Course: MDMBIO1: Introduction to Bioinformatics

Notes of Module 1
Basics of Molecular Biology

Contents:
Structure and function of DNA, RNA, and proteins, Central
Dogma of
Molecular Biology (Replication, Transcription, Translation),
Codons and genetic
code, Types of genes (structural, regulatory), Mutations and their
biological
effects
--

1. Structure and Function of DNA, RNA, and

Proteins Molecular Foundations: DNA, RNA,
and Proteins
A foundational understanding of the three primary macromolecules of life
is provided. It covers their structure, function, and interconnected roles,
which are essential for understanding all biological processes.
The Blueprint of Life - DNA
DNA (Deoxyribonucleic Acid) is the genetic blueprint for all known
living organisms. It is a long, double-stranded polymer that stores the
instructions necessary for an organism to develop, function, and
reproduce.
Structure of DNA
The structure of DNA is a double helix, resembling a twisted ladder. Each
strand is a polymer made up of repeating units called nucleotides. A
single nucleotide consists of three components:
1. A deoxyribose sugar
2. A phosphate group
3. One of four nitrogenous bases:
o Adenine
(A) o
Guanine (G)
o Cytosine
(C) o
Thymine (T)
The "backbone" of the DNA ladder is formed by the sugar and phosphate
groups linked together. The "rungs" of the ladder are formed by the
nitrogenous bases. These bases pair up specifically according to the
following rules:
• Adenine (A) always pairs with Thymine (T) via two hydrogen
bonds.
• Guanine (G) always pairs with Cytosine (C) via three hydrogen
bonds.
This complementary base pairing is fundamental to DNA's stability and its
ability to replicate. The two strands run in opposite directions, a
characteristic known as antiparallelism.
Structure of DNA

DNA's Primary Function - Replication

The main function of DNA is to store genetic information and pass it on to
new cells. The process by which DNA makes an identical copy of itself is
called DNA replication. This is a semi-conservative process, meaning
each new DNA molecule consists of one original strand and one newly
synthesized strand.

Steps of DNA Replication

1. Initiation: The DNA double helix unwinds at a specific point called
the origin of replication. An enzyme called helicase breaks the
hydrogen bonds between the complementary base pairs, separating
the two strands.
2. Elongation: The enzyme DNA polymerase synthesizes new
complementary strands for each of the two original strands.
o On the leading strand, synthesis is continuous as the
polymerase moves in the same direction as the replication
fork.
o On the lagging strand, synthesis is discontinuous, occurring in
small segments called Okazaki fragments.
3. Termination: The process ends when the entire DNA molecule has
been copied. The two new DNA molecules, each a perfect copy of
the original, are ready to be passed on to daughter cells.
This precise replication process ensures that the genetic
information remains constant from one generation of cells to the
next.
The Messenger Molecule - RNA
RNA (Ribonucleic Acid) acts as a critical intermediary between the
genetic instructions stored in DNA and the protein-building machinery of
the cell. It is a single-stranded nucleic acid with several key differences
from DNA:
• Single-Stranded: RNA typically exists as a single polynucleotide
chain, although it can fold back on itself to create complex 3D
structures.
• Sugar: RNA contains a ribose sugar instead of the deoxyribose
sugar found in DNA.
• Bases: RNA uses the base Uracil (U) instead of Thymine (T). In
transcription, Uracil pairs with Adenine.

Types of RNA
There are three main types of RNA, each with a unique structure and
function:
1. Messenger RNA (mRNA): mRNA carries the genetic instructions
from the DNA in the nucleus to the ribosomes in the cytoplasm. It is
a temporary "working copy" of a gene.
2. Transfer RNA (tRNA): tRNA is a small RNA molecule that acts as
an adapter, translating the genetic code from mRNA into an amino
acid. Each tRNA molecule has an anticodon that pairs with a
specific codon on the mRNA, and it carries the corresponding amino
acid.
3. Ribosomal RNA (rRNA): rRNA is a major structural and catalytic
component of ribosomes, the cellular machinery responsible for
protein synthesis. rRNA molecules help catalyze the formation of
peptide bonds between amino acids.

The Workhorses of the Cell - Proteins

Proteins are essential macromolecules that perform a vast array of
functions within living organisms. These functions include acting as
enzymes, providing structural
support, and participating in cellular signaling. The specific function of
a protein is determined by its unique 3D structure, which is determined by
the sequence of its amino acids.

Levels of Protein Structure

A protein's 3D structure is described at four hierarchical levels:
1. Primary Structure: This is the simple, linear sequence of amino
acids in the polypeptide chain. This sequence is determined by the
genetic code.
2. Secondary Structure: Localized folding of the polypeptide chain into
specific, repeating patterns. The two most common secondary
structures are the alpha-helix (a coil) and the beta-pleated sheet (a
folded, sheet-like structure). These are stabilized by hydrogen bonds
between the backbone atoms.
3. Tertiary Structure: The overall 3D shape of a single polypeptide
chain. This is formed by the interactions between the side chains (R-
groups) of the amino acids. These interactions include hydrogen
bonds, disulfide bridges, and hydrophobic interactions.
4. Quaternary Structure: This level of structure is only present in
proteins with more than one polypeptide chain (subunits). It
describes how these separate subunits are arranged and interact to
form a single, functional protein complex. For example, hemoglobin
is a protein with four subunits.
A protein must fold into its correct tertiary and quaternary structure to be
biologically active. The process of protein folding is critical for cellular
function, and misfolded proteins can lead to diseases.
--
2. The Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology is a fundamental concept
that describes the flow of genetic information within a biological system. It
states that genetic information flows from DNA to RNA to protein. This
process is the core mechanism by which the instructions stored in a cell's
genes are converted into functional products.
The Overview of the Central Dogma
The Central Dogma was first articulated by Francis Crick in 1958. It
provides a simple, yet powerful, framework for understanding how genes
are expressed. The process can be summarized in three key stages:
1. Replication: The process by which DNA makes a copy of itself. This
is essential for cell division, ensuring that each new cell receives a
complete set of genetic instructions.
2. Transcription: The process of converting a segment of DNA into a
messenger RNA (mRNA) molecule. This mRNA molecule serves as a
temporary, portable copy of the genetic information.
3. Translation: The process of decoding the mRNA molecule to
synthesize a protein. This is where the genetic "code" is finally
translated into a functional molecule.
This unidirectional flow of information is what connects an organism's
genotype (its genetic makeup) to its phenotype (its observable traits).
DNA Replication - Copying the Blueprint
DNA replication is the process by which a cell duplicates its DNA. This
occurs during the S phase of the cell cycle before a cell divides, ensuring
that both daughter cells inherit an identical copy of the genome.
Replication is a semi-conservative process, meaning that each new DNA
molecule consists of one original strand and one newly synthesized
strand.
Key Steps in Replication
1. Unwinding the Helix: An enzyme called helicase unwinds the
double helix, breaking the hydrogen bonds between the base pairs.
This creates a replication fork, the site where the new strands are
being synthesized.
2. Primer Synthesis: A small segment of RNA, called a primer, is
synthesized by an enzyme called primase. The primer provides a
starting point for DNA synthesis.
3. Elongation: The main enzyme, DNA polymerase, adds new
nucleotides to the primer, following the complementary base-pairing
rules (A with T, C with G).
o The leading strand is synthesized continuously in the 5' to 3'
direction. o The lagging strand is synthesized in short,
discontinuous fragments
called Okazaki fragments.
4. Ligation: The Okazaki fragments on the lagging strand are joined
together by
the enzyme DNA ligase.
This meticulous process ensures that the genetic information is accurately
copied, maintaining the integrity of the genome.

Transcription - The DNA to RNA Step

Transcription is the process of synthesizing an RNA molecule from a
DNA template. It is the first step of gene expression and occurs in the
nucleus of eukaryotic cells. The enzyme responsible for this process is
RNA polymerase.
Key Steps in Transcription
1. Initiation: RNA polymerase binds to a specific DNA sequence
called a promoter, located upstream of the gene. This binding
unwinds the DNA double helix, creating a transcription bubble.
2. Elongation: RNA polymerase moves along the template strand of
the DNA, synthesizing a complementary RNA molecule. As it moves,
it pairs RNA nucleotides with the DNA template: Adenine (A) pairs
with Uracil (U), and Guanine (G) pairs with Cytosine (C).
3. Termination: When RNA polymerase reaches a specific sequence
called a
terminator, it stops transcription and releases the newly formed
RNA molecule. After transcription, the mRNA molecule is processed
(spliced and capped) and then transported out of the nucleus to a
ribosome for translation.

The Genetic Code and Codons

The genetic information in an mRNA molecule is read in groups of three
nucleotides, called codons. Each codon corresponds to a specific amino
acid or a stop signal. The set of rules that defines this relationship is
known as the genetic code.
Key Properties of the Genetic Code
• Redundancy (or Degeneracy): Most amino acids are specified by
more than one codon. For example, UUU and UUC both code for the
amino acid Phenylalanine. This redundancy provides a buffer
against some mutations.
• Universality: The genetic code is nearly the same in almost all
organisms, from bacteria to humans. This suggests a common
evolutionary origin for all life.
• Start and Stop Codons: The codon AUG signals the start of
protein synthesis and codes for the amino acid Methionine. There
are three stop codons (UAA, UAG, UGA) that signal the end of
translation.

Translation - The RNA to Protein Step

Translation is the final step in the Central Dogma, where the genetic
information from an mRNA molecule is used to synthesize a protein. This
complex process occurs in the cytoplasm at a cellular organelle called the
ribosome.
Key Players in Translation
• mRNA: Carries the genetic message from DNA.
• Ribosome: The molecular machine that reads the mRNA and
synthesizes the protein.
• tRNA (Transfer RNA): Small RNA molecules that act as adapters,
each carrying a specific amino acid and an anticodon that is
complementary to an mRNA
codon.

1. Initiation: The ribosome binds to the mRNA and scans for the AUG
start codon. The first tRNA, carrying Methionine, binds to this start
codon.
2. Elongation: The ribosome moves along the mRNA, reading one
codon at a time. A new tRNA molecule carrying the next amino acid
enters the ribosome,
 and a peptide bond is formed between the adjacent amino acids,
creating a growing polypeptide chain.
3. Termination: When the ribosome encounters a stop codon, a release
factor protein binds to it, causing the polypeptide chain to be released.
The ribosome,
mRNA, and tRNA molecules all dissociate, ready to be reused.
The newly formed polypeptide then folds into its unique 3D structure to
become a functional protein.

The Link between Genotype and Phenotype

The Central Dogma provides the molecular basis for how an organism's
genotype (its DNA sequence) is translated into its phenotype (its
observable traits and characteristics). Mutations—changes in the DNA
sequence—can alter this process at any stage, leading to a wide range of
biological effects. --

[Link] and the Genetic

Code The Genetic Code
and Codons
The genetic code is the set of rules by which information encoded in DNA
and mRNA is translated into proteins. It is the language of life, dictating
how a sequence of nucleotides is read to produce a specific sequence of
amino acids. This process is mediated by codons, which are the
fundamental units of this code.
What is a Codon?
A codon is a sequence of three consecutive nucleotides on a messenger RNA
(mRNA) molecule. Each codon specifies either a particular amino acid or a
signal to stop protein
synthesis. Because there are four possible nucleotides (A, U, C, G), there
are 43=64 possible codons.
The DNA sequence of a gene is transcribed into an mRNA molecule, and it
is this mRNA that is "read" during translation. The reading of codons is a
critical process that determines the final protein product.
Key Components:
• Nucleotides: Adenine (A), Uracil (U), Cytosine (C), and Guanine (G).
• Codon: A three-nucleotide sequence (e.g., AUG, GGC, UAA).
• Amino Acid: The building block of a protein.
The Reading Frame
The sequence of codons in an mRNA molecule must be read in the correct
order, without any overlap. This is known as the reading frame. The
reading frame is established by the start codon, which is almost always
AUG. Once the ribosome recognizes the start codon, it begins reading the
mRNA three nucleotides at a time, continuously, until it encounters a stop
codon.
Example 1
One strand of genomic DNA (strand A, coding strand) contains the following
sequence
reading from 5' to 3':
TCGTCGACGATGATCATCGGCTACTCGA
This strand will form the duplex
5'-TCGTCGACGATGATCATCGGCTACTCGA-3' 3'-
AGCAGCTGCTACTAGTAGCCGATGAGCT-5'
The sequence of bases in the other strand of DNA (strand B) written 5' to 3' is
therefore
TCGAGTAGCCGATGATCATCGTCGACGA
In the mRNA transcribed from strand A of DNA, the sequence of bases written
5' to 3'
is
UCGAGUAGCCGAUGAUCAUCGUCGACGA
resulting in an amino acid sequence
Ser-Ser-Ser-Arg-STOP
However, if DNA strand B is the coding strand the mRNA sequence will be
UCGUCGACGAUGAUCAUCGGCUACUCGA
and the amino-acid sequence will be
Ser-Ser-Thr-Met-Ile-Ile-Gly-Tyr-Ser-
Example 2:
Consider the mRNA sequence: 5'-ACGAUGGCAUCGUAA-3'
• Correct Reading Frame: The ribosome starts at AUG. The codons
are AUG, GCA, UCG. The final UAA is a stop codon.
• Incorrect Reading Frame #1: If the ribosome starts at the first
nucleotide, the codons would be ACG, AUG, CAU, CGU. This would
result in a completely different, and likely non-functional, protein.
 • Incorrect Reading Frame #2: If the ribosome starts at the second
nucleotide,
the codons would be CGA, UGG, CAU, CGU. Again, a different protein
would be produced.
Maintaining the correct reading frame is essential for producing the right
protein. Mutations like insertions or deletions can cause a frameshift,
completely scrambling the amino acid sequence downstream of the
mutation.

The Genetic Code Table

The genetic code is often represented as a table that shows which of the
64 possible codons corresponds to each of the 20 common amino acids.
• Start Codon: The codon AUG serves as the primary initiation
signal for translation and codes for the amino acid Methionine.
• Stop Codons: There are three codons that signal the termination of
translation: UAA, UAG, and UGA. These codons do not code for any
amino acid but are
recognized by release factors that end protein synthesis.

1. Redundant (or Degenerate): The genetic code has more codons

(64) than amino acids (20). This means that most amino acids are
specified by multiple codons. For example, the amino acid Leucine
is coded by UUA, UUG, CUU, CUC, CUA, and CUG.
2. Unambiguous: Each codon specifies only one amino acid. For
example, UUU always codes for Phenylalanine, and nothing else.
3. Nearly Universal: The genetic code is a universal language of life,
with very few exceptions. The same codons specify the same amino
acids in almost all organisms, from bacteria to humans.

The Role of tRNA

The actual translation of the genetic code is performed by transfer RNA
(tRNA) molecules. Each tRNA molecule has a specific structure that
enables it to perform its critical function:
• Anticodon Loop: A three-nucleotide sequence on the tRNA that is
complementary to an mRNA codon. This is how the tRNA recognizes
and binds to the correct position on the mRNA.
• Amino Acid Attachment Site: At the other end of the tRNA, there is
a site where a specific amino acid is attached. This attachment is
catalyzed by a family
of enzymes called aminoacyl-tRNA synthetases.
During translation, the ribosome reads the mRNA codon, and a tRNA with
the matching anticodon arrives, carrying its specific amino acid. The
ribosome then catalyzes the formation of a peptide bond, adding the new
amino acid to the growing protein chain.

--
Types of genes (structural, regulatory)
Genes

Genes
A gene is a part of DNA that codes for a particular protein. DNA is the
information database of the cell and exists within the cell nucleus. It
carries all the important genetic instructions that produce proteins
required by our cells. Each gene carries a particular set of instructions,
which is usually in a coded format, used for an accurate function or for a
distinct protein. The said genes are first transcribed into mRNA and then
get converted into a polypeptide chain. A polypeptide is then converted to
a protein. All the hidden code inside our genes emerged as our physical
traits, which are known as gene expression.

This is a process where the gene’s genetic codes are used in managing
the protein synthesis that is required for our body to produce the cell
structures. Genes that carry information required for the sequences of
amino acids are termed structural genes. This process has two main
steps:
Transcription- In this step, with the help of RNA polymerase enzymes, the
messenger RNA is produced, resulting in the processing of mRNA
molecules.
Translation- The main function of mRNA is to direct the synthesis of a
protein resulting in the succeeding post-translational processing of the
protein molecules.
Regulation of Gene Expression

Gene expression is the process by which the instructions present in our

DNA are converted into a functional product, such as a protein. This
process is a tightly coordinated process which allows a cell to respond to
its changing environment.
During gene expression, genetic codes from the DNA code are converted
into a protein with the help of translation and transcription. The genetic
expression shows the process of the genetic makeup of an organism as its
physical traits. In this process, the information flows from genes to
proteins.
To understand this topic better, let us take the example of the Keratin
genes. Keratin is a protein that helps in the formation of our hairs, nails,
and skin. In most cases, these things grow at a continuous speed as our
hairs, nails, and skin get worn down over a period of time. The production
of excessive keratin could form many hairs on the skin, dry and hard skin,
and thick and long nails. To avoid this, it is necessary to regulate the
expression of the keratin gene.
Regulation of gene expression includes different mechanisms through
which our cells manage the amount of produced protein by our genes.

Gene Expression
Structural Genes
Structural genes are the genes that code for proteins and RNAs except
regulatory factors. The products include structural proteins and enzymes.
Structural genes also encode for non-coding RNAs such as the tRNAs and
rRNAs.
In prokaryotes, the structural genes of related functionality are usually
present adjacent to each other and regulated by a single promoter and
operator. However, in eukaryotes they are mostly found in the coding
regions. Clinically, the structural genes can be studied to find out any genetic
variations or mutations in the sequences.
Regulatory Genes
Regulator genes code for repressor proteins in prokaryotes. These
regulatory proteins control the level of expression of the structural genes.
The regulatory sequences are present several kilo bases far from the
initiation site of transcription. They are used clinically to activate or
repress the expression of a particular gene.

Structural vs. Regulatory Genes

Structural
Genes Regulatory Genes
Description
Structural genes are the genes that Regulatory genes are those genes
code that
code for proteins or factors that
for proteins and most RNAs except control
regulatory factors the expression of structural genes.
Location
In prokaryotes, the structural Regulatory genes are usually found a
genes of related functionality are bit far from the structural genes, say,
usually present adjacent to each 500 base pairs apart, and are mostly
other and regulated by a single found in the intron regions.
promoter and operator. However,
in eukaryotes they are mostly
found in the coding regions.
Genes Encoded
mRNA, rRNA, and tRNA miRNA and siRNA
Function
It encodes the proteins It encodes factors / proteins that
required for structural and control the expression of structural
functional uses. genes.
Example
Structural genes of the lac operon such Regulatory genes are lac I and
CAP.
as lac A, lac Y and lac Z.

--
Mutations and the Genetic Code

In biology, a mutation is an alteration in the nucleic acid sequence of the

genome of an organism, virus, or extrachromosomal DNA. Viral genomes
contain either DNA or RNA. Mutations result from errors during DNA or
viral replication, mitosis, or meiosis or other types of damage to DNA
(such as pyrimidine dimers caused by exposure to ultraviolet radiation),
which then may undergo error-prone repair (especially microhomology-
mediated end joining), cause an error during other forms of repair, or
cause an error during replication (translesion synthesis). Mutations may
also result
from substitution, insertion or deletion of segments of DNA due to mobile
genetic elements. A red tulip exhibiting a partially yellow petal due to a
somatic mutation in a cell that formed that petal. Mutations may or may
not produce detectable changes in the observable characteristics
(phenotype) of an organism. Mutations play a part in both normal and
abnormal biological processes including: evolution, cancer, and the
development of the immune system, including junctional diversity.
Mutation is the ultimate source of all genetic variation, providing the raw
material on which evolutionary forces such as natural selection can act.

Mutation can result in many different types of change in sequences.

Mutations in genes can have no effect, alter the product of a gene, or
prevent the gene from functioning properly or completely. Mutations can
also occur in non-genic regions. A 2007 study on genetic variations
between different species of Drosophila suggested that, if a mutation
changes a protein produced by a gene, the result is likely to be harmful,
with an estimated 70% of amino acid polymorphisms that have damaging
effects, and the remainder being either neutral or marginally beneficial.

Mutation and DNA damage are the two major types of errors that occur in
DNA, but they are fundamentally different. DNA damage is a physical
alteration in the DNA structure, such as a single or double strand break, a
modified guanosine residue in DNA such as 8-hydroxydeoxyguanosine, or a
polycyclic aromatic hydrocarbon adduct. DNA damages can be recognized by
enzymes, and therefore can be correctly repaired using the complementary
undamaged strand in DNA as a template or an undamaged sequence in a
homologous chromosome if it is available. If DNA damage remains in a cell,
transcription of a gene may be prevented and thus translation into a protein
may also be blocked. DNA replication may also be blocked and/or the cell
may die. In contrast to a DNA damage, a mutation is an alteration of the base
sequence of the DNA. Ordinarily, a mutation cannot be recognized by
enzymes once the base change is present in both DNA strands, and thus a
mutation is not ordinarily repaired. At the cellular level, mutations can alter
protein function and regulation. Unlike DNA damages, mutations are
replicated when the cell replicates. At the level of cell populations, cells with
mutations will increase or decrease in frequency according to the effects of
the mutations on the ability of the cell to survive and reproduce. Although
distinctly different from each other, DNA damages and mutations are related
because DNA damages often cause errors of DNA synthesis during replication
or repair and these errors are a major source of mutation.

1. The Genetic Code and its Properties

The genetic code is the set of rules that translates a nucleotide
sequence in a gene into an amino acid sequence in a protein. This code is
read in groups of three nucleotides, known as codons. With four possible
nucleotides (A, U, C, G), there are 43=64 possible codons.
 • Degeneracy: The code is degenerate, meaning most amino acids
are specified by more than one codon. This property provides a vital
buffer against mutations, as a change in the DNA might not change
the resulting amino acid. For example, both CUA and CUG code for
Leucine.
• Unambiguous: Each codon specifies only one amino acid.
• Universal: The genetic code is nearly universal across all life forms,
from bacteria to humans, highlighting a shared evolutionary history.
• Start and Stop Codons: The codon AUG acts as the start signal
for translation and codes for Methionine. There are three stop
codons (UAA, UAG, UGA) that signal the end of protein synthesis.

[Link] of Mutations and their Biological Effects

Mutations are broadly classified into two main types based on how they alter
the gene.

• Substitution: One nucleotide is replaced by another. This type of

mutation can have three possible outcomes:
o Silent Mutation: The substitution changes a codon but the
new codon still codes for the same amino acid due to the
code's degeneracy. This mutation has no effect on the
protein's function.
o Missense Mutation: The substitution changes a codon to one
that codes for a different amino acid. The effect on the protein
can range from negligible to drastic. A famous example is the
mutation that causes sickle cell anemia, where a single
base change results in a glutamic acid being replaced by a
valine. This alters the shape of the hemoglobin protein and
red blood cells.
o Nonsense Mutation: The substitution changes a codon into a
premature stop codon (UAA, UAG, or UGA). This results in a
shortened, or truncated, protein that is often non-functional.

Frameshift Mutations
Frameshift mutations are caused by the insertion or deletion of one or
more nucleotides. Since the genetic code is read in a three-base-pair
frame, adding or removing a number of nucleotides that is not a multiple
of three shifts the entire reading frame.
• Insertion Mutation: An extra nucleotide is added to the DNA
sequence.
• Deletion Mutation: A nucleotide is removed from the DNA
sequence.
The result of a frameshift is a complete change in all codons downstream
of the mutation. This almost always leads to a non-functional protein
because the amino acid sequence is completely scrambled and often a
stop codon is encountered prematurely. --
Mutations and their Biological Effects
A mutation is any change in the DNA sequence. Mutations can have a range
of effects:
 • Silent Mutation: A change in a single nucleotide that does not
change the amino acid sequence due to the redundancy of the
genetic code. These have no effect on the protein.
• Missense Mutation: A change in a single nucleotide that results in
a different amino acid being incorporated into the protein. This can
alter the protein's function, sometimes drastically.
• Nonsense Mutation: A change in a single nucleotide that creates a
premature stop codon, leading to a shortened and often non-functional
protein.
• Frameshift Mutation: An insertion or deletion of nucleotides that
shifts the reading frame of the codons. This can drastically alter the
entire amino acid sequence downstream of the mutation, almost
always resulting in a non-functional protein.
--
Question Bank:
Part A: 2-Mark Questions
1. What are the three main components of a DNA nucleotide?
2. What is the primary function of DNA in a cell?
3. Name the four nitrogenous bases found in DNA.
4. Which two bases are complementary in DNA, and how many
hydrogen bonds do they form?
5. What are the three main differences between DNA and RNA?
6. What is the purpose of the Central Dogma of Molecular Biology?
7. Define DNA replication.
8. What is the main enzyme involved in transcription?
9. What is a codon?
10. How many nucleotides make up a single codon?
11. What is the role of the AUG codon?
12. What is a stop codon?
13. How many common amino acids are there?
14. What are the two types of genes?
15. What is a silent mutation?
16. Define a point mutation.
17. What is the difference between an insertion and a deletion?
18. What is a missense mutation?
19. What is a nonsense mutation?
20. What is a frameshift mutation?
21. What is the role of mRNA?
22. What is the role of tRNA?
23. How many levels of structure does a protein have?
24. What is the primary structure of a protein?

Part B: 5-Mark Questions

 25. Describe the structure of a DNA double helix, mentioning the
sugar-phosphate backbone and base-pairing rules.
26. Explain the process of DNA replication in brief, including the
roles of helicase and DNA polymerase.
27. Describe the steps of transcription in detail, from initiation to
termination.
28. Explain the process of translation, including the roles of
mRNA, tRNA, and ribosomes.
29. Discuss the key properties of the genetic code, such as its
degeneracy and universality.
30. Differentiate between a structural gene and a regulatory
gene, providing an example for each.
31. Explain what a point mutation is and describe its three
different types.
32. Describe the effect of a frameshift mutation on a protein's
structure and function.
33. Explain the difference between DNA and RNA, focusing on
their structure and function.
34. How does the structure of a protein determine its function?
Explain using the concept of different structural levels.
35. Describe the role of codons and anticodons in protein
synthesis.
36. Explain why a silent mutation has no effect on the resulting
protein, while a missense mutation can.
37. Discuss the importance of the Central Dogma as a
foundational concept in biology.
38. What is a codon, and what is the maximum number of amino
acids a codon can specify?
39. Explain the role of amino acids as the building blocks of
proteins.

Part C: 10-Mark Questions

40. Describe in detail the Central Dogma of Molecular Biology,
explaining each of its three stages: replication, transcription, and
translation.
41. Elaborate on the different types of mutations. Explain what
causes them and their specific biological effects on the resulting
protein product.
42. Compare and contrast the structure and function of DNA, RNA,
and proteins.
43. Explain the concept of the genetic code. Discuss its properties
and its role in translating a gene's sequence into a protein's amino
acid sequence.
44. Describe the process of protein synthesis in detail. Start with a
gene in the DNA and trace the flow of information through
transcription and translation to the final protein product.
45. Explain the hierarchical levels of protein structure (primary,
secondary, tertiary, quaternary) and how each level contributes to
the final functional shape of a protein.
46. Discuss the various types of mutations (silent, missense,
nonsense, frameshift) and use an example sequence to illustrate
the effect of each.
47. Describe the components of a nucleotide for both DNA and
RNA and explain how these components are arranged to form the
nucleic acid polymers.
48. Explain the key differences between DNA replication,
transcription, and translation.
49. Discuss the significance of the genetic code's degeneracy.
How does it protect organisms from some of the negative effects of
mutations?
50. Write about Gene and Gene expression.