The Libyan Academy School of Basic

Sciences

Life Sciences Department

Microbiology Division

Association between Interleukin 17A and Interleukin 17F

Gene Polymorphisms and Periodontal Pathogens in Chronic
Periodontitis among Libyans.

A Research Submitted to the School of Basic Sciences at the Libyan Academy in

Partial fulfilment of the Requirements for the Degree of Master of Science in
Microbiology.

By

Eshraq Alsherif A. Alsherif

Bachelor of dentistry

Under the Supervision of:

Prof. Nabil S. Enattah

Professor of Medical Genetics

Department of Genetic Engineering, Biotechnology Research Centre (BTRC)
President of Tripoli University

Spring 2020

2
 ‫اﻷكاديمية الليبية‬

‫مدرسة العلوم اﻷساسية‬

‫قسم علوم الحياة‬
‫شعبة اﻷحياء الدقيقة‬

‫ظاهرة تعدد أشكال النوكليوتيدات المفردة في‬

‫إنتر لوكين‪17‬‬
‫)أ & ف( وارتباطه بمرض التهاب اللثة‬
‫المزمن وأكثر أنواع بكتريا مصاحبة للمرض‬
‫بين الليبيين‪.‬‬

‫‪3‬‬
‫بحث مقدم لمدرسة العلوم اﻷساسية باﻷكاديمية‬
‫الليبية كجزء من متطلبات الحصول على درجة‬
‫اﻹجازة العالية في علم اﻷحياء الدقيقة‪.‬‬
‫إعداد ;‬

‫إشراق الشريف عبد ﷲ الشريف‬

‫إشراف‪:‬‬

‫أ‪.‬د‪ .‬نبيل صبري محمد النطاح‬

‫أستاذ علم الوراثة الطبية‬
‫قسم الهندسة الوراثية‪ ،‬مركز البحوث تقنيات‬
‫الحيوية‬
‫رئيس جامعة طرابلس‬

‫ربيع ‪2020‬‬

‫‪4‬‬
Declaration

I hereby declare that this thesis is

the result of my own work unless
otherwise stated.

Eshraq Alsherif

5
 Dedication

This thesis is dedicated to my mother

(peace be up on her) and my father
who have encouraged me to continue
my education and provided support
throughout my life.

6
To my two lovely sisters Hana and
Aisha who stood with me in difficult
times.

7
Statement of support

This study was supported by the

Genetic Engineering Department of
the Biotechnology Research Centre in
Tripoli (BTRC), with collaboration of
Tripoli University and the Libyan
Academy.

8
Acknowledgments

9
I would like to express my special
appreciation and thanks to my
precious supervisor Prof. Nabil
Enattah for his guidance, brilliant
comments, suggestions and for his
support in both research and revision
process that has led to this thesis. Dr.
Nabil introduced me to Genetic
Engineering Department of the
Biotechnology Research Center, and
without delay the staff welcomed me
and helped me in my research process.

I would like to thank my co-supervisor

Dr. Inas Alhudiri for her patience and
advice during her supervision in the
lab. Her experience and dedication

10
were of great influence in success of
this study.

In addition I would like to thank Dr.

Muna ElJilani for her help and
brilliant comments in academic
writing.

The project wouldn’t have been

possible without the contribution of
Dr. Asaad Elbalog who showed me
how to do periodontal examination
and subgingival sample collection.

I am also grateful to Prof. Tarik Gebril

and Dr. Ellolou ben Dharif, for their
valuable insight and advices with
respect to this study.

11
The project wouldn`t have been
possible without the help of different
dental facilities like Dental clinics of
Periodontology Department of faculty
of Dentistry (Tripoli –Libya), Tripoli
Dental Centre , Alhuria poly clinic
center ,Private Dental Clinics in
different location in Libya for
collaboration in sample collection .

I would very much like to

acknowledge two teaching staff
members of Libyan Academy Dr.
Abdul-Rahman Attaweel, and Dr.
Mahmoud Buazzi, whom I am
fortunate and proud of being one of
their students, and I was greatly

12
benefited from the valuable advices
that both offered me during
conducting this study.

All appreciation and thanks to the

person who illuminated and enriched
my life with knowledge Dr Fatima
Ben Talib.
Much gratitude goes to Najwa Kzam,
Amal Gnedi, Nusayba Awad, Naziha
salama greatly valued their friendship
and deeply appreciated their belief in
me. Special thanks and appreciation to
a great person who did help me in hard
times without any hesitation to Prof.
Paul Rutland.

13
 List of Contents

1.1 Background: ................................................ 49

14
1.2 Epidemiology of CP:................................... 53

1.3 Pathogenesis of CP: .................................... 58

1.3.1 Red complex (RC) ................................ 69

1.3.2 Orange complex (OC) .......................... 71

1.3.3 Green complex (GC) ............................ 73

1.4 Cytokines: ................................................... 79

1.5 Interleukin 17: ............................................. 80

1.5.1 Interleukin 17 A gene: .......................... 83

1.5.2 Interleukin 17 F gene: ........................... 83

1.6 Single nucleotide polymorphisms in chronic

periodontitis: ..................................................... 84

IL-17A and IL-17F Gene Polymorphisms in

chronic periodontitis: ..................................... 85

15
1.7 Problem Statement: ..................................... 86

2.1 Literature review: ........................................ 88

2.2 Aims of this study: ...................................... 98

Study population: ....................................... 100

3.2 Subgingival samples: ................................ 104

3.3 Sample preparation for PCR: .................... 105

3.4 Polymerase Chain Reaction (PCR): .......... 106

3.5 Conventional PCR procedure for individual

pathogens: ....................................................... 109

3.6 Agarose Gel Electrophoresis: ................... 111

16
3.7 Multiplex PCR procedure: ........................ 112

3.8 Agarose Gel Electrophoresis: ................... 115

3.9 Sample collection: ..................................... 115

3.10 DNA Extraction: ..................................... 116

3.11 DNA Isolation Protocol:........................ 117

3.11.1 Measurement of genomic DNA

concentration: .............................................. 118

3.11.2 Agarose Gel Electrophoresis of extracted

DNA: 120

3.12 Polymerase Chain Reaction (PCR): ...... 122

3.13 Post-PCR Agarose Gel Electrophoresis 125

3.14 Purification of the PCR products: ......... 125

17
3.15 Post-Purification Agarose Gel

Electrophoresis:............................................... 127

3.16 DNA Cycle Sequencing: ........................ 127

3.16.1 Extension Products Purification: ...... 130

3.16.2 Capillary Electrophoresis: ................ 132

3.16.3 Sequencing Data Analysis: ............... 133

3.17 Statistical analysis: .................................. 134

Analysis of clinical parameters: .......... 136

4.2 Distribution of chronic periodontitis in

study population: ......................................... 137

4.3 Geographical distribution in study

population: ...................................................... 139

18
4.4 Detection of individual periodontal pathogens

in chronic periodontitis by conventional

PCR:…………………. ................................... 140

4.5 Detection of sub-gingival pathogens in CP

group by Multiplex PCR: ................................ 142

4.5.1 Red complex: ..................................... 142

4.5.2 Orange complex:............................... 143

4.5.3 Green complex:................................... 144

4.6 Detection of sub-gingival pathogens in HC

group by Multiplex PCR: ................................ 145

4.6.1 Red complex: ................................... 145

4.6.2 Orange complex:............................... 146

4.6.3 Green complex in HC group:............ 147

19
4.8 Prevalence and distribution of the eight sub-

gingival pathogens in study population groups:

......................................................................... 148

4.9 Association between the clinical parameters

and study groups: ............................................ 150

4.10 Association between the sub-gingival

pathogens and CP:........................................... 152

4.11 Association between single sub-gingival

pathogen and CP in study population: ............ 156

4.12 Association between bacterial species in CP

group: .............................................................. 158

4.13 Genomic DNA concentration and purity: 160

4.14 Detection of IL- 17 A gene: .................... 161

20
4.15 Detection of IL- 17 F gene: ..................... 162

4.16 Purification of IL- 17 A PCR product: ... 163

4.17 Purification of IL- 17 F PCR products:.. 164

4.18 Genotype frequency: ............................... 165

4.19 IL-17A allele frequency: ......................... 167

4.20 IL-17F allele frequency: ........................ 167

4.21 Novel genatic variant : ............................ 168

4.22 Genotype frequency for Novel genetic

variant: ............................................................ 170

4.23 Allele frequency for Novel genetic variant

c.*34G>A in IL17F gene: ............................... 171

4.24 Association between Novel genetic variant

c.*34G>A and CP: .......................................... 171

21
 5.1 Discussion: ................................................ 174

6.1 Conclusions: .............................................. 188

1.1 Recommendations: .............................. 190

List of Tables

Table 1.1 Periodontal pathogens and their

association with periodontal diseases, the clinical

response to elimination, immune response and

virulence factors ................................................... 76

22
Table 2.1 Comparison between different

populations in subgingival pathogens profile in

patient with CP . ................................................... 89

Table 2.2 Comparison between CP and HC groups

in subgingival pathogens profile of different

populations ........................................................... 92

Table 2.3 IL-17(A، F) reference SNP. ................. 95

Table 2.4 Comparison between eight conducted

studies to investigate the association between

Interleukin-17A and Interleukin -17F Gene

polymorphism and CP in in different population

around the world................................................... 97

Table 3.1 Primer pairs used for subgingival bacterial

detection checked with Human Microbial Taxon ID

(HMT) for specificity. ........................................ 107

23
Table 3.2 Summary of PCR reaction components for

individual subgingival pathogen detection ......... 109

Table 3.3 Summary of polymerase chain reaction

cycle settings for [Link] , .......................... 110

Table3.4 Summary of polymerase chain reaction

cycle settings for A. actinomycetemcomitans, P.

intermedia,and P. nigrescens. ............................ 110

Table 3.5 Multiplex PCR Components. ............. 113

Table 3.6 Thermal cycler proGram. ................... 114

Table 3.7 Contents of Isohelix Buccal DNA

Isolation Kit. ....................................................... 116

Table 3.8 Main characteristics IL- 17 A and IL- 17

F gene polymorphisms and primers’ sequences. 122

Table 3.9 Summary of PCR reagents used and their

quantity for each sample. ................................... 123

24
Table 3.10 Summary of polymerase chain reaction

proGram. ............................................................ 124

Table 3.11 DNA Cycle Sequencing reaction

components......................................................... 128

Table 3.12 Cycle sequencing proGram. ............. 129

Table 3.13 Extension Products Purification with

ethanol/EDTA precipitation. .............................. 130

Table 4.1 Analysis of clinical parameters by mean

and standard deviation. ....................................... 136

Table 4.2 The distribution of chronic periodontitis

and healthy control groups among Libyans

according to PDI................................................. 137

Table 4.3 Geographical distribution in study

population groups (CP and HC). ........................ 139

25
Table 4.4 Prevalence and distribution of eight sub-

gingival pathogen in chronic periodontitis and

healthy control groups among Libyans. ............. 148

Table 4.5 Association between red complex

pathogens and clinical parameters (BOP). ......... 152

Table 4.6 Association between red complex

pathogens and clinical parameters (CAL). ......... 152

Table 4.7 Association between red complex

pathogens and clinical parameters (PD). ............ 153

Table 4.8 Association between green complex

pathogens and clinical parameters (BOP). ......... 153

Table 4.9 Association between green complex

pathogens and clinical parameters...................... 154

Table 4.10 Association between green complex

pathogens and clinical parameters (PD). ............ 154

26
Table 4.11 Association between orange complex

pathogens and clinical parameters (BOP). ......... 155

Table 4.12 Association between orange complex

pathogens and clinical parameters (CAL). ......... 155

Table 4.13 Association between orange complex

pathogens and clinical parameters (PD). ............ 156

Table 4.14 Association between single sub-gingival

pathogen in CP group. ........................................ 156

Table 4.15 Association between single sub-gingival

pathogen in HC group. ....................................... 157

Table 4.16 the odds ratio (95 % confidence intervals)

of associations among species tested from (N= 50)

chronic periodontitis subjects. ............................ 159

Table 4.17 Genotype frequency for IL-17A....... 165

Table 4.18 Genotype frequency for IL-17F ....... 165

27
Table 4.19 Allele frequency for IL-17A gene

(rs2275913). ....................................................... 167

Table 4.20 Allele frequency for IL-17F gene

(rs763780). ......................................................... 167

Table 4.21 Genotype frequency for Novel genetic

variant c.*34G>A in IL17F gene. ...................... 170

Table 4.22 Allele frequency for novel genetic

variant c.*34G>A in IL17F gene. ...................... 171

Table 4.23 Association between Novel genetic

variant c.*34G>A and CP. ................................. 172

List of

Figures

28
Figure 1.1 Tooth structure and components of

periodontium . ..................................................... 50
&
Figure 1.2 Healthy Periodontium Figure 1.3

Chronic Periodontitis............................................ 51

Figure 1.4 Stages of periodontal disease. ............. 60

Figure 1.5 Bacterial Complexes ........................... 65

Figure 1.6 Cytokine mechanism........................... 79

Figure 1.7 Cytokines are produced by different cells

.............................................................................. 80

Figure 1.8 IL- 17 A and IL- 17 F Gene location in

human ................................................................... 80

Figure 1.9 Functions of IL-17 and its role in

inflammation ........................................................ 81

Figure 1.10 Interleukin 17A gene. ....................... 83

Figure 1.11 Interleukin 17F gene. ........................ 83

29
Figure 2.1 Prevalence of the eight subgingival

pathogens in different populations. ...................... 91

Figure 2.2 Comparison between CP and HC groups

in subgingival pathogens profile of different

population. ............................................................ 93

Figure 3.1 periodontal examination. .................. 102

Figure 3.2 Method of paper points sample collection

and site of insertions in maxilla & mandible in CP

patient. ................................................................ 105

Figure 3.3 Buccal swab sample from a patient in

dental clinic. ....................................................... 116

Figure 4.1 The distribution of scores in healthy

control groups among Libyans according to PDI.

............................................................................ 138

30
Figure 4.2 The distribution of scores in chronic

periodontitis group among Libyans according to

PDI. .................................................................... 138

Figure 4.3 Conventional PCR bands of specific 16S

RNA gene region for .......................................... 140

Figure 4.4 Conventional PCR bands of specific 16S

RNA gene region for .......................................... 141

Figure 4.5 multiplex bands of specific 16S gene

regions in Red complex pathogens for CP group.

............................................................................ 142

Figure 4.6 Multiplex bands of specific 16S RNA

gene regions in Orange complex for CP group. . 143

Figure 4.7 Multiplex bands of specific 16S gene

regions in Orange complex pathogens for CP group.

............................................................................ 144
31
Figure 4.8 Multiplex bands of specific 16S RNA

gene regions in Red complex pathogens for HC

group................................................................... 145

Figure 4.9 Multiplex bands of specific 16S RNA

gene regions in Orange complex pathogens for HC

group................................................................... 146

Figure 4.10 Multiplex bands of specific 16S RNA

gene regions in Green complex pathogens for HC

group................................................................... 147

Figure 4.11 Prevalence and distribution of eight sub-

gingival pathogen in chronic periodontitis and

healthy control groups among Libyans. ............. 149

Figure 4.12 Scatter plot diaGram of BOP in cases

and controls, red line represents the mean. ........ 150

32
Figure 4.13 Scatter plot diaGram of CAL in cases

and controls, red line represents the mean. ........ 151

Figure 4.14 Scatter plot diaGram of PD in cases and

controls, red line represents the mean. ............... 151

Figure 4.15 Bands of specific IL- 17 A gene regions.

............................................................................ 161

Figure 4.16 Bands of specific IL- 17 F gene regions.

............................................................................ 162

Figure 4.17 Bands of purified IL- 17 A gene PCR

product regions. .................................................. 163

Figure 4.18 bands of purified IL- 17 F gene regions.

............................................................................ 164

Figure 4.19 ChromatoGram IL-17A (rs2275913)

SNP (ambiguity code: R). .................................. 166

33
Figure 4.20 ChromatoGram showing T7488C

(rs763780) SNP in IL17F ................................... 166

Figure 4.21 ChromatoGram showing Novel genetic

variant c.*34G>A in IL17F gene. ...................... 169

List of Appendix

Appendix 1 Questionnaire& consent form in Arabic

language ................................................................. ii

Appendix 2 Patient Data sheet ............................... ii

Appendix 2 Patient Data sheet .............................. iii

Appendix 3 Additional informative sheet about the

study in Arabic language. ...................................... iv

Appendix 4 Ethical approval .................................. v

34
 List of abbreviations:

Aa Aggregatibacter actinomycetemcomitans
Ab1–42 Amyloid beta 1–42
APCs Antigen-Presenting Cells
B2 Binding Buffer
BOP Bleeding On Probing
BTRC Biotechnology Research Centre
CAL Clinical Attachment Level
CD4 Cluster of Differentiation 4
CGF Crevicular Gingival Fluid
CP Chronic Periodontitis
Cr Campylobacter rectus
CT Capture Buffer
DC’s Dendritic Cells
DNA Deoxyribose Nucleic Acid
DNTPs Deoxy ribonucleotides Triphosphate
DS DNA Double strand DNA
EBV Epstein Barr virus
Ec Eikenella corrodens
Etbr Ethidium Bromide

35
HC Healthy Control
HCMV Human cytomegalovirus
HMT ID Human Microbial Taxon ID
HOMD Human Oral Microbiome Database
HSV Herpes Simplex Virus
IL 17 Interleukin 17
IL 17 R Interleukin 17 Receptor
IL 25 Interleukin 25
IL 6 Interleukin 6
IL 8 Interleukin 8
LPS Lipopolysaccharide
LS Lysis Buffer
MAF Minor Allele Frequency
MAPK Mitogen-Activated Protein Kinase
MPO Myeloperoxidase
NF-kB Nuclear Factor Kappa-Light-Chain-Enhancer of Activated
OC Orange Complex
PBS Phosphate buffer saline
PCR Polymerase Chain Reaction
PD Probing Depth
PDI Periodontal Disease Index
Pg Porphyromonas gingivalis
PGE2 prostaglandin E2
Pi Prevotella intermedia
PK Proteinase K
PLBW Preterm Low Birth Weight
36
PTB Preterm Birth
RANKL Receptor activator of nuclear factor kappa B ligand
RC Red Complex
RPM Rotation per Minute
RS Reference SNP
RT-PCR Real Time PCR
RTX Repeats in toxin
SNP Single-nucleotide polymorphism
TBE Tris - Borate – EDTA
Td Treponema denticola
TE Tris-EDTA
Tf Tannerella forsythia
Th17 T helper 17 cells
UV Ultraviolet Light

37
 ‫الملخص‪:‬‬
‫خلفية الموضوع‪ :‬التهاب اللثة المزمن ينجم‬
‫عن بكتريا مسببة ﻷمراض اللثة‪ ،‬وأيضا يتأثر هدا‬
‫المرض بالعوامل الوراثية والبيئية والمسبب‬
‫الرئيسي لها هو البيو فليم التي تقوم بإفرازه‬
‫مجموعة من البكتريا المسببة ﻷمراض اللثة‪،‬‬
‫وتشير الدراسات الحديثة إلى أن السيتوكينات‬
‫المضادة لﻼلتهابات مثل إنترلوكين )‪ (IL-17‬تلعب‬
‫دورا بارزا ﻓﻲ التسبب ﻓﻲ مرض التهاب اللثة‬
‫المزمن‪.‬‬

‫‪38‬‬
‫الغرض من الدراسة‪ :‬دراسة العﻼقة بين تعدد‬
‫اﻷشكال الجينية إنترلوكين‪) 17‬أ‪ ،‬ف( ومرض‬
‫التهاب اللثة المزمن وكذلك دراسة العﻼقة بين‬
‫ثمانية أنواع من بكتيريا ومرض التهاب اللثة‬
‫الليبيين‪.‬‬ ‫المزمن بين‬
‫المواد وطرق البحث‪ :‬تكونت الدراسة من عدد‬
‫‪ 100‬متطوع من المواطنين الليبيين‪ 50 ،‬رجﻼً‬
‫و‪ 50‬امرأة بين عمر )‪ (65- 25‬عاما‪ .‬تم إجراء‬
‫فحص اﻷسنان لكل مشارك‪ ،‬تم تشخيص أمراض‬
‫اللثة وفقًا للمعايير السريرية لمؤشرات أمراض‬
‫اللثة )‪ ( BOP، CAL، PD،PDI‬وتم أخذ عينات من‬
‫الحمض النووي عن طريق مسحة من الفم لتحليل‬
‫اﻻختﻼفات في الجينات لﻺنترلوكين ‪)17‬أ‪ ،‬اف(‬
‫المرتبطة بمرض التهاب اللثة المزمن‪ .‬وكذلك‬
‫أخذت عينة من الطبقة البيولوجية )بيوفيلم(‬

‫‪39‬‬
‫الموجود في الجيوب اللثوية للكشف عن ثمانية‬
‫أنواع من البكتريا الموجودة بالفم‪.‬‬

‫تم تحليل النمط الجيني بواسطة تفاعل البلمرة‬

‫المتسلسل من ثم تحديد تسلسل النوكليوتيد الدقيق‬
‫في جزء معين من الحمض النووي للكشف عن‬
‫تعدد اﻷشكال الجيني لﻺنترلوكين ‪)17‬أ‪ ،‬اف(‪،‬‬
‫بينما تم التعرف على عدد ثمانية أنواع من بكتريا‬
‫مسببة ﻷمراض اللثة بواسطة تفاعل البلمرة‬
‫المتسلسل المتعدد والترحيل الكهربائي للهﻼم‪.‬‬
‫تم العثور على متغير جديد >‪C. *34G‬‬ ‫النتائج‪:‬‬
‫‪A‬في ‪ IL17F‬حوالي ‪ %14.6‬من المرضى‬
‫وارتباطه مع مرض التهاب اللثة المزمن )‪p-‬‬

‫‪ ,(value = 0.010‬تم الكشف عن اﻷنماط الوراثية‬

‫)‪ ( GG،AG‬في ‪ (rs2275913) IL17A‬في‬
‫المرضى الذين يعانون من التهاب اللثة المزمن‪،‬‬
‫أيضا شوهد النمط الوراثي )‪IL17F (CT‬‬

‫‪40‬‬
‫)‪ (rs763780‬في الفئة المصابة بالمرض ولكن ﻻ‬
‫يوجد عﻼقة ارتباط مع مرض التهاب اللثة المزمن‬
‫)‪ (p-value = 0.334‬وجود ارتباط قوي بين ثمانية‬
‫انواع من البكتريا و مرض اللثة المزمن‪(p-‬‬

‫)‪value =0.0001‬وزيادة معدل انتشارها في الفئة‬

‫المصابة بالمرض‪.‬‬

‫اﻻستنتاج ‪:‬توجد عﻼقة قوية بين ثمانية انواع من‬

‫البكتريا مع مرض التهاب اللثة المزمن ‪.‬هناك‬
‫حاجة إلى مزيد من الدراسات الجينية واسعة‬
‫النطاق لتوضيح الرابطة بين ‪ IL17A‬ومرض‬
‫التهاب اللثة المزمن وأيضا على متغير جديد *‪c.‬‬

‫‪34G> A‬في ‪ IL17F‬وعﻼقته بي مرض التهاب‬

‫اللثة المزمن في حجم عينة أكبر‪.‬‬

‫‪41‬‬
Abstract

42
Background: Chronic periodontitis
(CP) is triggered by periodontal
pathogens and influenced by genetic
and environmental factors. Recent
studies suggest that anti-inflammatory
cytokines such as interleukin 17 (IL-17)
plays a prominent role in the
pathogenesis of CP. This study aims to
investigate the association between CP
and interleukin IL- 17 (A and F) gene
polymorphisms. We also aim to
evaluate the association between eight
sub-gingival pathogens and CP among
Libyans.
Materials and Methods: The study
consisted of 100 Libyan individuals

43
between the ages of 25 and 65 years
including 50cases and 50controls.
DNA was extracted from buccal swabs
and paper points for sub-gingival
pathogen samples. IL 17 (A&F)
genotyping was performed by PCR
followed by Sanger sequencing.
Specific 16S rRNA primers for each
pathogen were applied in a multiplex
PCR reaction and visualized by agarose
gel electrophoresis for detection of sub-
gingival pathogens.
Results: A novel variant c.*34G>A in
IL17F was found in 14.6% of patients
and it was associated with CP (p-value
= 0.010). IL17A GG and AG

44
(rs2275913) genotypes were detected in
patients with CP.
IL-17F CT (rs763780) showed no
association with CP (p-value = 0.334).

Significant association between the

eight sub-gingival pathogens and CP
(p-value =0.0001) and high
prevalence of sub-gingival pathogens
in CP group.
Conclusion: There is a strong
association between eight sub-
gingival pathogens and CP. More

extensive genetic studies with a larger

45
sample size are needed to further the
association between interleukin-17 A
and CP and the relation between
novel variant c.*34G>A and CP
among Libyans.

46
47
 INTR
ODUCTION

48
 1.1 Background:

The periodontium is the tissues that

support and surround the teeth
structure, the word comes from the
Greek terms peri-, meaning "around"
and -odont, meaning "tooth" and it
consists of four components: Gingiva,
Periodontal ligament, Cementum and
Alveolar bone as shown in figure (1.1)
1

49
 Figure 1.1 Tooth structure and
components of periodontium 2 .

Chronic periodontitis (CP) is an

inflammatory disease of supporting
tissue of the teeth ‘the
periodontium’ causing progressive
destruction in periodontal ligament,
alveolar bone, and pocket formation
3
. Clinical view of both healthy
Periodontium and chronic
50
Periodontitis patient as shown in
figures (1.2) and (1.3).

Figure 1.2 Healthy Periodontium 4 .

Figure 1.3 Chronic Periodontitis 4.
51
 CP is a silent disease; chronic
gingival inflammation and bone
destruction are often painless, it has
few symptoms in the early stages, in
many individuals the disease has
progressed significantly before they
even know and seek treatment,
symptoms may include the following:

1. Redness or bleeding of
gingiva while brushing teeth,
using dental floss or biting on
hard food (e.g., apples).
2. Gingival swelling.

52
 3. Halitosis (bad breath), and a
persistent metallic taste in the
mouth.
4. Gingival recession, resulting
in apparent lengthening of
teeth.
5. Deep pockets between the
teeth.
6. Loose teeth and finally in the
later stages; tooth loss 5,6.

1.2 Epidemiology of CP:

Periodontitis is the most common

chronic inflammatory disease seen in
53
humans, affecting nearly half of adults
in the United Kingdom of whom 60%
are over 65 years old; it is a main public
health problem, regardless of the higher
level of awareness and dental care in
developed countries, periodontitis is
widely spread among their populations
3
.

In 2009-2012 the United States had

periodontitis with different forms
(mild, moderate and severe) affecting
as many as 47.2% of adults
representing 64.7 million people.
Prevalence rates up to 70.1% are
associated with old age 7.
54
 A longitudinal cohort study
conducted in South Korea found the
incidence of tooth extraction is
increasing, and at a higher rate in
patients with periodontal disease. In
2002, 50.6% of tooth extraction cases
were caused by periodontal disease, and
this increased to 70.8% In 2013 8.

In 2014, Kassebaum et al. published a

paper estimating the global burden of
oral conditions from 1990 to 2010,
periodontitis was estimated to be the
sixth most prevalent disease globally,
affecting 743 million people
55
worldwide, incidence of severe
periodontitis in 2010 was 701 cases per
100,000 person years 9,10.

In Libya, the information about

prevalence or the awareness level of
the periodontal diseases is limited. Few
of the conducted studies, showed a little
information regarding periodontal
health. In 2013 a cross-sectional study
was conducted among 1,255
participants aged between 18-34 years
in Sabha reported that only 4.7% had
healthy periodontium 11.

In 2017 another cross-sectional study

conducted in Libya, showed varying
56
degrees of periodontitis severity, half of
the patients (50%) were moderate, 21%
were severe, and 15% had a mild form
of CP 12.

The International Classification of

Functioning, Disability and Health, has
described health-related domains that
impact capacity and performance of a
person with tooth-supporting tissue
distraction, loss of periodontal
attachment and alveolar bone and
finally tooth loss, all these will lead to
activity limitations, difficulties in
chewing, speaking and smiling,
participation restrictions, also personal
57
and professional relationships may be
affected 13.

The risk for CP was raised from 5–15

fold in smokers, being proportional to
the duration and amount of smoking
“smoking appears to impact biofilm
formation from the moment of its
development, changing it from a health-
compatible community to a pathogen-
enriched community, predisposing the
individual to periodontal disease.” 14.

1.3 Pathogenesis of CP:

Colonization of the gingival crevice

occurs initially by bacterial interactions
58
with the tooth and later by inter-
bacterial interactions, leading to the
formation of an organized, cooperating
community called the biofilm 15.

It is evident that CP has

multifactorial etiologies, stemming
from the development of biofilm
(bacterial colonization) on the tooth
surface and gingiva, initially these
bacterial deposits induce a gingival
inflammation (gingivitis) which is
completely reversible, continued along
with the supporting tissues of the teeth,
progressive attachment loss, pocket
formation and bone loss (periodontitis),

59
finally leading to tooth loss, as shown in
figure (1.4) 16,17. Social and behavioural
factors, and genetic or epigenetic
factors, all are modulated and
controlled by the underlying immune
and inflammatory responses of the host
16
.

Figure 1.4 Stages of periodontal disease 18.

60
 The host inflammatory immune
reaction begins after the recognition of
the bacterial pathogens by antigen-
presenting cells (APCs), such as
dendritic cells (DCs). DCs have a
strong capability of catching antigens,
which enables them to stimulate T cells.
In CP, activation of DCs occurs after
contact with lipopolysaccharide (LPS)
or by immune complexes produced by
periodontal pathogens 19–23.

Over 700 bacterial species have been

identified in the human oral cavity,
about 400 of these species have been
identified in the periodontal pocket,

61
whereas about 300 species have been
found in other oral sites including the
tongue, oral mucous membranes, dental
carious lesions, and endodontic
infections 24.

The intricacy of the subgingival

microbiota has been recognized
through microscopic examination by
van Leeuwenhoek in 1683, who was the
first to observe that subgingival plaques
are comprised of a large complex
mixture of bacterial species 25.

Indeed, it has been estimated that 400

or more species are present inside this

62
area, since that time several studies
have evaluated and estimated the
composition of plaque using
microscopy, culture and more recently
26
DNA probe techniques . The
anaerobic culture methods may fail in
identifying all the organisms due to the
extremely slow growth (time
consuming) or very specific growth
requirements of some oral pathogens,
which inhabit the subgingival
microflora 26.
Several alternative methods have
been developed for the detection of oral
pathogens, such as the 16S rRNA gene
detection by conventional PCR or

63
Multiplex PCR for the oral pathogens
that are uncultivable and are difficult to
identify, these methods can eliminate
the ambiguity in the diagnostic
microbiology 26.

In recent years, highly sensitive

microbiological detection techniques
such as real-time PCR can be used to
identify and quantify oral bacteria in
subgingival samples 26,27.

Socransky et al (1998) proposed that

oral diseases could be better understood
by focusing on the consortia of
organisms rather than on individual

64
pathogens, they identified five sets of
bacteria or complexes that were
repeatedly found together in
periodontitis as shown in figure (1.5) 17.

Figure1.5 Bacterial Complexes 17.

The majority of subgingival

microorganisms is considered to be a
normal flora, only several species have
65
been implicated as periodontal
pathogens. Socransky et al in 1998
suggested that the most pathogenic
complex including Porphyromonas
gingivalis (Pg), Treponema denticola
(Td), and Tannerella forsythia (Tf)
termed the Red Complex (RC), was
strongly associated with CP, they are
also often associated with each other
and with diseased sites and may inhibit
innate host defence functions 17,28,29.

Other recognized pathogens called

Orange Complex (OC), including
Prevotella intermedia (Pi), it is the one
preceding (RC) in colonization and

66
proliferation. Additionally, Prevotella
nigrescns (Pn), and Campylobacter
rectus (Cr) also increase the depth of
periodontal pockets and considered as
periodontal pathogens30. Also there is
Green complex (GC) including
Aggregatibacter
actinomycetemcomitans (Aa) and
Eikenella corrodens (Ec) which are
often considered important in
periodontal disease 24,30 .

Subgingival microbiota was detected

less frequently in shallow pockets (up to
4 mm); they were found to increase in
quantity in pockets of 4 to 6 mm depth

67
and were in the highest levels in pockets
of over 6 mm depth 31.
However, there is sufficient evidence
that the periodontal pathogens
[Link], [Link] and
[Link] are detected more
frequently in deep periodontal pockets
(> 5 mm) than in shallow ones (< 4 mm)
31
.

Understanding of CP has increased

significantly with extensive analysis of
the dental plaque associated with either
clinically healthy or diseased sites,
periodontitis has been characterized as

68
a polymicrobial oral disease and
another issue has been noted a
microbial shift in an oral cavity from
mostly Gram-positive in healthy
periodontium to the mostly Gram-
negative diseased site 29.

1.3.1 Red complex (RC)

1. Porphyromonas gingivalis (Pg):

It is a Gram-negative, anaerobic, rod-
shaped, non-motile pathogenic
bacteria, which is black pigmented
and it has a strong association with the
incidence and severity of CP 32.

2. Tannerella forsythia (Tf):

69
It is a Gram-negative, anaerobic
pathogenic bacteria, rod-shaped, and
was originally isolated in the 1970s by
Dr. Anne Tanner from dental plaque
collected from patients with CP 33.

3. Treponema denticola (Td):

It is a Gram-negative, obligate
anaerobic, spiral-shaped pathogenic
bacteria, it is present in a complex
microbial community within the oral
cavity. It has a strong association with
the incidence and severity of CP 34.

70
1.3.2 Orange complex (OC)

1. Prevotella intermedia (Pi):

It is a Gram-negative, obligate
anaerobic, rod-shaped pathogenic
bacteria involved in periodontitis, and
commonly isolated from dental
abscesses, where obligate anaerobes
predominate 35.

2. Prevotella nigrescens (Pn):

It is a Gram-negative, obligate
anaerobic, rod-shaped and non-motile
pathogenic bacteria, it is part of the
normal oral flora but leads to disease
when it infects the local tissue. P.

71
nigrescens could increase the incidence
of periodontal diseases and play a role
in the pathogenesis of CP 36.

3. Campylobacter rectus (Cr):

It is a Gram-negative, facultative
anaerobic, bacillus-shaped and motile
pathogenic bacteria. [Link] is
associated with the initiation and
progression of periodontal disease 37.

72
1.3.3 Green complex (GC)

1. Aggregatibacter
actinomycetemcomitans (Aa):
It is a Gram-negative, facultative
anaerobic, non-motile pathogenic
bacteria. A. actinomycetemcomitans is
associated with the initiation and
progression of periodontal disease and
interference with host defence
mechanisms 38.
2. Eikenella corrodens (Ec):
It is a Gram-negative, facultative
anaerobic, pleomorphic bacillus
pathogenic bacteria. It is found
predominantly in subgingival plaque in

73
patients with advanced periodontitis
and may also cause extra oral infections
39
.

Recently sseveral studies have

demonstrated a positive association
between human cytomegalovirus
(HCMV), Epstein Barr (EBV), Herpes
Simplex Virus (HSV) and CP 40,41 .

In the following table a summary of

eight subgingival pathogens and their
association with periodontal diseases,
clinical response to elimination,
immune response and virulent factors
table (1.1)

74
75
 Table 1.1 Periodontal pathogens and their association with periodontal diseases, the clinical response to elimination,

immune response and virulence factors 42–45.

Bacterial
Complex Association Elimination Immune response Virulent factors
strain
P.g +++ +++ ++ proteolytic, capsule
Red T.d ++ +++ + motile, proteolytic
T. f ++ + + Proteolytic
A.a +++ + +++ leukotoxin, invasion
Green adherence to buccal epithelial
E.c + + +
cells
P.i ++ + + Proteolytic

Orange C.r ++ + / motile, leukotoxin invasion

Colonization , trigger immune
P.n ++ + +
system

(+) strength.
( /) Immune respond is unkn

76
 Previous studies showed a correlation between CP and many systemic
diseases, subgingival microorganisms play a critical role in etiology, for
example, (Aa) has been responsible for some systemic infectious diseases,
such as endocarditis, meningitis, osteomyelitis, glomerulonephritis and
arthritis. In addition, subgingival microorganisms are the most important
46,47
factor implicated in preterm birth (PTB) . There is a relationship
between oral and vaginal microflora and preterm low birth weight (PLBW),
related species are (Aa), (Pg), (Tf), (Td) and (PI). (>50% of women) in oral
samples were (Pg), (Tf ), (Td) , (Pi) in the preterm group. Studies showed
the amount of (Pg) in subgingival plaque of pre-term women was higher
than that of term women. 24.4% of all the pregnant subjects presented
periodontal pathogens in their vaginal swabs 46–49.

(RC) involved as an etiological factor in oesophageal adenocarcinoma

and oesophageal squamous cell carcinoma, although evidence is limited to
cross-sectional studies. In addition, (Tf) has been identified in
atherosclerotic lesions and also has been isolated from women with
bacterial vaginosis 48–50.

77
 A recent research discovered that (Pg) with their toxin called gingipains
was identified in the brain of Alzheimer’s disease patients. Oral (Pg)
infection in mice resulted in brain colonization and increased production
of A1–42, a component of amyloid plaques, blocked A1–42 production,
reduced neuroinflammation, and rescued neurons in the hippocampus,
gingipain inhibitors could be valuable in treating P. gingivalis brain
colonization and neurodegeneration in Alzheimer’s disease 51.

In vivo and in vitro studies demonstrate the importance of the fimbriae

of P. gingivalis to host cell entry and to promote atherothrombotic lesions
in experimental models. Hemagglutinin A (HagA) expressed by P.
gingivali have the capability to adhere and enter human coronary artery
endothelial cells and make damages 52.

E. corrodens also has been linked to a variety of disease states, including

abscess, endocarditis, meningitis, osteomyelitis, keratitis, conjunctivitis
and cellulitis 45.

78
1.4 Cytokines:

They are small proteins and signaling molecules, which play an

important role in cell to cell communication in immune responses, and
stimulation of the movement of cells towards sites of inflammation,
infection, and trauma, as shown in figure (1.6) 53.

Figure 1.6 Cytokine mechanism 54.

They are a large group of low molecular weight proteins, peptides or

glycoproteins that are secreted by specific cells of the immune system.
Cytokine is a general name; specific names include lymphokine
(cytokines made by lymphocytes), monokine (cytokines made by
monocytes), chemokine (cytokines with chemotactic activities), and
interleukins (cytokines made by one leukocyte and acting on another
leukocytes) as shown in figure (1.7) 53.

79
 Figure 1.7 Cytokines are produced by different cells 55.

1.5 Interleukin 17:

It is a pro-inflammatory cytokine secreted by activated T cells after
transformation to T helper 17 cells (Th17), the IL-17 family contains six
members, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E (or IL-25), and IL-
17F, and five receptors, IL-17 R(A,B,C,D) and SEF. Interleukin-17A is
the most homologous to IL-17F and the genes encoding them are
proximally located on the same chromosome (6p12) as shown in figure
(1.8) 45 .

Figure 1.8 IL- 17 A and IL- 17 F Gene location in human 58.

80
 After activation, DCs become mature, and stimulated to produce various
cytokine patterns, like (IL-17), which will define the selective migration
of CD4 T-helper subsets and the subsequent production of characteristic
cytokines as shown in figure (1.9)23.

Figure 1.9 Functions of IL-17 and its role in inflammation

and matrix destruction 59.

81
 Signaling downstream of IL-17R mediates NF-kB and MAPK, leading to
the production of pro-inflammatory cytokines and chemokines and
subsequent myeloid cell recruitment to the inflamed tissue. Although the
signalling events induced by IL-17A/F are not fully understood, several
key signaling molecules have been successfully identified. The IL-17A
activity is similar to IL-17F but significantly stronger. IL-17 cytokine can
stimulate fibroblasts, epithelial and endothelial cells, to produce IL-6, IL-
8 and prostaglandin E2 (PGE2) 57,60,61.

It is well established that IL-17 activity contributes to various aspects of

inflammation. The IL-17-mediated release of IL-6 and IL-8 from
mesenchymal cells leads to fever (caused by IL-6) and the accumulation
of neutrophils in blood and tissue (caused by IL-8). Also, it stimulates the
expression of RANKL in osteoblasts to activates the osteoclasts, which
can induce bone resorption mediated by these cells 59,62,63.

82
1.5.1 Interleukin 17 A gene:

It spans a region of 4252 bp, consisting of three exons, untranslated region

UTR, coding region and two introns. Exons 1, 2, and 3 are 72 bp, 203bp
and 1584 bp respectively, the two introns are 1144 bp and 1249 bp in
length as shown in figure (1.10) 64.

Figure 1.10 Interleukin 17A gene 64.

1.5.2 Interleukin 17 F gene:

It spans a region of 7.86 kb composed of three exons, untranslated region

UTR, coding region and two introns. Exons 1, 2, and 3 are 141 bp, 221,488
bp (238 bp coding region plus 250 bp 3' UTR) in length, the two introns
are 5446 bp and 1561 bp in length as shown in figure (1.11) 58.

Figure 1.11 Interleukin 17F gene 58.

83
1.6 Single nucleotide polymorphisms in chronic periodontitis:

It is a variation at a single position in a DNA sequence, a single

nucleotide that is replaced with any of the other three kinds of nucleotides
(Adenine, Guanine, Cytosine, Thymine) that occurs at a specific position
in the genome, where each variation is present to some significant degree
65
within a population with a frequency above 1% .

SNP within candidate genes may be related to changes in protein

expression, structure and function which may lead to variations in
phenotypic expression. It can also increase susceptibility to a wide range
of human diseases 65–67.

Hence SNPs are very important genetic markers for investigating inter-
individual differences in drug response and common diseases, they have
been also found to have a significant effect on the production and/or
functioning of cytokines 66.

CP inflammatory disease, caused by Gram-negative bacteria in the

periodontal pockets. Many reviews have been published in recent years
supporting the evidence that genetic influence an individual’s
predisposition for the initiation and progression of CP. Early identification

84
of risk factors for the development of periodontitis may also form the basis
for more focused and cost- effective preventive approaches 68,69.

IL-17A and IL-17F Gene Polymorphisms in chronic

periodontitis:

Allelic variations in cytokine genes and factors affecting their release

have caused phenotypic differences in cytokine response among
individuals and this is important for the individual’s susceptibility to
disease, the progression of disease or response to treatment, the
determination of allelic variants of genes may be used to assess the risk of
disease 70.

Many researches have demonstrated the presence of IL-17 in

periodontal tissues, crevicular gingival fluid (CGF), saliva, and plasma of
patients with periodontal disease 71,72.

Recent findings suggest that genetic factors, such as Interleukin IL- 17

gene polymorphisms, are important in the pathogenic process of CP,
genetic variation affecting the expression or activity and may influence the
susceptibility and severity of periodontitis 53,56,73,74.

85
1.7 Problem Statement:

CP is a multifactorial disease characterized by loss of the tissues

supporting the teeth ‘the periodontium’ leading to progressive destruction
in periodontal ligament, pocket formation and alveolar bone loss, it is the
most important cause of tooth loss among adults, it is the most prevalent
type of periodontitis triggered by periodontal pathogens and influenced by
genetic and environmental factors 3,75.

IL 17 gene polymorphisms may create phenotypic differences and allelic

variants in the interleukin response which is important for an individual’s
susceptibility to chronic periodontitis, progression of the disease or
response to treatment 69,76.

The present study is focused on the genetic variants of IL-17A and IL-
17F and investigating the effect of these variants on the susceptibility to
CP. In Libya, only clinical diagnosis was established for CP in dental
clinics, in the present study the aims are to investigate a possible
association between eight subgingival pathogens and the susceptibility to
CP, also to compare the prevalence of eight subgingival pathogens
between CP group and HC group in Libyan population to develop a
microbial diagnosis for periodontal diseases and support clinical diagnosis.

86
 LITERATURE
REVIEW& AIMS OF THE
STUDY

87
2.1 Literature review:

Regarding the pathogenesis, many clinical studies have been conducted

worldwide providing evidence of associations between bacterial species
and CP. Also regarding the prevalence and distribution of eight
subgingival pathogens between CP and HC groups in subgingival plaque,
comparing data from different populations and geographic regions, it has
become apparent that there are substantial differences in the composition
and proportion of the subgingival microbiota as shown in tables (2.1), (2.2).

88
 40,77–83
Table 2.1 Comparison between different populations in subgingival pathogens profile in patient with CP

Population Brazilian Iranian Swiss Spanish Chinese Indian Japanese Turkish

Year 2008 2010 2010 2012 2012 2012 2013 2013

Vito A Fraga et Norbert Cionca Puig silla et Mahalakshmi

Author Chalabi et al. Huang et al Tomita et al Ertugrul et al
al. et al. al. Krishnan et al

Sample 30 80 51 86 84 300 50 26
size CP=30 CP = 40 CP = 51 CP = 33 CP=60 CP=128 CP=20 CP=13
Age 17-55 ≥ 40 25-70 25 -50 21–52 years 20-60 years. >39 years >35 years

subgingival subgingival subgingival subgingival subgingival subgingival subgingival subgingival

Type of plaque taken by a plaque plaque taken by plaque taken plaque taken by plaque taken plaque taken plaque taken
sample sterile paper taken by a sterile a sterile paper by a sterile a sterile paper a sterile by sterile by a sterile
points Gracey curette points paper points points cotton pellet paper points cotton pellet

Method PCR Multiplex PCR RT -PCR PCR RT -PCR PCR RT -PCR PCR
Pg (73%) Pg (81%) Pg (73%) Pg (67%) Pg (95%) Pg (81%) Pg (75%) Pg (50%)

Tf (33%) Td(89%) Tf (33%) Td (49%) Pi (98%) Td(89%) Tf (85%) Tf (73%)

Aa (23%) Tf (96%) Pi (87%) Tf (70%) Aa (20%) Tf (96%) Aa (25%) Td (58%)
Pi (87%) Aa (19%) Aa (23%) Aa (33%) Aa (19%) Aa (8%)
Result Pi (72%) Pi (16%) Pi (46%)
Ec(16%)
p-value = 0.005 p-value = 0.001 p-value =0.001 p-value =0.05 p-value =0.05 Cr(17%)
Pn(13%) p-value = p-value =
p-value 0.05 0.05
=0.01

89
 To be continued Table 2.1 Comparison between different populations in subgingival pathogens profile in patient with CP 84–89.

Population Yemenis Italian Moroccan Iranian Congolese

Year 2014 2014 2015 2018 2018

Hanane Chahboun1 Atarbashi-moghadam et
Author Al-hebshi et al Gatto et al. Em Kalala-Kazadi et al
et al al
20 352 120 23 12
Sample size
CP=20 CP=352 CP= 20 CP=23 CP=12

Age 30–50 years >35 years >50 years 14-72 years

≤ 35 years
subgingival plaque subgingival plaque subgingival plaque subgingival plaque subgingival plaque
Type of sample taken by sterile taken by sterile taken by sterile taken by a sterile Gracey taken by sterile paper
paper points paper points paper points curette points
Method RT -PCR RT –PCR Culture PCR PCR

Pg (98%) Pg (78%) Pg (60%) Pg (43%) Pg (92%)

Aa (68%) Td (82%) Tf (45%) Aa (43%) Tf (92%)
Tf ( 100%) Tf (87%) Aa (25%) Cr (78 %) Td(100%)
Result (prevalence) Td ( 100%) Aa (19%) Pi (90%) Pi(75%)
Pi (66%) Ec(15%) p-value = 0.001 p-value = 0.001
Cr(15%)
Pn(90%)
p-value = 0.0063 p-value = 0.0001
p-value = 0.016

90
 100%

90%

80%
prevalence of individual pathogens

70%

60%

50%

40%

30%

20%

10%

0%

T.d P.g T.f A.a E.c P.i C.r P.n

Figure 2.1 Prevalence of the eight subgingival pathogens in different populations.

91
 Table 2.2 Comparison between CP and HC groups in subgingival pathogens profile of different populations 40,77,80,81,83.

Population Brazilian Iranian Chinese Indian Japanese Turkish

Year 2008 2010 2012 2012 2013 2013

Subgingival pathogens CP HC CP HC CP HC CP HC CP HC CP HC

T.d / / / / / / 71% 6% / / 77% 23%

P.g 73% 47% 95% 65% 95% 42% 81% 11% 75% 0% 77% 23%

T.f 33% 0% 75% 5% / / 73% 11% 85% 0% 92% 69%

A.a 23% 3% 13% 8% 20% 13% 32% 3% 25% 0% 15% 0%

E.c / / / / / / 16% 6% / / / /

P.i 87% 43% / / 98% 63% 16% 8% / / 77% 15%

C.r / / / / / / 17% 9% / / / /
P.n / / / / / / 13% 14% / / / /

( /) No relevant information.

92
 100%
90%
80%
prevalence of individual pathogens.

70%
60%
50%
40%
30%
20%
10%
0%
HC CP HC CP HC CP HC CP HC CP
Japanese Indian Chinese Iranian Brazilian

T.d P.g T.f A.a E.c P.i C.r P.n

Figure 2.2 Comparison between CP and HC groups in subgingival pathogens profile of different population.

93
 Several experimental and clinical studies have investigated gene
polymorphisms of the cytokines in CP and shown that IL-17 levels are
elevated in diseased human periodontal tissues and may play a destructive
effect on experimental models of periodontal disease. Data from different
studies all over the world investigating the association between IL-17 A
and IL-17 F Gene polymorphism and CP, for example, studies were
conducted in Brazil, India, Turkey and Iran were compared and reviewed
in this thesis 56,68,70,76,90–92.

In Brazil there were four studies conducted on IL- 17 A and IL- 17 F

gene polymorphism and degree of association with CP, the first study
conducted in 2012 to investigate the association between IL- 17 A and IL-
17 F Gene polymorphism and CP in Brazilian population, viewed results
that showed higher frequency of AG and AA alleles among the IL-17 A
(rs2275913 / G197A) genotypes of patients with CP comparing with HC
group, in particular, by a substitution of the G by an A nucleotide base in
the IL- 17 A gene promoter, is significantly associated with CP 76.

The presence of the allele A in IL- 17 A polymorphism was associated

with worse clinical and inflammatory periodontal parameters and
increased neutrophil activity (MPO activity and IL-8 levels) when
compared with the GG the genotype in CP group. In contrast, the IL- 17
F (rs763780 / T7488C) due to His-to-Arg substitution at amino acid 161

94
(H161R) in the exon 3 region, the genotypes did not affect the clinical
features of CP patients. SNPs are listed in table (2.3) 76 .

Table 2.3 IL-17(A، F) reference SNP.

Reference SNP
IL-17A rs2275913 G197A
IL-17F rs763780 T7488C /
His161Arg

The second study was conducted in 2013 and showed that the allelic
distribution of the IL-17A a higher frequency of GG genotype was founded
in CP group comparing to AA and AG genotype. No evidence showed for
associations between IL-17 F and patients with CP. SNPs are shown in
table (2.3) 93.

The third study was conducted in 2015 and showed that IL-17A
Polymorphism, IL- 17 A, AA genotype and A allele could be associated
with susceptibility to CP. No evidence was shown for associations
between IL- 17 F and CP. SNPs are shown in table (2.3) 56.

The fourth study was conducted in 2016 and showed that IL-17 A
Polymorphism had a higher frequency of GG genotype was founded in CP
group. SNPs are listed in table (2.3) 94.

95
Another study that was conducted in Turkey in 2015, showed that T and C
alleles IL-17F genotypes frequencies of the CP group were not
significantly different from the HC group, IL-17F gene polymorphisms
were not associated with CP in Turkish population. SNP are shown in table
(2.3) 70.

In India two studies were conducted among Indian population, the first
one’s in 2013 results showed that IL- 17 F gene (rs763780) polymorphisms
was not associated with CP in Indian population, SNPs are listed in table
(2.3) 90.

The second Indian study in 2016, showed that IL-17A gene

polymorphism, A allele are at 5 times greater risk of developing chronic
periodontitis than healthy controls, IL-17A was significantly associated
with CP in Indian population, type of SNP are shown in table (2.3) 91.

In Iran, one study conducted in 2013, showed that IL-17A gene

polymorphism (rs10484879) is significantly associated with CP and peri-
implantitis; destructive inflammatory process affecting the soft and hard
tissues surrounding dental implants in Iranian population 95.

96
 Table 2.4 Comparison between eight conducted studies to investigate the association between Interleukin-17A and

Interleukin -17F Gene polymorphism and CP in in different population around the world 56,70,76,90–93,95,96.

Population Brazilian Indian Turkish Iranian

Year 2012 2013 2015 2016 2013 2016 2015 2013
Machado et Zacarias et Linhartova et Liladhar et
Author Corrêa et al. Jain et al, Erdemir et al. Kadkhodazadeh et al.
al. al. al. al.
60 202 313 523 225 105 237 197
Sample size CP=30 CP=85 CP=140 CP=244 CP=63 CP=35 CP=90 CP= 75
HC=30 HC=72 HC=173 HC=154 HC=101 HC=35 HC=35 HC=84
Age >35 years 14–62 years >30 years / 20-60 years 20-56 years >30 years >30 years
Gingival
Type of sample Blood Blood Blood Blood Blood Blood Blood
tissue
IL- 17 A Yes Yes Yes Yes Yes Yes / Yes

IL- 17 A rs2275913 rs2275913 rs2275913 rs2275913 / rs2275913 / rs10484879

IL- 17 F Yes Yes Yes Yes Yes / Yes /

rs763780
IL- 17 F SNPs rs763780 rs763780 rs763780 / / /
rs2397084 rs763780
PCR and Competitive Allele
Method PCR-RFLP [Link] PCR-RFLP [Link] restriction PCR-RFLP [Link] Specific PCR(KASP)
enzyme technique
Result of IL- 17
+ + + + / + / +
A
Result of IL-
_ _ _ / _ / _ /
17 F

(+) Positive association.

(+) Negative association.
( /) No relevant information.
97
2.2 Aims of this study:

1) Investigation of the association between eight subgingival

pathogen (P.g, T.d, T.f, A.a, P.i, P.n, E.c, C.r) and CP, also
compare the prevalence of these subgingival pathogens between
CP group and HC group in Libyan population.

2) Investigation of the association between IL- 17 A (rs2275913) and

IL- 17 F (rs763780) gene polymorphisms and the susceptibility to
CP in Libyan population.

98
 MATERIALS &
METHODS

99
 Study population:

The study was conducted in the laboratories of Genetic Engineering

Department at the Biotechnology Research Centre in Tripoli. Medical
records, oral examination and sample collection were conducted in dental
clinics of Periodontology Department of Faculty of Dentistry, Tripoli
University, Tripoli Dental Centre, Alhuria Poly Clinic Center and some
private dental clinics from August 2018 to August 2019. The Bioethics
committee of Biotechnology Research Centre (No. BEC.BTRC05-2018)
Case-control study consisted of 100 individuals who were randomly
selected from adult Libyan volunteers who live in different geographical
places in Libya, divided into three geographic regions (West, East and
South).

Fifty periodontally healthy individuals and 50 patients with chronic

periodontitis, the age of the study population ranged between 25-65 years
were included in the study. The clinical examination was performed for
each participant by inspecting the soft tissues around the teeth with a probe
by using University of Michigan ‘0’ probe with William’s markings at 1,
2, 3, 5, 7, 8, 9, and 10 mm increments (no mark at 4 & 6 mm), radiographic
examination was performed by evaluating the patient's periapical X-ray
films; to determine the amount of bone loss around the teeth.

100
 The diagnosis for the periodontal status was established for all subjects
based on Periodontal Disease Index (PDI), developed by Ramfjord (1967),
which is a system designed to assess destructive periodontal disease; the
scores, ranging from 0 to 6, denote periodontal health or gingivitis (scores
0–3) and various levels of attachment loss denote periodontitis (scores 4–
6). Also known as (Ramfjord Index). For the PDI assessment, six teeth
were evaluated: the upper left central, first premolar and right first molar;
and the lower right central, first premolar, and left first molar were
measured 4,97.

Probing depth (PD) and clinical attachment level (CAL) were examined
at six sites (mesiovestibular, vestibular, distovestibular, mesiolingual,
lingual and distolingual) of each tooth as shown in figure (3.1) CAL was
measured with the distance from depth of periodontal pocket to the
cemento enamel junction (CEJ). The measurement PD was determined by
measuring distance from a gingival margin to the base of the periodontal
pocket with a calibrated periodontal probe 98.

Bleeding on probing (BOP) widely used criterion to diagnose gingival

inflammation, it is an indicator of tissue inflammatory response to
bacterial pathogens, is a limited but yet useful prognostic indicator in
clinical diagnosis for patients in CP 99.

101
 Figure 3.1 periodontal examination.

After the periodontal examination, participants were divided into two

different groups: chronic periodontitis group (n= 50) composed of
individuals who had at least 3 sites in different teeth with PD > 3mm, CAL
> 3mm, and more than 30% of BOP and Healthy control group (n =50),
formed by individuals who have CAL and PD less than 3 mm, less than
30% of BOP, with at least 18 teeth in the oral cavity except third molar 98–
100
.

Inclusion criteria for this study were:

1. Patients diagnosed with chronic periodontitis.

2. Patients should have at least 18 teeth .
3. Patients without systemic compromise (i.e., immunologic and
autoimmune disorders, diabetes mellitus, rheumatoid arthritis,
inflammatory bowel diseases and psoriasis).

102
 4. Patients who had not received any periodontal treatment during
last 6 months, with attachment loss > 3mm at more than one
tooth, at least 3 sites of probing depth > 3mm, more than 30% of
BOP and lesions distributed at least two teeth in each quadrant.
5. Non-smoker patient in both groups.

Exclusion criteria for this study were followed:

1. Patients with aggressive periodontitis.

2. Patients who used (antibiotic – anti-inflammatory and/or
anti-immunosuppressive) medications in 3 months preceding
the research.
3. Systemic diseases (i.e. immunologic and autoimmune disorders,
diabetes mellitus, rheumatoid arthritis, inflammatory bowel
diseases, psoriasis), pregnancy and breast feeding.
4. Smoker patient in both groups.

All volunteers informed and signed written consent before participating.

They filled a self-reported questionnaire containing age, ethnic
background, place of residence, smoking status, immunologic and
autoimmune disorders, rheumatoid arthritis, inflammatory bowel diseases,
psoriasis, diabetes mellitus, hypertension, cancer, cardiac disease,
pregnancy and breast feeding status. Ethical approval was obtained from
the Bioethics Committee at biotechnology research Centre.

103
 All selected patients and controls were informed about the aims of the
study and that DNA samples would be analysed for variations in genes
associated with CP, and subgingival samples analysed to identify the most
subgingival pathogenic organism associated with CP group and the
distribution of subgingival pathogen in HC group.

3.2 Subgingival samples:

The sub-gingival samples were taken from the deepest periodontal

pocket from a group of individuals with CP and from normal sulcus depth
in matched periodontal HC. Sub-gingival samples were collected for
pathogens identification, samples were collected by gently inserting sterile
paper points size 30 (META BIOMED, manufactured in China),
sterilization was done by autoclave (121 oC, 15 psi, 15 min), after the
supra-gingival plaque was removed before the sample was taken by using
a sterile Gracey curette and sterile cotton rolls, paper point was inserted
into the bottom of the pocket and removed after 10 seconds then placed in
a sterile 1.5 ml micro-centrifuge tube (Eppendorf) filled with phosphate
buffer saline (PBS) transported in ice and stored at -20 oC till they were
assayed. Paper point sample as shown in figure (3.2).

104
 Figure 3.2 Method of paper points sample collection and site of insertions in maxilla

& mandible in CP patient.

3.3 Sample preparation for PCR:

Bacterial genomic DNA was extracted from paper points size 30 (sterile
absorbent paper points, META BIOMED) using a modified protocol
(Ashimoto et al, 1996) as follows:

1. The paper point samples were placed in a 1.5ml centrifuge tube

(Eppendorf) that contains PBS and heated to 37°C in a heat block for 10
min and mixed well on a vortex mixer.

105
2. 0.3 ml of the microbial suspension was washed 3 times with distilled
water and spun down between each wash was at 14,000 rpm for 3 minutes.

3. The bacterial pellets were re-suspended in 100 µ nuclease -free water

then boiled in a heat block for 10 min and placed on ice for further
analysis by PCR.

3.4 Polymerase Chain Reaction (PCR):

Bacterial DNA was detected by using PCR to obtain multiple copies of
the target bacterial gene segments. Primers were designed according to a
publication by Ashimoto et al, in 1996 and ordered from Metabion
101
(Germany) . The specificity of primers sets was assessed by blasting
their sequences against reference oral bacterial 16S rRNA gene sequences
in Human Oral Microbiome Database (HOMD) are listed in table (3.1).

106
Table 3.1 Primer pairs used for subgingival bacterial detection checked with Human Microbial Taxon ID (HMT) for

specificity.

Base Amplicon HMT

Subgingival pathogen primers Sequence
position size ID
[Link] F 5' AAACCCATCTCTGAGTTCTTCTTC 3' 557
478-1,034 531
[Link] R 5' ATGCCAACTTGACGTTAAAT 3'
T. Forsythia F 5' GCGTATGTAACCTGCCCGCA 3'
120-760 641 613
T. Forsythia R 5' TGCTTCAGTGTCAGTTATACCT3'
C. rectus F 5' TTTCGGAGCGTAAACTCCTTTTC 3'
415-1,012 598 748
C. rectus R 5' TTTCTGCAAGCAGACACTCTT 3'
E. corrodens F 5' CTAATACCGCATACGTCCTAAG 3'
169-856 688 577
E. corrodens R 5' CTACTAAGCAATCAAGTTGCCC 3'
P. gingivalis F 5' AGGCAGCTTGCCATACTGCG 3'
729-1,132 404 619
P. gingivalis R 5' ACTGTTAGCAACTACCGATGT 3'
P. intermedia F 5' TTTGTTGGGGAGTAAAGCGGG 3'
458-1,032 575 643
P. intermedia R 5' TCAACATCTCTGTATCCTGCGT 3'
P. nigrescens F 5' ATGAAACAA AGG TTTTCCGGTAAG 3'
219-1,022 804 693
P. nigrescens R
5' CCCACGTCTCTG TGGGCTGCGA 3'
T. denticola F
5'TAATAC CGAATG TGCTCATTT ACA T 3'
193-508 316 584
T. denticola R
5' TCAAAG AAGCATTCC CTCTTC TTC TTA 3'
107
 Using 16S rRNA-based polymerase chain reaction which would
probably offers a highly sensitive and specific detection method for
bacteria in biological samples; 16S rRNA genes are present in every
bacterium and are conserved within a species, the genes contain signature
sequences distinguishable among different bacterial species, and it is
particularly valuable for detection of oral microorganisms that cannot be
cultivated. The optimal PCR conditions were determined, agarose gel
electrophoresis of PCR products revealed a single band at the predicted
size, to achieve the best multiplexing results primers were tested
individually prior to multiplexing procedure by using conventional PCR,
thermal cycling conditions, and primer sequences, reaction mix and
template DNA are shown in table (3.1), (3.2), (3.3) and (3.4). For
Multiplex PCR Components, reaction mix and template DNA, see table
(3.5) and (3.6). Negative control was obtained by using sterile paper point
size 30 not used in patient oral cavity, then put in microcentrifuge tube
(Eppendorf), that contains PBS and was processed in PCR procedures.

Multiplex PCR products were analyzed using agarose gel electrophoresis

and ethidium bromide staining.

108
3.5 Conventional PCR procedure for individual pathogens:

The eight subgingival pathogens were detected by polymerase chain

reaction using specific primers and protocol described by Ashimoto et al,
1996, primers which were used are listed in table (3.1).

A mastermix sufficient for all reactions was prepared, the standard reaction
mix contained: 1X (3 μl MgCl2) GoTaq™ Reaction Buffer 10μl of 5X
Buffer, 1μl of dNTPs, with 1.5μl each of forward and reverse primers, 0.25
μl of GoTaq™ DNA polymerase and finally the volume of water depends
on the number of samples (To 50 μl) as shown in table (3.2).

Table 3.2 Summary of PCR reaction components for individual subgingival pathogen

detection.

Reagent Final concentration Volume

MgCl2 (25mMol stock) 1.5 μM 3 μl
5X buffer 1 μM 10X
dNTPs (10 μM each) 0.2 μM 1 μl
Forward primer 0.3 μM 1.5μl
Reverse primer 0.3 μM 1.5μl
Taq DNA polymerase
1.25 μM 0.25 μl
5 U/ μl
DNA template 5μl
Nuclease- free water Up to 50μl

109
1. The reaction mix was placed in PCR tubes that were placed in cooled
(ice) rack, then 5 µl DNA templates ware added.
2. The PCR tubes containing the mix and DNA samples were placed in the
thermocycler machine (GeneAmp® PCR System 9700, Applied
Biosystems, Germany).
The PCR cycling conditions consists of about 36 cycles. Each cycle
consists of three precisely time controlled and temperature controlled steps:
denaturation, annealing and extension. As shown in tables (3.3) and (3.4).

Table 3.3 Summary of polymerase chain reaction cycle settings for [Link] ,
[Link], [Link] , [Link] , [Link].

Step Time Temperature

Initial denaturation 2 min 95°C
Denaturation 30 sec 95°C
Annealing 1 min 60°C
Extension 1 min 72°C
Final Extension 2 min 72°C
Soak Indefinite 4°C

Table 3.4 Summaryof polymerase chain reaction cycle settings for A.

actinomycetemcomitans, P. intermedia,and P. nigrescens.

Step Time Temperature

Initial denaturation 2 min 95°C
Denaturation 30 sec 94°C
Annealing 1 min 55°C
Extension 2 min 72°C
Final Extension 10 min 72°C
Soak Indefinite 4°C

110
3.6 Post PCR agarose gel electrophoresis for conventional
PCR:
Agarose gel electrophoresis allows separation and identification of
nucleic acids based on charge migration in an electric field which is
governed by the size and conformation of the nucleic acid. Nucleic acids
of different sizes are thus separated.

Gel preparation:

1. A 150 ml 1X TBE buffer (90 ml distilled water and 10 ml 10X TBE

Buffer for each 100 ml of buffer) was added to 3 g of agarose powder
(2%) in a volumetric flask.

2. The solution was heated using a microwave oven to dissolve the powder
thoroughly.

3. When the solution had cooled ~55-60° C, 3μl of ethidium bromide (EtBr)
(0.5µg/ml) was added to the solution and mixed well.

4. The solution was poured slowly into the gel casting equipment and the
comb was inserted to the tray and any bubbles in the solution were
removed.

5. The solution was left to set for about 40 min and the comb was carefully
removed.

6. 1x TBE running buffer was added to the gel tank.

111
 7. The gel was placed with the wells facing the electrode that provided the
negative current (cathode).

Loading and running the gel

1. 2μl of Blue/Orange 6X loading dye was placed in each of micro-

centrifuge tube, and 5μl of PCR product was added and mixed a few
times with a pipette tip, and then injected into the wells.

2. The cover on the gel rig was placed, the current was applied. The gel was
run at 90 volts and 120 mA for 30 minutes.

3. Higher agarose concentration was used to resolve smaller bands from

each other, and a lower percentage gel to separate larger bands.

The gel was then visualized in UV trans-illuminator (VILBER

LOURMAT UV transilluminator) to examine the presence of PCR
fragments at the expected length by a comparison with a 100 bp DNA
ladder (Metabion, Germany).

3.7 Multiplex PCR procedure:

Qiagen multiplex PCR kit was used for multiplexing. First 10X Primer
mix 2 µM each was prepared: For 100 µl primer mix 2 µl of each primer
(from 100 uM stock solution) was added. When using 3 primer mix 88µl
the remaining water was added to 12 µl total primers.

112
Procedure:

1. 2x QIAGEN Multiplex PCR Master Mix was prepared, and template

DNA, PCR grade water, and primer mix were then added to individual
PCR tubes. The solutions were mixed completely before thermocycling
use.

2. Prepared reaction components are shown in Table (3.5).

3. The reaction was mixed thoroughly and dispensed appropriate volumes

into PCR tubes.

4. DNA template was added (5 μl reaction) to the individual PCR tubes

that contained the reaction mix.

Table 3.5 Multiplex PCR Components.

Component Volume/reaction Final concentration

Reaction mix 2x 25 μl 1x
QIAGEN Multiplex
PCR Master Mix
10x primer mix, 5 μl 0.2 μM
2 μM each primer
RNase-free water 15 μl

Template DNA 5 μl ≤1 μg DNA/50 μl

Total volume 50 μl

113
5. Thermal cycler was program according to the manufacturer’s
instructions as shown in Table (3.6)

6. PCR tubes were placed in the thermal cycler and cycling program

was run.

Table 3.6 Thermal cycler program.

Step Duration Temperature

Initial step 15 min 95° C

Denaturation 30 s 95° C

38 cycles
Annealing 90 s 57 ° C

Extension 90 s 72° C

Final extension 10 min 72° C

114
3.8 Post PCR agarose gel electrophoresis for Multiplex PCR:

All information and steps regarding gel preparation, loading and running
gel, was previously mentioned in the section (3.6).

3.9 Sample collection:

IL- 17 A and IL- 17 F gene polymorphism sample:

Samples were collected by gently rubbing the inside of the mouth using
a non-invasive, cotton-tipped buccal swab. The volunteers were asked to
rinse their mouth with tap water 30 seconds before sampling of buccal
swabs, to avoid the contamination as a result of food particles. For each
individual, both sides of buccal mucosa were wiped with a cotton swab,
for 10 seconds epithelial cells were adhered to the swab. Once collected,
each swab was marked with the identification number as shown in Figure
(3.3).

115
 Figure 3.3 Buccal swab sample from a patient in dental clinic.

3.10 DNA Extraction:

Isohelix Buccal DNA Isolation Kit was used, for extraction of human
genomic DNA, which contains:

Solution LS 25 ml, solution PK 1ml, solution CT 25 ml, and solution TE

15 ml, as shown in table (3.7).

Table 3.7 Contents of Isohelix Buccal DNA Isolation Kit.

Reagent Volume Storage temperature

Solution LS 25 ml Room temperature
Solution PK 1 μl -20 0C
Solution CT 25 ml Room temperature
Solution TE 15 ml Room temperature

116
3.11 DNA Isolation Protocol:

1. DNA stabilization was obtained by adding 500 μl LS solution to the tube

containing the buccal swab.

2. 20μl PK solution was added to tube containing the buccal swab and LS
solution then Vortex briefly.

3. The tube that contained the swab, LS solution and PK solution was
placed in a Thermomixer on 60°C for 1 hour then Vortex briefly.

4. Then the liquid (approx. 500μl) was transferred into a 1.5 ml centrifuge
tube.

5. The swab head was moved into a sterile 1.5ml centrifuge tube
(Eppendorf) so that the swab head is uppermost after that the tube was
spun briefly using a sterile pipette tip. Then the recovered supernatant
was added to the 500μl collected previously, to increase yield.

6. 600μl CT solution was added to the tube then Vortex briefly.

7. The tube was placed in a micro centrifuge and spun at maximum speed
(13,000 rpm) for 7 minutes to pellet the DNA.

8. All the supernatant was removed carefully with a pipette tip so as to not
disturb the DNA pellet.

9. Then 1.5ml centrifuge tube (Eppendorf) was re-spun briefly and any
remaining liquid was removed.

10. 150μl TE solution was added to the tube.

117
11. The solution was left for at least 5 minutes at room temperature for the
DNA to re-hydrate, after that Vortex briefly.

12. Finally re-spun was done for 15 min at (13,000 rpm) undissolved debris
was removed the supernatant and transferred to a sterile 1.5ml tube.

3.11.1 Measurement of genomic DNA concentration:

The concentration and purity of extracted DNA was measured by the

Nano Drop Lite spectrophotometer (Thermo Fisher Scientific). It provides
concentration information by using the A260 measurement and sample
purity information by using the A260/A280 ratio.

Measurement procedure:

1. The appropriate application from the Home screen (DNA or RNA) was
selected for DNA measurements, dsDNA.
2. The on-screen instructions were followed and a blank was established
by pipetting 1 μl of the blanking buffer (TE buffer) on to the bottom
pedestal, lower arm then Blank button was pressed.
3. After blank measurement was completed, the arm was raised and the
buffer was wiped from both the upper and lower pedestals by using a
dry laboratory wipe.

118
4. Blank was confirmed by pipetting a fresh aliquot of blanking buffer (TE
buffer) onto the bottom pedestal, lower the arm then Blank was
pressed.

5. When the measurement was completed, the upper arm was raised then
the buffer was wiped from both the upper and lower pedestals using a
dry laboratory wipe.
6. The sample was measured by pipetting 1 μl of sample onto the bottom
pedestal, lower arm and then Measure button was pressed.
7. Upper and lower pedestals ware wiped by using a dry laboratory wipe
and the instrument was prepared to measure the next sample.

119
3.11.2 Agarose gel electrophoresis of extracted DNA:

To determine that the DNA samples extracted from the previous procedure
are suitable for PCR reaction, they were analysed by agarose gel
electrophoresis.

The gel preparation:

1. A 100ml 1X TBE buffer (90 ml distilled water and 10 ml 10X TBE

Buffer) was added to 0.85g (0.85%) of agarose powder in a volumetric
flask.
2. The solution was heated using a microwave oven to dissolve the
powder thoroughly.
3. When the solution cooled, 3μl ethidium bromide (EtBr) was added to
the solution and mixed well.
4. The solution was poured slowly to the tray and the comb was inserted
to the tray; any bubbles in the solution were removed.
5. After the solution was cooled and solidified, the comb was removed
carefully.
6. 1x TBE running buffer was added to the tray.
7. The gel was placed with the wells facing the electrode that provide the
negative current (cathode).

120
Loading and running the gel:

1. 2μl of Blue/Orange 6X loading dye was placed in each of the

centrifuge tube and 5μl of DNA solution was added. DNA sample
and the loading dye in each tube were mixed well for a few seconds
with a pipette tip, they were then injected in the wells left by the comb.

2. The cover on the gel rig was placed, the current was applied, and the
gel was run at 120 volts and 200 mA for 30 minutes.

3. Then the gel was removed from the gel electrophoresis machine then
put in to the ultraviolet trans-illuminator machine for visualization of
genomic DNA bands.

121
 3.12 Polymerase Chain Reaction (PCR):

The IL- 17 A and IL- 17 F genes polymorphisms was performed by the

separated polymerase chain reaction using specific primers described by
Zacarias et al in 2015, the specificity of primers was checked by BLAS,
the primers which were used are listed in table (3.8) 56.

IL-17A gene polymorphism at the promoter region (197G/A) with

amplicon size 102 bp, IL-17F gene polymorphism in the third exon due to
His-to-Arg substitution at amino acid 161 (H161R) with amplicon size 134
bp.

Table 3.8 Main characteristics IL- 17 A and IL- 17 F gene polymorphisms and primers’

sequences.

SNP ID Interleukin Primers sequences Amplicon size

IL- 17A F AACAAGTAAGAATGAAAAGAGGACATGGT
rs2275913 CCCCCAATGAGGTCATAGAAGAATC 102 bp
IL -17A R
ACCAAGGCTGCTCTGTTTCTACCAAGGCTGC
IL- 17F F
rs763780 TCTGTTTCT 143 bp
IL -17F R GGTAAGGAGTGGCATTTCTA

122
 A premix sufficient for all reactions was prepared. The standard final
reaction mix contained 1X GoTaq™ Reaction Buffer 10μl of 5X Buffer
(with 1.5 mM MgCl2), 1μl of dNTPs (0.2mM each dNTP), with 1.5μl each
of forward and reverse primers (0.3µM), 1.25u of GoTaq™ DNA
Polymerase and finally water to 50 μl as shown in table (3.9).

3. The reaction mixes were placed in PCR tubes placed in cooled (ice) rack,
then 2 µl DNA templates was added.
4. The PCR tubes containing the mix and DNA samples were placed in the
thermocycler machine (Eppendorf, GeneAmp*PCR System 9700,
Germany).

Table 3.9 Summary of PCR reagents used and their quantity for each sample.

Reagent Final concentration Volume

MgCl2 1.5 μM 3μl

5X buffer 1 μM 10X
dNTPs 10Mm each 0.2 μM 1μl
Forward primer 0.3 μM 1.5μl
Reverse primer 0.3 μM 1.5μl
Taq DNA polymerase
0.5 μM 1μl
5 U/ μl
DNA template 2 µl
H₂O Up to 50μl

123
The PCR process consists of 35 subsequent cycles. Each cycle consists of
three precisely time-controlled and temperature-controlled steps:
denaturation, annealing and extension. As shown in table (3.10)

Table 3.10 Summary of polymerase chain reaction program.

Step Time Temperature

Initial 2 min 95°C

denaturation
Denaturation 35 sec 95°C

35 cycles
IL- 17 A
Annealing 35 sec
59°C
IL- 17 F 53°C
Extension 1 min 72°C
Final Extension 5 min 72°C
Soak Indefinite 4°C

124
3.13 Post-PCR Agarose Gel Electrophoresis

To ensure the successful run of the PCR program and to detect PCR
product in specific length, agarose gel electrophoresis was applied. All
information and steps regarding gel preparation, loading and running gel,
was previously mentioned in the section (3.6).

3.14 Purification of the PCR products:

To remove excess salts, PCR primers, and dNTPs, the PCR product was
purified by using PureLink® PCR Purification Kit (Invitrogen) according
to the manufacturer’s instructions.

Purification was done as the following protocol:

1. Before use, 48 ml Isopropanol 100% was added to 72 ml Binding

Buffer (B2) to precipitate the DNA more firmly to the matrix.
2. 4 volumes of PureLink® Binding Buffer (B2) with isopropanol was
added to 1 volume of the PCR product (50 μL) and mixed well, after
that the mixture was placed in a PureLink® column collection tube.

3. Tubes were placed in the centrifuge and spun at 10,000 rpm speed
for 1 minute.

125
4. Binding Buffer (B2) after the flow-through was discarded and spun
column was placed into the collection tube.
5. 320 mL Ethanol 100% was added to 80 ml Wash Buffer before used.
6. 650 μL of Wash Buffer was added to spun column.

7. The spun column was centrifuged at room temperature at 10,000

rpm for 1 minute then the flow was discarded through from the
collection tube and place the column into the tube.

8. After that, the spin column was centrifuged for the second time at
(12,000 rpm), at room temperature for 2 minutes to eliminate any
residual wash buffer then. The collection tube was discarded.

9. Spun column was placed in a clean 1.7-mL PureLink® Elution Tube

supplied with the kit.

10. 50 μL of Elution Buffer was added to the center of the column.

11. Then the column was incubated at room temperature for 1 minute,
after that the column was centrifuged at (12,000 rpm) for 2 minutes.

12. The elution tube contains the purified PCR product. The column was
removed and discarded. The recovered Elution volume was ~48 μL.

13. The purified PCR product was stored at –20°C, kept for the cycle
sequencing.

126
3.15 Post-Purification Agarose Gel Electrophoresis:

To ensure the successful run of the Purification proGram, agarose gel

electrophoresis was applied. The same steps used in the Agarose Gel
Electrophoresis after PCR were applied. The Purified products were
separated at 120 Volt and 200 milliamperage, for 30 min. Then visualized
under ultraviolet (UV) light and photographed with digital camera for
documentation to assess the presence of fragments of the expected length
by a comparison with the 100 bp molecular weight marker, DNA ladder
(Metabion ,Germany).

3.16 DNA Cycle Sequencing:

The purified PCR products were cycle sequenced to determine the exact
IL-17A (rs2275913) and IL-17F (rs763780) SNPs in DNA fragment, the
following protocol was applied by using BigDye® Terminator v3.1 Cycle
Sequencing kit (Applied Biosystems). The sequencing PCR reaction was
done at the Pasteur Institute in Tunis.

127
DNA Cycle Sequencing was done as the following protocol:

1. 1 μM of Reverse primer was prepared for the sequencing reaction mix.

2. After that, 1μl of BigDye Mix (BigDye® Terminator v3.1), 3.5μl
Buffer (5X), 1μl of Reverse primer and 12.5 µL nuclease-free water
added. Then they were placed in a 1.5ml centrifuge tube (Eppendorf)
in a total volume of 19μl for each reaction.
3. The reaction mixture was vortexed and spun briefly, then 19μl of each

reaction mix was placed in a 96-well reaction plate in a specific order,

1μl of the purified DNA samples were added. As shown in Table
(3.11).

Table 3.11 DNA Cycle Sequencing reaction components.

Reagent Concentration Volume

Big Dye Mix 0.125x 1 µL

Buffer 5x 3.5 µL

Template - 2 µL

Primer - 1µL

Nuclease-free water - 12.5 µL

Total volume 1x 20 µL

128
4. The reaction plate was covered with an adhesive film then placed in
the thermocycler machine. Table (3.12) shows the cycle sequencing
program used. The PCR process consisted of a series of 25 subsequent
cycles.

Table 3.12 Cycle sequencing program.

Step Time Temperature

Initial
1 min. 96°C
denaturation
Denaturation 10 sec. 96°C
Annealing 5 sec. 50°C

Extension 4 min. 60°C

Soak Indefinite 4°C

129
3.16.1 Extension Products Purification:

Extension products Purification was done using ethanol/EDTA

precipitation protocol as follows:

1. 125 mM EDTA solution was prepared from 0.5 M EDTA, at 8 pH.

2. 70% ethanol was prepared using absolute ethanol.

3. The sequencing plate was briefly centrifuged for (5 to 10 seconds) at

10,000 rpm in a swinging bucket.

4. The MicroAmp™ Clear Adhesive Film from the plate was removed.

5. The following was added in the following order as shown in table 3.13:

Table 3.13 Extension Products Purification with ethanol/EDTA precipitation.

Component Volume

sequencing reaction 10 μl

125 mM EDTA solution 2.5 μl

absolute ethanol 30 μl

Total volume 42.5 μl/ well

130
6. The plate with MicroAmp™ Clear Adhesive Film was sealed.

7. Then the plate was vortexed for 2 to 3 seconds, after that briefly
centrifuged (5 to 10 seconds) at 10,000 rpm.

8. The plate was incubated at room temperature for 15 minutes, time was
critical in this step.

9. The plate was centrifuged for 45 minutes at 10,000 rpm in a swinging

bucket.

10. The MicroAmp™ Clear Adhesive Film was slowly removed to prevent
disruption of the pellet. 4 layers of absorbent paper were placed into the
centrifuge and the plate was carefully inverted onto the paper without
dislodging the pellet. Then centrifuged at 185 × g for 1 minute.

11. After that 30 μL from 70 % ethanol was added to each well.

12. The plate with MicroAmp™ Clear Adhesive Film was sealed and
centrifuged at 10,000 rpm (4°C) for 15 minutes.

13. The MicroAmp™ Clear Adhesive Film was slowly removed to prevent
disruption of the pellet. 4 layers of absorbent paper were placed into the
centrifuge and carefully invert the plate onto the paper without dislodging
the pellet. Then centrifuge at 185 × g for 1 minute.

14. Finally, the plate was allowed to air dry, and it was protected from
light, for 5 to 10 minutes at room temperature.

131
3.16.2 Capillary Electrophoresis:

Sanger Sequencing Method was applied, the run was performed on

Applied Biosystem (3500 Genetic Analyzer) as the following procedure:

1. The computer, the instrument, and the Data Collection Software were
started.

2. The capillary length, number of capillaries, and polymer type were

selected.

3. The polymer delivery system was checked for sufficient polymer and
absence of bubbles.

4. The buffer and water/waste reservoirs were prepared.

5. The 96-well reaction plate was placed into the instrument. The run was
setup by using Data Collection Software. A plate record and results
group with file name and folder preferences were created. Instrument
protocol, including run module and dye set configurations was created,
analysis protocol was created.

6. Run parameters were determined, the plate was linked and run was
started.

132
3.16.3 Sequencing Data Analysis:

Analysis protocols using Sequencing Analysis Software pure and

mixed bases were identified, a quality value for each base was assigned,
failed sequence samples were detected, quality values (QV) for each base
were calculated, data analysis output were imported to the Sequencher
software version (5.4.6).

A new project window was created, where reference sequence with SNPs
detected, sequence fragments and assembled contigs were imported,
manipulated, and displayed. Reference sequence facilitates comparative
sequence alignments and defines base numbering. The contigs were
assembled automatically and aligned to reference sequence.
Chromatograms were viewed, SNPs in reference sequence were selected,
and accordingly each SNP in the samples was examined manually and
wrote down.

133
3.17 Statistical analysis:

Summary statistics of clinical parameters; (age, gender, PDI, BOP, CAL,

PD) for CP and HC groups assessed by SPSS version 25 statistical
software package (SPSS Inc., Chicago, Illinois, USA).

Chi-square test was used to determine the association between the 8 sub-
gingival pathogen; (P.g, T.d, T.f, A.a, P.i, P.n, E.c, C.r) and clinical
parameters (BOP, CAL, PD), a p-value of less than 0.05 was considered
to be statistically significant for all analyses.

A Mann–Whitney U test was used to identify the differences in clinical

periodontal parameters (BOP, CAL, PD) between CP and HC.

The odds ratio was calculated to assess the association between the
bacterial species. Twenty eight bacterial combinations were tested for the
chronic periodontitis group, it was also used to determine whether any sub-
gingival pathogens singly had coincident effects on chronic periodontitis
by using cross-tabulation and Chi-square test, p-value less than 0.05 was
considered to be statistically significant for all analyses.

Chi-squared test was used test to determine the association between IL-
17 A &IL- 17 F gene polymorphisms and CP, a p-value of less than 0.05
was considered to be statistically significant for all analyses.

134
 RESULTS

135
 Analysis of clinical parameters:

The clinical parameters; (Age, Gender, PDI, BOP, CAL, PD) of CP and
HC groups were comparable in mean and standard deviation. This
summarized in table (4.1).

Table 4.1 Analysis of clinical parameters by mean and standard deviation.

Clinical
CP ( Mean ± SD, n =50) HC ( Mean ± SD, n =50)
parameters

Age 42.98± 9.87 35.96±7.87

Gender, 28 : 22
22 : 28
male : female 56 %: 44%
44% : 56%

PDI 5.40±0.49 1.90±0.67

38.58±11.85 7.34± 12.15

BOP

8.46±1.47 1.90±0.67
CAL

6.08± 0.98 1.90±0.67

PD

136
 4.2 Distribution of chronic periodontitis in study
population:

The distribution of CP and HC groups among Libyans according to PDI,

this summarized in table (4.2).

Table 4.2 The distribution of chronic periodontitis and healthy control groups among
Libyans according to PDI.

Score
groups Score (1) Score (2) Score (5) Score (6)
(0)
HC
50 35(70%) 8(%16) 7(14%) - -

CP
50 - - - 30 (60%) 20 (40%)

137
 HC group

14%

16%

70%

Score (0 ) Score (1) Score (2 )

Figure 4.1 The distribution of scores in healthy control groups among Libyans
according to PDI.

CP GROUP

40%
60%

Score (5 ) Score (6)

Figure 4.2 The distribution of scores in chronic periodontitis group among Libyans
according to PDI.

138
 4.3 Geographical distribution in study population:

The geographical distribution in CP and HC groups among Libyans, this is

summarized in table (4.3).

Table 4.3 The geographical distribution in CP and HC groups among Libyans.

Geographical reign CP HC Total

N (%) N (%) 100

West 22(44) 30(60) 52

South 17(34) 8 (16) 25

East 11 (22) 12 (24) 23

80% 60%
prevalence

60% 44%
34%
40% 24% 22%
16%
20%
0%
west south east

CP HC

Figure 4.3 The geographical distribution in study population groups (CP and HC).

139
4.4 Detection of individual periodontal pathogens in chronic
periodontitis by conventional PCR:

All primers in PCR amplified a band at the predicted size and no

amplification of non-specific bands was observed.

M 1 2 3 4 5
M 1

400 bp 316 bp

100 bp

Figure 4.4 Conventional PCR bands of specific 16S RNA gene region for
T. denticola.

PCR for T. denticola in CP group. Lanes 1-5 represent amplified target 16S RNA gene

for T. denticola at expected size 316 bp. Green arrow represent the expected amplicon

size of 316 bp.

Negative control for the PCR amplification represented by sample number (4) sterile

paper point and PBS was used.

M= 100 bp DNA Ladder (Metabion ,Germany) was run together with the PCR product

to determine the correct size.

140
 M 1 2 3 4 5 1 2 3 4

600 bp 641 bp
404 bp
100 bp

Figure 4.5 Conventional PCR bands of specific 16S RNA gene region for
P. gingivalis and T. forsythia.

PCR for [Link], and T. forsythia in CP [Link] and green arrows represent

P. gingivalis, and T. forsythia at sizes 641bp and 404 bp, respectively.

Negative control for the PCR amplification represented by sample number (5,2) sterile

paper point and PBS was used. M = 100 bp DNA Ladder (Metabion ,Germany) was

run together with the PCR product to determine the correct size. .

141
 4.5 Detection of sub-gingival pathogens in CP group by Multiplex
PCR:

Pathogens in red, orange and green complex groups were clearly seen at the
corresponding amplicon size when detected in the agarose gel.

4.5.1 Red complex:

6 9 10 11 14
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

600 bp 641 bp
4 404 bp
300 bp
1 316 bp

Figure 4.6 multiplex bands of specific 16S gene regions in Red complex pathogens
for CP group.

Lanes 1-15 represent amplified target DNA for T. denticola at sizes 316 bp, P.

gingivalis at sizes 404 bp, T. forsythia at size 641bp. M= 100 bp DNA Ladder

(Metabion ,Germany) was run together with the PCR product to determine the correct

size. Red arrows represent the corrospending sizes in the ladder for approximate

estimation of PCR amplicon size. Green arrow represent the expected amplicon size

of 641bp. Black arrow represents the expected amplicon size of 404 bp. Blue arrow

represent the expected amplicon size of 316.

142
 4.5.2 Orange complex:

A M 1 2 3 4 5 6 7 8 9 10 11 12
804 bp
800 bp 598 bp
500 bp 575 bp

B 804 bp
594 bp
575 bp

Figure 4.7 Multiplex bands of specific 16S RNA gene regions in Orange complex for
CP group.

A . Lanes 1-12 represent amplified target DNA for [Link] at sizes 575 bp, for

[Link] at size 598, for [Link] at size 804bp. M= 100 bp DNA Ladder

(Metabion ,Germany) was run together with the PCR product to determine the correct

size. Red arrows represent the corrospending sizes in the ladder for approximate

estimation of PCR amplicon size . Green arrow represents the expected amplicon size

of 804. Black arrow represents the expected amplicon size of 598, blue arrow

represents the expected amplicon size of 575.

B. Magnification of sample number 5.

143
 4.5.3 Green complex:

M 1 2 3 4 5 6 7 8 9
M 10
700 bp
500 bp 688 bp
557 bp

Figure 4.8 Multiplex bands of specific 16S gene regions in Orange complex
pathogens for CP group.

Lanes 1-10 represent amplified target DNA for A. actinomycetcmcomitans at sizes

557, E. corrodens at size 688 bp. M= 100 bp DNA Ladder (Metabion ,Germany) was

run together with the PCR product to determine the correct size . Red arrows corrospens

sizes in the ladder for approximate estimation of PCR amplicon size. Green arrow

represents the expected amplicon size of 688 [Link] arrow represents the expected

amplicon size of 557 bp.

144
 4.6 Detection of sub-gingival pathogens in HC group by Multiplex
PCR:

4.6.1 Red complex:

1 12 13

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

600 bp
641 bp
300 bp 404 bp
316 bp

Figure 4.9 Multiplex bands of specific 16S RNA gene regions in Red complex
pathogens for HC group.

Lanes 1-17 represent bands a of amplified target DNA for T. denticola at sizes 316,

P. gingivalis at sizes 404 in some of the samples, a negative result for T. forsythia at

size 641bp in all of the samples. M= 100 bp DNA Ladder (Metabion ,Germany) was

run together with the PCR product to determine the correct size. Red arrows represent

the corrospending sizes in the ladder for approximate estimation of PCR amplicon size.

Green arrow represents negative or invisible band of T. forsythia at size 641bp. Black

arrow represents expected band for P. gingivalis at sizes 404 bp. Blue arrow represents

weak band for T. denticola at sizes 316 bp.

145
 4.6.2 Orange complex:

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 7
804 bp
800 bp 598 bp
575 bp
500 bp

Figure 4.10 Multiplex bands of specific 16S RNA gene regions in Orange complex
pathogens for HC group.

Lanes 1-16 represent amplified target DNA for P. intermedia at sizes 575 bp, for C.

rectus at size 598, for P. ngrescens at size 804bp. M= 100 bp DNA Ladder

(Metabion ,Germany) was run together with the PCR product to determine the correct

size. Red arrows represent the corrospending sizes in the ladder for approximate

estimation of PCR amplicon size . Green arrow represents the expected amplicon size

of 804,black arrow represents the expected amplicon size of 598, blue arrow represents

the expected amplicon size of 575 bp.

146
 4.6.3 Green complex in HC group:

M 1 2 3 4 5 6
700 bp 688 bp
500 bp 557 bp

Figure 4.11 Multiplex bands of specific 16S RNA gene regions in Green complex
pathogens for HC group.

Lanes 1-6 represent amplified target DNA for A. actinomvcetcmcomitans at sizes 557,

E. Corrodens at size 688 bp. M= 100 bp DNA Ladder (Metabion ,Germany) was run

together with the PCR product to determine the correct size . Red arrows represent the

corrospending sizes in the ladder for approximate estimation of PCR amplicon size.

Green arrow represents the expected amplicon size of 688 bp,black arrow represents

the expected amplicon size of 557 bp.

147
4.8 Prevalence and distribution of the eight sub-gingival
pathogens in study population groups:

The Prevalence and distribution of the eight sub-gingival pathogens in

CP and HC groups among Libyans is summarized in table (4.4).

Table 4.4 Prevalence and distribution of eight sub-gingival pathogen in chronic

periodontitis and healthy control groups among Libyans.

CP n =50 HC n =50
Sub-gingival pathogens
(%) (%)

[Link] 50 (100) 20 (40)

[Link] 48 (96) 3 (6)
[Link] 46 (92) 10 (20)
[Link] 46 (92) 10 (20)
[Link] 41 (82) 6 (12)
[Link] 37 (74) 16 (32)
[Link] 36 (72) 15(30)
A. actinomycetemcomitans 20 (40) 8 (16)

148
 100%
100% 96%
92% 92%
90% 82%
80% 72% 74%
70%
prevalence

60%
50%
40% 40%
40% 32%
30%
30%
20% 20%
20% 16%
12%
10% 6%

0%

CP HC

Figure 4.12 Prevalence and distribution of eight sub-gingival pathogen in chronic

periodontitis and healthy control groups among Libyans.

149
 4.9 Association between the clinical parameters and study groups:

A Mann–Whitney U test was used to estimate the association

between clinical parameters and two study groups. The association was
significantly high (p-value = 0.0001) as shown in Figures (4.12), (4.13)
and (4.14).

Figure 4.13 Scatter plot diagram of BOP in cases and controls, red line represents the
mean.

150
 CAL
15

CAL meaurements
10

0
se

l
ro
ca

nt
co
L
A

L
C

A
C
Figure 4.14 Scatter plot diagram of CAL in cases and controls, red line represents the
mean.

Figure 4.15 Scatter plot diagram of PD in cases and controls, red line represents the
mean.

151
 4.10 Association between the sub-gingival pathogens and CP:

Chi-squared test used to estimate the relation between eight sub-

gingival pathogens and CP group, the association was significantly
high (p-value = 0.0001).

Table 4.5 Association between red complex pathogens and clinical parameters
(BOP).
Pathogen BOP < 30% BOP >30% p-value

[Link] 20 41 0.0001

[Link] 12 35 0.0001

[Link] 9 42 0.0001

Table 4.6 Association between red complex pathogens and clinical parameters (CAL).

Pathogen CAL < 3 CAL > 3 p-value

[Link] 10 46 0.0001

[Link] 6 41 0.0001

[Link] 3 48 0.0001

152
Table 4.7 Association between red complex pathogens and clinical parameters (PD).

Pathogen PD PD
p-value
<3 >3

[Link] 10 46 0.0001

[Link] 6 41 0.0001

[Link] 3 48 0.0001

Table 4.8 Association between green complex pathogens and clinical parameters
(BOP).

Pathogen BOP BOP p-value

< 30% > 30%

A. actinomycetemcomitans 8 20 0.0001

[Link] 16 40 0.0001

153
Table 4.9 Association between green complex pathogens and clinical parameters
(CAL).

Pathogen CAL CAL

p-value
< 3 >3

A. actinomycetemcomitans 8 20 0.0001

[Link] 10 46 0.0001

Table 4.10 Association between green complex pathogens and clinical parameters (PD).

Pathogen PD PD
p-value
<3 >3

A. actinomycetemcomitans 8 20 0.0001

[Link] 10 46 0.0001

154
Table 4.11 Association between orange complex pathogens and clinical parameters
(BOP).

Pathogen BOP BOP p-value

< 30% < 30%

[Link] 26 44 0.0001

[Link] 20 33 0.0001

[Link] 17 34 0.0001

Table 4.12 Association between orange complex pathogens and clinical parameters
(CAL).

Pathogen CAL CAL

p-value
<3 > 3

[Link] 20 50 0.0001

[Link] 16 37 0.0001

[Link] 15 36 0.0001

155
 Table 4.13 Association between orange complex pathogens and clinical parameters
(PD).

Pathogen PD PD p-value
<3 >3

[Link] 20 50 0.0001

[Link] 16 37 0.0001

[Link] 15 36 0.0001

4.11 Association between single sub-gingival pathogen and

CP in study population:

Analysis was used to determine whether any bacterial pathogen singly had
coincident effects on the CP group Chi-square test and odds ratio was used,

the p-value (0.0001) was significantly high.

Table 4.14 Association between single sub-gingival pathogen in CP group.

156
 Logistic regression for CP
Sub-gingival pathogens
Odds ratio p-value
[Link] 46 0.0001*

[Link] 33.4 0.0001*

[Link] 376 0.0001*
0.0001*
A. actinomycetemcomitans 3.50

[Link] 46 0.0001*
[Link] 73.5 0.0001*
[Link] 6.04 0.0001*
[Link] 6 0.0001*

Table 4.15 Association between single sub-gingival pathogen in HC group.

Sub-gingival pathogens Logistic regression for HC

Odd ratio p-value

[Link] 0.250 0.0001*
[Link] 0.136 0.0001*
[Link] 0.064 0.0001*
A. actinomycetemcomitans 0.190 0.0001*
[Link] 0.250 0.0001*
[Link] 0.667 0.160
[Link] 0.471 0.013
[Link] 0.429 0.006*

* Refers to significant p-value

157
4.12 Association between bacterial species in CP group:

Twenty-eight bacterial combinations were tested for the CP group by using

the Chi-square test, a statistically significant odds ratio (p<0.05) was
obtained for 18 of the 28 bacterial combinations. Significantly positive
association was obtained in 9 of the 17 with a high odds ratio for any 2
species; [Link] / [Link], [Link] and [Link] at
(OR=4.28, 8.78, 8.78), A. actinomycetemcomitans / [Link],
[Link], [Link] and [Link] (OR=8.5, 13.5, 28.5, 28.5),
another high ratio between [Link]/ [Link] (OR=12.64) ,
[Link]/ [Link] (OR=13.61) ,as shown in table (4.16).

158
 Table 4.16 The odds ratio (95 % confidence intervals) of associations among species tested from (N= 50) chronic
periodontitis subjects.

Sub-gingival pathogens Pg Td Tf Aa Pn Cr Pi Ec
Pg _

Td 4.28* _
(0.87-21.06)

Tf 8.78* 1.91 _
(1.06-72.52) (0.33-10.97)

Aa 0.14* 0.06* 0.03* _

(0.05-0.36) (0.01-0.19) (0.006-0.13)

Pn 0.47 0.24* 0.11* 13.5* _

(0.17-1.25) (0.07-0.83) (0.04-0.52) (2.81-64.67)

Cr 0.78 0.24* 0.14* 28.5* 1.01 _

(0.27-2.19) 0.07-0.83) (0.02-0.67) (3.52-230.1) (0.38-2.62)

Pi 8.78* 3.91 1.95 28.5* 13.61* 12.64* _

(1.09-74.29) (0.42-36.37) (0.17-22.79) (3.52-230.1) (1.69-109.10) (1.57-101.7)
Ec 2.78* 0.91 0.45 8.5* 6.61* 2.89 0.23 _
(0.70-11.04) 0.21-0.91) (0.08-2.62) (2.20-32.83) (1.39-31.27) (0.86-9.76) (0.025-2.17)

* Refers to significant p-value.

159
4.13 Genomic DNA concentration and purity:

Nano Drop Lite spectrophotometer (Thermo Fisher Scientific) was used to

measure concentration of genomic DNA and purity at the 260/280 ratio, it
was extracted from buccal swab samples. The mean of genomic DNA
concentration was 57 ng/μl, minimum value was 2.4 ng/μl and maximum
value was 203 ng/μl.

The mean A260/A280 ratio to assess the purity for extracted genomic
DNA was 1.5, minimum value was 1.1 and maximum value was 2.16.

160
 4.14 Detection of IL- 17 A gene:

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
M

200 bp
100 bp 102 bp

Figure 4.16 Bands of specific IL- 17 A gene regions.

Lanes 1-18 represent amplified target DNA IL- 17 A at sizes 102 bp. M= 100 bp

DNA Ladder(Metabion ,Germany) was run together with the PCR product to

determine the correct size. Red arrows represent the corrospending sizes in the ladder

for approximate estimation of PCR amplicon size. Green arrow represents the

expected amplicon size of 102 bp.

161
 4.15 Detection of IL- 17 F gene:

M 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14
M

5
200 bp
100 bp 143 bp

Figure 4.17 Bands of specific IL- 17 F gene regions.

Lanes 1-14 represent amplified target DNA IL- 17 F at sizes 143 bp. M= 100 bp DNA

Ladder (Metabion ,Germany)was run together with the PCR product to determine the

correct size. Red arrows represent the corrospending sizes in the ladder for

approximate estimation of PCR amplicon size. Green arrow represents the expected

amplicon size of 143 bp.

162
 4.16 Purification of IL- 17 A PCR product:

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14

200 bp3 102 bp

100 bp

Figure 4.18 Bands of purified IL- 17 A gene PCR product regions.

Lanes 1-14 represent purified PCR product for IL- 17 A at sizes 102 bp. M= 100 bp

DNA Ladder (Metabion ,Germany)was run together with the purified PCR product to

determine the correct size. Red arrows represent the corrospending sizes in the ladder

for approximate estimation of purified product size. Green arrow represents the

expected amplicon size of 102 bp.

163
 4.17 Purification of IL- 17 F PCR products:

200 bp3 143 bp

100 bp3

Figure 4.19 Bands of purified IL- 17 F gene regions.

Lanes 1-15 represent purified PCR product for IL- 17 F at sizes 143bp. M= 100 bp

DNA Ladder (Metabion ,Germany) was run together with the purified PCR product

to determine the correct size. Red arrows represent the corrospending sizes in the

ladder for approximate estimation of purified product size. Green arrow represents the

expected amplicon size of 143 bp.

164
 4.18 Genotype frequency:

Genotype analysis for IL-17A and IL-17F genes polymorphism was done

by Sequencher software version (5.4.6) in mRNA/genomic position c-197

g.4849 for IL-17A and mRNA/genomic position 553 IL-17F.

Table 4.17 Genotype frequency for IL-17A.

IL-17A genotype CP N(%)

GG 3 (40)
AA 0 (0)
AG 2 (40)
Total 5

Table 4.18 Genotype frequency for IL-17F

IL-17F CP HC MAF p-value

Genotype N (%) N (%) (CP)

TT(A) 32(78) 0(0) C=15.85 0.334

CC (G) 4(10) 8(100)

TC (R) 0(0)
5(12)

Total 41 8

165
Figure 4.20 Chromatogram IL-17A (rs2275913) SNP (ambiguity code: R).

Figure 4.21 Chromatogram showing T7488C (rs763780) SNP in IL17F

(ambiguity code: R).
.

166
4.19 IL-17A allele frequency:

Table 4.19 Allele frequency for IL-17A gene (rs2275913).

IL-17F CP
Allele N (%)

G 8 (80)

A 2 (20)
Total 10

4.20 IL-17F allele frequency:

Table 4.20 Allele frequency for IL-17F gene (rs763780).

IL-17F CP HC
p-value
Allele N (%) N (%)
T
69 (84.14) 0(0) 0.334

C 13 (15.85) 16(100)

Total 82 16

167
4.21 Novel genatic variant :

A novel variant c.*34G>A in IL17F was found in 14.6 % of CP patients,

a substitution of a single nucleotide caused change in glutamic amino acid

to lysine amino acid. Position on chromosome number (6)
AGAAGCTGTAGAAATGCCACT, in third exon.

GAA (glutamic amino acid)

AAA (lysine amino acid)

Missense mutation is a point mutation in which a single nucleotide

change results in a codon that codes for a different amino acid, glutamic
amino acid was replaced by lysine amino acid.

This novel variant has not been described in any database (NCBI db SNP,
ClinVar, ExAc, 1000 genome) nor reported in other studies.

168
Figure 4.22 Chromatogram showing Novel genetic variant c.*34G>A in IL17F gene.

169
 4.22 Genotype frequency for Novel genetic variant:

Genotype analysis for IL-17F gene was done by Sequencher software

version (5.4.6) in mRNA/genomic position 597.

Table 4.21 Genotype frequency for Novel genetic variant c.*34G>A in IL17F gene.

IL-17F CP HC MAF
p-value
Genotype N (%) N (%) (CP)

AA 0(0) 0(0)
A= 7.31 0.010

GG 35(85.3) 8(100)

AG 6(14.6) 0(0)

Total 41 8

170
 4.23 Allele frequency for Novel genetic variant c.*34G>A
in IL17F gene:

Table 4.21 Allele frequency for novel genetic variant c.*34G>A in IL17F gene.

IL-17F CP HC
p-value
Allele N (%) N (%)

G
76(92.68) 16(100) 0.010

A 6(7.31) 0(0)

Total 82 16

4.24 Association between Novel genetic variant c.*34G>A

and CP:

A novel variant was found in nine samples of total 49, Chi-squared

test was used to estimate the relation between novel genetic variant
c.*34G>A and chronic periodontitis, the association was significant

(p-value = 0.010) as shown in table (4.22), in addition, the distribution

of novel genetic variant c.*34G>A in CP was only in severe cases (PDI
score 6).

171
 Table 4.22 Association between Novel genetic variant c.*34G>A and CP.

Moderate Sever p-value

Group Healthy Total
periodontitis periodontitis

AA 0 0 0 0 0.010

GG 8 20 15 43

AG 0 0 6 6

172
DISCUSSION

173
5.1 Discussion:

Little information has been published about the periodontal conditions in

Libyan population and their effect on periodontal health. In 2013, a cross-
sectional survey was conducted among the young adults aged 18-34 years
from Sebha city by Syed Wali Peeran et al. A total of 1,255 individuals, of
which 80.15% were females and 19.84% were males were diagnosed with
CP 11. Within the limits of the study, it can be concluded from the clinical
examination that 40.63% patients were detected with shallow pockets (4-
5 mm) and 4.06% detected with deep pockets (>5 mm), only 4.7% young
adults in Sebha have healthy periodontium 11.

In 2017, Elhassan et al wrote about the reasons to seek periodontal

treatment in Libyan community, he tried to understand and analyse the
motivation factors to seek periodontal care in the Libyan community.
Variation in the degrees of periodontitis severity was found, 50% were
diagnosed as moderate chronic periodontitis, followed by 21% as severe
chronic periodontitis, 15% had a mild form of CP 12.

174
 Comparing to the present study of a total of 50 individuals in CP group,
which 56% were females and 44% males ware diagnosed with CP, it can
be concluded from clinical examination and PDI that 60% patients were
detected with pockets depth (4-6 mm) and 40% detected with deep pockets
(>6 mm), there was no mild form of CP diagnosed.

This is the first microbiological study in Libya that investigates the

association between eight sub-gingival pathogens and CP, detecting the
prevalence of eight sub-gingival pathogens in CP group and HC group
among Libyan population.

Regarding the investigation of CP pathogenesis, the relationship of the

species in the different complexes (red, green and orange ) to clinical
parameters (BOP, CAL and PD) was examined in the present study. Eight
sub-gingival pathogens ([Link], [Link], [Link], A.
actinomycetemcomitans, [Link], [Link], [Link] and
[Link]) exhibited a very strong relationship with pocket depth, clinical
attachment loss and bleeding on probing in CP group (p-value = 0.0001)
was significantly high, they were detected more frequently in deeper
periodontal pockets (≥ 5mm) more than in shallow ones (< 4 mm).
Socransky and Haffaiee in 1998 have detected the relationship between
pocket depth and members of the red complex, In addition, [Link]
and [Link] have been connected with the progression of gingivitis to

175
 periodontitis. [Link] could be useful as an indicator bacterium of
periodontal destruction in its early phase. Popova et al in 2014 have
investigated and provided enough evidence to relate red complex with CP
and these bacteria have been defined as key periodontal pathogens; disease
progression and unsuccessful periodontal therapy depend on a present of
17,33,42
accumulation of [Link], [Link], [Link] .

The CP was initiated through the colonization of the sub-gingival

pathogens, the next step is bacterial invasion or invasion by pathogenic
products into the periodontal tissues, interactions of bacteria or their
substances with host cells, and this directly or indirectly causes
degradation of the periodontium, resulting in tissue destruction 42,77,83. It
has been proven that P. gingivalis and A. actinomycetemcomitans can
invade and cause damage to gingival tissues and lead to progression of the
inflammatory process.A. actinomycetemcomitans is a green complex
bacteria associated with the severity of the disease concerning PD and
CAL, it was most frequently detected in sites with a pocket depth of ≥5
mm, this finding it was observed in multiple analyses. It is closely
associated with aggressive Periodontitis but could be found in patients
with chronic periodontitis 42,77,83.

176
 Socransky and Haffaiee in 1998 have noted that [Link] was
detected more frequently in deep periodontal pockets (≥5 mm) in CP
patient, Popova et al, provide strong evidence of bacterial accumulation of
orange complex pathogens including [Link], [Link], [Link]
colonization may lead to an increasing progression of periodontal disease
17,42
and damaging the periodontium due to stimulate immune respond .

Ashimoto et al in 1996 determine the prevalence of eight sub-gingival

pathogens in American population with CP used, a 16S rRNA-based
conventional PCR detection method, with the prevalence of [Link]
(86%), [Link] (74%), [Link] (70%), almost close to the present
study results; [Link] (96%), [Link] (74%), [Link] (82%), in
addition the Ashimoto finding showed a moderate prevalence of A.
actinomycetemcomitans (30%) and high prevalence of [Link] (80%)
which was close to the finding of the current study A.
actinomycetemcomitans (40%) and [Link] (92%), but the
prevalence was slightly different in [Link](52%), [Link] (54%)
and [Link] (58%), it was lower than the current study finding
[Link](74%), [Link] (92%), [Link] (100%). Both studies
showed significant association between eight sub-gingival pathogens and
CP group.

177
 Global differences in composition and prevalence of sub-gingival
pathogens in patients with CP visualized in different populations in
Mediterranean countries (Spain, Italy, Turkey, and Morocco), west Asia
(Iran, Yamen), East Asia (China, Japan), South Asia (India), South
America (Brazil), Western Europe (Switzerland) and Middle Africa
(Congo). Therefore, it is plausible that differences in prevalence rates are
not caused by geography solely, as well as differences among different
ethnic or racial groups, variety of microbial identification methods,
including culture, conventional PCR, multiplex PCR and RT PCR were
used in these studies, sub-gingival sampling methods: a sterile cotton pellet,
a sterile curette, a sterile paper point 102,103.

The present study reported a high prevalence of red complex bacteria,

[Link] (96%), [Link] (92%) and [Link] (82%) in CP
patients, on the contrary, the prevalence of [Link], was higher in the
Yemenis population (100%), it was similar to the results in Iranian and
Indian population (96%), the prevalence of [Link] was higher in the
Congolese and Yemenis population (100%), the prevalence of [Link]
was slightly higher in Yemenis (98%). Congolese population compared to
our finding in the present study, maybe this slight variance in increasing
prevalence was due to using RT PCR as a detection method in Yemenis
population as opposed to the Iranian and Indian used PCR 40,83,88,104.

178
 Also, the current study showed a moderate prevalence of
[Link] (40%) close to Iranian population with
prevalence(43%), on the contrary of Yemenis population, the prevalence
was higher(68%) than our results 89,104.

In orange complex bacteria, the prevalence of [Link] (100%) was

very close to the prevalence of Chinese (98%) and Moroccan population
(90%), the prevalence of [Link] was slightly higher in Iranian
population (78%) than present study (74%) maybe it was related to sub-
gingival sample collection method in Iranian study. The sub-gingival
sample had taken by a sterile periodontal curette, it was gently inserted to
the bottom of the periodontal pocket, and sub-gingival material was
removed by a single stroke, in the current study samples were collected
by gently inserting sterile paper points after the supra-gingival plaque was
removed by using a sterile Gracey curette. The prevalence of [Link]
(90%) in Moroccan population was slightly higher than the present study
(72%), all mentioned studies showed a significant association between
eight sub-gingival pathogens and chronic periodontist by using Chi-
squared test, the degree of the association was from significantly to high
with ranged p-value (0.05-0.0001)40,80,86.

179
 Comparing the distribution of eight sub-gingival pathogens in CP and HC
groups in different population with our results; our study reported a very
high prevalence of [Link] (96%) in CP but a low prevalence in HC
group (6%), similar to Japanese population with a high prevalence of
[Link] (85%) in CP but a low prevalence in HC group (0%)40,80,81,83.
Also Indian population showed a high prevalence of [Link] (75%) in
CP but a low prevalence in HC group (5%) and Chinese population had a
high prevalence of [Link] (73%) in CP but a low prevalence in HC
group (11%) 40,80,81,83.

In the current study, [Link] showed a high prevalence (92%) in CP

compared with HC (20%) in Libyan population, similar to Indian
population high prevalence (71%) in CP compared with HC (6%),
[Link] showed a high prevalence (82%) in CP compared with HC
(12%) in Libyan population, similar to Indian population high prevalence
(81%) in CP compared with HC (11%) and Japanese population high
prevalence (75%) in CP compared with HC (0%) 81,83.

In the current study, A. actinomycetemcomitans showed a moderate

prevalence (40%) in CP and low prevalence (16%) in HC group in Libyan
population, close to Indian population the prevalence was in CP (32%) and
HC (3%), [Link] showed a high prevalence (92%) in CP and low
prevalence (20%) in HC group in Libyan population, on the contrary in

180
Indian population the prevalence was low in CP (16%) and it was very low
in HC group (6%) 83.

In the current study, [Link] showed a very high prevalence (100%)

in CP and moderate prevalence (20%) in HC group in Libyan population,
close to Chinese population the prevalence was (98%) in CP and (63%)
in HC and Brazilian population the prevalence was (87%) in CP and (43%)
in HC, [Link] showed a high prevalence (74%) in CP and moderate
prevalence (32%) in HC group among Libyan population in the present
study, on the contrary in Indian population the prevalence was low in CP
(17%) and it was very low in HC group (9%), [Link] showed a high
prevalence (72%) in CP and moderate prevalence (30%) in HC group
among Libyan population in the present study, on the contrary in Indian
population the prevalence was low in CP (13%) and HC group (14%)
77,80,83
.

The odds ratio was calculated to assess the association between the
bacterial species. Twenty eight bacterial combinations were tested for the
CP group, a statistically significant odds ratio (p<0.05) was obtained for
18 of the 28 bacterial combinations for any two species.

Comparing to our result with the Indian population in 2012, a statistically

significant odds ratio (p<0.01) was obtained for 19 of the 28 bacterial
combinations for any two species. Also, Ashimoto et al showed a similar

181
result in their study in 1996, the odds ratio analysis of bacterial
combinations was statistically significant (p<0.01) for 17 of the 28
bacterial combinations for any two species 83,101.

In the current study, a significantly positive association was obtained in

9 of the 17, with a high odds ratio for any two species, such as the
relationship between the red complex bacteria; it showed a strong positive
association between ([Link] / [Link] ) and ([Link] /
[Link]) (OR=4.28, 8.78). The relationship between the orange
complex bacteria ([Link], [Link] and [Link]) showed very
strong positive association between [Link] / [Link] (OR=12.64),
[Link] / [Link] (OR=13.61). Besides, there was an obvious
association between red and orange complexes bacteria, there was a strong
positive association between [Link] and [Link] (OR=8.78).

The relationship between the two green complex bacteria (A.

actinomycetemcomitans and [Link]) showed a strong positive
association (OR=8.5), also, the relationship between the green and orange
complex bacteria showed a very strong positive association between A.
actinomycetemcomitans / [Link], [Link] and [Link] (OR=
13.5, 28.5, 28.5).

182
 Comparing our results to Ashimoto et al in 1996, similar positive results
were obtained but with lower OR values, they were obtained between T.
denticola / P. gingivalis (OR=3.44), P. gingivalis / P. intermedia (OR=
5.85), P. intermedia / C. rectus (OR=3.33), A. actinomycetemcomitans /
105
[Link] (OR= 3.57) .

Comparing to Mahalakshmi et al in 2012, similar positive results but

with lower OR values positive, they were obtained, they were between,
[Link] / [Link](OR=4.54),

[Link] / [Link] (OR=4.73),

[Link] / [Link] (OR=3.05)83.

High odds ratio between organisms may indicate a symbiotic

relationship in periodontal pockets. A pathogen may more readily colonize
sub-gingival sites already occupied by other organisms, due to gingival
inflammation or growth factors produced by other organisms. However,
some organisms may merely colonize together in periodontal lesions since
they both produce destructive disease without interacting with each other
101
.

183
 IL- 17 is a pro-inflammatory cytokine that stimulates T cells, fibroblasts
and osteoclasts for bone resorption, and takes part in dendritic cell
maturation. It Produces and secretes a wide spectrum of inflammatory
factors such as IFγ, tumour necrosis factor- α (TNF- α), IL- 6 and IL- 8.

IL- 17 levels in saliva, gingival crevicular fluid and plasma were observed
to be significantly higher in periodontal disease 57,60,61.

Most genetic research in periodontitis has focused on gene

polymorphisms that play role in immune regulation or metabolism, such
as cytokines, cell-surface receptors, chemokines, enzymes and others that
are related to antigen recognition 75.

Polymorphism is defined as a variant with a frequency above 1%. The

term “polymorphism” which has been used widely often leads to confusion
because of incorrect assumptions of pathogenic and benign effects,
respectively. According to the American College of Medical Genetics and
Genomics standards and guidelines in 2015, the term polymorphism is
replaced by “variant” with the following modifiers: (i) pathogenic, (ii)
likely pathogenic, (iii) uncertain significance, (iv) likely benign and (v)
benign 67,106.

184
 In 2015, a study was conducted to investigate the association between
vitamin D receptor (VDR) polymorphism and patients who had CP, it has
confirmed the importance of genetic factor (vitamin D receptor) and
susceptibility to disease, it may be used to assess the risk of CP in Libyan
population 107.

This is the first study to investigate the association between IL- 17 A

and IL- 17 F gene polymorphism with CP in the Libyan population. Indeed,
the SNPs selected for this study had been previously associated with the
occurrence of CP in different populations, such as Brazilian, Turkish and
Indian. All of the mentioned studies with different population gene
polymorphisms may create phenotypic differences in the cytokine
response among individuals and that is important for an individual’s
susceptibility to disease, the progression of disease or response to
treatment, by detection of genotype frequencies between CP and HC
groups, IL-17A (rs2275913) gene polymorphism was found to be
associated with CP. The presence of the A allele (AA or AG ) genotype,
was associated with increasing the risk of CP, also clinical and
inflammatory periodontal parameters in CP was increased, in Indian
population subjects with A allele are at 5 times greater risk of developing
CP than HC, other studies showed similar results, such as the studies of
Correa et al, Zacarias et al and Liladhar et al 56,76,91 .

185
 Other studies showed that the presence of the G allele (GG ) genotype
was associated with increasing the risk for chronic periodontitis,the
studies that showed similar results such as Saraiva et al and Linhartova et
al 93,94.

With the limitation of the present study, only five samples of IL-17A
genes from CP patients was completely cycle sequenced and showed clear
results, three of them ware GG genotype and two of them AG genotype,
which detected in patients diagnosed with severe chronic periodontitis, a
larger sample size is needed for more details about analysis and
association.

IL- 17 F (rs763780) gene polymorphism, was found not associated with

chronic periodontitis among different populations (Brazilian, Turkish and
Indian), genotype and allele frequencies of IL-17F (rs763780)
polymorphism were similar in both periodontitis and periodontally healthy
individuals, there was no relationship between the severity of the disease
56,70,76,90,93
and genotype frequencies .

The present study agreed with previous studies among different

populations such as Brazilian, Turkish and Indian, there was no association
between IL- 17F (rs763780) gene polymorphism and CP among Libyan
population p-value (0.334).

186
CONCLUSIONS

187
6.1 Conclusions:

We found highly significant association between eight sub-gingival

pathogen and chronic periodontitis patients (p-value = 0.0001) in Libyan
population. [Link], T. denticola, [Link], [Link] and
[Link] were frequently detected in the deepest pocket (≥ 6) and in
periodontal tissue breakdown (CAL= ≥5).

Also a highly significant association between novel variant c.*34G>A and

CP among Libyan population (p-value = 0.010).

There was no association between IL- 17 F (rs763780) gene polymorphism

and CP among Libyan population. More extensive genetic studies with a
larger sample size are needed to clarify the association between
interleukin-17A (rs2275913) gene polymorphism and CP, also the relation
between novel variant c.*34G>A and CP among Libyan population.

188
Chapter 7 .RECOMMENDATIONS

189
1.1 Recommendations:

1. In the future studies quantitative method (Q PCR) need to be

used to know bacterial load.

2. Determination of well-known subgingival pathogens in the

periodontal pockets, that allows the evolutionary potential and
progression of the periodontal disease to be estimated.

3. Prediction of the disease progression would allow targeted

preventive therapy in periodontology.

4. The availability of chairside diagnostic Test Kits will aid in

early diagnosis and treatment, to diagnose “active disease” as
soon as it occurs, rather than months later.

5. Using 16S ribosomal DNA (rDNA) associated with sequencing

method to determine the bacterial diversity in the human
subgingival plaque, also to determine species identity or closest
relatives by comparison with sequences of known species.

190
6. Perform a larger sample size for genetic analyses of IL-17A
gene polymorphism and novel variant c.*34G>A in IL17F
in CP patients.

7. The use of DNA sequencing method is generally preferred

over other methods like restriction enzymes when screening
the entire gene and hence detecting more SNPs in IL-17A and
IL-17F gene especially when studying new populations.

191
 REFERENCES:

1. Newman M, Takei H, Klokkevold P, C. F. Carranza’s clinical

periodontology. in 68. 494–5, 497–9 (Philadelphia Elsevier, 2007).

2. Li, J., Parada, C. & Chai, Y. Cellular and molecular mechanisms of tooth

root development. Co. Biol. 144, 374–384 (2017).

3. Chapple, I. L. C. Time to take periodontitis seriously. BMJ 348, 2645

(2014).

4. Lang, N. P. & Lindhe, J. Clinical Periodontology and Implant Dentistry.

in 5–382 (John Wiley & Sons, Ltd, 2015).

5. Munksgaard, B. Periodontal diagnoses and classifcation of periodontal

diseases. Periodontol. 2000 34, 9–21 (2004).

6. Armitage, G. C. The complete periodontal examination. Periodontol.

2000 34, 22–33 (2004).

7. Paul E,Bruce D ,Liang M,Gary S ,Gina T, Wenche B ,George T, Roy B,

James B, R. G. Update on Prevelence of Periodontitis in Adults in the

Unite States. J. Peridontology 86, 611–622 (2015).

8. Lee, Jae-hong , Oh, Jin-young, Choi, Jung-kyu, Kim, Yeon-tae, Park, Y.

192
 & Jeong, Seong-nyum, Choi, S. Trends in the incidence of tooth

extraction due to periodontal disease results of a 12-year longitudinal

cohort study in South Korea. Periodontal Implant Sci 47, 264–272 (2017).

9. Kassebaum, N. J. et al. Global burden of severe periodontitis in 1990-

2010: A systematic review and meta-regression. J. Dent. Res. 93, 1045–

1053 (2014).

10. Tomás, I. et al. Quantification by qPCR of pathobionts in chronic

periodontitis development of predictive models of disease severity at site-

specific level. Front. Microbiol. 8, 1–16 (2017).

11. Peeran, S. W., Singh, A. J. A. R., Alagamuthu, G. & Naveen Kumar, P.

G. Periodontal status and its risk factors among young adults of the Sebha

city (Libya). Dent. Res. J. (Isfahan). 10, 533–538 (2013).

12. Elhassan Ahmed, Taher Alfakry, Hatem Peeran, S. W. Reasons to Seek

Periodontal Treatment in a Libyan Community. Dent. Med. Res. 5, 38–42

(2017).

13. World Health Organization. Towards a common language for functioning ,

disability and health ICF. Int. cassification 1149, 1–22 (2002).

193
14. Kumar, P. S. Smoking and the subgingival ecosystem: a pathogen-

enriched community. Future Microbiol. 7, 917–9 (2012).

15. Kolenbrander, P. E. et al. Communication among Oral Bacteria. 66, 486–

505 (2002).

16. Kornman, K. S. Mapping the Pathogenesis of Periodontitis. J. Periodontol.

79, 1560–1568 (2008).

17. Socransky, S. S., Haffajee, a D., Cugini, M. a, Smith, C. & Kent, R. L.

Microbial complexes in subgingival plaque. J. Clin. Periodontol. 25, 134–

144 (1998).

18. Stages of periodontal disease. Available at:

[Link]

periodontal-disease/. (Accessed: 16th June 2019)

19. Jotwani, R. et al. Mature dendritic cells infiltrate the T cell-rich region of

oral mucosa in chronic periodontitis: in situ, in vivo, and in vitro studies.

J. Immunol. 167, 4693–4700 (2001).

20. Donaghy, H., Stebbing, J. & Patterson, S. Antigen presentation and the

role of dendritic cells in HIV. AIDS 1–6 (2004).

194
21. Jotwani, R., Moonga, B. S., Gupta, S. & Cutler, C. W. Nuclear factor-κB

p50 subunits in chronic periodontitis and Porphyromonasgingivalis

lipopolysaccharide-pulsed dendritic cells. Ann. N. Y. Acad. Sci. 1192,

278–285 (2010).

22. Schmidt, S. V., Nino-Castro, A. C. & Schultze, J. L. Regulatory dendritic

cells: There is more than just immune activation. Front. Immunol. 3, 1–

18 (2012).

23. Tew, J. G., El Shikh, M. E., El Sayed, R. M. & Schenkein, H. A. Dendritic

Cells, Antibodies Reactive with oxLDL, and Inflammation. J. Dent. Res.

91, 8–16 (2012).

24. Paster, B. J., Olsen, I., Aas, J. A. & Dewhirst, F. E. The breadth of

bacterial diversity in the human periodontal pocket and other oral sites.

Periodontol. 2000 42, 80–87 (2006).

25. Tran, S. D. & Rudney, J. D. Improved multiplex PCR using conserved

and species-specific 16S rRNA gene primers for simultaneous detection

of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and

Porphyromonas gingivalis. J. Clin. Microbiol. 37, 3504–3508 (1999).

26. Boutaga, K., Winkelhoff, A. J. Van, Vandenbroucke-grauls, C. M. J. E. &

195
 Savelkoul, P. H. M. Comparison of Real-Time PCR and Culture for

Detection of Porphyromonas gingivalis in Subgingival Plaque Samples.

41, 4950–4954 (2003).

27. Lee, H. J., Kim, J. K., Cho, J. Y., Lee, J. M. & Hong, S. H. Quantification

of subgingival bacterial pathogens at different stages of periodontal

diseases. Curr. Microbiol. 65, 22–27 (2012).

28. Haffajee, A. D. et al. Subgingival microbiota of chronic periodontitis

subjects from different geographic locations. J. Clin. Periodontol. 31,

996–1002 (2004).

29. Darveau, R. P. Periodontitis: a polymicrobial disruption of host

homeostasis Richard. Nat. Rev. Microbiol. 8, 481–490 (2010).

30. Kolenbrander, P. E. ORAL MICROBIAL COMMUNITIES: Biofilms,

Interactions, and Genetic Systems1. Annu. Rev. Microbiol. 54, 2000

(2000).

31. Dosseva-Panova, V. T., Popova, C. L. & Panov, V. E. SUBGINGIVAL

MICROBIAL PROFILE AND PRODUCTION OF

PROINFLAMMATORY CYTOKINES IN CHRONIC

PERIODONTITIS. Folia Med. (Plovdiv). 56, 152–160 (2014).

196
32. Mysak, J. et al. Porphyromonas gingivalis: Major Periodontopathic

Pathogen Overview. J. Immunol. Res. 2014, (2014).

33. Moore, H.-. Tannerella forsythia , a periodontal pathogen entering the

genomic era. 42, 88–113 (2006).

34. Simonson, L. G., Goodman, C. H., Bial, J. J. & Morton, H. E. Quantitative

Relationship of Treponema denticola to Severity of Periodontal Disease.

56, 726–728 (1988).

35. Zhang, Y. et al. Population-Genomic Insights into Variation in Prevotella

intermedia and Prevotella nigrescens Isolates and Its Association with

Periodontal Disease. 7, 1–13 (2017).

36. Stingu, C., Schaumann, R., Jentsch, H., Eschrich, K. & Brosteanu, O.

Association of periodontitis with increased colonization by Prevotella

nigrescens. 20–25 (2013).

37. R.M. Arcea, et al. Characterization of the Characterization of the invasive

and inflammatory traits of oral Campylobacter rectus in a murine model

of fetoplacental growth restriction and in trophoblast cultures. NIH Public

Access 14, 384–399 (2010).

197
38. Wiley, J. Aggregatibacter ( Actinobacillus ) actinomycetemcomitans : a

triple A * periodontopathogen ? Periodontol. 2000 54, 78–105 (2010).

39. Karim, M. M. et al. LuxS affects biofilm maturation and detachment of

the periodontopathogenic bacterium Eikenella corrodens. J. Biosci.

Bioeng. 116, 313–318 (2013).

40. Chalabi, M. et al. Periodontopathic bacteria and herpesviruses in chronic

periodontitis. 25, 236–240 (2010).

41. Chatzopoulou, E., Fanourakis, G. & Dereka, X. Dental Health : Current

Research Herpes Simplex Virus 1 and 2 in Chronic Periodontitis :

Prevalence and Association with Clinical Parameters. (2018).

42. Popova, C., Dosseva-panova, V. & Panov, V. Microbiology of

Periodontal Diseases . A Review. 2818, (2014).

43. Ebisu, S. & Okada, H. Eikenella corrodens Adherence to Human Buccal

Epithelial. Infect. Immun. 31, 21–27 (1981).

44. Larsen, J. M. The immune response to Prevotella bacteria in chronic

inflammatory disease. Immunology 151, 363–374 (2017).

45. Yumoto, H., Nakae, H., Fujinaka, K. & Ebisu, S. Interleukin-6 ( IL-6 )

198
 and IL-8 Are Induced in Human Oral Epithelial Cells in Response to

Exposure to Periodontopathic Eikenella corrodens. Infect. Immun. 67,

384–394 (1999).

46. Sugai, M. et al. The Cell Cycle-Specific Growth-Inhibitory Factor

Produced by Actinobacillus actinomycetemcomitans Is a Cytolethal

Distending Toxin. Infect. Immun. 66, 5008–5019 (1998).

47. Delange, N. et al. Periodontal disease and its connection to systemic

biomarkers of cardiovascular disease in young American Indian/Alaskan

natives. J. Peridontology 89, 219–227 (2018).

48. Cassini, M. A. et al. Periodontal bacteria in the genital tract: are they

related to adverse pregnancy outcome? Int. J. Immunopathol. Pharmacol.

26, 931–939 (2013).

49. Africa, C. W. J., Nel, J. & Stemmet, M. Anaerobes and bacterial vaginosis

in pregnancy: Virulence factors contributing to vaginal colonisation. Int.

J. Environ. Res. Public Health 11, 6979–7000 (2014).

50. Peters, B. A. et al. Oral Microbiome Composition Reflects Prospective

Risk for Esophageal Cancers. Cancer Res. 77, 6777–6788 (2017).

199
51. Dominy, S. S. et al. Porphyromonas gingivalis in Alzheimer ’ s disease

brains : Evidence for disease causation and treatment with small-molecule

inhibitors. Sci. Adv. 5, 1–22 (2019).

52. Sanz, M. et al. Periodontitis and Cardiovascular Diseases . Consensus

Report. Glob. Heart 15, 1–23 (2020).

53. Graves, D. Cytokines That Promote Periodontal Tissue Destruction. J.

Periodontol 79, 1585–1591 (2008).

54. Cytokine mechanism. Available at:

[Link]/cytokines-properties-receptors. (Accessed:

16th June 2019)

55. Mandal,A,Robertson, S. What are Cytokines ? [Link]

[Link]/health/[Link] 1–3 Available at:

[Link]

(Accessed: 16th June 2019)

56. Zacarias, J. M. V. et al. The influence of interleukin 17A and IL17F

polymorphisms on chronic periodontitis disease in Brazilian patients.

Mediators Inflamm. 2015, 11–13 (2015).

200
57. Jin, W. & Dong, C. IL-17 cytokines in immunity and inflammation.

Emerg. Microbes Infect. 2, e60 (2013).

58. Interleukin 17F gene. Available at:

[Link]

(Accessed: 16th June 2019)

59. Miossec, P. & Kolls, J. K. Targeting IL-17 and TH17 cells in chronic

inflammation. Nat. Rev. Drug Discov. 11, 763–776 (2012).

60. Scapoli, L. et al. IL6 and IL10 are genetic susceptibility factors of

periodontal disease. Dent. Res. J. (Isfahan). 9, S197-201 (2012).

61. Zhang, N. et al. Analysis of Interleukin-8 Gene Variants Reveals Their

Relative Importance as Genetic Susceptibility Factors for Chronic

Periodontitis in the Han Population. PLoS One 9, (2014).

62. Fossiez, F. Djossou,O,* Chornarat, p. T cell interleukin-17 induces

stromal cells to produce proinflammatory and hematopoietic cytokines. J.

Exp. Med. 183, 2593–2603 (1996).

63. Kotake, S. et al. IL-17 in synovial fluids from patients with rheumatoid

arthritis is a potent stimulator of osteoclastogenesis. J. Clin. Invest. 103,

201
 1345–1352 (1999).

64. IL17A (interleukin 17A). Available at:

[Link] (Accessed:

16th June 2019)

65. Liu, J. et al. An improved allele-specific PCR primer design method for

SNP marker analysis and its application. Plant Methods 8, 1 (2012).

66. Matsuda, K. PCR-Based Detection Methods for Single-Nucleotide

Polymorphism or Mutation: Real-Time PCR and Its Substantial

Contribution Toward Technological Refinement. Advances in Clinical

Chemistry 80, (Elsevier Inc., 2017).

67. Nielsen, R. Population genetic analysis of ascertained SNP data. Hum.

Genomics. 1, 218–224 (2004).

68. Takashiba, S. & Naruishi, K. Gene polymorphisms in periodontal health

and disease. Periodontol. 2000 40, 94–106 (2006).

69. Laine, M. L., Loos, B. G. & Crielaard, W. Gene polymorphisms in chronic

periodontitis. Int. J. Dent. 2010, 324719 (2010).

70. Erdemir, E. O., Hendek, M. K., Beyza, D., Kocakap, S. & Ozkan, S. Y.

202
 Interleukin (IL)-17F (H161R) and IL-23R (R381Q) Gene Polymorphisms

in Turkish Population with Periodontitis. J. Res. Med. Dent. Sci. 3, 104–

108 (2015).

71. Johnson, R. B., Wood, N. & Serio, F. G. Interleukin-11 and IL-17 and the

Pathogenesis of Periodontal Disease. J. Periodontol. 75, 37–43 (2004).

72. Zhao, L. et al. Effect of non-surgical periodontal therapyonthe levels

ofTh17/Th1/ Th2 cytokines and their transcription factors in Chinese

chronic periodontitis patients. J. Clin. Periodontol. 38, 509–516 (2011).

73. Trevilatto, P. C. et al. Association of IL1 gene polymorphisms with

chronic periodontitis in Brazilians. Arch. Oral Biol. 56, 54–62 (2011).

74. Graves, D. T. The Potential Role of Chemokines and Inflammatory

Cytokines in Periodontal Disease Progression. J. Infect. Dis. 28, 482–490

(1999).

75. Yoshie, H., Kobayashi, T., Tai, H. & Galicia, J. C. The role of genetic

polymorphisms in periodontitis. Periodontol. 2000 43, 102–132 (2007).

76. Corrêa, J. D. et al. Association between Polymorphisms in Interleukin-

17A and -17F Genes and Chronic Periodontal Disease. Mediators

203
 Inflamm. 2012, 1–9 (2012).

77. Vito, A., Fraga, R., Lotufo, M. & Nunes, F. D. Detection of Herpesviruses

and Periodontal Pathogens in Subgingival Plaque of Patients With

Chronic. 2313–2321 (2008).

78. Puig-silla, M. & Dasí-fernández, F. Prevalence of fimA genotypes of

Porphyromonas gingivalis and other periodontal bacteria in a Spanish

population with chronic periodontitis. Med Oral Patol Oral Cir Bucal 17,

1047–1053 (2012).

79. Cionca, N., Giannopoulou, C., Ugolotti, G. & Mombelli, A.

Microbiologic Testing and Outcomes of Full-Mouth Scaling and Root

Planing With or Without Amoxicillin/Metronidazole in Chronic

Periodontitis. J. Periodontol. 81, 15–23 (2010).

80. He, J., Huang, W. & Pan, Z. Quantitative analysis of microbiota in saliva ,

supragingival , and subgingival plaque of Chinese adults with chronic

periodontitis. Clin Oral Invest 16, 1579–1588 (2012).

81. Tomita, S. et al. Prevalence of Aggregatibacter actinomycetemcomitans ,

Porphyromonas gingivalis and Tannerella forsythia in Japanese patients

with generalized chronic and aggressive periodontitis. Microb. Pathog. 61,

204
 11–15 (2013).

82. Ertugrul, A. S., Arslan, U., Dursun, R. & Hakki, S. S. Periodontopathogen

profile of healthy and oral lichen planus patients with gingivitis or

periodontitis. Int. J. Oral Sci. 5, 92–97 (2013).

83. Mahalakshmi, K., Krishnan, P. & Chandrasekaran, S. C. Prevalence of

Periodontopathic Bacteria in the Subgingival Plaque of a South Indian

Population with Periodontitis. J. Clin. Diagnostic Res. 6, 747–752 (2012).

84. Al-hebshi, N. N., Shuga-Aldin, H. M., Al-Sharabi, A. K. & Ghandour, I.

Subgingival periodontal pathogens associated with chronic periodontitis

in Yemenis. BMC Oral Health 14, 13 (2014).

85. Gatto, M. R., Montevecchi, M., Paolucci, M., Landini, M. P. & Checchi,

L. Prevalence of six periodontal pathogens in subgingival samples of

Italian patients with chronic periodontitis. New Microbiol. 37, 517–524

(2014).

86. Chahboun, H., Arnau, M. M., Herrera, D., Sanz, M. & Ennibi, O. K.

Bacterial profile of aggressive periodontitis in Morocco a cross-sectional

study. BMC Oral Health 15, 1–8 (2015).

205
87. Tomás, I., Regueira-iglesias, A., López, M. & Arias-bujanda, N.

Quantification by qPCR of Pathobionts in Chronic Periodontitis:

Development of Predictive Models of Disease Severity at Site-Specific

Level. Front. Microbiol. 8, 1–16 (2017).

88. Kalala-Kazadi, E. et al. Periopathogenic bacteria in dental plaque of

Congolese patients with periodontitis a pilot study. J. Clin. Exp. Dent. 10,

e232–e236 (2018).

89. Atarbashi-moghadam, F., Havaei, S. R. & Havaei, S. A. Periopathogens

in atherosclerotic plaques of patients with both cardiovascular disease and

chronic periodontitis. ARYA Atheroscler. 14, 53–57 (2018).

90. Jain, N., Joseph, R., Balan, S., Arun, R. & Banerjee, M. Original Article

Association of interleukin 4 and interleukin 17F polymorphisms in

periodontitis in Dravidian ethnicity. Indian J. Hum. Genet. 19, 58–64

(2013).

91. Liladhar ,WARAD Shivaraj, Ashok. N. Association of Interleukin-17

polymorphism ( -197G / A ) in chronic and localized aggressive

periodontitis. Braz Oral Res 30, 1–7 (2016).

92. Vahabi, S., Nazemisalman, B. & Hosseinpour, S. Interleukin2, 16, and 17

206
 gene polymorphisms in Iranian patients with chronic periodontitis.

WILEY 1–6 (2018).

93. Machado, A. et al. Evaluation of IL17A expression and of IL17A , IL17F

and IL23R gene polymorphisms in Brazilian individuals with

periodontitis. Hum. Immunol. 74, 207–214 (2013).

94. Linhartova,P,Kastovsky,J,Lucanova, S. Interleukin-17A Gene Variability

in Patients with Type 1 Diabetes Mellitus and Chronic Periodontitis: Its

Correlation with IL-17 Levels and the Occurrence of Periodontopathic

Bacteria. Mediators Inflamm. 2016, 1–9 (2016).

95. Kadkhodazadeh, M., Baghani, Z., Mehdizadeh, A. R. & Azimi, N. IL-17

Gene Polymorphism Is Associated with Chronic Periodontitis and Peri-

implantitis in Iranian Patients : A Cross-Sectional Study. Immunol. Invest.

42, 156–163 (2013).

96. Linhartova, P. B. et al. Interleukin-17A Gene Variability in Patients with

Type 1 Diabetes Mellitus and Chronic Periodontitis : Its Correlation with

IL-17 Levels and the Occurrence of Periodontopathic Bacteria. Mediators

Inflamm. 2016, 1–9 (2016).

207
97. Guest, W., Profile, M., Ramfjord, S. P., Ramfjord, S. P. & Arbor, A. The

Periodontal Disease Index ( PDI ). J. Periodontol. 38, 38–40 (1967).

98. Page, R. C. & Eke, P. I. Case Definitions for Use in of Periodontitis.

Periodontology 2007, 1387–1399 (2007).

99. Lang, N. P., Joss, A., Orsanic, T., Francesco, A. & Siegrist, B. E. Bleeding

on probing . A predictor for the progression of periodontal disease ? Clin

Periodontol 13, 590–596 (1986).

100. Machtei, E. E. et al. Clinical Criteria for the Definition of " Established

Periodontitis "*. Periodontology 63, 206–214 (1992).

101. Ashimoto, A., Chen, C., Bakker, I. & Polymerase, S. J. Polymerase chain

reaction detection of 8 putative periodontal pathogens in subgingiva

plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol.

Immunol. 266–273 (1996).

102. Kim, T. S. et al. Differences in subgingival microflora of Korean and

German periodontal patients. Elsevier 54, 223–229 (2009).

103. Herrera, D. et al. Subgingival microbial profiles in chronic periodontitis

patients from Chile, Colombia and Spain. J. Clin. Periodontol. 35, 106–

208
 113 (2008).

104. Al-hebshi, N. N., Shuga-aldin, H. M., Al-sharabi, A. K. & Ghandour, I.

Subgingival periodontal pathogens associated with chronic periodontitis

in Yemenis. BMC Oral Health 14, 1–8 (2014).

105. Ashimoto, A., Chen, C., Bakker, I. & Slots, J. Polymerase chain reaction

detection of 8 putative periodontal pathogens in subgingival plaque of

gingivitis and advanced periodontitis lesions. Oral Microbiol. Immunol.

11, 266–273 (1996).

106. Richards, S., Aziz, N., Bale, S., Bick, D. & Das, S. ACMG Standards and

Guidelines Standards and guidelines for the interpretation of sequence

variants : a joint consensus recommendation of the American College of

Medical Genetics and Genomics and the Association for Molecular

Pathology. Genet. Med. 17, 405–424 (2015).

107. Jilani, M. M. El et al. Association between vitamin D receptor gene

polymorphisms and chronic periodontitis among Libyans. Libyan J. Med.

1, 1–7 (2015).

209
APPENDIX

i
 ‫‪Appendix 1 Questionnaire& consent form in Arabic language.‬‬

‫اﻻستبيان‬
‫اﻻسم ثﻼثي ‪-----------------------------‬تاريخ الميﻼد‪ ------------‬العمر‪-------‬‬
‫الجنس‪-----------------------‬مكان السكن‪----------------‬القبيلة ‪---------‬‬
‫فصيلة الدم‪--------------‬لون البشرة‪-----------‬رقم الحالة‪-------------‬المهنة ومكان العمل‪---------------------‬‬
‫‪-‬تاريخ التسجيل‪----------------‬رقم الهاتف‪------------‬‬

‫آخى العزيز اختى العزيزة‪ :‬نشكركم خالص الشكر ﻻشتراككم معنا في هذه الدراسة والتي تهدف إلى تحديد عﻼقة تعدد‬
‫أشكال النوكليوتيدات المفردة في جين انتر لوكين ‪)17‬أ &اف( بمرض التهاب اللثة المزمن وأكثر أنواع بكتريا‬
‫مصاحبة للمرض بين الليبيين ‪.‬‬

‫الرجاء اﻹجابة على جميع هذه اﻷسئلة‪:‬‬

‫) نعم ( )ﻻ( ‪------------‬‬ ‫‪ -1‬هل تعاني من مرض السكري ؟‬
‫) انسولين( )اقراص(‪......................................‬‬ ‫‪ -2‬هل تتناول أدوية للسكري؟‬
‫‪ -3‬هل تعاني من مرض ارتفاع ضغط الدم؟ ومنذ متى ؟ )نعم( )ﻻ( ‪------------‬‬
‫)نعم( )ﻻ( ‪------------‬‬ ‫‪ -4‬هل تعاني من اﻵم متكررة بالبطن؟‬
‫‪ -5‬هل تعاني من امراض التهابات في اﻷمعاء ؟ )نعم( )ﻻ( ‪------------‬‬
‫‪ -6‬هل تعاني من التهاب المفاصل )الروماتيزم( ؟ )نعم( )ﻻ( ‪------------‬‬
‫)نعم( )ﻻ( ‪------------‬‬ ‫‪ -7‬هل تعاني من داء الصدفية ؟‬
‫)نعم( )ﻻ( ‪------------‬‬ ‫‪ -8‬هل تعاني من امراض القلب‪/‬الجلطة؟‬
‫)نعم( )ﻻ( ‪------------‬‬ ‫‪ -9‬هل تناولت مضادات حيوية خﻼل ‪3‬اشهر الماضية ؟‬
‫‪ -10‬هل تناولت مضادات اﻻلتهابات خﻼل ‪3‬اشهر الماضية ؟ )نعم( )ﻻ( ‪-- ------------‬‬
‫‪ -11‬هل تعاني من امراض مناعية او اضطرابات المناعة الذاتية ؟ وما هي ؟ )نعم( )ﻻ( ‪.....................‬‬
‫‪ -12‬هل تناولت أدوية مثبطة للمناعة خﻼل ‪ 3‬اشهر الماضية ؟ )نعم( )ﻻ( ‪----------‬‬
‫‪ -13‬خاص بالسيدات‪ :‬هل أنتي حامل او مرضعة ؟ )نعم( )ﻻ( ‪----------‬‬

‫اقر أنا‪ -------------------------------------------‬بأنني اسمح بأخذ العينة الﻼزمة لهذه الدراسة طالما أنها في‬
‫إطار المتعارف عليه طبيا‪.‬‬

‫‪---------------------‬‬ ‫التوقيع‬

‫تمنياتنا للجميع بالصحة والعافية‬

‫‪Appendix 2 Patient Data sheet.‬‬

‫‪ii‬‬
PART 1: GENERAL DATA

Participant’s name: _______________ Date Examined: ________________

Participant’s Code: _______________ Age: __________

Marital Status:  S  M  W

Sex:  Male  Female

Education Attainment:  High school or lower  College or higher

Occupation: ______________

PART 2: MEDICAL HISTORY

Smoking history:  Smoker (____________________ pack years)  Non-smoker

Comorbidities:
 Diabetes mellitus  Inflammatory bowel diseases
 Hypertension  Rheumatoid arthritis  Bronchial Asthma
 Autoimmune disease
 Liver disease  Renal disease
 Cardiac disease  Others (specify)
 psoriasis

PART 3: CLINICAL DATA

BP: _________ Wt (kg): _________ Ht (cm): _________

Pertinent Physical Examination Findings:

_____________________________________________________________________________________________
_____________________________________________________________________________________________
____

PART 4: PERIODONTAL EXAMINATION

Total Number of Teeth Present: _________________________________________

Total Number of Teeth Lost: ____________________________________________

Periodontitis _____ Present ______ Absent

Severity of Periodontitis _____ Mild ______ Moderate _____ Severe

Other Findings: ________________________________________________________

Recommendation:_______________________________________________________

Appendix 3 Patient Data sheet.

iii
Appendix 4 Additional informative sheet about the study in Arabic language.

iv
 ‫الرسالة التوضيحية لدراسة عﻼقة تعدد أشكال النوكليوتيدات المفردة في انتر لوكين ‪)17‬أ &ف( بمرض‬

‫التهاب اللثة المزمن وأكثر أنواع بكتريا مصاحبة للمرض بين الليبيين‬

‫انتم مدعوون للمشاركة في هذه الدراسة البحثية‪ ،‬مشاركتك في هذا البحث طوعية تماما و لك الحق ان تقرر المشاركة في هذه‬
‫الدراسة إن رغبت او عدم المشاركة‪ .‬من المهم جدا أن تفهم اسباب القيام بهذا البحث وعلى ماذا سيشتمل‪ .‬الرجاء قراءة المعلومات‬
‫التالية بعناية و يمكنك مناقشة اي فقرة مع فريق البحث‪.‬‬

‫ما الغرض من هذا البحث؟‬

‫ان الغرض من هذه الدراسة هو أن ندرس الطفرات )التغييرات( و اﻻختﻼفات الجينية )المادة الوراثية( لمرض التهاب اللثة المزمن‬
‫ومدى انتشارها و فهم النمط الوراثي لهذا المرض في ليبيا وأيضا معرفة اكثر أنواع بكتريا المضرة المصاحبة لهذا المرض في ليبيا ‪.‬‬

‫لماذا يُطلب منك أن تشارك في هذه الدراسة؟‬

‫كل المصابين بمرض التهاب اللثة المزمن وكذلك ندعو جميع الليبيين اﻻصحاء ابتداء◌ً من سن ‪ 25‬سنة للمشاركة في هذه الدراسة‪.‬‬
‫ماذا سيحدث أثناء الدراسة؟‬
‫إذا وافقت على المشاركة في هذا البحث سيطلب منك توقيع نموذج الموافقة المستنيرة و تعبئة اﻻستبيان المرفق‪ .‬عملية البحث تشمل‬
‫اخذ عينة ‪,‬وهي عبارة عن مسحة من اللعاب و اخري من الجيوب اللثوية ‪.‬‬
‫ستتم الدراسة على المادة الوراثية المستخلصة من اللعاب و الجيوب اللثوية واجراء الفحوصات ذات العﻼقة بهدف الدراسة المذكور‪.‬‬

‫ماذا سيحدث للعينات الخاصة بي؟‬

‫سوف يتم تخزينها في مجمدات منخفضة الحرارة و تخزينها بدون كتابة اسمك عليها بعد اعطاءها رقم مرجعي خاص‪.‬‬

‫ما هي الفوائد المحتملة إذا كنت تشارك في الدراسة؟‬

‫إن المعلومات التي سيتم الحصول عليها في هذه الدراسة سوف تساعد الباحثين في فهم اﻻسباب المحتملة لمرض التهاب اللثة‬
‫المزمن و فيما اذا كان وجود طفرات او تغييرات في المادة الوراثية قد يكون سببا في هذا المرض وكذلك تهدف ايضا الدراسة الى‬
‫معرفة اكثر أنواع البكتريا الممرضة المتواجدة عند مريض التهاب اللثة المزمن في ليبيا‪.‬‬

‫ما هي المخاطر المحتملة إذا كنت تشارك في الدراسة؟‬

‫ﻻ يوجد أي خطر أو ضرر‪.‬‬

‫كيف سيتم الحفاظ على سرية المعلومات الخاصة بي؟‬

‫سوف نقوم بعناية بحماية المعلومات التي تطلعنا عليها بشأنك وعائلتك‪ .‬وما نتعرف عليه من المسائل الطبية وتاريخ ونتائج عينات‬
‫اللعاب والجيوب اللثوية سيتم وصفه فقط بالطريقة التي ﻻ تعرّ ف بك‪ .‬ولحماية خصوصيتك‪ ،‬سوف يتم تسجيل النتائج مع رمز سري‪.‬‬
‫سوف يتم تسجيل اسمك فقط في نموذج الموافقة‪ .‬سيتم اﻹبقاء على الرمز السري المعين في ملف مغلق ومحمي بعناية‪ .‬سيتم تخزين‬
‫الملفات اﻹلكترونية أو الورقية من هذا البحث في خزائن مقفلة والوصول اليها يتم فقط من قبل الباحث الرئيسي للدراسة واﻷفراد‬
‫المرخص لهم‪.‬‬

‫المشاركة الطوعية ‪ /‬اﻻنسحاب‬

‫ان المشاركة طوعية تماما‪ .‬يمكنك سحب موافقتك في أي وقت‪ .‬إذا اخترت عدم مشاركتك في الدراسة أو انسحابك في وقت ﻻحق من‬
‫هذه الدراسة‪ ,‬يمكنك اﻻتصال بالباحث الرئيسي‪.‬‬

‫‪Appendix 5 Ethical approval.‬‬

‫‪v‬‬
vi