Scribd
Upload
14 views2 pages

DNA Mutation Simulation Guide

The document outlines a DNA mutation simulation activity, guiding users to identify model components, analyze mRNA roles, and explore various mutations including point, frameshift, and silent mutations. Participants are instructed to manipulate DNA sequences and observe changes in protein synthesis. The final analysis encourages comparison of mutation types and their effects on protein outcomes.

Uploaded by

pboi1732
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
14 views2 pages

DNA Mutation Simulation Guide

The document outlines a DNA mutation simulation activity, guiding users to identify model components, analyze mRNA roles, and explore various mutations including point, frameshift, and silent mutations. Participants are instructed to manipulate DNA sequences and observe changes in protein synthesis. The final analysis encourages comparison of mutation types and their effects on protein outcomes.

Uploaded by

pboi1732
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Name: __________________________________________

DNA Mutation Simulation ​​ ​ ​


Access the simulation at: [Link]

1. Identify the parts of the model:

____ Ribosome
____ Amino Acids​
____ tRNA​
____ mRNA

2. What is the role of mRNA in this process?

3. Click on enter or edit DNA and copy this code: ​


ATGCCAGGCGGCGAGAGCTAA

Click the “Unfold Button” to see the protein sequence. Click on


each individual amino acid and write the sequence:

4. How many DNA triplets were in the original sequence?_____

How many amino acids are in the final protein? _____

5. Explain the significance of the last triplet (TAA) in the sequence:

6. Edit the DNA by changing the 4th base to G


New sequence: ATGGCAGGCGGCGAGAGCTAA
Check the new protein created by your new [Link] the new amino acid chain.

[Link]
7. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read
ATGA. ATGACCAGGCGGCGAGAGCTAA

Check the new protein created by your new [Link] the new amino acid chain.

8. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC.
New sequence: ATGCCCGGCGGCGAGAGCTAA

Check the new protein created by your new DNA. List the sequence of the new protein:

Final Analysis -
There are three mutations you explored in this activity. You can use what you observed in the activity to help
you answer the questions or search other sources if you are still confused.

9. First, you created a POINT mutation in your DNA. Describe what a point mutation is and how this can affect
the protein created by the gene.

10. The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it
affects the protein.

11. The third mutation you explored is a special kind of point mutation called a SILENT mutation. Explain what
this means.

12. Compare the different types of mutations. Which type will have the greatest effect on the outcome of the
protein?

[Link]

You might also like