Evolutionary theories

Lamarckism
The central premise of its
hypothesis revolved around
I return to two ideas
fundamentals:

The influence of the environment

Lamarck
in which they develop
(1744 – 1829)
Jean Baptiste de Monet,
species determine
knight of Lamarck, the changes of these.
French naturalist. In These changes are
1809 published Philosophy hereditary, that is, Skull and
zoological, where he exhibited
the first ideas
will be transmitted to the vertebrae
reasoned about the descendants. cervicals
evolution. His ideas do not of giraffe
were accepted.
Lamarckism
According to Lamarck, the modifications in the environment of a species
generates new needs, in response to which living beings
they are forced to use a certain specified organ:
"Function shapes the organ," in the words of Lamarck himself. Use
continued from the same strengthens and develops it, while the not
using it determines its atrophy and disappearance ('law of use and disuse').

Striving
and using it,
this animal
would achieve
develop your
neck. And
after
would achieve
transmit that
to his children.
1.-Lamarckism

The use of horns

it would provoke its development.
The great development of the
hind legs of
some animals
should be due to its great use.

The kiwi would have

atrophied its wings
for not using them.
Lamarckism

This hypothesis is totally

inadmissible nowadays due to the
Genetics, as it is known that the
acquired characters (such as,
for example, the increase in the
muscle mass through exercise or
getting tanned when drinking
the sun) is not transmitted to the
descendants, as they do not affect
to the genetic material.
 Evolutionary theories

2.-Darwinism

Darwin's ideas are

resumen en 3 conceptos:
Charles Darwin
1.- The struggle for existence (1809 – 1882)

2.- Intraspecific variability

3.- Natural selection
Natural selection tends to
promote the survival of the
more fit. This theory
revolutionary was published in
1859 in the famous treaty
origin of species by means of
of natural selection.

Let's look at these concepts...

How are living beings evolving?

Many are born...

More individuals are born than are able to survive.
in a setting with limited resources.

Within each species, there is variety in the

characteristics. Individuals are not identical among
Yes. They are born with differences among them, that is, there are
intraspecific variability (within the species)
 Many are born...

But...
Some not
they find enough
food or suffer
diseases and Others are the
they die capture of some
predator
There is a fight
for existence
Many are born...

But...

There is a struggle for the

existence and for the
Some do not find a partner
reproduction or they cannot reproduce
for some reason
Many are born...

But...
Only a few survive:
those who have been born
with characteristics
that allow them
better adapt to
its medium.
Natural Selection has
eliminated those who were born
with fewer features
appropriate for the
survival.

Only a few survive

Those who survive

they transmit to their children
those characteristics
that precisely them
helped to survive
better in your environment.
 Unlike Lamarck, Darwin
I thought giraffes were born with necks.
longer or shorter. They would survive.
only those who had inherited a
sufficiently long neck.
Compare the two theories and reflect
 Reflect:

How has evolution led to the fact that

this insect looks like a leaf...

... according to Lamarck's theory?

... according to Darwin's theory?

And in the case of

Giant Phyllium this caterpillar that
Does it look like a branch?
Darwin was very interested in knowing how the
farmers, ranchers, and animal breeders
they managed to obtain and improve different breeds
 Darwin was very interested in knowing how the
farmers, ranchers, and animal breeders
they could obtain and improve different breeds

If you want a good one

dairy cow breed no
animals that cross
they produce little milk.
Those are selected
females that produce
more milk. It is made a
Selective Breeding.
The Voyage of the Beagle.
After graduating from Cambridge in 1831, the
young Darwin enlisted at the age of 22 in the
reconnaissance ship HMS Beagle as
unpaid naturalist, to undertake a
scientific expedition around the world.
The expedition lasted five years and collected data.
hydrographic, geological and meteorological in South America
and many other places. The observations of zoology and
Darwin's botany led him to develop the theory of
natural selection.
The amazing wildlife of the Galapagos Islands gave a lot to
to think of Darwin
Iguana

Various
species of
finches

Cormorant
with wings Giant tortoises
atrophied
 About the 'monkey' no. His theory on the evolution of man was
grossly misunderstood and found much opposition.
The attacks on Darwin's ideas that found the most
ecos did not come from their scientific opponents, but from
his religious opponents.
Many attacked
to Darwin without
having read your
The idea that living beings had
book of knowing to
evolved by natural processes background sus
denied the divine creation of man arguments and
and it seemed to place him at the same level ideas.
than the animals. Both ideas
they represented a serious threat
for orthodox theology.
Darwin did not think that the
man descended from none
actual 'mono', but the
man and other primates
they all descended from
common ancestors.
Orangutan Gorilla Chimpanzee Human being

? In times of
Darwin does not
they knew fossils
of ancestors
humans
Darwin thought that
the human being does not
? Ancestor
proceed from none common
actual primate.
But I did believe that
we have ancestors
common with them.
 Orangutan Gorilla Chimpanzee Human being

? (5 million years ago)

of years)

Darwin was attacked

because in his time it was not
they knew the 'links' ? Australopithecus
"lost" from the chain of Proconsul
human evolution (20 million years ago)
of years)
But modern science
knows many links of
this chain
Modern Anthropology knows many more details about the
human evolution of what people think

Australopithecus afarensis
Modern Anthropology knows many more details about the
human evolution of what people think

Homo erectus
 Evolutionary theories
3.-Neodarwinism or Theory
Synthetic of Evolution
None of the scientists who were betting
through the evolutionary theories I knew the
existence of the genes nor of the
mutations, but even then they intuitively knew that
the changes occurring in individuals of
a species "were transmitted" to the
descendants.

Darwin did not know how to explain how

they transmit the characters
hereditary. In their time not
the chromosomes were known, nor
much less the DNA. The Laws
it was unknown to Mendel when
Darwin published his theory.
 Evolutionary theories
None
scientific
3.-Neodarwinism or Theory deny today
the fact
Synthetic of Evolution evolutionary

Modern biology explains the evolutionary fact

adding to Darwin's ideas the Laws of Mendel
and the knowledge of modern Genetics.

+ +=
Neodarwinism
or Theory
Synthetic of the
Evolution

Darwin Mendel Modern Genetics

Finally, the mystery of how it is transmitted was resolved.

the hereditary characteristics. The discovery of the laws of
the inheritance and the genetic material allowed to explain that
that the scientists opposed to Darwin criticized him the most.

The origin of species by Darwin was published in 1859, before Mendel's work.
 Evolutionary theories
3.-Neodarwinism or Synthetic Theory of Evolution
The genetic recombination that Daddy duck meets mommy duck...
it occurs in meiosis and the
sexual reproduction produces
intraspecific variability
the one Darwin spoke of

... mother duck put ...and they had beautiful ducklings. But there won't be an opportunity.
eggs in the nest… for "the ugly duckling": Natural Selection will take care of him.
The duck
Malvasia
Natural Selection continues to be accepted as the dive for
the main "motor" of Evolution. Selection obtain
food
Natural 'chooses' within variability. from the background

of lagoons
 evolutionary theories
3.-Neodarwinism or Synthetic Theory of Evolution
As you know, sometimes errors occur in DNA replication,
giving rise to altered genes, different from the original. They are the MUTATIONS.
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
Double helix of DNA without mutation

ATTCGCGGCATTAATCCGATACCTAGGACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCCTGGCGCCTAAATTTGTACCTAG
Double DNA strand with mutation Mutation
Mutations are the original source of variability. Meiosis
and sexual reproduction are added sources of variability.

Variability within the species Eriopis eschscholtzi

Some mutations cause death, but others, in themselves, are not
"good" or "bad": it will all depend on the environment where the species lives.
 Evolutionary theories
3.- Neodarwinism or Synthetic Theory of Evolution
Mutations, recombination
genetics in meiosis, and the combination
of gametes in sexual reproduction
occur randomly (by chance)

The number of
possible combinations of
alleles of genes in a
species is extremely high
("almost infinite").

Would you know how to calculate the number

of possible combinations
of dice figures
taking five of them?
 evolutionary theories
3.-Neodarwinism or Synthetic Theory of Evolution
In this environment, the mice
of dark phenotype
they survive with more
probability

Nature throws its

they give birth and animals are born

lighter, darker... Normal owl

Depending on the medium,
one color or another will be
better or worse
In this environment, the mice
of clear phenotype
they survive with more
probability
Snowy Owl
Over time, in this population of mice, the increase in
frequency of genes that determine the light phenotype