Articles

[Link]

The proportion of soil-borne pathogens increases

with warming at the global scale
Manuel Delgado-Baquerizo 1 ✉, Carlos A. Guerra 2,3, Concha Cano-Díaz 4, Eleonora Egidi 5,6
,
Jun-Tao Wang5,6,7, Nico Eisenhauer 2,8, Brajesh K. Singh 5,6 and Fernando T. Maestre 9,10

Understanding the present and future distribution of soil-borne plant pathogens is critical to supporting food and fibre pro-
duction in a warmer world. Using data from a global field survey and a nine-year field experiment, we show that warmer tem-
peratures increase the relative abundance of soil-borne potential fungal plant pathogens. Moreover, we provide a global atlas
of these organisms along with future distribution projections under different climate change and land-use scenarios. These
projections show an overall increase in the relative abundance of potential plant pathogens worldwide. This work advances
our understanding of the global distribution of potential fungal plant pathogens and their sensitivity to ongoing climate and
land-use changes, which is fundamental to reduce their incidence and impacts on terrestrial ecosystems globally.

A
round 15% of the global crop production is lost to biologi- abundance of fungal plant pathogens in the soil reservoir remains
cal threats1–5, a percentage that is expected to increase with largely unexplored.
ongoing global warming and the associated intensification Here, we used a global field survey15 conducted across 235
of pest incidence1. This will jeopardize food security and reduce natural ecosystems from six continents (Supplementary Fig. 1) and
the productivity and health of terrestrial plant communities world- a 9-year warming field experiment16 to evaluate how temperature17
wide4. Many of the most aggressive plant pathogens are soil-borne regulates the relative abundance of soil-borne potential fungal plant
fungi (for example, Alternaria alternata or Fusarium oxysporum)6–8 pathogens (potential plant pathogens hereafter). This global survey
that threaten food security as the chemical fungicides currently was previously used to identify the top dominant fungal phylo-
used against them are mostly ineffective6–8. In recent years, informa- types in soils across the globe15. We generated global atlases for the
tion on the distribution of plant diseases has increasingly become current and future distribution of potential plant pathogens under
available at local and regional scales (for example, via PlantWise, contrasting global change scenarios, and explored causal relation-
[Link] Moreover, the fundamental study in ships between their relative abundance and warming. Our global
Tedersoo et al.9 provided important insights on the distribution field survey (Methods) included a wide variety of vegetation,
of global fungi. Yet, global atlases of the current and future distri­ climates and soil types, and covered ~73% of the environmental
bution of plant pathogens under contrasting global change sce- conditions found on Earth (Supplementary Appendix 1).
narios based on multiple contrasting climates and vegetation types Using amplicon sequencing for the internal transcribed spacer
are still lacking. (ITS) gene, we identified 2,735 fungal phylotypes classified as
Soils from natural ecosystems provide an array of potential res- potential plant pathogens out of the 23,399 fungal phylotypes
ervoirs for fungal pathogens that surround croplands worldwide, found in our global survey (Supplementary Data 1)6. Together,
challenging their productivity6–8. Moreover, natural ecosystems, potential pathogenic phylotypes represented between 0.5 and 46.5%
which provide essential services (for example, timber and livestock (with the average at 14.4%) of all the ITS sequences at a given site
production)10,11 to billions of people, are also highly sensitive to the (Fig. 1a), and included multiple potential plant pathogens with
incidence of fungal pests1–6,10. Understanding the current and future single (plant pathogens only, 37.1% of all pathogenic phylotypes;
distribution of plant pathogens in natural ecosystems and the envi- for example, Venturia spp.) and mixed (plant pathogen and endo-
ronmental factors that influence them is critical to forecast their phyte and/or saprotrophic fungi, 62.8% of all pathogenic phylo-
impact on human well-being and ecosystem sustainability under types; for example, Fusarium spp.) trophic modes (Supplementary
projected climate and land-use change scenarios. This could read- Fig. 2 and Supplementary Data 1). Our results thus indicate that
ily be seen as temperatures continue to rise along this century3,12, soil-borne potential plant pathogens can be relatively abundant
which might have an impact on the proportion of potential plant in soils from natural ecosystems worldwide. This was particularly
pathogens worldwide. Temperature is known to determine the the case in tropical and dry forests, but not in boreal and cold for-
distributions of soil microbial communities9,13 as well as to influ- ests (Fig. 1b). On average, the surveyed soils were dominated by a
ence the distributions of fast-growing opportunistic fungal and ani- few genera of potential plant pathogens, which include Alternaria,
mal pests14. Even so, the potential role of warming in the relative Fusarium, Venturia and Phoma (Fig. 1c and Supplementary Data 1

1
Departamento de Sistemas Físicos, Químicos y Naturales, Universidad Pablo de Olavide, Sevilla, Spain. 2German Centre for Integrative Biodiversity
Research (iDiv) Halle–Jena–Leipzig, Leipzig, Germany. 3Institute of Biology, Martin-Luther University Halle–Wittenberg, Halle (Saale), Germany.
4
Departamento de Biología y Geología, Física y Química Inorgánica, Escuela Superior de Ciencias Experimentales y Tecnología, Universidad Rey Juan
Carlos, Móstoles, Spain. 5Global Centre for Land-Based Innovation, Western Sydney University, Penrith, New South Wales, Australia. 6Hawkesbury
Institute for the Environment, Western Sydney University, Penrith, New South Wales, Australia. 7State Key Laboratory of Urban and Regional Ecology,
Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, China. 8Institute of Biology, Leipzig University, Leipzig, Germany.
9
Instituto Multidisciplinar para el Estudio del Medio ‘Ramón Margalef’, Universidad de Alicante, Alicante, Spain. 10Departamento de Ecología, Universidad
de Alicante, Alicante, Spain. ✉e-mail: [Link]@[Link]

550 Nature Climate Change | VOL 10 | June 2020 | 550–554 | [Link]/natureclimatechange

NaTUre CliMaTe Change Articles
a b ANOVA P < 0.001 c
Africa (18) 3.5
60

Soil-borne plant pathogens (%)

Europe (31)
Asia (10) 3.0
50 Australia (85)
North America (77) 2.5
South America (14)
40 2.0
Number of sites

Boreal (3) 1.5

30 ANOVA P = 0.001
Cold forests (18)
Temperate forests (27) 1.0
Dry forests (60)
20 0.5
Tropical forests (7)
Cold grasslands (22)
0.0
10 Dry grasslands (42)

Alternaria

Venturia
Phoma

Knufia
Chalara
Fusarium

Cladosporium

Acremonium
Phaeosphaeriaceae

Coniochaetaceae
Other grasslands (41)
Shrublands (15)
0
0 10 20 30 40 50 0 5 10 15 20
Soil-borne plant pathogens (%) Soil-borne plant pathogens (%)

d e
Space Climate
P > 0.05
P < 0.05 Soil C
xA

Clay + silt
Bo

Soil pH
Plant cover
Forest
Soil Vegetation Grassland
PSEA
Box A
)
)

MAP
9 (P MAT
)
(←F
(←G

A)

0.25 (F←MAP) TSEA

SE
5 (←
0.34
0.25

–0.91 (G←MAT) MAT

0.7

0.83 (F←MAT) R 2 = 0.25

0.1

Spatial dissimilarity
0.21 (G←PSEA)
Pathogens Elevation
–0.41 (F←PSEA)
–0.31 (G←TSEA)
0.48 (F←TSEA) χ 2 = 0.10, P = 0.75, df = 1 –1.5 –1.0 –0.5 0.0 0.5 1.0 1.5 2.0 2.5
Bootstrap P = 0.65 STE (unitless)
RMSEA = 0.00, P = 0.81

Fig. 1 | Relative abundance, identity and ecological preferences of potential plant pathogens worldwide. a, Distribution of the relative abundance of total
fungal pathogens across the 235 ecosystems surveyed. Other grasslands include tropical and temperate grasslands. Shrublands include polar, temperate
and tropical shrublands. b, Mean values (± s.e.) for the relative abundance (%) of potential plant pathogens across continents and biomes. c, Relative
abundance (percentage of all ITS sequences) of the most common soil fungal pathogens identified (mean ± s.e.). d, A structural equation model to assess
the direct and indirect effects of environmental factors on the relative abundance of potential plant pathogens. We grouped the different categories of
predictors (climate, soil properties, vegetation and spatial influence) in the same box for graphical simplicity (these boxes do not represent latent variables).
Variables within these boxes are allowed to covary. Numbers adjacent to the arrows are indicative of the effect size of the relationship. Only significant
effects (P < 0.05) are plotted. Information on the environmental factors included in our SEM and on the direct effects for other SEM arrows can be found
in Supplementary Fig. 3 and Supplementary Tables 1 and 2. Supplementary Table 2 offers a complete view of our full SEM. The degree of freedom in this
SEM comes from the lack of relationship between precipitation seasonality (PSEA) and clay + silt (%). R2 values for other endogenous variables are given
in Supplementary Table 8. e, The total standardized effects on SEM (sum of the direct and indirect effects, STE ± bootstrap confidence interval 95%) on the
relative abundance of potential plant pathogens. In a and c–e, n = 235 locations. For b, n is shown in parentheses. F, forests; G, grasslands; MAP, mean annual
precipitation; TSEA, temperature seasonality; ANOVA, analysis of variance; RMSEA, root mean square error of approximation; df, degrees of freedom.

for a complete list), which together accounted for almost half found that mean annual temperature (MAT) had the largest positive
(43.0%) of the retrieved ITS sequences classified as potential and significant direct association with the relative abundance of
plant pathogens. Many of these soil-borne fungal taxa include soil pathogens globally (Fig. 1d; see all the considered associa-
economically important potential pathogens, as they are likely tions in Supplementary Fig. 3 and Supplementary Table 2). We also
to affect the health and productivity of many important crops detected multiple indirect effects of MAT on the relative abun-
(for example, wheat, sunflowers, cabbages, tomatoes and potatoes), dance of soil-borne potential plant pathogens via changes in vege­
gardening and cosmetic/medicinal plants (for example, Hibiscus, tation types (forests and grasslands; Fig. 1d). Similar results were
Aloe vera), and wild species that are an important food source observed when we calculated the relative abundances of potential
for livestock6–8,18,19. plant pathogens from rarefied abundances (Supplementary Tables 3
We then used structural equation modelling (SEM) (Supple­ and 8), considered the relative abundance of potential plant patho-
mentary Figs. 3–5 and Supplementary Tables 1–8) to identify the gens with single and mixed trophic modes (Supplementary Tables 4,
direct and indirect (for example, via changes in soil properties 5 and 8) and focused on the probable and highly probable patho-
and vegetation) associations between temperature and the rela- gens only (Supplementary Tables 6–8). Our analyses further indi-
tive abundance of potential plant pathogens across the globe. We cated that MAT was the most important factor to influence the

Nature Climate Change | VOL 10 | June 2020 | 550–554 | [Link]/natureclimatechange 551

Articles NaTUre CliMaTe Change

most abundant potential pathogen genera (Alternaria, Fusarium,

Spatial dissimilarity
Venturia and Phoma; Supplementary Fig. 5). Additional correla-
tion analyses suggested that MAT is positively associated with the

Soil Carbon
Plant cover

Grassland
Elevation
relative abundance of multiple genera classified as potential plant

Clay+silt
Forest
TSEA

PSEA
pathogens, which were found to be ubiquitous in soils across the

MAP
MAT

pH
globe (>50% of all locations) (Fig. 2 and Supplementary Data 1).
All plant pathogens
Likewise, ecosystem type (for example, forests and grasslands) and
Alternaria plant cover were heavily associated with the relative abundance of
Fusarium plant pathogens. These findings suggest that changes in land use—
Venturia as those predicted with global change20—might also alter the rela-
Phoma tive abundance of soil-borne potential pathogens globally. Other
Phaeosphaeriaceae predominant environmental factors associated with specific patho-
Cladosporium gen genera include precipitation and soil pH (Fig. 2).
Coniochaetaceae
Together, the findings from our observational survey15 suggest
that an increasing temperature may cause increases in the pres-
Acremonium
ence of potential fungal plant pathogens in soils, which might act
Knufia
as reservoirs of infection. Across the globe, natural areas are often
Chalara surrounded by croplands and there is important ‘spill over’ of soil
Mycosphaerellaceae microbes between them21. Given the high dispersal abilities of
Didymosphaeriaceae fungi22,23, our results suggest that warming-induced increases in the
Teratosphaeriaceae relative abundance of potential plant pathogens in soils from natural
Coniochaeta ecosystems will increase the risk of infection by these fungi in adja-
Devriesia cent croplands24–26. These impacts are likely to have implications for
Didymellaceae
sustaining a growing human population, which is predicted to reach
9.8 billion people in 205027. Furthermore, it can create significant
Pleosporaceae
constraints for livelihood in the least-developed countries, where
Clonostachys
the majority of people rely to a large degree on livestock and natural
Didymosphaeria products supported by natural ecosystems10.
Acrophialophora To experimentally corroborate the observed global patterns, we
Xylariaceae used a nine-year field warming experiment located at the centre of
Bipolaris the Iberian Peninsula16, where natural ecosystems are expected to
be markedly affected by global warming if emissions are not sub-
P > 0.05
stantially controlled17. Note that these data were not included in
–0.65 Correlation coefficient 0.65
our global survey and were analysed independently. This experi-
ment evaluates the effects of warming (~2 °C; Supplementary
Fig. 2 | Temperature is positively associated with the relative abundance
Fig. 6) on key ecosystem attributes in a semi-arid grassland with
of potential plant pathogens at the genus level. Spearman correlations
well-developed biocrusts (soil-surface communities dominated by
between environmental factors and the relative abundance of ubiquitous
lichens, mosses, fungi and cyanobacteria)16. Warming almost tripled
fungal plant pathogens at the genus level (n = 235). Information
the relative abundance of potential plant pathogens in soil (Fig. 3),
on environmental factors included in this analysis can be found in
which provides additional experimental evidence of the positive
Supplementary Table 1. Correlations with a false discovery rate adjusted
effect of temperature on the relative abundance of these organisms.
P > 0.05 are excluded (plotted in white).
Additionally, warming increased the relative (measured via ampli-
con sequencing) and total (measured via quantitative polymerase
chain reaction (qPCR) abundance of Alternaria, the most common
relative abundance of soil-borne potential plant pathogens glob- pathogenic fungal genus found in our global survey (Fig. 1), by
ally when both direct and indirect effects are considered simul- sevenfold and twofold, respectively (Fig. 3). Warming also increased
taneously (total standardized effects; Fig. 1e and Supplementary the relative abundance of the globally dominant Fusarium genus
Fig. 4). We also found that MAT had a total positive effect on the (Fig. 1) by almost five times (Supplementary Fig. 7), and also
relative abundance of fungal pathogens when we focused on the affected other common pathogens, such as Cladosporium spp., the

60 35 3.5
*** *** *
50
(gene copies g–1 soil)a

28
All pathogens (%)

Alternaria (%)

40 3.0
Alternaria

21
30
14
20 2.5
7
10

0 0 2.0
Control Warming Control Warming Control Warming

Fig. 3 | Experimental evidence that warming increases the relative and total abundance of potential plant pathogens. Warming effects on the relative
(%) and absolute (gene copies g−1 soil) abundance of fungal pathogens in a nine-year field warming experiment. The solid lines show mean values (n = 10).
***P < 0.001, *P < 0.05. a, log10-transformed. See Supplementary Table 9 for further statistical details.

552 Nature Climate Change | VOL 10 | June 2020 | 550–554 | [Link]/natureclimatechange

NaTUre CliMaTe Change Articles
a under contrasting global change scenarios are lacking. Based on
the consistent results from the global survey and experiment here,
we generated a global atlas that depicts the current distribution
of potential plant pathogens globally (Fig. 4a and Supplementary
Figs. 8 and 9; see Supplementary Appendix 2 for a cross-validation
of this map using an independent database9). We also generated a
similar map for the relative abundance of potential pathogens with
single tropic mode (plant pathogens only) (Supplementary Fig. 9);
High Low
this map is highly correlated to that including all the potential plant
Relative abundance pathogens together (Fig. 4a; Pearson’s r = 0.83, P < 0.0001). These
of pathogens atlases show that the highest relative abundance of these pathogens
can be found in warm areas, such as dryland and tropical ecosys-
b tems (Fig. 4a, Supplementary Fig. 9 and Supplementary Appendixes
1 and 2). Analyses conducted for the dominant potential plant
pathogens revealed that, although Venturia has a more homo­
geneous spread across the globe, with especial relevance across the
Northern Hemisphere, fungi from the genera Fusarium, Phoma
and Alternaria are more prevalent in tropical forests and drylands
(Supplementary Fig. 10). These results are consistent with findings
from croplands, for which the disease severity associated with these
No fungi is often more important in warmer climates7,30.
changes To provide new insights on other potential locations on Earth
Gain Loss that might be more vulnerable to these organisms in the future, we
No. of scenarios that
follow the same trend: 3 2 1 Mixed 1 2 3
forecast the relative abundance of potential plant pathogens under
trends global change scenarios (RCP2.6–SSP1, RCP6.0–SSP4 and RCP8.5–
SSP5 up to 2050; Fig. 4b and Supplementary Fig. 10; RCP, represen-
c 5% tative concentration pathway; SSP, shared socioeconomic pathway).
SSP1 SSP4 SSP5
These analyses show an increase in the relative abundance of
4%
potential plant pathogens in most regions of the world regardless
of the climate and land-use scenarios considered (Fig. 4b). Such
Relative change (%)

3%
an increase is supported by our experimental results, which show
2% a positive correlation of the abundance of these pathogens with
warming effects like those expected by global climate models.
1% Although caution should be taken regarding the local accuracy of
our model (Supplementary Appendix 1), the impacts of warming
0% are particularly evident in soils across the Northern Hemisphere,
towards the Arctic, as well as in South Africa, for which all the
–1%
Pathogens Alternaria Fusarium Venturia Phoma
scenarios show a systematic temperature rise (Fig. 4). Land use was
especially important for some potential pathogenic genera, such as
Fig. 4 | Current relative abundance and temporal projections (2050) Fusarium, which were found to be negatively correlated with plant
of potential plant pathogens across the globe. a, Relative abundance cover (Fig. 2) and thus might increase with the forecast increases
projection. A cross-validation of this map that uses an independent global in aridity11. Together, our analyses show those locations of Earth
survey is available in Supplementary Appendix 2. b, Agreement across in which potential plant pathogens are expected to become more
the different scenarios considered (‘gain’ reflects areas in which gain common in the near future. However, we also stress here that
is predicted, ‘loss’ reflects areas in which loss is predicted and ‘mixed' we have not measured pathogen infection or the disease of hosts,
reflects areas in which different scenarios predict gain or loss). c, Relative and that the importance of pathogens in determining vegetation
change for potential plant pathogens and that of the most abundant structure might differ in warm versus cold ecosystems, which
genera (Alternaria, Fusarium, Venturia and Phoma) assessed for scenarios might limit the implications of our results in boreal and Arctic
SSP1 (sustainability), SSP4 (regional inequality) and SSP5 (fossil-fuelled ecosystems. In addition, our study has a global focus and does not
development). The bars and bar plots indicate the interquartile interval and provide high-resolution information on the fine-scale (for example,
median value for each scenario, respectively. A map of the extrapolation on the scale of metres or centimetres) distributions of fungal patho-
uncertainty for our global database (235 locations) is available in gens, which are affected by factors not included in our analyses,
Supplementary Fig. 8 (see Supplementary Appendix 1). Also see such as microclimatic variations. Therefore, future work needs to
Supplementary Figs. 9 and 10 for an alternative panel for a, and for maps be done to identify the fine-scale distribution of plant pathogens in
of individual pathogen-associated genera. specific localities.
Our results, based on a global survey and a nine-year field exper-
iment, highlight the importance of soils from natural ecosystems
as an important reservoir for potential fungal plant pathogens,
relative abundance of which increased by 20-fold (see Supplementary and underline temperature as a major environmental factor that
Fig. 7 for more examples). drives their global distribution. They indicate that the proportion
Global atlases, similar to those that have been available for plants of potential plant pathogens will probably increase in most regions
and animals for centuries, now exist for some bacterial28 and fungal of the world regardless of the climate and land-use scenarios
(for example, mycorrhizal fungi)15,29 taxa. However, although consi­dered. Our findings advance our understanding of the distri-
regional and local information on plant diseases is starting to be bution and sensitivities to climate and land-use change of poten-
increasingly available ([Link] global atlases tial fungal plant pathogens in a warmer and human-dominated
for the current and future distribution of potential plant pathogens world. They can also be used to make better predictions on how

Nature Climate Change | VOL 10 | June 2020 | 550–554 | [Link]/natureclimatechange 553

Articles NaTUre CliMaTe Change

ongoing global environmental change will affect their distribution 13. Oliverio, A. M. et al. Identifying the microbial taxa that consistently respond to
and impact on food production and human livelihoods worldwide. soil warming across time and space. Glob. Change Biol. 23, 2117–2129 (2017).
14. Bebber, D. P. et al. The global spread of crop pests and pathogens. Glob. Ecol.
Biogeogr. 23, 1398–1407 (2013).
Online content 15. Egidi, E. et al. A few Ascomycota taxa dominate soil fungal communities
Any methods, additional references, Nature Research reporting worldwide. Nat. Commun. 10, 2369 (2019).
summaries, source data, extended data, supplementary informa- 16. De Guevara, M. L. et al. The ‘PhenoBox’, a flexible, automated, open‐source
plant phenotyping solution. New Phytol. 219, 808–823 (2018).
tion, acknowledgements, peer review information; details of author
17. Guiot, J. & Wolfgang Cramer, W. Mediterranean warming fast, deserts may
contributions and competing interests; and statements of data and spread in Europe. Science 354, 465–468 (2016).
code availability are available at [Link] 18. Dean, R. et al. The top 10 fungal pathogens in molecular plant pathology.
020-0759-3. Mol. Plant Pathol. 13, 414–430 (2012).
19. Agrios, G. N. Plant Pathology (Academic, 2005).
Received: 28 October 2019; Accepted: 25 March 2020; 20. IPCC Special Report on Land Use, Land-Use Change and Forestry
(Cambridge Univ. Press, 2000).
Published online: 11 May 2020
21. Bell, T. & Tylianakis, J. M. Microbes in the Anthropocene: spillover of
agriculturally selected bacteria and their impact on natural ecosystems.
References Proc. Biol. Sci. 283, 20160896 (2016).
1. Barford E. Crop pests advancing with global warming. Nature 22. Caliz, J. et al. A long-term survey unveils strong seasonal patterns in the
[Link] (2013). airborne microbiome coupled to general and regional atmospheric
2. Newbery, F. et al. Modelling impacts of climate change on arable crop diseases: circulations. Proc. Natl Acad. Sci. USA 115, 12229–12234 (2018).
progress, challenges and applications. Curr. Opin. Plant Biol. 32, 101–109 (2016). 23. Barberan, A. et al. Continental-scale distributions of dust-associated bacteria
3. Tollefson, J. IPCC says limiting global warming to 1.5 °C will require drastic and fungi. Proc. Natl Acad. Sci. USA 112, 5756–5761 (2015).
action. Nature 562, 172–173 (2018). 24. Sugden, A. M. Warming, crops, and insect pests. Science 361, 888–889 (2018).
4. Chakraborty, S. & Newton, A. C. Climate change, plant diseases and food 25. Borrelli, P. et al. An assessment of the global impact of 21st century land use
security. Plant Pathol. 60, 2–14 (2011). change on soil erosion. Nat. Commun. 8, 2013 (2017).
5. Moore, D. et al. 21st Century Guidebook to Fungi (Cambridge Univ. Press, 2011). 26. Panagos, P. et al. The new assessment of soil loss by water erosion in Europe.
6. Nguyen, N. H. et al. FUNGuild: an open annotation tool for parsing fungal Environ. Sci. Policy 54, 438 (2015).
community datasets by ecological guild. Fungal Ecol. 20, 241–248 (2016). 27. World Population Prospects 2019: Highlights (United Nations Department of
7. Parry, D. W. et al. Fusarium ear blight (scab) in small grain cereals—a review. Economic and Social Affairs, Population Division, 2019).
Plant Pathol. 44, 207–238 (1993). 28. Delgado-Baquerizo, M. et al. A global atlas of the dominant bacteria found in
8. Qiu, Z. et al. New frontiers in agriculture productivity: optimised microbial soil. Science 325, 320–325 (2018).
inoculants and in situ microbiome engineering. Biotechnol. Adv. 37, 29. Steidinger, B. S. et al. Climatic controls of decomposition drive the global
107371 (2019). biogeography of forest–tree symbioses. Nature 569, 404–408 (2019).
9. Tedersoo, L. et al. Global diversity and geography of soil fungi. Science 346, 30. Köhl, J. et al. Epidemiology of dark leaf spot caused by Alternaria brassicicola
1256688 (2014). and A. brassicae in organic seed production of cauliflower. Plant Pathol. 59,
10. Asner, G. P. et al. Grazing systems, ecosystem responses, and global change. 358–367 (2010).
Annu. Rev. Environ. Resour. 29, 261–299 (2004).
11. Maestre, F. T. et al. Structure and functioning of dryland ecosystems in a
changing world. Annu. Rev. Environ. Resour. 47, 215–237 (2016). Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
12. IPCC Climate Change 2013: The Physical Science Basis (eds Stocker, T. F. et al.) published maps and institutional affiliations.
(Cambridge Univ. Press, 2013). © The Author(s), under exclusive licence to Springer Nature Limited 2020

554 Nature Climate Change | VOL 10 | June 2020 | 550–554 | [Link]/natureclimatechange

NaTUre CliMaTe Change Articles
Methods of soil pathogens across the world. The implementation of these models was
Global survey. Study sites and soil sampling. We used data from a global field preceded by exploratory correlation analyses to identify the most important factors
survey15 to identify the ecological drivers and the current and future distributions associated with the distributions of potential plant pathogens. These included
of potential soil-borne plant pathogens in soils worldwide. Briefly, bulk soils climate (DMAT and DMAP), vegetation type (Dforest, forest and Dgrassland, grassland),
(top 7.5 cm) were collected from 235 ecosystems located in 18 countries from elevation (Selev) and soil variables (Stext, soil texture; Scarbon, soil carbon; SpH, soil
six continents (Supplementary Fig. 1) and covered nine biomes (temperate, pH). ‘S’ and ‘D’ indicate the variables that were either kept constant for current
tropical and dry forests, cold, temperate, tropical and arid grasslands, shrubland and future conditions (S) or those that changed in future scenarios (D). Climatic
and boreal) between 2003 and 2015. Locations were selected to provide a solid seasonality data were not included in these analyses given the current levels of
representation for most environmental conditions (for example, climate, soil and projection uncertainty associated with this type of data under contrasting global
vegetation types) found on Earth (Supplementary Appendix 1). For example, change scenarios38.
MAP and MAT in these locations ranged from 67 to 3,085 mm and from −11.4° For future projections of the relative abundance of potential plant pathogens,
to 26.5 °C, respectively. Given the global distribution of croplands, most natural we used precipitation, temperature and land-use datasets from the Inter-Sectoral
ecosystems are surrounded to a certain level by agricultural fields. Soil samples Impact Model Intercomparison Project39 and the Land-use Model Intercomparison
were sieved on arrival at the laboratory (2 mm mesh). Then, a portion of soil was Project (LUMIP)40 activities from the Intergovernmental Panel for Climate Change.
immediately frozen at −20 °C for molecular analyses, and the rest of the soil was This selection followed the protocol laid out in Kim et al.41.
air-dried and stored for a month before physicochemical analyses. In terms of climate datasets, we used the bias-corrected historical and future
ISMIP2a dataset39,42, which spans the timeframe from 1951 to 2099. We considered
Environmental factors. Our field global survey15 included 12 environmental three RCPs: RCP2.6 (+0.4 to 1.6 °C by 2050), RCP6.0 (+0.8 to 1.8 °C by 2050) and
variables, which were obtained either in the field or from satellites and databases. RCP8.5 (+1.4 to 2.6 °C by 2050). The monthly means of daily temperatures and
Elevation and climatic variables, which include MAT, MAP and temperature and daily total precipitation greater than 1 mm were calculated for the available period
precipitation seasonality, were collected from the Worldclim database (https:// of these data. For the purpose of this study, we selected two projection steps, 2010
[Link]; ~1 km resolution)31. Note that air and soil ([Link] and 2050. To avoid outliers, we calculated 20-year climatologies using an analysis
[Link]/) temperatures are highly correlated at the global scale (Pearson’s window centred in each year step. The dataset created was used as a climate input
r = 0.81, P = 0.0011) and that we used air temperature because current and future for all the model runs. For each SSP–RCP combination, we used two different
global models for this variable are more robust. Plant cover (2001–2015) was general circulation models (that is, gfdl-esm2m and noresm1-m)42.
obtained using remote sensing data from the Moderate Resolution Imaging For the land-use projections, we built on the dataset provided by the land-use
Spectroradiometer at a ~1 km resolution32. Soil properties (texture (% of clay + silt), Harmonized v2.0 project ([Link] This dataset was produced in the
pH and total organic C) were determined from topsoil (top 7.5 cm) samples context of the World Climate Research Program Coupled Model Intercomparison
collected from each location using standardized protocols33. To avoid biases Project 644,45, and contains a harmonized set of land-use scenarios that are
associated with having multiple laboratories analysing soils from different sites, consistent between historical reconstructions and future projections. It reproduces
all the samples were analysed at the Universidad Rey Juan Carlos (Spain). Soil pH annual land-use reconstructions for historical land-use forcing (which covers the
was measured with a pH meter in a 1:2.5 mass:volume soil and water suspension. period 850–2015) and for different integrated assessment models and SSPs from
Soil texture (% of fine fractions, clay + silt) was determined as detailed in Maestre 2015 to 2100 at a 0.25° resolution. These pathways represent a range of plausible
et al.33. The concentration of soil total organic carbon (C) was determined using a future scenarios based on different socioeconomic challenges for climate change
wet chemistry method34. mitigation (low in SSP1 (sustainability) and SSP4 (regional inequality); high in
SSP5 (fossil-fuelled development)), and potential challenges for adaptation (low
Statistical analyses. SEM. We used SEM35 to identify the direct and indirect effects in SSP1 and SSP5; high in SSP4). A full description of each scenario is given
of climate, vegetation and soil properties as drivers of the relative abundance in Popp et al.44. Each SSP corresponds to a specific RCP; here we selected the
potential plant pathogens (see our a priori model in Supplementary Fig. 3). The combinations SSP1–RCP2.6, SSP4–RCP6.0 and SSP5–RCP8.5. For the static
most common vegetation types in our database (forests and grasslands) were datasets, we resampled all the soil data from soil grids39 to 0.25° resolution to match
included in our SEM as categorical variables with two levels: 1 (a given ecosystem the resolution of the non-static datasets. The same procedure was done with the
type) and 0 (remaining ecosystem types). As some of the variables introduced elevation dataset46.
were not normally distributed, the probability that a path coefficient differs Using an exploratory analysis, which loops through all the potential variable
from zero was tested using bootstrap tests36. Bootstrapping is preferred to the combinations to maximize the predicted power of each equation, we obtained
classical maximum-likelihood estimation in these cases because, in bootstrapping, different equations for each of the analysis:
probability assessments are not based on an assumption that the data match
PPathogens ¼ 0:905 þ ð0:014 ´ DMAT Þ þ ð�0:0001 ´ DMAP Þ
a particular theoretical distribution. Thus, data are randomly sampled with
þð0:194 ´ Dforest Þ þ 0:119 ´ Dgrassland þ ð0:035 ´ Stext Þ
replacement to arrive at estimates of standard errors that are empirically associated
þð�0:295 ´ Scarbon Þ þ ð0:0001 ´ Selev Þ
with the distribution of the data in the sample. We conducted models for the
relative abundance (%) of all soil-borne fungal plant pathogens (unrarefied and
rarefied, 4,500 reads per sample; see Molecular analyses below), plant pathogens PAlternaria
 ¼ �0:194þ ð0:012 ´ DMAT Þ þ ð�0:052 ´ Dforest
 Þ
with single (plant pathogens only) and mixed trophic mode (plant pathogen and þ 0:010 ´ Dgrassland þ ð�0:113 ´ Stext Þ þ 0:913 ´ SpH
endophyte and/or saprotrophic fungi) and plant pathogens classified as probable þð�0:313 ´ Scarbon Þ þ ð0:0001 ´ Selev Þ
and highly probable plant pathogens (excluding possible pathogens)6. Moreover,
we conducted models for the most abundant pathogen genera (Alternaria,
Fusarium, Venturia and Phoma). The environmental data included in our model PFusarium
 ¼ �0:013 þ ð0:0012
 ´ DMAP
Þ
(Supplementary Table 1) did not suffer from multicollinearity (Pearson’s r < 0.7 in þ 0:117 ´ Dgrassland þ 0:409 ´ SpH þ ð�0:310 ´ Scarbon Þ
all cases; Supplementary Table 10). þð0:0001 ´ Selev Þ
We then tested the goodness of fit of our model. To do so, we used the
chi-square test (χ2; the model has a good fit when 0 ≤ χ2 ≤ 2 and 0.05 < P ≤ 1.00) and PPhoma ¼ �0:483 þ ð0:009 ´ DMAT Þ þð�0:0001 ´ DMAP
the RMSEA; the model has a good fit when 0 ≤ RMSEA ≤ 0.05 and 0.10 < P ≤ 1.00  Þ
þð0:175 ´ Dforest Þ þ 0:014 ´ Dgrassland þ 0:699 ´ SpH
(ref. 36). Finally, we confirmed the fit of the model using the Bollen–Stine bootstrap þð�0:029 ´ Stext Þ þ ð�0:00004 ´ Selev Þ
test (the model has a good fit when 0.10 < bootstrap P ≤ 1.00). Our model showed
a solid goodness of fit and, therefore, a satisfactory fit to our data (Fig. 1d). SEM
models were conducted with the software AMOS 20 (IBM SPSS Inc.). PVenturia ¼ 0:400 þ ð0:008 ´ DMAT Þ þð�0:0002 ´ DMAP Þ
þð0:162 ´ Dforest Þ þ ð0:041 ´ Stext Þ þ �0:585 ´ SpH
Correlation analyses. We conducted a Spearman correlation analyses to further þð0:173 ´ Scarbon Þ
evaluate the associations between climate, vegetation, soil properties and the
relative abundance of the most ubiquitous putative fungal plant pathogens (that The equations mentioned above translate to different fit parameters: (1) all
is, those genera found in >50% of all the locations surveyed). Spearman rank potential plant pathogens (PPathogens), R2 = 0.16, P < 0.001; (2) Alternaria (PAlternaria),
correlations measure the strength and direction of association between two ranked R = 0.27, P < 0.001; (3) Fusarium (PFusarium), R2 = 0.18, P < 0.001; (4) Phoma (PPhoma),
2

variables. They do not require normality of data, and linearity is not a strict R2 = 0.37, P < 0.001 and (5) Venturia (PVenturia), R2 = 0.26, P < 0.05. A map of the
assumption of these analyses. We used a false discovery rate approach to determine extrapolation uncertainty for our global database (235 locations) is available in
adjusted P values for all the correlations to control for spurious (false positives) Supplementary Fig. 8 (see also Supplementary Appendix 1). In addition, we further
correlations. We used the R package ‘fdrtool’37 to conduct these analyses. cross-validated our main map using an independent global database, as explained
in Supplementary Appendix 2.
Global mapping and predictions. We used the sampled dataset to generate global
maps of likely distributions of these pathogens. In particular, we conducted Field experiment. Study site and soil sampling. We used a nine-year manipulative
ordinary least squares models to project each map for current and future states field experiment to provide further experimental evidence for a causal link

Nature Climate Change | [Link]/natureclimatechange

Articles NaTUre CliMaTe Change
between warming and the relative abundance of soil-borne fungal potential plant genomes (r = 0.71; P < <0.001; 97% cut-off) (Supplementary Data 1). These
pathogens. This experiment is being conducted on a dryland ecosystem located analyses provide further support for our data.
in the centre of the Iberian Peninsula (40° 01′ 55.7″ N 3° 32′ 48.3″ W; 590 m above
sea level). MAT and mean annual rainfall are 15 °C and 349 mm, respectively, and qPCR analyses. qPCR analyses were done to further confirm the results from
the soil is classified as Gypsiric Leptosol (IUSS Working Group WRB, 2006; our warming experiment. The absolute abundance of Alternaria—the most
[Link] Perennial plant cover is lower than 40% and is dominated by predominant fungal plant pathogen in our surveys—was estimated by a real-time
the perennial grass Stipa tenacissima L. Open areas between plant patches contain qPCR using primers Dir1ITSAlt (TGTCTTTTGCGTACTTCTTGTTTCCT) and
a well-developed biocrust community dominated by lichens, such as Diploschistes Inv1ITSAlt (CGACTTGTGCTGCGCTC), which are commonly used to quantify
diacapsis, Squamarina lentigera and Psora decipiens. Biocrust communities have pathogenic plant-associated Alternaria spp.56. Mastermix reactions were prepared
been proposed as a system model to test the effects of global change on ecosystem in a volume of 10 μl that contained 1.5 ng of DNA template, 5 μl of 2 × SensiFast
functioning under global change scenarios47–50. The experiment, described in SYBR Hi-ROX kit (Bioline), 2 μl of water and 1 μl (5 μmol μl–1) of each primer.
De Guevara et al.16, was established in the study area in July 200850, and includes Amplifications were performed in 96-well reaction plates using a Bio-RAD CFX96
two levels of warming (ambient (control) versus ~2 °C increase (warming))16,50. real-time PCR system (Bio-Rad). Each plate included duplicate reactions per DNA
To achieve a temperature increase within the forecasts of climate change sample, standards and a negative control sample (without DNA). Standard curves
models for the study area51, we built open-top chambers of hexagonal design were generated using a tenfold serial dilution of PCR amplicons that contained the
with sloping sides of 40 cm × 50 cm × 32 cm in 1.2 × 1.2 m plots (Supplementary Alternaria target region. The amplification programme consisted of 1 cycle of 94 °C
Fig. 6). We used methacrylate to build our open-top chambers because this for 4 min, followed by 35 cycles of 94 °C for 30 s, 62 °C for 25 s and 72 °C for 20 s,
material does not substantially alter the characteristics of the light spectrum. Our and a final elongation step of 72 °C for 2 min. To determine the reaction specificity,
warming treatment promoted an average increase of air and surface soil (0–2 cm) a melting curve analysis was subsequently performed by incubating the samples at
temperature of 1.94 and 2.55 °C, respectively. Warming effects were highest during 95 °C for 2 min and annealing at 65 °C for 5 s, followed by heating them slowly at
the summer (June–September). 0.5 °C s–1 up to 95 °C, while continuously monitoring the fluorescence signal.
Soil samples (top 0–1 cm depth) were collected nine years after the beginning
of the experiment from ten plots per combination of treatments. Three soil Reporting summary. Further information on research design is available in the
samples per plot were sampled with a 5 cm diameter core, and then bulked to Nature Research Reporting Summary linked to this article.
obtain a unique sample per plot. Soil was sieved (2 mm mesh) and separated into
two fractions. A portion of soil was immediately frozen at −20 °C for molecular Data availability
analyses. Given the different soil-sampling depths between our experimental The data associated with the global field survey and the field experiment are
and observational studies, caution should potentially be applied when directly publicly available in Figshare57.
comparing the two datasets.
We used non-parametric PERMANOVA ([Link] to test
for important effects of warming on the (ITS amplicon sequencing and qPCR Code availability
analyses) abundance of fungal plant pathogens (see Molecular analyses). These Most numerical analyses included in this article do not have an associated code.
analyses are robust to the lack of normality in our data. Warming was considered Used codes are available in Figshare57.
a fixed factor in these analyses (n = 10). Non-metric PERMANOVA analyses were
carried out using PRIMER v6113 and PERMANOVA+ (PRIMER-E).
References
Molecular analyses. Amplicon sequencing. Amplicon sequencing analyses were 31. Hijmans, R. J. et al. Very high resolution interpolated climate surfaces for
used to determine the fungal communities in soils from the global survey and global land areas. Int. J. Clim. 25, 1965–1978 (2005).
warming experiment. The extracted DNA samples were frozen and shipped to 32. Filipponi, F. et al. Global MODIS fraction of green vegetation cover for
the Next Generation Genome Sequencing Facility of the University of Western monitoring abrupt and gradual vegetation changes. Remote Sens. 10,
Sydney (Australia). Fungal communities were determined by sequencing 653 (2018).
ITS region 2 with primers FITS7 (GTGARTCATCGAATCTTTG) and ITS4 33. Maestre, F. T. et al. Plant species richness and ecosystem multifunctionality in
(TCCTCCGCTTATTGATATGC) on an Illumina MiSeq platform (2 × 300 PE). global drylands. Science 335, 214–218 (2012).
Bioinformatic processing was performed using a combination of USEARCH52 34. Anderson, J. M. & Ingram, J. S. I. (eds) Tropical Soil Biology and Fertility:
and UNOISE353. Operational taxonomic units (OTUs (phylotypes)) were defined A Handbook of Methods 2nd edn (CABI, 1993).
at 100% similarity thresholds using UNOISE353. Phylotype identification was 35. Grace, J. B. Structural Equation Modeling Natural Systems (Cambridge Univ.
obtained against the UNITE fungal database (V7.2)54. The relative abundance (%) Press, 2006).
of each phylotype was calculated from the resulting OTU (phylotype) table. Plant 36. Schermelleh-Engel, K. et al. Evaluating the fit of structural equation models:
pathogenic lifestyles for fungal communities were determined using the FUNGuild tests of significance and descriptive goodness-of-fit measures. Methods
database ([Link] accessed September 2019)6. A Psychol. Res. 8, 23–74 (2003).
complete list of the potential soil-borne fungal plant pathogens included in this 37. Klaus B. & Strimmer K. Estimation of (Local) False Discovery Rates
study can be found in Supplementary Data 1. We obtained 12,086,669 (global and Higher Criticism. R package ‘drtool’ version 1.2.15 (2015);
survey, n = 235) and 787,142 (field experiment, n = 20) ITS reads across the studied [Link]
samples, being 14.4 and 21.6% of all the retrieved ITS reads classified as putative 38. Monteleoni, C. et al. Tracking climate models. Stat. Anal. Data Min. 4,
fungal plant pathogens in the global survey and field experiment, respectively. The 372–392 (2011).
relative abundance of all the soil-borne fungal plant pathogens (both exclusively 39. Hempel, S. et al. A trend-preserving bias correction—the ISI–MIP approach.
pathogenic or with mixed life styles) was calculated in both cases using unrarefied Earth Syst. Dyn. 4, 219–236 (2013).
ITS OTU tables, as the sum of the relative abundance (%) of all the ITS sequences 40. Lawrence, D. M. et al. The land use model intercomparison project (LUMIP)
classified as fungal plant pathogens (that is, the sum of all ITS reads classified as contribution to CMIP6: rationale and experimental design. Geosci. Model
pathogens/all ITS reads × 100 at each soil sample). The total relative abundance Dev. 9, 2973–2998 (2016).
of the potential plant pathogens was highly correlated with the same variable 41. Kim, H. et al. A protocol for an intercomparison of biodiversity and
calculated using a rarefied OTU table for the global field survey (4,500 reads per ecosystem services models using harmonized land-use and climate scenarios.
sample; r = 0.998; P < <0.001) and the field experiment (4,500 reads per sample; Geosci. Model Dev. 11, 4537–4562 (2018).
r = 0.999; P < <0.001), so the choice of not rarefying our data did not affect our 42. Dufresne, J.-L. et al. Climate change projections using the IPSL-CM5 Earth
conclusions. All Gibberella reads were considered as Fusarium in this study for System Model: from CMIP3 to CMIP5. Clim. Dyn. 40, 2123–2165 (2013).
consistency with the most recent classifications55. 43. Hurtt, G. C. et al. Harmonization of land-use scenarios for the period
1500–2100: 600 years of global gridded annual land-use transitions, wood
Additional taxonomic assignment analyses. To further confirm the robustness of the harvest, and resulting secondary lands. Clim. Change 109, 117 (2011).
taxonomic assignments, for each phylotype identified as a putative plant pathogen, 44. Popp, A. et al. Land-use futures in the shared socio-economic pathways.
we performed a BLAST search ([Link] against the Glob. Environ. Change 42, 331–345 (2017).
fungal ITS sequences from the type material, and representative fungal genomes 45. O’Neill, B. C. et al. A new scenario framework for climate change research:
available in GenBank ([Link] We then selected the concept of shared socioeconomic pathways. Clim. Change 122,
the top ten hits for each phylotype, and then re-parsed those matching species with 387–400 (2014).
FUNGuild. A total of 1,574 and 586 OTUs matched, at a 97% identity cutoff, with 46. USGS EROS Archive. Digital Elevation - Global Multi-resolution Terrain
ITS ex-type sequences and representative genomes, respectively (Supplementary Elevation Data 2010 (GMTED2010) (USGS, 2010); [Link]
Data 1), having pathogenic trophic modes (both exclusively pathogenic and mixed centers/eros/science/usgs-eros-archive-digital-elevation-global-multi-
modes). The relative abundance of all the plant pathogens identified using the resolution-terrain-elevation
UNITE fungal database (V7.2)54 was highly correlated to that calculated using 47. Maestre F. T. et al. in Biological Soil Crusts: An Organizing Principle in
GenBank from ITS ex-type (r = 0.96; P < <0.001; 97% cutoff) and representative Drylands (eds Weber, Büdel, B. and Belnap, J.) 407–425 (Springer, 2016).

Nature Climate Change | [Link]/natureclimatechange

NaTUre CliMaTe Change Articles
48. Bowker, M. A. et al. Biological soil crusts (biocrusts) as a model system in English of the manuscript. M.D.-B. is supported by a Ramón y Cajal grant from the
community, landscape and ecosystem ecology. Biodivers. Conserv. 23, Spanish Government (agreement no. RYC2018-025483-I) and a MUSGONET grant
1619–1637 (2014). (LRA17\1193) from the British Ecological Society. F.T.M. also acknowledges funding
49. Castillo-Monroy, A. P. et al. Biological soil crusts modulate nitrogen from Generalitat Valenciana (CIDEGENT/2018/041) and from sDiv, the synthesis centre
availability in semi-arid ecosystems: insights from a Mediterranean grassland. of the German Centre for Integrative Biodiversity Research Halle–Jena–Leipzig (iDiv).
Plant Soil 333, 21–34 (2010). Work on microbial distribution and colonization in the B.K.S. laboratory is funded by
50. Maestre, F. T. et al. Changes in biocrust cover drive carbon cycle responses the Australian Research Council (DP190103714). B.K.S. also acknowledges a research
to climate change in drylands. Glob. Change Biol. 19, 3835–3847 (2013). award by the Humboldt Foundation. C.A.G. and N.E. acknowledge support from iDiv,
51. De Castro, M. et al. Evaluación Preliminar de los Impactos en España por funded by the German Research Foundation (DFG FZT118) through flexpool proposals
Efecto del Cambio Climático (Ministerio Medio Ambiente, 2005). 34600850 and 34600844. N.E. also acknowledges support from the ERC under the
52. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. European Union’s Horizon 2020 research and innovation programme (grant agreement
Bioinformatics 26, 2460–2461 (2010). no. 677232).
53. Edgar, R. C. UNOISE2: improved error-correction for Illumina 16S and ITS
amplicon sequencing. Preprint at [Link] (2016).
54. Kõljalg, U. et al. UNITE: a database providing web-based methods for the Author contributions
molecular identification of ectomycorrhizal fungi. New Phytol. 166, M.D.-B. developed the original idea of the analyses presented in the manuscript.
1063–1068 (2005). M.D.-B, F.T.M. and B.K.S. led the global survey. F.T.M. designed the field warming
55. Geiser, D. M. et al. One fungus, one name: defining the genus Fusarium in a experiment and has maintained it over the years. Lab analyses were done by M.D.-B.,
scientifically robust way that preserves longstanding use. Phytopathology 103, C.C.-D., E.E., F.T.M. and B.K.S. Bioinformatic analyses were done by B.K.S., J.-T.W.
400–408 (2013). and E.E. Statistical modelling, mapping and data interpretations were done by C.A.G.,
56. Kulik, T. et al. Quantification of Alternaria, Cladosporium, Fusarium and N.E. and M.D.-B. The manuscript was written by M.D.-B. with contributions from
Penicillium verrucosum in conventional and organic grains by qPCR. all the co-authors.
J. Phytopathol. 163, 522–528 (2015).
57. Delgado-Baquerizo, M. et al. The Proportion of Soil-borne Pathogens Increases Competing interests
with Warming at the Global Scale [Link] The authors declare no competing interests.
11484747 (2020).

Acknowledgements Additional information

This project received funding from the European Union’s Horizon 2020 research and Supplementary information is available for this paper at [Link]
innovation programme under the Marie Sklodowska-Curie grant agreement No 702057 s41558-020-0759-3.
and the European Research Council (ERC) grant agreements no. 242658 (BIOCOM) and Correspondence and requests for materials should be addressed to M.D.-B.
no. 647038 (BIODESERT). We thank R. D. Bardgett, N. Fierer, A. Benavent-González
and D. J. Eldridge for their original contributions to the global survey, and V. Ochoa, Peer review information Nature Climate Change thanks Leho Tedersoo and the other,
C. Escolar, P. Alonso, B. Gozalo and S. Ochoa for maintaining the warming experiment anonymous, reviewer(s) for their contribution to the peer review of this work.
and for their help with laboratory analyses. We also thank M.S. Martin for revising the Reprints and permissions information is available at [Link]/reprints.

Nature Climate Change | [Link]/natureclimatechange

 nature research | reporting summary
Corresponding author(s): Manuel Delgado Baquerizo
Last updated by author(s): 2019/10/28

Reporting Summary
Nature Research wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency
in reporting. For further information on Nature Research policies, see Authors & Referees and the Editorial Policy Checklist.

Statistics
For all statistical analyses, confirm that the following items are present in the figure legend, table legend, main text, or Methods section.
n/a Confirmed
The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement
A statement on whether measurements were taken from distinct samples or whether the same sample was measured repeatedly
The statistical test(s) used AND whether they are one- or two-sided
Only common tests should be described solely by name; describe more complex techniques in the Methods section.

A description of all covariates tested

A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons
A full description of the statistical parameters including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient)
AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)

For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted
Give P values as exact values whenever suitable.

For Bayesian analysis, information on the choice of priors and Markov chain Monte Carlo settings
For hierarchical and complex designs, identification of the appropriate level for tests and full reporting of outcomes
Estimates of effect sizes (e.g. Cohen's d, Pearson's r), indicating how they were calculated
Our web collection on statistics for biologists contains articles on many of the points above.

Software and code

Policy information about availability of computer code
Data collection We conducted a global field survey (235 locations in six continents) and a nine-year field warming experiment. Data collection
information is included in the method section of our manuscript.

Data analysis For Bioinformatic analysis, a combination of USEARCH and UNOISE were used. The rest of the analysis were made with R. 3.6.1.
For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors/reviewers.
We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.

Data
Policy information about availability of data
All manuscripts must include a data availability statement. This statement should provide the following information, where applicable:
- Accession codes, unique identifiers, or web links for publicly available datasets
- A list of figures that have associated raw data
- A description of any restrictions on data availability

All the materials, raw data, and protocols used in the article are available upon request and without restriction, and all data will be made publicly available in a
October 2018

public repository (Figshare) upon publication.

1
 nature research | reporting summary
Field-specific reporting
Please select the one below that is the best fit for your research. If you are not sure, read the appropriate sections before making your selection.
Life sciences Behavioural & social sciences Ecological, evolutionary & environmental sciences
For a reference copy of the document with all sections, see [Link]/documents/[Link]

Ecological, evolutionary & environmental sciences study design

All studies must disclose on these points even when the disclosure is negative.
Study description Here, we conducted a global field survey across 235 natural ecosystems from six continents and collected data from a nine-year
warming field experiment to evaluate how temperature regulates the prevalence (relative abundance) of putative soil-borne fungal
plant pathogens.

Research sample Soils collected from 235 natural ecosystems from six continents, and from a nine-year warming field experiment

Sampling strategy Global survey. We conducted a global survey to identify the ecological drivers and the current and future distribution of potential
soil-borne plant pathogens in worldwide soils.

Field experiment. We used a nine-year manipulative warming field experiment to provide further experimental evidence for a
potential link between warming and the relative abundance of soil pathogens. This experiment is being conducted on a dryland
ecosystem located in the center of the Iberian Peninsula (40°01'55.7"N 3°32'48.3"W; 590 m.a.s.l.).

Data collection Global survey. Bulk soils were collected from 235 ecosystems located in 18 countries from six continents (Extended Data Fig. 1). Soil
samples were sieved upon arrival to the laboratory (2 mm mesh). Then, a portion of soil was immediately frozen at -20 ºC for
molecular analyses, while the rest of the soil was air-dried, and stored for a month, before physicochemical analyses.

Field experiment. Soil samples were collected nine years after the beginning of the experiment from ten plots per combination of
treatments. Three soil samples per plot were sampled with a soil core, which were then bulked to obtain a unique sample per plot.
Soil was sieved (2 mm mesh) and separated into two fractions. A portion of soil was immediately frozen at -20 ºC for molecular
analyses.

Timing and spatial scale Global survey. Sample collection of soils took place between 2003 and 2015. Global Scale.

Field experiment. Sample collection of soils took place in 2017. Local Scale.

Data exclusions N/A

Reproducibility Information about the sampled locations and methods used in this paper are included in our method section

Randomization N/A

Blinding N/A

Did the study involve field work? Yes No

Field work, collection and transport

Field conditions Global survey. Our global survey provides a solid representation for most environmental conditions (e.g., climate, soil and
vegetation types) found on Earth, covering nine biomes (temperate, tropical and dry forests, cold, temperate, tropical and arid
grasslands, shrubland, boreal, Extended Data Fig. 1). For example, mean annual precipitation and temperature in these locations
ranged from 67 to 3085mm and from -11.4º to 26.5ºC, respectively.

Field experiment. We used a nine-year manipulative warming field experiment to provide further experimental evidence for a
potential link between warming and the relative abundance of soil pathogens. This experiment is being conducted on a dryland
ecosystem located in the center of the Iberian Peninsula (40°01'55.7"N 3°32'48.3"W; 590 m.a.s.l.).

Location We conducted a global field survey (235 locations in six continents). See Extended Data Figure 1. The field warming experiment is
located in the center of the Iberian Peninsula (40°01'55.7"N 3°32'48.3"W; 590 m.a.s.l.)
October 2018

Access and import/export Samples were collected by authors in their respective locations and using local permits.

Disturbance This study did not cause any environmental disturbance

2
 nature research | reporting summary
Reporting for specific materials, systems and methods
We require information from authors about some types of materials, experimental systems and methods used in many studies. Here, indicate whether each material,
system or method listed is relevant to your study. If you are not sure if a list item applies to your research, read the appropriate section before selecting a response.

Materials & experimental systems Methods

n/a Involved in the study n/a Involved in the study
Antibodies ChIP-seq
Eukaryotic cell lines Flow cytometry
Palaeontology MRI-based neuroimaging
Animals and other organisms
Human research participants
Clinical data

October 2018