA synthetase. Two such ‘‘charging’’ reactions can be per-
formed, providing two different varieties of methionyl-tRNAiMet for use
in different assays. The limiting charging reaction produces radiolabeled
[35S]methionyl-tRNAiMet for use in 43S/80S gel shift assays. The stoichio-
metric charging reaction produces unlabeled methionyl-tRNAiMet for use
in many different assays. Limiting reactions are carried out on a small scale
because of the short half-life of 35S and the relatively small amounts required
for gel shift assays. In contrast, stoichiometric charging reactions can be
132 Michael G. Acker et al.

performed in bulk to yield the larger quantities of methionyl-tRNAiMet


required for fluorescence and GTP hydrolysis assays.

12.1. Limiting charging reaction


To help ensure that the tRNA is folded properly, before setting up the
charging reaction heat denature the tRNA at 95 for 5 min and allow
it to return to room temperature gradually over 20 to 30 min (or use a
thermocycler to decrease from 95 to 4 at 0.1 /s).
Final Concentrations in Charging Reaction
40 mM Tris  Cl (pH 7.6)
10 mM Mg(OAc)2
1 mM DTT
1 mM ATP  Mg2þ
0.3 mM 35S methionine
0.02 mg/ml glycogen
5% DMSO
5 mM tRNAiMet
yeast methionyl aminoacyl tRNA synthetase (yMetRS)
Glycogen makes the pellet after ethanol precipitation more visible.
DMSO mysteriously but reproducibly increases charging efficiency, but
can be left out if desired. We have observed that some component of
the commercially available 35S-methionine inhibits the reaction if the
methionine concentration is increased above 0.3 mM.
Set up a 100 ml reaction and, before adding the tRNA and enzyme to the
mix, remove enough to do a 20 ml ‘‘no-tRNA control’’ reaction. This
reaction will be identical in composition to the larger reaction except that
it will not contain tRNA; this control allows the measurement of back-
ground for the calculation of charging efficiency. Add tRNA to the larger
reaction (e.g., 4 ml to the remaining 80 ml); add ddH2O instead of tRNA to
the no-tRNA control (in this example, 1 ml). Add yMetRS to both reac-
tions (e.g., 4 ml to the reaction and 1 ml to the no-tRNA control) and
incubate at 30 for 30 min.
Remove 1 ml of the charging reaction and spot directly onto a Whatman
GF/C filter in a scintillation vial (‘‘input’’ filter). Spot 1 ml of the no-tRNA
control reaction onto another filter (no-tRNA control input filter). Each
input filter represents total 35S counts in the reaction from which its 1 ml
sample came.
Remove 5 ml of the charging reaction and add it to 50 ml of carrier RNA
(1 mg/ml bulk tRNA (Roche) and 0.81 M sodium acetate, pH 5). Add 1 ml
5% TCA/95% ethanol and incubate on ice. Do the same for 5 ml of the no
tRNA control reaction. Carrier RNA is used to minimize loss of the small
amount of tRNA in the 5 ml sample.
Reconstitution of Yeast Translation Initiation 133

While the 5 ml precipitations incubate on ice, extract the remainder of


the charging reaction once with neutral buffered phenol and once with
chloroform. Bring the solution to 0.3 M sodium acetate (pH 5.0), and
ethanol precipitate the 35S-Met-tRNAiMet at 20 for 1 h followed by
centrifugation. Resuspend the dry pellets in ddH2O to the desired volume,
determined by the following method.
Once the 5 ml precipitations have been on ice for at least 15 min (and up to
1 h), spot each full precipitation reaction onto its own Whatman GF/C filter on
a vacuum manifold, taking care to keep the drops near the center of the filter.
Wash each filter with 3 ml of cold 5% TCA (without ethanol), then 1 ml 100%
ethanol, being careful to wash the entire surface of the filter with each wash.
Throughout, be careful not to touch the filter with the pipette tip. Let the filter
dry for 1 min on the vacuum. Place each filter in its own scintillation vial,
using tweezers. Be careful to touch only the very outer edge of the filter. Add
scintillation fluid to each vial and use a scintillation counter to obtain 35S counts
for each of the input filters and filters from the 5 ml precipitations.
In this method 35S methionine–charged tRNAi is retained on the filter
and free 35S-methionine washes through; thus, 35S counts observed on the
filter should represent charged tRNA. Because the no-tRNA control by
definition could not contain any charged tRNA, any counts observed from
the no-tRNA control represent a background level that should be sub-
tracted from what is observed in the sample from the charging reaction.
Determine the charging efficiency by calculating (counts/[5 * input
counts]) for the charging reaction. After correcting for the no-tRNA
control reaction the resulting number is the fraction of methionine
incorporated. We generally expect 20 to 50% methionine incorporated
from a limiting charging. Multiply this fraction by the number of mol of
methionine in the reaction to obtain the mol of methionine incorporated,
and divide this number by the number of mol of tRNA in the reaction to
obtain the fraction of tRNA charged. We resuspend the pellets to a final
concentration of 60 nM charged tRNA.
Store charged tRNA at 80 in approximately single-use aliquots.
Freeze-thawing charged tRNA repeatedly leads to loss of activity. Charged
tRNA will keep for months in the freezer; its useful lifespan in the absence
of thawing and refreezing seems limited simply by the decay of the 35S.

12.2. Stoichiometric charging reaction


The procedure for stoichiometric charging is similar to that for the limiting
charge. One difference is that to calculate the level of charging, a test
reaction is spiked with 35S-methionine, and an equivalent amount of cold
methionine is added to the actual reaction to keep concentrations consis-
tent between the test and actual reactions. The concentrations used in a
stoichiometric charging are the following:
134 Michael G. Acker et al.

Final Concentrations in Charging Reaction


40 mM Tris  Cl (pH 7.6)
10 mM Mg(OAc)2
1 mM DTT
2 mM ATP  Mgþþ
300 mM methionine
5 mM tRNAiMet
yMetRS (same dilution as used for limiting charge)
The typical reaction size for a stoichiometric charging is 5 ml.
Before adding the tRNA and enzyme, remove enough mix to assemble a
30 ml no-tRNA control reaction (30 ml is a convenient size to spike with 1 ml
of 35S methionine). Add tRNA to the larger mix (and add ddH2O to the no-
tRNA control) and then remove enough mix to assemble a 30 ml ‘‘hot test’’
reaction. Add 1 ml of 35S methionine to both the no-tRNA control reaction
and the hot test reaction. Add an equivalent (1:30) volume fraction of cold
8.7 mM methionine to the larger charging reaction. Add yMetRS and
incubate at 30 for 30 min.
Determine charging efficiency as described for the limiting charging.
We generally expect between 20–30% tRNA charged from a stoichiomet-
ric charging reaction, and resuspend the pellets to 20 mM final charged
tRNA. Repeated attempts to get 100% charging have failed, although
control experiments have indicated that the uncharged tRNA does not
interfere with observable steps in initiation in vitro.

13. Filter Binding Assay to Monitor Ternary


Complex Formation
Final Concentrations in Binding Assay
25 mM Hepes  KOH (pH 7.6)
2.5 mM Mg(OAc)2
80 mM KOAc (pH 7.6)
2 mM DTT
0.5 mM GDPNP  Mg2þ
1 eIF2 dilution
1 nM Met-tRNAiMet charged with 35S methionine ([35S]Met-tRNAiMet)
Make 5 dilutions of eIF2 in eIF2 storage buffer with 0.6 mg/ml creatine
kinase. The addition of creatine kinase helps to prevent eIF2 from sticking
to the tube walls, a concern at low concentrations. Final concentrations
from 5 to 200 nM eIF2 constitute a good range with wild-type [35S]Met-
tRNAiMet and eIF2. Assemble the binding assay mix excluding the [35S]
Met-tRNAiMet and the eIF2. Aliquot the mix into individual tubes, add
eIF2 dilutions, and incubate 10 min at 26 . Add [35S]Met-tRNAiMet, and
Reconstitution of Yeast Translation Initiation 135

incubate 10 min at 26 . Longer incubation times may be necessary accord-


ing to the specifics of the experiment (e.g., if using a mutant [35S]Met-
tRNAiMet with a kinetic defect in binding to eIF2).
On a vacuum manifold, position a Nytran Supercharge (Whatman) mem-
brane with a nitrocellulose membrane on top. Both filters should be soaked for
1 h in filter binding wash buffer before use. The Supercharge membrane
(bottom) retains nucleic acids, whereas the nitrocellulose membrane (top)
retains protein, so that [35S]Met-tRNAiMet bound to eIF2 will be retained
on the nitrocellulose filter and free [35S]Met-tRNAiMet will pass through the
nitrocellulose filter and be retained by the Supercharge membrane.
Turn on the vacuum just before applying the reaction to the filters, so
the filters do not dry out. Filter 20 ml of the reaction, applying it to the
center of the filter, and immediately wash the entire surface of the filter with
5 ml ice-cold filter binding wash buffer. Allow the filters to dry on the
vacuum for a min or so.
Place each filter carefully in a separate vial, making sure to keep them
pointing up (i.e., the same way in which they were filtered). Add scintilla-
tion fluid to the vials and use a scintillation counter to measure the amount
of 35S-methionine on each filter. Determine the fraction of [35S]Met-
tRNAiMet bound to eIF2 by taking the counts on the top (nitrocellulose)
filter and dividing by the sum of the counts on the top and bottom filters
(as this sum should represent the total amount of [35S]Met-tRNAiMet; free
[35S]Met will pass through both filters).

14. Benchtop eIF2 GTPase Assay


Measuring the GTP hydrolysis activity of eIF2 in the presence and
absence of eIF5 is the best way to determine the extent of eIF5 contamina-
tion in purified eIF2. These reactions are carried out on the benchtop and
require significantly smaller amounts of reagents, but allow much lower
kinetic detail (minimum timepoints of 2 s) than rapid quench techniques. In
this experimental set-up, a structural reorganization of the pre-initiation
complex is rate limiting for GTP hydrolysis (Algire et al., 2005). GTPase
activity is monitored by the conversion of GTPg[32P] into GDP and 32Pi,
which are separated on a 15% polyacrylamide gel.

14.1. Gel preparation


Prepare and pour a 15% 29:1 acrylamide:bisacrylamide gel in 1 TBE (no
urea) using the same plates and spacers as for the RNA identity gel. Because
the signal is strong, a small loading volume is sufficient, and a 20-well comb
is recommended.
136 Michael G. Acker et al.

14.2. Experimental setup


Aliquot 6 ml of quench/dye solution (90% formamide, 0.02% bromophenol
blue, 100 mM EDTA) into a quench tube for each reaction, plus one tube for
an initial background measurement. Incubate 2 ternary complex (1
reconstitution buffer [recon buffer], 1.6 mM eIF2, 1.6 mM methionyl-
tRNAiMet, and 125 pM GTPg[32P]) at 26 for 15 min. Form 2 ribosomal
complex by combining 400 nM 40S subunits, 1.6 mM each eIF1 and eIF1A,
2 mM model mRNA, and 2 mM GDP  Mg2þ. The addition of excess GDP
in the 2 ribosomal complex prevents multiple turnovers of the reaction by
saturating eIF2 with GDP once a single round of GTP hydrolysis has
occurred. When interested in measuring the rate of GTP hydrolysis in the
presence of eIF5, include 1.6 mM eIF5 in the 2 ribosomal complex mix.
Just before beginning the experiment, add 1 ml 2 TC to 6 ml EDTA
quench/dye solution; this sample represents the background level of 32Pi
in the ternary complex. Assemble individual reactions to obtain the earliest
timepoints (2 to 15 s). To do this, aliquot 2 ml of 2 ribosomal complex and
initiate the reaction by adding 2 ml of 2 TC, mixing by pipetting. To stop
the reaction, pipette 2 ml of the reaction into the quench tube and mix
vigorously by pipetting. By mixing 2 ml of each 2 complex and quenching
2 ml total, it is possible to take relatively short timepoints without having to
change pipette tips. This can be repeated for each timepoint desired up to
15 s. If the timepoints are 20 s or more apart, it is possible to set up a single
reaction tube and quench aliquots over time. The quenched samples can be
analyzed immediately by gel electrophoresis, or frozen at 20 indefinitely
according to the activity of the [32P].

14.3. Separation of GTPg[32P] and 32Pi


Load 3 ml of each quenched sample onto the gel, using every other well.
Run the gel in 1 TBE for 35 min at 25 W. Load the remaining samples in
the unused wells and run for 20 min more. Place the gel between two layers
of plastic wrap, and fold the ends of the plastic wrap, sealing the gel. Expose
the wrapped gel to a phosphorimaging screen for 1 h. Scan the screen and
quantitate the spots corresponding to GTPg[32P] and 32Pi. GTPg[32P] will
be the higher of the two bands. Calculate the fraction of GTP hydrolyzed by
dividing the 32Pi value by the sum of the GTPg[32P] and 32Pi values, and
subtracting from this the fraction obtained from the background sample.
Note: 2 ternary complex is relatively stable, but care should be taken to
minimize the time between individual reactions for a given experiment. It
may be necessary to measure the rate of GTP hydrolysis by eIF2 in ternary
complex to verify that the background sample is valid throughout the
experiment.
Reconstitution of Yeast Translation Initiation 137

15. 43S/80S Complex Gel Shift Assay


Native gel electrophoresis can separate ternary, 43S (Fig. 6.6) and 80S
complexes (Fig. 6.7), and provides a way to monitor both the binding of
ternary complex to 40S subunits and the ribosomal subunit joining step of
initiation (Acker et al., 2006; Algire et al., 2005; Maag et al., 2005). We
describe these assays here because they are useful for characterizing the
activity of the components of the system.

15.1. Preparing an acrylamide gel for the 43S/80S gel


shift assay
A picture of the gel box used is shown in Fig. 6.8 (well behind gel—26.5 cm
wide, 19 cm tall, 2.5 cm deep; well in front of gel—31 cm wide, 5.5 cm tall,
6.5 cm deep). We use 18  30 cm plates (one notched) and 0.45 mm spacers.
Because the gel is both thin and soft (4% acrylamide:bisacrylamide, 37.5:1), it is
important that it stick well to one of the gel plates (we choose the unnotched
plate) and slide easily off the other. It is prone to tearing, stretching, or folding
otherwise, and once this happens the gel can rarely be saved. Several precau-
tions are recommended. Prepare the notched plate by siliconizing the surface
that will contact the gel (e.g., using Sigmacoat [Sigma]). Use a kimwipe
dampened with ethanol to clean a 2.5 cm strip along the top of the plate
where the wells will be. This will remove some of the coating and prevent the

(40S)

43S

*Met-tRNA

Figure 6.6 Native gel assay following 43S complex formation. Increasing amounts of
43S  mRNA complex (top band) are seen as the concentration of 40S subunits increases
(moving from left to right).The lower band is free [35S][Link] is generally
not stable on the native gels, dissociating rapidly into free Met-tRNAiMet.
138 Michael G. Acker et al.

1 2 3 4
eIF5B + + − −
GDPNP chase − + − +

80S
43S

*Met-tRNA

Figure 6.7 Native gel assay following 80S complex formation. 80S complexes were
formed in the presence or absence of eIF5B and GDPNP (denoted by þ or ) by combin-
ing 43S complexes (formed with GTP) with eIF5, 60S subunits, and the noted compo-
nents. The positions of 80S and 43S complexes and Met-tRNAMet i are noted. 80S
complex formation is enhanced in the presence of eIF5B (compare lanes 1 and 2).
GDPNP stabilizes 80S complexes formed in the presence of eIF5B (lane 2), but elimi-
nates 80S complexes in the absence of eIF5B, suggesting complexes formed in the
absence of eIF5B are not translationally competent. 43S complexes are also stabilized in
the presence of GDPNP. After one round of 43S complex formation, eIF2 can (slowly)
reenter the initiation pathway in a GDPNP-bound form, leading to dead-end 43S
complexes (see 43S band in lanes 2 and 4).

well dividers from falling into the lanes. It is important that the coating remain
on the notches themselves. To prepare the unnotched plate, scrub the surface
that will contact the gel with steel wool and soap. This will roughen the plate,
helping the gel to stick. Always treat the plates consistently, as once a plate has
been roughened it will be extremely difficult to make it slide off the gel.
Because it is difficult to insert the comb, do so before pouring the gel, pushing
it only about a quarter of the way in.
The native gel is made with and run in THEM buffer. Having tested
multiple buffer systems, we find that THEM yields the sharpest bands,
which is important for quantitation. Insert a coil of tubing (tygon tubing
can be made into a coil for this purpose), attached to a circulating water
bath, into the gel box behind the gel. This coil will cool the gel as it runs,
reducing the amount of gel ‘‘smiling’’ and minimizing the possibility of
degradation of the complexes while the gel is running (numerous controls
have shown the latter rarely to be a significant problem, however). Make
sure the coil does not actually touch the gel plates at any point and distribute
the coil as evenly throughout the box as possible. Fill both chambers with
1 THEM buffer and precool at 16 for 20 to 30 min before the gel will be
Reconstitution of Yeast Translation Initiation 139

Figure 6.8 Box for native gel [Link] native gel box was specially made byAladin
Enterprises, Inc. (San Francisco, CA). Dimensions: well behind gelç26.5 cm wide,
19 cm tall, 2.5 cm deep; well in front of gelç31 cm wide, 5.5 cm tall,6.5 cm deep.

loaded. Mark the location of the wells on the glass plate before removing the
comb. Adding buffer before removing the comb will help the lane dividers
remain in place. Use a syringe to gently rinse out each well, taking care not
to break or bend the lane dividers. If bubbles or bits of gel remain in any of
the wells, use a small piece of plastic (cutting a spacer off an old comb works
well) to help clear the well.

15.2. Preparing 43S gel shift reactions


Reactions are prepared in recon buffer. Although a given experiment may
require variations, our standard concentrations for testing components are
1 mM GDPNP  Mg2þ, 800 nM eIF2, 0.5 nM [35S]Met-tRNAiMet, 1 mM
eIF1 and eIF1A, 1 mM model mRNA(AUG), and 400 nM 40S ribosomal
subunits. Ternary complex is formed stepwise by first incubating
GDPNP  Mg2þ and eIF2 together for 10 min at 26 . [35S]Met-tRNAiMet
is then added and the solution is incubated for an additional 5 min. Once
preformed, TC can be added to 40S subunits and other factors to start the
reaction, which is then incubated at 26 as necessary. With an unstructured
model mRNA(AUG), 43S complex is fully formed after a few min of
incubation. In the absence of mRNA, longer incubation times are required.
140 Michael G. Acker et al.

15.3. Preparing 80S gel shift reactions


80S complexes can be formed following a protocol similar to that for 43S
complex formation (Acker et al., 2006). TC is formed with 200 mM
GTP  Mg2þ instead of GDPNP and added to 40S ribosomal subunits,
eIF1, eIF1A, and model mRNA to form 43S complexes. An initiation mix
composed of 60S ribosomal subunits, eIF5 and eIF5B is then added to the
43S complexes, initiating 80S complex formation. Typical final concentra-
tions of the initiation mix components are 400 nM 60S ribosomal subunits,
800 nM eIF5, and 500 nM eIF5B. Alternatively, GDPNP  Mg2þ can be
included with the initiation mix, resulting in a final concentration of 6 mM
GDPNP in the 80S gel shift reaction. The addition of GDPNP stabilizes
the 80S complexes because GDPNP-bound eIF5B has a greater affinity
for the 80S complex than posthydrolysis GDP-bound eIF5B (Fig. 6.7).

15.4. Running 43S/80S gels


For thermodynamic experiments, 10 ml of each reaction is mixed with 2 ml of
native gel dye (50% sucrose, 0.02% bromophenol blue, 0.02% xylene cyanol).
Samples are stable in the well for the amount of time it takes to load a 24-well
gel (approximately 15 min). Once all samples have been loaded, the gel is run
at 25 W for 30 min for 43S complexes. For 80S complexes, to sufficiently
separate the 43S and 80S bands, the gel should be run for a total of 1 h.
For experiments measuring 43S formation kinetics, reactions can be
stopped in two ways: either by loading the samples onto a running gel or
by chasing with excess, cold TC. Controls have indicated that the two
methods are equivalent for incubation times as short as 2 min. 80S complex
reactions can only be quenched by loading the samples onto a running gel.
When stopping the reaction by loading onto a gel running at 25 W, time-
points end only when the sample runs into the gel, not when they are mixed
with dye. With a skilled hand the sample can be taken from the original
reaction, mixed with dye, and loaded onto the gel in 20 s, allowing 3 points
a min to be completed. Remember that the gel is running while you are
loading and it is dangerous to put fingers in the buffer. Holding a tube in
your nondominant hand or keeping your other hand behind your back can
help to keep fingers away from the buffer. Accidental tests on rotation
students have found that in some cases placing gloved fingers in the buffer
does no actual damage to student or experiment, but erring on the side of
caution is strongly advised. Once all the points have been loaded the gel
should be run for an additional 30 min, but not more than 1 h total from the
loading of the first sample.
Stopping reactions by quenching with cold TC can be particularly useful
when taking short timepoints because there is no delay between the act of
quenching and the actual end of the reaction. It is also easier to do quickly as
Reconstitution of Yeast Translation Initiation 141

it involves one mixing step rather than mixing and loading. To stop reactions
with cold TC, add 10 ml of the reaction to 5 ml of 3 chase (3 mM
GDPNP  Mg2þ, 1 mM eIF2, 450 nM Met-tRNAiMet when using 0.5 nM
hot TC). The quenched reactions can be stored at room temperature and are
stable for several days. To check the effectiveness of the chase, assemble a
‘‘chase first’’ reaction in which 5 ml of 3 chase are added to 40S subunits and
other factors just before the addition of hot TC. If the chase is effective, then
very little 43S complex should be observed on the gel. Samples can be loaded
as in the thermodynamic experiment.

15.5. Disassembly and analysis of gels


Once one plate (usually the notched one) has been separated from the gel,
the gel is transferred to Whatman paper. It is then wrapped in plastic wrap
and taped, gel side up, to the bottom of a phosphorimaging cassette. After
placing a blank phosphorimaging screen on top, the entire cassette is
wrapped in three layers of plastic wrap, carefully sealing the sides. It is
important that it be wrapped well or moisture may damage the screen
when condensation forms upon its removal from the freezer. Place the
cassette in a 20 freezer overnight to prevent diffusion of the sample.
After exposing the screen, remove the cassette from the freezer and allow
it to warm on the bench top. Do not unwrap the cassette before it is at room
temperature or condensation may form on the cassette and screen. Once the
cassette comes to room temperature, wipe any moisture from the plastic and
unwrap the cassette. Scan the screen or remove the gel soon after it comes to
room temperature to prevent diffusion from causing a problem. Quantitate
the fraction of [35S]Met-tRNAiMet in 43S complex for each lane.

15.6. Testing 40S ribosomes


The 43S gel shift assay is a useful test of the quality of a ribosome prepara-
tion. Our standard tests include a concentration curve of 40S subunits from
0.5 to 50 nM in the presence of model mRNA(AUG) and from 10 to
250 nM in the absence of mRNA. We also assay several 40S concentration
points in the absence of eIF1 and several in the absence of eIF1A. It is
important to include mRNA(AUG) in these dropout reactions to allow
sufficient 43S complex formation to be observable on the gel. A Kd of
<1 nM (at the limit of detection of this assay) should be observed for the
case with mRNA(AUG), and a Kd of approximately 60 nM should be
observed without mRNA. A binding defect will be seen in the absence of
eIF1 or eIF1A. The defect without eIF1A is generally more severe. Because
both of these defects have a kinetic component, incubating these reactions
for 30 min rather than the longer time period usual for the no mRNA
reactions will make the defects more obvious.
142 Michael G. Acker et al.

16. Solutions
Standard Protease Inhibitors: 1 tablet Roche complete EDTA-free pro-
tease inhibitor cocktail per 50 ml buffer, 1 mg/ml leupeptin, 1 mg/ml
aprotinin, 1 mg/ml pepstatin, 1 mM benzamidine
10 Ribo Buffer A: 200 mM Hepes  KOH (pH 7.4), 1 M KOAc (pH
7.6), 25 mM Mg(OAc)2
Ribo Lysis Buffer: 1 Ribo Buffer A, 1 mg/ml heparin, 2 mM DTT,
protease inhibitor tabs, 0.5 mM AEBSF
Sucrose Cushion: 1 Ribo Buffer A, 500 mM KCl, 1 M sucrose, 2 mM
DTT
High Salt Wash: 1 Ribo Buffer A, 500 mM KCl, 1 mg/ml heparin,
2 mM DTT
Subunit Separation Buffer: 50 mM Hepes  KOH (pH 7.4), 500 mM
KCl, 2 mM MgCl2, 2 mM DTT
5% and 20% Sucrose Gradient Solutions: 50 mM Hepes  KOH (pH
7.4), 500 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 5% or 20% sucrose,
2 mM DTT
Ribosome Sucrose Storage Buffer: 1 Ribo Buffer A, 250 mM sucrose,
2 mM DTT
Ribosome Extract Buffer: 0.3 M NaOAc (pH 5.0), 12.5 mM EDTA,
0.5% SDS
eIF2 Lysis Buffer: 75 mM Hepes  KOH (pH 7.6), 100 mM KCl, 100 mM
GDP  Mg2þ, 10 mM BME, standard protease inhibitors
eIF2 NCLB-20: 20 mM Hepes  KOH (pH 7.6), 500 mM KCl, 0.1 mM
MgCl2, 10 mM GDP  Mg2þ, 20 mM imidazole, 10% glycerol, 10 mM
BME, standard protease inhibitors
eIF2 NCEB-250: eIF2 NCLB-20 with 250 mM imidazole instead of
20 mM.
eIF2 LSB: 20 mM Hepes  KOH (pH 7.6), 100 mM KCl, 0.1 mM MgCl2,
10 mM GDP  Mg2þ, 10% glycerol, 2 mM DTT
eIF2 HSB: eIF2 LSB with 1 m KCl instead of 100 mM.
eIF2 storage buffer: 20 mM Hepes  KOH (pH 7.6), 100 mM KOAc
(pH 7.6), 0.1 mM Mg(OAc)2, 10% glycerol, 2 mM DTT
eIF2 storage buffer with creatine kinase: eIF2 storage buffer, 0.6 mg/ml
creatine kinase
Intein Lysis Buffer: 20 mM Hepes  KOH (pH 7.4), 0.5 M KCl (pH 7.6),
0.1% Triton X100, 1 mM EDTA, standard protease inhibitors
Intein Cleavage Buffer: 20 mM Hepes  KOH (pH 8.0), 0.5 M KCl,
1 mM EDTA
Intein Wash Buffer: 20 mM Hepes  KOH (pH 7.4), 1 M KCl (pH 7.6),
0.1% Triton X100, 1 mM EDTA
LSB: eIF2 LSB without MgCl2 and without GDP
Reconstitution of Yeast Translation Initiation 143

HSB: eIF2 HSB without MgCl2 and without GDP


eIF3 ZCLB: 20 mM Tris (pH 7.6), 350 mM KCL, 5 mM MgCl2, 20 mM
imidazole, 10% glycerol, 5 mM BME
eIF3 ZCEB: eIF3 ZCLB with 250 mM imidazole instead of 20 mM
eIF1A NCLB-20: 20 mM Hepes  KOH (pH 7.6), 500 mM KCl, 20 mM
imidazole, 10% glycerol, 10 mM BME
eIF1A NCEB-250: eIF1A NCLB-20 with 250 mM imidazole instead of
20 mM
Buffer B-20: 10 mM MOPS (pH 6.7), 500 mM NaCl, 20 mM imidazole
(pH 7.0), 3 mM BME, 0.1 mM AEBSF
Buffer B-250: Buffer B-20 with 250 mM imidazole instead of 20 mM
Buffer A: 10 mM MOPS (pH 6.7), 100 mM or 500 mM NaCl, 10 mM
BME, 0.1 mM AEBSF
yMetRS storage buffer: 40 mM Tris (pH 7.4), 10 mM MgCl2, 10%
glycerol, 2 mM DTT
10 Transcription Buffer: 400 mM Tris (pH 8.1), 300 mM MgCl2,
20 mM spermidine, 1% Triton-X-100, 0.5 mg/ml BSA
Filter Binding Wash Buffer: 25 mM Hepes  KOH (pH 7.6), 2.5 mM
Mg(OAc)2, 80 mM KOAc, 2 mM DTT, 2% glycerol
10X THEM Buffer: 340 mM Tris Base, 570 mM Hepes, 1 mM EDTA,
25 mM MgCl2
10X Recon Buffer: 300 mM Hepes  KOH (pH 7.4), 1-M KOAc (pH
7.6), 30 mM Mg(OAc)2, 20 mM DTT
Enzyme Buffer: 20 mM Hepes KOH (pH 7.4), 0.1 M KOAc (pH 7.6),
10 % glycerol, 2 mM DTT
Gels:
Identity Gel: 5% 29:1 acrylamide:bisacrylamide, 1 TBE buffer, 8 M urea,
0.1% APS, 1 ml TEMED per ml gel
RNA Purification Gel: 12% 19:1 acrylamide:bisacrylamide, 1 TBE
buffer, 8-M urea, 0.1% APS, 1 ml TEMED per ml gel
GTPase Gel: 15% 29:1 acrylamide:bisacrylamide, 1 TBE buffer
Native Gel: 4% 37.5:1 acrylamide:bisacrylamide, 1 THEM buffer, 0.1%
APS, 1 ml TEMED per ml gel

ACKNOWLEDGMENTS
This work was supported by grants to J.R.L. from the National Institutes of Health (GM-
62128), the American Cancer Society (RSG-03-156-01-GMC), and the American Heart
Association (0555466U). Many of these techniques were developed during the tenure of
Mikkel Algire, Drew Applefield, Lee Kapp, and David Maag in the lab. We are grateful to
Alan Hinnebusch, Tom Dever, and members of their labs for very productive collaborations
and help at all stages of the development of this system.
144 Michael G. Acker et al.

REFERENCES
Acker, M. G., Shin, B. S., Dever, T. E., and Lorsch, J. R. (2006). Interaction between
eukaryotic initiation factors 1A and 5B is required for efficient ribosomal subunit joining.
J. Biol. Chem. 281, 8469–8475.
Algire, M. A., Maag, D., and Lorsch, J. R. (2005). Pi release from eIF2, not GTP hydrolysis,
is the step controlled by start-site selection during eukaryotic translation initiation. Mol.
Cell 20, 251–262.
Algire, M. A., Maag, D., Savio, P., Acker, M. G., Tarun, S. Z., Sachs, A. B., Asano, K.,
Nielsen, K. H., Olsen, D. S., Phan, L., Hinnebusch, A. G., and Lorsch, J. R. (2002).
Development and characterization of a reconstituted yeast translation initiation system.
RNA 8, 382–397.
Benne, R., and Hershey, J. W. B. (1978). The Mechanism of Action of Protein Synthesis
Initiation Factors from Rabbit Reticulocytes. J. Biol. Chem. 253, 3078–3087.
Choi, S. K., Olsen, D. S., Roll mecak, A., Martung, A., Remo, K. L., Burley, S. K.,
Hinnebusch, A. G., and Dever, T. E. (2000). Physical and functional interaction between
the eukaryotic orthologs of prokaryotic translation initiation factors IF1 and IF2. Mol.
Cell Biol. 20, 7183–7191.
Erickson, F. L., and Hannig, E. M. (1996). Ligand interactions with eukaryotic translation
initiation factor 2: Role of the gamma-subunit. EMBO J. 15, 6311–6320.
Fechter, P., Rudinger, J., Giege, R., and Theobald-Dietrich, A. (1998). Ribozyme pro-
cessed tRNA transcripts with unfriendly internal promoter for T7 RNA polymerase:
Production and activity. FEBS Lett. 436, 99–103.
Goode, B. L. (2002). Purification of yeast actin and actin-associated proteins. Methods
Enzymol. 351, 433–441.
Guillon, L., Schmitt, E., Blanquet, S., and Mechulam, Y. (2005). Initiator tRNA bind-
ing by e/aIF5B, the eukaryotic/archaeal homologue of bacterial initiation factor IF2.
Biochemistry 44, 15594–15601.
Jivotovskaya, A. V., Valasek, L., Hinnebusch, A. G., and Nielsen, K. H. (2006). Eukaryotic
translation initiation factor 3 (eIF3) and eIF2 can promote mRNA binding to 40S
subunits independently of eIF4G in yeast. Mol. Cell Biol. 26, 1355–1372.
Kapp, L. D., Kolitz, S. E., and Lorsch, J. R. (2006). Yeast initiator tRNA identity elements
cooperate to influence multiple steps of translation initiation. RNA 12, 751–764.
Kapp, L. D., and Lorsch, J. R. (2004a). GTP-dependent recognition of the methionine
moiety on initiator tRNA by translation factor eIF2. J. Mol. Biol. 335, 923–936.
Kapp, L. D., and Lorsch, J. R. (2004b). The molecular mechanics of eukaryotic translation.
Annu. Rev. Biochem. 73, 657–704.
Maag, D., Fekete, C. A., Gryczynski, Z., and Lorsch, J. R. (2005). A conformational change
in the eukaryotic translation preinitiation complex and release of eIF1 signal recognition
of the start codon. Mol. Cell 17, 265–275.
Maag, D., and Lorsch, J. R. (2003). Communication between eukaryotic translation initia-
tion factors 1 and 1A on the yeast small ribosomal subunit. J. Mol. Biol. 330, 917–924.
Marintchev, A., Kolupaeva, V. G., Pestova, T. V., and Wagner, G. (2003). Mapping the
binding interface between human eukaryotic initiation factors 1A and 5B: A new
interaction between old partners. Proc. Natl. Acad. Sci. USA 100, 1535–1540.
Muir, T. W., Dolan, S., and Cole, P. A. (1998). Expressed protein ligation: A general
method for protein engineering. Proc. Natl. Acad. Sci. USA 95, 6705–6710.
Olsen, D. S., Savner, E. M., Mathew, A., Zhang, F., Krishnamoorthy, T., Phan, L., and
Hinnebusch, A. G. (2003). Domains of eIF1A that mediate binding to eIF2, eIF3 and
eIF5B and promote ternary complex recruitment in vivo. EMBO J. 22, 193–204.
Reconstitution of Yeast Translation Initiation 145

Pavitt, G. D., Ramaiah, K. V., Kimball, S. R., and Hinnebusch, A. G. (1998). eIF2
independently binds two distinct eIF2B subcomplexes that catalyze and regulate
guanine-nucleotide exchange. Genes Dev. 12, 514–526.
Pestova, T., Lorsch, J. R., and Hellen, C. (2007). The Mechanism of Translation Initiation
in Eukaryotes. In ‘‘Translational Control in Biology and Medicine’’ (M. B. Mathews,
N. Sonenberg, and J. Hershey, eds.), pp. 87–128. Cold Spring Harbor Press, Cold Spring
Harbor, NY.
Pestova, T. V., Borukhov, S. I., and Hellen, C. U. T. (1998). Eukaryotic ribosomes require
initiation factors 1 and 1A to locate initiation codons. Nature 394, 854–859.
Pestova, T. V., and Hellen, C. U. (2000). The structure and function of initiation factors in
eukaryotic protein synthesis. Cell Mol. Life Sci. 57, 651–674.
Pestova, T. V., Kolupaeva, V. G., Lomakin, I. B., Pilipenko, E. V., Shatsky, I. N.,
Agol, V. I., and Hellen, C. U. (2001). Molecular mechanisms of translation initiation
in eukaryotes. Proc. Natl. Acad. Sci. USA 98, 7029–7036.
Phan, L., Zhang, X., Asano, K., Anderson, J., Vornlocher, H. P., Greenberg, J. R., Qin, J.,
and Hinnebusch, A. G. (1998). Identification of a translation initiation factor 3 (eIF3)
core complex, conserved in yeast and mammals, that interacts with eIF5. Mol. Cell Biol.
18, 4935–4946.
Scheibner, K. A., Zhang, Z., and Cole, P. A. (2003). Merging FRET and expressed protein
ligation to analyze protein-protein interactions. Anal. Biochem. 317, 226–232.
Trachsel, H., Erni, B., Schreier, M. H., and Staehelin, T. (1977). Initiation of mammalian
protein synthesis. II. The assembly of the initiation complex with purified initiation
factors. J. Mol. Biol. 116, 755–767.
Valasek, L., Nielsen, K. H., Zhang, F., Fekete, C. A., and Hinnebusch, A. G. (2004).
Interactions of eukaryotic translation initiation factor 3 (eIF3) subunit NIP1/c with eIF1
and eIF5 promote preinitiation complex assembly and regulate start codon selection. Mol.
Cell Biol. 24, 9437–9455.

You might also like