Scribd
Upload
24 views4 pages

DNA Sequence Analysis and Calculations

The document outlines a series of DNA-related problems and their solutions, including calculations of %GC and %AT, reverse complement sequences, melting temperature, base pair lengths, helical turns, and hydrogen bonds. It also addresses the composition of nucleotides in a given sequence and the labeling of DNA ends. Each section provides specific answers to the questions posed about DNA structure and properties.

Uploaded by

elumbaglyn
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
24 views4 pages

DNA Sequence Analysis and Calculations

The document outlines a series of DNA-related problems and their solutions, including calculations of %GC and %AT, reverse complement sequences, melting temperature, base pair lengths, helical turns, and hydrogen bonds. It also addresses the composition of nucleotides in a given sequence and the labeling of DNA ends. Each section provides specific answers to the questions posed about DNA structure and properties.

Uploaded by

elumbaglyn
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

DNA Problem Solving

I. Consider the sequence below and answer the following questions

5′-

ATGGCATTACGGTTTAATGCTGGAACCTGACCATGAGCTGGTAGCCGTTA

ACGGTACG-3′

1. Compute %GC and %AT (2 pts)

A = 14, T = 15, G = 17, C = 12

%GC = (G + C)/Total × 100 = (29/58) × 100 = 50%

%AT = (A + T)/Total × 100 = (29/58) × 100 = 50%

Answer: %GC = 50%, %AT = 50%

2. Write the reverse complement. Label 5′ and 3′ end (1 pt)

Answer:

5′- CGTACCGTTAACGGCTACCAGCTCATGGTCAGGTTCCAGCATTAAACC

GTAATGCCAT-3′

3. Compute the approximate melting temperature (Wallace rule) (1 pt)

Tm = 2°C × (A + T) + 4°C × (G + C)

Tm = 2(29) + 4(29) = 174°C

Answer: Tm ≈ 174°C
II. A DNA molecule has 5,000 base pairs

a. Total length in nanometers (nm) (1 pt)

5,000 bp × 0.34 nm/bp = 1,700 nm

b. Convert to micrometers (μm) (1 pt)

1,700 nm ÷ 1,000 = 1.7 μm

Answers: (a) 1,700 nm (b) 1.7 μm

III. A DNA molecule contains 20,000 base pairs. How many complete helical

turns does it make? (1 pt)

20,000 bp ÷ 10 bp/turn = 2,000 turns

Answer: 2,000 complete helical turns

IV. A DNA fiber measures 1.02 mm when stretched. Estimate the number of

base pairs contained in it.

1.02 mm = 1.02 × 10 ⁶ nm

1.02 × 10⁶ ÷ 0.34 = ≈ 3.0 × 10 ⁶ base pairs

Answer: ≈ 3,000,000 base pairs

V. Suppose a DNA sequence contains 20% A, what is the percentage of C? T? G?

(3 pts)
A = 20% → T = 20%

C + G = 60% → C = 30%, G = 30%

Answer: A = 20%, T = 20%, C = 30%, G = 30%

VI. If a specific DNA region contains a sequence of 5′-ATGCTAGCAT-3′, how

many hydrogen bonds are present between the two strands? (1 pt)

Count bases: A = 3, T = 3, G = 2, C = 2

A–T pairs → 6 × 2 = 12 H-bonds

G–C pairs → 4 × 3 = 12 H-bonds

Total = 24 hydrogen bonds

Answer: 24 hydrogen bonds

VII. Five turns of B-DNA will have how many purines and how many

pyrimidines? (2 pts)

1 turn = 10 base pairs → 5 turns = 50 base pairs

Each pair = 1 purine + 1 pyrimidine

Answer: 50 purines and 50 pyrimidines

VIII. Consider the tetranucleotide below

a. Label the 5′ and 3′ ends (2 pts)

5′ end = free phosphate group (PO₄³⁻)


3′ end = free hydroxyl (–OH)

b. Use the first letter of each nucleotide to write the sequence starting from the 5′

end (4 pts)

Answer: 5′-A G C T-3′

c. Give the sequence of the complementary strand (4 pts)

A↔T G↔C C↔G T↔A

Answer: 3′-T C G A-5′

You might also like