0% found this document useful (0 votes)
20 views44 pages

Data Preprocessing Overview by Indu Joshi

The document provides an overview of data preprocessing, detailing types of data, attributes, and their properties. It discusses various data quality issues, such as noise, outliers, and missing values, along with techniques for data preprocessing like aggregation, sampling, and dimensionality reduction. Additionally, it covers similarity and dissimilarity measures, including Euclidean and cosine similarity, to assess relationships between data objects.

Uploaded by

kartikey4115
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
20 views44 pages

Data Preprocessing Overview by Indu Joshi

The document provides an overview of data preprocessing, detailing types of data, attributes, and their properties. It discusses various data quality issues, such as noise, outliers, and missing values, along with techniques for data preprocessing like aggregation, sampling, and dimensionality reduction. Additionally, it covers similarity and dissimilarity measures, including Euclidean and cosine similarity, to assess relationships between data objects.

Uploaded by

kartikey4115
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Data Preprocessing

Dr. Indu Joshi

Assistant Professor at
Indian Institute of Technology Mandi

8 August 2025
What is Data?

• Collection of data objects and their attributes


• An attribute is a property or characteristic of an object
• Examples: eye color of a person, temperature, etc.
• Attribute is also known as variable, field, characteristic, or
feature
• A collection of attributes describe an object
• Object is also known as record, point, case, sample, entity, or
instance
Data: Example

Attributes
Tid Refund Marital Taxable Cheat
Status Income
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
Types of Attributes

• There are different types of attributes


– Nominal (Name only, no order)
• Examples: ID numbers, eye color, zip codes
– Ordinal (Order matters, but not the exact difference)
• Examples: rankings (e.g., taste of potato chips on a scale from
1–10), grades, height in {tall, medium, short}
– Numeric (Interval-Scaled) (Order exists, No true zero
point)
• Examples: calendar dates, temperatures in Celsius or
Fahrenheit
– Numeric (Ratio-Scaled) (Ratios matter because zero is
absolute)
• Examples: temperature in Kelvin, length, time, counts
Properties of Attribute Values

• The type of an attribute depends on which of the following


properties it possesses:
• Distinctness: =, ̸=
• Order: <, >
• Addition: +, −
• Multiplication: ∗, /

Nominal attribute: distinctness


Ordinal attribute: distinctness & order
Interval attribute: distinctness, order & addition
Ratio attribute: all 4 properties
Attribute Types

Attribute Description Examples


Type
Nominal The values of a nominal attribute zip codes, employee ID
are just different names, i.e., nom- numbers, eye color, sex:
inal attributes provide only enough {male, female}
information to distinguish one ob-
ject from another. (=, ̸=)
Ordinal The values of an ordinal attribute hardness of minerals,
provide enough information to or- {good, better, best},
der objects (<, >). grades, street numbers
Attribute Types

Attribute Description Examples


Type
Interval For interval attributes, the differ- calendar dates, tem-
ences between values are meaning- perature in Celsius or
ful, i.e., a unit of measurement ex- Fahrenheit
ists. (+, −)
Ratio For ratio variables, both differ- temperature in Kelvin,
ences and ratios are meaningful. monetary quantities,
(∗, /) counts, age, mass,
length, electrical cur-
rent
Discrete and Continuous Attributes

• Discrete Attribute
• Has only a finite or countably infinite set of values
• Examples: zip codes, counts, or the set of words in a collection
of documents
• Often represented as integer variables.
• Note: binary attributes are a special case of discrete attributes

• Continuous Attribute
• Has real numbers as attribute values
• Examples: temperature, height, or weight.
• Practically, real values can only be measured and represented
using a finite number of digits.
• Continuous attributes are typically represented as
floating-point variables.
Types of data sets

• Record
• Data Matrix
• Document Data
• Transaction Data

• Graph
• World Wide Web
• Molecular Structures

• Ordered
• Spatial Data
• Temporal Data
• Sequential Data
• Genetic Sequence Data
Record Data

• Data that consists of a collection of records, each of which


consists of a fixed set of attributes

Tid Refund Marital Status Taxable Income Cheat


1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
Data Matrix

• If data objects have the same fixed set of numeric attributes,


then the data objects can be thought of as points in a
multi-dimensional space, where each dimension represents a
distinct attribute.
• Such data set can be represented by an m × n matrix, where
there are m rows, one for each object, and n columns, one for
each attribute.

Projection Projection Distance Load Thickness


of x Load of y Load
10.23 5.27 15.22 2.7 1.2
12.65 6.25 16.22 2.2 1.1
Text Data

• Each document becomes a ‘term’ vector,


• each term is a component (attribute) of the vector,
• the value of each component is the number of times the
corresponding term occurs in the document.
Graph Data

• Examples: Facebook graph and HTML Links


Transaction Data

• A special type of record data, where


• each record (transaction) involves a set of items.
• For example, consider a grocery store. The set of products
purchased by a customer during one shopping trip constitute a
transaction, while the individual products that were purchased
are the items.

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Ordered Data

• Genomic sequence data

GGTTCGCCTTCAGCCCGGGC
CGCAGGGCCCGCCGCGGTCC
GAGAAGGGCGCCTGCCGTGC
GGGGAGGGGCCCGCGGAGGG
CCAACCGAGTCGACAGTGGC
CCCTCTGCTTAGACCTGAGG
GCTCATTAGGCCGAGGCTGG
GCCAAGTAGAACGGGCCAGG
TGGGTCGCCGCGGACCAGGG
Record Data
• Data that consists of a collection of records, each of which
consists of a fixed set of attributes

Tid Refund Marital Taxable Cheat


Status Income
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K No
9 No Married 75K No
10 No Single 90K Yes
Data Quality

• What kinds of data quality problems?


• How can we detect problems with the data?
• What can we do about these problems?
• Examples of data quality problems:
• Noise and outliers
• Missing values
• Duplicate data
Noise

• Noise refers to modification of original values


• Examples: distortion of a person’s voice when talking on a
poor phone line and “snow” (Random white and black dots)
on television screen
Outliers

• Outliers are data objects with characteristics that are


considerably different than most of the other data objects in
the data set
Missing Values

• Reasons for missing values


• Information is not collected (e.g., people decline to give their
age and weight)
• Attributes may not be applicable to all cases (e.g., annual
income is not applicable to children)

• Handling missing values


• Eliminate Data Objects
• Estimate Missing Values
Duplicate Data

• Data set may include data objects that are duplicates, or


almost duplicates of one another
• Major issue when merging data from heterogenous sources
• Examples:
• Same person with multiple email addresses
• Data cleaning
• Process of dealing with duplicate data issues
Data Preprocessing

• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation
Aggregation

• Combining two or more attributes (or objects) into a single


attribute (or object)
• Example- instead of keeping both height and weight
attributes, you combine them into body mass index (BMI) or
combining daily sales data into monthly sales data
• Purpose
• Data reduction
• Reduce the number of attributes or objects
• Change of scale
• Cities aggregated into regions, states, countries, etc
• More “stable” data
• Aggregated data tends to have less variability
Sampling

• Sampling is the main technique employed for data selection.


• It is often used for both the preliminary investigation of the
data and the final data analysis.

• Statisticians sample because obtaining the entire set of


data of interest is too expensive or time consuming.

• Sampling is used in data mining because processing the


entire set of data of interest is too expensive or time
consuming.
Sample Size

8000 points 2000 points 500 points


Sampling . . .

• The key principle for effective sampling is the following:


• using a sample will work almost as well as using the entire
data sets, if the sample is representative
• A sample is representative if it has approximately the same
property (of interest) as the original set of data
Types of Sampling

• Simple Random Sampling


There is an equal probability of selecting any particular item
• Sampling without replacement
As each item is selected, it is removed from the population
• Sampling with replacement
Objects are not removed from the population as they are
selected for the sample.
• In sampling with replacement, the same object can be picked
up more than once
• Stratified sampling
Split the data into several partitions; then draw random
samples from each partition
Curse of Dimensionality

• When dimensionality increases, data becomes increasingly


sparse in the space that it occupies
• Definitions of density and distance between points, which is
critical for clustering and outlier detection, become less
meaningful
Dimensionality Reduction

Purpose:
• Avoid curse of dimensionality
• Reduce amount of time and memory required by machine
learning algorithms
• Allow data to be more easily visualized
• May help to eliminate irrelevant features or reduce noise

Techniques:
• Principle Component Analysis
• Singular Value Decomposition
Feature Subset Selection

• Another way to reduce dimensionality of data


• Redundant features
• duplicate much or all of the information contained in one or
more other attributes
• Example: purchase price of a product and the amount of sales
tax paid
• Irrelevant features
• contain no information that is useful for the machine learning
task at hand
• Example: students’ ID is often irrelevant to the task of
predicting students’ GPA
Feature Creation

• Create new attributes that can capture the important


information in a data set much more efficiently than the
original attributes
• General methodologies::
• Feature Extraction
• domain-specific
• Mapping Data to New Space
Discretization

Data Equal interval width

Equal frequency K-means


Attribute Transformation

• A function that maps the entire set of values of a given


attribute to a new set of replacement values such that each
old value can be identified with one of the new values
• Simple functions: x k , log(x), e x , |x|
• Standardization and Normalization
Similarity and Dissimilarity

• Similarity
• Numerical measure of how alike two data objects are.
• Is higher when objects are more alike.
• Often falls in the range [0,1]
• Dissimilarity
• Numerical measure of how different are two data objects
• Lower when objects are more alike
• Minimum dissimilarity is often 0
• Proximity refers to a similarity or dissimilarity
Similarity/Dissimilarity for Simple Attributes

p and q are the attribute values for two data objects


Euclidean Distance

• Euclidean Distance
v
u n
uX
dist = t (pk − qk )2
k=1

• Where n is the number of dimensions (attributes) and pk and


qk are, respectively, the k th attributes (components) of data
objects p and q.
• Standardization is necessary, if scales differ.
Mahalanobis Distance
Definition

s(p, q) = (p − q) Σ−1 (p − q)T

Covariance Matrix of Input Data X


n
1 X  
Σj,k = Xij − X j Xik − X k
n−1
i=1
Cosine Similarity

• If d1 and d2 are two document vectors, then

d1 · d2
cos(d1 , d2 ) =
∥d1 ∥∥d2 ∥

where · indicates vector dot product and ∥d∥ is the length of


vector d.
Example:
d1 = 3205000200
d2 = 1000000102

d1 ·d2 = 3∗1+2∗0+0∗0+5∗0+0∗0+0∗0+0∗0+2∗1+0∗0+0∗2 = 5
Cosine Similarity

p
∥d1 ∥ = 32 + 22 + 02 + 52 + 02 + 02 + 02 + 22 + 02 + 02

= 42 = 6.481

p
∥d2 ∥ = 12 + 02 + 02 + 02 + 02 + 02 + 02 + 12 + 02 + 22

= 6 = 2.245
5
cos(d1 , d2 ) = = 0.3150
6.481 × 2.245
Similarity Between Binary Vectors
• Common situation is that objects, p and q, have only binary
attributes
• Compute similarities using the following quantities:
• M01 = the number of attributes where p was 0 and q was 1
• M10 = the number of attributes where p was 1 and q was 0
• M00 = the number of attributes where p was 0 and q was 0
• M11 = the number of attributes where p was 1 and q was 1
• Simple Matching and Jaccard Coefficients:
• Simple Matching Coefficient (SMC):

number of matches M11 + M00


SMC = =
number of attributes M01 + M10 + M11 + M00
• Jaccard Coefficient (J):

number of 11 matches M11


J= =
number of not-both-zero attribute values M01 + M10 + M11
Correlation

• Correlation measures the linear relationship between objects.


• To compute correlation, we standardize data objects, p and q,
and then take their dot product:

pk − mean(p)
pk′ =
std(p)
qk − mean(q)
qk′ =
std(q)
correlation(p, q) = p · q′

Visually Evaluating Correlation
Scatter plots showing similarity from −1 to 1
Correlation

• +1: Perfect positive correlation: The points lie exactly in an


upward-sloping straight line. As x increases, y increases
proportionally.
• -1: Perfect negative correlation: Points lie exactly on a
downward-sloping straight line. As x increases, y decreases
proportionally.
• 0: No correlation: Points are scattered randomly; no linear
relationship.
Thank You

Contact: indujoshi@[Link]

You might also like