Scribd
Upload
14 views2 pages

DNA and RNA Structures Explained

The document discusses the structures of DNA and RNA, highlighting their bases and sugar types. It explains the roles of primase in lagging strand synthesis and the concept of semi-conservative replication. Additionally, it differentiates between pre-mRNA and mature mRNA, describes frameshift mutations, and provides an example related to Sickle Cell Anemia.

Uploaded by

Audrey Edrea
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
14 views2 pages

DNA and RNA Structures Explained

The document discusses the structures of DNA and RNA, highlighting their bases and sugar types. It explains the roles of primase in lagging strand synthesis and the concept of semi-conservative replication. Additionally, it differentiates between pre-mRNA and mature mRNA, describes frameshift mutations, and provides an example related to Sickle Cell Anemia.

Uploaded by

Audrey Edrea
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

1. Draw the structure of DNA and RNA, the bases, and sugar type.

2. a. Why does lagging strand have multiple primase


b. What is semi-conservative
3. a. What is the difference between pre-mRNA and mature mRNA.
b. Why is the process necessary
4. DNA and amino acid fixing.
5. a. What is frameshift
b. Give example of frameshift

1. Structure of DNA and RNA’s base and sugar type

2. Lagging Strand and Semi-conservative


a. Primase will give a primer as a starting point for making new
DNA strands with the opposite prime, but lagging strand has
multiple primase because the way it moves is to the opposite
way from the Helicase, hence a repeated creation of primase will
occur, leading to the lagging strand.
b. Semi-conservative means that during DNA replication, the two
strands of nucleotides separate, after the recreation of a new
DNA strand, the result will be a double helices with the hybrid of
old and new DNA strands.
3. Pre-mRNA, Mature mRNA, and process
a. Pre-mRNA contains both intron and exon regions whereas
Mature mRNA have their intron removed but exon stays.
b. Because in order for the mRNA to create / encode a protein with
the right sequence, intron must be removed first.
4. Example :
DNA : ATACGAAATCGCGATCGCGGCGATTCGG
mRNA : UAUGCUUUAGCGCUAGCGCCGUAAGCC
Codons : AUG-CUU-UAG
Anticodons : UAC-GAA-AUC
Amino Acids : Methionine-
Leucine-Stop
5. Frameshift
a. Frameshift is something that
happens when one base or more
are inserted / deleted, resulting
an error in the code, hence
producing the wrong amino acid which results with a wrong
protein structure.
b. Sickle Cell Anemia.

You might also like