[Link].

in

GENETICS
18

Learning Objectives

At the end of this lesson the students will be able to :

‹‹Know about Mendelian laws.
‹‹Differentiate between phenotype and genotype.
‹‹Understand the process of monohybrid and dihybrid cross.
‹‹Differentiate between a chromosome, DNA and gene.
‹‹Understand the structure of chromosome.
‹‹Classify the chromosomes based on the position of centromere.
‹‹Understand the structure and replication of DNA.
‹‹Define mutation and classify the chromosomal and gene mutation.
‹‹Identify the chromosomal abnormality of Down’s syndrome.

Heredity is transmission of characters,

Introduction
from one generation to the next generation,
“Like Begets Like” is an important and while variation refers to the differences shown
universal phenomenon of life as the living by the individuals of the same species and also
beings produce offspring of their own kind. by the offspring of the same parents. All these
Colour of eye, color of hair, shape of nose, type can happen only due to chromosomes. Now
of earlobe, etc, are inheritable traits. Have you let’s see what chromosomes are and how they
ever wondered, how do we inherit traits and are composed with DNA, that form the genetic
characteristics from our father and mother? material.
Some of our characteristics might have been
18.1  Gregor Johann Mendel -
inherited from our grandparents. How do
Father of Genetics
we inherit characters from one generation to
another? It is because of the genes we inherit Mendel (1822-1884) was an Austrian monk
from our parents. These genes are responsible who discovered the basic principles of heredity
for the physical outlook and biological through his experiments. His experiments are
functions. The branch of biology that deals the foundation for modern genetics. He was
with the genes, genetic variation and heredity born in 1822 to a family of farmers in Silesian of
of living organisms is called genetics. Czechoslovakia. After finishing his high school
261

10th_Science [Link] 261 11-01-2020 15:18:49

 [Link]

at the age of 18, he entered the Augustinian

18.2 M
 onohybrid Cross –
Monastery at Brunn as a priest. From there he
Inheritance of One Gene
went to the University of Vienna for training
in physics, mathematics and natural science. Crosses involving inheritance of only
Mendel returned to the monastery in 1854 one pair of contrasting characters are called
and continued to work as a priest and teach in monohybrid crosses. For example it is a cross
high school. In his leisure time he started his between two forms of a single trait like a cross
famous experiments on the garden pea plant.
between tall and dwarf plant.
He conducted his experiments in the monastery
for about nine years from 1856 to 1865. He Mendel’s Explanation of Monohybrid Cross
had worked on nearly 10000 pea plants of 34
Parental generation: Pure breeding tall plant
different varieties. Mendel noted that they differ
and a pure breeding dwarf plant.
from one another in many ways.
Thus Mendel had chosen 7 pairs of F1 generation: Plants raised from the seeds of
contrasting characters for his study as shown pure breeding parental cross in F1 generation
in the table. were tall and monohybrids.

F2 generation: Selfing of the F1 monohybrids

Table 18.1 Constrasting characters of pea
resulted in tall and dwarf plants respectively
plant used by Mendel
in the ratio of 3:1. The actual number of tall
Characteris�c
studied
Dominant
character
Recessive
character and dwarf plants obtained by Mendel was 787
tall and 277 dwarf. External expression of a
Stem length Long Short
particular trait is known as phenotype. So the
phenotypic ratio is 3:1.
Flower Posi�on Axillary Terminal
In the F2 generation 3 different types were
obtained:
Flower colour Blue White

Pod shape Inflated Constricted Tall Homozygous – TT (Pure) – 1

Pod colour Green Yellow
Tall Heterozygous – Tt – 2
Seed shape Round Wrinkled Dwarf Homozygous – tt – 1
Seed colour Yellow Green So the genotypic ratio 1:2:1. A genotype is the
genetic expression of an organism
Reasons for Mendel’s success
He chose the pea plant as it was Mendel’s Interpretation on Monohybrid
advantageous for experimental work in many cross
aspects Based on these observations it was
1. It is naturally self-pollinating and so is very confirmed by Mendel that ‘factors’ are passed
easy to raise pure breeding individuals. on from one generation to another, now
2. It has a short life span as it is an annual refered to as genes. Tallness and Dwarfness
and so it was possible to follow several are determined by a pair of contrasting factors
generations. , tall plant possess a pair of factors (represented
3. It is easy to cross-pollinate. by T- taking the first letter of the dominant
character) and a plant is dwarf because it
4. It has deeply defined contrasting characters.
possess factors for dwarfness (represented as
5. The flowers are bisexual. t- recessive character). These factors occur

10th Standard Science 262

10th_Science [Link] 262 11-01-2020 15:18:49

 [Link]

Info bits
Parental
Genera�on Punnett square is a checker board form
TT (Tall) � (Dwarf)
devised by a British geneticist [Link]
Gametes T t for study of genetics. It is a graphical
T t
representation to calculate the probability
F1 Genera�on
Tt of all possible genotypes of offsprings in a
Genotype All are Tt X genetic cross.
(Ma�ng)
Phenotype All are tall
Tt Tt
Gametes T t T t

T T 18.3  Dihybrid Cross-

t TT t
Tt Tt Inheritance Two Genes
�
and Law of Independent
Assortment
F2 Genera�on

Genotype TT : Tt : � = 1 : 2 : 1
Phenotype Tall : Dwarf 3 : 1
Dihybrid cross involves the inheritance
TT Tt Tt �
(Tall) (Tall) (Tall) (Dwarf) of two pairs of contrasting characteristics
Figure 18.1 Monohybrid cross (or contrasting traits) at the same time. The
two pairs of contrasting characteristics chosen
in pairs and may be alike as in pure breeding by Mendel were shape and colour of seeds:
tall plants (TT) and dwarf plants (tt). This is round-yellow seeds and wrinkled-green
referred to as homozygous. If they are unlike seeds.
(Tt) they are referred to as heterozygous. Mendel crossed pea plants having round-
1. Two factors making up a pair of yellow seeds with pea plants having wrinkled-
contrasting characters are called alleles. green seeds. Mendel made the following
Phenotypic expression of alleles are called observations:
allelomorphs. One member of each pair is
1. Mendel first crossed pure breeding pea
contributed by one parent.
plants having round-yellow seeds with
2. When two factors for alternative
pure breeding pea plants having wrinkled-
expression of a trait are brought together
green seeds and found that only round-
by fertilization. The character which
yellow seeds were produced in the first
expresses itself is called dominant
(Tallness) condition and that which is generation (F1). No wrinkled-green seeds
masked is called recessive condition were obtained in the F1 generation. From
(Dwarfness). this it was concluded that round shape and
3. The factors are always pure and when yellow colour of the seeds were dominant
gametes are formed, the unit factors traits over the wrinkled shape and green
segregate so that each gamete gets one of color of the seeds.
the two alternative factors. It means that 2. When the hybrids of F1 generation pea
factors for tallness(T) and dwarfness(t) are plants having round-yellow seeds were
separate entities and in a gamete either T cross-bred by self pollination, then four
or t is present. When F1 hybrids are self types of seeds having different combinations
crossed the two entities separate and then
of shape and color were obtained in second
unite independently, forming tall and dwarf
generation or F2 generation. They were
plants.
263 Genetics

10th_Science [Link] 263 11-01-2020 15:18:50

 [Link]

Pure breeding Pure breeding Results of a Dihybrid Cross:

round, yellow wrinkled, green
seeds seeds Mendel got the following results from his
Parents dihybrid cross
RRYY rryy 1. Four Types of Plants: A dihybrid cross
produced four types of F2 offsprings in the
ry
ratio of 9 with two dominant traits, 3 with
RY Gametes
one dominant trait and one recessive trait,
3 with another dominant trait and another
Round, yellow
seeds recessive trait and 1 with two recessive traits.
F1 Dihybrid
(First genera�on) 2. New Combination: Two new combinations
RrYy × RrYy of traits with round green and wrinkled
yellow had appeared in the dihybrid cross
Self-pollina�on
(F2 generation).

RY rY Ry ry
18.4 Mendel’s Laws
RY
RRYY RrYY RRYy RrYy Based on his experiments of monohybrid
rY
and dihybrid cross, Mendel proposed three
RrYY rrYY RrYy rrYy important laws which are now called as
Mendel’s Laws of Heredity.
Ry
RRYy RrYy RRyy Rryy
• Law of Dominance:
ry
RrYy rrYy Rryy rryy
“When two homozygous individuals
with one or more sets of contrasting
Phenotypic ra�o of F2 genera�on - 9:3:3:1 characters are crossed, the characters that
Round, Yellow - 9 Wrinkled, Yellow - 3 appear in the F1 hybrid are dominant and
Round, Green - 3 Wrinkled, Green - 1 those that do not appear in F1 are recessive
characters".
Figure 18.2 Dihybrid Cross
• Law of Segregation or Law of purity of
round yellow, round-green, wrinkled gametes:
yellow and wrinkled-green seeds. “When a pair of contrasting factors are
The ratio of each phenotype (or appearance) brought together in a F1 hybrid. The two
of seeds in the F2 generation is 9:3:3:1. factors of the allelic pair remain together
This is known as the Dihybrid ratio. without mixing and when gametes are
formed, the two separate out, so that only
From the above results it can be one enters each gamete.”
concluded that the factors for each character
or trait remain independent and maintain • Law of independent assortment:
their identity in the gametes. The factors are “In case of inheritance of two or more
independent to each other and pass to the pairs of characters simultaneously, the
offsprings (through gametes).

10th Standard Science 264

10th_Science [Link] 264 11-01-2020 15:18:50

 [Link]

factors or genes of one pair assort out

independently of the other pair.”

More to Know

T.H. Morgan was awarded Nobel Prize in

1993 for determining the role of chromosomes
in heredity.

18.5 C
 hromosomes, DNA
and Genes
Figure 18.3 Structure of chromosome
The human body is made up of million
A chromosome consists of the following
cells. The nucleus of each cell contains thin
regions
thread like structures called chromosomes.
The term ‘chromosomes’ was first coined by Primary constriction: The two arms of a
Waldeyer in 1888. The chromosomes are the chromosome meet at a point called primary
carrier of genetic material which contain the constriction or centromere. The centromere
heredity information. is the region where spindle fibres attach to the
The chromosomes are highly condensed chromosomes during cell division.
coiled chromatin fibres packed with the Secondary constriction: Some chromosomes
DNA (Deoxyribonucleic acid) that forms the possess secondary constriction at any point
genetic material. Genes are segments of DNA, of the chromosome. They are known as
which are responsible for the inheritance the nuclear zone or nucleolar organizer
of a particular phenotypic character. Each (formation of nucleolus in the nucleus).
gene is present at a specific position on a
Telomere: The end of the chromosome is called
chromosome called its locus. During cell
telomere. Each extremity of the chromosome
division, the genetic information present in
has a polarity and prevents it from joining
the genes are passed from one generation to
the adjacent chromosome. It maintains and
another.
provides stability to the chromosomes.
18.5.1 Structure of a Chromosome Satellite: Some of the chromosomes have an
elongated knob-like appendage at one end
The chromosomes are thin, long and
of the chromosome known as satellite. The
thread like structures consisting of two identical
chromosomes with satellites are called as the
strands called sister chromatids. They are held
sat-chromosomes.
together by the centromere. Each chromatid is
made up of spirally coiled thin structure called
Telomeres act as aging clock
chromonema. The chromonema has number of
in every cell.
bead-like structures along its length which are
Telomeres are protective
called chromomeres. The chromosomes are
sequences of nucleotides found in
made up of DNA,RNA, chromosomal proteins
chromosomes. As a cell divides every time,
(histones and non-histones) and certain metallic
they become shorter. Telomeres get too
ions. These proteins provide structural support
short to do their job, causing our cells to age.
to the chromosome .

265 Genetics

10th_Science [Link] 265 11-01-2020 15:18:51

 [Link]

Centromere Centromere
Short arm

Equal
Long arm
arm

Figure 18.4 Types of chromosomes based on position of centromere

18.5.2 Types of Chromosomes 18.5.4 Karyotype

based on the position of The number of chromosomes in any living
Centromere organism (animal or plant) is constant. In
Based on the position of centromere, the human, each cell normally contains 23 pairs
chromosomes are classified as Telocentric, of chromosomes. Out of which 22 pairs are
Acrocentric, Submetacentric and Metacentric autosomes and the 23rd pair is the allosome or
1. Telocentric– The centromere is found on sex chromosome.
the proximal end. They are rod shaped In the body cells of sexually reproducing
chromosomes. organisms, the chromosomes generally occur
2. Acrocentric – The centromere is found at in pairs. This condition is called diploid (2n).
The gametes produced by the organisms
the one end with a short arm and a long arm.
contain a single set of chromosomes. Hence,
They are also rod-shaped chromosomes.
the gametes are said to be haploid (n).
3. Submetacentric – The centromere is
Karyotype is the number, size and shape of
found near the centre of the chromosome.
chromosomes in the cell nucleus of an organism.
Thus forming two unequal arms. They are J
Idiogram is the diagrammatic representation
shaped or L shaped chromosomes.
of karyotype of a species. It consists of all
4. Metacentric – The centromere occurs in
the metaphasic chromosomes arranged in
the centre of the chromosome and form two homologous pairs according to decreasing
equal arms. They are V shaped chromosomes length, thickness, position of centromere, shape
etc., with the sex chromosomes placed at the end.
18.5.3 Types of Chromosomes
based on function
The eukaryotic chromosomes are classified
into autosomes and allosomes.
Autosomes contain genes that determine
the somatic (body) characters. Male and
female have equal number of autosomes.
Allosomes are chromosomes which
are responsible for determining the sex of
an individual. They are also called as sex Figure 18.5 Normal human karyotype
chromosomes or hetero-chromosomes. There
are two types of sex chromosomes, X and 18.6 Structure of DNA
Y- chromosomes. Human male have one X
DNA is the hereditary material as it contains
chromosome and one Y chromosome and
the genetic information. It is the most important
human female have two X chromosomes.
constituent of a chromosome. The most widely

10th Standard Science 266

10th_Science [Link] 266 11-01-2020 15:18:51

 [Link]

accepted model of DNA is the * 

Cytosine (C) links Guanine (G) with
double helical structure of three hydrogen bonds( C ≡ G)
James Watson and Francis
This is called complementary base
Crick. They proposed the
pairing.
three-dimensional model of
DNA on the basis of X-ray
diffraction studies of DNA obtained by Rosalind
Franklin and Maurice Wilkins. In appreciation
of their discoveries on the molecular structure
of nucleic acids Watson, Crick and Wilkins were
awarded Nobel prize for Medicine in 1962.
Chemical Composition of DNA molecule
DNA is a large molecule consisting of
millions of nucleotides. Hence, it is also called
a polynucleotide. Each nucleotide consists of
three components.
1. A sugar molecules – Deoxyribose sugar.
2. A nitrogenous base. Figure 18.6 Structure of DNA
There are two types of nitrogenous bases in 5. Hydrogen bonds between the nitrogenous
DNA. They are bases make the DNA molecule stable.
(a) Purines (Adenine and Guanine)
6. Each turn of the double helix is 34 A°
(b) Pyrimidines (Cytosine and Thymine) (3.4 nm). There are ten base pairs in a
3. A phosphate group complete turn.
Nucleoside and Nucleotide 7. The nucleotides in a helix are joined
together by phosphodiester bonds.
Nucleoside = Nitrogen base + Sugar
Nucleotide = Nucleoside + Phosphate
The nucleotides are formed according to
the purines and pyrimidines present in them.

18.6.1 Watson and Crick model

of DNA
1. DNA molecule consists of two
polynucleotide chains.
2. These chains form a double helix structure
with two strands which run anti-parallel
Figure 18.7 Nucleotides in a DNA
to one another.
3. Nitrogenous bases in the centre are linked More to Know
to sugar-phosphate units which form the
backbone of the DNA. Chargaff rule of DNA base pairing
4. Pairing between the nitrogenous bases is Erwin Chargaff states that in DNA, the
very specific and is always between purine proportion of adenine is always equal to that
and pyrimidine linked by hydrogen bonds. of thymine. and the proportion of guanine
* Adenine (A) links Thymine (T) with two always equal to that of cytosine.
hydrogen bonds (A = T)
267 Genetics

10th_Science [Link] 267 11-01-2020 15:18:51

 [Link]

18.6.2 DNA Replication by the DNA template close to the origin of

DNA replication is one of the basic process replication site.
that occurs within a cell. DNA molecule
Synthesis of new complementary strand
produces exact copies of its own structure
from the parent strand
during replication process. The two strands
of a DNA molecule have complementary base After the formation of RNA primer,
pairs, the nucleotides of each strand provide the nucleotides are added with the help of
information needed to produce its new strand. an enzyme DNA polymerase and a new
The two resulting daughter cells contain exactly complementary strand of DNA is formed from
the same genetic information as the parent cell. each of the parent strand. The synthesis is
DNA replication involves the following steps unidirectional.
Origin of replication In one strand, the daughter strand is
synthesized as a continuous strand which is
The specific points on the DNA, where
called leading strand. In the other strand, short
the replication begins, is the site of origin of
replication. The two strands open and separate segments of DNA are synthesized. This strand
at this point forming the replication fork. is called lagging strand. The short segments
of DNA are called Okazaki fragments. The
Unwinding of DNA molecule fragments are joined together by the enzyme,
The enzyme called helicase, bind to the DNA ligase.
origin of replication site. Helicase separates the
The replication stops when the replication
two strands of the DNA. The enzyme called
fork of the two sides meet at a site called
topoisomerase separates the double helix above
terminus, which is situated opposite to origin
the replication fork and removes the twists
of replication site
formed during the unwinding process. Each
of the separated DNA strands function as a
18.6.3 Significance of DNA
template.
‹‹It is responsible for the transmission
Formation of RNA primer
of hereditary information from one
An RNA primer is a short segment of generation to next generation.
RNA nucleotides. The primer is synthesized
DNA polymerase

Original DNA
Topoisomerase

Okazaki RNA
fragment primer Primase

Helicase

Parent DNA

Figure 18.8 Replication of DNA

10th Standard Science 268

10th_Science [Link] 268 11-01-2020 15:18:51

 [Link]

‹‹It contains information required for the Now let’s see how the chromosomes take
formation of proteins. part in this formation. Fertilization of the egg
‹‹It controls the developmental process and (22+X) with a sperm (22+X) will produce a
life activities of an organism. female child (44+XX). while fertilization of the
egg (22+X) with a sperm (22+Y) will give rise
to a male child (44+XY).
18.7 Sex Determination

The formation of zygote into male or 18.7.2 Mutation

female sex during development is called The term mutation was introduced by
sex determination. Sex is determined by the Hugo De Vries in 1901 when he observed
chromosomes of an individual. phenotypic changes in the evening primrose
18.7.1 Sex Determination in Human plant, Oenothera lamarckiana. Mutation is
an inheritable sudden change in the genetic
Recall that human beings have 23 pairs
material (DNA) of an organism. Mutations
of chromosomes out of which 22 pairs are
are classified into two main types, namely
autosomes and one pair (23rd pair) is the sex
chromosomal mutation and gene mutation.
chromosome. The female gametes or the
eggs formed are similar in their chromosome 1. Chromosomal mutation
type (22+XX). Therefore, human females are The sudden change in the structure
homogametic. or number of chromosomes is called
The male gametes or sperms produced are of chromosomal mutation. This may result in
two types. They are produced in equal proportions. (i) Changes in the structure of
The sperm bearing (22+X) chromosomes and the chromosomes: Structural changes in the
sperm bearing (22+Y) chromosomes. The human chromosomes usually occurs due to errors
males are called heterogametic. in cell division. Changes in the number and
arrangement of genes takes place as a result of
deletion, duplication, inversion and translocation
in chromosomes.
(ii) Changes in the number of
chromosomes: They involve addition or
deletion in the number of chromosomes
present in a cell. This is called ploidy. There
are two types of ploidy
Female Male (a) Euploidy (b) Aneuploidy.
Figure 18.9 Sex determination in human
Euploidy: It is the condition in which the
It is a chance of probability as to which individual bears more than the usual number
category of sperm fuses with the egg. If the of diploid (2n) chromosomes. If an individual
egg (X) is fused by the X-bearing sperm an has three haploid sets of chromosomes, the
XX individual (female) is produced. If the condition is called triploidy (3n). Triploid
egg (X) is fused by the Y-bearing sperm an plants and animals are typically [Link] it
XY individual (male) is produced. The sperm, has four haploid sets of chromosomes, the
produced by the father, determines the sex of condition is called tetraploidy (4n). Tetraploid
the child. The mother is not responsible in plants are advantageous as they often result in
determining the sex of the child. increased fruit and flower size.
269 Genetics

10th_Science [Link] 269 11-01-2020 15:18:52

 [Link]

Sickle cell anaemia is

caused by the mutation of a
single gene. Alteration in the
gene brings a change in the structure of
the protein part of haemoglobin molecule.
Due to the change in the protein molecule,
the red blood cell (RBC) that carries the
haemoglobin is sickle shaped.

Points to Remember

Triploid Oyster Diploid Oyster ™™Variations are quite apparent among

closely related groups of organisms.
Figure 18.10 Euploidy
™™Mendel had choosen seven pairs of
Aneuploidy: It is the loss or gain of one distinguishing traits: flower colour,
or more chromosomes in a set. It is of three position, seed colour, shape, pod colour,
types. Monosomy (2n-1), Trisomy (2n+1)and pod shape, stem length.
Nullisomy (2n-2). In man, Down’s syndrome is ™™Every pea plant has two ‘factors’ which
one of the commonly known aneuploid condition. are responsible for producing a particular
Down’s syndrome character or trait is called allele.
™™The process of acquiring characters or
This condition was first identified by a
traits from parents is called ‘Heredity’.
doctor named Langdon Down in1866.
™™Each human cell contains 23 pairs of
It is a genetic condition in which there is an
chromosomes. Out of these 22 pairs are
extra copy of chromosome 21 (Trisomy 21). It
called autosomes and one pair is called
is associated with mental retardation, delayed
allosomes.
development, behavioural problems, weak
muscle tone, vision and hearing disability are ™™A chromosome consists of the regions:
some of the conditions seen in these children. primary constriction, centromere, secondary
constriction, telomere and satellite.
™™Based on the position of the centromere,
the chromosomes are classified as
telocentric, acrocentric, sub metacentric
and metacentric chromosomes.
™™Each nucleotide of DNA consists of a
deoxyribose sugar, a nitrogenous base
Figure 18.11 Aneuploidy and a phosphate group. Pairing is always
between a purine and a pyrimidine.
2. Gene or point mutation
™™The sperm, produced by the father,
Gene mutation is the changes occurring
in nucleotide sequence of a gene. It involves determines the sex of the child. The
substitution, deletion, insertion or inversion mother is not responsible in determining
of a single or more than one nitrogenous base. the sex of the child.
Gene alteration results in abnormal protein ™™Mutation is an inheritable change in the
formation in an organism. genetic material of an organism.
10th Standard Science 270

10th_Science [Link] 270 11-01-2020 15:18:52

 [Link]

TEXTBOOK EVALUATION

I. Choose the correct answer

8. Th
 e loss of one or more chromosome in a ploidy
According to Mendel alleles have the
1.  is called ___________.
following character
a) Tetraploidy b) Aneuploidy
a) Pair of genes c) Euploidy d) polyploidy
b) Responsible for character
c) Production of gametes II. Fill in the blanks
d) Recessive factors
The pairs of contrasting character (traits) of
1. 
2. 9 : 3 : 3 : 1 ratio is due to Mendel are called _________.
a) Segregation         b) Crossing over 2. 
Physical expression of a gene is called
c) Independent assortment   d) Recessiveness _________
3. 
The thin thread like structures found
3. 
The region of the chromosome where in the nucleus of each cell are called
the spindle fibres get attached during cell _________.
division
4. DNA consists of two ____________ chains
a) Chromomere b) Centrosome 5. An inheritable change in the amount or
c) Centromere d) Chromonema the structure of a gene or a chromosome is
4. The centromere is found at the centre of the called _______________.
________________ chromosome. Identify whether the statement are
III. 
a) Telocentric b) Metacentric True or False. Correct the false statement
c) Sub-metacentric d) Acrocentric 1. A typical Mendelian dihybrid ratio of F2
5. 
The _____________ units form the generation is 3:1.
backbone of the DNA. A recessive factor is altered by the presence
2. 
a) 5 carbon sugar b) Phosphate of a dominant factor.
c) Nitrogenous bases d) Sugar phosphate 3. Each gamete has only one allele of a gene.
6. Okasaki fragments are joined together by 4. Hybrid is an offspring from a cross between
___________________. genetically different parent.
a) Helicase b) DNA polymerase S ome of the chromosomes have an
5. 
c) RNA primer d) DNA ligase elongated knob-like appendages known as
7. 
The number of chromosomes found in telomere.
human beings are __________________. 6. 
New nucleotides are added and new
a) 22 pairs of autosomes and 1 pair of complementary strand of DNA is formed
allosomes. with the help of enzyme DNA polymerase.
b) 22 autosomes and 1 allosome 7. Down’s syndrome is the genetic condition
c) 46 autosomes with 45 chromosomes.
d) 46 pairs autosomes and 1 pair of
allosomes.

271 Genetics

10th_Science [Link] 271 11-01-2020 15:18:52

 [Link]

IV. Match the following

1. Autosomes - Trisomy 21
2. Diploid condition - 9:3:3:1
3. Allosome - 22 pair of chromosome
4. Down’s syndrome - 2n
5. Dihybrid ratio - 23rd pair of chromosome

V. Answer in a sentence
VII. Long answer questions
1. W hat is a cross in which inheritance of
two pairs of contrasting characters are 1. 
Explain with an example the inheritance
studied? of dihybrid cross. How is it different from
monohybrid cross?
2. Name the conditions when both the alleles
are identical? 2. 
How is the structure of DNA organised?
3. 
A garden pea plant produces axial white What is the biological significance of DNA?
flowers. Another of the same species produced 3. The sex of the new born child is a matter of
terminal violet flowers. Identify the dominant chance and neither of the parents may be
trait? considered responsible for it. What would be
4. 
What is the name given to the segments the possible fusion of gametes to determine
of DNA, which are responsible for the the sex of the child?
inheritance of a particular character?
5. Name the bond which binds the nucleotides VIII. Higher Order Thinking Skills (HOTS)
in a DNA. 1. Flowers of the garden pea are bisexual and
self-pollinated. Therefore, it is difficult to
VI. Short answers questions perform hybridization experiment by crossing
1. 
Why did Mendel select pea plant for his a particular pistil with the specific pollen
experiments? grains. How Mendel made it possible in his
2. 
What do you understand by the term monohybrid and dihybrid crosses?
phenotype and genotype? 2. Pure-bred tall pea plants are first crossed with
3. What are allosomes? pure-bred dwarf pea plants. The pea plants
4. What are Okazaki fragments? obtained in F1 generation are then selfed to
produce F2 generation of pea plants.
Why is euploidy considered to be
5. 
advantageous to both plants and animals? a. What do the plants of F1 generation look
6. A pure tall plant (TT) is crossed with pure like?
dwarf plant (tt), what would be the F1 and F2 b. What is the ratio of tall plants to dwarf
generations? Explain. plants in F2 generation?
7. Explain the structure of a chromosome.
c. 
Which type of plants were missing
8. Label the parts of the DNA in the diagram in F1 generation but reappeared in F2
given below. Explain the structure briefly. generation?

10th Standard Science 272

10th_Science [Link] 272 11-01-2020 15:18:52

 [Link]

3. Kavitha gave birth to a female baby. Her family IX. Value based question
members say that she can give birth to only 1. Under which conditions does the law of
female babies because of her family history. independent assortment hold good and
Is the statement given by her family members why?
true. Justify your answer.

REFERENCE BOOKS I NT ER NET R ES O U RCES

1. 
Veer Bala Rastogi, Introductory Cytology, [Link]
Rastogi Publications, Meerut [Link] [Link]
2. P. S. Verma and V.K. Agarwal, Genetics, S. [Link]
Chand and Company, New Delhi [Link]/
3. Gerald Karp, Janet Iwasa and Wallace Marshall, [Link]
Cell and Molecular Biology - Concepts and down-syndrome/
Experiment, 8th Edition, Wiley and Sons
Publishers

Concept Map

Genetics

Mendel’s Laws
Chromosomes DNA Mutation
of Heredity

Structure Chromosomal mutation

•Primary constriction
Nucleotide
•Changes in the structure
Law of Dominance
•a pentose sugar •Law of Dominance
•Secondary constriction •Changes in number
•a nitrogenous base •Law of Segregation
•Centromere •Euploidy
• a phosphate group •Law of Independent
•Telomere •Aneuploidy
•Satellite • Down’s syndrome assortment

Replication Gene mutation

Types of chromosome
•Origin of replication •Substitution
•Telocentric •Unwinding of DNA •Deletion
•Acrocentric •Formation of RNA primer •Insertion
•Submetacentric •Synthesis of new •Inversion
•Metacentric complementary DNA
•Termination

Kinds of chromosomes
•Autosomes
•Allosomes

Sex determination
inhuman
•Male (44+XY)
•Female (44+XX

273 Genetics

10th_Science [Link] 273 11-01-2020 15:18:52

 [Link]

Learning Objectives

At the end of this lesson the students will be able to:

‹‹Know about Big Bang theory on the origin of universe.
‹‹Understand theories of origin of life.
‹‹Discuss the process of evolution on the basis of the available evidences.
‹‹Relate the principles of Lamarck and Darwin with evolution.
‹‹Know how variation occurs and its significance.
‹‹List the importance of fossils and describe the process of fossilization.
‹‹Identify the plants of ethnobotanical importance.
‹‹Realize about extraterrestrial life.

(Big Bang) and originated 15 billion years ago.

Introduction
The universe comprised of stars, clouds of gas
Living organisms possess distinct and dust which form the galaxies. The solar
characteristics, display organisational and system was probably created when the gaseous
functional unity, entail a mechanism of origin clouds started to collapse due to the force of
and evolution of diversities and maintain a its own gravity forming atoms and particles.
balanced relationship with nature. Most aspects Atoms, dust grains and gaseous disc aggregated
of evolution indicate that the knowledge of the to form clumps and gave rise to planets. This
past has become essential for fully understanding forms the solar system of the milky way galaxy.
the present. Life since its beginning on earth Earth was supposed to have been formed about
had changed through time. The history of life 4.5 billion years back. Life appeared 500 million
years after the formation of earth.
comprises of two aspects, one is the origin of life
on earth and the other is mechanism involved
in the gradual changes and adaptations of living 19.1 Theories on Origin of Life
organisms through time which is known as the
evolution of life. Many theories have been postulated to
explain the origin of life. The views on the origin
Origin of Earth: Origin of life is linked
of life has been putforth as
with the origin of earth. The Big Bang theory
explains the Origin of Universe. It proposes Special creation: This idea embodies
that the universe had an explosive beginning that life on Earth is a divine creation and also
274

10th_Science [Link] 274 11-01-2020 13:47:58

 [Link]

attributes to supernatural event at a particular 19.2.1 Evidences from

time in the [Link] also emphasizes that life has Morphology and Anatomy
not changed ever since its origin.
The comparative study of morphology and
Spontaneous generation (Abiogenesis): anatomy of animals, reveal that they possess
According to this theory life originated common set of characteristics.
spontaneously from lifeless matter. It was
i. Homologous organs: The homologous
believed that fishes originated from mud, frogs
organs are those which have inherited
from moist soil and insects from decaying
from common ancestors with similar
matter.
developmental pattern in embryos. The
Biogenesis: It was speculated by Louis fore limbs of mammals are homologous
Pasteur (1862) that life originates from pre- structures. A human hand, a front leg of a
existing life. He showed that pre-sterilised cat, flipper of a whale and a bat’s wing look
flasks kept closed airtight, with killed yeast, did dissimilar and adapted for different
not give rise to any life form, while in another functions. Their mode of development
flask kept open to air living organisms arose and basic structure of bone are similar.
from killed yeast.
Human
Extraterresterial or Cosmic origin: Some Cat Whale Bat

scientists still believe that life came from outer Humerus

space. This states that units of life called spores Humerus

Ulna Radius
Carpal
(Panspermia) were transferred to different 5
Metacarpal
Radius
Ulna
4
planets including earth. This is still an idea of Carpal
1
Radius
some astronomers. Ulna
Carpal 5

Chemical Evolution of Life: This idea Meta- 1

3 4 2
carpal
was developed by Oparin (1922) and Haldane 5
1
5 43
2 2
3
Phalanges
(1929). They proposed that with the conditions 4 32 Phalanges

prevailing on earth, life arose by a series of Figure 19.1 Forelimbs of vertebrates showing
sequential chemical reactions. The first form homologous structure
of life could have come from pre-existing non-
ii. Analogous organs: The analogous
living inorganic molecules which gave rise
organs look similar and perform similar
to formation of diverse organic molecules
functions but they have different origin
which are transformed into colloid system to
produce life. The modern concept on chemical Bat wing

evolution regarding origin of life was accepted.

19.2 Evidences of Evolution Bird wing

Evolution can be better understood only

by observing the interrelationship between
the existing organisms and also relating the Insect wing

similarities with the extinct organisms. The inter

relationship of the organisms is also supported
by evidences from different branches of biology.
These evidences support the concept that all Figure 19.2 Analogous structure showing a bat
organisms have evolved from common ancestors. wing, a bird wing and an insect wing
275 Origin and Evolution of Life

10th_Science [Link] 275 11-01-2020 13:47:59

 [Link]

and developmental pattern. The function animal repeats the evolutionary history of the
of the wings of a bat, the wings of a bird entire race of the animal.
and wings of an insect are similar, but
their basic structures are different. 19.2.2 Evidences from
Palaeontology
iii. Vestigial organs: The degenerated
and non-functional organs of Palaeontology deals with
animals are called vestigial organs. the study of fossils. Leonardo
The same organs are found to be well- da Vinci is called the Father of
developed and functional, in some Palaeontology. The study of
of the related forms. Some of the fossils helps us to understand
vestigial organs in man are vermiform the line of evolution of many
appendix, nictitating membrane, invertebrates and vertebrates. Fossil records
caudal vertebra, coccyx etc. show that the evolution has taken a gradual
process from simple to complex organisms.
iv. Atavism: The reappearance of ancestral
The origin of modern birds is supported by the
characters in some individuals is called
evidences from palaeontology.
atavism. e.g. Presence of rudimentary
tail in new born babies, presence of Archaeopteryx: Archaeopteryx is the
thick hair on the human body. oldest known fossil bird. It was an early bird-
like form found in the Jurassic [Link] is
19.2.2 E
 vidences from considered to be a connecting link between
Embryology reptiles and birds. It had wings with feathers,
like a bird. It had long tail, clawed digits and
The study of comparative embryology
conical teeth, like a reptile.
of different animals, supports the concept of
evolution. The embryos from fish to mammals
are similar in their early stages of development.
The differentiation of their special characters
appear in the later stages of development.

Gill-slits

Figure 19.4 Archaeopteryx - Fossil bird

Gill
slits
Tail Tail
Gills Fore-limb bud

19.3 Theories of Evolution

Hind-limb bud

Life had evolved along with evolution of

earth towards the end of 18th century. Evolution
is the gradual change occurring in living
Fish Salamander Tortoise Chick Rabbit Man
organisms over a period of time. Formation
Figure 19.3 Embryonic development of new species due to changes in specific
of vertebrates characters over several generations as response
Biogenetic law or Recapitulation theory to natural selection, is called evolution. The
was given by Ernst Haeckel. According to this natural changes occuring is explained through
theory, Ontogeny recapitulates Phylogeny. the theories of evolution as proposed by
The stages of development of the individual Lamarck and Darwin.

10th Standard Science 276

10th_Science [Link] 276 11-01-2020 13:47:59

 [Link]

19.3.1 Lamarckism leaves from trees. The continuous stretching

of their neck and forelimbs resulted in
Jean Baptiste Lamarck (1744-1829) was a
the development of long neck and long
French naturalist, well known for his theory of
forelimbs which is an example for constant
evolution. Lamarck’s theory of evolution was
published in ‘Philosophic Zoologique’ in the use of an organ. The degenerated wing of
year 1809. It is popularly known as ‘Theory of Kiwi is an example for organ of disuse.
inheritance of Acquired Characters” or “Use iv. Theory of Inheritance of acquired
and Disuse theory” or Lamarckism. characters
When there is a change in the environment,
Principles of Lamarckism the animals respond to the change. They
i. Internal vital force develop adaptive structures. The characters
Living organisms or their component parts developed by the animals during their life
tend to increase in size continuously. This time, in response to the environmental
increase in size is due to the inherent ability changes are called acquired characters.
of the organisms. According to Lamarck, the acquired
ii. Environment and new needs characters are transmitted to the offspring
A change in the environment brings about by the process of inheritance.
changes in the need of the organisms. In
response to the changing environment, 19.3.2 Darwinism or Theory of
the organisms develop certain adaptive Natural Selection
characters. The adaptations of the organisms Charles Darwin (1809-1882) was one
may be in the form of development of new of the great naturalist and philosopher of 18th
parts of the body. century. He was born in England in 1809. While
iii. Use and disuse theory studying in college through his friendship with
Lamarck’s use and disuse theory states that Professor [Link] he was fascinated towards
if an organ is used constantly, the organ nature. At that time the British Admiralty
develops well and gets strengthened. When planned a voyage of exploration for 5 years
an organ is not used for a long time, it on a ship named H.M.S. Beagle around South
gradually degenerates. America. Dr Henslow was asked to nominate
The ancestors of giraffe were provided a young naturalist for the voyage. Darwin was
with short neck and short forelimbs. Due to given the opportunity. During his five years
shortage of grass, they were forced to feed on (1831–1835) voyage he visited many parts of

Environmental change

Need for new structure

Development of new structure

Organs of Use Organs of Disuse

Inheritance of adaptive characters Degeneration of the structure

Origin of new species

Flow chart showing the postulates of Lamarckism
277 Origin and Evolution of Life

10th_Science [Link] 277 11-01-2020 13:47:59

 [Link]

the world, a number of islands including the remain the same. This creates an intense
Galapagos island and Pacific island. Darwin competition among the organisms for food
made elaborate observations on nature of the and space leading to struggle. The struggle
land, plants and animals of the regions he visited. for existence are of three types:
He further worked for a period of 20 years to a. Intraspecific struggle: Competition
develop the theory of natural selection. among the individuals of same species.
Darwin published his observations and b. Interspecific struggle: Competition
conclusions under the name ‘Origin of species’ between the organisms of different
in 1859. The book of Darwin demonstrates species living together.
the fact of evolution. It elaborates on the c. Environmental struggle: Natural
theory of Natural selection for evolutionary conditions like extreme heat or cold,
transformation, drought and floods can affect the
existence of organisms
Principles of Darwinism iii. Variations
i. Overproduction The occurrence of variation is a
Living beings have the ability to reproduce characteristic feature of all plants and
more individuals and form their own animals. Small variations are important
progeny. They have the capacity to for evolution. According to Darwin
multiply in a geometrical manner. This will favourable variations are useful to the
organism and unfavourable variations are
increase reproductive potential leading to
harmful or useless to the organism.
overproduction.
iv. Survival of the fittest or Natural selection
ii. Struggle for existence
During the struggle for existence, the
Due to over production, a geometric ratio
organisms which can overcome the
of increase in population occurs. The space
challenging situation, survive and adapt to
to live and food available for the organisms

Overproduction

Struggle for existence

Variations

Organisms eliminated from Natural selection

the environment
Survival of the fittest

Inheritance of acquired
characters

Gradual accumulation of
favourable characters

Origin of new species

Flowchart showing the postulates of Darwinism

10th Standard Science 278

10th_Science [Link] 278 11-01-2020 13:47:59

 [Link]

the surrounding environment. Organisms Discontinuous variation: These are sudden

which are unable to face the challenges, are changes which occur in an organism due to
unfit to survive and disappear. The process mutations. They do not have any intermediate
of selection of organisms with favourable forms. These large variations are not useful for
variation is called as natural selection.
evolution. e.g. short legged Ancon sheep, six or
v. Origin of species more digits (fingers) in human, etc.
According to Darwin, new species
originates by the gradual accumulation Discontinuous variation form the basis for
of favourable variations for a number of Mutation theory proposed by De Vries.
generations.
Relationship between Mutation and
19.4 Variation Variation
Mutation and Variation are two events
Sexual reproduction, which involves involved in the process of evolution. Mutation
meiosis helps in recombination of genes arises due to errors occurring in DNA during
during gametic fusion. This leads to replication or exposure to UV rays or chemicals.
differences in the phenotype of the offspring Mutation leads to variation. It brings about
from its parents. These differences are called changes in a single individual.
variation.
Variation is the difference found among
individuals of the same species and the 19.5 Paleobotany
offspring of the same parent. Variation is the
raw material which plays an important role Paleobotany is derived from Greek words
in evolution. Evolution would not be possible paleon that means “old” and botany the study
without variation. of plants. It is the branch of paleontology that
deals with recovery and identification of plant
Types of variations remains of geological past.
Somatic variation: These are the variations A plant fossil is any preserved part of
which affect the body (somatic) cells of the a plant that has died long back. Fossils may
organisms. They are not heritable. They occur be a prehistoric impression that may be
due to environmental factors. hundred to millions of years old. Majority
Germinal variation: These variations are of the plant fossils are disarticulated parts
produced in germ cells of an organism. They are of plants, it is rare to find plants to be
inherited. They may be present in ancestors or preserved as whole.
may occur suddenly. They are classified into two
types: Importance of fossils
1. Continuous variation i They throw light on phylogeny and
2. Discontinuous variation evolution of plants.
Continuous variation: These are small variations ii Fossil plants give a historical approach to
which occur among individuals of a population. plant kingdom.
They are also called as fluctuating variations. iii Fossils are useful in classification of
They occur by gradual accumulation in a plants.
population. e.g. skin colour, height and weight iv. Fossil plants can be used in the field of
of an individual, colour of eye, etc. descriptive and comparative anatomy.

279 Origin and Evolution of Life

10th_Science [Link] 279 11-01-2020 13:47:59

 [Link]

Kaspar Maria Von Sternberg bed and are covered by sediment. The process
He is the “Father of Paleobotany” (1761– of sedimentation goes on continuously and
1838) was born in Europe. He established the fossils are formed.
Bohemian National Museum in Prague and is
Infiltration or Replacement
deemed to be the founder of Modern Paleobotany.
The precipitation of minerals takes place
Birbal Sahani which later on infiltrate the cell wall. The
He is the “Father of Indian Paleobotany” process is brought about by several mineral
(1891–1949). He presented his research on two elements such as silica, calcium carbonate
different areas of Paleobotany (i) The anatomy and magnesium carbonate. Hard parts are
and morphology of Paleozoic Ferns (ii) The fossil dissolved and replaced by these minerals.
plants of the Indian Gondwana Formations.
Living Fossils: These are living
19.5.1 Fossilization
organisms that are similar in
The process of formation of fossil in the appearance to their fossilized
rocks is called fossilization. distant ancestors and usually have no
Common methods of fossilization includes extinct close features. e.g. Ginko biloba.
petrifaction, molds and cast, carbonization,
preservation, compression and infiltration.
19.5.2 Determination of age of
Petrifaction Fossils
Minerals like silica slowly penetrate in and The age of fossils is determined by radioactive
replace the original organic tissue and forms elements present in it. They may be carbon,
a rock like fossil. This method of fossilization uranium, lead or potassium. It is used in
can preserve hard and soft parts. Most bones paleobotany and anthropology for determining
and wood fossils are petrified. the age of human fossils and manuscripts.
Mold and Cast Radioactive carbon(C14) dating method
A replica of a plant or animal is preserved This method was discovered by
in sedimentary rocks. When the organism W.F. Libby (1956). Carbon consumption of
gets buried in sediment it is dissolved by animals and plants stops after death and since
underground water leaving a hollow depression then, only the decaying process of C14 occurs
called a mold. It shows the original shape continuously. The time passed since death of a
but does not reveal the internal structure. plant or animal can be calculated by measuring
Minerals or sediment fill the hollow depression the amount of C14. present in their body.
and forms a cast.
Preservation More to Know
Original remains can be preserved in What is the Geologic Time Scale?
ice or amber (tree sap). They protect the The geological time scale is a system of
organisms from decay. The entire plant or chronological dating that relates geological
animal is preserved. rock strata to time, and is used by geologists,
Compression paleontologists, and other Earth scientists to
describe the timing and relationships of events
When an organism dies, the hard parts
that have occurred during Earth’s history.
of their bodies settle at the bottom of the sea

10th Standard Science 280

10th_Science [Link] 280 11-01-2020 13:48:00

 [Link]

‹‹Tribal communities utilize

Thiruvakkarai fossil wood
ethnomedicinal plant parts like bark,
park (Villupuram district,
stem, roots, leaves, flower bud, flowers,
Tamil Nadu): 2 million years
fruits, seeds, oils, resins, dyes, gum for
ago tree trunks that got buried
the treatment of diseases like diarrhoea,
along the river, incourse of time the
fever, headache, diabetes, jaundice,
organic matter was replaced by silica and
snakebites, leprosy, etc.
was fossilized. They retained their color,
shape and texture and was converted
into solid rocks. The 19.7 Astrobiology/Exobiology
annular rings, the
texture, colors of the Are we alone in the universe? If your answer
layers, nodes and is no, then how do you detect the existence of
every properties of life in space? Astrobiology/exobiology is the
plants are still visible. science which looks for the presence of extra
terrestrial life in the universe.
Astrobiology deals with the origin,
19.6 Ethnobotany evolution and distribution of life in the
universe and to investigate the possibility of
Ethnobotany is the study of a region’s
life in other world.
plants and their practical uses through the
traditional knowledge of the local culture The major concept in astrobiology is the
of people. The term Ethnobotany was coined habitable zone. The theory explains that any
by J.W. Harshberger in 1895 to include the planets can support the existence of life, if it
study of plants used by the primitive and fulfills two important criteria.
aboriginal people. Though this discipline has i It must have a right mass to retain an
existed for ages, ethnobotany emerged as a atmosphere.
distinct academic branch of natural science in
ii It must have an orbit at just the right
20th century.
distance from its star (Sun) that it allows
Aspects of ethnobotany liquid water to exist. Thus, the distance
need to be neither too hot or not too cold
Ethnobotany has relevance with problems
and is often referred as Goldilock Zone for
of nutrition, health care and life support
life.
system, faith in plants, cottage industries,
economic upliftment, conservation of In our solar system ‘Earth’ is the only
biodiversity and sustainable use of plant planet in the goldilock zone. Since, this zone
resources. varies at times as the star evolves, we know
that Mars have also been habitable. The life on
Importance of Ethnobotany
Mars are likely to be the creatures, we find in
‹‹It provides traditional uses of plant. extreme environments on earth.
‹‹It gives information about certain The organisms which live in extreme
unknown and known useful plants. environmental conditions on earth are called
‹‹The ethnomedicinal data will serve extremophiles. Thus, within our own Solar
as a useful source of information for System, there are many areas that are different
the chemists, pharmacologists and from the Earth where it is probable to find the
practitioners of herbal medicine. presence of life similar to extremophile bacteria.
281 Origin and Evolution of Life

10th_Science [Link] 281 11-01-2020 13:48:00

 [Link]

Figure 19.5 Microbial diversity from sandstone and granite from the McMurdo Dry Valleys, Antarctica

selection and origin of species are the main

NASA is developing the Mars postulates of Darwinism.
2020 astrobiology to investigate
Each species tends to produce large
 
an astrobiologically relevant
number of offsprings, but only the fittest
ancient environment on Mars, its surface can survive.
geological processes and the possibility
Homologous, analogous organs and
 
of past life on Mars and preservation of embryological evidences explain
biosignatures within accessible geological evolutionary relationships.
materials. Some traits in organisms would be similar
 
because they are inherited from a common
Points to Remember
ancestor.
Lamarck proposed that the acquired
  Fossils are evidences of ancient life forms
 
characters are passed on to the offsprings or ancient habitats which have been
in the next generation preserved by natural processes.
Internal vital force, environment and
  Ethnobotanical importance of various
 
new needs, use and disuse theory and types of plants are know through
inheritance of acquired characters are the traditional knowledge.
main principles of Lamarckism. Astrobiology/exobiology is the science
 
Overproduction, struggle for existence,
  which looks for the presence of extra
variations, survival of the fittest or Natural terrestrial life in the universe

TEXTBOOK EVALUATION

I Choose the correct answer 2. The ‘use and disuse theory’ was proposed
1. Biogenetic law states that ______________ by ______________.

a. Ontogeny and phylogeny go together a. Charles Darwin

b. Ontogeny recapitulates phylogeny b. Ernst Haeckel

c. Phylogeny recapitulates ontogeny c. Jean Baptiste Lamarck

d. 
There is no relationship between d. Gregor Mendel
phylogeny and ontogeny
10th Standard Science 282

10th_Science [Link] 282 11-01-2020 13:48:00

 [Link]

3. Paleontologists deal with IV Match the following

a. Embryological evidences Column A Column B
b. Fossil evidences a) Atavism caudal vertebrae and
c. Vestigial organ evidences vermiform appendix
d. All the above b) Vestigial a forelimb of a cat and a
organs bat’s wing
4. The best way of direct dating fossils of
c) Analogous rudimentary tail and
recent origin is by
organs thick hair on the body
a. Radio-carbon method d) Homologous a wing of a bat and
b. Uranium lead method organs a wing of an insect
c. Potassium-argon method e) Wood park radiocarbon dating
d. Both (a) and (c) f) W.F. Libby Thiruvakkarai
5. The term Ethnobotany was coined by
V Answer in a word or sentence
a. Khorana b. J.W. Harsbberger
1. A human hand, a front leg of a cat, a
c. Ronald Ross d. Hugo de Vries
front flipper of a whale and a bat’s wing
II Fill in the blanks look dissimilar and adapted for different
functions. What is the name given to these
1. The characters developed by the animals
organs?
during their life time, in response to
the environmental changes are called 2. Which organism is considered to be the
fossil bird?
______________.
3. What is the study of fossils called?
2. The degenerated and non-functional
organs found in an organism are called VI Short answers questions
______________.
1. The degenerated wing of a kiwi is an
3. The forelimbs of bat and human are acquired character. Why is it an acquired
examples of ______________ organs. character?
4. The theory of natural selection for 2. Why is Archaeopteryx considered to be a
evolution was proposed by ____________. connecting link?
3. Define Ethnobotany and write its importance.
III 
State true or false. Correct the false
4. How can you determine the age of the fossils?
statements
1. The use and disuse theory of organs’ was VII Long answer questions
postulated by Charles Darwin. 1. Natural selection is a driving force for
2. The homologous organs look similar evolution-How?
and perform similar functions but they 2. How do you differentiate homologous
have different origin and developmental organs from analogous organs?
pattern. 3. How does fossilization occur in plants?
3. Birds have evolved from reptiles.

283 Origin and Evolution of Life

10th_Science [Link] 283 11-01-2020 13:48:00

 [Link]

IX Higher Order Thinking Skills (HOTS) 2. Stephen. C. Stearns and Rolf. F. Hoekstra
1. Arun was playing in the garden. Suddenly Evolution - An introduction
he saw a dragon fly sitting on a plant. He 3. Archer, S.D.J., Asuncion de los, R., Lee,
observed the wings of it. He thought it K.C., Niederberger, T.S., Cary, S.C.,
looked similar to a wing of a crow. Is he Coyne, K.J., Douglas, S., Lacap-Bugler,
correct? Give reason for your answer. D.C. and Pointing, S.B., 2017. A Endolithic
2. Imprints of fossils tell us about evolution- microbial diversity in sandstone and
How? granite from the McMurdo Dry Valleys,
3. Octopus, cockroach and frog all have eyes. Antarctica. Polar biology, 40 (5): 997-1006.
Can we group these animals together to
establish a common evolutionary origin.
Justify your answer. I NT ER NET R ES O U RCES

[Link]
REFERENCE BOOKS
[Link]
1. 
B. [Link] and S. P. Singh, An Introduction exobiology/
to General Biology, 9th Edition, Rastogi
[Link]
Publications, Meerut.

Concept Map
Evolution

Origin of life Evidences for evolution Theories of evolution

Views Morphology and Anatomy Lamarckism

• Special creation •Homologous organs •Use and Disuse Theory
•Analogous organs
• Spontaneous •Vestigial organs
generation (Abiogenesis) •Atavism
Darwinism
• Biogenesis
• Theory of Natural Selection
• Extra terresterial
or Cosmic orgin Embryology
• Chemical evolution •Biogenetic law
of life

Paleontology
•Fossils

10th Standard Science 284

10th_Science [Link] 284 11-01-2020 13:48:00

 [Link]

Ethnic groups in india

Ethnobotany

Importance of ethnobotany

Petrifaction
Evolution
Mold and cast

Fossilization Preservation

Compression

Paleobotany Replacement

Determination of Radioactive carbon

age of fossils dating method

ICT CORNER ORIGIN AND EVOLUTION OF LIFE

This game will enable the students

to understand the evolution of living
organisms. But it was created on the basis
of general truths and not specific scientific
related.
Steps
• Access the application “HUMAN EVOLUTION CLICKER GAME:RISE OF MANKIND” with the help
of provided URL or QR code. Download and Install it in the mobile.
• You can view a bubble for ten seconds, touch it to reveal the hidden DNA.
• By joining two DNAs, a bacteria will be formed. By joining two bacteria, amoeba will be appeared.
• Continue the same to form many other species by combining different species. There are 52 living
organism exist now in the application. Explore everything.

Step1 Step2 Step3 Step4

Cells alive
[Link]

*Pictures are indicative only

285 Origin and Evolution of Life

10th_Science [Link] 285 11-01-2020 13:48:02

 [Link]

BREEDING
20 AND
BIOTECHNOLOGY

Learning Objectives

At the end of this lesson the students will be able to :

‹‹Define and discuss the steps and methods involved in plant breeding.
‹‹Know the crop varieties produced by crop improvement.
‹‹Understand animal breeding and its implications.
‹‹Point out the differences between inbreeding and outbreeding.
‹‹Know what is hybrid vigour and its importance.
‹‹Identify the steps involved in genetic engineering.
‹‹Understand the practical applications of DNA fingerprinting.
‹‹Gain knowledge on gene therapy.
‹‹Know the importance of stem cell technology.

which paved way to develop advanced healthcare

Introduction
products, diagnostic kits and food production to
India’s population is likely to reach 1.7 improve the quality of human life.
billion by 2050. Current rate of India’s food
production will be able to meet only 59% of 20.1  Modern Agricultural
the country’s food demand at that time. How Practices and Crop
can India feed 1.7 billion people by 2050? This Improvement
can be made possible by ‘Plant breeding’ and Modern agricultural practices are
‘Animal husbandry’. activities carried out to improve cultivation of
Plant breeding is the art of developing plants. It includes preparation of soil, sowing,
economically important plants with superior application of manures and fertilizers, proper
quality. irrigation, protection from weeds and pests
Animal husbandry involves the breeding of harvesting, threshing and storage.
animals. It aims at improving the genotypes of The aim of crop improvement is to
animals to make them more useful to the welfare develop improved crop varieties possesing
of [Link] emphasizes domestication higher yield, better quality, resistance to
and propagation of animals,under controlled diseases and shorter duration.
conditions to enhance food production and
food quality. 20.2 Green Revolution
Another breakthrough was the emergence Green Revolution is the process of
of biotechnology as an entity of modern biology, increasing food production through high
286

10th_Science [Link] 286 11-01-2020 14:19:39

 [Link]

yielding crop varieties and modern agricultural Peta from Indonesia, and Dee-geo-woo-gen
techniques in underdeveloped and developing (DGWG) a dwarf variety from China.
nations. Dr. Norman E. Borlaug, an American
agronomist the “Father of the Green
Revolution”, received the Nobel Peace Prize in
1970. In India Dr. M. S. Swaminathan joined
with [Link] in bringing Green Revolution
by introducing Mexican wheat varieties. This
eventually increased wheat and rice production
between 1960 and 2000.
Figure 20.1 IR-8
20.2.1 Breeding for high yield
and better quality More to Know
Major challenge that India faced during
Dr. G. Nammalvar
post-independance period was having
Dr. G. Nammalvar (1938-2013)
enough food production for the growing
was a Tamil agricultural
population. Efforts were taken to develop
scientist, environmental
high yielding varieties of crops, leading to
activist and organic farming
Green Revolution.
expert. He founded Nammalvar Ecological
Semi-Dwarf varieties in Wheat and Rice Foundation for Farm Research and Global
Sonalika, Kalyan Sona are semi-dwarf Food Security Trust (NEFFFRGFST-
varieties of wheat developed from high- Vanagam) to create public awareness about
yielding, semi-dwarf, fertilizer responsive the benefits of organic farming.
wheat varieties from Mexico. IR-8 (Miracle
rice) is a high-yielding semi-dwarf rice variety
20.2.2 Plant Breeding for
developed by International Rice Research
Disease Resistance
Institute (IRRI),Philippines. In 1966, this was
first introduced in Philippines and India. It Plant diseases are caused by pathogens like
was a hybrid of a high yielding rice variety viruses, bacteria and fungi. This affects crop
yield. Hence, it is important to develop disease
More to Know resistant varieties of crops, that would increase
the yield and reduce the use of fungicides and
Dr. M. S. Swaminathan bactericides. Some disease resistant varieties
Dr. Mankombu Sambasivan developed by plant breeding are given below:
Swaminathan is an Indian
scientist known for his Table 20.1 Disease resistant crop varieties
leading role in India’s Green Crop Variety Resistance to
Revolution. His research on diseases
potato, wheat, rice and jute are well known
Wheat Himgiri Leaf and stipe
plant breeding experiments. Due to his
rust, hill bunt
efforts the wheat production increased from
twelve million tonnes in 1960's to seventy Cauliflower Pusa Shubhra, Black rot
million tonnes now. He is aptly called as the Pusa Snowball K-1
“Father of Indian Green Revolution”. Cowpea Pusa Komal Bacterial blight

287 Breeding and Biotechnology

10th_Science [Link] 287 11-01-2020 14:19:39

 [Link]

20.2.3 Plant Breeding for

Insects/Pests Resistance
In addition to microorganisms, a large
number of insects and pests also cause damage
to the crops. Hence, insect and pest resistant
crop varieties were developed. Some of them
are given below:

Table 20.2 Insects /pests resistant varieties Figure 20.2 Protina–lysine rich Maize

Crop Variety Resistant to 2. Atlas 66, a protein rich wheat variety.

Insects/Pests
Brassica Pusa Gaurav Aphids
Flat Bean Pusa Sem 2, Leaf hopper,
Pusa Sem 3 aphids and
fruit borer
Lady’s finger Pusa Sawani, Shoot and fruit
Pusa A4 borer

Figure 20.3 Atlas 66-protein rich Wheat

20.2.4 Plant Breeding for Improved
Nutritional Quality 3. Iron rich fortified rice variety.
Undernutrition and protein malnutrition 4. Vitamin A enriched carrots, pumpkin and
among human population is a major health spinach.
problem which has been receiving much focus
throughout the world. Apart, from humans it also 20.3  Methods of Plant
affects the health of farm animals. To combat these Breeding for Crop
conditions, human and animal health are to be Improvement
determined by the nutritional quality of the feed
Methods of plant breeding to develop
crops. The nutritional quality of crops depends on
high yielding varieties are given below:
quality and quantity of [Link] nutritional
quality may be improved with respect to its 1. Introduction of new varieties of plants
1. Protein content and quality of protein 2. Selection
3. Polyploidy breeding
2. Oil content
4. Mutation breeding
3. Mineral content
5. Hybridization
Biofortification
20.3.1 Introduction of New
Biofortification is the scientific process Varieties of Plants
of developing crop plants enriched with high
levels of desirable nutrients like vitamins, It is a process of introducing high yielding
proteins and minerals. Some examples of crop varieties of plants from one place to another. Such
plants are called as exotic species. These imported
varieties developed as a result of biofortification
plant materials may carry pathogens and pests,
are given below:
hence they are thoroughly tested in a plant
1. Protina, Shakti and Rathna are lysine rich quarantine before being introduced to the fields.
maize hybrids (developed in India). e.g Phaseolus mungo was introduced from China.

10th Standard Science 288

10th_Science [Link] 288 11-01-2020 14:19:39

 [Link]

20.3.2 Selection is also called as individual plant selection.

In pureline selection large numbers of plants
Selection is one of the oldest methods of
are selected from a self-pollinated crop and
plant breeding in which individual plants or
harvested individually.
groups of plants are sorted out from a mixed
population based on the morphological Individual plant progenies from them are
characters. evaluated separately. The best one is released
as a pureline variety. Progeny is similar both
Methods of selection
genotypically and phenotypically.
There are three methods of selection.
They are 3. Clonal selection
1. Mass selection A group of plants produced from a
2. Pureline selection single plant through vegetative or asexual
3. Clonal selection reproduction are called clones.
All the plants of a clone are similar both
1. Mass selection
in genotype and phenotype. Selection of
Seeds of best plants showing desired
desirable clones from the mixed population of
characters are collected from a mixed
vegetatively propagated crop is called clonal
population. The collected seeds are allowed
selection.
to raise the second generation. This process is
carried out for seven or eight generations. At
the end, they will be multiplied and distributed 20.3.3 Polyploidy Breeding
to the farmers for cultivation. Sexually reproducing organisms have
Some common examples for mass two complete set of chromosomes in their
selection are groundnut varieties like TMV–2 somatic cells. This is called diploid (2n).
and AK–10. Its schematic representation is The gametic cells have only one set of
given below. chromosome. This is called haploid (n).
An organism having more than two sets of
chromosomes is called polyploid (Greek :
Polys = many + aploos = one fold + eidos =
form). Such condition is called Polyploidy. It
can be induced by physical agents such as
heat or cold treatment, X-rays and chemical
agents like colchicine.

Achievements of polyploidy breeding

Some achievements of polyploidy
breeding are
a. Seedless watermelons (3n) and bananas (3n).
b. TV-29 (triploid variety of tea) with larger
shoots and drought tolerance.
Figure 20.5 Mass Selection c. Triticale (6n) is a hybrid of wheat and rye. To
make this plant fertile polyploidy is induced.
2. Pureline selection It has higher dietary fibre and protein.
Pureline is “the progeny of a single d. Raphano brassica is an allotetraploid by
individual obtained by self breeding”. This colchicine treatment.
289 Breeding and Biotechnology

10th_Science [Link] 289 11-01-2020 14:19:39

 [Link]

20.3.4 Mutation Breeding Achievements of mutation breeding

Some achievements of mutation breeding are
Mutation is defined as the sudden
heritable change in the nucleotide sequence a. Sharbati Sonora wheat produced from
of DNA in an organism. It is a process by Sonora-64 by using gamma rays.
which genetic variations are created which b. Atomita 2 rice with saline tolerance and
in turn brings about changes in the organism. pest resistance
The organism which undergoes mutation is c. Groundnuts with thick shells
called a mutant.
The factors which induce mutations are 20.3.5 Hybridization
known as mutagens or mutagenic agents. Hybridization may be defined as the
Mutagens are of two types namely physical process of crossing two or more types of plants
mutagens and chemical mutagens. for bringing their desired characters together
into one progeny called hybrid. Hybrid is
More to Know superior in one or more characters to both
parents. Hybridization is the common method
Gamma Garden of creating genetic variation to get improved
Gamma garden or Atomic garden is a varieties.
concept popularised after World War II for
the peaceful use of atomic energy for crop Hybridization Experiment: Triticale (The
improvement. This is a type of induced first man – made cereal)
mutation breeding where radioactive sources Triticale is the first man- made cereal
particularly gamma rays from Cobalt-60 or hybrid. It is obtained by crossing wheat
Caesium-137 are used to induce desirable (Triticum durum, 2n = 28) and rye (Secale
mutations in crop plants. cereal, 2n = 14). The F 1 hybrid is sterile
(2n = 21). Then the chromosome number is
doubled using colchicine and it becomes a
hexaploid Triticale (2n = 42).
The cycle of crop raising and selection
continues till the plants with the desired
characters are finally obtained. The
development of new varieties is a long-drawn
process. Two main aspects of hybridization
are to combine the characters of two plants in
one plant and to utilize hybrid vigour.
i Physical mutagens
Radiations like X-rays, α, β and γ-rays, 20.4 Animal Breeding
UV rays, temperature etc. which induce
mutations are called physical mutagens A breed is a group of animals of common
origin within a species that has certain
ii Chemical mutagens distinguishing characters that are not found in
Chemical substances that induce other members of the same species like general
mutations are called chemical mutagens. appearance and others striking features.
e.g. Mustard gas and nitrous acid. The utilisation Breeding involves mating parents of
of induced mutation in crop improvement is
different varieties each having some desired
called mutation breeding.
trait which are passed onto the offspring.

10th Standard Science 290

10th_Science [Link] 290 11-01-2020 14:19:39

 [Link]

Objectives of Animal Breeding

Animal breeding aims at improving the
genotypes of domesticated animals to increase
their yield and improve the desirable qualities to
produce milk, egg and meat.
When breeding takes place between
animals of the same breed, it is called
inbreeding. The cross between different breeds
is called outbreeding.

20.4.1 Inbreeding
Inbreeding refers to the mating of closely
Figure 20.6 Cross breeding to produce Mule
related animals within the same breed for
with superior characters
about 4-6 generations. Superior males and
superior females of the same breed are identified Info bits
and mated in pairs. It helps in the accumulation
of superior genes and elimination of genes Cross breed of fowls:
which are undesirable. White Leghorn X Plymouth Rock
Hissardale is a new breed of sheep
developed in Punjab by crossing Bikaneri Hybrid fowl - yield more eggs
(Magra) ewes and Australian Marino rams.
Cross breed of cows:
Inbreeding depression: Continued inbreeding Developed by mating the bulls of exotic
reduces fertility and productivity. Inbreeding breeds and cows of indigenous breeds.
exposes harmful recessive genes that are
Brown Swiss X Sahiwal
eliminated by selection.

Karan Swiss - yield 2-3 times more milk

20.4.2 Outbreeding than indigenous cows.

It is the breeding of unrelated animals.

The offsprings formed are called hybrids. The
20.4.3 Heterosis
hybrids are stronger and vigorous than their
parents. Cross between two different species with The superiority of the hybrid obtained by
desirable features of economic value are mated. cross breeding is called as heterosis or hybrid
Let’s see what cross produce a mule. vigour.
Cross breeding
Effects of hybrid vigour in animal breeding
Male Donkey X Female Horse - Increased production of milk by
cattle
Mule - Increased production of egg by poultry
- High quality of meat is produced
Mule is superior to horse in strength,
- Increased growth rate in domesticated
intelligence, ability to work and resistance to
animals
diseases but they are sterile.

291 Breeding and Biotechnology

10th_Science [Link] 291 11-01-2020 14:19:39

 [Link]

a. Presence of plasmid in bacteria that can

20.5 Genetic Engineering
undergo replication independently along
Genetic engineering with chromosomal DNA.
is the manipulation and b. Restriction enzymes cuts or break DNA
transfer of genes from at specific sites and are also called as
one organism to another molecular scissors.
organisms to create a new c. DNA ligases are the enzymes which help in
DNA called as recombinant ligating (joining) the broken DNA fragments.
DNA(rDNA). The term
20.5.2 Gene Cloning
recombinant is used because DNA from two
different sources can be joined together. What reminds to your mind when you
Hence, genetic engineering is also called as hear the word clone? Of course, ‘DOLLY’
recombinant DNA technology. the cloned sheep. The carbon copy of an
individual is often called a clone. However,
Plasmid is the small more appropriately, a clone means to make a
circular double stranded genetically exact copy of an organism.
DNA molecule found in the In gene cloning, a gene or a piece of
cytoplasm of bacterial cell and separated DNA fragment is inserted into a bacterial cell
from chromosomal DNA. It can replicate where DNA will be multiplied (copied) as the
independently. cell divides. A brief outline of the basic steps
involved in gene cloning are:
i. Isolation of desired DNA fragment by
using restriction enzymes
ii. Insertion of the DNA fragment into a
suitable vector (Plasmid) to make rDNA
More to Know iii. Transfer of rDNA into bacterial host cell
(Transformation)
Restriction enzymes recognises a specific
iv. Selection and multiplication of recombinant
base pair sequence (palindromic sequence)
host cell to get a clone
in DNA called as restriction site and cleaves
v. Expression of cloned gene in host cell.
the phosphodiester bond within DNA.
Using this strategy several enzymes,
hormones and vaccines can be produced

20.5.1 Techniques of Genetic
Engineering – Basic
Requirements
Important discoveries that led to the Figure 20.7 Genetic engineering technique
stepping stone of rDNA technology were (Gene cloning)
10th Standard Science 292

10th_Science [Link] 292 11-01-2020 14:19:40

 [Link]

d. Tissue plasminogen activator is used to

Info bits
dissolve blood clots and prevent heart attack.
Development of Dolly
e. Development of vaccines against various
Dolly was the first cloned female sheep,
diseases like Hepatitis B and rabies
developed by Dr. Ian Wilmut and his
colleagues at the Roslin Institute, Scotland
in July 1996. She was created by somatic cell Eli Lilly and Company,
nuclear transfer technique. She lived for 6.5 United States, in 1979 first
years and died in 2003 because of lung disease. started commercial production
of human insulin by using rDNA
technology.

Gene Therapy
Gene therapy refers to the replacement
of defective gene by the direct transfer of
functional genes into humans to treat genetic
disease or disorder. The genetic makeup of
the ‘patient’ cell is altered using recombinant
DNA technology. It was first successfully
implemented in 1990.
Somatic gene therapy is the replacement
Surrogate of defective gene in somatic cells.
mother (with
implanted
embryo)
Germ line gene therapy replacement of
defective gene in germ cell (egg and sperm).
Gene therapy conducted till date has
targeted only somatic (non-reproductive)
cells. Correction of genetic defects in somatic
cells may be beneficial to the patient but the
20.6 Biotechnology in Medicine corrected gene may not be carried to the next
generation.
Using genetic engineering techniques
medicinally important valuable proteins 20.7 Stem Cells
or polypeptides that form the potential
pharmaceutical products for treatment of Our body is composed of over 200
various diseases have been developed on a specialised cell types, that can carry out specific
commercial scale. functions. e.g. neurons or nerve cell that can
Pharmaceutical products developed by transmit signals, or heart cells which contract
rDNA technique to pump blood or pancreatic cells to secrete
insulin. These specialised cells are called as
a. Insulin used in the treatment of diabetes.
differentiated cells.
b. Human growth hormone used for treating
In contrast to differentiated cells, stem
children with growth deficiencies.
cells are undifferentiated or unspecialised
c. Blood clotting factors are developed to mass of cells. The stem cells are the cells of
treat haemophilia.
293 Breeding and Biotechnology

10th_Science [Link] 293 11-01-2020 14:19:40

 [Link]

variable potency. Potency refers to the number Parkinson’s disease and Alzheimer’s disease
of possible fates that a cell can acquire. The neuronal stem cells can be used to replace the
two important properties of stem cells that damaged or lost neurons.
differentiate them from other cells are:
i. its ability to divide and give rise to more 20.8  DNA Fingerprinting
stem cells by self-renewal Technology
ii. its ability to give rise to specialised cells The human genome has 3 billion base
with specific functions by the process of pairs. Did you know that the DNA pattern
differentiation. of two individuals cannot be same except for
identical twins. Each person’s DNA sequence
Types of stem cells is unique due to the small difference in the base
Embryonic stem cells can be extracted pairs. Therefore, if we want to compare the
genetic difference among the two individuals,
and cultured from the early embryos. These
DNA fingerprinting is the easier and quicker
cells are derived from the inner cell mass of
method. This technique was developed by
blastocyst. These cells can be developed into
Alec Jeffrey.
any cell in the body.
The technique analyses each individual’s
Adult stem cell or somatic stem cell are
unique DNA sequences and provides
found in the neonatal (new born) and adults.
distinctive characteristics of individual which
They have the ability to divide and give rise to
helps in identification. Variable number of
specific cell types. Sources of adult stem cells tandem repeat sequences (VNTRs) serve as
are amniotic fluid, umbilical cord and bone molecular markers for identification.
marrow.
In human beings, 99 % of the DNA base
sequences are the same and this is called
as bulk genomic DNA. The remaining 1 %
DNA sequence differs from one individual to
another. This 1 % DNA sequence is present
as small stretch of repeated sequences which
is known as satellite DNA. The number of
copies of the repeat sequence also called
as VNTRs differs from one individual to
another, and results in variation in the size of
the DNA segment.

Figure 20.8 Differentiation of stem cells

Stem-cell therapy
Sometimes cells, tissues and organs in the
body may be permanently damaged or lost due
to genetic condition or disease or injury. In such VNTRs illustration of three persons
situations stem cells are used for the treatment
As shown in the illustration, the sequence
of diseases which is called stem-cell therapy.
AGCT is repeated six times in first person, five
In treating neurodegenerative disorders like
times in second person and seven times in third

10th Standard Science 294

10th_Science [Link] 294 11-01-2020 14:19:40

 [Link]

person. Because of this, DNA segment of third genetically modified (GM) plants and animals.
person will be larger in size followed by DNA Genetic modification refers to the alteration
segment of first person and then the second or manipulation of genes in the organisms
person. Thus, it is clear that satellite DNA using rDNA techniques in order to produce
bring about variation within the population. the desired characteristics. The DNA fragment
Variation in DNA banding pattern reveals
inserted is called transgene. Plants or animals
differences among the individuals.
expressing a modified endogenous gene or
Applications of DNA Fingerprinting a foregin gene are also known as transgenic
i. DNA fingerprinting technique is widely organisms.
used in forensic applications like crime The transgenic plants are much stable,
investigation such as identifying the with improved nutritional quality, resistant to
culprit. It is also used for paternity testing diseases and tolerant to various environment
in case of disputes. conditions. Similarly transgenic animals
ii. It also helps in the study of genetic diversity are used to produce proteins of medicinal
of population, evolution and speciation. importance at low cost and improve livestock
quality.
20.9  Genetically Modified Some examples of genetically modified
Organisms (GMOs) plants and animals are given in the table
One of the most tremendous development below.
of genetic engineering is the production of

Genetically Modified Plants

Objective Gene inserted Achievement

Improved nutritional Beta carotene gene Golden Rice

quality in Rice (In humans, Beta carotene is required (Genetically modified rice can
for the synthesis of Vitamin A) produce beta carotene, that can
prevent Vitamin A deficiency)

Increased crop Bt gene from bacteria Bacillus Insect resistant plants

production thuringiensis. (These plants can produce the toxin
(Bt gene produces a protein that is toxic protein that kills the insects which
to insects) attack them)

Genetically Modified Animals

Objective Gene inserted Achievement

Improved wool quality Genes for synthesis of amino acid, Transgenic sheep
and production cysteine (gene expressed)

Increased growth in Salmon or Rainbow trout or Tilapia Transgenic fish

fishes growth hormone gene (gene expressed)

295 Breeding and Biotechnology

10th_Science [Link] 295 11-01-2020 14:19:40

 [Link]

Points to Remember ™™The superiority of the hybrid obtained

by cross breeding is called as heterosis or
™™Crop improvement is the development of hybrid vigour.
improved crop varieties possesing higher
™™Genetic engineering is the manipulation
yield, better quality, resistance to diseases
and transfer of genes from one organism
and shorter duration.
to another organism.
™™When breeding takes place between
™™Stem cells are undifferentiated or
animals of the same breed, it is called
unspecialised mass of cells and can be used
[Link] cross between different
for the treatment known as stem cell therapy.
breeds is called outbreeding.

TEXTBOOK EVALUATION

I Choose the correct answer c. vitamins

1. Which method of crop improvement can be d. both (a) and (b)
practised by a farmer if he is inexperienced? 6. We can cut the DNA with the help of
a. clonal selection b. mass selection
a. scissors    b. restriction endonucleases
c. pureline selection d. hybridisation
c. knife      d. RNAase
2. Pusa Komal is a disease resistant variety of
_________. 7. rDNA is a
a. sugarcane b. rice a. vector DNA
c. cow pea d. maize b. circular DNA
3. Himgiri developed by hybridisation and c. recombinant of vector DNA and
selection for disease resistance against desired DNA
rust pathogens is a variety of __________. d. satellite DNA
a. chilli b. maize
8. DNA fingerprinting is based on the
c. sugarcane d. wheat
principle of identifying ---------------
4. The miracle rice which saved millions of sequences of DNA
lives and celebrated its 50th birthday is a. single stranded b. mutated
_______ c. polymorphic d. repetitive
a. IR 8 b. IR 24 c. Atomita 2 d. Ponni
9. Organisms with modified endogenous
5. Which of the following is used to gene or a foregin gene are also known as
produce products useful to humans by (a) transgenic organsims
biotechnology techniques? (b) genetically modified
a. enzyme from organism (c) mutated
b. live organism (d) both a and b

10th Standard Science 296

10th_Science [Link] 296 11-01-2020 14:19:40

 [Link]

10. In a hexaploid wheat( 2n = 6 x = 42 ) the 4. Iron fortified rice variety determines the
haploid (n) and the basic(x) number of protein quality of the cultivated plant
chromosomes respectively are 5. Golden rice is a hybrid.
a. n = 7 and x = 21 b. n = 21 and x = 21 6. Bt gene from bacteria can kill insects.
c. n = 7 and x = 7 d. n = 21 and x = 7 7. In vitro fertilisation means the fertilisation
II Fill in the blanks done inside the body.
1. Economically important crop plants with 8. DNA fingerprinting technique was
superior quality are raised by_________. developed by Alec Jeffrey.
9. Molecular scissors refers to DNA ligases.
2. A protein rich wheat variety is ________.
3. __________is the chemical used for
IV Match the following
doubling the chromosomes.
Column A Column B
4. The scientific process which produces crop
plants enriched with desirable nutrients is 1. Sonalika Phaseolus mungo
called __________. 2. IR 8 Sugarcane
5. Rice normally grows well in alluvial soil, 3. Saccharum Semi-dwarf wheat
but _________ is a rice variety produced 4. Mung No. 1 Ground nut
by mutation breeding that grows well in 5. TMV – 2 Semi-dwarf Rice
saline soil.
6. Insulin Bacillus thuringienesis
6. __________ technique made it possible to 7. Bt toxin Beta carotene
genetically engineer living organism.
8. Golden rice first hormone produced
7. Restriction endonucleases cut the DNA using rDNA technique
molecule at specific positions known as
__________. V 
Understand the assertion statement,
justify the reason given and choose the
8. Similar DNA fingerprinting is obtained
correct choice
for __________.
a. Assertion is correct and reason is wrong
9. __________ cells are undifferentiated b. Reason is correct and the assertion is
mass of cells. wrong
10. In gene cloning the DNA of interest is c. Both assertion and reason is correct
integrated in a __________. d. Both assertion and reason is wrong.
1. Assertion: Hybrid is superior than either
III State whether true or false. If false, write
of its parents.
the correct statement
Reason: Hybrid vigour is lost upon
1. Raphano brassica is a man-made tetraploid inbreeding.
produced by colchicine treatment. 2. Assertion: Colchicine reduces the
2. The process of producing an organism chromosome number.
with more than two sets of chromosome Reason: It promotes the movement of
is called mutation. sister chromatids to the opposite poles.
3. A group of plants produced from a single 3. Assertion: rDNA is superior over
plant through vegetative or asexual hybridisation techniques.
reproduction are called a pureline.

297 Breeding and Biotechnology

10th_Science [Link] 297 11-01-2020 14:19:40

 [Link]

Reason: Desired genes are inserted 2. Describe mutation breeding with an example.
without introducing the undesriable 3. Biofortification may help in removing
genes in target organisms. hidden hunger. How?
4. With a neat labelled diagram explain the
VI Answer in a sentence
techniques involved in gene cloning.
1. Give the name of wheat variety having
5. Discuss the importance of biotechnology
higher dietary fibre and protein.
in the field of medicine.
2. Semi-dwarf varieties were introduced
in rice. This was made possible by the IX Higher Order Thinking Skills (HOTS)
presence of dwarfing gene in rice. Name
1. A breeder wishes to incorporate desirable
this dwarfing gene.
characters into the crop plants. Prepare a
3. Define genetic engineering.
list of characters he will incorporate
4. Name the types of stem cells.
5. What are transgenic organisms? 2. Organic farming is better than Green
6. State the importance of biofertiliser. Revolution. Give reasons
3. Polyploids are characterised by gigantism.
VII Short answers questions
Justify your answer.
1. Discuss the method of breeding for disease
4. ‘P’ is a gene required for the synthesis of
resistance.
vitamin A. It is integrated with genome of
2. Name three improved characteristics of
‘Q’ to produce genetically modified plant ‘R’.
wheat that helped India to achieve high
productivity. i. What is P, Q and R?
3. Name two maize hybrids rich in amino ii. State the importance of ‘R’ in India.
acid lysine
4. Distinguish between REFERENCE BOOKS
a. somatic gene therapy and germ line
gene therapy 1. Chaudhari, H.K., Elementary Principles
b. undifferentiated cells and differentiated of Plant Breeding, 2nd Edition.
cells 2. Dubey, R.C., A Text book of Biotechnology.
5. State the applications of DNA fingerprinting 5th Edition. S. Chand and Company Pvt. Ltd.
technique. NewDelhi.
6. How are stem cells useful in regenerative
process?
I NT ER NET R ES O U RCES
7. Differentiate between outbreeding and [Link]
inbreeding. cow-rosie-concept
VIII Long answers questions [Link]
1. What are the effects of hybrid vigour in [Link]
animals. at shoots-potato-in-roots

10th Standard Science 298

10th_Science [Link] 298 11-01-2020 14:19:40

 [Link]

Concept Map
Plant Breeding
Disease Insects/
resistance pests resistance

Improved
High yield Green Revolution nutritional quality

Crop Improvement Plant breeding

Methods
Natural Selection Hybridization

Polyploidy brecding Mutation breeding

Mass selection Artificial

Purelne selection Clonal selection

Animal Breeding and Biotechnology

Animal Breeding Genetic Engineering Applications of

Requirements Biotechnology

Desired gene Pharmaceutical

Inbreeding
products
Cloning vector
(Plasmid) Gene therapy
Outbreeding
Restriction DNA
endonucleases fingerprinting
Heterosis or
Hybrid vigour
DNA ligases Stem cell
technology

Recombinant Genetically
DNA (rDNA) modified plants
and animals
(Transgenics)

299 Breeding and Biotechnology

10th_Science [Link] 299 11-01-2020 14:19:40

 [Link]

5
UNIT - II

Molecular
Genetics
CHAPTER

New life for Woolly Mammoth DNA-researchers

Chapter Outline can now re-create the genes of mammoth and
study the proteins they encoded
5.1 Gene as the functional unit of inheritance
5.2 In search of the genetic material

M
5.3 DNA is the genetic material endel’s theory dispelled the mystery
5.4 Chemistry of nucleic acids
of why traits seemed to appear and
5.5 RNA world
5.6 Properties of genetic material disappear magically from one generation to
5.7 Packaging of DNA helix the next. Mendel’s work reveals the patterns of
5.8 DNA Replication heredity and reflect the transmission of evolved
5.9 Transcription information from parents to offspring. This
5.10 Genetic code information is located on the chromosomes.
5.11 tRNA – the adapter molecule One of the most advanced realizations of
5.12 Translation
human knowledge was that our unique
5.13 Regulation of Gene expression
5.14 Human Genome Project (HGP) characteristics are encoded within molecules
5.15 DNA finger printing technique of DNA. The discovery that DNA is the genetic
material left several questions unanswered.
How is the information in DNA used? Scientists
Learning Objectives
now know that DNA directs the construction
➢ Identifies DNA as the genetic material. of proteins. Proteins determine the shapes of
➢ Understands the organization of prokaryotic cells and the rate of chemical reactions, such
and eukaryotic genome. as those that occur during metabolism and
➢ Learns to differentiate the nucleotides of DNA photosynthesis. The hereditary nature of every
and RNA. living organism is defined by its genome,
➢ Understands gene expression - which consists of a long sequence of nucleic
Replication, Transcription and
acids that provide the information needed to
Translation.
construct the organism. The genome contains
➢ Learns about codons and the
salient features of genetic code. the complete set of hereditary information for
➢ Understands the gene regulation any organism. The genome may be divided into
through Lac operon model. a number of different nucleic acid molecules.
➢ Realizes the importance of Human Genome Each of the nucleic acid molecule may contain
Project. large number of genes. Each gene is a sequence
➢ Illustrates the applications of DNA finger within the nucleic acid that represents a single
printing technique.
protein. In this chapter we will discuss the

61 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 61 24-02-2020 4.01.33 PM

 [Link]

structure of DNA, its replication, the process

of making RNA from DNA (transcription), the One gene-one enzyme hypothesis
genetic code that determines the sequence of The experiments of George Beadle
amino acid in protein synthesis (translation), and Edward Tatum in the early 1940’s
regulation of gene expression and the essentials on Neurospora crassa (the red bread
of human genome sequencing. mould) led them to propose one ­gene-
one enzyme hypothesis, which states that
5.1 Gene as the functional unit one gene controls the production of one
of inheritance enzyme.
A gene is a basic physical and functional One gene-one polypeptide hypothesis
unit of heredity. The concept of the gene It was observed that an enzyme
was first explained by Gregor Mendel in may be composed of more than one
1860’s. He never used the term ‘gene’. He polypeptide chain and a gene can code
called it ‘factor’. In 1909, the Danish biologist for only one polypeptide chain. Thus one
Wilhelm Johannsen, coined the term ‘gene’, gene-one polypeptide hypothesis states
that was referred to discrete determiners of that one gene controls the production of
inherited characteristics. only one polypeptide chain of an enzyme
molecule.
According to the classical concept of
gene introduced by Sutton in 1902, genes 5.2 In search of the genetic material
have been defined as discrete particles that
As early as 1848, Wilhelm Hofmeister,
follow Mendelian rules of inheritance,
a German botanist, had observed that cell
occupy a definite locus in the chromosome nuclei organize themselves into small,
and are responsible for the expression of rod like bodies during mitosis called
specific phenotypic character. They show the chromosomes. In 1869, Friedrich Miescher,
following properties: a Swiss physician, isolated a substance from
• Number of genes in each organism is the cell nuclei and called it as nuclein. It
more than the number of chromosomes; was renamed as nucleic acid by Altman
hence several genes are located on the (1889), and is now known as DNA. By 1920,
it became clear that chromosomes are made
same chromosome.
up of proteins and DNA. Many experiments
• The genes are arranged in a single linear were carried out to study the actual carriers
order like beads on a string. of genetic information. Griffith's experiment
• Each gene occupies a specific position proved that DNA is the genetic material
which has been dealt in class XI. Bacterial
called locus.
transformation experiments provided the
• Genes may exist in several alternate forms first proof that DNA is the genetic material.
called alleles. However, he could not understand the
• Genes may undergo sudden change cause of bacterial transformation, and the
in positions and composition called biochemical nature of genetic material was
not defined from his experiments.
mutations.
Later, Oswald Avery, Colin Macleod and
• Genes are capable of self-duplication Maclyn McCarty in 1944 repeated Griffith’s
producing their own copies. experiments in an ‘in vitro’ system in order

Molecular Genetics 62

TN_GOVT_XII_Zoology_chapter5.indd 62 24-02-2020 4.01.33 PM

 [Link]

+\SRWKHVLV7KHJHQHWLFPDWHULDORIWKHFHOOLVHLWKHUSURWHLQRUQXFOHLFDFLG '1$RU51$

5HPRYHOLSLGVDQG
VXJDUVIURPDVROXWLRQRI
+HDWNLOOHG /LSLGV KHDWNLOOHG6FHOOV
6FHOOV 6XJDUV 3URWHLQV51$DQG'1$
UHPDLQ

$GGSURWHLQDVH $GG51DVH $GG'1DVH 7UHDWVROXWLRQVZLWK

HQ]\PHVWRGHVWUR\
SURWHLQ51$RU'1$
123527(,1 1251$ 12'1$

$GGWRFXOWXUHFRQWDLQLQJ
$GG5FHOOV $GG5FHOOV $GG5FHOOV
OLYLQJ5FHOOV2EVHUYHIRU
WUDQVIRUPDWLRQE\WHVWLQJ
IRUWKHSUHVHQFHRI
YLUXOHQW6FHOOV

6FHOOVDSSHDU 6FHOOVDSSHDU 1R6FHOOV

&RQFOXVLRQ7UDQVIRUPDWLRQUHTXLUHV'1$WKHUHIRUHLWLVWKHJHQHWLFPDWHULDORIWKHFHOO

Fig. 5.1 Transformation experiment of Avery et. al., (1944)

to identify the nature of the transforming proteases (an enzyme which destroys protein)
substance responsible for converting a non- did not affect the transformation. Digestion
virulent strain into virulent strain. They with DNase inhibited transformation
observed that the DNA, RNA and proteins suggesting that the DNA caused the
isolated from the heat-killed S-strain transformation. These experiments suggested
when added to R-strain changed their that DNA and not proteins is the genetic
surface character from rough to smooth material. The phenomenon, by which DNA
and also made them pathogenic (Fig. 5.1). isolated from one type of cell (S – strain),
But when the extract was treated with when introduced into another type (R-strain),
DNase (an enzyme which destroys DNA) is able to retain some of the properties of the
the transforming ability was lost. RNase S - strain is referred to as transformation.
(an enzyme which destroys RNA) and

63 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 63 24-02-2020 4.01.34 PM

 [Link]

Radioactive Sulfur (35S)

Bacteriophages Radioactive Phosphorus (32 P)
labelled DNA (red)
labelled protein capsule (red)

Infection

Blending

Radioactive Sulfur (35S)

No Radioactivity detected
detected in supernatant
in supernatant

Centrifugation

After centrifugation After centrifugation Radioactive

no Radioactive Sulfur (35S) Phosphorus (32 P)
detected in cells. detected in cells.

Fig. 5.2 The Hershey-Chase (blender) experiment

5.3 DNA is the genetic material phages (virus) are added to bacteria, they
Many biologists despite the earlier adsorb to the outer surface, some material
experiments of Griffith, Avery and others, enters the bacterium, and then later each
still believed that protein, not DNA, was the bacterium lyses to release a large number of
hereditary material in a cell. As eukaryotic progeny phage. Hershey and Chase wanted to
chromosomes consist of roughly equal observe whether it was DNA or protein that
amounts of protein and DNA, it was said entered the bacteria. All nucleic acids contain
that only a protein had sufficient chemical phosphorus, and proteins contain sulphur
diversity and complexity to encode the (in the amino acid cysteine and methionine).
information required for genetic material. Hershey and Chase designed an experiment
In 1952, however, the results of the using radioactive isotopes of Sulphur (35S)
Hershey-Chase experiment finally provided and phosphorus (32P) to keep separate track of
convincing evidence that DNA is the genetic the viral protein and nucleic acids during the
material. infection process. The phages were allowed
5.3.1 Hershey and Chase experiment to infect bacteria in culture medium which
on T2 bacteriophage containing the radioactive isotopes 35S or 32P.
The bacteriophage that grew in the presence of
Alfred Hershey and Martha Chase (1952) 35
S had labelled proteins and bacteriophages
conducted experiments on bacteriophages
grown in the presence of 32P had labelled DNA.
that infect bacteria. Phage T2 is a virus that
infects the bacterium Escherichia coli. When

Molecular Genetics 64

TN_GOVT_XII_Zoology_chapter5.indd 64 24-02-2020 4.01.34 PM

 [Link]

The differential labelling thus enabled them to Nitrogenous bases

identify DNA and proteins of the phage. The bases are nitrogen containing
Hershey and Chalse mixed the labelled molecules having the chemical properties
phages with unlabeled E. coli and allowed of a base (a substance that accepts H+ ion or
bacteriophages to attack and inject their proton in solution). DNA and RNA both have
genetic material. Soon after infection four bases (two purines and two pyrimidines)
(before lysis of bacteria), the bacterial cells in their nucleotide chain. Two of the bases,
were gently agitated in a blender to loosen the Adenine (A) and Guanine (G) have double
adhering phase particles. It was observed that carbon–nitrogen ring structures and are
only 32P was found associated with bacterial called purines. The bases, Thymine (T),
cells and 35S was in the surrounding medium Cytosine (C) and Uracil (U) have single ring
and not in the bacterial cells. When phage structure and these are called pyrimidines.
progeny was studied for radioactivity, it was Thymine is unique for DNA, while Uracil is
found that it carried only 32P and not 35S unique for RNA.
(Fig. 5.2). These results clearly indicate
that only DNA and not protein coat entered The phosphate functional group
the bacterial cells. Hershey and Chase It is derived from phosphoric acid
thus conclusively proved that it was DNA, (H3PO4), has three active OH- groups of which
not protein, which carries the hereditary two are involved in strand formation. The
information from virus to bacteria. phosphate functional group (PO4) gives DNA
and RNA the property of an acid (a substance
5.4 Chemistry of Nucleic Acids that releases an H+ ion or proton in solution)
Having identified the genetic material as at physiological pH, hence the name nucleic
the nucleic acid DNA (or RNA), we proceed acid. The bonds that are formed from
to examine the chemical structure of these phosphates are esters. The oxygen atom of the
molecules. Generally nucleic acids are a phosphate group is negatively charged after
long chain or polymer of repeating subunits the formation of the phosphodiester bonds.
called nucleotides. Each nucleotide subunit is This negatively charged phosphate ensures
composed of three parts: a nitrogenous base, the retention of nucleic acid within the cell or
a five carbon sugar (pentose) and a phosphate nuclear membrane.
group.
Nucleoside and nucleotide
Pentose sugar The nitrogenous base is chemically
There are two types of nucleic acids linked to one molecule of sugar (at the
depending on the type of pentose sugar. 1-carbon of the sugar) forming a nucleoside.
Those containing deoxyribose sugar are called When a phosphate group is attached to the
Deoxyribo Nucleic Acid (DNA) and those 5' carbon of the same sugar, the nucleoside
with ribose sugar are known as Ribonucleic becomes a nucleotide. The nucleotides are
Acid (RNA). DNA is found in the nucleus joined (polymerized) by condensation
of eukaryotes and nucleoid of prokaryotes. reaction to form a polynucleotide chain. The
The only difference between these two hydroxyl group on the 3' carbon of a sugar of
sugars is that there is one oxygen atom less in one nucleotide forms an ester with the
deoxyribose. phosphate of another nucleotide. The
chemical bonds that link the sugar

65 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 65 24-02-2020 4.01.34 PM

 [Link]

components of adjacent nucleotides are called separated RNA from the protein of TMV
phosphodiester bond (5' 3'), indicating viruses. Three molecular biologists in the early
the polarity of the strand. 1980’s (Leslie Orgel, Francis Brick and Carl
The ends of the DNA or RNA are distinct. Woese) independently proposed the ‘RNA
The two ends are designated by the symbols world’ as the first stage in the evolution of
5' and 3'. The symbol 5' refers to carbon in the life, a stage when RNA catalysed all molecules
sugar to which a phosphate (PO4) functional necessary for survival and replication. The
group is attached. The symbol 3' refers to term ‘RNA world’ first used by Walter Gilbert
carbon in the sugar to which hydroxyl (OH) in 1986, hypothesizes RNA as the first genetic
functional group is attached. In RNA, every material on earth. There is now enough
nucleotide residue has an additional –OH evidence to suggest that essential life processes
group at 2' position in the ribose. (such as metabolism, translation, splicing etc.,)
Understanding the 5' 3' direction of a evolved around RNA. RNA has the ability to act
nucleic acid is critical for understanding the as both genetic material and catalyst. There are
aspects of replication and transcription. several biochemical reactions in living systems
Based on the X - ray diffraction analysis of that are catalysed by RNA. This catalytic
Maurice Wilkins and Rosalind Franklin, the RNA is known as ribozyme. But, RNA being
double helix model for DNA was proposed by a catalyst was reactive and hence unstable.
James Watson and Francis Crick in 1953. The This led to evolution of a more stable form of
highlight was the base pairing between the DNA, with certain chemical modifications.
two strands of the polynucleotide chain. This Since DNA is a double stranded molecule
proposition was based on the observations having complementary strand, it has resisted
of Erwin Chargaff that Adenine pairs with changes by evolving a process of repair. Some
Thymine (A = T) with two hydrogen bonds RNA molecules function as gene regulators by
and Guanine pairs with Cytosine (G ≡ C) binding to DNA and affect gene expression.
with three hydrogen bonds. The ratios Some viruses use RNA as the genetic material.
between Adenine with Thymine and Guanine Andrew Fire and Craig Mellow (recipients of
with Cytosine are constant and equal. The Nobel Prize in 2006) were of the opinion that
base pairing confers a unique property to RNA is an active ingredient in the chemistry of
the polynucleotide chain. They are said to be life. The types of RNA and their role have been
complementary to each other, that is, if the discussed in class XI.
sequence of bases in one strand (template) is
known, then the sequence in the other strand 5.6 Properties of genetic material
can be predicted. The salient features of DNA The experiment by Hershey and Chase
structure has already been dealt in class XI. clearly indicates that it is DNA that acts
as a genetic material. However, in some
5.5 RNA world viruses like Tobacco mosaic virus (TMV),
A typical cell contains about ten times as bacteriophage θB, RNA acts as the genetic
much RNA as DNA. The high RNA content material. A molecule that can act as a genetic
is mainly due to the variety of roles played by material should have the following properties:
RNA in the cell. Fraenkel-Conrat and Singer S elf Replication: It should be able to
• 
(1957) first demonstrated that RNA is the replicate. According to the rule of base
genetic material in RNA containing viruses pairing and complementarity, both nucleic
like TMV (Tobacco Mosaic Virus) and they acids (DNA and RNA) have the ability to

Molecular Genetics 66

TN_GOVT_XII_Zoology_chapter5.indd 66 24-02-2020 4.01.34 PM

 [Link]

direct duplications. Proteins fail to fulfill RNA genome with shorter life span can
this criteria. mutate and evolve faster.
• Stability: It should be stable structurally and The above discussion indicates that both
chemically. The genetic material should be RNA and DNA can function as a genetic
stable enough not to change with different material. DNA is more stable, and is preferred
stages of life cycle, age or with change in for storage of genetic information.
physiology of the organism. Stability as one
of property of genetic material was clearly 5.7 Packaging of DNA helix
evident in Griffith’s transforming principle.
The distance between two consecutive
Heat which killed the bacteria did not
base pairs is 0.34nm (0.34×10-9m) of the
destroy some of the properties of genetic
DNA double helix in a typical mammalian
material. In DNA the two strands being
cell. When the total number of base pairs is
complementary, if separated (denatured) by
multiplied with the distance between two
heating can come together (renaturation)
consecutive base pairs (6.6 × 109 × 0.34 ×10-9
when appropriate condition is provided.
m/bp), the length of DNA double helix is
Further 2' OH group present at every
approximately 2.2 m. (The total length of the
nucleotide in RNA is a reactive
group that makes RNA liable and
$
easily degradable. RNA is also
known to be catalytic and reactive.
Hence, DNA is chemically more
stable and chemically less reactive
when compared to RNA. Presence 1XFOHRVRPH
of thymine instead of uracil in &RUH'1$

DNA confers additional stability +$ +% + +

to DNA. /LQNHU'1$
% +
• Information storage: It should be
able to express itself in the form
of ‘Mendelian characters’. RNA $
can directly code for protein $ &
synthesis and can easily express '

the characters. DNA, however

depends on RNA for synthesis
of proteins. Both DNA and RNA
can act as a genetic material, but )

DNA being more stable stores (

the genetic information and RNA

transfers the genetic information. +
'1$
+$+%+
DQG+ WZR +LVWRQHRFWDPHU
• Variation through mutation: It PROHFXOHVHDFK
+ +LVWRQHSURWHLQ

should be able to mutate. Both

1XFOHRVRPH
DNA and RNA are able to mutate.
RNA being unstable, mutates at a Fig. 5.3 Condensation of DNA - A - DNA, B-Nucleosomes
faster rate. Thus viruses having and Histones, C- Chromatin fiber, D- Coiled chromatin
fiber, E- Coiled coil, F- metaphase chromatid

67 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 67 24-02-2020 4.01.35 PM

 [Link]

double helical DNA = total number of base octameres and the two turns are sealed off by
pairs × distance between two consecutive an H1 molecule. Chromatin lacking H1 has a
base pairs). If the length of E. coli DNA is beads-on-a-string appearance in which DNA
1.36 mm, the number of base pairs in E. coli is enters and leaves the nucleosomes at random
4 ×106bp (1.36 × 103 m/0.34 ×10-9). The places. H1 of one nucleosome can interact
length of the DNA double helix is far greater with H1 of the neighbouring nucleosomes
than the dimension of a typical mammalian resulting in the further folding of the fibre.
nucleus (approximately 10-6 m). How is such a The chromatin fiber in interphase nuclei and
long DNA polymer packaged in a cell? mitotic chromosomes have a diameter that
Chromosomes are carriers of genes which vary between 200-300 nm and represents
are responsible for various characters from inactive chromatin. 30 nm fibre arises from the
generation to generation. Du Praw (1965) folding of nucleosome, chains into a solenoid
proposed a single stranded model (unineme), structure having six nucleosomes per turn. This
as a long coiled molecule which is associated structure is stabilized by interaction between
with histone proteins in eukaryotes. Plants different H1 molecules. DNA is a solenoid and
and animals have more DNA than bacteria packed about 40 folds. The hierarchical nature
and must fold this DNA to fit into the cell of chromosome structure is illustrated in
nucleus. In prokaryotes such as E. coli though (Fig. 5.3). Additional set of proteins are
they do not have defined nucleus, the DNA required for packing of chromatin at higher
is not scattered throughout the cell. DNA level and are referred to as non-histone
(being negatively charged) is held with some chromosomal proteins (NHC). In a typical
proteins (that have positive charges) in a nucleus, some regions of chromatin are
region called the nucleoid. The DNA as a loosely packed (lightly stained) and are
nucleoid is organized into large loops held referred to as euchromatin. The chromatin
by protein. DNA of prokaryotes is almost that is tightly packed (stained darkly) is
circular and lacks chromatin organization, called heterochromatin. Euchromatin is
hence termed genophore. transcriptionally active and heterochromatin
is transcriptionally inactive.
In eukaryotes, this organization is much more
complex. Chromatin is formed by a series of
repeating units called nucleosomes. Kornberg 5.8 DNA Replication
proposed a model for the nucleosome, in Replication of DNA takes place during the
which 2 molecules of the four histone proteins S phase of cell cycle. During replication, each
H2A, H2B, H3 and H4 are organized to DNA molecule gives rise to two DNA strands,
form a unit of eight molecules called histone identical to each other as well as to the parent
octamere. The negatively charged DNA strand. Three hypotheses of DNA replication
is wrapped around the positively charged have been proposed. They are conservative
histone octamere to form a structure called replication, dispersive replication, and semi-
nucleosome. A typical nucleosome contains conservative replication.
200 bp of DNA helix. The histone octameres In conservative replication, the original
are in close contact and DNA is coiled on double helix serves as a template. The original
the outside of nucleosome. Neighbouring molecule is preserved intact and an entirely
nucleosomes are connected by linker DNA new double stranded molecule is synthesized.
(H1) that is exposed to enzymes. The DNA In dispersive replication, the original molecule
makes two complete turns around the histone is broken into fragments and each fragment

Molecular Genetics 68

TN_GOVT_XII_Zoology_chapter5.indd 68 24-02-2020 4.01.35 PM

 [Link]

3' 5'
Semi-conservative replication was
T A
proposed by Watson and Crick in 1953. This
C G mechanism of replication is based on the
A T
Parent DNA model. They suggested that the two
C G polynucleotide strands of DNA molecule
C G
G C unwind and start separating at one end.
T A
During this process, covalent hydrogen bonds
C G are broken. The separated single strand then
T A
C G acts as template for the synthesis of a new
T A
strand. Subsequently, each daughter double
T A
Parental Parental helix carries one polynucleotide strand from
A T
strand A T strand the parent molecule that acts as a template
C 3' 5' C
C G C G
and the other strand is newly synthesised
G C and complementary to the parent strand
G C TA
T A (Fig. 5.4).
C G
C G T A
T A
T A
C G C G 5.8.1 Experimental proof of
A T
T A
DNA replication
T A
A T A T The mode of DNA replication was
5'
3'
3'
determined in 1958 by Meselson and Stahl.
5'
They designed an experiment to distinguish
Daughter
strands between semi conservative, conservative and
dispersive replications. In their experiment,
Fig. 5.4 Semiconservative DNA replication they grew two cultures of [Link] for many
serves as a template for the synthesis of generations in separate media. The ‘heavy’
complementary fragments. Finally two new culture was grown in a medium in which
molecules are formed which consist of both the nitrogen source (NH4Cl) contained the
old and new fragments. heavy isotope 15N and the ‘light’ culture was
grown in a medium in which the nitrogen

Generation I Generation II
15 14
N-DNA N-DNA 14
N-DNA
15
N-DNA 15
N-DNA
14
20 min 40 min N-DNA
14
Gravitational force N-DNA

15 15 14 15 14 14 14 15
N N N N N N N N
Heavy Hybrid Light Hybrid

Fig. 5.5 Meselson and Stahl experiment to support semiconservative mode of DNAreplication

69 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 69 24-02-2020 4.01.35 PM

 [Link]

source contained light isotope 14N for many to mutation. However replication errors are
generations. At the end of growth, they corrected by repair enzymes such as nucleases.
observed that the bacterial DNA in the heavy Deoxy nucleotide triphosphate acts as substrate
culture contained only 15N and in the light and also provides energy for polymerization
culture only 14N. The heavy DNA could be reaction.
distinguished from light DNA (15N from 14N) Replication begins at the initiation site called
with a technique called Cesium Chloride the site of ‘origin of replication’ (ori). In
(CsCl) density gradient centrifugation. In prokaryotes, there is only one origin of
this process, heavy and light DNA extracted replication, whereas in eukaryotes with giant
from cells in the two cultures settled into two DNA molecules, there can be several origins of
distinct and separate bands (hybrid DNA) replication (replicons). Since the two strands of
(Fig. 5.5). DNA cannot be separated throughout at a time
The heavy culture (15N) was then transferred (due to large requirement of energy) the
into a medium that had only NH4Cl, and took replication occurs within a small opening of the
samples at various definite time intervals DNA helix called as replication fork. Unwinding
(20 minutes duration). After the first replication, of the DNA strand is carried out by DNA
they extracted DNA and subjected it to density helicase. Thus, in one strand (template strand
gradient centrifugation. The DNA settled with polarity 3' 5') the replication is
into a band that was intermediate in position continuous and is known as the leading strand
between the previously determined heavy while in the other strand (coding strand with
and light bands. After the second replication polarity 5' 3') replication is discontinuous,
(40 minutes duration), they again extracted known as the lagging strand (Fig. 5.6). The
DNA samples, and this time found the DNA discontinuously synthesized fragments of the
settling into two bands, one at the light band lagging strand (called the Okazaki fragments)
position and one at intermediate position. are joined by the enzyme DNA ligase.
These results confirm Watson and Crick’s semi
conservative replication hypothesis.

5.8.2 Enzymes and mechanism

of replication
In prokaryotes, replication process
requires three types of DNA polymerases
(DNA polymerase I, II, and III). DNA
polymerase III is the main enzyme involved
in DNA replication. DNA polymerase I
(also known as Kornberg enzyme) and
DNA polymerase II are involved in DNA
repair mechanism. Eukaryotes have five
types of DNA polymerases that catalyses
the polymerization of nucleotides at the
3' OH of the new strand within a short
period of time. [Link] that has 4.6 X 106 bp
completes its replication process within 38
minutes. Replication takes place faster at the Fig 5.6 Mechanism of replication showing a
same time accurately. Any error will lead replication fork

Molecular Genetics 70

TN_GOVT_XII_Zoology_chapter5.indd 70 24-02-2020 4.01.35 PM

 [Link]

As they move away in both directions, newly of information is reversed. RNA synthesizes
synthesized complementary nucleotides are DNA by reverse transcription, then transcribed
paired with the existing nucleotides on the into mRNA by transcription and then into
parent strand and covalently bonded together proteins by translation.
by DNA polymerase. Formation of new strand For a cell to operate, its genes must be
requires a primer (a short stretch of RNA)for expressed. This means that the gene products,
initiation. The primer produces a 3'-OH end on whether proteins or RNA molecules must be
the sequence of ribonucleotides, to which deoxy made. The RNA that carries genetic information
ribonucleotides are added. The RNA primer is encoding a protein from genes into the cell is
ultimately removed leaving a gap in the newly known as messenger RNA (mRNA). For a gene
synthesized DNA strand. It is removed from to be transcribed, the DNA which is a double
5' end one by one by the exonuclease activity helix must be pulled apart temporarily, and
of DNA polymerase. Finally, when all the RNA is synthesized by RNA polymerase. This
nucleotides are in position, gaps are sealed by enzyme binds to DNA at the start of a gene and
the enzyme DNA ligase. opens the double helix. Finally, RNA molecule
is synthesized. The nucleotide sequence in the
At the point of origin of replication, the
RNA is complementary to the DNA template
helicases and topoisomerases (DNA gyrase)
strand from which it is synthesized.
unwind and pull apart the strands, forming a
Y-Shaped structure called the replication fork. Both the strands of DNA are not copied
There are two replication forks at each origin. during transcription for two reasons. 1. If both
The two strands of a DNA helix have an the strands act as a template, they would code
antiparallel orientation. The enzyme DNA for RNA with different sequences. This in turn
polymerase can only catalyse the addition of a would code for proteins with different amino
nucleotide to the new strands in the 5' 3' acid sequences. This would result in one segment
of DNA coding for two different proteins, hence
direction, as it can only add nucleotides to the
complicate the genetic information transfer
3' carbon position.
machinery. 2. If two RNA molecules were
5.9 Transcription produced simultaneously, double stranded RNA
Francis Crick proposed the Central dogma complementary to each other would be formed.
of protein synthesis in molecular biology This would prevent RNA from being translated
states that genetic information flows as into proteins.
follows: 5.9.1 Transcription unit and gene
A transcriptional unit in DNA is defined by
three regions, a promoter, the structural gene
and a terminator. The promoter is located
towards the 5' end of the coding strand. It is a
DNA sequence that provides binding site for
RNA polymerase. The presence of promoter
The process of copying genetic information in a transcription unit, defines the template
from one strand of DNA into RNA is and coding strands. The terminator region
termed transcription. This process takes located towards the 3' end of the coding strand
place in presence of DNA dependent RNA contains a DNA sequence that causes the RNA
polymerase. In some retroviruses that contain polymerase to stop transcribing. In eukaryotes
the promoter has AT rich regions called
RNA as the genetic material (e.g, HIV), the flow
TATA box (Goldberg-Hogness box) and in

71 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 71 24-02-2020 4.01.35 PM

 [Link]

Fig. 5. 7 Schematic structure of a transcription unit

prokaryotes this region is called Pribnow box. RNA polymerase opens up the DNA to form the
Besides promoter, eukaryotes also require an transcription bubble. The core enzyme moves
enhancer. ahead, manufacturing RNA leaving the sigma
The two strands of the DNA in the structural subunit behind at the promoter region. The end
gene of a transcription unit have opposite of a gene is marked by a terminator sequence
polarity. DNA dependent RNA polymerase that forms a hair pin structure in the RNA. The
catalyses the polymerization in only one sub-class of terminators require a recognition
direction, the strand that has the polarity protein, known as rho (ρ), to function.
3' 5' acts as a template, and is called the
5.9.2 Process of transcription
template strand. The other strand which has
In prokaryotes, there are three major types of
the polarity 5' 3' has a sequence same as
RNAs: mRNA, tRNA, and rRNA. All three RNAs
RNA (except thymine instead of uracil) and is
are needed to synthesize a protein in a cell. The
displaced during transcription. This strand is
mRNA provides the template, tRNA brings amino
called coding strand (Fig. 5.7).
acids and reads the genetic code, and rRNAs play
The structural gene may be monocistronic
structural and catalytic role during translation.
(eukaryotes) or polycistronic (prokaryotes). In
There is a single DNA-dependent RNA polymerase
eukaryotes, each mRNA carries only a single
that catalyses transcription of all types of RNA. It
gene and encodes information for only a single
binds to the promoter and initiates transcription
protein and is called monocistronic mRNA. In
(Initiation). The polymerases binding sites are
prokaryotes, clusters of related genes, known as
called promoters. It uses nucleoside triphosphate as
operon, often found next to each other on the
substrate and polymerases in a template depended
chromosome are transcribed together to give a
fashion following the rule of complementarity.
single mRNA and hence are polycistronic.
After the initiation of transcription, the polymerase
Before starting transcription, RNA polymerase continues to elongate the RNA, adding one
binds to the promoter, a recognition sequence in nucleotide after another to the growing RNA
front of the gene. Bacterial (prokaryotic) RNA chain. Only a short stretch of RNA remains bound
polymerase consists of two major components, to the enzyme, when the polymerase reaches a
the core enzyme and the sigma subunit. The terminator at the end of a gene, the nascent RNA
core enzyme (2α, β, β1 and ω) is responsible falls off, so also the RNA polymerase.
for RNA synthesis whereas a sigma subunit is
The question is, how the RNA polymerases
responsible for recognition of the promoter.
are able to catalyse the three steps initiation,
Promoter sequences vary in different organisms.
elongation and termination? The RNA

Molecular Genetics 72

TN_GOVT_XII_Zoology_chapter5.indd 72 24-02-2020 4.01.35 PM

 [Link]

Initiation
3' 3'
5' 5'
Promoter σ RNA polymerase DNA helix
Sigma factor
polymerase found in the
Elongation organelles). There is a clear
division of labour. The RNA
3' 3'
polymerase I transcribes
5' 3' rRNAs (28S, 18S and
Terminator
RNA σ 5.8S), whereas the RNA
polymerase III is responsible
Termination for transcription of tRNA,
3' 3'
5S rRNA and snRNA.
The RNA polymerase
5' 5'
II transcribes precursor
Rho factor ρ of mRNA, the hnRNA
RNA (heterogenous nuclear
RNA Polymerase RNA). In eukaryotes, the
Fig. 5. 8 Process of transcription in prokaryotes monocistronic structural
genes have interrupted coding sequences
polymerase is only capable of catalyzing the known as exons (expressed sequences) and non-
process of elongation. The RNA polymerase coding sequences called introns (intervening
associates transiently with initiation factor sigma sequences). The introns are removed by a process
(σ) and termination factor rho (r) to initiate called splicing. hnRNA undergoes additional
and terminate the transcription, respectively. processing called capping and tailing. In capping
Association of RNA with these factors instructs an unusual nucleotide, methyl guanosine
the RNA polymerase either to initiate or triphosphate is added at the 5' end, whereas
terminate the process of transcription (Fig. 5.8). adenylate residues (200-300) (Poly A) are added
at the 3' end in tailing (Fig. 5.9). Thereafter,
In bacteria, since the mRNA does not
this processed hnRNA, now called mRNA is
require any processing to become active
transported out of the nucleus for translation.
and also since transcription and translation
take place simultaneously in the same The split gene feature of eukaryotic genes
compartment (since there is no separation of is almost entirely absent in prokaryotes.
cytosol and nucleus in bacteria), many times Originally each exon may have coded for
the translation can begin much before the a single polypeptide chain with a specific
mRNA is fully transcribed. This is because function. Since exon arrangement and intron
the genetic material is not separated from removal are flexible, the exon coding for
other cell organelles by a nuclear membrane these polypeptide subunits act as domains
consequently; transcription and translation combining in various ways to form new genes.
can be coupled in bacteria. Single genes can produce different functional
proteins by arranging their exons in several
In Eukaryotes, there are at least three RNA
different ways through alternate splicing
polymerases in the nucleus (in addition to RNA
73 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 73 24-02-2020 4.01.35 PM

 [Link]

language of codes
5' 5' what is the nature
of genetic code?
3' 3' The translation of
Capping proteins follows
3' m RNA
Intron the triplet rule;
Cap Exon a sequence of
three mRNA base
m
Gppp Polyadenylation (a codon) designates
5'
RNA splicing one of the 20
3' different kinds of
m
Gppp
5' amino acids used in
Poly A tail protein synthesis.
m
Gppp Genetic code is the
5' sequence relationship
3'
between nucleotide in
Messenger 5' Gppp
m

genes (or mRNA) and

RNA (m RNA)
the amino acids in the
proteins they encode.
Fig. 5.9 Process of transcription in eukaryotes
There are 64 possible
patterns, a mechanism known to play an
triplets, and 61 of them are used to represent
important role in generating both protein and
amino acids. The remaining three triplet codons
functional diversity in animals. Introns would
are termination signals for polypeptide chains.
have arosen before or after the evolution of
Since there are only 20 amino acids involved
eukaryotic gene. If introns arose late how did
in protein synthesis, most of them are encoded
they enter eukaryotic gene? Introns are mobile
by more than one triplet. Two things make this
DNA sequences that can splice themselves out
multiple (degenerate) coding possible. First,
of, as well as into, specific ‘target sites’ acting
there is more than one tRNA for most amino
like mobile transposon-like elements (that
acids. Each tRNA has a different anticodon.
mediate transfer of genes between organisms
Second, this pairing is highly specific for the
– Horizontal Gene Transfer - HGT). HGT
first two portions on the codon, permitting
occurs between lineages of prokaryotic
Watson and Crick base pairs (A – U and G - C)
cells, or from prokaryotic to eukaryotic cells
to be formed. But at the third position there is
and between eukaryotic cells. HGT is now
a great deal of flexibility as to which base pairs
hypothesized to have played a major role in
are acceptable. Most part of the genetic code is
the evolution of life on earth.
universal, being the same in prokaryotes and
5.10 Genetic Code eukaryotes.
DNA is the genetic material that carries The order of base pairs along DNA molecule
genetic information in a cell and from controls the kind and order of amino acids
generation to generation. At this stage, an found in the proteins of an organism. This
attempt will be made to determine in what specific order of base pairs is called genetic
manner the genetic information exists in DNA code, the blue print establishing the kinds of
molecule? Are they written in coded language proteins to be synthesized which makes an
on a DNA molecule? If they occur in the organism unique.

Molecular Genetics 74

TN_GOVT_XII_Zoology_chapter5.indd 74 24-02-2020 4.01.35 PM

 [Link]

Marshall Nirenberg, Severo Ochoa • A non-overlapping codon means that the

(enzyme polynucleotide phosphorylase called same letter is not used for two different
Ochoa’s enzyme), Hargobind Khorana, Francis codons. For instance, the nucleotide
Crick and many others have contributed sequence GUU GUC represents only two
significantly to decipher the genetic code. The codons.
order in which bases are arranged in mRNA • It is comma less, which means that the
decides the order in which amino acids are message would be read directly from one
arranged in proteins. Finally a checker board end to the other i.e., no punctuation are
for genetic code was prepared (table 5.1). needed between two codes.
The salient features of genetic code are as • A degenerate code means that more than
follows: one triplet codon could code for a specific
• The genetic codon is a triplet code and amino acid. For example, codons GUU,
61 codons code for amino acids and 3 GUC, GUA and GUG code for valine.
codons do not code for any amino acid and • Non-ambiguous code means that one
function as stop codon (Termination). codon will code for one amino acid.
• The genetic code is universal. It means • The code is always read in a fixed direction
that all known living systems use nucleic i.e. from 5'→3' direction called polarity.
acids and the same three base codons • AUG has dual functions. It acts as a
(triplet codon) direct the synthesis of protein initiator codon and also codes for the
from amino acids. For example, the mRNA amino acid methionine.
(UUU) codon codes for phenylalanine in all
• UAA, UAG and UGA) codons are
cells of all organisms. Some exceptions are
designated as termination (stop) codons
reported in prokaryotic, mitochondrial and
and also are known as “non-sense” codons.
chloroplast genomes. However similarities
are more common than differences.

Table 5.1 Genetic code dictionary

6HFRQG1XFOHRWLGHLQ&RGRQ
8 & $ *
8883KH)3KHQ\ODODQLQH 8&86HU66HULQH 8$87\U<7\URVLQH 8*8&\V&&\VWHLQH 8
88&3KH)3KHQ\ODODQLQH 8&&6HU66HULQH 8$&7\U<7\URVLQH 8*&&\V&&\VWHLQH &
8 8&$6HU66HULQH 8$$7HUPLQDWLRQ 8*$7HUPLQDWLRQ
88$/HX//HXFLQH $
8&*6HU66HULQH 8$*7HUPLQDWLRQ 8**7US:7U\SWRSKDQ
7KLUGQXFOHRWLGHLQFRGRQ ¶HQG

88*/HX//HXFLQH *
)LUVWQXFOHRWLGHLQFRGRQ ¶HQG

&88/HX//HXFLQH &&83UR33UROLQH &$8+LV++LVWLGLQH &*8$UJ5$UJLQLQH 8

&$&+LV++LVWLGLQH &*&$UJ5$UJLQLQH
& &8&/HX//HXFLQH &&&3UR33UROLQH &
&8$/HX//HXFLQH &&$3UR33UROLQH &$$*OQ4*OXWDPLQH &*$$UJ5$UJLQLQH $
&8*/HX//HXFLQH &&*3UR33UROLQH &$**OQ4*OXWDPLQH &**$UJ5$UJLQLQH *

$88,OH,,VROHXFLQH $&87KU77KUHRQLQH $$8$VQ1$VSDUDJLQH $*86HU66HULQH 8

$ $8&,OH,,VROHXFLQH $&&7KU77KUHRQLQH $$&$VQ1$VSDUDJLQH $*&6HU66HULQH &
$8$,OH,,VROHXFLQH $&$7KU77KUHRQLQH $$$/\V./\VLQH $*$$UJ5$UJLQLQH $
$8*0HW00HWKLRQLQH $&*7KU77KUHRQLQH $$*/\V./\VLQH $**$UJ5$UJLQLQH *

*889DO99DOLQH *&8$OD$$ODQLQH *$8$VS'$VSDUWLFDFLG **8*O\**O\FLQH 8

* *8&9DO99DOLQH *&&$OD$$ODQLQH *$&$VS'$VSDUWLFDFLG **&*O\**O\FLQH &
*8$9DO99DOLQH *&$$OD$$ODQLQH *$$*OX(*OXWDPLFDFLG **$*O\**O\FLQH $
*8*9DO99DOLQH *&*$OD$$ODQLQH *$**OX(*OXWDPLFDFLG ****O\**O\FLQH *

&RGRQ 7KUHHOHWWHUDQGVLQJOHOHWWHUDEEUHYLDWLRQV

75 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 75 24-02-2020 4.01.35 PM

 [Link]

5.10.1 Mutation and genetic code

Wobble Hypothesis
Comparative studies of mutations (sudden
change in a gene) and corresponding It is a hypothesis proposed by Crick
alteration in amino acid sequence of specific (1966) which states that tRNA anticodon
protein have confirmed the validity of the has the ability to wobble at its 5’ end by
genetic code. The relationship between genes pairing with even non-complementary
and DNA are best understood by mutation base of mRNA codon. According to this
studies. The simplest type of mutation at the hypothesis, in codon-anticodon pairing
molecular level is a change in nucleotide that the third base may not be complementary.
substitutes one base for another. Such changes The third base of the codon is called
are known as base substitutions which may wobble base and this position is called
occur spontaneously or due to the action of wobble position. The actual base pairing
mutagens. A well studied example is sickle occurs at first two positions only. The
cell anaemia in humans which results from a importance of Wobbling hypothesis
point mutation of an allele of β-haemoglobin is that it reduces the number of tRNAs
gene (βHb). A haemoglobin molecule required for polypeptide synthesis and it
consists of four polypeptide chains of two overcomes the effect of code degeneracy.
types, two α chains and two β-chains. Each
chain has a heme group on its surface. The
heme groups are involved in the binding of
oxygen. The human blood disease, sickle cell
anaemia is due to abnormal haemoglobin.
This abnormality in haemoglobin is due to a
single base substitution at the sixth codon of
the beta globin gene from GAG to GTG in β
-chain of haemoglobin. It results in a change In the above example though the
of amino acid glutamic acid to valine at the 6th codon and the anti codon do not match
position of the β -chain. This is the classical perfectly, yet the required amino acid
example of point mutation that results in the is brought perfectly. This enables the
change of amino acid residue glutamic acid to economy of tRNA, GUU, GUC, GUA and
valine (Fig. 5.10). The mutant haemoglobin GUG code for the amino acid - Valine.

DNA sequence 5' 3'

of non-template G T G C A C C T G A C T C C T G A G G A G
(coding) strand

Amino acid Glutamic Glutamic

sequence Valine Histidine Leucine Threonine Proline acid Normal red blood cells
acid

DNA sequence 5' 3'

of non-template G T G C A C C T G A C T C C T G T G G A G
(coding) strand

Amino acid Glutamic

Valine Histidine Leucine Threonine Proline Valine
sequence acid
Mutant Sickled red blood cells

DNA point mutation can lead to a different amino acid sequence Phenotype

Fig. 5. 10 DNA point mutation

Molecular Genetics 76

TN_GOVT_XII_Zoology_chapter5.indd 76 24-02-2020 4.01.36 PM

 [Link]

undergoes polymerisation under oxygen variable loop or extra arm. The amino acid
tension causing the change in the shape of is attached to one end (amino acid acceptor
the RBC from biconcave to a sickle shaped end) and the other end consists of three
structure. anticodon nucleotides. The anticodon pairs
with a codon in mRNA ensuring that the
The effect of point mutation can be
correct amino acid is incorporated into the
understood by the following example.
growing polypeptide chain. Four different
ABC DEF GHI JKL regions of double-stranded RNA are formed
during the folding process. Modified bases
If we insert a letter O between DEF are especially common in tRNA. Wobbling
and GHI the arrangement would be between anticodon and codon allows some
ABC DEF OGH IJK L tRNA molecules to read more than one codon.
The process of addition of amino acid
If we insert OQ at the same place the to tRNA is known as aminoacylation or
arrangement would be charging and the resultant product is called
aminoacyl- tRNA (charged tRNA). Without
ABC DEF OQG HIJ KL
aminoacylation tRNA is known as uncharged
The above information shows that insertion tRNA (Fig. 5.12). If two such tRNAs are
or deletion of one or two bases, changes the brought together peptide bond formation is
reading frame from the point of insertions or favoured energetically. Numbers of amino
deletions. Such mutations are referred to as acids are joined by peptide bonds to form a
frame shift insertion or deletion mutations. polypeptide chain. This aminoacylation is
This forms the genetic basis of proof that codon catalyzed by an enzyme aminoacyl – tRNA
is a triplet and is read in a continuous manner synthetase. This is an endothermic reaction
and is associated with ATP hydrolysis. 20
5.11. tRNA – the adapter molecule
$PLQRDFLGDWWDFKHGKHUH
The transfer RNA, (tRNA) molecule of a
cell acts as a vehicle that picks up the amino $  HQG
&
acids scattered through the cytoplasm and &
$ 6WHP
also reads specific codes of mRNA molecules.  HQG & *
* &
Hence it is called an adapter molecule. This & *
$ 8
term was postulated by Francis Crick. 8 $
& * 7ORRS 7\&
The two dimensional clover leaf model of 'ORRS '+8 $ 8 8
tRNA was proposed by Robert Holley. The ' * $ & 8 & * $8 *$ & $& & $
& *
secondary structure of tRNA depicted in * & 8* 8* 7 \ &
* ' $ * $ * &* &
8 7K\PLGLQH3VHXGRXULGLQH
Fig. 5.11 looks like a clover leaf. In actual
'LK\GURXULGLQH & *$ * DQG&\WLGLQH
structure, the tRNA is a compact molecule * & * 9DULDEOHORRS
$ 8
which looks like an inverted L. The clover & *
leaf model of tRNA shows the presence of $ \
& $
three arms namely DHU arm, middle arm 8 < $QWLFRGRQORRS
*$ $
and TΨC arm. These arms have loops such
as amino acyl binding loop, anticodon loop $QWLFRGRQ
and ribosomal binding loop at their ends. Fig. 5.11 Holley’s two-dimensional clover
In addition it also shows a small lump called leaf model of transfer RNA
77 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 77 24-02-2020 4.01.36 PM

 [Link]

different aminoacyl – tRNA synthetases are 5.12.1 Mechanism of

known. The power to recognize codon on the Translation
mRNA lies in the tRNA and not in the attached The cellular factory
amino acid molecule. responsible for synthesizing
protein is the ribosome.
The ribosome consists of
structural RNAs and about 80 different
proteins. In inactive state, it exists as two
subunits; large subunit and small subunit.
When the subunit encounters an mRNA,
the process of translation of the mRNA to
protein begins. The prokaryotic ribosome
(70 S) consists of two subunits, the
larger subunit (50 S) and smaller subunit
(30 S). The ribosomes of eukaryotes (80 S) are
larger, consisting of 60 S and 40 S sub units. ‘S’
denotes the sedimentation coefficient which
is expressed as Svedberg unit (S).
One of the alternative ways of dividing
up a sequence of bases in DNA or RNA
into codons is called reading frame. Any
sequence of DNA or RNA, beginning with
a start codon and which can be translated
into a protein is known as an Open Reading
Frame (ORF). A translational unit in mRNA
Fig. 5.12 Steps involved in charging tRNA.
is the sequence of RNA that is flanked by
The ‘X’ denotes that for each amino acid
the start codon (AUG) and the stop codon
only the corresponding specific tRNA and
and codes for polypeptides. mRNA also
specific aminoacyl tRNA synthetase enzyme
are involved in the charging process. have some additional sequences that are not
translated and are referred to as Untranslated
5.12 Translation Regions (UTR). UTRs are present at both
5' end (before start codon) and at 3' end
Translation refers to the process of
(after stop codon). The start codon (AUG)
polymerization of amino acids to form poly
begins the coding sequence and is read by a
peptide chain. The decoding process is carried
special tRNA that carries methionine (met).
out by ribosomes that bind mRNA and charged
The initiator tRNA charged with methionine
tRNA molecules. The mRNA is translated,
binds to the AUG start codon. In prokaryotes,
starting at the 5' end. After binding to mRNA,
N - formyl methionine (f met) is attached to
the ribosomes move along it, adding new amino
the initiator tRNA whereas in eukaryotes
acids to the growing polypeptide chain each
unmodified methionine is used. The 5' end
time it reads a codon. Each codon is read by an
of the mRNA of prokaryotes has a special
anticodon on the corresponding tRNA. Hence
sequence which precedes the initial AUG
the order and sequence of amino acids are
start codon of mRNA. This ribosome binding
defined by the sequence of bases in the mRNA.
site is called the Shine – Dalgarno sequence

Molecular Genetics 78

TN_GOVT_XII_Zoology_chapter5.indd 78 24-02-2020 4.01.36 PM

 [Link]

The assembly of ribosomal subunits, mRNA

and tRNA represent the initiation complex.
Once initiation complex has been assembled,
IF3 is released and allows the initiation
complex to combine with the 50S ribosomal
subunit to form the complete ribosome
(70S). In this process a molecule of GTP is
hydrolyzed providing the required energy

Fig. 5.13 a-Translation components

or S-D sequence. This sequences base-pairs

with a region of the 16Sr RNA of the small
ribosomal subunit facilitating initiation. The
subunits of the ribosomes (30 S and 50 S) are
usually dissociated from each other when not
involved in translation (Fig. 5.13a).
Initiation of translation in E. coli begins
with the formation of an initiation complex,
consisting of the 30S subunits of the ribosome,
a messenger RNA and the charged N-formyl
methionine tRNA (fmet – t RNA fmet), three
proteinaceous initiation factors (IF1, IF2, IF3),
GTP(Guanine Tri Phosphate) and Mg 2+.
The components that form the initiation
complex interact in a series of steps. IF3
binds to the 30S and allows the 30S subunit
to bind to mRNA. Another initiation protein
(IF2) then enhances the binding of charged
formyl methionine tRNA to the small subunit
in response to the AUG triplet. This step
‘sets’ the reading frame so that all subsequent
groups of three ribonucleotides are translated
accurately.
Fig. 5.13 b- Initiation

79 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 79 24-02-2020 4.01.36 PM

 [Link]

and the initiation factors

(IF1 and IF2 and
GDP) are released
(Fig. 5.13 b).
Elongation is the second
phase of translation. Once
both subunits of the ribosomes
are assembled with the mRNA,
binding sites for two charged
tRNA molecules are formed.
The sites in the ribosome are
referred to as the aminoacyl
site (A site), the peptidyl site (P
site) and the exit site (E site).
The charged initiator tRNA
binds to the P site. The next
step in prokaryotic translation
is to position the second tRNA
at the ‘A’ site of the ribosome
to form hydrogen bonds
between its anticodon and the
second codon on the mRNA
(step1). This step requires the
correct transfer RNA, another
GTP and two proteins called
elongation factors (EF-Ts and
EF-Tu).
Once the charged tRNA
molecule is positioned at the
A site, the enzyme peptidyl
transferase catalyses the
formation of peptide bonds that Fig. 5.13 c- Elongation of the growing polypeptide chain
link the two amino acids together during translation
(step 2). At the same time, the
of three nucleotides (step 3). This step requires
covalent bond between the amino acid and tRNA
several elongation factors (EFs) and the energy
occupying the P site is hydrolyzed (broken). The
derived from hydrolysis of GTP. This results in the
product of this reaction is a dipeptide which is
third triplet of mRNA to accept another charged
attached to the 3' end of tRNA still residing in the
tRNA into the A site (step 4). The sequence of
A site. For elongation to be repeated, the tRNA
elongation is repeated over and over (step 5 and
attached to the P site, which is now uncharged is
step 6). An additional amino acid is added to the
released from the large subunit. The uncharged
growing polypeptide, each time mRNA advances
tRNA moves through the ‘E’ site on the ribosome.
through the ribosome. Once a polypeptide chain
The entire mRNA-tRNA-aa1-aa2 complex
shifts in the direction of the ‘P’ site by a distance

Molecular Genetics 80

TN_GOVT_XII_Zoology_chapter5.indd 80 24-02-2020 4.01.37 PM

 [Link]

is assembled, it emerges out from the base of the in support of the idea that genes can be turned
large subunit (Fig. 5.13 c). on and off is very convincing. Regulation of
Termination is the third phase of translation. gene expression has been extensively studied
Termination of protein synthesis occurs when in prokaryotes, especially in E. coli. Gene
one of the three stop codons appears in the expression can be controlled or regulated
‘A’ site of the ribosome. The terminal codon at transcriptional or post transcriptional or
signals the action of GTP – dependent release translational level. Here, we are going to discuss
factor, which cleaves the polypeptide chain regulation of gene expression at transcriptional
from the terminal tRNA releasing it from level. Usually, small extracellular or intracellular
the translational complex (step 1). The tRNA metabolites trigger initiation or inhibition
is then released from the ribosome, which of gene expression. The clusters of gene with
then dissociates into its subunits (step 2) related functions are called operons. They
(Fig. 5.13 d). usually transcribe single mRNA molecules.
In [Link], nearly 260 genes are grouped into
75 different operons.

Many antibiotics do not allow pathogenic

bacteria to flourish in animal host because
they inhibit one or the other stage of bacterial
protein synthesis. The antibiotic tetracycline
inhibits binding between aminoacyl
tRNA and mRNA. Neomycin inhibits the
interaction between tRNA and mRNA.
Erythromycin inhibits the translocation of
mRNA along the ribosome. Streptomycin
inhibits the initiation of translation and
causes misreading. Chloramphenicol
inhibits peptidyl transferase and formation
of peptide bonds.

Structure of the operon: Each operon is a unit

of gene expression and regulation and consists
of one or more structural genes and an adjacent
operator gene that controls transcriptional
activity of the structural gene.
Fig. 5.13 d- Termination of the process of i) The structural gene codes for proteins,
translation rRNA and tRNA required by the cell.
5.13 R
 egulation of gene expression ii) Promoters are the signal sequences in
DNA that initiate RNA synthesis. RNA
We have previously established how DNA
polymerase binds to the promoter prior
is organized into genes, how genes store
to the initiation of transcription.
genetic information, and how this information
iii) The operators are present between the
is expressed. We now consider the most
promoters and structural genes. The
fundamental issues in molecular genetics.
repressor protein binds to the operator
How is genetic expression regulated? Evidence
region of the operon.

81 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 81 24-02-2020 4.01.37 PM

 [Link]

The Lac (Lactose) operon: 51$3RO\PHUDVH

The metabolism of lactose in XQDEOHWRELQGWR
SURPRWRU
[Link] requires three enzymes – S L S R ] \ D
,QDEVHQFH
RILQGXFHU
permease, β-galactosidase (β-gal)
and transacetylase. The enzyme 5HSUHVVRUELQGVWRWKHRSHUDWRU
permease is needed for entry of 5HSUHVVRUP51$ UHJLRQ R DQGSUHYHQWV51$
SRO\PHUDVHIURPWUDQVFULELQJ
lactose into the cell, β-galactosidase WKHRSHURQ
brings about hydrolysis of lactose
to glucose and galactose, while 5HSUHVVRU

transacetylase transfers acetyl 51$3RO\PHUDVHELQGWRSURPRWRU

group from acetyl Co A to S L S R ] \ D
,QSUHVHQFH
RILQGXFHU
β-galactosidase.
7UDQVFULSWLRQ
The lac operon consists of one
regulator gene (‘i’ gene refers to 5HSUHVVRUP51$ ODFP51$
inhibitor) promoter sites (p), and
operator site (o). Besides these, it ] \ D
,QGXFHU 7UDQVODWLRQ
has three structural genes namely
lac z,y and lac a. The lac ‘z’ gene βJDODFWRVLGDVHSHUPHDVHWUDQVDFHW\ODVH

codes for β-galactosidase, lac ‘y’ ,QDFWLYHUHSUHVVRU

gene codes for permease and ‘a’ Fig. 5.14 Lac Operon model
gene codes for transacetylase.
of all the required enzymes needed for lactose
Jacob and Monod proposed the classical model metabolism (Fig. 5.14). This regulation of
of Lac operon to explain gene expression and lac operon by the repressor is an example of
regulation in [Link]. In lac operon, a polycistronic negative control of transcription initiation. Lac
structural gene is regulated by a common operon is also under the control of positive
promoter and regulatory gene. When the cell is regulation as well.
using its normal energy source as glucose, the
‘i’ gene transcribes a repressor mRNA and after 5.14 Human Genome
its translation, a repressor protein is produced. Project (HGP)
It binds to the operator region of the operon and The international human genome project
prevents translation, as a result, β-galactosidase is was launched in the year 1990. It was a mega
not produced. In the absence of preferred carbon project and took 13 years to complete. The
source such as glucose, if lactose is available as human genome is about 25 times larger than the
an energy source for the bacteria then lactose genome of any organism sequenced to date and
enters the cell as a result of permease enzyme. is the first vertebrate genome to be completed.
Lactose acts as an inducer and interacts with the Human genome is said to have approximately
repressor to inactivate it. 3×109 bp. HGP was closely associated with the
The repressor protein binds to the operator rapid development of a new area in biology
of the operon and prevents RNA polymerase called bioinformatics.
from transcribing the operon. In the presence
of inducer, such as lactose or allolactose, the 5.14.1 Goals and methodologies of
repressor is inactivated by interaction with the Human Genome Project
inducer. This allows RNA polymerase to bind The main goals of Human Genome Project
to the promotor site and transcribe the operon are as follows
to produce lac mRNA which enables formation

Molecular Genetics 82

TN_GOVT_XII_Zoology_chapter5.indd 82 24-02-2020 4.01.37 PM

 [Link]

• Identify all the genes (approximately 30000) method called Shotgun sequencing using
in human DNA. super computers, which has replaced the
• Determine the sequence of the three billion traditional sequencing methods.
chemical base pairs that makeup the human
DNA. 5.14.2 Salient features of Human
• To store this information in databases. Genome Project:
• Improve tools for data analysis. • The human genome contains 3 billion
• Transfer related technologies to other nucleotide bases.
sectors, such as industries. • An average gene consists of 3000 bases,
• Address the ethical, legal and social issues the largest known human gene being
(ELSI) that may arise from the project. dystrophin with 2.4 million bases.

The methodologies of the Human Genome • Genes are distributed over 24

Project involved two major approaches. One chromosomes. Chromosome 19 has the
approach was focused on identifying all the highest gene density. Chromosome 13 and
genes that are expressed as RNA (ESTS – Y chromosome have lowest gene densities.
Expressed Sequence Tags). The other approach • The chromosomal organization of human
was sequence annotation. Here, sequencing the genes shows diversity.
whole set of genome was taken, that contains all
• There may be 35000-40000 genes in the
the coding and non-coding sequences and later
genome and almost 99.9 nucleotide bases
assigning different regions in the sequences with
are exactly the same in all people.
functions. For sequencing, the total DNA from
a cell is isolated and converted into random • Functions for over 50 percent of the
fragments of relatively smaller sizes and cloned discovered genes are unknown.
in suitable hosts using specialized vectors. This • Less than 2 percent of the genome codes
cloning results in amplification of pieces of for proteins.
DNA fragments so that it could subsequently
• Repeated sequences make up very large
be sequenced with ease. Bacteria and yeast
portion of the human genome. Repetitive
are two commonly used hosts and these
sequences have no direct coding functions
vectors are called as BAC (Bacterial Artificial
but they shed light on chromosome
Chromosomes) and YAC (Yeast Artificial
structure, dynamics and evolution
Chromosomes). The fragments are sequenced
(genetic diversity).
using automated DNA sequencers (developed
by Frederick Sanger). The sequences are then • Chromosome 1 has 2968 genes whereas
arranged based on few overlapping regions, chromosome ’Y’ has 231 genes.
using specialized computer based programs. • Scientists have identified about
These sequences were subsequently annotated 1.4 million locations where single
and are assigned to each chromosome. The base DNA differences (SNPs – Single
genetic and physical maps on the genome are nucleotidepolymorphism – pronounce as
assigned using information on polymorphism ‘snips’) occur in humans. Identification of
of restriction endonuclease recognition ‘SNIPS’ is helpful in finding chromosomal
sites and some repetitive DNA sequences, locations for disease associated sequences
called microsatellites. The latest method of and tracing human history.
sequencing even longer fragments is by a

83 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 83 24-02-2020 4.01.37 PM

 [Link]

5.14.3 Applications and 5.15 DNA fingerprinting technique

future challenges The DNA fingerprinting technique was first
The mapping of human chromosomes is developed by Alec Jeffreys in 1985 (Recipient
possible to examine a person’s DNA and to of the Royal Society’s Copley Medal in 2014).
identify genetic abnormalities. This is extremely Each of us have the same chemical structure of
useful in diagnosing diseases and to provide DNA. But there are millions of differences in
genetic counselling to those planning to have the DNA sequence of base pairs. This makes
children. This kind of information would also the uniqueness among us so that each of us
create possibilities for new gene therapies. Besides except identical twins is different from each
providing clues to understand human biology, other genetically. The DNA of a person and
learning about non-human organisms, DNA finger prints are unique. There are 23 pairs of
sequences can lead to an understanding of their human chromosomes with 1.5 million pairs
natural capabilities that can be applied towards of genes. It is a well known fact that genes are
solving challenges in healthcare, agriculture, segments of DNA which differ in the sequence
energy production and environmental of their nucleotides. Not all segments of
remediation. A new era of molecular medicine, DNA code for proteins, some DNA segments
characterized by looking into the most have a regulatory function, while others are
fundamental causes of disease than treating the intervening sequences (introns) and still
symptoms will be an important advantage. others are repeated DNA sequences. In DNA
• Once genetic sequence becomes easier fingerprinting, short repetitive nucleotide
to determine, some people may attempt sequences are specific for a person. These
to use this information for profit or for nucleotide sequences are called as variable
political power. number tandem repeats (VNTR).The
• Insurance companies may refuse to insure VNTRs of two persons generally show
people at ‘genetic risk’ and this would save variations and are useful as genetic markers.
the companies the expense of future medical 1
bills incurred by ‘less than perfect’ people. 2 Chromosome 7 Chromosome 7

• Another fear is that attempts are being

Chromosome 2 Chromosome 2
made to “breed out” certain genes of
people from the human population in Chromosome 16 Chromosome 16
order to create a ‘perfect race’. 1 Paternal Chromosome DNA from individual (A)

2 Maternal Chromosome DNA from individual (B)

Pharmacogenomics C A B
0 11
Number of short tandem repeats

is the study of how 12

genes affect a person’s

11
Chromosome 7 10
9

response to drugs. 8
7
Chromosome 2 6
This relatively new field combines 5
4

pharmacology (the science of drugs)

3
2
Chromosome 16 1

and genomics (the study of genes and DNA from crime scene (c) Amplified repeats, separated by size on
a gel, give a DNA fingerprint
their functions) to develop effective, Fig. 5.15 Schematic representation of
safe medications and doses that will be DNA fingerprinting : Few representative
tailored to a person’s genetic makeup. chromosomes have been shown to contain
different copy number of VNTR
Molecular Genetics 84

TN_GOVT_XII_Zoology_chapter5.indd 84 24-02-2020 4.01.37 PM

 [Link]

DNA finger printing involves identifying DNA of a criminal suspect to determine guilt
differences in some specific regions in DNA or innocence. VNTR patterns are also useful in
sequence called repetitive DNA, because establishing the identity of a homicide victim,
in these sequences, a small stretch of DNA either from DNA found as evidence or from the
is repeated many times. These repetitive body itself.
DNA are separated from bulk genomic DNA
The Steps in DNA Fingerprinting technique is
as different peaks during density gradient
depicted in Fig. 5.16.
centrifugation. The bulk DNA forms a major
1. Extraction of DNA
peak and the other small peaks are referred
to as satellite DNA. Depending on base The process of DNA fingerprinting starts
composition (A : T rich or G : C rich), length with obtaining a sample of DNA from
of segment and number of repetitive units, blood, semen, vaginal fluids, hair roots,
the satellite DNA is classified into many sub teeth, bones, etc.,
categories such as micro-satellites, mini- 2. Polymerase chain reaction (PCR)
satellites, etc., These sequences do not code for In many situations, there is only a small
any proteins, but they form a large portion of amount of DNA available for DNA
human genome. These sequences show high fingerprinting. If needed many copies
degree of polymorphism and form the basis of of the DNA can be produced by PCR
DNA fingerprinting (Fig. 5.15). DNA isolated (DNA amplification).
from blood, hair, skin cells, or other genetic 3. Fragmenting DNA
evidences left at the scene of a crime can be DNA is treated with restriction enzymes
compared through VNTR patterns, with the which cut the DNA into smaller fragments
at specific sites.

2 3

DNA is extracted DNA is cut into

from blood cells fragments by a
1
restriction enzyme 4
Blood sample
The DNA fragments
are separated into bands
during electrophoresis
11 in an agarose gel
The X-ray film is developed
to make visible the pattern of
bands which is known as a
DNA fingerprint 6 5
The radioactive The DNA band pattern in
DNA probe the gel is transferred to
is prepared a nylon membrane by
10 a technique known
as southern blotting
X-ray film is placed
next to the membrane
to detect the radioactive
pattern 7
The DNA probe binds
to specific DNA
sequences on the
9 membrane
At this stage, the
8
radioactivity probe is
bound to the DNA pattern Excess DNA probe is
on the membrane washed off

Fig. 5.16 Steps in DNA finger printing

85 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 85 24-02-2020 4.01.39 PM

 [Link]

4. Separation of DNA by electrophoresis • Pedigree analysis – inheritance pattern of

During electrophoresis in an agarose gel, the genes through generations and for detecting
DNA fragments are separated into bands inherited diseases.
of different sizes. The bands of separated • Conservation of wild life – protection of
DNA are sieved out of the gel using a nylon endangered species. By maintaining DNA
membrane (treated with chemicals that records for identification of tissues of the
allow for it to break the hydrogen bonds of dead endangered organisms.
DNA so there are single strands).
• Anthropological studies–It is useful in
5. Denaturing DNA determining the origin and migration of
The DNA on gels is denatured by using human populations and genetic diversities.
alkaline chemicals or by heating.
6. Blotting Summary
The DNA band pattern in the gel is In the twentieth century, one of the landmark
transferred to a thin nylon membrane placed discovery in biology was the identification of
over the ‘size fractionated DNA strand’ by DNA, as genetic material of living organisms.
Southern blotting. Gene may be defined as a segment of DNA which
7. Using probes to identify specific DNA is responsible for inheritance and expression of a
A radioactive probe (DNA labeled with particular character.
a radioactive substance) is added to the In 1953, James Watson and Francis Crick
DNA bands. The probe attaches by base proposed DNA structure based on X-ray
pairing to those restriction fragments crystallographic studies provided by Maurice
that are complementary to its sequence. Wilkins and Rosalind Franklin. Nucleotides
The probes can also be prepared by using are the structural units of nucleic acids. Each
either ‘fluorescent substance’ or ‘radioactive nucleotide has three components, i) pentose sugar
isotopes’. ii) nitrogenous base and iii) phosphate. DNA
8. Hybridization with probe and RNA are polynucleotides. DNA has double
After the probe hybridizes and the excess stranded helical structure while RNA is a single
probe washed off, a photographic film is stranded structure. DNA acts as genetic material of
placed on the membrane containing ‘DNA almost all the living organism except few viruses.
hybrids’. The non genetic RNAs are of three types;
m-RNA, r-RNA and t-RNA. They help in protein
9. Exposure on film to make a genetic/DNA
synthesis. DNA has capacity of replication, while
Fingerprint
the three types of RNA are transcribed on DNA.
The radioactive label exposes the film to form Meselson and Stahl (1958) proved experimentally
an image (image of bands) corresponding the semi-conservative nature of DNA replication
to specific DNA bands. The thick and thin using heavy isotope of nitrogen N15 in [Link].
dark bands form a pattern of bars which In 1958 Crick proposed that DNA determines
constitutes a genetic fingerprint. the sequence of amino acids in a polypeptide
Application of DNA finger printing (protein) through mRNA, and proposed the
central dogma of protein synthesis which
• Forensic analysis - It can be used in the
involves transcription and translation. The
identification of a person involved in
process of copying genetic information from one
criminal activities, for settling paternity
strand of DNA into RNA is termed transcription.
or maternity disputes, and in determining
The DNA transcribed RNA molecules serve as a
relationships for immigration purposes.
template for the synthesis of polypeptides by a
process termed translation. Each amino acid in

Molecular Genetics 86

TN_GOVT_XII_Zoology_chapter5.indd 86 24-02-2020 4.01.39 PM

 [Link]

a polypeptide chain is represented by a sequence 3. A mRNA molecule is produced by

of three nucleotides in the RNA known as the a) Replication b) Transcription
genetic code. RNA transfers genetic message c) Duplication d) Translation
from nucleus to the cytoplasm. DNA is always
4. The total number of nitrogenous bases in
present in the nucleus and synthesis is also
human genome is estimated to be about
confined to the nucleus
a) 3.5 million b) 35000
Jacob and Monod proposed the classical model
of Lac operon to explain gene expression and c) 35 million d) 3.1 billion
regulation in E. coli. In lac operon a polycistronic 5. E. coli cell grown on 15N medium are
structural gene is regulated by a common transferred to 14N medium and allowed to
promoter and regulator. It is an example of
grow for two generations. DNA extracted
negative control of transcription initiation.
from these cells is ultracentrifuged in a
Human genome project, a mega project was cesium chloride density gradient. What
aimed to sequence every gene in the human density distribution of DNA would you
genome. Polymerase chain reaction is an in vitro expect in this experiment?
method of synthesis of nucleic acids wherein,
(a) One high and one low density band.
a specific DNA segment is amplified rapidly
without concomitant replication of the rest of (b) One intermediate density band.
the DNA molecule. DNA fingerprinting is a (c) One high and one intermediate density
technique to identify variations in individuals of band.
a population at the DNA level. It has immense
(d) 
One low and one intermediate
applications in the field of forensic analysis,
density band.
pedigree analysis, anthropological studies, and
conservation of wild life. 6. What is the basis for the difference in the
synthesis of the leading and lagging strand
of DNA molecules?
Evaluation (a) Origin of replication occurs only at the
1. Hershey and Chase 5' end of the molecules.
experiment with (b) DNA ligase works only in the 3' → 5'
bacteriophage showed direction.
that (c) 
DNA polymerase can join new
a) Protein gets into the bacterial cells nucleotides only to the 3' end of the
b) DNA is the genetic material growing stand.
c) DNA contains radioactive sulphur (d) Helicases and single-strand binding
d) Viruses undergo transformation proteins that work at the 5' end.

2. DNA and RNA are similar with respect to 7. Which of the following is the correct
a) Thymine as a nitrogen base sequence of event with reference to the
b) A single-stranded helix shape central dogma?
c) Nucleotide containing sugars, nitrogen (a) Transcription, Translation, Replication
bases and phosphates (b) Transcription, Replication, Translation
d) The same sequence of nucleotides for the (c) Duplication, Translation, Transcription
amino acid phenyl alanine (d) Replication, Transcription, Translation

87 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 87 24-02-2020 4.01.39 PM

 [Link]

8. Which of the following statements about 13. An operon is a:

DNA replication is not correct? (a) Protein that suppresses gene expression
(a) Unwinding of DNA molecule occurs (b) Protein that accelerates gene expression
as hydrogen bonds break. C luster of structural genes with
(c) 
(b) Replication occurs as each base is related function
paired with another exactly like it. (d) Gene that switched other genes on or off
(c) Process is known as semi conservative 14. When lactose is present in the culture
replication because one old strand is medium:
conserved in the new molecule. (a) Transcription of lac y, lac z, lac a genes
(d) C omplementary base pairs are held occurs.
together with hydrogen bonds. (b) Repressor is unable to bind to the
9. Which of the following statements is not operator.
true about DNA replication in eukaryotes? Repressor is able to bind to the
(c) 
operator.
(a) Replication begins at a single origin of
(d) Both (a) and (b) are correct.
replication.
(b) Replication is bidirectional from the 15. Give reasons: Genetic code is ‘universal’.
origins.
16. Name the parts marked ‘A’ and ‘B’ in the
(c) Replication occurs at about 1 million
given transcription unit:
base pairs per minute.
(d) There are numerous different 17. Differentiate - Leading stand and lagging
bacterial chromosomes, with strand
replication ocurring in each at the
same time.
3’
10. 
The first codon to be deciphered was A
__________ which codes for ________.
(a) AAA, proline (b) GGG, alanine 3’
(c) UUU, Phenylalanine (d)TTT, arginine
B
11. Meselson and Stahl’s experiment proved
(a)Transduction 18. D
ifferentiate - Template strand and
(b) Transformation coding strand.
(c) DNA is the genetic material 19. Mention any two ways in which single
(d) 
S emi-conservative nature of DNA nucleotide polymorphism (SNPs)
replication identified in human genome can bring
12. Ribosomes are composed of two subunits; revolutionary change in biological and
the smaller subunit of a ribosome has a medical science.
binding site for _________ and the larger
subunit has two binding sites for two 20. State any three goals of the human genome
__________. (mRNA, tRNA) project.

Molecular Genetics 88

TN_GOVT_XII_Zoology_chapter5.indd 88 24-02-2020 4.01.39 PM

 [Link]

21. In [Link], three enzymes β- galactosidase, c) 

Write the source of energy for this
permease and transacetylase are produced replication and name the enzyme
in the presence of lactose. Explain why involved in this process.
the enzymes are not synthesized in the d) Mention the differences in the synthesis
absence of lactose. of protein, based on the polarity of the
22. Distinguish between structural gene, two template strands.
regulatory gene and operator gene. 31. If the coding sequence in a transcription
unit is written as follows:
23. A low level of expression of lac operon
occurs at all the time. Justify the statement. 5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
24. HGP is the windows for treatment of
32. How is the two stage process of protein
various genetic disorders. Justify the
synthesis advantageous?
statement.
[Link] did Hershey and Chase use
25. Why the human genome project is called radioactively labelled phosphorous
a mega project? and sulphur only? Would they have got
26. From their examination of the structure the same result if they use radiolabelled
of DNA, What did Watson and Crick carbon and nitrogen?
infer about the probable mechanism of 34. Explain the formation of a nucleosome.
DNA replication, coding capability and
35. It is established that RNA is the first
mutation?
genetic material. Justify giving reasons.
27. Why tRNA is called an adapter molecule?

28. What are the three structural differences

between RNA and DNA?

29. Name the anticodon required to recognize

the following codons: AAU, CGA, UAU,
and GCA.

30. a) Identify the figure given below

b) Redraw the structure as a replicating

fork and label the parts

3'
5'
3'
5'

89 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 89 24-02-2020 4.01.39 PM

 Molecular Genetics
Concept Map
&RQFOXVLYHO\

90
'1$LVWKH 'RXEOHKHOL[ 6SOLFLQJ
6LQJOHVWUDQG

TN_GOVT_XII_Zoology_chapter5.indd 90
JHQHWLFPDWHULDO QXFOHRVLGHV FDSSLQJ
P51$
QXFOHRWLGHV +HOLFDVH WDLOLQJ
W51$U51$
SRODULW\ LVRPHUDVH
%LRORJLVW
QRW SRO\PHUDVH
+HUVKH\
FRQYLQFHG DQG&KDVH
H[SHULPHQW &LVWURQ
([RQ,QWURQ

'1$LVWKH 51$
*ULIILWK¶V
JHQHWLF
H[SHULPHQW
PDWHULDO 7UDQVFULSWLRQ
5HSOLFDWLRQ XQLW3URPRWRU
'1$ 6WUXFWXUDOJHQH
%DFWHULDO 7HUPLQDWRU
WUDQVIRUPDWLRQ
6HDUFKLQJ
IRUJHQHWLF
PDWHULDO 7UDQVFULSWLRQ
FRGRQVVWRS
0ROHFXODU FRGRQV8QDPELJXRXV
'1$)LQJHU *HQHWLFV VSHFLILFGHJHQHUDWH
*HQHWLF
[Link]

SULQWLQJ XQLYHUVDO$8*
FRGH LQLWLDWRUFRGRQ

+XPDQ
9175DV JHQRPH 7UDQVODWLRQ
SUREH SURMHFW 5HJXODWLRQ
RIJHQH
H[SUHVVLRQ

&KDUJLQJRIW51$
$PLQRDF\ODWLRQ
,QHXNDU\RWHV± RIW51$8QUHODWHG
WUDQVFULSWLRQDOOHYHO UHJLRQVDQG
,GHQWLI\GHWHUPLQHWKH
3URFHVVLQJOHYHO 5HOHDVHIDFWRU
VHTXHQFHVWRUHGDWD
DQDO\VLVWUDQVIHUDQG 7UDQVSRUWRIP51$
(/6, DQG7UDQVODWLRQDO
OHYHO

24-02-2020 4.01.39 PM
 [Link]

ICT CORNER
Molecular Genetics

Lets us explore the gene

expression

Procedure :
Step 1: Use the URL or scan the QR Code to launch the “Gene Expression Essentials” activity
page.
Step 2: 
Click “Expression” pick the genetic material from the Biomolecule Toolbox,
understand the changes for the three different genes.
Step 3: Click “mRNA” and slide through the slider in Positive Transcription factors and
Negative Transcription factors such as Concentration, Affinity. Also Slide through
“Affinity” in RNA Polymerase.
Step 4: Click “Multiple Cells” and find the average protein level vs Time in the graph indicated
above.

Step 1 Step 2 Step 3

Step 4

Molecular Genetics URL:

[Link]
latest/gene-expression-essentials_en.html

*Pictures are indicative only

*Allow flash player

91 Molecular Genetics

TN_GOVT_XII_Zoology_chapter5.indd 91 24-02-2020 4.01.41 PM