SOLUTIONS TO PROBLEMS

Chapter 1 Since ΔG°′ is positive, the reaction is endergonic under standard

1. An amino or imino group gives a molecule a positive charge; a car- conditions.
−1 −1 −1
boxylate or phosphoryl group gives a molecule a negative charge. 14. Keq = e−ΔG°′/RT = e−(−20,900 J · mol )/(8.314 J · K · mol )(298 K)
2. A Thiol (sulfhydryl) group = 4.6 × 103
B Carbonyl group 15. From Eq. 1-17, Keq = [G6P]/[G1P] = e−ΔG°′/RT
−1 −1 −1
C Amide linkage [G6P] /[G1P] = e−(−7100 J · mol )/(8.3145 J · K · mol )(298 K)
D Phosphoanhydride (pyrophosphoryl) linkage [G6P]/ [G1P] = 17.6
E Phosphoryl group (Pi) [G1P]/ [G6P] = 0.057
F Hydroxyl group 16. The cell membrane must be semipermeable so that the cell can
retain essential compounds while allowing nutrients to enter and
3. Hydrolysis reactions tend to occur with an increase in entropy, be-
wastes to exit.
cause the highly ordered polymer is broken down into separate units.
17. Membrane-enclosed cellular compartments are typical of eukaryotic
4. Typical prokaryotic cells are 1–10 μm in diameter, so T. namibiensis
but not prokaryotic cells.
is about 10–300 times larger (or has 1000 to 27 million times the
volume). Typical eukaryotic cells are 10–100 μm in diameter, so 18. Concentration = (number of moles)/(volume)
T. namibiensis is about the same size or up to 30 times larger (or has Volume = (4/3)π r3 = (4/3)π(5 × 10−7 m)3
the same to 27,000 times the volume). = 5.24 × 10−19 m3 = 5.24 × 10−16 L
5. The data indicate that eukaryotes are more similar to the archaea Moles of protein = (2 molecules)/(6.022 × 1023 molecules · mol−1)
than to the eubacteria. = 3.32 × 10−24 mol
6. (a) Liquid water; (b) ice has less entropy at the lower temperature. Concentration = (3.32 × 10−24 mol)/(5.24 × 10−16 L)
7. (a) Decreases; (b) increases; (c) increases; (d) no change. = 6.3 × 10−9 M = 6.3 nM
8. No. When the change in enthalpy is positive and the change in en- 19. Number of molecules = (molar conc.)(volume) (6.022 ×
tropy is negative, the free energy change for the process is greater 1023 molecules · mol−1)
than zero, which makes the process unfavorable. = (1.0 × 10−3 mol · L−1)(5.24 × 10−16 L)
9. (a) False. A spontaneous reaction occurs in only one direction. (6.022 × 1023 molecules · mol−1)
= 3.2 × 105 molecules
(b) False. Thermodynamics does not specify the rate of a reaction.
20. In order for ΔG to have a negative value (a spontaneous reaction),
(c) True. (d) True. A reaction is spontaneous as long as ΔS > ΔH/T.
TΔS must be greater than ΔH.
10. (a) T = 273 + 10 = 283 K
TΔS > ΔH
ΔG = ΔH − TΔS
T > ΔH/ΔS
ΔG = 15 kJ − (283 K)(0.05 kJ · K−1)
T > 7000 J · mol−1/20 J · K−1 · mol−1
= 15 − 14.15 kJ = 0.85 kJ
T > 350 K or 77°C
ΔG is greater than zero, so the reaction is not spontaneous.
(b) T = 273 + 80 = 353 K [R]
21. (a) Because Keq = = 25, at equilibrium, the concentration of
ΔG = ΔH − TΔS [Q]
ΔG = 15 kJ − (353 K)(0.05 kJ · K−1) R is 25 times greater than the concentration of Q. When equal con-
= 15 − 17.65 kJ = −2.65 kJ centrations of Q and R are mixed, molecules of Q will be converted
ΔG is less than zero, so the reaction is spontaneous. to molecules of R.
11. ΔG = ΔH − TΔS (b) Let x = amount of Q converted to R, so that [R] will be 50 μM +
ΔG = −7000 J · mol−1 − (298 K)(−25 J · K−1 · mol−1) [R]
ΔG = −7000 + 7450 J · mol−1 = 450 J · mol−1 x and [Q] will be 50 μM −x. Since Keq = = 25,
[Q]
The reaction is not spontaneous because ΔG > 0. The temperature 50 + x = 25(50 − x)
must be decreased in order to decrease the value of the TΔS term. 50 + x = 1250 − 25x
[C] 26x = 1200
12. ΔG°′ = −RT ln x = 46.15
[A] [B]
[ R ] = 50 μM + 46.15 μM = 96.15 μM
(0.009) [ Q ] = 50 μM − 46.15 μM = 3.85 μM
= −(8.314 J · K−1 · mol−1 ) (298 K) ln
(0.002) (0.003)
22. At 10°C = 283 K (1/T = 0.00353), Keq = 100 and ln K = 4.61.
= −18,000 J · mol−1 = −18 kJ · mol−1 At 30°C = 303 K (1/T = 0.00330), Keq = 10 and ln K = 2.30.
13. ΔG°′ = −RT ln Keq = −RT ln([C][D]/[A][B]) These two points generate a line on a van’t Hoff plot (ln Keq versus
= −(8.314 J · K−1 · mol−1) (298 K) ln[(3 × 10−6) (5 × 10−6)/ 1/T) with a positive slope that is equal to (−ΔH°/R). ΔH must
(10 × 10−6) (15 × 10−6)] therefore be negative, indicating that enthalpy decreases during the
= 5700 J · mol−1 = 5.7 kJ · mol−1 reaction (heat is given off).

SP-1
SP-2
23. This strategy will not work because Reaction 1 has a negative enthalpy sis bag. At equilibrium, the compositions of the solutions inside and
change, releasing heat, and will therefore become more favorable with outside the dialysis bag are identical. If the membrane were solute-
decreasing temperature, whereas Reaction 2, which has a positive impermeable, essentially all the water would leave the dialysis bag.
enthalpy change, will become less favorable. Thus decreasing the 8. (a) Water will move out of the cell by osmosis, from an area of high
temperature will favor Reaction 1, not Reaction 2. To make Reaction 2 concentration (low solute concentration) to an area of low concen-
more favorable, the temperature must be raised. tration (high solute concentration). (b) Salt ions would undergo a
To calculate the amount that the temperature must be raised, net movement by diffusion from the surrounding solution (high salt
Equation 1-18 may be used as follows: concentration) into the cell (low salt concentration).
−ΔH° 1 ΔS° 9. (a) COO– (b) COO–
ln Keq = +
R ( T ) R CH H C H
K T1 1 −ΔH°1 1 1 NH+3
ln = − ) HC
K T1 2 R ( T1 T2
COO–
K T2 1 −ΔH °2 1 1
ln T2 = − )
K2 R ( T1 T2 10. (a) COO– (b) COO–
On subtraction of the previous two equations, and taking into
H C H H C CH2 COO–
K T2 1
account that T1 = 1, we get NH2 NH+3
K1
K 1T1K T2 2 K T2 2 ΔH °2 − ΔH °1 1 1 11. pH 4, NH+4; pH 8, NH+4; pH 11, NH3.
ln [ T2 T1 ]
= ln = − )
K1 K 2 K1 T2
R ( T1 T2 12. pH 4, H2PO−4; pH 8, HPO24−; pH 11, HPO24−.
13. The increase in [H+] due to the addition of HCl is (50 mL)(l mM)/
K T2 2
We would like T2 = 10. Substituting in all values and solving for (250 mL) = 0.2 mM = 2 × 10−4 M. Because the [H+] of pure water,
T2 we get K1 10−7 M, is relatively insignificant, the pH of the solution is equal
to −log(2 × 10−4) or 3.7.
K 2T2 28,000 + 28,000 1 1
= ln 10 = 2.3 = (298 − T2 ) 14. (a) (0.010 L)(5 mol · L−1 NaOH)/(1 L) = 0.05 M NaOH ≡
ln
K 1T2 8.31
0.05 M OH−
Solving for T2 we get
[H+] = Kw /[OH−] = (10−14)/(0.05) = 2 × 10−13 M
1 pH = −log[H+] = −log(2 × 10−13) = 12.7
T2 = = 332 K
1 2.3 × 8.31 (b) (0.020 L)(5 mol · L−1 HCl)/(1 L) = 0.1 M HCl ≡ 0.1 M H+
−
298 56,000 Because the contribution of 0.010 L × 100 mM/(1 L) = 1 mM glycine
Hence, to increase K2 /K1 from 1 to 10, the temperature must be is insignificant in the presence of 0.1 M HCl,
raised from 298 K to 332 K. pH = −log[ H + ] = −log(0.1) = 1.0

Chapter 2 (c) pH = pK + log([acetate]/[acetic acid])

[acetate] = (5 g)(1 mol/82 g)/(1 L) = 0.061 M
1. (a) Donors: NH1, NH2 at C2, NH9; acceptors: N3, O at C6, N7.
[acetic acid] = (0.010 L)(2 mol · L−1)/(1 L) = 0.02 M
(b) Donors: NH+, NH2 at C4; acceptors: O at C2, N3. (c) Donors:
NH+3 group, OH group; acceptors: COO− group, OH group. pH = 4.76 + log(0.061/0.02) = 4.76 + 0.48 = 5.24
2. From most soluble (most polar) to least soluble (least polar): c, b, e, 15. The pK corresponding to the equilibrium between H2PO−4 (HA)
a, d. and HPO42− (A−) is 6.82 (Table 2-4). The concentration of A− is
(50 mL)(2.0 M)/(200 mL) = 0.5 M, and the concentration of HA is
3. 18 mL of water has a mass of about 18 g; one mole contains
(25 mL)(2.0 M)/(200 mL) = 0.25 M. Substitute these values into
about 6 × 1023 molecules, and the molecular mass of H2O is about
the Henderson–Hasselbalch equation (Eq. 2-10):
18 g · mol−1. Therefore, the spoon holds (18 g)(6 × 1023 molecules ·
mol−1)/(18 g · mol−1) = 6 ×1023 molecules. [ A− ]
pH = pK + log
4. (a) (2.6 × 108 ions)(40 g · mol−1)(1 mol/6 × 1023 ions) = 1.7 × [ HA ]
10−14 g. Because the mass of the ions is 1% the mass of the cell, the 0.5
pH = 6.82 + log
mass of the cell is 100 times greater, or about 1.7 × 10−12 g. 0.25
(b) (2 × 108 molecules)(1 mol/6 × 1023 molecules)(150 g · mol−1) = pH = 6.82 + log 2
5 × 10−14 g pH = 6.82 + 0.30 = 7.12
The fraction of the cell’s mass due to carbohydrates is (5 × 10−14 g)/ 16. Use the Henderson–Hasselbalch equation (Eq. 2-10) and solve for pK:
(1.7 ×10−12 g) = 0.03 or about 3%. [ A− ]
(c) (0.006)(1.7 × 10−12 g)(6 × 1023 molecules · mol−1)(1 mol/5.6 × pH = pK + log
[ HA ]
109 g) = 1
[ A− ]
5. (a) Water; (b) water. pK = pH − log
[ HA ]
6. (a) Micelle, with the polar carboxylate group on the surface; (b) in
the interior of the micelle. 0.2
pK = 6.5 − log
7. Water molecules move from inside the dialysis bag to the surrounding 0.1
seawater by osmosis. Ions from the seawater diffuse into the dialy- pK = 6.5 − 0.3 = 6.2
 SP-3
17. (a) At pH 7.0, [H+] = 10−7 M, so 10−7 moles of water molecules have 28. Ammonia (NH3) is a base, so as it accumulates, the pH increases.
ionized. This is equivalent to (10−7 mol)(6 × 1023 molecules · mol−1) = Oxalic acid (Table 2-4) releases protons to restore the pH to near
6 × 1016 molecules. neutral. Mutant cells that cannot produce the acid cannot neutralize
(b) If the concentration of water is 55.5 M, then there are (55.5 mol) the ammonia and die when the pH rises too high.
(6 ×1023 molecules · mol−1) = 3.3 × 1025 molecules of water in 29. Let HA = sodium succinate and A−= disodium succinate.
1 L. The fraction of ionized molecules is 6 × 1016 molecules)/(3.3 × [A−] + [HA] = 0.05 M, so [A−] = 0.05 M − [HA]
1025 molecules) = 1.8 × 10−9 or 1.8 × 10−7%.
From Eq. 2-10 and Table 2-4,
18. (a) Succinic acid; (b) ammonia; (c) HEPES.
log([A−] /[HA]) = pH − pK = 6.0 − 5.64 = 0.36
19. U, the energy of association of two charged particles, is equal to
Kq1q2/Dr. Because D, the dielectric constant, for a hydrocarbon is [A−]/[HA] = 100.36 = 2.29
<3 and D for H2O is 78.5, U is at least 26 times greater (78.5 ÷ 3) (0.05 M − [HA])/[HA] = 2.29
in benzene than in water. [HA] = 0.015 M
20. The standard free energy change can be calculated using Eq. 1-16 [A−] = 0.05 M − 0.015 M = 0.035 M
and the value of K from Table 2-4.
grams of sodium succinate = (0.015 mol · L−1)(140 g · mol−1) ×
ΔG°′ = −RT ln K (1 L) = 2.1 g
= −(8.314 J · K−1 · mol−1 ) (298 K) ln(3.39 × 10−8 ) grams of disodium succinate = (0.035 mol · L−1)(162 g · mol−1) ×
= 42,600 J · mol−1 = 42.6 kJ · mol−1 (1 L) = 5.7 g

21. A protonated (and therefore positively charged) nitrogen would pro- 30. At pH 4, essentially all the phosphoric acid is in the H2PO−4 form,
mote the separation of charge in the adjacent C—H bond so that and at pH 9, essentially all is in the HPO24− form (Fig. 2-18). There-
the C would have a partial negative charge and the H would have fore, the concentration of OH− required is equivalent to the con-
a partial positive charge. This would make the H more likely to be centration of the acid: (0.100 mol · L−1 phosphoric acid)(0.1 L) =
donated to a hydrogen bond acceptor group. 0.01 mol NaOH required = (0.01 mol)(1 L/5 mol · L−1 NaOH) =
0.002 L = 2 mL.
22. The waxed car is a hydrophobic surface. To minimize its interaction
with the hydrophobic molecules (wax), each water drop minimizes 31. The dissociation of TrisH+ to its basic form and H+ is associated
its surface area by becoming a sphere (the geometrical shape with with a large, positive enthalpy change. Consequently, heat is taken
the lowest possible ratio of surface to volume). Water does not bead up by the reactant on dissociation. When the temperature is lowered,
on glass, because the glass presents a hydrophilic surface with which there is less heat available for this process, shifting the equilibrium
the water molecules interact. This allows the water to spread out. constant toward the associated form (the effect of temperature on the
equilibrium constant of a reaction is given by Eq. 1-18). To avoid
23. The high solute concentration of honey tends to draw water out of this problem, the buffer should be prepared at the same temperature
microorganisms by osmosis, thereby preventing their growth. as its planned use.
24. Option 2 would reduce the NaCl concentration more effectively. For 32. (a) Carboxylic acid groups are stronger acids than ammonium
option 1, the final NaCl concentration in the sample would be groups and therefore lose their protons at lower pH values. This can
initial amount of NaCl (0.05 L)(0.05 M) be seen in Fig. 2-17, where the carboxylic acid group of CH3COOH
= = 0.000624 M is 50% dissociated to CH3COO−+ H+ at pH 4.7 while it is not until
total volume 4.005 L
= 0.624 mM pH 9.25 that the ammonium ion is 50% dissociated to NH3.
For option 2, the NaCl concentration after the first step would be (b) H3N+CH2COOH ⇌ H3N+CH2COO−+ H+ ⇌
H2NCH2COO−+ 2 H+
(0.005 L) (0.5 M) (c) The pK values of glycine’s two ionizable groups are sufficiently
= 0.0025 M
1.005 L different so that the Henderson–Hasselbalch equation (Section
After the second step, the concentration would be 2-2B) adequately describes the behavior of the solution of the diacid
(0.005 L) (0.0025 M) and the monodissociated species.
= 0.0000124 M = 0.012 mM
1.005 L [ A− ]
pH = pK + log
25. The high concentration of bicarbonate in the dialysate means that [ HA ]
some bicarbonate will diffuse from the dialysate across the dialysis 0.02
2.65 = pK + log
membrane into the patient’s blood, where it will combine with and 0.01
neutralize excess protons. pK = 2.65 − 0.3
26. With a pK value of 9.25, ammonia exists in the blood (pH 7.4) as pK = 2.35
NH+4 . The ammonium ion is charged, so it will not easily diffuse
across a hydrophobic membrane.
27. The tomato juice is mildly acidic, with a pH of about 4.4 (Table 2-3).
The protons in the juice react with the calcium carbonate, eventually
producing H2O and CO2, which evaporate, leaving a scar on the
marble surface.
2 H + + CaCO3 → H2CO3 + Ca2+ → H2O + CO2 + Ca2+
SP-4
(d) 12 13. Because each amino acid corresponds to three nucleotides (a codon),
+
– +H a minimum of 90 nucleotides are required. The corresponding gene
OO
H2
C is likely much larger than that, since it must contain additional
NC
H2
10 sequences—before and after the coding sequence—to facilitate tran-
–
pK2 O scription and translation.
+ H 2CO
NC
H3 14. The ∼3-billion base human genome differs between two individuals
8 by 1 nucleotide per 1000. Hence they differ by around 3 × 109/1 ×
103 = 3 million nucleotides.
15. 5′–ACGT–3′ 5′–CGAATC–3′
pH 6
+
3′–TGCAGC–5′ 3′–T TAG–5′
16. (a) AluI, EcoRV, HaeIII, PvuII; (b) HpaII and MspI; (c) BamHI and
BglII; HpaII and TaqI; SalI and XhoI.
4 +
O
– +H 17. In O. tauri, the gene density is 8000 genes/13,000 kb = 0.62, a
C
+ H2 O
NC
value that is somewhat lower than that of the prokaryote E. coli
pK1 H 3
(4300 genes/4639 kb = 0.93) but more than that of the plant A.
2
+ H2 CO
OH thaliana (25,500 genes/119,200 kb = 0.21).
NC
H3 18. The desired clones are colorless when grown in the presence of ampicillin
and X-gal. Nontransformed bacteria cannot grow in the presence of am-
0 0.5 1.0 1.5 2.0 picillin, because they lack the ampR gene carried by the plasmid. Clones
H+ ions dissociated/molecule transformed with the plasmid only are blue, since they have an intact lacZ
gene and produce β-galactosidase, which cleaves the chromogenic sub-
strate X-gal. Clones that contain the plasmid with the foreign DNA insert
Chapter 3 are colorless because the insert interrupts the lacZ gene.
1. Guanosine 5′-diphosphate 19. Use of the enzymes Nar1, BglI, MstI, PvuI, and PvuII would inter-
fere with β-galactosidase production.
2. Adenosine-3′,5′-cyclic monophosphate (cyclic AMP)
3. 20. Use of the enzymes AflIII, HgiEIII, SspI, AatII, EcoO109, and NdeI
NH2 would not interfere with ampicillin resistance or β-galactosidase
CH3
production.
N 21. The genomic library contains DNA sequences corresponding to all
the organism’s DNA, which includes genes and nontranscribed se-
O N quences. A cDNA library represents only the DNA sequences that
are transcribed into mRNA.
H
22. Different cell types express different sets of genes. Therefore, the
5-Methylcytosine
populations of mRNA molecules used to construct the cDNA librar-
4. The resulting base is uracil. ies also differ.
5. (a) Yes; (b) no. 23.
6. (a) No; (b) yes. CH3
HN
7. Since the haploid genome contains 21% G, it must contain 21% C
(because G = C) and 58% A + T (or 29% A and 29% T, because
N
A = T). Each cell is diploid, containing 90,000 kb or 9 × 107 bases. N
Therefore,
N
A = T = (0.29) (9 × 107 ) = 2.61 × 107 bases HO CH2 O N
C = G = (0.21) (9 × 107 ) = 1.89 × 107 bases H H
8. The DNA contains 40 bases in all. Since G = C, there are 7 cyto- H H
sine residues. The remainder (40 – 14 = 26) must be adenine and OH OH
thymine. Since A = T, there are 13 adenine residues. There are no
N6-methyladenosine
uracil residues (U is a component of RNA but not DNA).
9. The high pH tends to eliminate the hydrogen-bonding protons be- 24. Methylation at N6 leaves one amino hydrogen atom available to par-
tween bases, making it easier to separate the strands of DNA. ticipate in hydrogen bonding, so the modified residue would be able
10. At higher NaCl concentrations, there are more Na+ ions to shield to participate in standard base pairing with T or U residues.
the negatively charged DNA backbones, thus reducing electrostatic 25.
repulsions and requiring more energy to separate the strands.
NH2 NH
11. According to the central dogma, DNA serves as a template for RNA
synthesis. The HIV enzyme, called reverse transcriptase, works in H
N N N N
reverse by synthesizing DNA from an RNA template. H H
12. The number of possible sequences of four different nucleotides is 4n N N
where n is the number of nucleotides in the sequence. Therefore, H N H N
(a) 41 = 4, (b) 42 = 16, (c) 43 = 64, and (d) 44 = 256. H H
 SP-5
26. 35. (a) Only single DNA strands of variable length extending from the
NH2 NH remaining primer would be obtained. The number of these strands
would increase linearly with the number of cycles rather than
H H H geometrically.
N N
(b) PCR would yield a mixture of DNA segments whose lengths
correspond to the distance between the position of the primer with
O N H O N H
a single binding site and the various sites where the multispecific
R R primer binds.
36. (a) The first cycle of PCR would yield only the new strand that is
27. The energy of N1 in a purine ring is lowest when it is in its un- complementary to the intact DNA strand, since DNA synthesis can-
charged trivalent form. Thus, protonated and therefore tetravalent not proceed when the template is broken. However, since the new
and positively charged N1 in adenine readily gives up its proton to strand has the same sequence as the broken strand, PCR can proceed
water (has a low pK value) to yield its uncharged trivalent form. In normally from the second cycle on.
contrast, the trivalent N1 of neutral guanine resists donating its pro-
(b) DNA synthesis would terminate at the breaks in the first cycle of
ton to water (has a high pK value) to yield a divalent and therefore
PCR.
negatively charged ion.
37. ATAGGCATAGGC and CTGACCAGCGCC.
28. Unprotonated N3 in cytosine and protonated N3 in uracil are both
trivalent. Consequently, cytosine has a has a lower pK value than 38. (a) If an individual is homozygous (has two copies of the same
uracil. allele) at a locus, then only one peak will appear in the electropho-
retogram (for example, the D3S1358 locus from Suspect 2).
29.
(b) Suspect 3, whose alleles exactly match those from the blood
H
stain, is the most likely source of the blood.
N O H N N (c) Analysis of each of the three STR loci in this example shows a
match between the sample and Suspect 3, and no matches with the
N N other suspects. In practice, however, multiple loci are analyzed in
N H N
H H order to minimize the probability of obtaining a match by chance.
N N (d) The peak heights are higher for Suspect 1 compared to Suspect 4,
Hypoxanthine Adenine suggesting that more DNA was available for PCR amplification
30. from Suspect 1.
H
Chapter 4
N O H N
1. Gly and Ala, Ser and Thr; Val, Leu and Ile; Asn and Gln; Asp and Glu.
N N H N
2. Arginine, glutamine, and proline.
+
H 3. H3N—CH2—CH2—COO–
N N
4. (a) Taurine lacks a carboxylate group at the carbon atom where the
O
H amino group is attached.
Hypoxanthine Cytosine (b) Taurine is derived from cysteine. The sulfhydryl group of the
Cys side chain has been oxidized to a sulfonic acid group, and the
31. (a) Newly synthesized chains would be terminated less frequently,
α-carboxylate group has been removed.
so the bands representing truncated fragments on the sequencing gel
would appear faint. 5. N
(b) Chain termination would occur more frequently, so longer frag-
HN
ments would be less abundant. COO–
32. (a) The amount of DNA synthesis would decrease and the resulting
CH2 H CH2
gel bands would appear faint. +
(b) No effect. H3N C C N C COO–
33. The C. elegans genome contains 97,000 kb, so H O H
f = 5/97,000 = 5.2 × 10−5
6. The first residue can be one of the five residues, the second one of
Using Eq. 3-2, the remaining four, etc.
N = log(1 − P)/log(1 − f )
N = log(1 − 0.99)/log(1 − 5.2 × 10−5 ) N = 5 × 4 × 3 × 2 × 1 = 120
N = −2/(−2.24 × 10−5 ) = 8.91 × 104 7. Hydrogen bond donors: α-amino group, amide nitrogen. Hydrogen
34. Use Equation 3-1 to calculate P, given N = 5000 and f = 250 kb/ bond acceptors: α-carboxylate group, amide carbonyl.
2,500,000 kb = 10–4. 8. The negatively charged aspartate —COO– group helps “pull” a hy-
P = 1 − (1 − f ) N drogen ion from the hydroxyl group of the serine side chain.
= 1 − (1 − 10−4 ) 5000 9. (a) +1; (b) 0; (c) –1; (d) –2.
= 0.39 10. (a) +2; (b) +1; (c) 0; (d) –1.
The probability that you have cloned the desired DNA segment is 11. (a) chiral; (b) nonchiral; (c) chiral; (d) chiral; (e) nonchiral; (f) chiral;
less than 40%. (g) chiral.
SP-6
12. 4-1D). The pI is approximately midway between the pK’s of the
O O– O O– O O– two ionizations involving the neutral species (the pK of Asp and the
C C C N-terminal pK):
+
H3N C H H C H H C H 1
O O
pI ≈ (3.90 + 8.0) ≈ 5.95
H C CH3 H C C H C C plane of 2
O– O– symmetry
H C H HO C H H C H (b) The net charge at pH 7.0 is 0 (as drawn above).
H C H C C 26. At position A8, duck insulin has a Glu residue, whereas human insu-
O O– O O– lin has a Thr residue. Since Glu is negatively charged at physiologi-
H
cal pH and Thr is neutral, human insulin has a higher pI than duck
13. (a) Glutamate; (b) aspartate insulin. (The other amino acids that differ between the proteins do
14. Decarboxylation of L-DOPA yields dopamine (see Fig. 4-15). not affect the pI because they are uncharged.)
15. Glutamate
27.
COO– COO–
16. O
+ +
H3N C H H C NH3
CH2 O P O–
H C OH HO C H
O–
17. Isopeptide bonds can form from the side chain amino group of Lys CH3 CH3
and from the side chain carboxylate groups of Asp and Glu.
18.
COO– O COO– COO–
+ +
+
H3N CH CH2 CH2 CH2 CH2 NH C CH CH3 H3N C H H C NH3
+
NH3 HO C H H C OH

19. COO– O CH3 CH3

NH CH CH2 CH2 C
28. COO–
20. –OOC CH CH2 S CH2 CH COO– + Replace with CH3 to
H3N C H
give D -Ala
NH+ 3 NH+ 3
H
21. The polypeptide would be even less soluble than free Tyr, because
most of the amino and carboxylate groups that interact with water 29.
and make Tyr at least slightly soluble are lost in forming the peptide H O CH3 O H O CH3 O H O

bonds in poly(Tyr). R HN C C N C C N C C N C C N C C R′
H H H H
22. (a) The net charge is zero (the N-terminus is positively charged and H H CH2 H CH
the C-terminus is negatively charged). (b) The tripeptide has one H3C CH3
CH
positive and one negative charge. Hydrolysis increases the total
H3C CH3
number of charges to 6: one positively charged ammonium group
and one negatively charged carboxylate group for each of the three 30. (2S,3S)-Isoleucine
alanines.
31. (a) Serine (N-acetylserine); (b) lysine (5-hydroxylysine); (c) methio-
23. (a) pI = (2.35 + 9.87)/2 = 6.11 nine (N-formylmethionine)
(b) pI = (6.04 + 9.33)/2 = 7.68 32. Phosphorylation of Ser, carboxylation of Glu, and acetylation of Lys
(c) pI = (2.10 + 4.07)/2 = 3.08 would lower the pI. Hydroxylation of Pro and methylation of His
24. The relevant ionizable groups for the neutral species are the His side would not greatly affect the pI.
chain (pKR = 6.04) and the Ser amino group (pK2 = 9.21). 33.
N NH
pI = (6.04 + 9.21)/2 = 7.62

This value is only an estimate because the pK values of ionizable O CH2

groups in free amino acids are not the same as the pK values of the
+H N COO–
groups in amino acid residues. 3 CH2 CH2 C NH CH
25.
O O O O O 34. (a) +2, (b) +1, (c) 0, (d) –1. The N-terminus (amino group) has
+
H3N CH C NH CH C NH CH C NH CH C NH CH C NH CH COO – a pK of about 8.0, the C-terminus (carboxylate group) has a pK of
CH3 H C OH CH2 CH2 CH3 (CH2)4 about 4.0, and the imidazole ring has a pK of about 6.0.
CH3 H C CH3 COO– NH+
3

CH3
Chapter 5

(a) The pK’s of the ionizable side chains (Table 4-1) are 3.90 (Asp) and 1. There are 810 or about 1 billion possibilities.
10.54 (Lys); assume that the C-terminal Lys carboxyl group has a 2. Since there are four Cys residues on the A chain and two on the B
pK of 3.5 and the N-terminal Ala amino group has a pK of 8.0 (Section chain, there are 4 × 2 = 8 possible ways to form a single Cys—Cys
 SP-7
linkage between the two chains. This leaves three unlinked Cys resi- (b) Conservative substitutions occur at Position 1 (Asp and Lys, both
dues on the A chain and one unlinked Cys residue on the B chain, charged), Position 10 (Ile and Leu, similar in structure and hy-
so there are 3 × 1 = 3 ways of forming a second Cys—Cys linkage drophobicity), and Position 2 (all uncharged bulky side chains).
between the two chains. Hence there are 8 × 3 = 24 ways of form- Positions 5 and 8 appear to tolerate some substitution.
ing two disulfide bonds between the two chains. Hence there are a (c) The most variable positions are 3, 4, and 7, where a variety of resi-
total of 8 + 24 = 32 ways of disulfide-linking the A and B chains. dues appear.
3. Peptide B, because it contains more Trp and other aromatic residues.
4. Since A = εcl, A = (0.4 mL · mg–1 · cm–1)(2.0 mg/mL)(1 cm) = 0.8 19. A C B

5. Lowering the pH from 7.0 to 5.0 would promote the precipitation

of protein Q because the protein will be least soluble when its net
charge is zero (when pH = pI).
6. Blood circulating at the body’s surface experiences lower tempera-
tures than blood in the core of the body, so proteins with low solu- 20. There are several possibilities, since the lengths of the branches mat-
bility at low temperatures tend to precipitate inside vessels in the ter but not their positions. For example,
skin. The resulting aggregate of insoluble proteins blocks blood flow
through the vessels, which prevents oxygen delivery and kills nearby B A C
cells.
7. (a) Leu, His, Arg. (b) Lys, Val, Glu.
8. At neutral pH, serum albumin (pI = 4.9) is negatively charged, and
ribonuclease A (pI = 9.4) is positively charged. Serum albumin
will therefore flow through a cation exchange column and can be
recovered, while ribonuclease A will interact with the anionic car- 21. Add a salt such as ammonium sulfate to the dilute protein solution
boxymethyl groups and can be recovered later by increasing the salt to reach a final salt concentration that is somewhat higher than the
concentration or increasing the pH. salting-out point for the protein. Centrifuge the solution, collect the
9. The protein behaves like a larger protein during gel filtration, sug- protein precipitate, and then dissolve the precipitate in a small vol-
gesting that it has an elongated shape. The mass determined by ume of buffer.
SDS-PAGE is more accurate since the mobility of a denatured SDS- 22. (a) The supernatant contains 2 M ammonium sulfate, a salt concen-
coated protein depends only on its size. tration that is too high for the cells to survive. (b) Placing the solu-
10. The protein contains two 60-kD polypeptides and two 40-kD poly- tion inside dialysis tubing in a large volume of a low-salt solution
peptides. Each 40-kD chain is disulfide bonded to a 60-kD chain. would allow the ammonium sulfate to diffuse out (see Fig. 2-14),
The 100-kD units associate noncovalently to form a protein with a leaving the desired protein in a low-salt solution that would be com-
molecular mass of 200 kD. patible with the cells used in the assay.
11. The protein aggregates at the higher salt concentration. 23. Because protein 1 has a greater proportion of hydrophobic residues
(Ala, Ile, Pro, Val) than do proteins 2 and 3, hydrophobic interaction
12. The protein appears to be a tetramer of 200-kD subunits. The
chromatography could be used to isolate it.
subunits separate under the denaturing conditions of SDS-PAGE
(giving an apparent mass of 200 kD). Both gel filtration and 24.
ultracentrifugation are performed under nondenaturing conditions, (a)
so the protein behaves as an 800-kD particle.
RNA polymerase
cytochrome c
Absorbance at 280 nm

13. Dansyl chloride reacts with primary amino groups, including the
ε-amino group of Lys residues.
14. (a) Gly; (b) Thr; (c) none (the N-terminal amino group is acetylated
and hence unreactive with Edman’s reagent).
15. The mass of an asparagine (N) residue is 114 g · mol–1 and the
mass of a lysine (K) residue is 128 g · mol–1 (Table 4-1). Since an
intact peptide contains an additional O atom at its C-terminus and
two additional H atoms at its N-terminus, the mass of the penta-
peptide is (4 × 114) + 128 + 16 + 2 g · mol–1 = 602 g · mol–1.
16. Only fragments resulting from a single peptide bond cleavage Elution volume
and containing the positively-charged K residue will be detect-
ed by the mass spectrometer because the charges at the N- and (b)
C-termini residues of each fragment cancel each other. These –
fragments have the sequences NNKNN (the unfragmented but
still positively charged pentapeptide), NNKN, NNK, NKNN, RNA polymerase
and KNN, which have the respective masses 602, 488, 374, 488, Direction
and 374. of
17. Because the side chain of Gly is only an H atom, it often occurs in migration
a protein at a position where no other residue can fit. Consequently,
Gly can take the place of a larger residue more easily than a larger cytochrome c
residue, such as Val, can take the place of Gly.
18. (a) Position 6 (Gly) and Position 9 (Val) appear to be invariant. +
SP-8
25. (a) (b) There are 1 H, 6 K, 11 R, and 1 NH2 at the N-terminus. Therefore,
the maximum number of positive charges that can be obtained is 19.
mg Specific activity 30. (a) From Sample Calculation 5-1 we see that
Purification total 𝛍mol (𝛍mol Mb/mg Fold
step protein Mb total protein) % yield purification M = (p2 − 1) (p1 − 1)/(p2 − p1 )
Therefore
1. Crude 1550 0.75 4.8 × 10–4 100 1
extract M = (1789.2 − 1) (1590.6 − 1)/(1789.2 − 1590.6)
2. DEAE- 550 0.35 6.4 × 10 –4
47 1.3 = (1788.2) (1589.6)/198.6
cellulose = 14,312.8
chromato-
graphy (b) Peak 5 is p1 in our calculation. From Sample Calculation 5-1,
–2
3. Affinity 5.0 0.28 5.6 × 10 80 from 117-fold p1 = (M + z)/z
chromato- affinity overall, 1590.6 = (14312.8 + z)/z
graphy chromato- (87-fold
1590.6z − z = 14312.8
graphy from
(37 overall) affinity z(1590.6 − 1) = 14312.8
chromato- z = 14312.8/1589.6 = 9.00
graphy)
The charge on the fifth peak in the mass spectrum is 9.00.
(b) The DEAE chromatography step results in only a 47% yield, while 31. Gln–Ala–Phe–Val–Lys–Gly–Tyr–Asn–Arg–Leu–Glu
the affinity chromatography step results in an 80% yield from the 32. Asp–Met–Leu–Phe–Met–Arg–Ala–Tyr–Gly–Asn
step before it. The DEAE chromatography step therefore results in
33. Ala Val Cys Arg Thr Gly Cys Lys Asn Phe Leu
the greatest loss of Mb.
(c) The DEAE chromatography step results in a 1.3-fold purification,
while the affinity chromatography step results in a 87-fold purification Tyr Lys Cys Phe Arg His Thr Lys Cys Ser
from the previous step. The affinity chromatography step therefore
results in the greatest purification of Mb. 34. Arg–Ile–Pro–Lys–Cys–Arg–Lys–Phe–Gln–Gln–Ala–Gln–His–
Leu–Arg–Ala–Cys–Gln–Gln–Trp–Leu–His–Lys–Gln–Ala–Asn–
(d) The affinity chromatography step is the best choice for a one-step
Gln–Ser–Gly–Gly–Gly–Pro–Ser
purification of Mb in this example.
26. (a) The extract contains 32 mg · mL–1 × 50 mL = 1600 mg protein
Chapter 6
and has a specific activity of (0.14 μmol–1 · min–1) × [50 mL ×
(1000 μL/mL)/10 μL]/1600 mg = 0.44 μmol–1 · min–1 · mg–1. The 1.
R R
purified fraction contains 50 mg · mL–1 × 10 mL = 500 mg protein H H
and has a specific activity of (0.65 μmol–1 · min–1) × [10 mL ×
Cα Cα
(1000 μL/mL)/10 μL]/500 mg = 1.30 μmol –1 · min –1 · mg –1.
The fold purification therefore is (1.30 μmol –1 · min–1 · mg –1)/ C N
(0.44 μmol–1 · min–1 · mg–1) = 3.0.
O H
(b) The total enzyme activity in the crude extract is (0.14 μmol · min–1/
0.010 mL–1) × 50 mL = 700 μmol · min–1, and the total enzyme 2. There are 10 peptide bonds.
activity in the purified fraction is (0.65 μmol · min–1 / 0.010 mL–1) × 3. The large side chains of the amino acids all project from the side of
10 mL = 650 μmol · min–1, so the % yield is (650 μmol · min–1)/ the helix but would still sterically interfere with each other.
(700 μmol · min–1) × 100 = 93%.
4. (100 residues)(1 α-helical turn/3.6 residues)(5.1 Å/keratin turn) =
27. Thermolysin would yield the most fragments (9) and endopeptidase 142 Å
V8 would yield the fewest (2).
5. The reducing conditions promote cleavage of the disulfide bonds
28. (a) There is one Met, so CNBr, which cleaves polypeptides after Met that cross-link α keratin molecules. This helps the larvae digest the
residues, would produce two peptides, unless Met was the C-terminal wool clothing that they eat.
residue, in which case it would yield one peptide.
6. The residues are 5-hydroxylysine (left) and methionine (right).
(b) There are four possible sites for chymotrypsin to hydrolyze the pep-
7. Collagen’s primary structure is its amino acid sequence, which is a
tide: following Phe, Tyr (twice), and Trp. This would yield five peptides
repeating triplet of mostly Gly–Pro–Hyp. Its secondary structure is
unless one of the residues was at the C-terminus, in which case it would
the left-handed helical conformation characteristic of its repeating
yield four peptides.
sequence. Its tertiary structure is essentially the same as its second-
(c) Four Cys residues form two disulfide bonds. ary structure, as most of the protein consists of one type of second-
(d) Arbitrarily choosing one Cys residue, there are three ways it can ary structure, but with the addition of its side chains. Collagen’s
make a disulfide bond with the remaining three Cys residues. After quaternary structure is the arrangement of its three chains in a right-
choosing one of them, there is only one way that the remaining two handed triple helix.
Cys residues can form a disulfide bond. Thus there are 3 × 1 = 3 8. Because collagen has such an unusual amino acid composition
possible arrangements of the disulfide bonds. (almost two-thirds consists of Gly and Pro or Pro derivatives), it
29. (a) The positive charges are caused by the protonation of basic contains relatively fewer of the other amino acids and is therefore
side chains (H, K, and R) and the N-terminal amino groups of the not as good a source of amino acids as proteins containing a greater
protein. variety of amino acids.
 SP-9
9. A fibrous protein such as α keratin does not have a discrete globular 23. Peptide c is most likely to form an α helix with its three charged resi-
core. Most of the residues in its coiled coil structure are exposed to dues (Lys, Glu, and Arg) aligned on one face of the helix. Peptide a
the solvent. The exception is the strip of nonpolar side chains at the has adjacent basic residues (Arg and Lys), which would destabilize
interface of the two coils. a helix. Peptide b contains Gly and Pro, both of which are helix-
10. Yes, although such irregularity should not be construed as random. breaking (Table 6-1).
11. In a protein crystal, the residues at the end of a polypeptide chain 24. The presence of Gly and Pro in peptide b would inhibit the forma-
may experience fewer intramolecular contacts and therefore tend to tion of β strands, so peptide b is least likely to form a β strand.
be less ordered (more mobile in the crystal). If their disorder pre- 25. Each backbone N—H group in an α helix normally forms a hydro-
vents them from generating a coherent diffraction pattern, it may be gen bond to the carbonyl oxygen atom four residues back along
impossible to map their electron density. the chain (toward the N-terminus; Fig. 6-7). Pro, which lacks a
12. (a) Gln; (b) Ser; (c) Ile; (d) Cys. See Table 6-1. backbone N—H group, cannot do so and hence its presence in
13. (a) α; (b) α/β an interior position of an α helix destabilizes the helix through
14. (a) α/β; (b) β the loss of hydrogen bonding to the otherwise carbonyl acceptor.
However, the four most N-terminal residues of an α helix cannot
15. (a) Phe. Ala and Phe are both hydrophobic, but Phe is much larger
donate hydrogen bonds within the α helix. In addition, the pyr-
and might not fit as well in Val’s place.
rolidine ring of a Pro residue in the interior of an α helix sterically
(b) Asp. Replacing a positively charged Lys residue with an oppo- interferes with the residue one turn towards the N-terminus. Pro
sitely charged Asp residue is likely to be more disruptive. residues in the N-terminal turn of an α helix do not have such
(c) Glu. The amide-containing Asn would be a better substitute for steric clashes. Hence Pro residues can occupy the N-terminal turn
Gln than the acidic Glu. of an α helix.
(d) His. Pro’s constrained geometry is best approximated by Gly, 26. (a) C4 and D2; (b) C6 and D3.
which lacks a side chain, rather than a residue with a bulkier side
27. D6
chain such as His.
28. Causing a protein solution to foam greatly increases the area of the
16. A polypeptide synthesized in a living cell has a sequence that has
air–solution interface. Protein molecules at this interface have one
been optimized by natural selection so that it folds properly (with
side out of contact with water. Consequently, that side is not stabi-
hydrophobic residues on the inside and polar residues on the out-
lized by hydrophobic bonding. Such protein molecules are destabi-
side). The random sequence of the synthetic peptide cannot direct
lized so that they easily denature.
a coherent folding process, so hydrophobic side chains on different
molecules aggregate, causing the polypeptide to precipitate from 29. No.
solution. 30. Hydrophobic effects, van der Waals interactions, and hydrogen
17. The brains of the Alzheimer’s-prone mice were already burdened bonds are destroyed during denaturation. Covalent cross-links are
with accumulated Aβ, so the PrPSc aggregation augmented the brain retained.
damage, leading to earlier onset of symptoms than in mice whose 31. At physiological pH, the positively charged Lys side chains repel
brains were not already damaged by Aβ accumulation. (There is each other. Increasing the pH above their pK (>10.5) would neutral-
also some evidence that Aβ oligomers may interact directly with ize the side chains and allow an α helix to form.
PrP.) 32. Intrinsically disordered polypeptide segments would contain rela-
18. The formation of hydrogen-bonded β strands in and between the tively more hydrophilic residues because such structures would be
proteins makes it difficult to solubilize individual protein molecules. extended and exposed to aqueous solution. Hydrophobic groups
Furthermore, this stable but nonnative structure may not revert would tend to aggregate with each other or with other hydrophobic
easily to a native or functional structure. substances in the cell.
19. O 33. The molecular mass of O2 is 32 D. Hence the ratio of the masses of
hemoglobin and 4 O2, which is equal to the ratio of their volumes,
is 65,000/(4 × 32) = 508. The 70-kg office worker has a volume
of 70 kg × 1 cm3/g × (1000 g/kg) × (1 m/100 cm)3 = 0.070 m3.
NH Hence the ratio of the volumes of the office and the office worker
is (4 × 4 × 3)/0.070 = 686. These ratios are similar in magnitude,
O
which you may not have expected.
Pyroglutamate
34. (a) Each codon corresponds to an amino acid. The proba-
20. In forming the lactam, the positive charge of the N-terminal amino bility that the first residue is correct is 1 – 5 × 10–4 = 0.9995.
group and the negative charge of the glutamate side chain are lost. Hence the probability that the entire 500-residue polypeptide is
The resulting protein is less soluble and therefore more prone to correctly synthesized is (0.9995)500 = 0.78, so that the fraction
aggregate. of polypeptides containing at least one incorrect amino acid is
21. (a) 3.613; (b) steeper. 1 – 0.78 = 0.22.
22. (a) The first and fourth side chains of the two helices of a coiled (b) For a 2000-residue polypeptide the fraction that is correctly syn-
coil form buried hydrophobic interacting surfaces, but the remaining thesized is (0.9995)2000 = 0.37, so that the fraction of polypeptides
side chains are exposed to the solvent and therefore tend to be polar containing at least one incorrect residue is 1 – 0.37 = 0.63.
or charged. 35. (a) In one subunit there are 386 residues, each with a (1 – 1/3000)
(b) Although the residues at positions 1 and 4 in both sequences probability of being correctly inserted. For the entire subunit this
are hydrophobic, Trp and Tyr are much larger than Ile and Val and is (1 – 1/3000)386 = 0.879. For the entire coat of 180 subunits, the
would therefore not fit as well in the area of contact between the two number of subunits that will have to be synthesized, on average, to
polypeptides in a coiled coil. form a perfect coat is 180/0.879 = 205.
SP-10
(b) If the coat were one polypeptide chain, it would have 180 × 386 = 1.0
69,480 residues. The probability of such a coat being perfectly (a) Monomeric protein:
synthesized is (1 – 1/3000)69480 = 8.71 × 10–11. Consequently, 0.8 hyperbolic saturation curve
1/(8.71 × 10–11) = 1.14 × 1010 coats would have to be synthesized
in order to obtain an average of one perfect coat. 0.6
36. At elevated temperatures, more protein denaturation is likely, so it is Y
advantageous for a cell to increase the rate at which it can eliminate 0.4
these nonfunctional and possibly toxic proteins.
(b) Cooperative oligomeric
37. Oxidation can cause a protein to unfold, so cells increase the pro- 0.2 protein: sigmoidal
duction of heat shock proteins to help the damaged proteins refold. saturation curve
Under the same conditions, the level of reduced glutathione (GSH) 0
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7
decreases and the level of oxidized glutathione (GSSG) increases as [Ligand] (mM)
oxidized proteins are restored to a reduced state.
38. An α helix can readily form by a local collapse of a folding poly- 3. For hemoglobin, p 50 = 26 torr. Let the Hill constant, n, equal 3.
peptide because its hydrogen bonding donors (the backbone N—H
groups) are in close proximity to their hydrogen bonding acceptors (p O2 ) n
YO2 =
Ê

(the backbone carbonyl oxygen atoms four residues toward the (p50 ) n + (p O2 ) n
Ê

N-terminus). However, β sheets consist of two or more covalently

distant polypeptide strands. The probability of such an assembly (a)
forming at random during the early stages of folding is much less (20) 3 8000
than the probability that the hydrogen bonding groups of an α helix YO2 = = = 0.31
(26) 3 + (20) 3 17,576 + 8000
will find each other in this manner.
39. The GroEL/ES system behaves analogously to a wheel equipped (b)
with a ratchet that only permits the wheel to rotate in one direc- (40) 3 64,000
tion. Thus, in Step 1 of Fig. 6-45, the binding of GroES to the YO2 = = = 0.78
(26) 3 + (40) 3 17,576 + 64,000
GroEL–(ATP)7 complex to yield the cis ring induces conforma-
tional changes in GroEL that ensure the hydrolysis of the ATP (c)
bound to the cis rings, while preventing the binding of ATP to the (60) 3 216,000
trans ring. The ensuing hydrolysis of the cis ring-bound ATP to YO2 = = = 0.92
(26) 3 + (60) 3 17,576 + 216,000
ADP + Pi and the subsequent release of Pi in Step 2 weakens these
interactions, thereby permitting 7ATP to bind to the trans ring in 4. Let the Hill constant, n, equal 3 and use Equation 7-8 to solve for
Step 3. The resulting conformational changes in GroEL further p 50.
weaken the interactions in the cis ring, leading to the release of (pO2 ) n
its bound 7ADP + GroES in Step 4. At this point, the cis and YO2 =
(p50 ) n + (pO2 ) n
trans rings of GroEL have exchanged roles and the cycle repeats.
What prevents this process from going backward (the ratchet) are: (pO2 ) n
(p50 ) n + (pO2 ) n =
in Step 1, the free energy of binding of GroES to the cis ring of YO2
GroEL; in Step 2, the irreversibility of ATP hydrolysis; in Step 3,
(pO2 ) n
the free energy of binding of ATP to the trans ring of GroEL; and (p50 ) n = − (pO2 ) n
in Step 4, the low affinity of the GroEL cis ring for GroES and YO2
ADP. Thus, all four steps are irreversible (exergonic). The free (25) 3 15,625
energy for this process is ultimately supplied by the irreversible (p50 ) 3 = − (25) 3 = − 15,625
82 82
hydrolysis of the ATP.
(p50 ) 3 = 3429.9
Chapter 7 p50 = 15 torr
1.
5. (a) Vitamin O is useless because the body’s capacity to absorb oxy-
1.0 gen is not limited by the amount of oxygen available, but by the abil-
ity of hemoglobin to bind and transport O2. Furthermore, oxygen
0.8 is normally introduced into the body via the lungs, so it is unlikely
that the gastrointestinal tract would have an efficient mechanism for
0.6 extracting oxygen.
Y (b) The fact that oxygen delivery in vertebrates requires a dedicated
0.4 O2-binding protein (hemoglobin) indicates that dissolved oxygen by
K = 0.6 mM
itself cannot attain the high concentrations required. Moreover, a few
0.2 drops of vitamin O would make an insignificant contribution to the
amount of oxygen already present in a much larger volume of blood.
0
0 1 2 3 4 5 6 7 6. High-altitude adaptation includes the production of additional red
[Ligand] (mM) blood cells, which would increase the oxygen-delivery capacity of
the body at both high and low altitude. The production of red blood
2. Set b describes sigmoidal binding to an oligomeric protein and cells requires several weeks, so a day or two at high elevation would
hence represents cooperative binding. not provide much advantage for the runner.
 SP-11
7. (a) Lower; (b) higher. The Asp 99β → His mutation of hemoglobin 20. (a) 12; (b) 60
Yakima disrupts a hydrogen bond at the α1–β2 interface of the T 21. According to Eq. 7-6,
state (Fig. 7-9a), causing the T ⇌ R equilibrium to shift toward p O2
YO2 =
Ê

R state (lower p50). The Asn 102β → Thr of hemoglobin Kansas

K + p O2
causes the opposite shift in the T ⇌ R equilibrium by abolishing
Ê

an R-state hydrogen bond (Fig. 7-9b). When pO2 = 10 torr,

8. (a) Because the mutation destabilizes the T conformation of 10
hemoglobin Rainier, the R (oxy) conformation is more stable. YO2 = = 0.78
2.8 + 10
Therefore, the oxygen affinity of hemoglobin Rainier is greater
than normal. When pO2 = 1 torr,
(b) The ion pairs that normally form in deoxyhemoglobin absorb pro- 1
YO2 = = 0.26
tons. The absence of the ion pairs in hemoglobin Rainier decreases 2.8 + 1
the Bohr effect (in fact, the Bohr effect in hemoglobin Rainier is about
The difference in YO2 values is 0.78 – 0.26 = 0.52. Therefore, in ac-
half that of normal hemoglobin).
tive muscle cells, myoglobin can transport a significant amount of
(c) Because the R conformation of hemoglobin Rainier is more O2 by diffusion from the cell surface to the mitochondria.
stable than the T conformation, even when the molecule is not
22. Using Equation 7-8 and a p50 value of 26 torr to calculate a frac-
oxygenated, O2-binding cooperativity is reduced. The Hill con-
tional saturation shows that when pO2 = 10 torr,
stant of hemoglobin Rainier is therefore less than that for normal
hemoglobin. 10
YO2 = = 0.27
9. The increased BPG helps the remaining erythrocytes deliver 26 + 10
O2 to tissues. However, BPG stabilizes the T conformation of When pO2 = 1 torr,
hemoglobin, so it promotes sickling and therefore aggravates the
disease. 1
YO2 = = 0.03
10. (a) A Lys residue is positively charged and therefore would not 26 + 1
bind in the hydrophobic pocket to which the side chain of Val 6 in The difference in these quantities, 0.27 − 0.03 = 0.24, is relatively
hemoglobin S binds (as is also the case for the negatively charged small [about half of the 0.52 difference exhibited by normal myoglo-
Glu 6 in normal hemoglobin). Hence, hemoglobin C does not bin (p50 = 2.8 torr) under the same conditions; see Problem 21] and
polymerize as does hemoglobin S. (b) The shorter lifetime of red hence this hypothetical myoglobin would be relatively ineffective in
blood cells containing hemoglobin C would reduce the time that facilitating the diffusion of O2.
Plasmodium can spend inside the cell, thereby helping to limit 23.
infection by the parasite. 1.0
11. Myosin is both fibrous and globular. Its two heads are globular, with
several layers of secondary structure. Its tail, however, consists of a
lengthy, fibrous coiled coil.
12. Each cell of striated muscle is a muscle fiber with numerous sarco-
meres positioned end-to-end. If cytokinesis occurred more frequently, Y 0.5
individual muscle cells would be much shorter. Sarcomeres located in
separate small cells would likely not align optimally, and the overall
shortening of the muscle would be less.
13. Because many myosin heads bind along a thin filament where it
overlaps a thick filament, and because the myosin molecules do not 0
execute their power strokes simultaneously, the thick and thin fila- pO2
ments can move past each other by more than 100 Å in the interval
between power strokes of an individual myosin molecule. 24. The Hill constant most likely has a value between 1 (no cooperativ-
14. In the absence of ATP, each myosin head adopts a conformation that ity) and 2 (infinite cooperativity between the two subunits).
does not allow it to release its bound actin molecule. Consequently, 25. (a) Hyperventilation eliminates CO2, but it does not significantly
thick and thin filaments form a rigid cross-linked array. affect the O2 concentration, since the hemoglobin in arterial blood is
15. Because cell volume is constant, the sarcomeres must widen as they already essentially saturated with oxygen.
shorten. As a result, the distance from each myosin head to its bind- (b) The removal of CO2 also removes protons, according to the reaction
ing site on an actin filament increases, diminishing the ability of the
myosin heads to pull on the thin filament. H+ + HCO−
3 ⇌ H2O + CO2
16. Actin is normally sequestered within cells. When an intracellular
infection kills the host cell, the actin is released, alerting the immune The resulting increase in blood pH would increase the O2 affinity
system to the presence of the pathogen. of hemoglobin through the Bohr effect. The net result would be
that less oxygen could be delivered to the tissues until the CO2 bal-
17. (a) 150–200 kD; (b) 150–200 kD; (c) ∼23 kD and 53–75 kD
ance was restored. Thus, hyperventilation has the opposite of the
18. The fish IgM molecule has the structure (H2L2)4J. intended effect (note that since hyperventilation suppresses the urge
Total mass = 4[(2 × 70 kD) + (2 × 25 kD)] + 15 kD = 775 kD to breathe, doing so may cause the diver to lose consciousness due
19. The loops are on the surface of the domain, so they can tolerate more to lack of O2 and hence drown).
amino acid substitutions. Amino acid changes in the β sheets would 26. As the crocodile remains under water without breathing, its metabo-
be more likely to destabilize the domain. lism generates CO2 and hence the HCO− 3 content of its blood increases.
SP-12
The HCO− 3 preferentially binds to the crocodile’s deoxyhemoglobin, 5.
which allosterically prompts the hemoglobin to assume the deoxy H
conformation and thus release its O2. This helps the crocodile stay
under water long enough to drown its prey. H O H HOH2C O H
H
27. In the case of anemia, the Hb that is present functions normally and
H H H H
is presumably present in sufficient quantity to carry the required HO OH H OH
amount of O2 (at least under conditions of low exertion). In the CO
poisoning case, half the O2 binding sites of Hb bind CO essentially OH OH OH OH
irreversibly. This converts most of the Hb to the R state which great-
ly increases its O2 affinity over that of normal Hb. Therefore, at the 6.
tissues, little of the O2 carried by this Hb will be discharged, result- O H
ing in the asphyxiation of the victim. C
28. Since the tense muscle maintains a constant length, its myosin
HO C H
heads cannot “walk” up the actin filaments in a concerted fashion
as they do during muscle contraction. Rather, they “dither,” that is, H C OH
a given myosin head “walks” up a thin filament for a short distance
thereby generating tension and then relaxes thereby releasing the H C OH
thin filament. The myosin head “walking” consumes ATP as it HO C H
does during a normal contraction but the energy is dissipated as
heat since the muscle as a whole is prevented from doing thermo- CH3
dynamic work. L-Fucose

29. Microfilaments consist entirely of actin subunits that are assem-

L-Fucose is the 6-deoxy form of L-galactose.
bled in a head-to-tail fashion so the polarity of the subunits is pre-
served in the fully assembled fiber. In keratin filaments, however, 7.
successive heterodimers align in an antiparallel fashion, so that CH2OH
in a fully assembled intermediate filament, half the molecules are
oriented in one direction and half are oriented in the opposite di- H O OH
rection (Fig. 6-16). H
OH H
30. The newly synthesized microfilaments would have a higher propor- HO H
tion of actin subunits that have not yet hydrolyzed their bound ATP.
Older microfilaments would contain relatively more ADP in the H SH
nucleotide-binding sites of the actin subunits.
31. The antigenic site in the native protein usually consists of several 8.
–2O POCH O
peptide segments that are no longer contiguous when the tertiary 3 2 CH2OH
structure of the protein is disrupted. H HO
32. (a) Fab fragments are monovalent and therefore cannot cross-link H OH
antigens to produce a precipitate. (b) A small antigen has only one
HO H
antigenic site and therefore cannot bind more than one antibody to
produce a precipitate. (c) When antibody is in great excess, most
9. Tagatose is derived from galactose.
antibodies that are bound to antigen bind only one per immunoglob-
ulin molecule. When antigen is in excess, most immunoglobulins 10. Rhamnose is a deoxy sugar (6-deoxy-L-mannose).
bind to two independent antigens. 11.
33. Cleaving the IgA molecules into separate Fab fragments destroys HOCH2
their ability to cross-link antigens. Although the Fab fragments can
O
still bind to the bacteria, the bacteria will not become trapped in a H H H
cross-linked network and can still initiate an infection.
OH HO
34. (a) Normally DNA is intracellular and not accessible to B cells, HO
so no anti-DNA antibodies are produced. For substances such as
phospholipids, which are present on cell surfaces, the body’s self- HOCH2 H H
tolerance mechanisms prevent antibody production. (b) In an au-
O O
toimmune disease such as SLE, there is an essentially unlimited H H
H
supply of antigens, so the resulting antigen–antibody complexes
overwhelm the mechanisms that normally clear the complexes from OH HO CH2
HO O
the body. O
H O
H H H
Chapter 8 HO
HO H
1. (a) 4; (b) 8; (c) 16
H H
2. (a) Yes; (b) no (its symmetric halves are superimposable); (c) no.
3. (a) 12. Galactose is linked to fructose by a β(1→6) bond.
4. (b) 13. One
 SP-13
14. Amylose (it has only one nonreducing end from which glucose can 23. 19. C1 of one glucopyranose can form α or β glycosidic linkages
be mobilized). with C1, C2, C3, C4, or C6 of a second glucopyranose, which can
15. Glucosamine is a building block of certain glycosaminoglycan com- also be in the α or β form. However, α-glucose-(1→1)-β-glucose
ponents of proteoglycans (Fig. 8-12). Boosting the body’s supply of is identical to β-glucose-(1→1)-α-glucose, so the total is 19 rather
glucosamine might slow the progression of the disease osteoarthritis, than 20.
which is characterized by the degradation of proteoglycan-rich articular 24. There are 35 in addition to lactose. The first sugar can form α or
(relating to a joint) cartilage. [Note, however, that clinical trials indicate β glycosidic bonds with C2, C3, C4, or C6 of the second sugar,
that glucosamine does not affect the progress of osteoarthritis.] which can have the α or β form. In this way, glucose can form 16
16. different linkages to galactose, and galactose can form 16 different
COO– linkages to glucose. In addition, the anomeric carbons can link to
each other for four more options, giving a total of 36: α-glucose-
O
H (1→1)-α-galactose, α-glucose-(1→1)-β-galactose, β-glucose-(1→1)-
H α-galactose, and β-glucose-(1→1)-β-galactose.
OH H 25. (a) α-D-glucose-(1→1)-α-D-glucose. (b) The numerous hydrogen-
H O
bonding —OH groups of the disaccharide act as substitutes for
H OH water molecules. Because trehalose is a nonreducing sugar, it is
unlikely to participate in oxidation–reduction reactions with other
17. −200 biomolecules when it is present at high concentrations.
18. The growth factor is rich in Lys and Arg. These positively charged 26.
groups can interact with the negatively charged groups of glycos-
CH2OH
aminoglycans.
19. Cl O H ClCH2 O H
CH2OH + H
NH2
OH H H HO
H O NH C NH CH2 CH2 CH2 H O CH2Cl
H
OH H H OH OH H
HO H
27.
H NHCOCH3
COO– H
20. Either Ser or Thr could undergo O-mannosylation:
H O H O H
H COO–
CH2OH R NH O
OH HO OH HO
O HO H OH
H O CH CH R = H or CH3
H
C O H H H H
OH HO
HO H
28.
H H CH2OH CH2OH

21. HO O H O OH
H H
CH2OH CH2OH O
OH H OH H
HO O H O OH H H H
H H
O H O H OH
OH H OH H
H H H
Gal H
H O H NH
H O
GlcNAc CH3
O C
H
H HO
CH3 OH H
H O
CH3
OH H
H HO
HO H
29. (a) One
OH H (b)
Fuc H3COCH2
22. Each population of glycoprotein molecules is a mixture of gly- H O OH
coforms that differ slightly in size and possibly charge due to the H
heterogeneity in the number and structure of their oligosaccharide OCH3 H
groups. In contrast, the nonglycosylated protein molecules are all HO H
identical and therefore exhibit no variation in their electrophoretic
mobility. H OCH3
SP-14
30. (a) There are four types of methylated glucose molecules, cor- 4. 1-myristoyl-2-palmitoleoyl-3-phosphatidylserine
responding to (1) the residue at the reducing end of the glycogen 5. Of the 4 × 4 = 16 pairs of fatty acid residues at C1 and C3, only 10
molecule, (2) residues at the nonreducing ends, (3) residues at the are unique because a molecule with different substituents at C1 and
α(l→6) branch points, and (4) residues from the linear α(l→4)-linked C3 is identical to the molecule with the reverse substitution order.
segments of glycogen. Type 4 is the most abundant type of residue. However, C2 may have any of the four substituents for a total of
CH2OCH3 4 × 10 = 40 different triacylglycerols.
6. (a) Palmitic acid and 2-oleoyl-3-phosphatidylserine;
H O H
H (b) oleic acid and 1-palmitoyl-3-phosphatidylserine;
OCH3 H (c) phosphoserine and 1-palmitoyl-2-oleoyl-glycerol;
HO OH (d) serine and 1-palmitoyl-2-oleoyl-phosphatidic acid.
H OCH3 7. All except choline can form hydrogen bonds.
8. No; the two acyl chains of the “head group” are buried in the bilayer
31. The cationic Ca2+ ions shield the negative charges of the glycos- interior, leaving a head group of diphosphoglycerol.
aminoglycans in the proteoglycans, so that they can be stored in 9. This lipid is ceramide-1-phosphate, produced by the phosphoryla-
a relatively small volume inside the cell. When the Ca2+ ions are tion of the ceramide derived from a sphingomyelin.
pumped out, the repulsion between the glycosaminoglycan chains 10.
causes them to expand in the extracellular space. O
32. The pores in the peptidoglycan structure allow nutrients to diffuse
OH
through the cell wall to the cell surface, where they can be trans- N
ported across the plasma membrane into the cell. H
33.
11. Eicosanoids synthesized from arachidonic acid are necessary for
intercellular communication. Cultured cells do not need such com-
munication and therefore do not require linoleic acid.
12. The branched and ring-containing fatty acids will increase mem-
brane fluidity because they cannot pack next to other lipids as
efficiently as straight-chain fatty acids.
13. Triacylglycerols lack polar head groups, so they do not orient them-
Reducing end selves in a bilayer with their acyl chains inward and their glycerol
moiety toward the surface.
14. The large oligosaccharide head groups of gangliosides would pre-
vent the necessary close packing of the lipids in a bilayer.
The filled circles represent the glucose residues that can be cleaved
away by β-amylase. The remainder is the limit dextrin. 15. (a) Saturated; (b) long-chain. By increasing the proportion of satu-
rated and long-chain fatty acids, which have higher melting points,
34. The ingestion of an effective intestinal amylase inhibitor with a
the bacteria can maintain constant membrane fluidity at the higher
starch-containing meal would result in the starch being transported,
temperature.
in undigested form, to the colon. There, the bacterial flora, which are
equipped with a large variety of carbohydrate-hydrolyzing enzymes, 16. The icefish has shorter fatty acyl chains and more unsaturated fatty
would readily digest it, with a resulting digestive upset similar to but acyl chains, compared to a tropical fish, in order to maintain mem-
probably more severe than that suffered by individuals with lactose brane fluidity at the low temperatures at which it lives.
intolerance who drink milk. However, since the purported amylase 17. (a) (1 turn/5.4 Å)(30 Å) = 5.6 turns
inhibitor is a protein, it would probably be denatured and partially (b) (3.6 residues/turn)(5.6 turns) = 20 residues
degraded by the high acidity and (acid-resistant) proteolytic en- (c) The additional residues form a helix, which partially satisfies
zymes in the stomach before it enters the intestines. backbone hydrogen bonding requirements, where the lipid head
groups do not offer hydrogen bonding partners.
Chapter 9 18. No. Although the β strand could span the bilayer, a single strand
1. trans-Oleic acid has a higher melting point because, in the solid would be unstable because its backbone could not form the hydrogen
state, its hydrocarbon chains pack together more tightly than those bonds it would form with water in aqueous solution.
of cis-oleic acid. 19. (a) Inner; (b) outer. See Fig. 9-32.
2. The triacylglycerol containing the stearic acid residues yields more 20. Phosphatidylserine is normally present only in the inner leaflet of
energy since it is fully reduced. the cell membrane (see Fig. 9-32). A damaged cell that is no longer
3. spending the energy of ATP to maintain lipid asymmetry will dis-
O play PS on its outer surface and will therefore be consumed by the
macrophage.
O CH2 O C (CH2)14CH3
21. (a)
H3C(CH2)7CH CH(CH2)7 C O CH O O OH

CH2 O P O CH2CH2NH3+ –
O P O CH2 CH CH CH CH (CH2)12 CH3
– –
O O NH3+
 SP-15
(b) To convert sphingomyelin to sphingosine-1-phosphate, a por- 35. Since all subunits must have the same orientation with respect to
tion of the head group (typically choline or ethanolamine) must be the membrane, the only allowed rotational symmetry axes must be
hydrolytically cleaved, leaving a phosphate group, and the amide perpendicular to the membrane plane. This constraint eliminates all
linkage to the fatty acyl group must be hydrolyzed. but cyclic symmetries; that is, C2, C3, C4, etc.
22. The sulfatide is a galactocerebroside. It differs from other cerebro- 36. (a) Type O individuals are universal donors because their red cells do
sides in having a sulfate group covalently linked to C3 of the galac- not carry A or B antigens. Hence, the anti-A antibodies in the plasma
tose group. of types B and O individuals or the anti-B antibodies in the plasma
23. Both DNA and phospholipids have exposed phosphate groups that of types A and O individuals will not agglutinate (cross-link) these
are recognized by the antibodies. cells. Type AB individuals are the universal recipients because their
24. Steroid hormones, which are hydrophobic, can diffuse through the blood plasma contains neither anti-A nor anti-B antibodies so that it
cell membrane to reach their receptors. will not agglutinate the red cells from donors with other blood types.
25. The monosaccharide groups are glucosamine-4-phosphate (left) (b) Blood plasma from type A individuals contains anti-B antibod-
and glucosamine-1-phosphate (right). Four 3-hydroxy-tetradecanoyl ies that agglutinate blood cells from types B and AB individuals.
(β-hydroxy-myristoyl) groups are attached via ester or amide bonds Likewise, type B blood plasma agglutinates blood cells from types
to the glucosamine groups, and two of these chains have additional A and AB individuals. Plasma from type O individuals contains
tetradecanoyl (myristoyl) groups esterified to their hydroxyl groups. anti-A and anti-B antibodies and therefore agglutinates blood cells
from type A, B and AB individuals. However, plasma from type AB
26. The archaeal lipid includes isoprenoid tails whereas phosphatidyl-
individuals lacks both anti-A and anti-B antigens and hence does not
glycerol includes fatty acyl tails. The chains are attached to the glyc-
agglutinate cells from all blood types (A, B, AB, and O).
erol backbone by ether linkages in the archaeal lipid, and by ester
linkages in phosphatidylglycerol. (c) Any anti-A and/or anti-B antibodies in blood that is transfused into
a recipient are rapidly diluted in an “incompatible” recipient's blood to
27. Proteins that are tethered to membranes via N-myristoylation
the point that they do not agglutinate the recipient's blood cells.
would be set free by the action of an enzyme that cleaved away the
N-terminal glycine to which the fatty acyl group was attached.
[This is just one event during infection by Shigella, which produces Chapter 10
∼20 proteins that interfere with host cell function.]
28. The positively charged Arg side chains interact with the two negatively [ glucose] in
charged phosphate groups of cardiolipin. 1. ΔG = RT ln
[ glucose] out
29. (a) Both the intra- and extracellular portions will be labeled. (b) Only
(0.003)
the extracellular portion will be labeled. (c) Only the intracellular por- = (8.3145) J ∙ K−1 ∙ mol−1) (298 K) ln
tion will be labeled. (0.005)
30. The residues of the membrane-spanning helix are underlined: = −1270 J ∙ mol−1 = −1.27 kJ ∙ mol−1
FRYVNGPVLIRKLYSWWNLIMILLQY- 2. (a) ΔG = RT ln ([Na+]in /[Na+]out)
FAIMGNLVMNTGDVNELTANTITT = (8.314 J ∙ K−1 ∙ mol−1) (310 K) ln (0.01/0.15)
31. An overactive endocytic pathway would require large amounts of = (8.314) (310) (−2.71) J ∙ mol−1
membrane material to form the numerous intracellular vesicles. The =−6980 J ∙ mol−1 = −7.0 kJ ∙ mol−1
cell cannot keep up with the demand, so its membranes become at- (b) ΔG = RT ln([Na+]in /[Na+]out) + ZℱΔΨ
tenuated and rupture, which kills the cell. =−6980 + (1)(96,485 J ∙ V−1 mol−1)(−0.06 V)
32. Phospholipase A2 catalyzes hydrolysis of the C2 acyl group in glyc-
=−6980 J ∙ mol−1 −5790 J ∙ mol−1
erophospholipids. The resulting lysophospholipid has a more coni-
cal shape than its parent molecule. Consequently, the bilayer leaflet =−12,770 J ∙ mol−1 =−12.8 kJ ∙ mol−1
will become more convex at that point. Depending on which leaflet 3. Use Equation 10-3 and let Z = 2 and T = 310 K:
is affected, the membrane might be more or less able to flex, which [ Ca2+ ] in
is necessary for the bilayer fusion and separation events that occur (a) ΔG = RT ln + ZℱΔΨ
[ Ca2+ ] out
during endocytosis and exocytosis.
33. The mutant signal peptidase would cleave many preproteins within =(8.314 J ∙ K−1 ∙ mol−1)(310 K) ln (10−7/10−3)
their signal peptides, which often contain Leu–Leu sequences. This + (2)(96,485 J ∙ V−1 ∙ mol−1)(−0.050 V)
would not affect translocation into the ER, since signal peptidase =−23,700 J ∙ mol−1 − 9600 J ∙ mol−1
acts after the signal peptide enters the ER lumen. Proteins lacking =−33,300 J ∙ mol−1 =−33.3 kJ ∙ mol−1
the Leu–Leu sequence would retain their signal peptides. These pro-
The negative value of ΔG indicates a thermodynamically favorable
teins, and those with abnormally cleaved signal sequences, would be
process.
more likely to fold abnormally and therefore function abnormally.
34. For a neuron to repeatedly release neurotransmitters, the compo- [ Ca2+ ] in
(b) ΔG = RT ln + ZℱΔΨ
nents of its exocytotic machinery must be recycled. Following the [ Ca2+ ] out
fusion of synaptic vesicles with the plasma membrane, the four- = (8.314 J ∙ K−1 ∙ mol−1)(310 K) ln (10−7/10−3)
helix SNARE complex is disassembled so that the Q-SNAREs remain
+ (2)(96,485 J ∙ V−1 ∙ mol−1)(+0.150 V)
in the plasma membrane while portions of the membrane containing
R-SNAREs can be used to re-form synaptic vesicles. This recycling = −23,700 J · mol−1 + 28,900 J · mol−1
process would not be possible if the R- and Q-SNAREs remained = +5,200 J · mol−1 = +5.2 kJ · mol−1
associated, and the neuron would eventually be unable to release The positive value of ΔG indicates a thermodynamically unfavorable
neurotransmitters. process.
SP-16
4. ΔG = RT ln ([K+]in /[K+]out) + ZℱΔΨ 17. K+ transport ceases because the ionophore-K+ complex cannot dif-
= (8.314 J ∙ K−1 ∙ mol−1) (310 K) ln (0.14/0.004) fuse through the membrane when the lipids are immobilized in a
+(1)(96,485 J ∙ V−1 ∙ mol−1) (−0.070 V) gel-like state.
= 9163 J ∙ mol−1 − 6754 J ∙ mol−1 18. The number of ions to be transported is
= 2409 J ∙ mol−1 = 2.4 kJ ∙ mol−1 (10 mM) (100 μm3 ) (N)
5. (a) Nonmediated; (b) mediated; (c) nonmediated; (d) mediated. = (0.010 mol · L−1 ) (10−13 L) (6.02 × 1023 ions · mol−1 )
6. The less polar a substance, the faster it can diffuse through the lipid
= 6.02 × 108 ions
bilayer. From slowest to fastest: C, A, B.
7. An eight-stranded β barrel has a solid core. A β barrel with 16 or Since there are 100 ionophores, each must transport 6.02 × 106 ions.
18 strands has a diameter large enough to accommodate a pore for The time required is (6.02 × 106 ions) (1 s/104 ions) = 602 s = 10 min.
solute transport. 19. (a) No; there is no glycerol backbone.
8. Positively charged Lys and Arg would be relatively abundant at the (b) Miltefosine is amphipathic and therefore cannot cross the para-
entrance of the pore, so as to attract the negatively charged phos- site cell membrane by diffusion. Since it is not a normal cell compo-
phate ions and repel cations. nent, it probably does not have a dedicated active transporter. It most
9. The presence of a series of K+ ions within the channel prevents likely enters the cell via a passive transport protein.
water molecules from forming a hydrogen-bonded chain. (c) This amphipathic molecule most likely accumulates in mem-
10. (a) Acetylcholine binding triggers the opening of the channel, an branes, with its hydrophobic tail buried in the bilayer and its polar
example of a ligand-gated transport protein. head group exposed to the solvent.
(b) Na+ ions flow into the muscle cell, where their concentration is (d) The protein recognizes the phosphocholine head group, which
low. also occurs in some sphingolipids and some glycerophospholipids.
(c) The influx of positive charges causes the membrane potential to Since the protein does not bind all phospholipids or triacylglycerols,
increase. it does not recognize the hydrocarbon tail.
11. A channel provides an open pore across the membrane, whereas a 20. (a) A transporter similar to a porin would be inadequate since even
pump operates by changing its conformation in an ATP-dependent a large β barrel would be far too small to accommodate the massive
manner. The additional time required for ATP hydrolysis and protein ribosome. Likewise, a transport protein with alternating conforma-
conformation changes causes ion movement through a pump to be tions would not be up to the task due to its small size relative to the
slower than through a channel. ribosome. In addition, neither type of protein would be suited for
transporting a particle across two membranes. (In fact, ribosomes
12. Overexpression of an MDR transporter would increase the ability of
and other large particles move between the nucleus and cytoplasm
the cancer cell to excrete anticancer drugs. Higher concentrations of
via nuclear pores, which are constructed from many different pro-
the drugs or different drugs would then be required to kill the drug-
teins and form a structure that is much larger than the ribosome and
resistant cells.
spans both nuclear membranes.)
13. In the absence of ATP, Na+ extrusion by the (Na+−K+)–ATPase (b) Ribosomal transport might appear to be a thermodynamically
would cease, so no glucose could enter the cell by the Na+–glucose favorable process, since the concentration of ribosomes is greater
symport. The glucose in the cell would then exit via the passive-me- in the nucleus, where they are synthesized. However, free energy
diated glucose transporter, and the cellular [glucose] would decrease would ultimately be required to establish a pore (which would span
until it matched the extracellular [glucose] (of course, the cell would two membrane thicknesses) for the ribosome to pass through. (In
probably osmotically burst before this could occur). fact, the nucleocytoplasmic transport of all but very small substanc-
14. In order for the protein to function as an antiporter, H+ must move es requires the activity of GTPases that escort particles through the
into the cell, down its concentration gradient (which provides the nuclear pore assembly and help ensure that transport proceeds in
free energy to drive Na+ export). Therefore, the extracellular space one direction.)
has a lower pH (higher H+ concentration). 21. (a) The data do not indicate the involvement of a transport protein,
15. (a) The phosphate transporter is more likely to function like since the rate of transport does not approach a maximum as [X]
the transport protein GLUT1, because a channel large enough increases. (b) To verify that a transport protein is involved, increase
to accommodate phosphate ions would be unable to prevent the [X] to demonstrate saturation of the transporter at high [X], or add
transmembrane movement of smaller ions such as Cl−. (b) The a structural analog of X to compete with X for binding to the trans-
phosphate transporter is a symport system. (c) There are more H+ porter, resulting in a lower flux of X.
ions inside the cell than outside, so phosphate transport cannot be 22. The hyperbolic curve for glucose transport into pericytes indicates a
driven by a pH gradient, which would require a higher extracel- protein-mediated sodium-dependent process. The transport protein
lular [H+]. has binding sites for sodium ions. At low [Na+], glucose transport
16. (a) Xylose moves up its gradient; since protons move down their is directly proportional to [Na+]. However, at high [Na+], all Na+
gradient into the cell, the xylose also moves into the cell. binding sites on the transport protein are occupied, and thus glu-
(b) cose transport reaches a maximum velocity. Glucose transport into
extracellular space endothelial cells is not sodium-dependent and occurs at a high rate
cytosol whether or not Na+ is present. There is not enough information in
T the figure to determine whether glucose transport into endothelial
H+ cells is protein-mediated.
xylose 23. (a) pH = −log[H+] = −log(0.15) = 0.82
The pH of the secreted HCl is more than 6 pH units lower than the
cytosolic pH, which corresponds to a [H+] of ∼4 × 10−8 M.
 SP-17
(b) CO2 + H2O ⇌ HCO−3 + H+ the enzyme-catalyzed reaction approaches the rate of the nonenzy-
(c) matic reaction.
K+ K+
H+ Cl–
‡
ΔGN
a

H+ Cl– G ‡
b ΔGE
‡
ΔGE
c
K+

Reaction coordinate
24. (a) Ammonia is small and uncharged and therefore was expected
to be able to pass across a membrane by simple diffusion. (b) The 7. At 25°C, every 10-fold increase in rate corresponds to a decrease of
ammonia concentration gradient drives ammonia transport (passive- about 5.7 kJ ∙ mol−1 in ΔG‡. For the nuclease, with a rate enhance-
mediated transport). (c) The proton pump is an ATP-requiring active ment on the order of 1014, ΔG‡ is lowered about 14 × 5.7 kJ ∙ mol−1,
transport system. The combination of H+ and NH3 outside the cell or about 80 kJ ∙ mol−1. Alternatively, since the rate enhancement, k,
forms NH+ is given by k = eΔΔGcat /RT ,
‡
4 , which, because it is ionic, is unable to reenter the cell
via the ammonia channel. ln k = ln (1014 ) = Δ ΔG‡cat/8.3145 × (273 + 25)
25. CO2 is converted to carbonic acid, which dissociates to form bicar- Hence Δ ΔG‡cat = 80 kJ · mol −1.
bonate and protons. The protons block the pain signals that would
8. Assuming that the free energy of a low-barrier hydrogen bond is
otherwise be triggered by high [CO2]. This allows the animals to
−40 kJ ∙ mol−1, the rate enhancement would be
tolerate the crowded conditions in its burrows.
Rate enhancement = eΔΔGcat/RT
‡
26. By delaying inactivation of the Na+ channels, the action potential
is prolonged, which leads to greater pain signaling. As a result, a = e(40,000 J · mol
−1
)/(8.314 J · K−1 · mol−1)(298 K)
potential predator, after being stung by the scorpion, is more likely
to let it go than to try eating it. = e16.14
= 107
Chapter 11 9. As the temperature increases, thermal energy boosts the proportion
of reactants that can achieve the transition state per unit time, so the
1. b
rate increases. Above an optimal temperature, the enzyme becomes
2. As shown in Table 11-1, the only relationship between the rates of denatured and rapidly loses catalytic activity (recall that proteins are
catalyzed and uncatalyzed reactions is that the catalyzed reaction typically only marginally stable; Section 6-4).
is faster than the uncatalyzed reaction. The absolute rate of an un-
10. The active form of the enzyme contains the thiolate ion. The increased
catalyzed reaction does not correlate with the degree to which it is
pK would increase the nucleophilicity of the thiolate and thereby in-
accelerated by an enzyme.
crease the rate of the reaction catalyzed by the active form of the en-
3. (a) isomerase (alanine racemase); (b) lyase (pyruvate decarboxylase). zyme. However, at physiological pH, there would be less of the active
4. (a) oxidoreductase (lactate dehydrogenase); (b) ligase (glutamine form of the enzyme and therefore the overall rate would be decreased.
synthetase). 11. Glu has a pK of ∼4 and, in its ionized form, acts as a base catalyst. Lys
5. There are three transition states (X‡) and two intermediates (I). The has a pK of ∼10 and, in its protonated form, acts as an acid catalyst.
reaction is not thermodynamically favorable because the free energy 12. DNA lacks the 2′-OH group required for the formation of the
of the products is greater than that of the reactants. 2′,3′-cyclic reaction intermediate.
‡ 13. Inhibition by various metal ions suggests that urease requires a metal
X1
ion for catalysis, whose replacement by Hg, Co, or Cd inactivates
‡
the enzyme. However, the inhibitory metal ions could also disrupt
X2 the enzyme’s structure by binding somewhere other than the active
site, so this inhibitory effect does not prove that urease acts via metal
ion catalysis. (In fact, urease activity requires two catalytic Ni ions.)
‡
I1 X3 14. The preferential binding of the transition state to an enzyme is an
important (often the most important) part of an enzyme’s catalytic
G mechanism. Hence, the substrate binding site is the catalytic site.
I2
15. The lysozyme active site is arranged to cleave oligosaccharides be-
tween the fourth and fifth residues. Moreover, since the lysozyme
active site can bind at least six monosaccharide units, (NAG)6 would
be more tightly bound to the enzyme than (NAG)4, and this addi-
tional binding free energy would be applied to distorting the D ring
to its half-chair conformation, thereby facilitating the reaction.
Reaction coordinate 16. Although the polymeric chains of cellulose, which are β(1→4)-
linked glucose residues, have the same overall configuration as the
6. The tighter S binds to the enzyme, the greater the value of ΔG‡E. As NAG—NAM repeating disaccharide of lysozyme’s primary substrate
the value of ΔG‡E for reaction c approaches that of ΔG‡N, the rate of peptidoglycan, cellulose chains typically occur in hydrogen-bonded
SP-18
networks, which would make them unavailable to bind in the surface 22. H R′
groove of the enzyme. In addition, the absence of the N-acetyl and R N C O
lactyl groups on the sugar residues would prevent them from fitting
H R″
snugly into the active site, a prerequisite for efficient catalysis.
17. O CH3 O
A H
CH3 S NH CH C CH2Cl

O
H R′
Tosyl-L-alanine chloromethylketone or
R N+ C OH
H3C CH3
O CH O H R″

CH3 S NH CH C CH2Cl –
A
O

Tosyl-L-valine chloromethylketone
H R′
18. (a) Little or no effect; (b) catalysis would be much slower because +
the mutation disrupts the function of the catalytic triad. N C + OH –
R R″
19. His
CH2 Lys A H
CH2
H N CH2 23. The ability of RNA molecules to form complex tertiary structures al-
N CH2 lows them to bind substrates and catalyze reactions through proximity
H CH2 and orientation effects as well as by transition state stabilization, even
N Ser though RNA lacks a wide variety of functional groups. In addition, the
Mg2+ ions that RNA normally binds may also have catalytic functions.
H H CH2 DNA lacks the 2′-OH functional group that is present in RNA. More-
O over, in its double helical form, DNA is conformationally rigid and is
20. The observation that subtilisin and chymotrypsin are genetically therefore unable to form the required complex tertiary structures.
unrelated indicates that their active site geometries arose by con- 24. Two such analogs are
vergent evolution. Assuming that evolution has optimized the cata-
lytic efficiencies of these enzymes and that there is only one optimal _ _
COO COO
arrangement of catalytic groups, any similarities between the ac- O S
tive sites of subtilisin and chymotrypsin must be of catalytic sig-
nificance. Conversely, any differences are unlikely to be catalytically Furan-2-carboxylate Thiophene-2-carboxylate
important.
Both of these molecules are planar, particularly at the C atom to
21. H R′ which the carboxylate is bonded, as is true of the transition state for
the proline racemase reaction.
R N C O
25. Asp 101 and Arg 114 form hydrogen bonds with the substrate mol-
H R″ ecule (Fig. 11-19). Ala cannot form these hydrogen bonds, so the
substituted enzyme is less active.
B 26. The mutations would diminish lysozyme’s activity because the re-
moval or addition of a methylene group would move the Glu and Asp
carboxyl groups from their catalytically most effective positions.
H R′ 27. Yes. An enzyme decreases the activation energy barrier for both the
forward and the reverse directions of a reaction.
–
R N C O 28. As a digestive enzyme, chymotrypsin’s function is to indiscriminately
R″
degrade a wide variety of ingested proteins, so that their component
amino acids can be recovered. Broad substrate specificity would
+
B H be dangerous for a protease that functions outside of the digestive
system, since it might degrade proteins other than its intended target.
29. If the soybean trypsin inhibitor were not removed from tofu, it
would inhibit the trypsin in the intestine. At best, this would reduce
H R′
+ the nutritional value of the meal by rendering its protein indigest-
N C + OH – ible. It might very well also lead to intestinal upset.
R R″ 30. The lysosomal enzymes would be expected to have pH optima of
around 5, corresponding to their environmental pH. Outside the
B lysosome, where the pH is closer to neutral, the enzymes would be
 SP-19
much less catalytically active and therefore unlikely to carry out hy- 6. Only a plot of ln[reactant] versus t gives a straight line, so
drolytic reactions in other parts of the cell. the reaction is first order. The negative of the slope, k, is
31. Activated factor IXa leads, via several steps, to the activation of the fi- 0.17 s−1.
nal coagulation protease, thrombin. The absence of factor IX therefore
slows the production of thrombin, delaying clot formation, and causing
Time (s) ln[Reactant]
the bleeding of hemophilia. Although activated factor XIa also leads
to thrombin production, factor XI plays no role until it is activated by 0 1.69
thrombin itself. By this point, coagulation is already well underway, so
1 1.53
a deficiency of factor XI does not significantly delay coagulation.
2 1.36
32. Factor IX is part of the intrinsic pathway that helps initiate and sus-
tain blood clotting, which explains why a factor IX deficiency leads 3 1.16
to inadequate clotting. Exogenous factor VII can correct the defect 4 0.99
because it bypasses the factor IX–dependent step by activating factor 5 0.83
X directly, which leads to thrombin activation and fibrin formation.

Chapter 12
2.0
1. (a) v = k [ A ]
k = v/ [ A ]
k = (5 μM · min−1 )(20 mM) 1.5

ln [Reactant]
= (0.005 mM · min−1 )(20 mM)
= 2.5 × 10−4 min−1 1.0
(b) The reaction has a molecularity of 1.
2. v = k[ A ] 2 0.5
v = (10−6 M−1 · s−1 ) (0.010 M) (0.010 M)
v = 10−10 M · s−1
1 2 3 4 5
3. From Eq. 12-7, [A] = [A] o e−kt. Since t1/2 = 0.693/k, k = 0.693/
14 d = 0.05 d−1. (a) 7 mmol; (b) 5 μmol; (c) 3.5 μmol; (d) 0.3 μmol. t (s)
4. For a second-order reaction,
t1/2 = 1/k[ A ] o 7.
−3 −1 −1 −6
= 1/(3.6 × 10 M · s ) (6 × 10 M)
= 4.63 × 10 s 7
[P] [ES]
= 4.63 × 107 s(1 h/3600 s) (1 d/24 h) (1 yr/365 d)
= 1.47 yr
5. Only a plot of 1/[reactant] versus t gives a straight line, so the reac-
Time Time
tion is second order. The slope, k, is 0.15 mM−1 · s−1.

Time (s) 1/[reactant](mM−1)

0 0.16
1 0.32 vo
2 0.48
3 0.62
4 0.78 [E] T
5 0.91
8. Enzyme activity is measured as an initial reaction velocity, the ve-
locity before much substrate has been depleted and before much
1.0 product has been generated. It is easier to measure the appearance
of a small amount of product from a baseline of zero product than to
1/[Reactant] (mM–1)

0.8 measure the disappearance of a small amount of substrate against a

background of a high concentration of substrate.
0.6
9. vo = Vmax [S] /(KM + [S] )
0.4 vo /Vmax = [ S ] / (KM + [S] )
0.95 = [S] /(KM + [S] )
0.2
[S] = 0.95 KM + 0.95[ S]
0.05[ S] = 0.95 KM
1 2 3 4 5 [S] = (0.95/0.05)KM = 19 KM
t (s) 10. Acetylcholinesterase, carbonic anhydrase, catalase, and fumarase.
SP-20
11. Construct a Lineweaver–Burk plot. 18. Molecule B is more likely to be a competitive inhibitor because it
more closely resembles the enzyme’s substrate (molecule A).
19. The lines of the double-reciprocal plots intersect to the left of the 1/vo
3
axis (on the 1/[S] axis). Hence, inhibition is mixed (with α = α′).

vo (mM ⋅s)
–1 2 [S] 1/[S] 1/vo 1/vo with I

1 1.00 0.7692 1.2500

__
1

1 2 0.50 0.5000 0.8333

4 0.25 0.3571 0.5882
8 0.125 0.2778 0.4545
–5 0 5 10
1
__ 12 0.083 0.2500 0.4167
(μM –1)
[S]

KM = −1/x-intercept = −1/(−4 μM−1 ) = 0.25 μM 1.4

Vmax = 1/y-intercept = 1/(0.8 mM−1 · s) = 1.25 mM · s−1
12. Set A corresponds to [S] > KM, and set B corresponds to [S] < KM. 1.2
Ideally, a single data set should include [S] values that are both larger
and smaller than KM. 1
with I

1/vo (mM–1 ⴢ min)

Set A Set B
0.8
[S](mM) vo (μM ∙ s−1) [S](mM) vo (μM ∙ s−1)
no I
0.6
2 0.42 0.12 0.17
1 0.38 0.10 0.15 0.4
0.67 0.34 0.08 0.13
0.50 0.32 0.07 0.11 0.2

0
0.4 – 0.4 – 0.2 0 0.2 0.4 0.6 0.8 1 1.2
1/[S] (mM – 1)
Set A
0.3
vo (μM⋅s–1)

20. From Eq. 12-32, α is 3.

α = 3 = 1 + [ I ] /KI = 1 + 5 mM/KI
0.2
KI = 2.5 mM
0.1 Set B 21. Velocity measurements can be made using any convenient unit of
change per unit of time. KM is, by definition, a substrate concen-
tration (the concentration when vo = Vmax/2), so its value does not
0.5 1.0 1.5 2.0 reflect how the velocity is measured.
[S] (mM) 22. (a, b) It is not necessary to know [E]T. The only variables required to
determine KM and Vmax (for example, by constructing a Lineweaver–
13. (a) N-Acetyltyrosine ethyl ester, with the lower value of KM, has Burk plot) are [S] and vo. (c) The value of [E] T is required to calcu-
greater apparent affinity for chymotrypsin. (b) The value of Vmax is late k cat since kcat = Vmax/[E] T.
not related to the value of KM, so no conclusion can be drawn. 23. Comparing the two data points, since a 100-fold increase in substrate
14. Product P will be more abundant because enzyme A has a much concentration only produces a 10-fold increase in reaction velocity, it
lower KM for the substrate than enzyme B. Because Vmax is approxi- appears that when [S] = 100 mM, the velocity is close to Vmax. There-
mately the same for the two enzymes, the relative efficiency of the fore, assume that Vmax ≈ 50 μM · s−1 and use the other data point to
enzymes depends almost entirely on their KM values. estimate KM using the Michaelis–Menten equation:
15. A* will appear if the reaction follows a Ping Pong mechanism, since Vmax [S]
a double-displacement reaction can exchange an isotope from P vo =
KM + [S]
back to A in the absence of B.
16. In a reaction that has a sequential mechanism, A will not become Vmax [S]
KM + [S] =
isotopically labeled, because P cannot be converted back to A in the vo
absence of Q. Vmax [S]
17. By irreversibly reacting with chymotrypsin’s active site, DIPF KM = − [S]
vo
would decrease [E]T. The apparent Vmax would decrease since
Vmax = kcat [ E ] T· KM would not be affected since the uninhibited en- (50 μM · s−1 ) (1 μM)
KM = − (1 μM) = 9 μM
zyme would bind substrate normally. (5 μM · s−1 )
 SP-21
inhibitor, K M = 1/0.04 μM−1 = 25 μM. Vmax is determined from
app
The true Vmax must be greater than the estimated value, so the value
of KM is an underestimate of the true KM. the y-intercept (= 1/Vmax). In the absence of inhibitor, Vmax =
24. The experimentally determined KM would be greater than the 1/0.008 mg−1 · min = 125 mg · min−1. In the presence of inhibitor,
V max = 1/0.01 mg−1 · min = 100 mg · min−1.
app
true KM because the actual substrate concentration is less than
expected. (b) The lines in the double-reciprocal plots intersect very close to the
25. The enzyme concentration is comparable to the lowest substrate 1/vo axis. Hence, threo-sphingosine is most likely a competitive in-
concentration and therefore does not meet the requirement that hibitor. Competitive inhibition is likely also because of the struc-
[E] ≪ [S]. You could fix this problem by decreasing the amount of tural similarity between the inhibitor and the substrate, which allows
enzyme used for each measurement. them to compete for binding to the enzyme active site.
26. Enzyme Y is more efficient at low [S]; enzyme X is more efficient at 31. Since the molecular mass of methanol (MeOH) is 32 D, 100 mL of
high [S]. methanol in 40 L of solution has the concentration
27. If an irreversible inhibitor is present, the enzyme solution’s activity 100 mL × 0.79 g · mL−1
would be exactly 100 times lower when the sample is diluted 100- [ MeOH ] = = 0.062 M
fold. Dilution would not significantly change the enzyme’s degree 32 g · mol−1 × 40 L
of inhibition. Ethanol (EtOH) is a competitive inhibitor of methanol with LADH.
28. For reversible inhibition, KI = [E][I]/[EI] so that [E]/[EI] = KI/[I]. Vmax [ S]
Hence, if a reversible inhibitor is present, dilution would lower the vo (uninhibited) =
KM + [ S]
concentrations of both the enzyme and inhibitor so that the degree
of dissociation of the inhibitor from the enzyme would increase. The Vmax [ S]
vo (inhibited) =
enzyme solution’s activity would therefore not be exactly 100 times αKM + [ S]
less than the undiluted sample, but would be greater than this value
[I]
because the proportion of uninhibited enzyme would be greater at the where α = (1 + , [ MeOH ] = [ S] , and KM = 0.01 M.
lower concentration. KI )
29. (a) Inhibition is most likely mixed (noncompetitive) with α = α′ We require that
since it is reversible and only Vmax is affected.
vo (inhibited) KM + [ MeOH ]
app
(b) Since V max = 0.8 Vmax, 80% of the enzyme remains uninhibited. = 0.05 =
vo (uninhibited) αKM + [ MeOH ]
Therefore, 20% of the enzyme molecules have bound inhibitor.
app
(c) As indicated in Table 12-2 for mixed inhibition, V max = Vmax/α′. 0.01 + 0.062
0.05 =
Thus, 0.01α + 0.062
Vmax 1 0.0005α + 0.0031 = 0.072
α′ = = = 1.25 [I]
V app 0.8 α = 138 = (1 +
KI )
max

From Eq. 12-32,

[ I ] = (138 − 1)KI = 137KI = 137 × 1.0 × 10−3
[I]
1.25 = 1 + [ I ] = 0.137 M = [ EtOH ]
K′I
Mol EtOH = 0.137 M × 40 L = 5.48 mol
5 nM
K′I = = 20 nM Molecular mass EtOH = 46 D
1.25 − 1
Mass EtOH = 46 g · mol−1 × 5.48 mol = 252 g
30.
252 g
0.12 Volume pure EtOH = = 319 mL
0.79 g · mL−1

0.10 Since 100 proof whiskey is 50% ethanol by volume, it is necessary

to imbibe 2 × 319 mL = 638 mL (which is about 5/6 of a “fifth” of
whiskey).
vo (mg ⋅min)

0.08 32. The effects of competitive inhibitors can be diluted out by substrate
whereas those of uncompetitive and mixed inhibitors cannot.
–1

Threo-sphingosine
0.06
__
1

Chapter 13
0.04
1. Somatostatin is a 14-residue peptide hormone and is not lipid-
No inhibitor
soluble, so it would require a cell-surface receptor.
0.02 2. No. Because retinoic acid is a lipid, it can diffuse through the cell
membrane to associate with an intracellular receptor.
3. (a) Norepinephrine is synthesized by the decarboxylation of Tyr and
–0.2 –0.1 0 0.1 0.2 0.3 0.4 by hydroxylation of its β carbon and its phenyl group. (b) Epineph-
1
__ (μM –1) rine is derived from norepinephrine by N-methylation.
[S]
4. (a) Methandrostenolone differs from testosterone by methylation of
(a) KM is determined from the x-intercept (= −1/KM). In the absence C17 and desaturation of the C1—C2 bond. (b) Anabolic steroids
of inhibitor, KM = 1/0.14 μM−1 = 7 μM. In the presence of promote cell growth, a necessary part of wound healing.
SP-22
5. A plot of fractional saturation (Y) versus [L] yields a hyperbola interference that prevents dimerization of the receptor, a necessary
where the estimated value of 0.5Y corresponds to a ligand concen- step for signal transduction. In either case, growth-promoting signals
tration, or KL, of about 3.5 μM. would be diminished, thereby slowing the growth of cancerous cells.
13. Because the GTP analog cannot be hydrolyzed, Gα remains active.
1.0
Analog binding to Gs therefore increases cAMP production. Analog
binding to Gi decreases cAMP production.
0.8
14. In order to survive intracellularly, M. tuberculosis must interfere
with the host cell’s normal activities, for example, by disrupting the
0.6 cell’s signal transduction pathways. In this case, the overproduction
Y of cAMP and the prolonged presence of the second messenger pre-
0.4 vents infected cells from responding normally to the presence of the
infecting bacteria.
0.2 15. Like cholera toxin, B. anthracis EF leads to the overproduction of
cAMP which triggers the release of fluid from cells. The result is
0 edema.
0 2 4 6 8
[L] (μM) 16. By preventing MAPK kinases from activating MAPK, LF interferes
with the signaling pathway required for white blood cells to become
6. A Scatchard plot (B/F versus B) has a slope of −0.33 mM−1. Since activated and respond to infections.
slope = −1/KL, KL = 3 mM. 17. Diacylglycerol kinase converts DAG to phosphatidic acid (Sec-
tion 9-1C).
4.0
18. Activation of the kinase converts the nonpolar DAG to a more am-
phiphilic molecule that can no longer activate protein kinase C. In
effect, the kinase limits the activity of one of the second messen-
3.0 gers produced during signaling by the phosphoinositide pathway.
19. Li+ blocks the conversion of phosphorylated inositol species to
inositol, thereby preventing the recycling of IP3 and its degradation
B
2.0 products back to inositol. This in turn prevents the synthesis of phos-
F
phatidylinositol and PIP2, the precursor of the IP3 second messenger.
20. Insulin binding to its receptor triggers a signaling cascade that
1.0 begins with the tyrosine kinase activity of the insulin receptor.
However, as in all signaling pathways, intracellular responses are
eventually shut down. Activation of a phosphatase such as SHP-2,
0 which participates in transducing the insulin signal by activating the
0 2 4 6 8 10 MAPK pathway, can also act to limit the cellular response, by de-
B (mM) phosphorylating phospho-Tyr groups.
21. Use Equation 13-8, letting [L] = 1 μM and [B] = [I50] = 2.5 μM,
7. N [ I50 ]
CH2 KI =
N [L]
(1 + KL )
2–
PO3
(2.5 × 10−6 )
=
8. ADP is a product of the kinase-catalyzed reaction, so a compound (1 × 10−6 )
with a similar structure might bind in the kinase active site to act as 1 +
( (5 × 10−6 ) )
a competitive inhibitor.
9. The SH2 domain allows the enzyme to bind to phospho-Tyr residues 2.5 × 10−6
= = 2.1 μM
on its target proteins. Because targets typically contain more than one 1.2
phospho-Tyr group, the phosphatase can recognize and bind to one 22. Rearranging Equation 13-8 gives
site on the target protein while dephosphorylating another site on
the same protein. [L]
[ I50 ] = KI 1 +
10. In the presence of the viral protein, the cell would undergo more ( KL )
cycles of cell division in response to the growth factor. 1.0 × 10−8
= (8.9 × 10−9 ) (1 +
11. Transformation to the cancerous state results from several genetic 4.8 × 10−8 )
changes in a cell. Thus, a single oncogene supplied to an otherwise
= (8.9 × 10−9 )(1 + 0.208) = 1.1 × 10−8 M
normal cell will be insufficient to transform it. However, an immor-
talized cell already has some of the genetic changes necessary for 23. The PH domain allows the IRS to be localized to the intracellu-
transformation (malignant cells are also immortal). In such cells, lar leaflet of the cell membrane, close to the insulin receptor and
the additional oncogene may be all they require to complete their ready to participate in signal transduction. The PTB domain, like
transformation. an SH2 domain, recognizes phospho-Tyr residues, in this case on
12. The antibody might bind to the receptor such that growth factor bind- the autophosphorylated insulin receptor. As a result, the IRS can be
ing is blocked. Alternatively, antibody binding could generate steric activated following insulin binding to its receptor. The phospho-Tyr
 SP-23
residues on the IRS itself are recognition points for SH2-containing Chapter 14
proteins, which can thereby become activated.
1. A heterotroph relies on other organisms for food, which may include
24. Because Sos functions as a guanine nucleotide exchange factor, it substances the heterotroph cannot synthesize (including vitamins).
promotes the activity of Ras. The mutation will diminish Ras activ- An autotroph can produce all the molecules it needs.
ity and therefore slow cell growth.
2. (a) The methanogens, which produce methane from inorganic pre-
25. (a) Yes, because the binding of Src’s SH3 domain to the linker that cursors, are autotrophic. The methane consumers rely on the product
connects its SH2 domain to the N-terminal lobe of its PTK domain is of the methanogens and so are heterotrophic.
required for Src to maintain its autoinhibited conformation. Hence, (b) The organisms associate so that the methanotrophs can consume
the deletion of this SH3 domain would constitutively activate Src, the methane that is released by the methanogens.
thereby driving the cell with this mutation to a state of unrestrained 3. Arsenic, which resembles phosphorus, is incorporated into nu-
proliferation. cleic acids and other compounds that ordinarily contain phos-
(b) No, because the phosphorylation of Tyr 416 is required for the phate groups.
activation of Src and hence the Y416F mutation would inhibit the 4. Ions of Cd and Hg, which are below Zn in the periodic table, take
mutant cell’s proliferation. the place of Zn2+ ions that serve as cofactors for essential cellular
26. (a) Yes, because the phosphorylation of Tyr 527 is required for the enzymes.
autoinhibition of Src via the binding of its SH2 domain and hence 5. C, D, A, E, B
the Y527F mutant Src would be constitutively activated.
6. (a) Reduction; (b) reduction.
(b) No, because replacing the wild-type sequence (one Pro) with a
7. (a) K = e−ΔG°′/RT
sequence containing two Pro residues would make the 250 to 253 −1 −1 −1

segment of Src a better binding target for the SH3 domain, thereby K = e−(−31,500 J·mol )/(8.3145 J·K ·mol )(310 K)
stabilizing Src’s autoinhibited conformation. K = 2.0 × 105
27. When Gsα catalyzes the hydrolysis of its bound GTP to GDP + Pi, (b) The large change in free energy makes the citrate synthase reac-
the Arg side chain that cholera toxin ADP-ribosylates functions to tion irreversible, so it could (and does; Section 17-4B) serve as a
stabilize the transition state’s developing negative charge. The ADP- control point for the citric acid cycle.
ribosylated Gsα therefore hydrolyzes its bound GTP at a greatly re- 8. b
duced rate and hence remains activated far longer than normal Gsα. 9. We can assume that ATP’s three phosphoryl groups behave like
Mutating this Arg will have a similar effect. Consequently, in cells phosphoric acid, which has three pK values (2.15, 6.82, and 12.38).
in which a Gsα. GTP functions to induce cell proliferation, mutating At physiological pH (7.4), ionization of the first proton on each
this Arg will drive the cell into a state of unrestrained proliferation, phosphoryl group is complete (since its pK value is 2.15), and ion-
a requirement for the malignant transformation of the cell. The gene ization of the second proton (if present) is more than halfway com-
encoding such a Gsα subunit is a proto-oncogene and the mutation plete (since pH 7.4 is greater than the pK value of 6.82). Therefore
of its Arg residue converts it to an oncogene. the net charge of an ATP molecule is between −3.5 and −4.
28. Cholera toxin does not cause cancer because the Gsα it ADP- 10. Although the plus sign suggests a positive charge, all four dinucleo-
ribosylates only mediates the intestinal cell’s secretion of diges- tides are negatively charged. The oxidized nicotinamide group has
tive fluid, not its rate of proliferation. Moreover, cholera toxin a charge of +1 and the reduced group is neutral. NAD+/NADH has
does not pass through the intestine to the other tissues and hence two phosphoryl groups, and NADP+/NADPH has three phosphoryl
does not affect other cells. However, even if it did so, its effect groups, so the net charges are NAD+ −1, NADH −2, NADP+ −2,
would only last as long as the cholera infection, whereas a muta- and NADPH −3.
tion permanently affects the cell in which it has occurred and all 11. The theoretical maximum yield of ATP is equivalent to (ΔG°′ for
its progeny. fuel oxidation)/(ΔG°′ for ATP synthesis) = (−2850 kJ · mol−1)/
29. No. Although the diacylglycerol second messengers are identical, (−30.5 kJ · mol−1) ≈ 93 ATP
phosphatidylethanolamine does not generate an IP3 second messen- 12. The theoretical maximum yield of ATP is equivalent to
ger that triggers the release of Ca2+, which in turn alters protein
kinase C activity. (ΔG°′ for fuel oxidation)/(ΔG°′ for ATP synthesis)
= (−9781 kJ · mol−1 )/(−30.5 kJ · mol−1 ) ≈ 320 ATP
30. Pertussis toxin ADP ribosylates Giα so as to prevent it from exchang-
ing its bound GDP for GTP and hence from releasing Gβγ on in- 13. The exergonic hydrolysis of PPi by pyrophosphatase (ΔG°′ =
teracting with its cognate activated GPCRs. The resulting decrease −19.2 kJ · mol−1) drives fatty acid activation.
in active Gβγ inhibits PLC, which is normally activated through its 14. (a) Because the ΔG°′ value for the reaction is greater than 0, the
association with free Gβγs. reaction will not occur under standard conditions. It could occur
31. (a) The positively charged Ca2+ ions bind to negatively charged lipids under cellular conditions, depending on the actual concentrations of
at the membrane surface. This disrupts the electrostatic interactions be- the reactants and products.
tween CD3 and the membrane so that the proteins dissociate from the (b) The malate dehydrogenase and citrate synthase reactions are
membrane and expose their Tyr side chains to the NRTKs for phos- coupled through their common intermediate oxaloacetate
phorylation. (b) This is an example of feed-forward activation: the bind-
Malate + NAD + → oxaloacetate + NADH + H +
ing of antigen initiates signaling that leads to Ca2+ influx, which in turn
promotes additional events (phosphorylation of the CD3 proteins); the Oxaloacetate + acetyl-CoA → citrate + HS-CoA
two-step mechanism means a stronger cellular response to the antigen. so the overall ΔG°′ is the sum of the ΔG°′ values for the two reac-
32. PMA is an analog of diacylglycerol, the second messenger that binds tions: 29.7 kJ · mol−1 + (−31.5 kJ · mol−1) = −1.8 kJ · mol−1.
to and activates protein kinase C. The activated kinase stimulates cel- The citrate synthase reaction helps “pull” the malate dehydroge-
lular activities, including cell growth and division, which increases nase reaction forward by consuming the oxaloacetate produced
the number of dividing cells available for cytogenetic analysis. from malate.
SP-24
15. The more positive the reduction potential, the greater the oxidizing The reaction is not spontaneous since ΔG > 0.
power. From Table 14-4, (c) The reaction can proceed in the cell if the product B is the sub-
strate for a second reaction such that the second reaction continually
Compound °′(V) draws off B, causing the first reaction to continually produce more B
from A.
SO2−
4 −0.515 24. (a) For enzymes that catalyze near-equilibrium reactions, ΔG ≈ 0
Acetoacetate –0.346 and the direction of flux depends on the relative concentrations of sub-
strates and products. Consequently, these enzymes can catalyze both
NAD+ −0.315 the forward (e.g., anabolic) and reverse (e.g., catabolic) reactions.
Pyruvate −0.185 (b) For a metabolic pathway to proceed in the forward direction, ΔG
3+ must be less than zero. The reverse process, involving the same reac-
Cytochrome b (Fe ) 0.077
tions, must therefore have ΔG > 0. However, if the opposing path-
16. Cytochrome a has a higher standard reduction potential (0.29 V) ways involve different reactions, catalyzed by different enzymes, then
than cytochrome c1 (0.22 V), so electrons will tend to flow from cy- both pathways can proceed with favorable changes in free energy.
tochrome c1 to cytochrome a. Under standard conditions, electrons 25. At pH 6, the phosphate groups are more ionized than they are
will not flow from cytochrome c1 to cytochrome b, whose standard at pH 5, which increases their electrostatic repulsion and there-
reduction potential (0.077 V) is less than that of cytochrome c1. fore increases the magnitude of ΔG for hydrolysis (makes it more
17. Using the data in Table 14-4: negative).
26. Removing a phosphoryl group from ATP has a large change in free
Δℰ°′ = ℰ°′(e− acceptor) − ℰ°′(e− donor) = ℰ°′(fumarate) − ℰ°′(NAD +)
energy because there is a large difference in resonance and electrostatic
= 0.031 V − (−0.315 V) = 0.346 V stabilization between the reactants and products. Removing a phos-
phoryl group from AMP has a smaller change in free energy because
Because Δℰ°′ > 0, ΔG°′ < 0 and the reaction will spontaneously the difference in resonance and electrostatic stabilization between
proceed as written. AMP (which has only one phosphate group) and Pi is not as large.
18. No. Here, 27. Calculating ΔG for the reaction ATP + creatine ⇌ phospho-
Δℰ°′ = ℰ°′(e−acceptor) − ℰ°′(e−donor) = ℰ°′(cyto b (Fe3 +)) − ℰ°′(cyto a (Fe2 + )) creatine + ADP, using Eq. 14-1:
= 0.077 V − (0.29 V) = −0.213 V. [ phosphocreatine] [ ADP]
ΔG = ΔG°′ + RT ln ( )
Because Δℰ°′ < 0, ΔG°′ > 0 and the reaction will spontaneously [creatine] [ATP]
−1 −1 −1
proceed in the opposite direction from that written. = 12.6 kJ · mol + (8.3145 J · K · mol )(298 K)
19. Probably not. Although all cells carry out a similar set of basic (2.5 mM)(0.15 mM)
metabolic reactions, the enzymes that catalyze the reactions have ln (
(1 mM)(4 mM) )
different amino acid sequences and hence different gene sequences. = 12.6 kJ · mol−1 − 5.9 kJ · mol−1 = 6.7 kJ · mol−1
cDNAs produced from mammalian mRNAs would be unlikely to
hybridize with bacterial DNA segments. Since ΔG > 0, the reaction will proceed in the opposite direction as
20. Only a small portion (∼1.2%) of the human genome consists of pro- written above, that is, in the direction of ATP synthesis.
tein-coding sequences. Building a gene chip with DNA sequences 28. Using the data in Table 14-3, we calculate ΔG°′ for the adenylate
corresponding to genes that are transcribed increases the likelihood kinase reaction.
of “capturing” complementary segments derived from the mRNA ΔG°¿
population of the cells under study. ATP + H2O → AMP + PPi −45.6 kJ · mol−1
21. Unlike nucleic acids, metabolites cannot be amplified, and metabo- 2 ADP + 2 Pi → 2 ATP + 2 H2O 2 × 30.5 kJ · mol−1
lite structures are not encoded by genetic information. In addition, = 61.0 kJ · mol−1
attaching a large fluorescent molecule to a metabolite might alter its PPi + H2O → 2 Pi −19.2 kJ · mol−1
biological activity.
2 ADP → ATP + AMP −3.8 kJ · mol−1
22. The researchers could look at the expression of genes in response to
statins: even in the absence of gene sequence differences, the level of Since ΔG for a reaction at equilibrium is zero, Eq. 14-1 becomes
mRNA and protein generated from the genes could vary among patients. ΔG°′ = −RT ln Keq so that
23. (a) Since ΔG°′ = −RT ln K, Keq = e−ΔG°′/RT.
K = e−ΔG°′/RT [ATP] [ AMP]
Keq = = e−ΔG°′/RT
K = e−(7500 J·mol
−1 −1 −1
)/(8.3145 J·K ·mol )(298 K) [ ADP] 2

K = 0.048 (5 × 10−4 M) 2 −1
)/(8.3145 J·K−1 ·mol−1)(298 K)
[ AMP] = e−(−3800 J·mol
(5 × 10−3 M)
[B]
(b) ΔG = ΔG°′ + RT ln [ AMP] = 2.3 × 10−4 M = 0.23 mM
[A]
29. ....
ΔG = 7500 J · mol−1 Cys Gln

(0.0001) CH2 CH2

+ (8.3145 J · K−1 · mol−1 )(310 K) ln
(0.0005) S CH2
−1 −1 C
ΔG = 7500 J · mol − 4150 J · mol
ΔG = 3350 J · mol−1 = 3.35 kJ · mol−1 O
 SP-25
30. Gln Gln 4. This reaction resembles Step 2 of glycolysis (the conversion of an
aldose to a ketose) and is catalyzed by an isomerase, which in this
CH2 CH2 case converts a ketose to an aldose.
CH2 CH2 5. C1 of DHAP and C1 of GAP are achiral but become chiral in FBP
(as C3 and C4). There are four stereoisomeric products that differ in
C O C O configuration at C3 and C4: fructose-1,6-bisphosphate, psicose-1,6-
bisphosphate, tagatose-1,6-bisphosphate, and sorbose-1,6-bisphos-
O NH
phate (see Fig. 8-2).
R R 6. The Zn2+ polarizes the carbonyl oxygen of the substrate to stabilize
the enolate intermediate of the reaction.
31. The ubiquinone half-reaction has a higher reduction potential
(0.045 V) than the NAD+ half-reaction (−0.315 V). Therefore, CH2OPO23 – CH2OPO23 –
electrons will flow from NADH (which becomes oxidized) to ubi-
–
quinone (which becomes reduced). C O . . . Zn2+ Enzyme C O . . . Zn2+ Enzyme
32. The O2 ⇌ H2O half-reaction has a standard reduction potential of C
–
C
0.815 V, whereas the nitrate ⇌ nitrite half-reaction has a standard HO H HO H
reduction potential of only 0.42 V. Because the free energy change
for a redox reaction is proportional to the change in reduction poten- 7. The reaction intermediate is glucose-1,6-bisphosphate (G1,6P).
tial, ΔG°′ = −nℱΔℰ°′, transferring electrons from the fuel mol- 8. (a) G1,6P inhibits hexokinase. Production of G1,6P indicates that
ecule to O2 will have a larger free energy change than transferring G1P (derived from glycogen or from other sugars such as galactose)
the electrons from the fuel molecule to nitrate. is already present and the cell does not need to initiate glycolysis
33. The balanced equation is with glucose. (b) G1,6P activates PFK to increase the flux of phos-
phorylated sugars through the rest of the glycolytic pathway.
2 cyto c (Fe3+ ) + ubiquinol → 2 cyto c (Fe2+ ) + ubiquinone + 2H +
9. Alcoholic fermentation, unlike homolactic fermentation, includes a
Using the data in Table 14-4, step (the pyruvate decarboxylase reaction) in which a carbon is lost
Δℰ°′ = ℰ°′(e− acceptor) − ℰ°′(e− donor) = 0.235 V − 0.045 V as CO2. Because the CO2 diffuses (bubbles) away, the reaction can-
not proceed in reverse.
= 0.190 V
10. For the coupled reaction
ΔG°′ = −nℱΔℰ°′ = −(2)(96,485 J · V−1 · mol−1 )(0.190 V)
Pyruvate + NADH + H + → lactate + NAD +
= −36.7 kJ · mol−1 Δℰ°′ = (−0.185 V) − (−0.315 V) = 0.130 V.
34. Using the data in Table 14-4, for the oxidation of free FADH2 According to Eq. 14-8,
(ℰ°′ = −0.219 V) by ubiquinone (ℰ°′ = 0.045 V), RT [ lactate] [ NAD + ]
Δℰ = ℰ°′(ubiquinone) − ℰ°′(FADH2) = (0.045 V) − (−0.219 V) Δℰ = Δℰ°′ − ln (
nℱ [ pyruvate] [ NADH ] )
= 0.264 V and ΔG = −nℱΔℰ (Eq. 14-7). Since two electrons are transferred
ΔG°′ = −nℱΔℰ°′ = −(2)(96,485 J · V −1 −1
· mol )(0.264 V) in the above reaction, n = 2.
RT
= −50.9 kJ · mol−1 (a) Δℰ = 0.130 V − ln(1) = 0.130 V
nℱ
This is more than enough free energy to drive the synthesis of ATP ΔG = −(2)(96,485 J · V −1 · mol −1 )(0.130 V) = −25.1 kJ · mol −1
from ADP + Pi (ΔG°′ = +30.5 kJ · mol−1 ; Table 14-3). (b) RTnℱ = 18.3145 J · K −1 · mol −1 )(298 K)
(2)(96,485 J · V −1 · mol −1 ) = 0.01284 V
B C A
35. Z ⟶ W ⟶ Y ⟶ X
36. (a) The step catalyzed by enzyme Y is likely to be the major flux- Δℰ = 0.130 V − 0.01284 V ln(160 × 160)
control point, since this step operates farthest from equilibrium (it is Δℰ = 0.130 V− 0.130 V = 0
an irreversible step). (b) Inhibition of enzyme Z would cause the con- ΔG = 0
centration of D, the reaction’s product, to decrease, and it would cause (c) Δℰ = 0.130 V − 0.01284 V ln(1000 × 1000)
C, the reaction’s substrate, to accumulate. The concentrations of A Δℰ = 0.130 V − 0.177 V = −0.047 V
and B would not change because the steps catalyzed by enzymes X ΔG = −(2)(96,485 J · V −1 mol −1 )(−0.047 V)
and Y would not be affected. The accumulated C would not be trans-
= 9.1 kJ · mol −1
formed back to B since the step catalyzed by enzyme Y is irreversible.
(d) At the concentration ratios of Part a, ΔG is negative and the reaction
proceeds as written. As [lactate]/[pyruvate] increases, the reaction ΔG
Chapter 15
increases even though [NAD+]/[NADH] also increases so that in Part
1. (a) Reactions 1, 3, 7, and 10; (b) Reactions 2, 5, and 8; (c) Reaction 6; b the reaction is at equilibrium (ΔG = 0) and in Part c ΔG is positive
(d) Reaction 9; (e) Reaction 4. and the reaction proceeds spontaneously in the opposite direction.
2. Proteolysis of enzymes such as aldolase and enolase destroys their 11. ΔG values differ from ΔG°′ values because ΔG = ΔG°′ + RT
activity, thereby inhibiting glycolytic flux. As a result, the cell would ln[products]/[reactants] and cellular reactants and products are not
be unable to generate ATP from glucose and would die. The advan- in their standard states.
tage of this response would be the elimination of the infected cell, 12. Yes. The same in vivo conditions that decrease the value of ΔG
which would help limit the growth and dissemination of Salmonella. relative to ΔG°′ may also decrease ΔG for ATP synthesis.
3. This reaction resembles Step 4 of glycolysis and is carried out by an 13. Pyruvate kinase regulation is important for controlling the flux of
aldolase, which links dihydroxyacetone phosphate to an aldehyde metabolites, such as fructose (in liver), which enter glycolysis after
(erythrose-4-phosphate). the PFK step.
SP-26
14. FBP is the product of the third reaction of glycolysis, so it acts as because iodoacetate inhibits the activity of GAPDH and prevents
a feed-forward activator of the enzyme that catalyzes Step 10. This fermentation. (c) Because yeast do not normally metabolize lactose
regulatory mechanism helps ensure that once metabolites pass the (milk sugar), the balloon would inflate much more slowly than if
PFK step of glycolysis, they will continue through the pathway. sucrose were present.
15. The high glycolytic flux rapidly generates the ATP needed for cell 26. GAPDH catalyzes the phosphorylation of glyceraldehyde-3-phos-
growth and division. phate, producing 1,3-bisphosphoglycerate that subsequently phos-
16. Pyruvate kinase catalyzes the final reaction of glycolysis, so a slow phorylates ADP to generate ATP. The ATP produced in this way
reaction rate would lead to the accumulation of glycolytic interme- powers axonal transport where mitochondria are not available to
diates that could be diverted to biosynthetic pathways. In addition produce ATP by oxidative phosphorylation.
to providing ATP, glycolysis can generate the metabolic materials 27. When [ GAP] = 10 −4 M, [ DHAP] = 5.5 × 10 −4 M. According
necessary for the growth of tumor cells. to Eq. 1-17,
17. The three glucose molecules that proceed through glycolysis yield 6
ATP. The bypass through the pentose phosphate pathway results in K = e−ΔG°′/RT
a yield of 5 ATP. [ GAP] [ DHAP] −1 −1
= e−(22,800 J · mol )/(8.3145 J · K · mol)(310 K)
18. The label will appear at C1 and C3 of F6P (see Fig. 15-30). [ FBP]
19. H OH (10 −4 )(5.5 × 10 −4 )
= 1.4 × 10 −4
C [ FBP]
C O– [ FBP] = 3.8 × 10 −4 M

H C OH
[ FBP]  [ GAP] = (3.8 × 10 −4 M)(10 −4 M) = 3.8

H C OH 28. The liver enzyme is far more sensitive than the brain enzyme to the
three activators. It is possible that liver PFK-1 is subject to a greater
CH2OPO23 – degree of regulation than brain PFK-1. Fuel must be supplied to
the brain continuously and thus glycolysis is always active, but the
1,2-Enediolate
intermediate liver has a wide variety of physiological roles and is more likely to
regulate cellular pathways.
20. H 29. Galactokinase, which catalyzes a highly exergonic reaction, is a pos-
H C OH sible control point. Because galactose enters the glycolytic pathway
as glucose-6-phosphate, the PFK reaction is also likely to be a major
C O– control point.
C OH 30. The inhibition of phosphoglucomutase, which catalyzes Step 4 of
the galactose-metabolizing pathway, would slow the production of
H C OH G6P from galactose and thereby slow the rate at which galactose is
CH2OPO23 – catabolized. Because glucose enters glycolysis without the phos-
phoglucomutase-catalyzed step, its flux through glycolysis is faster.
2,3-Enediolate 31. (a) Glycerol can be converted to the glycolytic intermediate DHAP
intermediate by the activity of glycerol kinase and glycerol phosphate dehydroge-
21. Transketolase transfers 2-carbon units from a ketose to an aldose, so nase (Fig. 15-27). (b) One ATP is consumed by the glycerol kinase
the products are a 3-carbon sugar and a 7-carbon sugar. reaction, but two ATP are produced (by the PGK and PK reactions),
22. The products are a 4-carbon and a 7-carbon sugar. The order of for a net yield of one ATP per glycerol (this does not count the ATP
binding does matter. The ketose binds first and transfers the 2-car- that might be generated through oxidative phosphorylation from the
bon unit to the TPP on the enzyme. The aldose then binds and ac- NADH produced in the glycerol phosphate dehydrogenase reaction).
cepts the 2-carbon unit. 32. Fermentation pathways regenerate one NAD+ needed for the
23. (a) Glucose + 2 NAD + + 2 ADP + 2 Pi → GAPDH reaction of glycolysis. The catabolism of glycerol includes
2 pyruvate + 2 NADH + 2 ATP + 2 H2O the GAPDH reaction, but it also includes the glycerol phosphate
dehydrogenase reaction, which also generates NADH. Therefore,
(b) Glucose + 2 NAD + + 2 ADP + 2 AsO3− 4 →
homolactic or alcoholic fermentation could only regenerate half the
2 pyruvate + 2 NADH + 2 ADP⏤AsO2− 3 + 2 H2O NAD+ required for glycerol catabolism.
2 ADP⏤AsO2− 3 + 2 H2O → 2 ADP + AsO4
3−
33. Even when the flux of glucose through glycolysis and hence the cit-
Overall: Glucose + 2 NAD + → 2 pyruvate + 2 NADH ric acid cycle is blocked, glucose can be oxidized by the pentose
phosphate pathway, with the generation of CO2.
(c) Arsenate is a poison because it uncouples ATP generation
from glycolysis. Consequently, glycolytic energy generation cannot 34. (a) COO
–
H O
occur. C
C O
24. Like phosphoglycerate mutase, phosphoglucomutase catalyzes a
CH3
+ H C OH
phosphoryl group transfer in which a phosphorylated group in the
enzyme active site donates its phosphoryl group to the substrate and CH2OPO23 –
then receives a second phosphoryl group from the substrate. The Pyruvate GAP
active site Ser can undergo reversible phosphorylation.
25. (a) The volume of the balloon would increase as the yeast produce (b) The pyruvate product of the aldolase reaction is not further mod-
CO2 by fermenting the sugar. (b) The balloon would not inflate ified. The GAP product is converted to pyruvate by the actions of
 SP-27
the glycolytic enzymes glyceraldehyde-3-phosphate dehydrogenase, 9. (a) Circulating [glucose] is high because cells do not respond to the
phosphoglycerate kinase, phosphoglycerate mutase, enolase, and insulin signal to take up glucose.
pyruvate kinase. (b) Insulin is unable to activate phosphoprotein phosphatase-1 in
(c) One ATP is consumed when glucose is converted to glucose- muscle, so glycogen synthesis is not stimulated. Moreover, glyco-
6-phosphate. One ATP is generated by the phosphoglycerate kinase gen synthesis is much reduced by the lack of available glucose in
reaction and one by the pyruvate kinase reaction (these quantities the cell.
are not doubled because only one three-carbon fragment of glucose 10. The two tissues perform different physiological functions and
follows this route), for a net yield of one ATP per glucose. The stan- therefore respond differently to the same hormone. Liver responds
dard glycolytic pathway generates two ATP per glucose. by promoting glycogenolysis and gluconeogenesis to produce glu-
35. (a) Reaction 8, (b) Reaction 5, (c) Reaction 1, (d) Reaction 2, cose that can be released for use by other tissues. Muscles respond
(e) Reaction 3. to the hormone by increasing the flux of glycogen-derived glu-
36. (a) Glucose-6-phosphate dehydrogenase (pentose phosphate path- cose through glycolysis in order to generate ATP to power muscle
way, Reaction 1 of Fig. 15-30). contraction.
(b) UDP–galactose-4-epimerase (galactose metabolism, Reaction 3 11. During the domestication process, wolves, which are carnivores,
of Fig. 15-28). would have been provided with grain-based (starchy) foods produced
(c) Phosphoglucose isomerase (glycolysis, Reaction 2 of Fig. 15-1). by humans. Additional amylase genes would have made starch diges-
tion more efficient, giving the animals a survival advantage.
(d) Phosphomannose isomerase (mannose metabolism, Section 15-5C).
12. The enzyme activities catalyze sequential steps of gluconeogen-
(e) Phosphoglycerate mutase (glycolysis, Reaction 8 of Fig. 15-1)
esis (aldol condensation followed by dephosphorylation), so in-
or phosphoglucomutase (galactose metabolism, Reaction 4 of
cluding both in one protein means that the reactions can proceed
Fig. 15-28).
efficiently with no loss of the intermediate product (fructose-1,
6-bisphosphate).
Chapter 16 13. The equation for glycolysis is
1. Glycogen is broken down when the cell needs to catabolize glucose Glucose + 2 NAD + + 2 ADP + 2 Pi →
to produce ATP. The G1P generated by the glycogen phosphorylase
2 pyruvate + 2 NADH + 4 H + + 2 ATP + 2 H2O
reaction is quickly isomerized to G6P and enters glycolysis. The
continual consumption of G1P “pulls” the phosphorylase reaction The equation for gluconeogenesis is
forward, making it thermodynamically favorable. 2 Pyruvate + 2 NADH + 4 H + + 4 ATP + 2 GTP + 6 H2O →
2. This mechanism allows glycogen phosphorylase activity to be regu- glucose + 2 NAD + + 4 ADP + 2 GDP + 6 Pi
lated by the concentration of glucose so that glycogen is not broken
For the two processes operating sequentially,
down when glucose is already plentiful.
3. Phosphoglucokinase activity generates G1,6P, which is necessary 2 ATP + 2 GTP + 4 H2O → 2 ADP + 2 GDP + 4 Pi
to “prime” phosphoglucomutase that has become dephosphorylated 14. The equation for catabolism of 6 G6P by the pentose phosphate
and thereby inactivated through the loss of its G1,6P reaction inter- pathway is
mediate. 6 G6P + 12 NADP + + 6 H2O →
4. A defect in G6P transport would have the symptoms of glucose- 6 Ru5P + 12 NADPH + 12 H + + 6 CO2
6-phosphatase deficiency: accumulation of glycogen and hypogly-
cemia. Ru5P can be converted to G6P by transaldolase, transketolase, and
gluconeogenesis:
5. The conversion of circulating glucose to lactate in the muscle gen-
erates 2 ATP. If muscle glycogen could be mobilized, the energy 6 Ru5P + H2O → 5 G6P + Pi
yield would be 3 ATP, since phosphorolysis of glycogen bypasses The net equation is therefore
the hexokinase-catalyzed step that consumes ATP in the first stage
G6P + 12 NADP + + 7 H2O → 12 NADPH + 12 H + + 6 CO2 + Pi
of glycolysis.
6. The deficiency is in branching enzyme (Type IV glycogen storage 15. (a) +9 ATP, (b) +6 ATP, (c) −18 ATP.
disease). The high ratio of G1P to glucose indicates abnormally long 16. (a) Lactate dehydrogenase, pyruvate carboxylase, PEPCK, enolase,
chains of α(1→4)-linked residues with few α(1→6)-linked branch phosphoglycerate mutase, phosphoglycerate kinase, GAPDH, triose
points (the normal ratio is ∼10). phosphate isomerase, aldolase, fructose-1,6-bisphosphatase, phos-
7. A glycogen molecule with 28 tiers would represent the most efficient phoglucose isomerase, and glucose-6-phosphatase. (b) Two ATP are
arrangement for storing glucose, and its outermost tier would con- produced by glycolysis, and 6 ATP are consumed by gluconeogen-
tain considerably more glucose residues than a glycogen molecule esis, so there is a net loss of 4 ATP.
with only 12 tiers. However, densely packed glucose residues would 17. (a) At the beginning of a fast, blood glucose levels are normal, be-
be inaccessible to phosphorylase. In fact, such a dense glycogen cause dietary sources or glycogenolysis can supply glucose. (b) After
molecule could not be synthesized because glycogen synthase and a fast, the blood glucose levels are very low, because dietary glucose
branching enzyme would have no room to operate (see Box 16-3 for and glycogen have been depleted and gluconeogenesis is impaired
a discussion of glycogen structure). due to the fructose-1,6-bisphosphatase deficiency.
8. Amylose is a linear form of starch, so during digestion, glucose 18. Pyruvate, a substrate for gluconeogenesis, cannot be converted
monomers can be released only one at a time from the end of the to glucose and instead accumulates, because the gluconeogenic
molecule. Amylopectin, a branched form of starch, can release glu- enzyme fructose-1,6-bisphosphatase is deficient.
cose from each of its branches. Consequently, the rate of glucose 19. PFK-2 converts fructose-6-phosphate to fructose-2,6-bisphosphate,
release from amylose is slower than from amylopectin, and less an allosteric activator of PFK-1. The result is increased glycolytic
glucose appears in the blood. flux to generate the ATP to power cell division during angiogenesis.
SP-28
20. Angiogenic cells carry out anaerobic glycolysis because the oxygen 31. UDP–Glucose + fructose-6-phosphate
required for oxidative phosphorylation is scarce—the reason the
cells are proliferating is to construct new blood vessels to improve
UDP
oxygen delivery to tissues.
21. (a) Microorganisms that produce fucosidase can cleave fucose sucrose-6-phosphate
residues from the glycoproteins, thereby obtaining a source of
H2O
free energy from the host. (b) The pathogens cannot use this food
source and therefore are less likely to survive when no other food Pi
is available.
sucrose
22. (a) The mice do not produce normal amounts of fucosyltransfer-
ase, the enzyme that adds fucose to the growing oligosaccharide.
32. In starch synthesis, α(1→4)-linked glucose residues are added one
(b) Instead, the oligosaccharide chains end with galactose and
by one. In cellulose, as indicated in Fig. 8-9, each successive glu-
sialic acid.
cose residue is flipped by 180° to form the β(1→4)-linked polymer.
23. In the course of glucose catabolism, a detour through glycogen This geometry would require an enzyme with a single active site
synthesis and glycogen breakdown begins and ends with G6P. The to reorient by 180° with every residue added. By simultaneously
energy cost of this detour is 1 ATP equivalent, consumed in the accommodating two ADP–glucose substrates, one flipped 180° rela-
UDP–glucose pyrophosphorylase step. The overall energy lost is tive to the other, and catalyzing two glucosyl transfer reactions, the
therefore 1/32 or ∼3%. synthase can build cellulose two residues at a time without having
24. The overall free energy change for debranching is to be repositioned.
Breaking α(1→4) bond ΔG°′ = −15.5 kJ · mol −1 33. The first tier has 21 − 1 = 1 branch; the 2nd tier has 22−1 = 2
Forming α(1→4) bond +15.5 kJ · mol −1 branches for a total of 2 + 1 = 3 = 22 − 1 branches through that
Hydrolyzing α(1→6) bond −7.1 kJ · mol−1 tier; the 3rd tier has 23−1 = 4 branches for a total of 4 + 3 = 7 =
23 − 1 branches through that tier; etc. Hence in n tiers, there are a
Total ΔG°′ = −7.1 kJ · mol−1
total of 2n − 1 branches. The particle therefore has a total of 212 − 1
The overall free energy change for branching is branches of 13 residues each for a total of (212 − 1) × 13 = 53,235
glucose residues.
Breaking α(1→4) bond ΔG°′ = −15.5 kJ · mol−1
Forming α(1→6) bond +7.1 kJ · mol−1 34. Muscle uses glycogen breakdown for the rapid acquisition of
−1 metabolic energy. Since muscle only stores a few seconds worth
Total ΔG°′ = −8.4 kJ · mol
of ATP and creatine (an ATP buffer; Section 14-2C), glycogen
Assuming that ΔG°′ is close to ΔG, the sum of the two reactions must be rapidly mobilized when there is a need for it. Liver, on
of branching has ΔG < 0, but debranching would be endergonic the other hand, functions to maintain a steady level of blood
(ΔG > 0) without the additional step of hydrolyzing the α(1→6) glucose, a quantity that fluctuates over minutes and hours rather
bond to form glucose. than seconds. Muscle glycogen phosphorylase is therefore better
adapted to its function if it responds more quickly to external
25. (a) Aspartate can be transaminated to produce oxaloacetate, a
stimuli.
gluconeogenic precursor. (b) To convert 2 aspartate to glucose,
2 GTP are consumed in the PEPCK reaction and 2 ATP are con-
sumed in the phosphoglycerate kinase reaction, for a total of Chapter 17
4 ATP equivalents. 1. The labeled carbon becomes C4 of the succinyl moiety of succinyl-
26. (a) In alcoholic fermentation (Section 15-3B), pyruvate decarbox- CoA. Because succinate is symmetrical, the label appears at C1
ylase converts pyruvate to acetaldehyde and CO2. In gluconeogen- and C4 of succinate. When the resulting oxaloacetate begins the
esis (Section 16-4A), pyruvate carboxylase transfers a bicarbonate second round, the labeled carbons appear as 14CO2 in the isocitrate
group to pyruvate to form oxaloacetate. (b) Pyruvate decarboxylase dehydrogenase and the α-ketoglutarate dehydrogenase reactions
uses a thiamine pyrophosphate cofactor; pyruvate carboxylase uses (see Fig. 17-2).
a biotin cofactor. 2. The labeled carbon becomes C3 of the succinyl moiety of succinyl-
27. The reactions catalyzed by pyruvate carboxylase and phospho- CoA and hence appears at C2 and C3 of succinate, fumarate,
enolpyruvate carboxykinase are phosphate transfer reactions. malate, and oxaloacetate. Neither C2 nor C3 of oxaloacetate is re-
28. The reaction catalyzed by UDP–glucose pyrophosphorylase involves leased as CO2 in the second round of the cycle. However, the 14C
cleavage of UTP but is not a phosphoryl group transfer reaction (the label appears at C1 and C2 of the succinyl moiety of succinyl-CoA
UMP group is transferred). in the second round and therefore appears at all four positions of
29. A high level of AMP results from a high rate of ATP consumption the resulting oxaloacetate. Thus, in the third round, 14C is released
in the cell, so it would act to promote flux through ATP-generating as 14CO2.
pathways such as glycolysis. Therefore, AMP would be expected 3. In mammals, pyruvate can be converted to lactate (reduction), to
to inhibit the activity of the gluconeogenic enzyme fructose-1,6- alanine (transamination), to acetyl-CoA (oxidative decarboxyl-
bisphosphatase. ation), and to oxaloacetate (carboxylation). In yeast, pyruvate is also
30. A high level of acetyl-CoA, the product of fatty acid catabolism (it is converted to acetaldehyde (decarboxylation).
also generated from pyruvate and amino acid catabolism), indicates 4. Citric acid cycle intermediates are all acids and as such represent a
that the cell has adequate metabolic fuel available. The stimulation source of hydrogen ions that would lead to a decrease in blood pH
of pyruvate carboxylase, the first enzyme of gluconeogenesis, allows (acidosis).
the cell to direct resources toward glucose synthesis, a mechanism 5. The decarboxylation step is most likely to be metabolically irrevers-
for stockpiling fuel for later use. ible since the CO2 product is rapidly hydrated to bicarbonate. The
 SP-29
reverse reaction, a carboxylation, requires the input of free energy 16. From Table 17-2, the ΔG°′ value of the aconitase reaction is
to become favorable (Section 16-4A). The other four reactions are ∼5 kJ ∙ mol−1 and the ΔG value is ∼0.
transfer reactions or oxidation–reduction reactions (transfer of elec-
[ isocitrate]
trons) that are more easily reversed. ΔG = ΔG°′ + RT ln (
[ citrate] )
6. PDP removes the phosphate group that inactivates the pyruvate
dehydrogenase complex. A deficiency of PDP leads to less pyruvate [ isocitrate]
ΔG°′ = −RT ln (
dehydrogenase activity in muscle cells, making it difficult for the [ citrate] )
muscle to increase flux through the citric acid cycle in order to meet
the energy demands of exercise. [ isocitrate] −ΔG°′/RT
( [ citrate] ) = e
7. Unlike the CO2 generated by the pyruvate dehydrogenase complex,
−1 −1
· mol−1)(310 K)
the formate produced in the reaction is a charged molecule and = e−(5000 J · mol )/(8.3145 J · K
therefore does not diffuse out of the cell. Instead, it can be used for = e−1.9 = 0.14
other biosynthetic reactions.
17. When pyruvate concentrations rise, indicating a need for in-
8. Although both processes generate acetyl-CoA for the citric
creased flux through the citric acid cycle, some of the pyruvate is
acid cycle, they differ in their redox properties. The pyruvate-
carboxylated to produce oxaloacetate to boost the cycle’s capac-
formate lyase reaction is not a redox reaction, so no NADH is
ity. If this step cannot occur, then excess pyruvate is converted to
generated. In contrast, the pyruvate dehydrogenase reaction
lactate instead.
generates NADH, which drives ATP synthesis through oxidative
phosphorylation. 18. If the pyruvate dehydrogenase complex cannot efficiently convert
pyruvate to acetyl-CoA, then pyruvate, an acid, accumulates and
OH causes the blood pH to drop.
|
9. −
OOC⏤CH⏤CH2⏤CH2⏤COO− 19. (a) Because citric acid cycle intermediates such as citrate and succinyl-
CoA are precursors for the biosynthesis of other compounds, anaer-
10. Inhibition of glutamate transamination to α-ketoglutarate would
obes must be able to synthesize them.
prevent the increase in citric acid cycle intermediates that would
allow increased flux of acetyl carbons through the cycle. (b) These organisms do not need a complete citric acid cycle, which
would yield reduced coenzymes that must be reoxidized.
11. Competitive inhibition can be overcome by adding more substrate—
in this case, succinate. Oxaloacetate overcomes malonate inhibition 20. Citrate can be cleaved to generate an acetyl group and oxaloacetate. The
because it is converted to succinate by the reactions of the citric acid oxaloacetate can then be converted to succinate to complete the cycle.
cycle. 21. Oxaloacetate + FADH2 + NADH + H+ → succinate + FAD +
12. Malonate inhibits the succinate dehydrogenase reaction, so its sub- NAD+ + H2O
strate succinate would accumulate. Since the succinyl-CoA synthe- 22. (a) α-Ketoglutarate + NAD+ + GDP + Pi → succinate + CO2 +
tase reaction operates near equilibrium, its substrate succinyl-CoA NADH + H+ + GTP
would also accumulate. (b) α-Ketoglutarate + CO2 + 2 NADH + 2 H+ + CoASH + FADH2 →
13. The ΔG°′ value is the sum of the ΔG°′ values for the malate de- succinate + acetyl-CoA + 2 NAD+ + 2H2O + FAD
hydrogenase reaction (29.7 kJ ∙ mol−1) and the citrate synthase 23. O
reaction (−31.5 kJ ∙ mol−1): −1.8 kJ ∙ mol−1. H3C
14. For the reaction isocitrate + NAD+ ⇌ α-ketoglutarate + NADH CH C S CoA
+ CO2 + H+, we assume [H+] = 1 and [CO2] = 1. According to H3C
Eq. 14-1, 24. Thiamine pyrophosphate is a cofactor for the pyruvate dehydro-
genase and α-ketoglutarate dehydrogenase complexes. In beriberi,
[ NADH ] [ α-ketoglutarate]
ΔG = ΔG°′ + RT ln ( the substrates for these enzymes, pyruvate and α-ketoglutarate,
[ NAD + ] [ isocitrate] )
would accumulate.
(1)(0.1) 25. NAD + (ℰ°′ = −0.315 V) does not have a high enough reduc-
= −21 kJ · mol−1 + (8.3145 J · K · mol−1 )(298 K) ln [
(8)(0.02) ] tion potential to support oxidation of succinate to fumarate
(ℰ°′ = +0.031 V); that is, the succinate dehydrogenase reac-
= −21 kJ · mol−1 − 1.16 kJ · mol−1 = −22.16 kJ · mol−1
tion has insufficient free energy to reduce NAD+. Enzyme-bound
With such a large negative free energy of reaction under physiologi- FAD (ℰ°′ ≈ 0) is more suitable for oxidizing succinate.
cal conditions, isocitrate dehydrogenase is likely to be a metabolic
26. The alternate pathway bypasses the succinyl-CoA synthetase reac-
control point.
tion of the standard citric acid cycle, a step that is accompanied by
15. From Table 17-2, for the succinate dehydrogenase reaction, ΔG°′ = the phosphorylation of ADP. The alternate pathway therefore gener-
6 kJ ∙ mol−1 and ΔG = ∼0. ates one less ATP than the standard citric acid cycle. There is no
[ fumarate] difference in the number of reduced cofactors generated.
ΔG = ΔG°′ + RT ln (
[ succinate] ) 27. The phosphofructokinase reaction is the major flux-control point
for glycolysis. Inhibiting phosphofructokinase slows the entire path-
[ fumarate] way, so the production of acetyl-CoA by glycolysis followed by the
ΔG°′ = −RT ln (
[ succinate] ) pyruvate dehydrogenase complex can be decreased when the citric
[ fumarate] acid cycle is operating at maximum capacity and the citrate concen-
−ΔG°′/RT
( [ succinate] ) = e tration is high. As citric acid cycle intermediates are consumed in
−1
synthetic pathways, the citrate concentration drops, relieving phos-
= e−(6000 J · mol )/(8.3145 J · K
−1
· mol−1)(310 K)
phofructokinase inhibition and allowing glycolysis to proceed in
= e−2.33 = 0.10 order to replenish the citric acid cycle intermediates.
SP-30
28. No. When glucose is abundant, a cell generates ATP through gly- 34. (a)
colysis followed by the citric acid cycle. The insulin-stimulated NAD+ malate
increase in pyruvate dehydrogenase activity does not function to
increase the number of acetyl groups that enter the citric acid cycle,
since the cell’s energy needs are already being met. Instead, the NADP+
acetyl groups are destined for fatty acid synthesis, a mechanism that NADH
helps the cell store metabolic fuel as triacylglycerols (in addition to
oxaloacetate
glycogen).
29. Succinyl-CoA ADP + Pi NADPH + CO2
succinyl-CoA synthetase

Succinate pyruvate
ATP + CO2
succinate dehydrogenase
(b) ATP + NADH + NADP + → ADP + Pi + NAD + + NADPH
Fumarate The net result is that NADH reducing equivalents are converted to
fumarase NADPH reducing equivalents, at the expense of 1 ATP.
35. First, the six-carbon isocitrate is decarboxylated to α-ketoglutarate.
Malate (mitochondrial) Next, glutamate dehydrogenase catalyzes reductive amination to pro-
duce glutamate. Finally, glutamate is isomerized to methylaspartate.
malate transporter
O
Malate (cytosolic) 36. ⏤CH2⏤CH2⏤CH2⏤CH2⏤NH⏤C⏤CH3
malate dehydrogenase The lysine side chain loses its positive charge when acetylated and
therefore cannot interact as closely with negatively charged DNA.
Oxaloacetate [Histone acetylation, which plays a role in gene expression, is
described more fully in Chapter 28.]
30. (a) The citric acid cycle is a multistep catalyst. Degrading an amino
acid to a citric acid cycle intermediate boosts the catalytic activity of Chapter 18
the cycle but does not alter the stoichiometry of the overall reaction 1. Mitochondria with more cristae have more surface area and there-
(acetyl-CoA → 2 CO2). To undergo oxidation, the citric acid cycle fore more proteins for electron transport and oxidative phosphoryla-
intermediate must exit the cycle and be converted to acetyl-CoA to tion. Tissues with a high demand for ATP synthesis (such as heart)
re-enter the cycle as a substrate. contain mitochondria with more cristae than tissues with lower de-
(b) Pyruvate derived from the degradation of an amino acid can be con- mand for oxidative phosphorylation (such as liver).
verted to acetyl-CoA by the pyruvate dehydrogenase complex; these 2. Maternally inherited mitochondrial diseases result from mutations
amino acid carbons can then be completely oxidized by the citric in mitochondrial rather than nuclear DNA. A mother provides mi-
acid cycle. tochondria to her offspring via eggs; a father’s mitochondria are not
31. To synthesize citrate, pyruvate must be converted to oxaloacetate by passed to his offspring.
pyruvate carboxylase: 3. When NADH participates in the glycerophosphate shuttle, the elec-
Pyruvate + CO2 + ATP + H2O → oxaloacetate + ADP + Pi trons of NADH flow to FAD and then to CoQ, bypassing Complex
I. Thus, about 1.5 ATP are synthesized per NADH.
A second pyruvate is converted to acetyl-CoA by pyruvate dehydro-
genase: 4. About 2.5 ATP per NADH are produced when NADH participates
in the malate–aspartate shuttle.
Pyruvate + CoASH + NAD + → acetyl-CoA + CO2 + NADH
5. If the mitochondrial electron-transport chain cannot function normally,
The acetyl-CoA then combines with oxaloacetate to produce citrate: then cells cannot rely on oxidative phosphorylation to meet their ATP
Oxaloacetate + acetyl-CoA + H2O → citrate + CoASH + H + needs. Instead, glycolysis occurs at a high rate, which helps generate
the necessary ATP but also produces lactate as an end product.
The net reaction is
6. Most of the electrons that enter the electron transport chain and
2 Pyruvate + ATP + NAD + + 2 H2O → that ultimately drive ATP production derive from NADH generated
citrate + ADP + Pi + NADH + H + by a large number of enzymes (in glycolysis, the citric acid cycle,
and fatty acid oxidation). Any defect in this pathway (Complex I
32. Animals cannot carry out the net synthesis of glucose from acetyl- → Complex III → Complex IV) would severely impact the mito-
CoA (to which acetate is converted). However, 14C-labeled acetyl- chondrion’s ability to generate ATP. In contrast, electrons that enter
CoA enters the citric acid cycle and is converted to oxaloacetate. the chain at Complex II (the succinate dehydrogenase reaction of
Some of this oxaloacetate may exchange with the cellular pool the citric acid cycle) make a relatively minor contribution to the
of oxaloacetate to be converted to glucose through gluconeogen- cell’s energy budget, so a defect in Complex II would have a smaller
esis and subsequently taken up by muscle and incorporated into effect.
glycogen. 7. The relevant half-reactions (Table 14-4) are
33. The malic enzyme reaction yields reducing power in the form of
FAD + 2 H + + 2 e− ⇌ FADH2 ℰ°′ = −0.219 V
NADPH, which is required for many biosynthetic processes (Sec-
+ −
tion 15-6). 1
2 O2 + 2 H + 2 e ⇌ H2O ℰ°′ = 0.815 V
 SP-31
Since the O2 /H2O half-reaction has the more positive Δℰ°′, the 16. The range of reduction potentials associated with the Cu ion suggests
FAD half-reaction is reversed and the overall reaction is that the surrounding protein, not just the immediate ligands for the
2 O2 + FADH2 ⇌ H2O + FAD
1 Cu ion, play a major role in determining the affinity of the Cu for
Δℰ°′ = 0.815 V − (−0.219 V) = 1.034 V electrons.
Since ΔG°′ = −nℱΔℰ°′, 17. O2 H2O
−1 −1 −1
ΔG°′ = −(2)(96,485 J · V · mol )(1.034 V) = −200 kJ · mol
Electron
The maximum number of ATPs that could be synthesized under transporting IV
complexes
standard conditions is therefore 200 kJ ∙ mol−l/30.5 kJ ∙ mol−1 = ADP + Pi
6.6 mol ATP/mol FADH2 oxidized by O2. III H+ H+
8. The reaction for Complex II is succinate + CoQ → fumarate + ATP
CoQH2. e– I ATP synthase
The relevant half-reactions and their standard reduction potentials
are given in Table 14-4.
Fumarate + 2 H+ + 2 e− ⇌ succinate ℰ°′ = −0.031 V 18. An increase in external pH (decrease in [H+]) increases the electro-
CoQ + 2 H + + 2 e− ⇌ CoQH2 ℰ°′ = 0.045 V chemical potential across the mitochondrial membrane and there-
Δℰ°′ = ℰ°′(e− acceptor) − ℰ°′(e− donor) fore leads to an increase in ATP synthesis.
= (0.045 V) − (0.031 V) = 0.014 V 19. The import of ADP (net charge −3) and the export of ATP (net
ΔG = −nℱΔℰ charge −4) represents a loss of negative charge from inside the
= −(2)(96,485 J · V−1 · mol−1 )(0.014 V) mitochondrion. This decreases the difference in electrical charge
across the membrane, since the outside is positive due to the translo-
= 2700 J · mol−1 = 2.7 kJ · mol−1
cation of protons during electron transport. Consequently, the elec-
This reaction does not supply enough free energy for the synthesis
trochemical gradient is diminished by the activity of the ADP–ATP
of ATP, which requires ∼30.5 kJ ∙ mol−1.
translocator. The activity of the Pi –H+ symport protein diminishes
9. Vitamin K resembles ubiquinone and is likely to play a similar role the proton gradient by allowing protons from the intermembrane
as a membrane-soluble carrier that delivers electrons from Com- space to re-enter the matrix.
plexes I and II to Complex III.
20. The transport of both ADP and Pi is driven by the free energy of
10. Pyocyanin resembles the flavin (isoalloxazine) portion of the cofac-
the electrochemical proton gradient, since the transport systems for
tors FMN (which occurs in Complex I) and FAD (which occurs in
ADP and Pi both dissipate the proton gradient.
Complex II).
21. The protonation and subsequent deprotonation of Asp 61 of the
11. Cytochrome c has several positively charged lysine residues on its
F1F0-ATPase’s c subunits induces the rotation of the c-ring, which
surface (Fig. 18-16), which would allow it to interact electrostati-
in turn, mechanically drives the synthesis of ATP. DCCD reacts
cally with cardiolipin, which has a net charge of −2 (Table 9-2).
with Asp 61 in a manner that prevents it from binding a proton and
12. (a) Normally, cytochrome c is confined to the intermembrane space thereby prevents the synthesis of ATP.
and is therefore sequestered from the cytosol. (b) For cytochrome c to
trigger apoptosis, the permeability of the outer mitochondrial mem- 22. Inhibition of proton transport in ATP synthase prevents ATP pro-
brane must increase enough to allow cytochrome c to enter the cytosol. duction by oxidative phosphorylation. The resulting buildup of the
proton gradient causes electron transport to slow, thereby slowing
13. NO− 3 is the electron acceptor and NADH is the electron donor. Their
the reoxidation of reduced cofactors produced by processes such
standard reduction potentials are listed in Table 14-4.
as the citric acid cycle. In this situation, continued production of
Δℰ°′ = ℰ°′(NO−3 ) − ℰ°′(NADH) ATP depends on anaerobic glycolysis. Because pyruvate-derived
= (0.42 V) − (−0.315 V) = 0.735 V acetyl-CoA cannot be processed by the citric acid cycle and because
ΔG = −nℱΔℰ NAD+ for glycolysis cannot be regenerated by the electron transport
= −(2)(96,485 J · V−1 · mol−1 )(0.735 V) chain, homolactic fermentation converts pyruvate to lactate, which
= −142,000 J · mol−1 = −142 kJ · mol−1 accumulates.
Since the standard free energy change for ATP synthesis is 30.5 kJ ∙ 23. DNP and related compounds dissipate the proton gradient required
mol−1, approximately 142/30.5 = 4.6 ATP could be synthesized. for ATP synthesis. The dissipation of the gradient decreases the rate
of synthesis of ATP, decreasing the ATP mass action ratio. Decreas-
14. S is the electron acceptor and acetate is the electron donor. Their
ing this ratio relieves the inhibition of the electron transport chain,
standard reduction potentials are listed in Table 14-4.
causing an increase in metabolic rate.
Δℰ°′ = ℰ°′(S) − ℰ°′(acetate)
24. Hormones stimulate the release of fatty acids from stored triacyl-
= (−0.23 V) − (−0.581 V) = 0.351 V
glycerols, which activates UCP1 and also provides the fuel whose
ΔG = −nℱΔℰ oxidation yields electrons for the heat-generating electron transfer
= −(2)(96,485 J · V−1 · mol−1 )(0.351 V) process. This cascade also amplifies the effect of the hormone.
= −68,000 J · mol−1 = −68 kJ · mol−1 25. The switch to aerobic metabolism allows ATP to be produced by
Since the standard free energy change for ATP synthesis is 30.5 kJ ∙ oxidative phosphorylation. The phosphorylation of ADP increases
mol−1, approximately 68/30.5 = 2.2 ATP could be synthesized. the [ATP]/[ADP] ratio, which then increases the [NADH]/[NAD+]
15. ℰ may differ from ℰ°′, depending on the redox center’s microenviron- ratio because a high ATP mass action ratio slows electron transport.
ment and the concentrations of reactants and products. In addition, the The increases in [ATP] and [NADH] inhibit their target enzymes in
tight coupling between successive electron transfers within a complex glycolysis and the citric acid cycle (Fig. 18-30) and thereby slow
may “pull” electrons so that the overall process is spontaneous. these processes.
SP-32
26. (a) If the channels allowed the transit of ions other than Ca2+, they 33. (a) NAD+ and NADP+ have similar standard reduction potentials
would dissipate the proton gradient across the inner mitochondrial (ℰ°′ values of −0.315 V and −0.320 V, respectively; Table 14-4),
membrane and prevent ATP synthesis. (b) Because Ca2+ ions stimu- so it is unlikely that the value of Δℰ under cellular conditions would
late several citric acid cycle enzymes (Fig. 18-30), the effect would generate a large value of ΔG. (b) The NNT reaction reduces the
be an increase in production of reduced cofactors that would in- efficiency of oxidative phosphorylation by consuming NADH that
crease electron transport and oxidative phosphorylation. could otherwise pass electrons to the electron-transport chain, and
27. Glucose is shunted through the pentose phosphate pathway to pro- by translocating a proton that could otherwise help drive the rotation
vide NADPH, whose electrons are required to reduce O2 to O−
2· .
of ATP synthase.
28. Because SOD apparently protects cells from oxidative damage, cells 34. 3-Phosphoglycerol dehydrogenase is part of the glycerol phosphate
with defective SOD would be expected to be more susceptible to shuttle system. Inhibiting the enzyme would block the entry of
such damage. (In fact, the mutant SOD retains its enzymatic activ- reducing equivalents (as NADH) from entering the electron-transport
ity but may misfold or aggregate so as to disrupt normal cellular chain at Complex II and so would reduce ATP production by
activities.) oxidative phosphorylation.
35. In an ATP synthase with more c subunits, more proton transloca-
29. (a) (b) tion events are required to drive one complete rotation of the c-ring.
Consequently, more substrate oxidation (O2 consumption) is re-
quired to synthesize three ATP (the yield of one cycle of the rotary
engine), and the P/O ratio is lower.
[O2] [O2] 36. (a) Since one ATP is synthesized for every one-third turn of the
c-ring, 10/3 or 3.3 protons are required to synthesize 1 ATP.
(b) 15/3 = 5 protons are required to synthesize 1 ATP.
37. Oxygen consumption will decrease when α-ketoglutarate levels in-
1 2 1 2
crease because the activity of ATP synthase is coupled to the activ-
t t
ity of the electron transport chain, which includes the O2-consuming
Complex IV.
(a) O2 consumption ceases because amytal blocks electron transport
38. Yes; dietary restriction increases the production of α-ketoglutarate,
in Complex I.
which leads to a decrease in the generation of reactive oxygen
(b) Electrons from succinate bypass the amytal block by entering the species that are believed to be partly responsible for the damage that
electron-transport chain at Complex II and thereby restore electron occurs during aging.
transport through Complexes III and IV.
39. The dead algae are a source of food for aerobic microorganisms
30. (a) (b) lower in the water column. As the growth of these organisms in-
creases, the rate of respiration and O2 consumption increase to the
point where the concentration of O2 in the water becomes too low to
sustain larger aerobic organisms.
[O2] [O2] 40. The molasses and oil are food for microorganisms. As the food is
consumed, the rate of respiration and oxygen consumption increase.
Eventually, the depletion of oxygen creates a more reducing envi-
ronment that favors the reduction of Cr(VI) compounds to Cr(III)
1 2 1 2 compounds.
t t 41. (a) Antimycin A binds to the Qi site of cytochrome bc1. This blocks
the binding of CoQ to this site and hence prevents its reduction
by heme bH. However, a simplistic interpretation of the Q cycle (Fig.
(a) CN− blocks electron transport in Complex IV, after the point of
18-15) might suggest that this would not prevent CoQH2 at the Qo
entry of succinate.
site from reducing cytochrome c1 via the iron–sulfur protein (ISP)
(b) Oligomycin blocks oxidative phosphorylation and hence O2 and shedding its two protons in the intermembrane space, thereby
consumption. DNP uncouples electron transport from oxidative pumping 50% of the four protons that it does in the absence of
phosphorylation and thereby permits O2 consumption to resume. inhibitor.
31. For the transport of a proton from outside to inside (Eq. 18-1), (b) The foregoing scenario implicitly assumes that either (1) CoQ⋅−
ΔG = 2.3 RT [ pH (side 1) − pH (side 2) ] + Z ℱΔ Ψ is released from the Qo site to allow subsequent rounds of the Q cy-
cle’s first cycle and that the CoQ⋅− is then reconverted to CoQH2
The difference in pH is −1.4. Since an ion is transported from the by Complex I and/or Complex II without binding protons from the
positive to the negative side of the membrane, ΔΨ is negative. intermembrane space; or (2) that CoQ⋅− is able to reduce the ISP
ΔG = (2.3)(8.314 J · K−1 · mol−1 )(298 K)(− 1.4) (which, in turn, reduces cytochrome c1) and is then released as CoQ.
However, since CoQ⋅− binds in a different subsite of Qo than does
+ (1)(96,485 J · V−1 · mol−1 )(−0.06 V)
CoQH2, it is both unlikely that CoQ⋅− would be readily released by
ΔG = −7980 J · mol−1 − 5790 J · mol−1 = −13.8 kJ · mol−1 Qo and that the ISP would be in a position to be reduced by CoQ⋅−.
32. Proton transport has a free energy change of −13.8 kJ ∙ mol−1 Hence neither of these scenarios appears to be correct.
(Problem 31). Since ΔG°′ for ATP synthesis is 30.5 kJ ∙ mol−1 and 42. Death is essentially an irreversible loss of order. On dying, cells lose
30.5/13.8 = 2.2, between two and three moles of protons must be their order on the molecular level by losing their ion gradients, en-
transported to provide the free energy to synthesize one mole of zymatically digesting their macromolecular components, breaking
ATP under standard biochemical conditions. down their membranes, etc. Thus, although cells and the organisms they
 SP-33
comprise appear to change little on dying, the microscopic changes The overall reaction is
that occur are profound and cannot be reversed by simply “curing” 2 NADP + + 2 H2O → 2 NADPH + O2 + 2 H +
the condition that caused death.
Δℰ°′ = −0.320 V − (0.815 V) = −1.135 V
ΔG°′ = −n ℱΔℰ°′
Chapter 19
= −(4)(96,485 J · V−1 mol−1 )(−1.135 V)
1. 2 H2O + 2 NADP+ → 2 NADPH + 2 H+ + O2
= 438 kJ · mol−1
2. 6 CO2 + 12 H2S + light energy → C6H12O6 + 6 S2 + 6 H2O
13. Because the light-dependent reactions (measured as O2 produced
3. The color of the seawater indicates that the photosynthetic pigments by PSII) and the light-independent reactions (measured as CO2
of the algae absorb colors of visible light other than red. fixed by the Calvin cycle) are only indirectly linked via ATP and
4. The light-harvesting complexes absorb light energy of a variety of NADPH, they may vary. Cyclic electron flow, which increases ATP
wavelengths and then pass the energy to the special pair. In order production without increasing NADPH production, may increase
for the excitation to remain on the special pair—that is, not be trans- the amount of O2 produced without increasing CO2 fixation.
ferred back to the light-harvesting complex—the special pair must 14. When cyclic electron flow occurs, photoactivation of PSI drives
have a lower excitation energy than the components of the light- electron transport independently of the flow of electrons derived
harvesting complex. Thus the special pair absorbs light at a longer from water. Thus, the oxidation of H2O by PSII is not linked to the
wavelength than do the antenna chromophores. number of photons consumed by PSI.
5. The energy per photon is E = hc/λ, so the energy per mole of pho- 15. Because chloroplast cytochrome b6 f is functionally and structurally
tons (λ = 700 nm) is similar to mitochondrial Complex III, myxothiazol would be expected
E = Nhc/λ to block electron transport in the chloroplast. As a result, the Q cycle
= (6.022 × 1023 mol−1 )(6.626 × 10−34 J · s) would not function and no proton gradient would be generated. No
(2.998 × 108 m · s−1 )/(7 × 10−7 m) ATP would be produced and no electrons would reach NADP+.
= 1.71 × 105 J · mol−1 16. At 40°C, membrane fluidity is increased such that protons may leak
across the membrane, thereby preventing the synthesis of the ATP
= 171 kJ · mol−1
required for the Calvin cycle. Without the desaturase, the chloro-
6. (171 kJ ∙ mol−1)/(30.5 kJ ∙ mol−1) = 5.6 plast would be unable to synthesize membrane lipids with highly
Thus 5 mol of ATP could theoretically be synthesized. unsaturated tails. As a result, the membrane would be less fluid
7. The order of action is water–plastoquinone oxidoreductase (Pho- (Section 9-2) and therefore less likely to become leaky at higher
tosystem II), plastoquinone–plastocyanin oxidoreductase (cy- temperatures.
tochrome b6 f ), and plastocyanin–ferredoxin oxidoreductase 17. Using Equation 18-1,
(Photosystem I).
ΔG = 2.3 RT [ pH (side 1) − pH (side 2) ]
8. The label appears as 18O2:
light
ΔG = 2.3(8.3145 J · K−1 · mol−1 )(298 K)(−3.4)
H 218O + CO2 ⟶ (CH2O) + 18O2 = −19,400 J · mol−1 = −19.4 kJ · mol−1
9. Both systems mediate cyclic electron flows. The photooxidized bac- 18. Because 3 ATP are produced for each complete rotation of the ATP
terial reaction center passes electrons through a series of electron synthase c-ring, and one proton is translocated for each c subunit,
carriers so that electrons return to the reaction center (e.g., P960+) 14/3 = 4.7 protons must be translocated to synthesize 1 ATP.
and restore it to its original state. During cyclic electron flow in PSI, 19. An uncoupler dissipates the transmembrane proton gradient by pro-
electrons from photooxidized P700 are transferred to cytochrome viding a route for proton translocation other than ATP synthase.
b6 f and, via plastoquinone and plastocyanin, back to P700. In both Therefore, chloroplast ATP production would decrease.
cases, there is no net change in the redox state of the reaction cen- 20. The uncoupler would not affect NADP+ reduction since light-driven
ter, but the light-driven electron movements are accompanied by the electron transfer reactions would continue regardless of the state of
transmembrane movement of protons. the proton gradient.
10. Use the data provided in Table 14-4. 21. By allowing K+ ions to cross the thylakoid membrane from the
Q + 2 H + + 2 e − → QH2 ℰ°′ = 0.045 V lumen to the stroma, the channel would dissipate a portion of the
2 cyt c2(ox) + 2 H + + 2 e − → 2 cyt c2(red) ℰ°′ = 0.230 V membrane potential (ΔΨ) without affecting ΔpH. This would help
maintain electrical neutrality and fine-tune the protonmotive force
The overall reaction is
needed for ATP synthesis.
QH2 + cyt c2(ox) → 2 Q2 + 2 cyt c2(red)
22. The protonmotive force depends on a lower pH (higher [H+]) in the
Δℰ°′ = 0.230 V − (0.045 V) = 0.185 V lumen. A rise in lumenal pH would indicate a weak protonmotive
ΔG°′ = −n ℱΔℰ°′ force, which would decrease the activity of the K+ channel.
= −(2)(96,485 J · V−1 · mol−1 )(0.185 V) 23. After the light is turned off, ATP and NADPH levels fall as these
= 36,000 J · mol−1 = 36 kJ · mol−1 substances are used up in the Calvin cycle without being replaced
11. The change in reduction potential is about −1.5 V (Fig. 19-10). by the light reactions. The RuBP level drops because it is consumed
by the RuBP carboxylase reaction (which requires neither ATP nor
Since ΔG°′ = −nℱΔℰ°′,
NADPH) and its replenishment is blocked by the lack of ATP for the
ΔG = −(1)(96,485 J · V−1 · mol−1 )(−1.5 V) phosphoribulokinase reaction.
= 140,000 J · mol−1 = 140 kJ · mol−1 24. 3PG builds up because it cannot pass through the phosphoglycerate
12. The relevant half-reactions are (Table 14-4): kinase reaction in the absence of ATP.
O2 + 4 H + + 4 e − ⇌ 2 H2O ℰ°′ = 0.815 V 25. The carbonic anhydrase catalyzes the conversion of bicarbonate to
NADP + + H + + 2 e − ⇌ NADPH ℰ°′ = −0.320 V CO2, which is the substrate for RuBP carboxylase.
SP-34
26. O2 competes with CO2 for the active site of the carboxylase. By mini- 39. The net synthesis of 2 GAP from 6 CO2 in the initial stage of the
mizing the presence of O2, the carboxysome minimizes the frequen- Calvin cycle (Fig. 19-26) consumes 18 ATP and 12 NADPH (equiv-
cy of photooxidation and improves the efficiency of carbon fixation. alent to 30 ATP). The conversion of 2 GAP to glucose-6-phosphate
27. The cyanobacterial enzyme is more efficient at carboxylation but (G6P) by gluconeogenesis does not require energy input (Section
is still limited by the amount of CO2 available. Hence augmenting 16-4B), nor does the isomerization of G6P to glucose-1-phosphate
the CO2 supply by introducing bicarbonate transporters is beneficial (G1P). The activation of G1P to its nucleotide derivative consumes
(carbonic anhydrase converts the bicarbonate to CO2). 2 ATP equivalents (Section 16-5), but ADP is released when the
28. An increase in [O2] increases the oxygenase activity of RuBP carbox- glucose residue is incorporated into starch. These steps represent an
ylase–oxygenase and therefore lowers the efficiency of CO2 fixation. overall energy investment of 18 + 30 + 1 = 49 ATP.
29. These plants store CO2 by CAM. At night, CO2 reacts with PEP to Starch breakdown by phosphorolysis yields G1P, whose subse-
form malate. By morning, so much malate (malic acid) has accumu- quent degradation by glycolysis yields 3 ATP, 2 NADH (equivalent
lated that the leaves have a sour taste (the taste of H+). During the to 5 ATP), and 2 pyruvate. Complete oxidation of 2 pyruvate to 6 CO2
day, the malate is converted to pyruvate + CO2. The leaves therefore by the pyruvate dehydrogenase reaction and the citric acid cycle
become less acidic and hence tasteless. Late in the day, when all the (Section 17-1) yields 8 NADH (equivalent to 20 ATP), 2 FADH2
malate is consumed, the leaves become slightly basic; that is, bitter. (equivalent to 3 ATP), and 2 GTP (equivalent to 2 ATP). The overall
ATP yield is therefore 3 + 5 + 20 + 3 + 2 = 33 ATP.
30. The increased availability of the substrate CO2 would increase the
rate of photosynthesis. Because C4 plants spend relatively more en- The ratio of energy spent to energy recovered is 49/33 = 1.5.
ergy to acquire CO2 for the Calvin cycle, C3 plants might have the 40. (a) Glycolysis generates pyruvate, which is decarboxylated to yield
advantage when CO2 is more accessible. acetyl-CoA for fatty acid synthesis and CO2, which diffuses out of
31. The increased concentration of CO2 would mean that plants would the cell. In order not to waste this CO2, the seed’s RuBP carboxylase
need to open their stomata less to obtain the CO2 needed for the combines the CO2 with RuBP to incorporate it back into carbohy-
Calvin cycle. Consequently, less water would be lost through the drates that can be broken down to yield more acetyl-CoA to support
stomata and the plants’ water consumption would decrease. fatty acid synthesis.
32. The C4 plants are able to open their stomata to collect CO2 without (b) Photons absorbed by PSII and transferred to cytochrome b6 f
losing much water, which is concentrated near the bundle-sheath could drive the synthesis of ATP to support carbon fixation by RuBP
cells. C3 plants lack this specialization of function and so are at risk carboxylase. Because the entire Calvin cycle does not function, the
of losing too much water while collecting CO2 for the Calvin cycle. RuBP must be regenerated by other mechanisms (in this case, it is
derived from glycolytic intermediates).
33. The longer-wavelength absorption maximum allows the bacteria to
collect more low-energy (longer-wavelength) light to use for photo- 41. If nighttime warming exceeds daytime warming, then respiration
synthesis. (which occurs day and night) might proceed at a rate greater than
could be sustained by photosynthesis (which occurs only during the
34. The cyanobacteria adapt to the light conditions by altering the
day). As a result, plant growth would be slowed.
production of different pigments so that their color (indicating the
wavelengths not absorbed) is complementary to the light used for 42. In warm dry areas, the overall rate of photosynthesis is limited mainly
photosynthesis. Under medium-energy green light, the bacteria are by the need to prevent evaporative water loss, so plants in these areas
relatively rich in pigments that capture high-energy wavelengths cannot benefit from the temperature-driven increase in photosynthetic
(the blue end of the spectrum) but not low-energy (red) light. Under rates. In cool wet areas, the rate of photosynthesis is limited mainly by
low-energy red light, the bacteria are relatively rich in pigments that temperature, so these plants do benefit from rising temperatures.
capture the low-energy light and absorb less blue light. 43. The partial pressure of CO2 at which a C4 plant can photosynthesize
35. One mole of photons of red light (λ = 700 nm) has an energy of 171 kJ. is much lower than that of a C3 plant. Moreover, at very low partial
Therefore, 438/171 = 2.6 moles of photons are theoretically required to pressures of CO2, the C3 plant reverses the effects of photosynthesis
drive the oxidation of H2O by NADP+ to form one mole of O2. by photorespiration. In the sealed box, the C4 plant maintains the
CO2 partial pressure so low that the C3 plant wastes away through
36. The energy of a mole of photons of UV light (λ = 220 nm) is
photorespiration. In effect, the C4 plant devours the C3 plant.
E = Nhc/λ
= (6.022 × 1023 mol−1 )(6.626 × 10−34 J · s) Chapter 20
(2.998 × 108 m · s−1 )/(2.2 × 10−7 m) 1. ATP ADP
CH2OH CH2OH
= 544 kJ · mol−1
HO C H HO C H
The number of moles of 220-nm photons required to produce one glycerol
mole of O2 is 438/544 = 0.8. CH2OH kinase CH2 O PO32–
37. The buildup of the proton gradient is indicative of a high level of ac-
L-Glycerol L-Glycerol-3-phosphate
tivity of the photosystems. A steep gradient could therefore trigger
photoprotective activity to prevent further photooxidation when the
NAD+ glycerol-3-
proton-translocating machinery is operating at maximal capacity.
phosphate
38. Photooxidation would not be a good protective mechanism since it dehydrogenase
might interfere with the normal redox balance among the electron- NADH + H+
carrying groups in the thylakoid membrane. Releasing the energy
CH2OH
by exciton transfer or fluorescence (emitting light of a longer wave-
length) could potentially funnel light energy back to the overactive C O
photosystems. Dissipation of the excess energy via internal conversion
CH2 O PO32–
to heat would be the safest mechanism, since the photosystems do not
have any way to harvest thermal energy to drive chemical reactions. Dihydroxyacetone phosphate
 SP-35
2. The reaction products are palmitate, oleate, and 2-oleoylglycerol. Likewise, glucose catabolism has an efficiency of
3. (a) The various bile acids bear carboxylic acid or sulfonic acid 32 × 30.5/2850 × 100 = 34 %
groups that are ionized at neutral pH, so they have a net negative Thus, the two processes have very nearly the same overall efficiency.
charge. (b) The bile acids are amphiphilic and act as detergents that
11. Because ACP carries the growing acyl chain between the sepa-
solubilize bacterial cell membranes, killing the cells.
rate enzymes of the bacterial fatty acid synthesis pathway, it must
4. (a) accommodate reaction intermediates, which are mostly hydrophobic,
O
12. The Glu side chains create a patch of negative charge on ACP. The
C O– E. coli dehydrase must have a positively charged surface in order
to dock with ACP, which delivers the intermediates of fatty acid
CH3 synthesis, so it is likely to be rich in Lys and Arg side chains.
13. Six rounds of β oxidation are required to convert the 16-carbon pal-
mitate to the 4-carbon butyrate.
CH3
14. One round of β oxidation of butyrate produces 1 NADH and
1 FADH2, which are used to produce 4 ATP by oxidative phosphory-
lation. The 2 acetyl-CoA derived from butyrate enter the citric acid
cycle and generate 20 ATP. Since butyryl-CoA formation costs 2
H
ATP equivalents, the net yield is 22 ATP.
(b) Removing the glycine group at C24 and the hydroxyl groups at C3, 15. There are not as many usable nutritional calories per gram in un-
C7, and C12 generates a more hydrophobic (less soluble) product. saturated fatty acids as there are in saturated fatty acids. This is be-
(c) The less-soluble bile acids are more likely to precipitate or cause oxidation of fatty acids containing double bonds yields fewer
aggregate and so are less able to disrupt bacterial membrane integrity. reduced coenzymes whose oxidation drives the synthesis of ATP. In
the oxidation of fatty acids with a double bond at an odd-numbered
5. Lipoprotein B, with a greater proportion of protein, has a higher density. carbon, the enoyl-CoA isomerase reaction bypasses the acyl-CoA
6. (a) Perilipin likely resembles the water-soluble apolipoproteins, dehydrogenase reaction and therefore does not generate FADH2
since it is able to interact with the phospholipid surface of a lipid (equivalent to 1.5 ATP). A double bond at an even-numbered carbon
droplet. Perilipin likely contains amphipathic α helices. must be reduced by NADPH (equivalent to the loss of 2.5 ATP).
(b) Phosphorylation of perilipin likely interferes with perilipin– 16. The β oxidation of a saturated C18 fatty acid would yield 120 ATP:
phospholipid interactions, because the negatively charged phos- 8 cycles of β oxidation = 32 ATP; 9 acetyl-CoA yield 90 ATP via
phate groups would repel the phospholipid head groups. As a result, the citric acid cycle and oxidative phosphorylation; and 2 ATP are
perilipin would associate less tightly with the lipid droplet, allowing consumed in activating the fatty acid. During β oxidation of oleate,
access to lipases. the presence of the double bond allows the FADH2-generating
7. A defect in carnitine palmitoyl transferase II prevents normal trans- acyl-CoA dehydrogenase step to be skipped, at a cost of 1.5 ATP
port of activated fatty acids into the mitochondria for β oxidation. equivalents. Therefore, the ATP yield from oleate is 118.5.
Tissues such as muscle that use fatty acids as metabolic fuels there- 17. Oxidation of odd-chain fatty acids generates succinyl-CoA, an
fore cannot generate ATP as needed. intermediate of the citric acid cycle. Because the citric acid cycle
8. The problem is more severe during a fast because other fuels, such operates as a multistep catalyst to convert acetyl groups to CO2,
as dietary glucose, are not readily available. increasing the concentration of a cycle intermediate can increase the
9. The first three steps of β oxidation resemble the reactions that catalytic activity of the cycle.
convert succinate to oxaloacetate (Sections 17-3F–17-3H). 18. Conversion of propionyl-CoA to succinyl-CoA consumes 1 ATP.
Conversion of succinyl-CoA to malate by the citric acid cycle pro-
CO–2 CO–2 duces 1 GTP (equivalent to 1 ATP) and 1 FADH2 (equivalent to 1.5
FAD FADH2 H2O ATP). The conversion of malate to pyruvate produces 1 NADPH
CH2 C H
(equivalent to 2.5 ATP, assuming NADPH is energetically equiva-
CH2 succinate H C fumarase lent to NADH). Conversion of pyruvate to acetyl-CoA produces 1
dehydrogenase NADH (equivalent to 2.5 ATP). Each acetyl-CoA that enters the cit-
– –
CO 2 CO 2 ric acid cycle yields 10 ATP equivalents. Consequently, catabolism
Succinate Fumarate of propionyl-CoA yields 16.5 ATP, 6.5 more than for acetyl-CoA.
19. 3-Ketoacyl-CoA transferase is required to convert ketone bodies to
CO–2 CO–2
NAD+
+
NADH + H acetyl-CoA. If the liver contained this enzyme, it would be unable to
HO C H C O supply ketone bodies as fuels for other tissues.
CH2 malate CH2 20. See Fig. 20-21.
dehydrogenase O O
– –
CO 2 CO 2 14 14 –
H3C C CH2 C O
L-Malate Oxaloacetate
Acetoacetate
10. Palmitate oxidation produces 106 ATP and glucose catabolism 21. The label does not appear in palmitate because 14CO2 is released in
produces 32 ATP (Section 17-4). The standard free energy of ATP Reaction 2b of fatty acid synthesis (Fig. 20-26).
synthesis from ADP + Pi is 30.5 kJ ∙ mol−1. Palmitate catabolism
22. Enoyl-CoA reductase catalyzes step 5 of fatty acid synthesis.
therefore has an efficiency of
Inhibiting this reaction would kill bacteria by preventing them from
106 × 30.5/9781 × 100 = 33% producing essential lipids.
SP-36
23. The breakdown of glucose by glycolysis generates the dihydroxy- 34. Pristanate has a methyl group at the α position, which does not
acetone phosphate that becomes the glycerol backbone of triacyl- interfere with the reactions of β oxidation.
glycerols (Fig. 20-29).
24. Glycerol kinase converts glycerol to glycerol-3-phosphate, a precursor
O–
for triacylglycerol synthesis. By promoting triacylglycerol synthesis, the
drug decreases the concentration of unesterified fatty acids in the body.
O
25. ACC catalyzes the first committed step of fatty acid synthesis, so
Pristanate
blocking this step might decrease the fatty acids available for storage
as triacylglycerols (fat). The malonyl-CoA produced in the ACC The products of β oxidation of pristanate are three acetyl-CoA, three
reaction inhibits import of fatty acyl-CoA into the mitochondria, so propionyl-CoA, and one methylpropionyl-CoA.
lowering the level of malonyl-CoA might help promote fatty acid 35. Palmitate (C16) synthesis requires 14 NADPH. The transport of 8
oxidation and reduce fat accumulation. acetyl-CoA to the cytosol by the tricarboxylate transport system
26. Dietary fatty acids may be abundant in an obese individual, so that supplies 8 NADPH (Fig. 20-23), which represents 8/14 × 100 =
fatty acid synthesis occurs at a low rate. Inhibition of ACC might 57% of the required NADPH.
therefore have little effect on fat metabolism. 36. This fatty acid (linolenate) cannot be synthesized by animals
27. (a) Yes; the egg phosphatidylcholine is a source of choline that is because it contains a double bond closer than 6 carbons from its
eventually converted to TMAO. (b) No; excess phosphatidylcholine noncarboxylate end.
would increase the concentration of TMAO and promote athero- 37. The synthesis of stearate (18:0) from mitochondrial acetyl-CoA
sclerosis. Atherosclerosis is a progressive disease that often accom- requires 9 ATP to transport 9 acetyl-CoA from the mitochondria to
panies aging, so this condition would only worsen with increased the cytosol. Seven rounds of fatty acid synthesis consume 7 ATP (in
intake of phosphatidylcholine. the acetyl-CoA carboxylase reaction) and 14 NADPH (equivalent to
28. See Fig. 20-35. 35 ATP). Elongation of palmitate to stearate requires 1 NADH and
OH 1 NADPH (equivalent to 5 ATP). The energy cost is therefore 9 + 7
+ 35 + 5 = 56 ATP.
14
CH (CH2)14 CH3
The degradation of stearate to 9 acetyl-CoA consumes 2 ATP
H2N C H (in the acyl-CoA synthetase reaction) but generates, in eight rounds
of β oxidation, 8 FADH2 (equivalent to 12 ATP) and 8 NADH
CH2OH (equivalent to 20 ATP). Thus, the energy yield is 12 + 20 − 2 =
30 ATP. This represents only about half of the energy consumed in
Sphinganine
synthesizing stearate (30 ATP versus 56 ATP).
29. This molecule consists of palmitate that has been esterified to 38. The synthesis of stearate from acetyl-CoA costs 56 ATP and its
12-hydroxy stearate. β oxidation yields 30 ATP (Problem 37). The complete oxida-
30. From top to bottom: linoleate, myristate, palmitate. tion of the 9 acetyl-CoA to CO2 by the citric acid cycle yields an
31. The products are heptadecane (C17H36) and pentadecane (C15H32). additional 9 GTP (equivalent to 9 ATP), 27 NADH (equivalent to
32. The products are one palmitoyl methyl ester, two oleoyl methyl 67.5 ATP), and 9 FADH2 (equivalent to 13.5 ATP) for a total of
esters, and one glycerol: 30+9+67.5+13.5=120 ATP. Thus, more than twice the energy
investment of synthesizing stearate is recovered (120 ATP versus 56
O
ATP).
H3C (CH2)14 C O CH3 39. Palmitate biosynthesis consumes 7 ATP and 14 NADPH (equivalent
to 35 ATP). The addition of four more 2-carbon units as acetyl-CoA
O in the mitochondrion (Fig. 20-28) consumes 4 NADH (equivalent to
H3C (CH2)7 CH CH (CH2)7 C O CH3 10 ATP) and 4 NADPH (equivalent to 10 ATP), so that a total of 62
ATP are consumed.
H2C CH CH2 40. Palmitate biosynthesis consumes 7 ATP and 14 NADPH (equivalent
HO OH OH
to 35 ATP). The addition of four more 2-carbon units, initially in the
form of acetyl-CoA, in the endoplasmic reticulum consumes 4 ATP
33. (a) Phytanate can be esterified to CoA, but the methyl group at the (in converting acetyl-CoA to malonyl-CoA). The steps of fatty acid
β position prevents the dehydrogenation catalyzed by hydroxyacyl- synthesis consume 8 NADPH (equivalent to 20 ATP), so a total of
CoA dehydrogenase (reaction 3 of the β oxidation pathway). 66 ATP are consumed.
(b) 41. Statins inhibit the HMG-CoA reductase reaction, which produces
O mevalonate, a precursor of cholesterol. Although lower cholesterol
levels induce the synthesis of HMG-CoA reductase to make up for
SCoA the loss in activity, some decrease in activity may still be present.
OH Because mevalonate is also the precursor of ubiquinone (coenzyme
2-Hydroxyphytanoyl-CoA Q), supplementary ubiquinone may be necessary.
(c) 42. At the very low pH of the stomach, atorvastatin’s carboxylate group
is protonated and neutral, which enhances the drug’s hydrophobicity.
At the neutral pH of the intestine, the drug is more soluble because
the carboxylate group is ionized.
43. The patient is suffering from a deficiency of lipoprotein lipase (an
O inherited disease), which normally functions to hydrolyze the
Pristanal
 SP-37
triacylglycerols of chylomicrons and VLDL. The symptoms of the O O
disease may be minimized by maintaining a low fat diet since chylo-
microns are intestinally packaged dietary lipids. CH3 C SCoA + CH3 CH2 C SCoA

Acetyl-CoA Propionyl-CoA
Chapter 21
10.
1. Proteasome-dependent proteolysis requires ATP to activate bond to be cleaved
ubiquitin in the first step of linking ubiquitin to the target protein
(Fig. 21-2) and for denaturing the protein as it enters the proteasome. O H
2. The structure of the inhibitor suggests that the archaebacterial prote- C CH2 C COO–
asome cleaves polypeptide substrates at hydrophobic residues such
as Leu.
3. The proteasome would facilitate the degradation of intracellular NH2 N
+
H
proteins that have been damaged or denatured by heat or oxidation
OH
and would therefore help the cell eliminate these nonfunctional and O
–
possibly toxic proteins so that they could be replaced by newly syn- –2
O3PO
thesized proteins.
4. By interfering with normal cellular protein turnover by the pro- +
N CH3
teasome, ritonavir could promote the accumulation of damaged or H
unneeded proteins. Such protein accumulation is particularly prob-
11. Tyrosine is derived from the essential amino acid phenylalanine,
lematic in long-lived cells such as neurons (see Section 6-5C).
and cysteine is derived from the essential amino acid methionine.
5. A glutamate receptor would have helped human ancestors recognize A diet lacking sufficient phenylalanine and methionine will lead to
protein-rich foods, because foods containing significant amounts of shortages of tyrosine and cysteine also.
protein also contain relatively large amounts of glutamate, one of
12. The grain protein contains little Lys, whereas the bean protein con-
the most abundant amino acids.
tains little Met; together, the foods provide a balanced complement
6. Amino acid + H2O + O2 → α-keto acid + NH3 + H2O2 of essential amino acids.
7. (a) Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Met, Pro, Ser, and Val 13. Glutamate dehydrogenase, glutamine synthetase, and carbamoyl
(b) Leu and Lys phosphate synthetase.
(c) Ile, Phe, Thr, Trp, and Tyr 14. The γ-carboxylate group of glutamate is reduced to form glutamate-
8. Tryptophan can be considered a member of this group since one of 5-semialdehyde. An aminotransferase then transfers an amino group
its degradation products is alanine, which is converted to pyruvate (from glutamate or another amino acid) to yield ornithine.
by deamination. 15. In the absence of uridylyl-removing enzyme, adenylyltransferase ·
9. Since the three reactions converting tiglyl-CoA to acetyl-CoA PII will be fully uridylylated, since there is no mechanism for remov-
and propionyl-CoA are analogous to those of fatty acid oxidation ing the uridylyl groups once they are attached. Uridylylated adenyl-
(β oxidation; Fig. 20-12), the reactions are yltransferase · PII adenylylates glutamine synthetase, which activates
it. Hence, the defective E. coli cells will have a hyperactive gluta-
O mine synthetase and thus a higher than normal glutamine concen-
CH3 CH C C SCoA tration. Reactions requiring glutamine will therefore be accelerated,
thereby depleting glutamate and the citric acid cycle intermediate
CH3 α-ketoglutarate. Consequently, biosynthetic reactions requiring
Tiglyl-CoA transamination, as well as energy metabolism, will be suppressed.
16. Since only plants and microorganisms synthesize aromatic amino
H2O acids, herbicides that inhibit these pathways do not affect amino acid
(a hydratase)
metabolism in animals.
17. Glycine
H O
18. The reaction is a transamination that removes the tryptophan
CH3 C CH C SCoA α-amino group, reduces the kynurenine carbonyl group, and con-
nects the α carbon to the amino group that was originally part of the
OH CH3
tryptophan side chain.
NAD+ 19. 2-Phenylethanol is derived from phenylalanine by removal of the amino
(a dehydrogenase) group and reduction of the carboxylate group to a hydroxide group.
NADH 20. Tyramine is decarboxylated tyrosine.
21. Agmatine is derived by decarboxylation from arginine.
O O 22. The compound resembles the urea cycle intermediate ornithine
CH3 C CH C SCoA (with a CHF2 group at its Cα atom).
23. A methyl group is added to the hydroxyl group of the phenyl ring,
CH3
and the amino group is replaced by a carboxylate group by oxidative
CoASH deamination.
(a thiolase)
24. The MAO inhibitors help block degradation of epinephrine, which
functions as neurotransmitter in the brain.
SP-38
25. The pigment coloring skin and hair is melanin, which is synthesized (Section 21-6B). c bond cleavage: serine hydroxymethyltransferase
from tyrosine. When tyrosine is in short supply, as when dietary (Fig. 21-14).
protein is not available, melanin cannot be synthesized in normal 36. Biotin, conversion of pyruvate to oxaloacetate by pyruvate carboxyl-
amounts, and the skin and hair become depigmented. ase (Fig. 16-18); coenzyme B12, conversion of (S)-methylmalonyl-
26. Melatonin is derived from tryptophan, which undergoes decarboxyl- CoA to (R)-methylmalonyl-CoA (Fig. 20-19); S-adenosylmethionine,
ation, N-acetylation, hydroxylation, and O-methylation. the conversion of norepinephrine to epinephrine by phenylethanol-
27. The standard nitrogenase reaction, N2 → NH3, also produces H2. amine N-methyltransferase (Fig. 21-39); tetrahydrofolate, the conver-
This H2 is used to reduce CO to C2H6 and C3H8. sion of glycine to serine by serine hydroxymethyltransferase (Fig.
28. The oxidation of ammonia to nitrite is an exergonic process that 21-14); thiamine pyrophosphate, the decarboxylation of pyruvate by
yields the ATP and reduced NADPH required for the Calvin cycle. pyruvate dehydrogenase (Fig. 17-6).
29. The urea cycle transforms excess nitrogen from protein breakdown to 37. Yes; one product of the glycine cleavage system is N 5, N10-methylene-
an excretable form, urea. In a deficiency of a urea cycle enzyme, the THF, which provide the one-carbon group for converting dUMP to
preceding urea cycle intermediates may build up to a toxic level. A low- dTMP.
protein diet minimizes the amount of nitrogen that enters the urea cycle 38. The oxidation of methylene-tetrahydrofolate (Fig. 21-20) generates
and therefore reduces the concentrations of the toxic intermediates. NADPH that could be used for biosynthetic reactions.
30. An individual consuming a high-protein diet uses amino acids as 39. Threonine dehydrogenase converts threonine to α-amino-β-
metabolic fuels. As the amino acid skeletons are converted to glu- ketobutyrate (Fig. 21-14), which is then broken down to acetyl-CoA
cogenic or ketogenic compounds, the amino groups are disposed and glycine. The glycine cleavage system transfers a one-carbon group
of as urea, leading to increased flux through the urea cycle. During to THF. Homocysteine reacts with methyl-THF to yield methionine
starvation, proteins (primarily from muscle) are degraded to provide (Fig. 21-18), which is a precursor for S-adenosylmethionine.
precursors for gluconeogenesis. Nitrogen from the protein-derived 40. Fertilizer provides nitrogen in the form of ammonia or nitrate,
amino acids must be eliminated, which demands a high level of urea which must be taken up by plants and assimilated. The experimen-
cycle activity. tal results suggest that the allocation of amino groups in the plant,
31. (a) Three ATP are converted to 2 ADP and AMP + PPi, for a total rather than the uptake of nitrogen from fertilizer, is the limiting step.
of 4 ATP equivalents. The increased alanine aminotransferase activity permits assimilated
(b) The fumarate produced in the urea cycle can be converted to nitrogen to more rapidly be distributed among amino acids through
malate and then to pyruvate by malic enzyme, generating NADPH transamination reactions.
(equivalent to 2.5 ATP). Conversion of pyruvate to acetyl-CoA 41. Ferrochelatase is a homodimer. Thus in heterozygotes for a defec-
generates NADH (2.5 ATP equivalents), and the oxidation of the tive ferrochelatase, if it is expressed in normal amounts, 25% of the
acetyl-CoA by the citric acid cycle yields another 10 ATP, for a dimers will have both subunits defective, 50% will have one subunit
total of 15 ATP. defective and the other normal, and 25% will have both subunits
32. (a) normal. Apparently, only a dimer with two normal subunits is en-
zymatically active, thereby accounting for the observed activity of
O
ferrochelatase in heterozygotes.
H2N C NH2 + H2O 2 NH3 + CO2
Chapter 22

(b) The NH3 produced by the action of urease can combine with 1. At high altitude, less oxygen is available for aerobic metabolism, so
protons in gastric fluid to form NH4+ . This could reduce the concen- glycolysis, an anaerobic pathway, would become relatively more im-
tration of protons and therefore increase the pH. portant in active muscles. An increase in GLUT1 would increase the
33. The ε-amino group is removed by the addition of α-ketoglutarate intracellular glucose concentration, and an increase in PFK would
followed by the departure of glutamate (Fig. 21-22, Reactions 1 and 2). increase the flux of glucose through the pathway.
The α-amino group is eliminated when α-aminoadipate undergoes 2. Lactate must be converted back to pyruvate, which generates NADH
transamination with α-ketoglutarate (Fig. 21-22, Reaction 4). (equivalent to 2.5 ATP). Another NADH (2.5 ATP) is generated by
34. Glutamate is converted to α-ketoglutarate by glutamate dehydroge- the conversion of pyruvate to acetyl-CoA. Complete oxidation of the
nase, producing 1 NADPH (equivalent to 2.5 ATP). The conver- acetyl-CoA by the citric acid cycle generates 10 more ATP equiva-
sion of α-ketoglutarate to malate by the citric acid cycle produces 1 lents, for a total of 15 ATP. The ATP yield from 1 mol of lactate is
NADH, 1 GTP, and 1 FADH2 (equivalent to 5 ATP). Malic enzyme 15 mol.
converts malate to pyruvate and generates 1 NADH (2.5 ATP equiv- 3. Cardiac muscle relies on oxidation of fatty acids to supply ATP for
alents). The conversion of pyruvate to acetyl-CoA also produces 1 muscle contraction. The muscle performs poorly when β oxidation
NADH (2.5 ATP). The complete oxidation of acetyl-CoA by the is inhibited, and the blood glucose concentration drops as the heart
citric acid cycle generates 10 ATP, for a total of 22.5 ATP. takes up glucose instead to meet its need for ATP through glycolysis.
The conversion of methionine to homocysteine costs 3 ATP equiva- 4. The pentose phosphate pathway supplies ribose as well as NADPH
lents. The conversion of homocysteine to propionyl-CoA generates to support the biosynthetic processes, including nucleotide synthe-
1 NADH (2.5 ATP equivalents). Conversion of propionyl-CoA to sis, that are necessary for cell growth and division.
succinyl-CoA consumes 1 ATP. Converting succinyl-CoA to malate 5. GLUT2 has a higher KM than GLUT1 so that the rate of glucose
by the citric acid cycle generates 1 GTP and 1 FADH2 (1.5 ATP entry into liver cells can vary directly with the concentration of glu-
equivalents). The remaining steps are the same as described for cose in the blood. A transporter with a high KM is less likely to be
glutamate. The net yield of ATP from methionine breakdown is 16 saturated with its ligand and therefore would not limit the rate of
ATP, significantly less than from glutamate. transport.
35. a bond cleavage: transaminases (Fig. 21-8) and serine–threonine de- 6. Type 1 glycogen storage disease results from a deficiency of glu-
hydratase (Fig. 21-15). b bond cleavage: amino acid decarboxylases cose-6-phosphatase so that glucose-6-phosphate produced by
 SP-39
glycogenolysis cannot exit the cell as glucose. A defect in the cells do not respond efficiently to insulin. Increasing the availability
glucose-transport protein GLUT2 would similarly prevent the exit of the hormone may boost its signaling activity in some patients, but
of glucose (a passive transporter can operate in either direction). in the majority of type 2 diabetics, insulin levels are already elevated
In both cases, the buildup of intracellular glucose-6-phosphate and further increases are ineffective.
prevents glycogen breakdown, and glycogen accumulates. 22. The test measures circulating glucose, which is abnormally high in
7. The portal vein delivers NH+4-rich blood from the intestine directly diabetics. In nondiabetic individuals, blood glucose concentrations
to the liver, which can convert it to urea (only the liver carries out remain relatively low, even after a glucose “challenge” because in-
the urea cycle; Section 21-3). The remaining NH+4 is carried through sulin signaling promotes tissue uptake of glucose.
the circulation to other tissues, where glutamine synthetase converts 23. PFK-2 catalyzes the production of fructose-2,6-bisphosphate, so in-
glutamate to glutamine (Section 21-5A). creasing PFK-2 activity would increase the concentration of this ac-
8. (a) Glutamate dehydrogenase converts glutamate to α-ketoglutarate tivator of phosphofructokinase. The effect would be increased flux
and NH+4 (Section 21-2B). Glutaminase converts glutamine to glu- of glucose through glycolysis, which would help lower the concen-
tamate and NH3 (Section 21-4C). tration of glucose in the blood.
(b) α-Ketoglutarate → succinyl-CoA → succinate → fumarate 24. Severely underweight individuals are at a higher risk of dying from
→ malate → oxaloacetate → PEP → 2PG → 3PG → 1,3BPG → malnutrition-related causes, while severely overweight individuals
DHAP/GAP → F1,6BP → F6P → G6P → glucose. are at higher risk of dying from obesity-related diseases such as dia-
9. The availability of nutrients in the colon is limited, so organisms betes and atherosclerosis. Both these groups are more likely to die
that can extract more free energy from metabolic fuels through than individuals of intermediate weight.
nitrate-based respiration have an advantage over organisms that are 25. 3-Phosphoglycerate is an intermediate of glycolysis; its concentra-
strictly limited to fermentation. tion increases when glycolytic flux slows. By inhibiting 6-phospho-
10. An individual’s microbiome consists of hundreds of species of gluconate dehydrogenase, 3PG slows pentose phosphate pathway
microbes that exist in a stable community. Ingested probiotic spe- activity also. Slower consumption of glucose would tend to slow the
cies are unlikely to find an available niche in an already established growth of the cancer cell.
ecosystem and therefore cannot change the overall makeup or func- 26. These genes encode gluconeogenic enzymes whose activity would
tion of the microbiome. diminish the high glycolytic flux that cancer cells need for continued
11. Insulin promotes the uptake of glucose via the increase in GLUT4 growth.
receptors on the adipocyte surface. A source of glucose is necessary 27. ATP generating pathways such as glycolysis and fatty acid oxidation
to supply the glycerol-3-phosphate backbone of triacylglycerols. require an initial investment of ATP (the hexokinase and phospho-
12. Hyperinsulinemia would result in a decrease in blood glucose. The fructokinase steps of glycolysis and the acyl-CoA synthetase activa-
decrease in [glucose] for the brain would cause loss of brain func- tion step that precedes β oxidation). This “priming” cannot occur
tion (leading to coma and death). when ATP has been exhausted.
28. (a) In the absence of MCAD, fatty acids cannot be fully oxidized to
13. Insulin activates ATP-citrate lyase, which is the enzyme that con-
acetyl-CoA (Section 20-2C). Since ketone bodies are synthesized
verts citrate to oxaloacetate and acetyl-CoA (Section 20-4A). The
from acetyl-CoA (Section 20-3), ketogenesis is impaired.
activity of this enzyme is essential for making acetyl units available
for fatty acid biosynthesis in the cytosol. The acetyl units, generated (b) In normal individuals, acetyl-CoA activates pyruvate carboxylase
from pyruvate in the mitochondria, combine with oxaloacetate to (Section 17-5B), which converts pyruvate to oxaloacetate. This in-
form citrate, which can then be transported from the mitochondria creases the capacity of the citric acid cycle to metabolize acetyl-CoA.
to the cytosol for reconversion to acetyl-CoA. When glucose levels are low, the oxaloacetate is used for gluconeo-
genesis (Section 16-4). In MCAD deficiency, lack of fatty acid–de-
14. (a) Decrease; (b) decrease; (c) increase; (d) increase.
rived acetyl-CoA keeps pyruvate carboxylase activity low, thereby
15. Adipose tissue synthesizes and releases the polypeptide hormones limiting the synthesis of glucose and contributing to hypoglycemia.
adiponectin, leptin, and resistin.
29. Because fatty acids, like glucose, are metabolic fuels, it makes meta-
16. The leptin produced by the normal mouse will enter the circulation bolic sense for them to stimulate insulin release, which is a signal of
of the ob/ob mouse, resulting in decreases in its appetite and weight. abundant fuel.
17. Since PYY3–36 is a peptide hormone, it would be digested if taken 30. Elevated levels of circulating fatty acids occur during an extended
orally. Introducing it directly into the bloodstream avoids degradation. fast, when dietary glucose and glucose mobilized from glycogen
18. Yes; PYY3–36 signals the hypothalamus to reduce secretion of the stores are no longer available. Insulin release would be inappropri-
appetite-stimulating neuropeptide Y. A feeling of nausea would also ate for these conditions. A combination of abundant fatty acids and
make a person averse to eating. glucose, indicating the fed state, would serve as a better trigger for
19. Adiponectin is a polypeptide hormone (247 residues) that exists as insulin release.
multimers in vivo, so it is difficult to prepare a form of the hormone 31. Leucine is an essential amino acid; it cannot be synthesized by hu-
that is stable and whose concentration can be accurately monitored. mans. Circulating leucine therefore serves as a marker of sufficient
A small molecule agonist would be easier to evaluate and to use as food intake.
a drug. Moreover, if taken orally, adiponectin would be digested, 32. The short-chain fatty acids, which are produced by the fermentation
whereas a small molecule agonist could survive the digestive tract. of indigestible polysaccharides by intestinal microbes, represent re-
20. Mice lacking UCP1 are unable to dissipate excess fat through ther- cent food intake and therefore help diminish appetite by triggering
mogenesis and therefore store the fat, becoming obese. At lower leptin release.
temperatures, the mice burn fat to generate heat (by mechanisms 33. Ingesting glucose while in the resting state causes the pancreas to re-
that do not involve UCP1) and do not become obese. lease insulin. This stimulates the liver, muscle, and adipose tissue to
21. Type 1 diabetics lack β cells that produce insulin, so providing the synthesize glycogen, fat, and protein from the excess nutrients while
hormone is an effective treatment for the disorder. In type 2 diabetes, inhibiting the breakdown of these metabolic fuels. Hence, ingesting
SP-40
glucose before a race will gear the runner’s metabolism for resting 3. Guanine has an amino group attached to C2; in azahypoxanthine,
rather than for running. nitrogen is part of the ring structure.
34. During starvation, the synthesis of glucose from liver oxaloacetate 4.
depletes the supply of citric acid cycle intermediates and thus de- O
creases the ability of the liver to metabolize acetyl-CoA via the cit- O O
ric acid cycle. N NH
–O P O P O
35. An intermediate in the biosynthesis of triacylglycerols is diacylglyc-
CH2 O N
erol (DAG), a second messenger responsible for activating PKC. O– O– N
NH2
36. (a) Amylin helps insulin maintain a constant level of glucose in the H H
blood by slowing the movement of food from the stomach to the in- H H
testine and by slowing digestion, both of which decrease the rate of
entry of food-derived glucose into the blood. (b) In hypoglycemia, the O OH
brain does not respond to amylin, which allows food to be digested –O P O
and absorbed quickly in order to restore normal blood glucose levels.
37. Physical inactivity would lead to a decreased need for ATP in mus- O
cle, which would be reflected by a decreased AMP to ATP ratio. A –O P O
decrease in the ratio would lead to a decrease in AMPK activity.
AMPK activity is positively associated with glucose uptake by cells O–
due to an increase in GLUT4 activity. GLUT4 activity is also in-
ppGpp
creased by insulin. A decrease in AMPK activity causes a decrease
in GLUT4 activity, making insulin’s job more difficult. 5. Amidophosphoribosyl transferase (step 2 of IMP synthesis), FGAM
38. Cells that lack asparagine synthetase cannot synthesize asparagine synthetase (step 5 of IMP synthesis), GMP synthetase (GMP syn-
from aspartate (which is easily made by transamination of oxaloace- thesis), carbamoyl phosphate synthetase II (step 1 of UMP synthe-
tate) and must obtain asparagine from the circulation. Asparaginase, sis), and CTP synthetase (CTP synthesis).
which catalyzes removal of asparagine’s amino group to generate 6. PRPP and FGAR accumulate because they are substrates of Reactions
aspartate, reduces the availability of asparagine to the point where 2 and 5 in the IMP biosynthetic pathway (Fig. 23-1). XMP also accu-
leukemic cells cannot survive. mulates because the GMP synthetase reaction is blocked (Fig. 23-3).
39. The liver is the only organ capable of urea biosynthesis so that, upon Although glutamine is a substrate of carbamoyl phosphate synthetase
liver failure, the ammonia level in the blood rises, leading to am- II (the first enzyme of UMP synthesis; Fig. 23-5), the other substrates
monia toxicity. Severe hypoglycemia also ensues because the liver of this enzyme do not accumulate. UTP, a substrate of the CTP syn-
normally functions to maintain blood glucose levels between meals thetase reaction, also accumulates, although strictly speaking, it is a
via gluconeogenesis. Many toxic substances will accumulate in the nucleotide biosynthetic product rather than an intermediate.
blood because the liver is unable to detoxify them. 7. (a) 7 ATP; (b) 8 ATP; (c) 7 ATP
40. In the absence of carbohydrate intake, all citric acid cycle intermedi- 8. (a) The compound is a uridine derivative (it lacks the ring nitrogen)
ates must be derived from the glucogenic amino acids obtained in and acts as a competitive inhibitor of CTP synthase. (b) Because
the diet or from protein degradation. The bad breath, which is due to CTP is a precursor of CDP–choline and CDP–ethanolamine
the exhalation of acetone, a ketone body, indicates that there is more (Fig. 20-33), reduced CTP production also limits the production of
lipid and ketogenic amino acid degradation to acetyl-CoA and then the lipids phosphatidylcholine and phosphatidylethanolamine.
to ketone bodies than is needed for the generation of ATP by the cit- 9. Hydroxyurea destroys the tyrosyl radical that is essential for the
ric acid cycle and oxidative phosphorylation (a condition known as activity of ribonucleotide reductase. Tumor cells are generally fast-
ketosis, although it is not as extreme as in diabetes; Section 22-4B). growing and cannot survive without this enzyme, which supplies
The loss of ketone bodies in the urine and via acetone exhalation dNTPs for nucleic acid synthesis. In contrast, most normal cells grow
makes lipid and amino acid metabolism less efficient than it would slowly, if at all, and hence have less need for nucleic acid synthesis.
be with adequate supplies of carbohydrate. In addition, the intake
10. dATP inhibits ribonucleotide reductase, thereby preventing the syn-
of large quantities of fat increases the concentration of fatty acids
thesis of the deoxynucleotides required for DNA synthesis.
in the blood, which in turn increases fatty acid oxidation and inhib-
its glucose oxidation via the glucose–fatty acid cycle (Randle cycle; 11. Serine donates a hydroxymethyl group to THF in order to regenerate
Section 18-4A). Amino acids stimulate glucagon secretion (although the cofactor for the conversion of dUMP to dTMP by thymidylate
high concentrations also stimulate insulin secretion), which activates synthase (Fig. 23-16).
gluconeogenesis in the liver to maintain the glucose concentration in 12. FdUMP and methotrexate kill rapidly proliferating cells, such as
the blood. Since fatty acid oxidation, rather than lipogenesis, is stim- cancer cells and those of hair follicles. Consequently, hair falls out.
ulated with a high-fat diet and amino acids from protein are available 13. The synthesis of histidine and methionine requires THF. The cell’s
for gluconeogenesis to maintain glucose concentration, such a diet is THF is converted to DHF by the thymidylate synthase reaction, but
usually effective at achieving fat breakdown and weight loss. (There in the presence of methotrexate, THF cannot be regenerated.
is, however, debate as to the long-term health effects of such a diet.) 14. The conversion of dUMP to dTMP is a reductive methylation. In the
thymidylate synthase reaction shown in Fig. 23-15, THF is oxidized
to DHF, so that DHFR must subsequently reduce the DHF to THF.
Chapter 23 Organisms that lack DHFR use an alternative mechanism for con-
1. Following aspartate addition to IMP, adenylosuccinate lyase re- verting dUMP to dTMP in which the FAD cofactor of the enzyme,
moves fumarate, leaving an amino group. In the urea cycle, following rather than the folate, undergoes oxidation.
the addition of aspartate to citrulline, argininosuccinase removes 15. Trimethoprim binds to bacterial dihydrofolate reductase but does
fumarate, leaving an amino group. not permanently inactivate the enzyme. Therefore, it is not a
2. Caffeine is derived by the methylation of xanthine. mechanism-based inhibitor.
 SP-41
16. p-Aminosalicylate is an analog of p-aminobenzoate, which the bacte- bond), leaving PPi, whose subsequent hydrolysis breaks a third
ria use to synthesize tetrahydrofolate. The additional hydroxyl group “high-energy” bond.
prevents the resulting folate derivative from participating normally in 24. The conversion of thymine to methylmalonyl-CoA consumes NADPH
the thymidylate synthesis pathway, so the bacteria cannot grow. (In but generates NADH. Methylmalonyl-CoA is converted to succinyl-
fact, the folate derivative of the drug blocks the DHFR reaction.) CoA, which enters the citric acid cycle and is converted to malate,
17. Allopurinol is oxidized by xanthine oxidase to a product that ir- thereby producing one ATP equivalent and FADH2 (equivalent to
reversibly binds to the enzyme. It is therefore a mechanism-based 1.5 ATP). Malate is converted to pyruvate by malic enzyme, producing
inhibitor of xanthine oxidase. NADPH (equivalent to 2.5 ATP). The pyruvate dehydrogenase reac-
18. Fumarate is converted to malate by fumarase; malic enzyme de- tion generates NADH (2.5 ATP equivalents) and acetyl-CoA. Oxida-
carboxylates malate to produce pyruvate; pyruvate is converted to tion of acetyl-CoA by the citric acid cycle generates 1 ATP, 3 NADH
acetyl-CoA and CO2 by pyruvate dehydrogenase; and the citric acid (7.5 ATP), and FADH2 (1.5 ATP), for a total yield of 17.5 ATP.
cycle oxidizes the acetyl group to 2 CO2. 25. UTP functions as a feedback inhibitor of its own synthesis, to pre-
19. Uracil and thymine accumulate in the urine because they cannot be vent the cell from synthesizing too many pyrimidine nucleotides.
further degraded in the absence of the dihydropyrimidine dehydro- ATP activates pyrimidine nucleotide synthesis so that when ATP
genase (Fig. 23-25). concentrations are high, the production of other nucleotides will in-
20. 5-Fluorouracil is an anticancer drug because it is converted in the body crease to match it.
to FdUMP, an inhibitor of thymidylate synthase. In the absence of 26. Ribose phosphate pyrophosphokinase catalyzes the activation of
adequate dihydropyrimidine dehydrogenase activity, the drug cannot ribose-5-phosphate to produce PRPP, the substrate for the second
readily be broken down, so it accumulates to toxic levels in the body. reaction of purine nucleotide synthesis and the fifth step of pyrimi-
21. Nicotinamide dine nucleotide synthesis. High concentrations of ADP and GDP
signify high metabolic demand and low concentration of nucleo-
side triphosphates, a situation when the cell’s resources should be
O directed toward energy metabolism rather than the production of
C nucleotides for the synthesis of DNA or RNA.
NH2 27. Threonine is broken down to acetyl-CoA and glycine, either directly
+ via the serine hydroxymethyltransferase reaction (reaction 5 in
_2
O3P O CH2 O N Fig. 21-14) or through the intermediacy of α-amino-β-ketobutyrate
via the threonine dehydrogenase reaction (reaction 6 of Fig. 21-14)
H H followed by the α-amino-β-ketobutyrate lyase reaction (reaction 7
H H
of Fig. 21-14). The acetyl-CoA can enter the citric acid cycle to
OH OH produce considerable ATP via oxidative phosphorylation. The gly-
Nicotinamide mononucleotide (NMN) cine is a substrate of the glycine cleavage system, which generates
N5,N10-methylene-THF (reaction 3 of Fig. 21-14), the methyl-group
donor required for thymidylate synthesis.
O 28. The mutant cells grow because the medium contains the thymidine
C
they are unable to make. Normal cells, however, continue to synthe-
NH2 size their own thymidine and thereby convert their limited supply of
THF to DHF. The methotrexate inhibits dihydrofolate reductase, so
+
N Adenine THF cannot be regenerated. Without a supply of THF for the synthe-
sis of nucleotides and amino acids, the cells die.
Ribose P P Ribose
+ 29. In muscles, the purine nucleotide cycle functions to convert aspartate
Nicotinamide adenine dinucleotide (NAD ) to fumarate to boost the capacity of the citric acid cycle. If glutamate
dehydrogenase activity were high, then it would combine the NH+4
22. O CH2 O OH produced by the purine nucleotide cycle with α-ketoglutarate to yield
glutamate, a reaction that depletes a citric acid cycle intermediate.
H H
H H 30. In von Gierke’s disease (glucose-6-phosphatase deficiency),
glucose-6-phosphate accumulates in liver cells, thereby stimulating
HO O C CH3
the pentose phosphate pathway. The resulting increase in ribose-
NH2 O 5-phosphate production boosts the concentration of PRPP, which in
O P O– turn stimulates purine biosynthesis. High levels of uric acid derived
N N from the breakdown of the excess purines causes gout.
O
31. Meat contains relatively large quantities of nucleic acids, which are
O P O– N
N broken down to yield, among other products, uric acid. This ad-
ditional uric acid may increase the uric acid concentration beyond
O CH2 O the solubility limit in some otherwise gout-free individuals, thereby
H H precipitating a gout attack.
H H 32. Glycine is incorporated in the purine ring during its de novo synthesis.
HO OH If the gout is due to overproduction of purines, the excreted uric acid
should contain a high proportion of 15N. If the gout is due to impaired
23. The kinase-catalyzed phosphorylation of riboflavin consumes one excretion of uric acid, much of the excess uric acid will arise from the
“high-energy” bond. In the second reaction, an AMP group is trans- degradation of ingested purines and hence be 15N-free. The fraction of
ferred from ATP to FMN (thereby breaking a second “high-energy” excreted uric acid containing 15N will therefore be relatively low.
SP-42
33. (a) The recovered deoxycytidylate would be equally labeled in its 6. Table 11-1 shows that the rate of the reaction that is catalyzed by
base and ribose components (i.e., the same labeling pattern as in the Staphylococcal nuclease, hydrolysis of a polynucleotide chain, is
original cytidine). 1.7 × 10−13 s−1 in the absence of the enzyme. The half-life for the
(b) The recovered deoxycytidylate would be unequally labeled reaction is t1/2 = 0.693/k (Equation 12-9), or 0.693/(1.7 × 10−13 s−1)
in its base and ribose components because the separated 14C- = 4.1 × 1012 s. This is equivalent to (4.1 × 1012 s)(1 min/60 s)
cytosine and 14C-ribose would mix with the different-sized (1 h/60 min)(1 d/24 h)(1 yr/365 d) = 130,000 years.
pools of unlabeled cellular cytosine and ribose before recom- 7.
bining as the deoxycytidylate that becomes incorporated into H
DNA. [This experiment established that deoxyribonucleotides, H
in fact, are synthesized from their corresponding ribonucleotides N N N
(alternative a).] H.....
H N N
34. 6-Mercaptopurine, being a hypoxanthine analog, is oxidized to N
2-oxo-6-mercaptopurine by xanthine oxidase. This reaction largely N H ...
..

....
inactivates this chemotherapeutic agent. The presence of allopuri- O O N

...
...
nol inactivates xanthine oxidase, thereby increasing the effective
N

.
concentration of 6-mercaptopurine. H

...
H N H

.
H N H

....
Chapter 24 H
N

...

......
1. Hypoxanthine pairs with cytosine in much the same way as does N O. . . . . O
guanine. . .H

.
N
H N
H
N H... O N N N. . . . . . .H
N N N

N ...H N N H
H
R
N N
O H 8.
R
C T
Hypoxanthine
T
2. A T
O A
T
G G
N H... O N G G
G G
N G G
O...H N N G G
R R G G
N A
U NH2 A T
T
G T
3. Since amino acids have an average molecular mass of ∼110 D, the T
50-kD protein contains 50,000 D ÷ 110 D/residue = ∼455 residues.
These residues are encoded by 455 × 3 = 1365 nucleotides. In B-
DNA, the rise per base pair is 3.4 Å, so the contour length of 1365 bp 9. Assuming all the DNAs in Figure 24-8 contain the same number of
is 3.4 Å/bp × 1365 bp = 4641 Å, or 0.46 μm. base pairs, the most supercoiled structure would move farthest dur-
4. In A-DNA, the contour length would be 1365 bp × 2.9 Å/bp = 3959 Å, ing electrophoresis, because its compact structure allows it to move
or 0.40 μm. fastest through the agarose matrix.
5. 10. The enzyme has no effect on the supercoiling of DNA since cleav-
O ing the C2′—C3′ bond of ribose does not sever the sugar–phosphate
chain of DNA.
O N
NH 11. Its Tm decreases because the charges on the phosphate groups are
–O less shielded from each other at lower ionic strength and hence repel
P O
N N NH2 each other more strongly, thereby destabilizing the double helix.
OH O O
12. The nonpolar solvent diminishes the hydrophobic forces that stabi-
H H
H H H H lize double-stranded DNA and hence lowers the Tm.
H H
O 13. The segment with 20% A residues (i.e., 40% A ∙ T base pairs)
OH O contains 60% G ∙ C base pairs and therefore melts at a higher
N N
O P O– temperature than a segment with 30% A residues (i.e., 40% G ∙ C
N O base pairs).
N
14. (a) As the temperature increases, the stacked bases melt apart so that
NH2 their ultraviolet absorbance increases (the hyperchromic effect).
 SP-43
(b) The broad shape of the poly(A) melting curve indicates non- 20. (a) A 6-nt sequence would be expected to occur, on average, every
cooperative changes, as expected for a single-stranded RNA. The 46 = 4096 nt in single-stranded DNA. However, in double-stranded
sharp melting curve for double-stranded DNA reflects the coopera- DNA, it would be expected to occur at twice this frequency, that
tivity of strand separation. is, every 4096/2 = 2048 bp. Thus the expected number of copies
15. of a 6-bp sequence in the E. coli genome is 4,639,000 bp/2048 bp
= 2265.
C
A U U G G (b) A 12-bp sequence would be expected to occur, on average,
A every 412/2 = 8,388,608 bp, which is nearly twice as large as the
A A U A G C C number of base pairs in the E. coli genome. Thus the trp repres-
U
sor is unlikely to bind specifically to any other site in the E. coli
16. chromosome.
21. Because they interact closely with DNA, protamines must be rich in
G basic amino acids. In fact, they are particularly rich in arginine.
C G
A T 22. The decarboxylation of the amino acid ornithine, an intermediate of
C G the urea cycle (Fig. 21-9), generates 1,4-diaminobutane (also known
C G as putrescine):
T A +
G C H3N—(CH2)4—NH+3
A T This cationic molecule interacts electrostatically with the negatively
5-T C A T G C-3 charged phosphate groups of DNA.
3-A G T A C G-5 23. (a) Increased ion concentrations would interfere with the electrostatic
T A interactions between M1 and histones and would weaken binding.
C G
A T
(b) Decreasing the pH would protonate and neutralize negatively
G C charged carboxylate groups, which are important for interacting
G C with the positively charged groups on the histones. Neutral M1
T A would then bind to histones less tightly.
G C
C 24. (a) The ARSK sequence in NS1 is almost identical to the ARTK
sequence in histone H3. (b) By mimicking the N-terminus of
17. the histone, NS1 may compete for the enzymes that covalently
modify histones. Since histone modification can alter the tran-
scription of the associated DNA in the nucleosome, NS1 can alter
Top – gene expression.
28S RNA
25. (a) The contour length is 5 × 107 bp × 3.4 Å /bp = 1.7 × 108 Å =
17 mm.
16S RNA
(b) A nucleosome, which binds ∼200 bp, compresses the DNA to
Direction
of an 80-Å-high supercoil. The length of the DNA is therefore (80 Å /
migration 200 bp) × (5 × 107 bp) = 2 × 107 Å = 2 mm.
26. The 30-nm fiber compacts DNA by a factor of ∼36. Thus the length
of the 50,000-bp 30-nm fiber is (5 × 107 bp × 3.4 Å / bp)/36 = 1.7 ×
5S RNA 108 Å /36 = 0.47 mm.
Bottom + 27. Histones are required in large amounts during a relatively short
period when DNA is replicated prior to cell division. The large num-
ber of histone genes allows the efficient production of histones.
28. Base methylation is expected to have little or no effect on nucleosomal
18. Experiment 1. The restriction enzyme failed to digest the genomic
structure, because there are few contacts between histones and bases
DNA, leaving the DNA too large to enter the gel during electropho-
and the small, nonpolar methyl group would be unlikely to disrupt
resis.
the mostly ionic interactions between the histones and the DNA
Experiment 2. The hybridization conditions were too “relaxed,” backbone.
resulting in nonspecific hybridization of the probe to all the DNA
29.
fragments. This problem could be corrected by boiling the blot to
remove the probe and repeating the hybridization at a higher tem- H
perature and/or lower salt concentration.
N H... .... O CH3
Experiment 3. The probe hybridized with three different mouse
N
genes. The different intensity of each band reflects the related-
ness of the sequences. The most intense band is most similar to the
.
N. . H N
human rxr-1 gene, whereas the least intense band is least similar to N N
the rxr-1 gene. N O
19. The target sequence consists of 6 symmetry-related base pairs. Since
there are 4 possible base pairs (A ∙ T, T ∙ A, G ∙ C, and C ∙ G), the A T
probability that any two base pairs are randomly related by symme-
try is 1/4. Hence, the probability of finding all 6 pairs of base pairs The helix diameter is smaller in this alternate arrangement
by random chance is (1/4)6 = 2.4 × 10−4. (Hoogsteen base pairing).
SP-44
30. denatures but its strands cannot unwind from each other (L remains
H constant). However, the stiff double-helical structure has collapsed so
H that denatured type I DNA is a highly compact entity. This accounts
H .
O .. H
N for its 53S sedimentation coefficient.
N
N 38. Naked nicked circular duplex DNA cannot maintain its supercoils
H because the intact sugar phosphate chain can swivel about the bonds
. N
N N.. H N opposite the nick. The observation that nicking does not abolish
supercoiling in the single DNA molecule of the bacterial chromo-
N O some indicates that its proteins somehow prevent this swiveling or
at least prevent its effects from being transmitted along the entire
G C length of the DNA molecule. For example, if the DNA in the chro-
mosome consists of a series of loops rigidly held by protein as dia-
31. grammed below, nicking one loop would not affect the supercoiling
O O in neighboring loops.
+H N
3 CH2 CH2 NH CH2 C NH CH2 CH2 NH CH2 C O–

32. The PNA backbone contains six covalent bonds between each base- DNA
attachment site, the same number of bonds as in a DNA backbone
(see Fig. 24-5). Consequently, the spacing between bases within
each polymer is compatible with base pairing. Protein

33. The bonds opposite atoms C2′ and C3′ in the ribose ring both con- ... ...
tain O1′. Since O1′ has no extra-annular substituents, none of the
substituents to the ribose ring will be eclipsed if either C2′ or C3′
is out of the plane of the other ring atoms. This minimizes the steric Chapter 25
interference between ring substituents. 1. Okazaki fragments are 1000 to 2000 nt long, and the E. coli chro-
34. At extremely high [Na+], there is little water available to promote mosome contains 4.6 × 106 bp. Therefore, E. coli chromosomal
hydrophobic bonding because most water molecules are involved replication requires 2300 to 4600 Okazaki fragments.
in solvating the ions in the solution. Consequently, the structure of 2. Okazaki fragments are 100 to 200 nt long in humans, and the
double-helical DNA, which is largely stabilized by hydrophobic chromosomes contain 6.0 × 109 bp (humans are diploid). Therefore,
forces, is destabilized by increasing [Na+] as is indicated by its human chromosomal replication requires 6.0 × 107 to 3.0 × 107
decreasing Tm. Okazaki fragments.
35. L = T + W. For the constrained DNA circle, W = 0 so that L = T = 3. The drug would inhibit DNA synthesis because the polymerization
207. For the unconstrained DNA circle, L = 207 since this quantity reaction is accompanied by the release and hydrolysis of PPi. Fail-
is invariant, T = 2310 bp/(10.5 bp/turn) = 220, and W = L − T = ure to hydrolyze the PPi would remove the thermodynamic driving
207 − 220 = −13. For the constrained DNA circle, σ = W/ T = force for polymerization, that is, it would be reversible.
0/207 = 0. For the unconstrained DNA circle, σ = −13/220 = −0.059
4. The 5′ → 3′ exonuclease activity is essential for DNA replication
(a value that is typical of naturally occurring DNA circles in vivo).
because it removes RNA primers and replaces them with DNA.
36. In the B-DNA to Z-DNA transition, a right-handed helix with one Absence of this activity would be lethal.
turn per 10.5 base pairs converts to a left-handed helix with one turn
5. When DNA polymerase begins synthesizing a new strand, it binds
per 12 base pairs. Since a right-handed duplex helix has a positive
the template DNA to which an RNA primer is already base paired.
twist, the twist decreases:
In order to extend the primer, the polymerase active site must ac-
−100 100 commodate the DNA–RNA hybrid helix, which has an A-DNA-like
ΔT = − = −17.9 turns
12 10.5 structure (Fig. 24-4).
The linking number must remain constant (ΔL = 0) since no 6. PPi is the product of the polymerization reaction catalyzed by DNA
covalent bonds are broken. Hence, the change in writhing number is polymerase. This reaction also requires a template DNA strand and
ΔW = −ΔT = 17.9 turns. a primer with a free 3′ end.
37. Type I is closed circular duplex DNA, type II is a nicked circular (a) There is no primer strand, so no PPi is produced.
duplex DNA, and type III is linear duplex DNA. Type I DNA has (b) There is no primer strand, so no PPi is produced.
such a broad melting curve and a high Tm because its strands cannot (c) PPi is produced.
separate from each other without breaking a covalent bond (its ΔS (d) No PPi is produced because there is no 3′ end that can be
of melting is unusually small). The bases therefore tend to remain extended.
paired above the Tm for the equivalent linear DNA.
(e) PPi is produced.
The slightly greater sedimentation coefficient of type I in comparison
(f) PPi is produced.
with type II DNA indicates that type I is supercoiled, which makes
it more compact than type II. The relaxed circles of type II DNA 7. AT-rich DNA is less stable than GC-rich DNA and therefore would
are more compact than type III, the linear duplex, and hence type II more readily melt apart, a requirement for initiating replication.
DNA sediments faster than type III. 8. DNA gyrase adds negative supercoils to relieve the positive super-
At pH 13, which denatures duplex DNA, type III DNA undergoes coiling that helicase-catalyzed unwinding produces ahead of the
strand separation to yield linear single strands of 16S. Type II DNA replication fork.
also undergoes strand separation to yield a 16S linear single strand 9. DNA polymerase could extend a primer that entered its active site,
and a slightly more compact 18S single-stranded circle. Type I DNA but polymerization would not be highly processive unless the sliding
 SP-45
clamp was in place. If the primer first associates with the clamp, enzyme is inhibited, more of the oxidized dATP is incorporated into
which then interacts with DNA polymerase, the primer can be DNA, where it blocks normal transcription and replication. Since
extended in a processive and therefore more efficient manner. cancer cells synthesize both RNA and DNA at a high rate, the in-
10. Mismatch repair and other repair systems correct most of the errors creased burden of damaged DNA can lead to death of the cancer
missed by the proofreading functions of DNA polymerases. cell.
11. The E. coli replication system can fully replicate only circular 21. (a) Without an active site Cys residue, the alkyl transfer reaction
DNAs. Bacteria do not have a mechanism (e.g., telomerase- cannot occur.
catalyzed extension of telomeres) for replicating the extreme 3′ ends (b) Although the proteins cannot remove the alkyl group attached to
of linear template strands. the guanine by direct repair, they can still bind to the modified residue,
12. The broken end of a chromosome will not have the characteristic thereby marking this region of DNA for repair by NER enzymes.
structure of a telomere, which includes repeating DNA sequences 22. In eukaryotes, DNA polymerase α, which lacks proofreading ac-
plus telomere-binding proteins. tivity, begins extending the RNA primer of each Okazaki fragment
13. After adding the 6-nt telomere sequence, telomerase translocates to before polymerization is handed off to the more accurate DNA
the new 3′ end to add another repeat. The RNA template includes polymerase δ. Because lagging strand synthesis involves multiple
a region of overlap (∼3 nt) that helps position the enzyme and tem- Okazaki fragments, this strand of DNA is more likely than the con-
plate for the next addition of nucleotides (see Fig. 25-27). tinuously synthesized leading strand to contain errors, particularly if
14. (a) DNA polymerase; (b) reverse transcriptase or telomerase; the pol α–synthesized DNA is not fully replaced.
(c) RNA polymerase or primase. 23. When 5-methylcytosine residues deaminate, they form thymine
15. (a) residues.
NH2 O
Br O H... O N
CH3 H CH3
N N
N...H
N
N
N N O N O N
O...H N
H 5-Methyl-C T
5BU
Since thymine is a normal DNA base, the repair systems cannot de-
(enol tautomer) Guanine
termine whether such a T or its opposing G is the mutated base.
(b) When 5BU incorporated into DNA pairs with G, the result is an Consequently, only about half of the deaminated 5-methylcytosines
A ∙ T → G ∙ C transition after two more rounds of DNA replication: are correctly repaired.
A ∙ T → A ∙ 5BU → G ∙ 5BU → G ∙ C 24. Mammalian DNA contains 5-methylcytosine residues paired with
16. The cytosine derivative base pairs with adenine, generating a C ∙ G guanine residues. Oxidative deamination of m5C produces thymine.
→ T ∙ A transition. The thymine–DNA glycosylase removes the T in the resulting T ∙ G
base pair so that it can be replaced with C to restore the correct
H O H
C ∙ G base pair.
N...H N N 25. Base excision repair. The deaminated base can be recognized be-
cause hypoxanthine does not normally occur in DNA.
H...N
N
N 26. After the damaged DNA has been removed and replaced by the ac-
N N tion of DNA polymerase, the final phosphodiester bond (between
O the 5′ end of the original DNA and the 3′-OH of the last nucleotide
added) must be formed by the action of DNA ligase.
Adenine
27. First, an endoribonuclease must cleave one of the two phosphodiester
bonds involving the ribonucleotide, then a second endonuclease
17. (a) The original A ∙ T base pair becomes an I ∙ T base pair. When the must cleave the other bond to completely remove the ribonucleotide.
DNA replicates, the template T will pair with A, and the template The resulting gap can be filled in by DNA polymerase, and the nick
I will pair with C. Thus, one daughter cell will be normal and one sealed by DNA ligase.
will have an abnormal I ∙ C base pair. (b) After the second round of
28. An intrastrand cross-link can be repaired by a system such as
cell division, two cells will be normal (A ∙ T base pairs). One cell
nucleotide excision repair or recombination repair with no net loss
will have an abnormal I ∙ C base pair, and one will have a normal but
of nucleotides. However, repair of an interstrand cross-link requires
mutated C ∙ G base pair.
the removal and replacement of nucleotides on both strands of
18. (a) After one round of cell division, one daughter cell will contain DNA, so that even with a system such as homology-directed repair,
a normal A ∙ T base pair, and the other cell will contain a C ∙ A the repaired DNA is less likely to have the same sequence as the
mismatch. original DNA.
(b) Two rounds of cell division yield three cells with a normal A ∙ T 29. Topoisomerases maintain the appropriate degree of supercoiling dur-
base pair and one cell with a C ∙ G base pair (a transition mutation). ing DNA replication. These enzymes act by cleaving one or both DNA
19. The triphosphatase destroys nucleotides containing the modified strands and covalently linking the 3′- or 5′-phosphate to an enzyme
base before they can be incorporated into DNA during replication. Tyr residue (Section 24-1D). If the catalytic cycle is not completed,
20. The enzyme normally minimizes the concentration of 2-OH-dATP, the enzyme remains associated with the cut DNA and impedes rep-
which can serve as a substrate for DNA polymerase. When the lication and transcription. A tyrosyl–DNA phosphodiesterase frees
SP-46
the trapped topoisomerase so that the DNA can be repaired by other (a) The length of B-DNA is 3.4 Å/bp. The replisome replicates DNA
enzymes. at the rate of ∼1000 bp/s. Hence, the rate of travel of the expanded
30. DNA polymerase η can synthesize a complementary DNA strand, replisome is
but the thymine dimer is still present. It can be repaired later by the 3.4 Å/bp × 1000 bp/s × 0.05 m/Å × 3600 s/hr
NER pathway. × 0.001 km/m = 610 km/hr
31. Pol V is less processive than Pol III. When the progress of Pol III is (b) The E. coli genome consists of ∼4.6 million bp (Table 3-3). Each
arrested by the presence of a thymine dimer, Pol V can take over, al- replisome in E. coli’s bidirectional replication fork replicates half
lowing replication to continue at a high rate, although with a greater this DNA. Hence the distance each replisome must travel is
incidence of mispairings. The damage is minimal, however, since ° °
Pol V soon dissociates from the DNA, allowing the more accurate 1/2 × 4.6 × 106 bp × 3.4 A /bp × 0.05 m/A × 0.001 km/m = 390 km
Pol III to resume replicating DNA. (c) Okazaki fragments in E. coli range in length from 1000 to 2000 nt.
32. (a) Loss of the helicase DnaB, which unwinds DNA for replication, Hence their expanded lengths would be
would be lethal. ° °
(1000 to 2000) nt × 3.4 A/nt × 0.05 m/A × 0.001 km/m
(b) Loss of Pol I would prevent the excision of RNA primers and
= (0.17 to 0.34) km
would therefore be lethal.
(c) SSB prevents reannealing of separated single strands. Loss of (d) The E. coli replisome makes around one error for every 10 mil-
SSB would be lethal. lion bases it correctly replicates. Hence the distance between errors
(d) RecA protein mediates the SOS response and homologous that it would travel in our expanded system is
recombination. Loss of RecA would be harmful but not necessarily ° °
107 nt × 3.4 A/nt × 0.05 m/A × 0.001 km/m = 1700 km
lethal.
33. In conjugation, the ssDNA becomes incorporated into the recipi- 38. DNA polymerase η and HIV reverse transcriptase incorporate the cor-
ent’s DNA through homologous recombination. RecBCD includes rect nucleotide with approximately the same efficiency (420 versus
nuclease and helicase activity, which are necessary to nick and 800 μM ∙ min−1 × 103). However, polymerase η incorporates a
unwind the recipient dsDNA so that the incoming ssDNA can be mispaired nucleotide much more efficiently than does HIV RT (22 ver-
introduced. sus 0.07 μM ∙ min–1 × 103). These results indicate that the polymerase
34. In gene therapy, a normal copy of the gene is introduced, but the η has a higher error rate due to its ability to incorporate the wrong
defective gene is still present; in the CRISPR–Cas9 approach, the nucleotide rather than its inability to incorporate the correct nucleotide.
defective gene can be entirely removed and replaced. 39. The Klenow fragment, which lacks 5′ → 3′ exonuclease activity (and
35. As indicated in Fig. a (below), nucleotides would be added to a poly- therefore cannot catalyze nick translation), is used to ensure that all
nucleotide strand by attack of the 3′-OH of the incoming nucleotide the replicated DNA chains have the same 5′ terminus. For the chain
on the 5′ triphosphate group of the growing strand with the elimina- terminator method of sequencing DNA, this is a necessity because
tion of PPi. The hydrolytic removal of a mispaired nucleotide by the a sequence is assigned according to fragment length. For pyrose-
5′ → 3′ exonuclease activity (Fig. b, below) would leave only an OH quencing or Illumina sequencing, the DNA segments at a particular
group or a monophosphate group at the 5′ end of the DNA chain. position on the sequencing well or slide must all be identical or the
This would require an additional activation step before further chain identification of each nucleotide in the sequence will be ambiguous.
elongation could commence. 40. E. coli contains a low concentration of dUTP, which DNA poly-
merase incorporates into DNA in place of dTTP. The resulting ura-
(a) 3′ → 5′ Polymerase
5′ 3′
cil bases are rapidly excised by uracil–DNA glycosylase followed
PPi by nucleotide excision repair (NER), which temporarily causes a
break in the DNA chain. DNA that is isolated before DNA poly-
OH ... ...
+ merase I and DNA ligase can complete the repair process would be
ppp ppp p p ppp p p p fragmented. However, in the absence of a functional uracil–DNA
glycosylase, the inappropriate uracil residues would remain in place,
and hence leading strand DNA would be free of breaks. The lag-
(b) 5′ → 3′ Exonuclease
5′ 3′
ging strand, being synthesized discontinuously, would still contain
breaks, although fewer than otherwise.
H2O
... OH ... 41. Use Equation 12-6,
+
ppp p p p ppp p p p ln[ A ] = ln[ A ] o − kt

where [A]o = 6.0 × 109, [A] = [A]o − 2 × 104 = 5.99998 × 109,

36. DNA polymerization results in the formation of base pairs. Since and t = 1 d. Solve the equation for k:
a back reaction should be the exact reverse of a forward reac-
tion, pyrophosphorolysis, the back reaction of DNA polymer- [A]o 6 × 109
k = (ln /t = ( 5.99998 × 109 )/1 d
ization, should act only on base paired 3′-terminal nucleotides. ln
[A] )
Consequently, there must be two forms of the enzyme–DNA com-
plex. That which is base paired favors synthesis or pyrophospho- k = ln (1.0000033)/1 d = 0.0000033 d −1
rolysis, whereas that which is unpaired favors hydrolysis. Hence,
the enzyme must have two at least partially separate active sites for Using Equation 12.9,
these activities.
t1/2 = 0.693/k = 0.693/0.0000033 d −1
37. The conversion factor between the real and expanded systems is
1 m/20 Å = 0.05 m/Å. = 2.08 × 105 d × (1 y/365 d) = 570 y
 SP-47
42. The E. coli genome consists of 4.6 × 106 bp so that it has 2 × 4.6 × sequences, such as core promoter elements and enhancers that inter-
106 = 9.2 × 106 nt. The Chi sequence (GCTGGTGG), which alters act with the same transcription factors.
the behavior of RecBCD, consists of 8 nt. Hence, if it occurred at 6. Transcription of an rRNA gene yields a single rRNA molecule that
random, its expected frequency would be once every 48 nt. Con- is incorporated into a ribosome. In contrast, transcription of a ribo-
sequently, the randomly expected number of Chi sequences in the somal protein gene yields an mRNA that can be translated many
E. coli genome is times to produce many copies of its corresponding protein. The
greater number of rRNA genes relative to ribosomal protein genes
Expected number of Chi sequences = 2 × 4.6 × 106 nt/48 nt = 143
helps ensure the balanced synthesis of rRNA and proteins necessary
Therefore, the Chi sequence occurs 1009/143 = 7.1 times more fre- for ribosome assembly.
quently than if it occurred at random. 7. Increasing the error rate of transcription increases the chances of
43. By aligning its identical tracts of DNA side by side, D. radiodurans introducing a mutation that prevents the virus from completing its
has prepared these sequences for rapid recombinational repair, the life cycle in the host cell.
only nonmutagenic mode for restoring the double-strand breaks that 8.
DNA pol RNA pol
ionizing radiation frequently induces in DNA.
44. A composite transposon consists of a central region flanked by two 3′ 5′
5′
IS-like units, which in turn, are each flanked by inverted repeats:

ike Central region IS-li

IS-l it unit
ke DNA pol
un
Composite 3′ 5′
transposon 5′

9. In the presence of bicyclomycin, transcription of Rho-dependent

genes does not terminate, causing read-through into adjacent cod-
ing regions. This results in the transcription of the adjacent gene(s),
Plasmid often causing the inappropriate expression of the corresponding
protein(s).
10. (a) Because expression of bacteriophage genes requires the host’s
Thus, the plasmid has the same relationship to the IS-like units as RNAP, the increased rate of transcription of bacteriophage genes
does the transposon’s central region; that is, it is flanked by these and decreased rate of transcription termination boost the production
IS-like units with their flanking inverted repeats. The entire plasmid, of phage-specific mRNAs.
with the flanking IS-units, may therefore be transposed rather than (b) Q must recognize the promoters of bacteriophage genes so that it
the composite transposon. Indeed, the plasmid with the flanking can bind to the RNAP transcribing those genes. Without this speci-
IS-like units is a transposon. ficity, Q could enhance transcription of all genes in E. coli.
11. The cell lysates can be applied to a column containing a matrix with
Chapter 26 immobilized poly(dT). The poly(A) tails of processed mRNAs will
1. (a) Cordycepin is the 3′-deoxy analog of adenosine. bind to the poly(dT) while other cellular components are washed
away. The mRNAs can be eluted by decreasing the salt concentra-
(b) Because it lacks a 3′-OH group, the cordycepin incorporated
tion to destabilize the A ∙ T base pairs.
into a growing RNA chain cannot support further chain elongation
in the 5′ → 3′ direction. 12. (a) The phosphate groups of the phosphodiester backbone of the
mRNA will be labeled at all sites where α-[32P]ATP is used as a
2. (a) mRNA(n residues) + Pi → NDP + mRNA(n − 1 residues)
substrate by RNA polymerase.
(b) The reverse of the phosphorolysis reaction is an RNA poly- (b) 32P will appear only at the 5′ end of mRNA molecules that have
merization reaction. PNPase uses an NDP substrate to extend the A as the first residue (this residue retains its α and β phosphates).
RNA by one nucleotide residue and releases Pi and is template- In all other cases where β-[32P]ATP is used as a substrate for RNA
independent. RNA polymerase uses an NTP substrate, releases PPi, synthesis, the β and γ phosphates are released as PPi (see Fig. 26-7).
and requires a template DNA.
(c) No 32P will appear in the RNA chain. During polymerization, the
(c) High processivity would allow the exonuclease to rapidly β and γ phosphates are released as PPi. The terminal (γ) phosphate
degrade mRNA molecules. This would be important in cases of an A residue at the 5′ end of an RNA molecule is removed during
where the gene product was no longer needed. An mRNA that was the capping process.
degraded more slowly could potentially continue to be translated.
13. DNA polymerase needs a primer; poly(A) polymerase uses the pre-
3. The probe should have a sequence complementary to the consensus mRNA as a primer; CCA-adding polymerase uses the immature
sequence of the 6-nt Pribnow box: 5′-ATTATA-3′. tRNA as a primer; and RNA polymerase does not require a primer.
4. G ∙ C base pairs are more stable than A ∙ T base pairs. Hence, the Both DNA polymerase and RNA polymerase require a DNA tem-
more G ∙ C base pairs that the promoter contains, the more difficult plate, but neither poly(A) polymerase nor CCA-adding polymerase
it is to form the open complex during transcription initiation. uses a template. The four polymerases use different sets of nucleo-
5. (a) Operons allow cells to turn sets of related genes on and off to- tides: DNA polymerase uses all four dNTPS; RNA polymerase uses
gether, thereby maximizing efficiency, since all the necessary genes all four NTPs; poly(A) polymerase uses only ATP; and CCA-adding
are expressed at the same time and in the same amount. polymerase uses ATP and CTP.
(b) In eukaryotes, genes in different locations can be turned on or 14. The active site of poly(A) polymerase is narrower because it does
off at the same time if they share the same transcriptional regulatory not need to accommodate a template strand.
SP-48
15. The mechanism of RNase hydrolysis requires a free 2′-OH group to 25. Promoter elements for RNA polymerase II include sequences at −27
form a 2′,3′-cyclic phosphate intermediate (Figure 11-10). Nucleo- (the TATA box) and between –50 and –100. The insertion of 10 bp
tide residues lacking a 2′-OH group would therefore be resistant to would separate the promoter elements by the distance of the turn of
RNase-catalyzed hydrolysis. the DNA helix, thereby diminishing the binding of proteins required
16. The NAD+ group most likely functions analogously to the eukary- for transcription initiation. However, the protein-binding sites would
otic mRNA 5′ cap in protecting the RNA from premature degrada- still be on the same side of the helix. Inserting 5 bp (half of a helical
tion. Because binding proteins can distinguish NAD+ from NADH, turn) would move the protein-binding sites to opposite sides of the
the interaction of the RNA with proteins may be influenced by the helix, making it even more difficult to initiate transcription.
relative concentrations of competing NAD+ and NADH in the cell, 26. By introducing a T7 promoter into recombinant DNA and using T7
which depend on metabolic activity. RNAP, genetic engineers can control the expression of a specific
17. The mRNA splicing reaction, which requires no free energy input gene without interference from other RNAP enzymes or other pro-
and results in no loss of phosphodiester bonds, is theoretically re- moter sequences that might be present in the experimental system.
versible in vitro. However, the degradation of the excised intron 27. Because TFIIB can bind directly to DNA at the promoter and in-
makes the reaction irreversible in the cell. directly to DNA at the end of the gene, it can cause the interven-
18. The intron must be large enough to include a spliceosome binding site(s). ing DNA to form a loop. As a result, an RNA polymerase that has
19. Histone genes lack introns, so their mRNAs do not undergo splicing, finished transcribing a gene will be positioned near the promoter so
and their mRNAs do not have a poly(A) tail. that transcription can be quickly reinitiated.
20. (a) H3C 28. The RNA genomes of certain viruses are not processed and hence
NH the first nucleotide includes a triphosphate group. Recognizing this
feature allows a cell to detect the presence of an infecting virus. The
N
N cell’s own RNA molecules (other than mRNA, which is capped)
N are all processed (hydrolyzed from larger precursors) and therefore
N H contain only a single phosphate at their 5′ ends.
(b) Base pairing with U residues involves adenine N1 as a hydrogen 29. Enhancers are recognized by specific transcription factors that
bond acceptor and the amino group at position 6 as a hydrogen bond stimulate RNAP II to bind to the associated promoter. Enhancers
donor. Methylation of the amino nitrogen weakens but does not pre- are usually distant from the promoter on the same DNA and hence
vent hydrogen bonding, so a stem-loop structure could still form. the interaction between the enhancer-bound transcription factor and
21. Inhibition of snRNA processing interferes with mRNA splicing. As the promoter-bound RNAP II requires that the DNA loop around.
a result, host mRNA cannot be translated, so the host ribosomes will If the enhancer and promoter are on different but catenated plas-
synthesize only viral proteins. mids, the enhancer-bound transcription factor and the promoter-
bound RNAP II can arrange themselves to contact one another and
22.
thus stimulate translational initiation at the promoter. However, if
exon 1 exon 2 exon 3 the two plasmids are not catenated, the transcription factor and the
RNAP II are unlikely to find each other and hence transcription
initiation will not occur.
Alternative mRNA splicing can generate different forms of the pro- 30. In wild-type E. coli, RNA processing begins before a transcript has
tein. If exon 2 encodes a membrane-spanning segment, then joining been completely synthesized. Hence, intact primary rRNA tran-
exon 1 to exon 2 will generate a membrane-bound protein. If exon 3 scripts never actually exist in such organisms.
encodes a soluble segment, then joining exon 1 to exon 3 will gener-
ate a soluble protein.
Chapter 27
23. The top strand is the sense strand. Its TATGAT segment differs by
only one base from the TATAAT consensus sequence of the pro- 1. A 4-nt insertion would add one codon and shift the gene’s read-
moter’s −10 sequence; its TTTACA sequence differs by only one ing frame by one nucleotide. The proper reading frame could be
base from the TTGACA consensus sequence of the promoter’s −35 restored by deleting a nucleotide. Gene function, however, would
sequence and is appropriately located ∼25 nt to the 5′ side of the not be restored if (a) the 4-nt insertion interrupted the codon for
−10 sequence; and the initiating G nucleotide is the only purine that a functionally critical amino acid; (b) the 4-nt insertion created a
is located ∼10 nt downstream of the –10 sequence. codon for a structure-breaking amino acid; (c) the 4-nt insertion in-
troduced a Stop codon early in the gene; or (d) the 1-nt deletion
5- CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA- 3
occurred far from the 4-nt insertion so that even though the reading
frame was restored, a long stretch of frame-shifted codons separated
–35 –10 start
region region point the insertion and deletion points.
2. There are two DNA strands corresponding to the sequence: the one
24. whose sequence is given and the one that is complementary to it.
U G G Each strand has three possible reading frames, so there are 6 different
U A ways the DNA could be translated.
G -3
G C U C 3. The possible codons are UUU, UUG, UGU, GUU, UGG, GUG,
U G A G G A U G G C A G C GGU, and GGG. The encoded amino acids are Phe, Leu, Cys, Val,
A 
C U C C U

A C C G U C G
Trp, and Gly (Table 27-1).
U 4. A UAG Stop codon results from any of the point mutations XAG,
C U U U
U -5 UXG, or UAX to UAG. The XAG codons specify Gln, Lys, and
U C
Glu; the UXG codons specify Leu, Ser, and Trp; and the UAX co-
U C U
dons that are not Stop codons both specify Tyr. Hence some of the
 SP-49
codons specifying these amino acids can undergo a point mutation 16. eIF2 is a G protein that delivers the initiator tRNA to the 40S ribo-
to UAG. somal subunit and then hydrolyzes its bound GTP to GDP. The GEF
5. There are still two other Stop codons, UAA and UAG, to terminate eIF2B helps eIF2 release GDP in order to bind GTP so that it can
translation. participate in another round of translation initiation.
6. The likeliest codons to specify Met would be AUU, AUC, or AUA 17. The constrained geometry of Pro could affect the efficiency of
(all of which specify Ile in the standard genetic code), because these peptidyl transfer, or the poly-Pro segment could fit poorly in the
codons differ from AUG only at the third position. ribosome exit tunnel, slowing the rate of chain lengthening.
7. (a) Like an aaRS, Xpot must recognize features of tRNA structure 18. The 13 proteins synthesized by the mitoribosome are all integral
that are present in all tRNAs, such as the acceptor stem and the membrane proteins containing large numbers of membrane-
TψC loop. (b) Xpot can distinguish mature and pre-tRNAs because spanning α helices. The hydrophobic exit channel probably allows
mature tRNAs have a processed 5′ end with a single phosphate these protein segments to begin forming hydrophobic helices before
group, and the 3′ end must be a —CCA sequence (see Fig. 27-3). they exit the ribosome.
8. 19. +
NH 3 O
O
–OOC CH CH2 CH2 C NH CH COO–
HN
CH2

S N SH

Ribose 20. Formation of a peptide bond is an endergonic reaction. In fact, the

2-Thiouridine synthetase requires the free energy of ATP.
21. The repeating sequence can be translated as GGG-GCC, GGG-
9. Gly and Ala; Val and Leu; Ser and Thr, Asn and Gln; and Asp CCG, and GGC-CGG, which correspond to the repeating peptides
and Glu. –Gly–Ala–, –Gly–Pro–, and –Gly–Arg–.
10. A mutation that generates a seldom-used codon that requires a rare 22. The normal peptide has the sequence –Asp–Ser–Phe–Arg–Gln–
tRNA could slow the rate of translation so that although the result- Ser–Glu–, and frameshifting at the CGU codon yields the sequence
ing protein is structurally normal, less of it is synthesized. –Asp–Ser–Phe–Val–Ser–Pro–Arg–.
11. 23. (a) Each ORF begins with an initiation codon (ATG) and ends with
H a Stop codon (TGA):
N O H N ATGCTCAACTATATGTGA encodes vir-2 and ATGCCGCAT-
GCTCTGTTAATCACATATAGTTGA on the complementary
I C strand encodes vir-1.
N N H N (b) vir-1: MPHALLITYS; vir-2: MLNYM.
N N (c) vir-1: MPHALLIPYS; vir-2: MLNYMGLTEHAA.
O 24. There are four exons (the underlined bases)
TATA ATAC G C G CA ATACA AT C TACAG C T T C G C G TA
O AATCGTAGGTAAGTTGTAATAAATATAAGTGAGTAT
G ATA C A G G C T T T G G A C C G ATA G AT G C G A C C C T G
G AG G TA AG TATAG AT TA AT TA AG C AC AG G C AT G
N O H N
I U CAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGT
N CAATTAATTCAGGCAGTAGATGAATAAACGATATCGATC
N N H O GGTTAGGTAAGTCTGAT
N The mature mRNA, which has a 5′ cap and a 3′ poly(A) tail, there-
fore has the sequence
12. This arrangement ensures that the rRNAs will be made in the equal GCGUAAAUCGUAGGCUUUGGACCGAUAGAUGCGAC
amounts required by functional ribosomes. CCUGGAGGCAUGCAGGGAUAUCCUCCAAAAAGGCAU
13. Only newly synthesized bacterial polypeptides have fMet at their GCAGGGAUAUCCUCCAAAUAGGCAGUAGAUGAAUAA
N-terminus. Consequently, the appearance of fMet in a mamma- ACGAUAUCGAUCGGUUAG
lian system signifies the presence of invading bacteria. Leukocytes The initiation codon and termination codon are shown in boldface.
that recognize the fMet residue can therefore combat these bacteria The encoded protein has the sequence
through phagocytosis. MRPWRHAGISSKKACRDILQIGSR
14. Prokaryotic ribosomes can select an initiation codon located any- 25. As expected, the correctly charged tRNAs (Ala–tRNAAla and Gln–
where on the mRNA molecule as long as it lies just downstream of tRNAGln) bind to EF-Tu with approximately the same affinity, so
a Shine–Dalgarno sequence. In contrast, eukaryotic ribosomes usu- they are delivered to the ribosomal A site with the same efficiency.
ally select the AUG closest to the 5′ end of the mRNA. Eukaryotic The mischarged Ala–tRNAGln binds to EF-Tu much more loosely,
ribosomes therefore cannot recognize a translation initiation site on indicating that it may dissociate from EF-Tu before it reaches the
a circular mRNA. ribosome. The mischarged Gln-tRNAAla binds to EF-Tu much more
15. Ribosomes cannot translate double-stranded RNA, so the base tightly, indicating that EF-Tu may not be able to dissociate from
pairing of a complementary antisense RNA to an mRNA prevents it at the ribosome. These results suggest that either a higher or a
its translation. lower binding affinity could affect the ability of EF-Tu to carry out
SP-50
its function, which would decrease the rate at which mischarged 35. The E. coli ribosome contains 52 proteins + 3 RNAs.
aminoacyl–tRNAs bind to the ribosomal A site during translation. A minimum of 31 noninitiating tRNAs and their 20 cognate
26. By inducing the same conformational changes that occur during aminoacyl-tRNA synthetases is required.
correct tRNA–mRNA pairing, paromomycin can mask the presence
of an incorrect codon–anticodon match. Without proofreading at tRNAMetf is also required (it is charged by the aminoacyl–tRNA
the aminoacyl–tRNA binding step, the ribosome often synthesizes a synthetase for Met).
polypeptide with the wrong amino acids, which is likely to be non- Initiation requires 3 factors: IF-1, IF-2, and IF-3.
functional or toxic to the cell. Elongation requires 3 factors: EF-Tu, EF-Ts, and EF-G.
27. Transpeptidation involves the nucleophilic attack of the amino Termination requires 4 factors: RF-1, RF-2, RF-3, and RRF.
group of the aminoacyl–tRNA on the carbonyl carbon of the pep- mRNA is also required.
tidyl–tRNA. As the pH increases, the amino group becomes more
Thus, the total number of macromolecules is:
nucleophilic (less likely to be protonated).
28. As the pH increases, residue A2486 would be less likely to be 52 + 3 + 31 + 20 + 1 + 3 + 3 + 4 + 1 = 118 different
protonated and therefore less likely to stabilize the negatively macromolecules.
charged oxyanion of the tetrahedral reaction intermediate. Thus, 36. Fixmycin apparently inhibits translocation. Since dipeptides are
the mechanistic embellishment is inconsistent with the observed formed, it must not inhibit initiation, aminoacyl-tRNA binding in
effect. the A site, or transpeptidation. There is also no indication that it
29. From Table 27-2: The 2 amino acids specified by only one codon inhibits termination (although there is likewise no information to the
each require a tRNA. The 12 amino acids that are specified by PQX contrary).
where X may be either purine or else either pyrimidine can each be
specified by a single tRNA according to the wobble pairing rules
Chapter 28
(Table 27-3). Ile, which is specified by AUY, where Y = U, C or
A, also requires a single tRNA. However, the 8 amino acids that are 1. Virtually all the DNA sequences in E. coli are present as single copies,
specified by RSZ, where Z = U, C, A or G, must each have 2 tRNAs so the renaturation of E. coli DNA is a straightforward process of
specifying them (Leu, Arg and Ser are specified by both PQX and each fragment reassociating with its complementary strand. In con-
RSZ). Finally, an initiator tRNA is required. Thus, trast, the human genome contains many repetitive DNA sequences.
2 + 12 + 1 + 2 × 8 + 1 = 32 tRNAs are minimally required The many DNA fragments containing these sequences find each
other to form double-stranded regions (renature) much faster than
30. The starvation-induced protein binds to the anti-Shine–Dalgarno
the single-copy DNA sequences that are also present, giving rise to
sequence of the rRNA, which prevents mRNAs from binding to the
a biphasic renaturation curve.
ribosome. Because this blocks translation initiation, the starving cell
can avoid undertaking energetically expensive protein synthesis. 2. Because genes encoding proteins with related functions often occur
in operons, the identification of one or several genes in an operon
31. The enzyme hydrolyzes peptidyl–tRNA molecules that dissociate
may suggest functions for the remaining genes in that operon.
from a ribosome before normal translation termination takes place.
Because peptide synthesis is prematurely halted, the resulting poly- 3. The Daphnia and Drosophila genomes are similar in size (200,000 kb
peptide, which is still linked to tRNA, is likely to be nonfunctional. versus 180,000 kb), but Daphnia contains far more genes (∼30,000
Peptidyl–tRNA hydrolase is necessary for recycling the amino acids versus ∼13,000). The Daphnia genome is much smaller than the
and the tRNA. human genome (200,000 kb versus 3,038,000 kb) but appears to
contain more genes (∼30,000 versus ∼21,000).
32. When a ribosome translates an mRNA lacking a Stop codon, trans-
lation proceeds all the way to the mRNA’s poly(A) tail. Since AAA 4. The alga O. tauri allots about 13,000 kb/8000 genes or ∼1600 bp
is the codon for Lys, the appearance of a poly(Lys) sequence signals per gene, which is not much more than E. coli, which allots 4639 kb/
the cell to destroy the newly made polypeptide, which is likely to be 4289 genes or ∼1100 bp per gene.
nonfunctional. 5. (a) Translation of CAG repeats will yield polypeptides containing
33. Aminoacylation occurs via pyrophosphate cleavage of ATP, and polyglutamine (from the CAG codon), polyserine (from the AGC
hence the aminoacylation of 100 tRNAs requires 200 ATP equiva- codon), and polyalanine (from the GCA codon). (b) Translation of
lents; translation initiation requires 1 GTP (1 ATP equivalent); 99 CTG repeats will yield polypeptides containing polyleucine (from
cycles of elongation require 99 GTP (99 ATP equivalents) for EF- the CUG codon), polycysteine (from the UGC codon), and polyala-
Tu action; 99 cycles of ribosomal translocation require 99 GTP (99 nine (from the GCU codon).
ATP equivalents) for EF-G action; and translation termination re- 6. Eleven CNPs of 465 kb each is 5115 kb, or about 5115 kb/3,038,000 kb
quires 1 GTP (1 ATP equivalent), bringing the total energy cost to = 0.0017 of the genome.
200 + 1 + 99 + 99 + 1 = 400 ATP equivalents. 7. O1 is the primary repressor-binding site, so lac repressor cannot sta-
34. bly bind to the operator in its absence and repression cannot occur.
Met Lys Pro Ala 8. (a) Both O2 and O3 are secondary repressor-binding sequences. If
5′-AGGAGCUX-4 A
G UG AA GA CCX GCX- one is absent, the other can still function, resulting in only a small
loss of repressor effectiveness.
Shine-Dalgarno sequence.
(b) In the absence of both O2 and O3, the repressor can bind only to
3-10 base pairs with G . U’s
allowed
O1, which partially interferes with transcription but does not repress
transcription as fully as when a DNA loop forms through the coop-
Gly Thr Glu Asn Ser Stop
erative binding of lac repressor to O1 and either O2 or O3.
A U
GGX ACX GA G AA C UCX UAA 9. In the absence of β-galactosidase (the product of the lacZ gene),
or UAG-3′ lactose is not converted to the inducer allolactose. Consequently, lac
AG UC UGA enzymes, including galactoside permease, are not synthesized.
 SP-51
10. Since operons other than the lac operon maintain their sensitivity to 19. The imprecise joining of V, D, and J segments, along with nucleo-
the absence of glucose, the defect is probably not in the gene that tide addition or removal at the junction, can generate a Stop codon
encodes CAP. Instead, the defect is probably located in the portion (yielding a truncated and hence nonfunctional immunoglobulin
of the lac operon that binds CAP–cAMP. chain) or create a shift in the reading frame (yielding a misfolded
11. In eukaryotes, transcription takes place in the nucleus and transla- and nonfunctional protein).
tion occurs in the cytoplasm. Hence, in eukaryotes, ribosomes are 20. AID, a cytidine deaminase, is required for somatic hypermutation
never in contact with nascent mRNAs, an essential aspect of the in B cells. If the enzyme were active in another cell, that cell might
attenuation mechanism in prokaryotes. exhibit a very high rate of mutation.
12. Deletion of the leader peptide sequence from trpL would eliminate 21. In multicellular organisms, apoptosis of damaged cells minimizes
sequence 1 of the attenuator. Consequently, the 2 · 3 hairpin rather damage to the entire organism. For a single-celled organism, sur-
than the 3 · 4 terminator hairpin would form. Transcription would vival of a genetically damaged cell is preferable (in a Darwinian
therefore continue into the remainder of the trp operon, which would sense) to its death.
then be regulated solely by trp repressor. 22. Phosphatidylserine is normally present only on the inner leaflet of
13. the plasma membrane (Section 9-4C). The loss of membrane asym-
(CH2)4 metry in a dying cell would distinguish it from normal cells and
facilitate its disposal.
NH
23. The esc gene is apparently a maternal-effect gene. Thus, the proper
C O distribution of the esc gene product in the fertilized egg, which
is maternally specified, is sufficient to permit normal embryonic
CH3
development regardless of the embryo’s genotype.
Acetyllysine
24. The knirps mRNA is expressed in a band posterior to the embryo’s
In acetyllysine, the cationic side chain of Lys has been converted to midpoint (Fig. 28-56c). This band would appear blue due to the
a polar but uncharged side chain. action of β-galactosidase on X-gal.
14. 25. Red–green color blindness is conferred by a mutation in an X-linked
gene so female carriers of the condition, who do not appear to be
(CH2)3
red–green colorblind, have one wild-type gene and one mutated
NH gene. In placental mammals such as humans, females are mosaics
of clones of cells in which only one of their two X chromosomes
(CH2)4 C
is transcriptionally active. Hence in a female carrier of red–green
+ +
NH2 H2 N NH color blindness, the transcriptionally active X chromosome in some
clones will contain the wild-type gene and the others will contain
CH3 CH3
the mutated gene. The former type of retinal clone is able to differ-
Methyllysine Methylarginine
entiate red and green light, whereas the latter type of retinal clone
is unable to do so. Apparently, these retinal clones are small enough
In methyllysine and methylarginine, the hydrophobic methyl group so that a narrow beam of light is necessary to separately interrogate
partially masks the cationic character of the Lys or Arg side chain. them.
15. The product is a citrulline side chain (Fig. 21-9). 26. Transcriptionally active chromatin has a more open structure due to
histone modifications that help make the DNA more accessible to
N CH C
H transcription factors and RNA polymerase as well as nucleases.
(CH2)3 O 27. Histone and DNA methylation requires S-adenosylmethionine
NH (SAM), which becomes S-adenosylhomocysteine after it gives up
its methyl group (Fig. 21-18). S-Adenosylhomocysteine is converted
C back to methionine, the precursor of SAM, in a reaction in which the
O NH2 methyl group is donated by the folic acid derivative tetrahydrofolate
(THF; Fig. 21-18). A shortage of this cofactor could limit cellular
16. A sequence located downstream of the gene’s promoter (i.e., within production of SAM, which would result in the undermethylation of
the coding region) could regulate gene expression if it were recog- histones and DNA.
nized by the appropriate transcription factor such that the resulting 28. (a) Protein phosphorylation (Section 13-2B) leads to immediate
DNA–protein complex successfully recruited RNA polymerase to changes in protein function through allosteric effects, so the release
the promoter. of active NF-κB is rapid.
17. The susceptibility of RNA to degradation in vivo makes it possible (b) Phosphorylation of a protein introduces negative charges that
to regulate gene expression by adjusting the rate of mRNA degrada- might impede the binding of the transcription factor to its recognition
tion. If mRNA were very stable, it might continue to direct transla- sequences in DNA. This potential problem is avoided by the indirect
tion even when the cell no longer needed the encoded protein. activation of NF-κB through phosphorylation of its inhibitor IκB.
18. Since there are 65 VH, 27 D, and 6 JH segments that can be used to (c) By removing ubiquitin from IκB, the Yersinia protein prevents
assemble the coding sequence of the variable region of the heavy IκB degradation. As a result, IκB is able to bind to NF-κB, prevent-
chain, somatic recombination could theoretically generate 65 × ing the transcription factor from turning on the genes required for
27 × 6 = 10,530 heavy chain genes (junctional flexibility would in- lymphocyte proliferation and differentiation. Thus, the bacteria can
crease this number). Since each immunoglobulin molecule contains suppress the immune response.
two identical heavy chains and two identical light chains, the possible 29. A 22-bp segment of RNA, incorporating all four nucleotides, has
number of immunoglobulins would be 10,530 × 2000 = ∼21 million. 422 = 1.8 × 1013 possible unique sequences. An RNA half this size
SP-52
would have only 411 or 4.2 × 106 possible sequences. The shorter the than one type of heavy and light chain. The resulting mixed chain
siRNA, the greater the probability that it could hybridize with more immunoglobulins would be unable to cross-link antigens since the
than one complementary mRNA, thereby making it less efficient two antigen-binding sites would have different binding specificities.
in silencing a specific gene. (In the 3.0 × 109-bp human genome, 31. If the cancer cell’s transformed state results, at least in part, from the
a sequence of 16 bp has a high probability of randomly occurring absence of a functional tumor suppressor gene such as that express-
at least once.) ing pRb, and if the chromosomes that the normal cell contribute to
30. B cells are diploid [have two sets of genes specifying heavy chains the fused cell express that tumor suppressor gene, then the fused cell
and fours sets of genes specifying light chains (two κ’s and two will have a nontumorigenic phenotype. This is because tumor sup-
λ’s)]. Hence, if allelic exclusion were defective, they would continue pressor gene products suppress uncontrolled cell proliferation (can-
to rearrange gene segments even after functional heavy and light cer) so that cells requiring such a gene product for normal growth,
chain genes had been assembled. Such a B cell could produce more but lacking it, will assume the cancerous state.