Methods in

Molecular Biology 1391

S. Mohan Jain Editor

Protocols for In Vitro

Cultures and Secondary
Metabolite Analysis
of Aromatic and
Medicinal Plants
Second Edition
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

[Link]
Protocols for In Vitro Cultures
and Secondary Metabolite
Analysis of Aromatic
and Medicinal Plants
Second Edition

Edited by

S. Mohan Jain
Applied Biology, University of Helsinki, Helsinki, Finland
Editor
S. Mohan Jain
Applied Biology
University of Helsinki
Helsinki, Finland

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-3330-3 ISBN 978-1-4939-3332-7 (eBook)
DOI 10.1007/978-1-4939-3332-7

Library of Congress Control Number: 2016934450

Springer New York Heidelberg Dordrecht London

© Springer Science+Business Media New York 2016
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed
to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.

Printed on acid-free paper

Humana Press is a brand of Springer

Springer Science+Business Media LLC New York is part of Springer Science+Business Media ([Link])
Preface

It is well known that plants consistently synthesize, accumulate, and use a bewildering
range of secondary metabolites as a part of their overall defense strategy. Many of these
metabolites have been used around the world as medicines for various human health prob-
lems. In recent years the quest for quality of life and a common belief that plants are “natu-
ral and therefore safe” have paved the way for a wider acceptance of plant-based medicines
worldwide. International trade in medicinal plants has become a major force in the global
economy, and the demand is increasing in both developed and developing countries. Thus,
the continued rise in consumer demand for plant-based medicines and the expanding world
population have resulted in the indiscriminate harvest of wild species of medicinal plants.
As well, a reduction of natural habitats for medicinal plants has placed many wild species in
danger of extinction. The impact of rapid climate changes may also have an adverse effect
on wild plant species leading to the loss of useful genetic material. Most medicinal plants
are harvested from the wild, and the traditional agricultural and horticultural practices have
not been developed even for most commonly used medicinal plant species.
The quality and consistency of the products are most challenging issues facing the
plant-based medicines. The production of medicinal metabolites in plants is affected by
plant genotype, cultivation, harvesting, processing, and distribution. Medicinal plant prep-
arations may also be contaminated with microbes and soil contaminants such as heavy met-
als, herbicides, pesticides, and other agricultural chemicals which can cause qualitative and
quantitative changes in the levels of medicinal metabolites. The widespread occurrence of
chemical variability and compromised quality of medicinal plants remain the major factors
in inconsistent results of clinical trials of plant-based medicines. New regulations are cur-
rently being developed internationally to ensure consistency, safety, and efficacy of plant-
based medicines as well as how they are developed, manufactured, and marketed. Clearly,
there is an imminent need for the development of new technologies and production
approaches to improve the overall strategy of medicinal plant production to comply with
upcoming legal regulations.
In vitro cell culture and controlled environment production systems offer an excellent
opportunity for the selection and seasonal independent propagation of elite lines with spe-
cific, consistent levels of medicinal metabolites with minimum contamination. Additionally,
the plant materials produced by in vitro techniques allow efficient application of the emerg-
ing analytical methods. The impact of these techniques perhaps greatest in the improvement
of medicinal plants since the resulting genetic diversity may open avenues for the discovery
of new medicinal metabolites and treatments. This book provides a detailed step-by-step
description of protocols for the establishment of in vitro cultures of important medicinal
plants, their mass multiplication in controlled environment, and stepwise secondary metabo-
lite analysis. In addition many of these protocols will provide a basis for much needed efforts
of in vitro germplasm conservation or cryopreservation of medicinal plant species at the
brink of extinction as well as to protect them from the adverse impact of rapid climatic
changes. This book will certainly appeal to graduate and postgraduate students, researchers,
biotechnologists, industry, and the Government agencies and could be used as a textbook.

v
vi Preface

This book contains 30 book chapters dealing with in vitro propagation of medicinal
plants. Each manuscript has been peer reviewed and revised accordingly.
We greatly appreciate all reviewers who have contributed their time to review manu-
scripts that certainly helped in improving the quality of contributory manuscripts. Our
sincere thanks are due to the Humana Publishers for giving us the opportunity to edit
this book.

Helsinki, Finland S. Mohan Jain

Contents

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi

1 Protocols for In Vitro Mass Multiplication and Analysis

of Medicinally Important Phenolics of a Salep Orchid,
Satyrium nepalense [Link] (“Salam Mishri”) . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Shashi B. Babbar and Deepak K. Singh
2 In Vitro Culture and Phytochemical Analysis of Passiflora tenuifila
Killip and Passiflora setacea DC (Passifloraceae). . . . . . . . . . . . . . . . . . . . . . . . 13
Jenny Sumara Sozo, Daniel Cuzziol Cruz, Ana Flavia Pavei,
Isadora Medeiros da Costa Pereira, Marcia Wolfart, Fernanda Ramlov,
Daiane Fiuza Montagner, Marcelo Maraschin, and Ana Maria Viana
3 Shoot Tip Meristem Cryopreservation of Hypericum Species . . . . . . . . . . . . . . 31
Katarína Bruňáková and Eva Čellárová
4 Protocols for Biotechnological Interventions in Improvement
of Vanilla (Vanilla planifolia Andrews.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Minoo Divakaran, K. Nirmal Babu, and K.V. Peter
5 Assessment of In Vitro Biological Activities of Anthocyanins-Rich
Plant Species Based on Plinia cauliflora Study Model . . . . . . . . . . . . . . . . . . . 65
Heloisa S. Pitz, Adriana C.D. Trevisan, Fausto R. Cardoso,
Aline Pereira, Eduardo L.G. Moreira, Manuel A. de Prá,
Letícia Mazzarino, Maria B. Veleirinho, Rosendo A. Yunes,
Rosa M.R. do Valle, and Marcelo Maraschin
6 Biotechnological Approaches for Biomass and Cardenolide
Production in Digitalis purpurea L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Naivy Pérez-Alonso, Borys Chong-Pérez, Alina Capote, Anabel Pérez,
André Gerth, Geert Angenon, and Elio Jiménez
7 In Vitro Regeneration of Endangered Medicinal Plant
Heliotropium kotschyi (Ramram) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
Manal Ahmed Sadeq, Malabika Roy Pathak, Ahmed Ali Salih,
Mohammed Abido, and Asma Abahussain
8 Micropropagation and Biomass Production of True-to-Type
Stevia rebaudiana Bertoni. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
Arpan R. Modi, Vikas Sharma, Ghanshyam Patil,
Amritpal S. Singh, N. Subhash, and Nitish Kumar
9 Panax ginseng Adventitious Root Suspension Culture:
Protocol for Biomass Production and Analysis
of Ginsenosides by High Pressure Liquid Chromatography . . . . . . . . . . . . . . . 125
Hosakatte Niranjana Murthy and Kee Yoeup Paek

vii
viii Contents

10 Immobilization of Rubia tinctorum L. Suspension Cultures

and Biomass Production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
Pınar Nartop
11 In Vitro Propagation and Conservation of Bacopa monnieri L. . . . . . . . . . . . . 153
Neelam Sharma, Rakesh Singh, and Ruchira Pandey
12 Establishment, Culture, and Scale-up of Brugmansia candida
Hairy Roots for the Production of Tropane Alkaloids . . . . . . . . . . . . . . . . . . . 173
Alejandra Beatriz Cardillo, Julián Rodriguez Talou,
and Ana María Giulietti
13 Micropropagation, Acclimatization, and Greenhouse
Culture of Veratrum californicum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
Sarah A. White, Jeffrey Adelberg, Jacqueline Naylor-Adelberg,
David A. Mann, Ju Yeon Song, and Youping Sun
14 In Vitro Propagation of Withania somnifera (L.) Dunal . . . . . . . . . . . . . . . . . 201
Pritika Singh, Rupam Guleri, and Pratap Kumar Pati
15 In Vitro Propagation of Sambong (Blumea balsamifera Linn.) . . . . . . . . . . . . 215
Thelma L. Soriano and Evangelina C. Cangao
16 Production of Gymnemic Acid from Cell Suspension Cultures
of Gymnema sylvestre . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
Praveen Nagella, Vijayalaxmi S. Dandin,
and Hosakatte Niranjana Murthy
17 Scale-Up of Agrobacterium rhizogenes-Mediated
Hairy Root Cultures of Rauwolfia serpentina:
A Persuasive Approach for Stable Reserpine Production. . . . . . . . . . . . . . . . . . 241
Shakti Mehrotra, Vikas Srivastava, Manoj K. Goel,
and Arun K. Kukreja
18 In Vitro Shoot Cultures and Analysis of Steroidal
Lactones in Withania coagulans (Stocks) Dunal. . . . . . . . . . . . . . . . . . . . . . . . 259
Rohit Jain, Sumita Kachhwaha, and S.L. Kothari
19 In Vitro Propagation of Cannabis sativa L. and Evaluation
of Regenerated Plants for Genetic Fidelity and Cannabinoids
Content for Quality Assurance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
Hemant Lata, Suman Chandra, Ikhlas A. Khan,
and Mahmoud A. ElSohly
20 Transcript Quantification of Genes Involved in Steviol Glycoside
Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase
Chain Reaction (RT-PCR) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Arpan Modi, Nitish Kumar, and Subhash Narayanan
21 In Vitro Propagation and Conservation of Withania somnifera (Dunal) L. . . . 303
Nigar Fatima, Naseem Ahmad, and Mohammad Anis
22 Construction of Hypericin Gland-Specific cDNA Library via
Suppression Subtractive Hybridization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 317
Rupesh Kumar Singh, Weina Hou, and Gregory Franklin
 Contents ix

23 In Vitro and Cryopreservation Techniques for Conservation

of Snow Mountain Garlic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 335
Ritu Mahajan
24 In Vitro Callus Induction and Plant Regeneration
from Stem Explants of Ceropegia noorjahaniae,
a Critically Endangered Medicinal Herb . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 347
Jaykumar J. Chavan and Mahendra L. Ahire
25 Somatic Embryogenesis of Date Palm (Phoenix dactylifera L.)
Through Cell Suspension Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357
Poornananda M. Naik and Jameel M. Al-Khayri
26 Protocols for Improvement of Black Pepper (Piper nigrum L.)
Utilizing Biotechnological Tools . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 367
K. Nirmal Babu, Minoo Divakaran, G. Yamuna,
P.N. Ravindran, and K.V. Peter
27 Protocols for In Vitro Propagation, Conservation,
Synthetic Seed Production, Microrhizome Production,
and Molecular Profiling in Turmeric (Curcuma longa L.) . . . . . . . . . . . . . . . . 387
K. Nirmal Babu, Minoo Divakaran, Geetha S. Pillai,
V. Sumathi, K. Praveen, Rahul P. Raj, H.J. Akshita,
P.N. Ravindran, and K.V. Peter
28 Protocols for In Vitro Propagation, Conservation,
Synthetic Seed Production, Embryo Rescue,
Microrhizome Production, Molecular Profiling,
and Genetic Transformation in Ginger (Zingiber officinale Roscoe.) . . . . . . . . 403
K. Nirmal Babu, K. Samsudeen, Minoo Divakaran,
Geetha S. Pillai, V. Sumathi, K. Praveen,
P.N. Ravindran, and K.V. Peter
29 Hairy Root Cultures of Gymnema sylvestre R. Br.
to Produce Gymnemic Acid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 427
J. Rajashekar, Vadlapudi Kumar, V. Veerashree, D.V. Poornima,
Torankumar Sannabommaji, Hari Gajula, and B. Giridhara
30 In Vitro Mass Propagation of Cymbopogon citratus
Stapf., a Medicinal Gramineae. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 445
Elisa Quiala, Raúl Barbón, Alina Capote, Naivy Pérez,
and Elio Jiménez

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 459
Contributors

ASMA ABAHUSSAIN • Desert and Arid Zone Sciences Program, College of Graduate Studies,
Arabian Gulf University, Manama, Kingdom of Bahrain
MOHAMMED ABIDO • Desert and Arid Zone Sciences Program, College of Graduate Studies,
Arabian Gulf University, Manama, Kingdom of Bahrain
JEFFREY ADELBERG • Department of Agricultural and Environmental Sciences,
Clemson University, Clemson, SC, USA
MAHENDRA L. AHIRE • Department of Botany, Laboratory of Plant Biotechnology
and Biochemistry, Yashavantrao Chavan Institute of Science, Satara, India
NASEEM AHMAD • Plant Biotechnology Laboratory, Department of Botany,
Aligarh Muslim University, Aligarh, India; Department of Botany and Microbiology,
College of Science, King Saud University, Riyadh, Saudi Arabia
H.J. AKSHITA • All India Coordinated Research Project on Spices, Indian Institute of Spices
Research, Kozhikode, Kerala, India
JAMEEL M. AL-KHAYRI • Department of Agricultural Biotechnology, College of Agriculture
and Food Sciences, King Faisal University, Al-Hassa, Saudi Arabia
GEERT ANGENON • Laboratory of Plant Genetics, Vrije Universiteit Brussel,
Brussels, Belgium
MOHAMMAD ANIS • Plant Biotechnology Laboratory, Department of Botany,
Aligarh Muslim University, Aligarh, India; Department of Botany and Microbiology,
College of Science, King Saud University, Riyadh, Saudi Arabia
SHASHI B. BABBAR • Department of Botany, University of Delhi, Delhi, India
RAÚL BARBÓN • Instituto de Biotecnología de las Plantas, Universidad Central “Marta
Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba
KATARÍNA BRUŇÁKOVÁ • Faculty of Science, Institute of Biology and Ecology, P. J. Šafárik
University in Košice, Košice, Slovakia
EVANGELINA C. CANGAO • Department of Agriculture, Bureau of Plant Industry,
San Andres, Malate, Manila, Philippines
ALINA CAPOTE • Instituto de Biotecnología de las Plantas, Universidad Central “Marta
Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba
ALEJANDRA BEATRIZ CARDILLO • Cátedra de Biotecnología-Instituto NANOBIOTEC
(UBA/CONICET), Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires,
Buenos Aires, Argentina
FAUSTO R. CARDOSO • Plant Morphogenesis and Biochemistry Laboratory, Natural Products
Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina State, Brazil
EVA ČELLÁROVÁ • Faculty of Science, Institute of Biology and Ecology, P. J. Šafárik
University in Košice, Košice, Slovakia
SUMAN CHANDRA • National Center for Natural Product Research, Research Institute of
Pharmaceutical Sciences, School of Pharmacy, University of Mississippi, Mississippi, MS, USA
JAYKUMAR J. CHAVAN • Department of Botany, Laboratory of Plant Biotechnology and
Biochemistry, Yashavantrao Chavan Institute of Science, Satara, India

xi
xii Contributors

BORYS CHONG-PÉREZ • Instituto de Biotecnología de las Plantas, Universidad Central

“Marta Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba; Laboratory of Plant
Genetics, Vrije Universiteit Brussel, Brussels, Belgium
ISADORA MEDEIROS DA COSTA PEREIRA • Departamento de Botânica (Centro de Ciências
Biológicas), Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
DANIEL CUZZIOL CRUZ • Departamento de Botânica (Centro de Ciências Biológicas),
Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
VIJAYALAXMI S. DANDIN • Department of Botany, Karnatak University, Dharwad, India
MINOO DIVAKARAN • Providence Women’s College, Kozhikode, India
MAHMOUD A. ELSOHLY • National Center for Natural Product Research, Research
Institute of Pharmaceutical Sciences, School of Pharmacy, University of Mississippi,
Mississippi, MS, USA; Department of Pharmaceutics, School of Pharmacy,
University of Mississippi, Mississippi, MS, USA
NIGAR FATIMA • Department of Agriculural Microbiology, Aligarh Muslim University,
Aligarh (UP) India
GREGORY FRANKLIN • Centre for the Research and Technology of Agro-Environment and
Biological Sciences (CITAB), University of Minho, Braga, Portugal; Department of
Integrative Plant Biology, Institute of Plant Genetics of the Polish Academy of Sciences,
Poznan, Wielkopolska, Poland
HARI GAJULA • Department of Biochemistry, Davangere University, Shivagangothri,
Davangere, Karnataka, India
ANDRÉ GERTH • VITA, Leipzig, Germany
B. GIRIDHARA • Department of Biochemistry, Davangere University, Shivagangothri,
Davangere, Karnataka, India
ANA MARÍA GIULIETTI • Cátedra de Biotecnología-Instituto NANOBIOTEC (UBA/
CONICET), Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires,
Buenos Aires, Argentina
MANOJ K. GOEL • BioSeed Research India Limited, ICRISAT,
Patancheru, Hyderabad, India
RUPAM GULERI • Department of Biotechnology, Guru Nanak Dev University,
Amritsar, Punjab, India
WEINA HOU • Centre for the Research and Technology of Agro-Environment and Biological
Sciences (CITAB), University of Minho, Braga, Portugal
ROHIT JAIN • Department of Botany, University of Rajasthan, Jaipur, India; Department
of Biosciences, Manipal University, Jaipur, India
ELIO JIMÉNEZ • Instituto de Biotecnología de las Plantas, Universidad Central “Marta Abreu”
de Las Villas, Santa Clara, Villa Clara, Cuba; Tropical Research and Education Center,
Institute of Food and Agricultural Sciences, University of Florida, Homestead, FL, USA
SUMITA KACHHWAHA • Department of Botany, University of Rajasthan, Jaipur, India
IKHLAS A. KHAN • National Center for Natural Product Research, Research Institute
of Pharmaceutical Sciences, School of Pharmacy, University of Mississippi, Mississippi,
MS, USA; Department of Pharmacognosy, School of Pharmacy, University of Mississippi,
Mississippi, MS, USA
S.L. KOTHARI • Department of Botany, University of Rajasthan, Jaipur, India;
Amity Institute of Biotechnology, Amity University Rajasthan, Jaipur, India
ARUN K. KUKREJA • Plant Biotechnology Division, Central Institute of Medicinal &
Aromatic Plants, Lucknow, India
 Contributors xiii

NITISH KUMAR • Centre of Biological Sciences (Biotechnology), School of Earth,

Biological and Environmental Science, Central University of Bihar, Patna, India
VADLAPUDI KUMAR • Department of Biochemistry, Davangere University, Shivagangothri,
Davangere, Karnataka, India; Department of Biochemistry, Kuvempu
University-P.G. Centre, Shivagangothri, Davangere, Karnataka, India
TORANKUMAR SANNABOMMAJI • Department of Biochemistry, Davangere University,
Shivagangothri, Davangere, Karnataka, India
HEMANT LATA • National Center for Natural Product Research, Research Institute of
Pharmaceutical Sciences, School of Pharmacy, University of Mississippi, Mississippi, MS, USA
RITU MAHAJAN • School of Biotechnology, University of Jammu, Jammu, India
DAVID A. MANN • Infinity Pharmaceutical, Cambridge, MA, USA
MARCELO MARASCHIN • Plant Morphogenesis and Biochemistry Laboratory, Natural
Products Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina
State, Brazil
LETÍCIA MAZZARINO • Plant Morphogenesis and Biochemistry Laboratory, Natural Products
Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina State, Brazil;
Nanoscoping Solutions in Nanotechnology, Florianópolis, Santa Catarina State, Brazil
SHAKTI MEHROTRA • Plant Biotechnology Division, Central Institute of Medicinal &
Aromatic Plants, Lucknow, India
ARPAN R. MODI • Department of Agricultural Biotechnology, Plant Tissue Culture Lab,
Anand Agricultural University, Anand, Gujarat, India
EDUARDO L.G. MOREIRA • Nanoscoping Solutions in Nanotechnology, Florianópolis, Santa
Catarina State, Brazil
HOSAKATTE NIRANJANA MURTHY • Department of Botany, Karnatak University, Dharwad,
India
PRAVEEN NAGELLA • Department of Botany, Christ University, Bangalore, India
POORNANANDA M. NAIK • Department of Agricultural Biotechnology, College of
Agriculture and Food Sciences, King Faisal University, Al-Hassa, Saudi Arabia
SUBHASH NARAYANAN • Department of Agricultural Biotechnology, Anand Agricultural
University, Anand, India
PINAR NARTOP • Department of Biomedical Engineering, Çorlu Faculty of Engineering,
Namik Kemal University, Çorlu, Tekirdağ, Turkey
JACQUELINE NAYLOR-ADELBERG • Department of Agricultural and Environmental Sciences,
Clemson University, Clemson, SC, USA
K. NIRMAL BABU • All India Coordinated Research Project on Spices, Indian Institute of
Spices Research, Kozhikode, Kerala, India
KEE YOEUP PAEK • Research Center for the Development of Advanced Horticultural
Technology, Chungbuk National University, Cheongju, Republic of Korea
RUCHIRA PANDEY • Tissue Culture and Cryopreservation Unit, ICAR-National Bureau of
Plant Genetic Resources (NBPGR), New Delhi, India
MALABIKA ROY PATHAK • Department of Life Sciences, Agricultural Biotechnology Program,
College of Graduate Studies, Arabian Gulf University, Manama, Kingdom of Bahrain
PRATAP KUMAR PATI • Department of Biotechnology, Guru Nanak Dev University,
Amritsar, Punjab, India
GHANSHYAM PATIL • Department of Agricultural Biotechnology, Plant Tissue Culture Lab,
Anand Agricultural University, Anand, Gujarat, India
ANA FLAVIA PAVEI • Departamento de Botânica (Centro de Ciências Biológicas),
Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
xiv Contributors

ALINE PEREIRA • Plant Morphogenesis and Biochemistry Laboratory, Natural Products

Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina State, Brazil
ANABEL PÉREZ • Instituto de Biotecnología de las Plantas, Universidad Central “Marta
Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba
NAIVY PÉREZ • Instituto de Biotecnología de las Plantas, Universidad Central “Marta
Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba
NAIVY PÉREZ-ALONSO • Instituto de Biotecnología de las Plantas, Universidad Central
“Marta Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba
K.V. PETER • World Noni Research Foundation, Chennai, India
GEETHA S. PILLAI • Centre for Medicinal Plants Research, Arya Vaidya Sala, Kottakkal,
Kerala, India
HELOISA S. PITZ • Plant Morphogenesis and Biochemistry Laboratory, Natural Products
Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina State, Brazil
D.V. POORNIMA • Department of Biochemistry, Davangere University, Shivagangothri,
Davangere, Karnataka, India
MANUEL A. DE PRÁ • Plant Morphogenesis and Biochemistry Laboratory, Natural Products
Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina State, Brazil;
Nanoscoping Solutions in Nanotechnology, Florianópolis, Santa Catarina State, Brazil
K. PRAVEEN • All India Coordinated Research Project on Spices, Indian Institute of Spices
Research, Kozhikode, Kerala, India
ELISA QUIALA • Instituto de Biotecnología de las Plantas, Universidad Central “Marta
Abreu” de Las Villas, Santa Clara, Villa Clara, Cuba
RAHUL P. RAJ • All India Coordinated Research Project on Spices, Indian Institute of Spices
Research, Kozhikode, Kerala, India
J. RAJASHEKAR • Department of Biochemistry, Davangere University, Shivagangothri,
Davangere, Karnataka, India
FERNANDA RAMLOV • Laboratório de Morfogênese e Bioquímica Vegetal (Centro de Ciências
Agrárias), Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
P.N. RAVINDRAN • All India Coordinated Research Project on Spices, Indian Institute of
Spices Research, Kozhikode, Kerala, India
MANAL AHMED SADEQ • Desert and Arid Zone Sciences Program, College of Graduate
Studies, Arabian Gulf University, Manama, Kingdom of Bahrain
AHMED ALI SALIH • Desert and Arid Zone Sciences Program, College of Graduate Studies,
Arabian Gulf University, Manama, Kingdom of Bahrain
K. SAMSUDEEN • Central Plantation Crops Research Institute, Kasaragod, Kerala, India
DAIANE FIUZA MONTAGNER • Departamento de Botânica (Centro de Ciências Biológicas),
Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
NEELAM SHARMA • Tissue Culture and Cryopreservation Unit, ICAR-National
Bureau of Plant Genetic Resources (NBPGR), New Delhi, India
VIKAS SHARMA • Department of Biotechnology, Arni University, Kathgarh, Indora, H.P.,
India
PRITIKA SINGH • Department of Biotechnology, Guru Nanak Dev University, Amritsar,
Punjab, India
RAKESH SINGH • Division of Genomic Resources, ICAR-National Bureau of Plant Genetic
Resources, New Delhi, India
RUPESH KUMAR SINGH • Centre for the Research and Technology of Agro-Environment
and Biological Sciences (CITAB), University of Minho, Braga, Portugal
 Contributors xv

AMRITPAL S. SINGH • Department of Agricultural Biotechnology, Plant Tissue Culture Lab,

Anand Agricultural University, Anand, Gujarat, India
DEEPAK K. SINGH • Department of Botany, University of Delhi, Delhi, India
JU YEON SONG • Department of Agricultural and Environmental Sciences,
Clemson University, Clemson, SC, USA
THELMA L. SORIANO • Department of Agriculture, Bureau of Plant Industry,
San Andres, Malate, Manila, Philippines
JENNY SUMARA SOZO • Departamento de Botânica (Centro de Ciências Biológicas),
Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
VIKAS SRIVASTAVA • National Institute of Plant Genome Research, New Delhi, India
N. SUBHASH • Department of Agricultural Biotechnology, Plant Tissue Culture Lab,
Anand Agricultural University, Anand, Gujarat, India
V. SUMATHI • All India Coordinated Research Project on Spices, Indian Institute of Spices
Research, Kozhikode, Kerala, India
YOUPING SUN • Department of Agricultural and Environmental Sciences, Clemson
University, Clemson, SC, USA
JULIÁN RODRIGUEZ TALOU • Cátedra de Biotecnología-Instituto NANOBIOTEC (UBA/
CONICET), Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires,
Buenos Aires, Argentina
ADRIANA C.D. TREVISAN • Plant Morphogenesis and Biochemistry Laboratory, Natural
Products Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina
State, Brazil
ROSA M.R. DO VALLE • Plant Morphogenesis and Biochemistry Laboratory, Natural
Products Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina
State, Brazil
V. VEERASHREE • Department of Biochemistry, Kuvempu University-P.G. Centre,
Shivagangothri, Davangere, Karnataka, India
MARIA B. VELEIRINHO • Plant Morphogenesis and Biochemistry Laboratory, Natural
Products Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina
State, Brazil; Nanoscoping Solutions in Nanotechnology, Florianópolis, Santa Catarina
State, Brazil
ANA MARIA VIANA • Departamento de Botânica (Centro de Ciências Biológicas),
Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
SARAH A. WHITE • Department of Agricultural and Environmental Sciences, Clemson
University, Clemson, SC, USA
MARCIA WOLFART • Departamento de Botânica (Centro de Ciências Biológicas),
Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil
G. YAMUNA • All India Coordinated Research Project on Spices, Indian Institute of Spices
Research, Kozhikode, Kerala, India
ROSENDO A. YUNES • Plant Morphogenesis and Biochemistry Laboratory, Natural Products
Core, Federal University of Santa Catarina, Florianópolis, Santa Catarina State, Brazil
 Chapter 1

Protocols for In Vitro Mass Multiplication and Analysis

of Medicinally Important Phenolics of a Salep Orchid,
Satyrium nepalense [Link] (“Salam Mishri”)
Shashi B. Babbar and Deepak K. Singh

Abstract
Satyrium nepalense is a rare and threatened medicinal orchid, populations of which in its native habitats are
dwindling because of indiscriminate collections and habitat destruction, thus necessitating the development
of methods for its in situ and ex situ conservation. Because of non-endospermous nature of the seeds and the
immature embryos at seed dispersal stage, orchids cannot be seed-propagated as other plants. Micropropagation,
using plant tissue culture techniques, offers an effective method for the multiplication of orchids. In this
chapter, a five-step efficient reproducible protocol for large-scale in vitro multiplication of Satyrium nepalense
is described. The first step involves asymbiotic germination of seeds isolated from immature green pods and
cultured on Mitra’s medium (M) gelled with 0.8 % agar and supplemented with 2 % sucrose and 1 % peptone
(hereafter referred to as basal medium, BM). On this medium, seeds start germinating after a week of culture.
Protocorms developed from the seeds are sub-cultured on BM fortified with 4 μM kinetin (Kn) after 8 weeks,
for shoot differentiation and multiplication. The shoots developed on Kn-supplemented medium are trans-
ferred to BM alone for their elongation for the same period. The elongated shoots are transferred to the
rooting medium, comprising BM supplemented with 0.5 or 1.0 μM indole-3-butyric acid, for further 8
weeks. The regenerated plantlets are transferred to a potting mix of sand and vermiculite (1:1) for acclimati-
zation. The tubers and leaves excised from both in vitro-developed plants and those from their native habitats
are analyzed and compared for the contents and concentration of medicinally important phenolics using
high-performance liquid chromatography (HPLC), details of which are provided in this chapter.

Key words Asymbiotic seed germination, High-performance liquid chromatography, Medicinal

orchid, Micropropagation, Phenolics, Satyrium nepalense, Shoot multiplication

1 Introduction

Satyrium nepalense (Fig. 1a), a terrestrial orchid, is a threatened

medicinal herb, which is also considered as Salep orchid or “Salam
Mishri” [1–3], a name also used for other orchids, such as
Dactylorhiza hatagirea Syn. Orchis latifolia [4], Eulophia dabia
[1], and E. nuda [5]. The plant is a stout aromatic terrestrial
attaining a height of 25–60 cm. It is usually found at the higher
altitudes ranging from 2400 to 5000 m [6]. The native people of

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_1, © Springer Science+Business Media New York 2016

1
2 Shashi B. Babbar and Deepak K. Singh

Fig. 1 In vitro multiplication of Satyrium nepalense -seeds to shoots. (a) A mature plant in its natural habitat. (b)
A capsule pod. (c) Acetocarmine-stained seeds to show the stage of embryo at the time of culture (arrow). (d)
PLBs developed from the seeds germinated on BM, after 10 days of culture. (e) Initiation of leaves on PLBs on BM
after 60 days of culture. (f) Multiple shoots from the sub-cultured PLBs after 60 days of culture on BM + 4 μM Kn

upper Nilgiris correlates flower (twin spur) of S. nepalense with

“bullock’s horns” [7]. Decoctions of stems, roots, and tubers of
the plant have been prescribed in various contagious ailments and
also as dietary supplement since ancient times [8]. It is also used as
a food and energizing tonic, and in diarrhea, dysentery, fever, and
malaria [2, 7–10]. The methanolic extract of S. nepalense tubers
has been demonstrated to have antimicrobial properties [6]. The
plant is assumed to have aphrodisiac properties [11].
 In Vitro Multiplication and Analysis of Phenolics of Satyrium Nepalense 3

Phenolics are secondary metabolites abundant in edible and

nonedible plants with a variety of roles in plant growth, develop-
ment, and defense mechanisms [12, 13]. Many of these have proved
to be beneficial for human health due to their antioxidant properties
[14]. In addition to having antioxidant properties [15], phenolics
also act as metal chelators [16–18], antimicrobial agents [19], clari-
fying agents [20], antimutagen, and anticarcinogens [21–23].
Extensive collections of S. nepalense due to its therapeutic properties
and destruction of its habitats have led to decrease in its numbers in
wild [24]. To avoid the possibility of its extinction in future, there is
an urgent need for formulating conservation strategies involving
domestication of the species by standardizing methods for its large-
scale multiplication and developing agro-techniques for its cultiva-
tion to the extent fulfilling the need of pharmaceutical industries.
Orchids cannot be propagated through seeds like other crops
because of their peculiar characteristics. The seeds of orchids are
microscopic; lack endosperms, cotyledons, and root initials; and
require fungal infection for germination and initial growth [25]. In
nature out of thousands to millions of microscopic seeds produced
by a single pod of orchids, only 2.3 % of them germinate [26].
Multiplication by means of vegetative propagation is extremely slow
and time consuming [27]. Its slow growing properties hardly fulfill
the need of people, market, and various pharmaceutical companies
[28]. In vitro methodology circumvents these difficulties by reduc-
ing the length of time needed for germination as well as large-scale
multiplication [27]. The development of a defined nutrient medium
by Knudson in 1922 [29] for asymbiotic seed germination of
orchids revolutionized the hybridization and commercial propaga-
tion of orchids [30, 31], however, predominantly for ornamental
orchids. In this chapter, an efficient protocol for the mass multipli-
cation of S. nepalense is described. A detailed method for isolation of
some important phenolics from the roots and leaves of both in vitro
and in vivo plants and their estimation by high-performance liquid
chromatography (HPLC) is also documented. Micropropagation of
this orchid has also been reported earlier by Mahendran and Bai [7].

2 Materials

2.1 Plant Material 1. Immature (green) capsules of the Satyrium nepalense (Fig. 1b),
collected from the wild (see Note 1).

2.2 Surface 1. Two drops each of Tween-20 and Teepol in 50 ml distilled water.
Sterilization 2. 70 % Ethanol.
of Capsules
3. Sterilized distilled water (SDW, see Note 2).

2.3 Germination 1. Rimless test tubes (25 mm × 150 mm).

of Seeds 2. Cotton plugs (non-adsorbent cotton wrapped in cheese cloth).
4 Shashi B. Babbar and Deepak K. Singh

2.4 Shoot 1. BM + 4 μM kinetin (Kn), pH 5.6 (see Note 3).

Differentiation 2, 3. Same as 1 and 2 under Subheading 2.3
and Multiplication

2.5 Elongation 1. BM alone.

of Shoots 2, 3. Same as 1 and 2 under Subheading 2.3

2.6 Rooting 1. BM + 0.5 or 1.0 μM indole-3-butyric acid (IBA), pH 5.6

of In Vitro- (see Note 3).
Regenerated Shoots 2, 3. Same as 1 and 2 under Subheading 2.3

2.7 Acclimatization 1. Sterilized vermiculite and sand (1:1, w/w).

of Plantlets 2. Plastic pots (diameter 12 cm).
3. BM without sucrose and agar.
4. 0.1 % Bavistin (a fungicide) prepared in distilled water.
5. Transparent polythene bags.

2.8 Incubation 1. Culture trolleys with shelves, each fitted with cool daylight
of Cultures fluorescent tubes providing an irradiance of 63 μmol/m2/s in
16-h photoperiod. The trolleys are housed in culture room
maintained at 25 ± 2 °C.

2.9 HPLC Analysis 1. Oven dried leaves and tubers.

of Phenolics 2. Liquid nitrogen.
3. HPLC-grade acetonitrile.
4. 50 mM Ammonium acetate, pH 3.5, adjusted with acetic acid,
to be used as one of the mobile phases.
5. HPLC-grade water.
6. HPLC-grade glacial acetic acid.
7. Stock solutions (1 mg/ml, prepared in acetonitrile:water, 1:1)
of standards of gallic acid, syringic acid, p-hydroxybenzoic acid
(HBA), and caffeic acid and store in freezer at 4 °C (see Note 4).

3 Methods

3.1 Surface 1. Treat green capsules with the solution of Tween-20 and Teepol
Sterilization for 3 min and then rinse the capsules thrice with sterilized dis-
of Capsules tilled water.
2. In a laminar flow cabinet, sterilize the capsules with 0.25 %
mercuric chloride for 8 min. Thereafter, rinse them thoroughly
(5–6 times) with SDW.
3. Dip the capsules in 70 % alcohol for 30 s.
4. Flame the alcohol-treated capsules.
 In Vitro Multiplication and Analysis of Phenolics of Satyrium Nepalense 5

3.2 Raising Seed 1. Transfer the capsules, treated as described above, to a sterilized
Cultures Petri plate. Give longitudinal slit to the capsules and scoop out
the seeds (see Note 5).
2. Inoculate around 9–10 seeds (Fig. 1c) per culture tube contain-
ing 20 ml of BM. BM comprises Mitra’s (M, Mitra et al. 1976)
medium (Table 1) containing 2 % sucrose and gelled with 0.8 %
agar and supplemented with 0.1 % peptone, pH of the medium
adjusted to 5.6 by addition of 0.1 N NaOH or 0.1 N HCl,
before autoclaving at 121 °C and 105 kPa for 15 min.

Table 1
Composition of Mitra’s medium (Mitra et al. 1976)

Constituents mg/L
Major inorganic nutrients
KNO3 180.0
MgSO4·2H2O 250.0
KH2PO4 150.0
(NH4)2SO4 100.0
CaNO3·4H2O 200.0
Minor inorganic nutrients
KI 0.03
H3BO3 0.06
ZnSO4·7H2O 0.05
Na2MoO4·2H2O 0.05
CuSO4·5H2O 0.05
Co(NO3)2·6H2O 0.05
MnCl2 0.42
Iron source
FeSO4·7H2O 27.8
Na2EDTA·2H2O 37.3
Vitamins
Thiamine HCl 0.3
Pyridoxine HCl 0.3
Nicotinic acid 1.25
Riboflavin 0.05
Biotin 0.05
Folic acid 0.3
6 Shashi B. Babbar and Deepak K. Singh

3. Incubate the cultures at 25 ± 2 °C for 6 weeks in the dark.

Within 6 weeks, protocorm-like bodies (PLBs) with rhizoids at
the basal regions develop from the seeds (Fig. 1d). Transfer the
cultures to illuminated conditions (63 μmol/m2/s, 16-h pho-
toperiod) after 6 weeks.

3.3 Shoot 1. After 8 weeks of initiation of seed cultures, transfer the PLBs
Development, (three per tube, each containing 20 ml of the culture medium)
Multiplication, having rhizoids at the basal region to BM + 4 μM Kn for shoot
and Elongation development and multiplication. Incubate the cultures in illu-
minated conditions for 2 months during which multiple shoots
develop from each PLB (Fig. 1e, f).
2. Separate the individual shoots (0.5–1.0 cm) from the clumps
and transfer (two shoots per culture) to BM alone and incubate
the culture for 2 months under lighted conditions (see Note 6).

3.4 Rooting 1. Sub-culture vertically the 3–4 cm long shoots having two
of In Vitro- expanded leaves on BM + 0.5 or 1.0 μM IBA (two per tube, each
Regenerated Shoots containing 20 ml culture medium). In 2 months of incubation,
the shoots develop 3–4 thick adventitious roots (Fig. 2b). Now
the plantlets are ready for the transfer from the culture tubes.

3.5 Acclimatization 1. Remove plantlets (5–6 cm long, Fig. 2c) from the culture tubes
of the Regenerated and wash them thoroughly under running tap water and later
Plants with lukewarm water to remove any adhering agar (see Note 7).
2. After washing, plant the in vitro-raised plantlets individually in
the sterilized potting mix of sand and vermiculite (1:1) con-
tained in perforated plastic pots (12 cm diameter, Fig. 2d).
Cover the plantlets with porous transparent poly bags and keep
the pots in culture room for 2 weeks.
3. After transplanting, spray the plants with 0.1 % bavistin (a fun-
gicide) and mist irrigate with liquid BM on alternate days for 2
weeks. During the third week, spray bavistin only if required
and irrigate with liquid BM alternating with water alone.
Porous poly bags were removed gradually.
4. Shift the potted plants to the laboratory conditions and main-
tain them there for 1 week by watering them with tap water on
alternate days.
5. After 4 weeks of acclimatization, plants can be transferred to
the field under their native conditions.

3.6 Biochemical 1. Dry in vitro and in vivo leaves and tubers for 48 h in an oven
Profiling of Phenolics maintained at 50 °C.
by HPLC 2. Pulverize the plant material in liquid nitrogen.
3.6.1 Preparation 3. Take 100 mg powder of each sample and incubate individually
of Plant Extracts for 12 h in 5 ml solution of acetonitrile and water (1:1, v/v)
 In Vitro Multiplication and Analysis of Phenolics of Satyrium Nepalense 7

Fig. 2 In vitro multiplication of Satyrium nepalense shoots to plants. (a) Elongated shoots 60 days after transfer
to BM. (b) Rooted shoots (plantlets), 60 days after transfer to BM + 0.5 μM IBA. (c) Plantlets ready for transfer
to pots. (d) Plantlets transferred to potting mix (sand and vermiculite (1:1)) for hardening

contained in 50 ml Falcon tubes on a rotary shaker run at

200 rpm and maintained at 25 °C.
4. Centrifuge the extracts at 10,000 × g for 20 min.
5. Filter the supernatant through Millipore filters (size: 0.22 μm)
and store the filtrates at 4 °C till further use.

3.6.2 Analysis 1. The profile of phenolics can be analyzed and the concentra-
and Estimation tions of individual phenolic acids can be estimated by HPLC.
of Phenolics 2. The protocol described here employs “Waters” chromato-
graphic system consisting of dual 515 pump, C18 Colum
(250 mm × 4.6 mm, 5 μm), and 2998 photodiode array detec-
tor. Estimations are done using gradient elution system.
3. Sonicate 50 mM acidic ammonium acetate for 2 min. Wash the
column (C-18) with both mobile phases, comprising ammo-
nium acetate and acetonitrile, till a stable base line is observed.
4. The mobile phases used are ammonium acetate and acetoni-
trile. Set the initial and final conditions for ammonium acetate
at 90 % for 0–20 min, so that both mobile phases return to the
original condition in last 5 min. Monitor the eluent at 270 nm.
8 Shashi B. Babbar and Deepak K. Singh

5. Plot the calibration curve by using 50–500 μg/ml of each stan-

dard. Prepare the required concentrations of each standard by
diluting the stock solutions with acetonitrile and water (1:1).
6. Inject 20 μl of each sample and to have reproducible estimates
repeat twice for each sample.

Fig. 3 Biochemical profiling of Satyrium nepalense for medicinally important phenolic acids, gallic acid (GA),
p-hydroxybenzoic acid (HBA), syringic acid (SA), and caffeic acid (CA) by HPLC. (a) HPLC profile of the stan-
dards to show their retention time. (b–e) HPLC profiles of the four phenolic acids in in vivo tubers (b), in vivo
leaves (c), in vitro tubers (d), and in vitro leaves (e)
 In Vitro Multiplication and Analysis of Phenolics of Satyrium Nepalense 9

7. Confirm the presence of particular phenolic acids by comparing

the retention times of the resolved peaks in chromatograms of
the plant extract with those of the standards (Fig. 3a). This can
be further confirmed by “spiking” the samples with standard
solutions of the phenolic acids. Use “Empower” or equivalent
software to estimate the concentration of individual phenolic
acids (Fig. 3b–e).

4 Notes

1. Satyrium nepalense is a widely distributed plant. It grows at

higher altitudes (1300–1400 m) and flowers from July to
September. Capsules can be collected from September
onwards.
2. Sterilize all culture media, potting mixture, distilled water,
glassware, and instruments by autoclaving at 103 kPa at 121 °C
for 15 min.
3. For preparing the stock solution of Kn, first dissolve its weighed
amount in few drops of 1 N NaOH and then raise the volume
to the desired level with distilled water. Likewise, IBA is first
dissolved in ethanol before addition of distilled water to make
up the desired volume.
4. Prepare stock solution of each standard, gallic acid (GA), syrin-
gic acid (SA), HBA, and caffeic acid (CA), by individually dis-
solving 10 mg of each in 10 ml of solvent containing equal
volume of distilled water and acetonitrile. Store stock solutions
at 4 °C.
5. The capsules dipped in 70 % alcohol are flamed only as long
as the alcohol is burning. Thereafter, these are transferred to
a sterilized Petri plate. The longitudinal slit is given to the
capsules with a flame-sterilized and cooled scalpel only after
the surface of the capsules becomes totally dry. For scooping
out the seeds from the slit capsules, use a narrow tapered
spatula with minimum possible thickness at the tapered end.
It has to be flame sterilized and cooled by dipping in steril-
ized distilled water each time the seeds are picked to be
inoculated.
6. Injury to shoots should be avoided while separating them
from the clumps for transfer to BM for elongation. The
shoots injured while separating should be discarded. While
planting the shoots on BM, the leaves should not touch the
medium.
7. For transfer to the potting mix from the culture tubes, the
plantlets are to be pulled out gently to avoid injury.
10 Shashi B. Babbar and Deepak K. Singh

Acknowledgements

The work was supported by a research project sanctioned to S.B.B.

from the Indian Council Medical Research, New Delhi, and
Research and Development grant from the University of Delhi.
D.K.S. gratefully acknowledges the award of Junior and Senior
Fellowships under the INSPIRE program of the Department of
Science and Technology, Government of India.

References
1. Jalal JS, Kumar P, Pangtey YPS (2008) 12. Liu RH (2004) Potential synergy of phyto-
Ethnomedicinal orchids of Uttarakhand, Western chemicals in cancer prevention: mechanism of
Himalaya. Ethnobot Leaflets 12:1227–1230 action. J Nutr 134:3479S–3485S
2. Joshi G, Tewari LM, Lohani N, Upreti K, Jalal 13. El Gharras H (2009) Polyphenols: food
JS, Tewari G (2009) Diversity of orchids on sources, properties and applications – a review.
Uttarakhand and their conservation strategy Int J Food Sci Technol 44:2512–2518
with special reference to their medicinal impor- 14. Merken HM, Beecher GR (2000)
tance. Rep Opin 1:47–52 Measurement of food flavonoids by high-per-
3. Bhatt D, Sharma P, Sharma L, Joshi GC formance liquid chromatography: a review.
(2012) Folk herbal remedies for skin care in J Agric Food Chem 48:577–599
Kumaun Himalaya. J Non-Timber Forest Prod 15. Proestos C, Bakogiannis A, Psarianos C,
19:309–312 Koutinas AA, Kanellaki M, Komaitis M (2005)
4. Thakur M, Dixit VK (2008) Ameliorative High performance liquid chromatography
effect of fructo-oligosaccharide rich extract of analysis of phenolic substances in Greek wines.
Orchis latifolia Linn. on sexual dysfunction in Food Control 16:319–323
hyperglycemic male rats. Sex Disabil 26:37–46 16. Rice-Evans C, Miller N, Paganga G (1997)
5. Panwar D, Ram K, Harish SNS (2012) In vitro Antioxidant properties of phenolic com-
propagation of Eulophia nuda Lindl., an pounds. Trends Plant Sci 2:152–159
endangered orchid. Sci Hortic 139:46–52 17. Ruf J (1999) Wine and polyphenols related to
6. Mishra AP, Saklani S (2012) Satyrium nepal- platelet aggregation and atherothrombosis.
ense: a rare medicinal orchid of Western Drugs Exp Clin Res 25:125–131
Himalaya (India); phytochemical screening, 18. Tedesco I, Russo M, Russo P, Iacomino G,
antimicrobial evaluation and conservation Russo GL, Carraturo A, Faruolo C, Moio L,
studies. Indones J Pharm 23:162–170 Palumbo R (2000) Antioxidant effect of red
7. Mahendran G, Bai VN (2009) Mass propagation wine polyphenols on red blood cells. J Nutr
of Satyrium nepalense [Link].—A medicinal Biochem 11:114–119
orchid via seed culture. Sci Hortic 119:203–207 19. Rauha JP, Remes S, Heinonen M, Hopia A,
8. Saklani S, Mishra AP, Parcha V, Chandra S Kähkönen M, Kujala T, Pihlaja K, Vuorela H,
(2011) Phytochemical and antibacterial Vuorela P (2000) Antimicrobial effects of
evaluation of Satyrium nepalense and Finnish plant extracts containing flavonoids
Saussurea simpsoniana, the threatened and other phenolic compounds. Int J Food
medicinal herbs of Uttarakhand. J Pharm Microbiol 56:3–12
Res 4:3866–3870 20. Jackson RS (1994) Wine science: principles
9. Medhi R, Chakrabarti S (2009) Traditional and applications. Academic, San Diego, USA
knowledge of NE people on conservation of 21. Arimoto-Kobayashi S, Sugiyama C, Harada N,
wild orchids. Indian J Tradit Knowl 8:11–16 Takeuchi M, Takemura M, Hayatsu H (1999)
10. Kumari P, Singh BK, Joshi GC, Tiwari LM Inhibitory effects of beer and other alcoholic
(2009) Veternary ethnomedicinal plants in beverages on mutagenesis and DNA adduct
Uttarakhand Himalayan region, India. formation induced by several carcinogens.
Ethanobot Leaflets 13:1312–1327 J Agric Food Chem 47:221–230
11. Arditti J (2009) Micropropagation of orchids. 22. Malaveille C, Hautefeuille A, Pignatelli B,
Wiley, New York Talaska G, Vineis P, Bartsch H (1998)
 In Vitro Multiplication and Analysis of Phenolics of Satyrium Nepalense 11

Antimutagenic dietary phenolics as antigeno- 27. Pradhan S, Pant B (2009) In vitro seed germina-
toxic substances in urothelium of smokers. tion in Cymbidium elegans Lindl. and Dendrobium
Mutat Res 402:219–224 densiflorum Lindl. ex Wall. (Orchidaceae). Bot
23. Huang WY, Cai YZ, Zhang Y (2009) Natural Orient J Plant Sci 6:100–102
phenolic compounds from medicinal herbs 28. Basker S, Bai VN (2010) In vitro propagation
and dietary plants: potential use for cancer pre- of an epiphytic and rare orchid Eria bambusifo-
vention. Nutr Cancer 62:1–20 lia Lindl. Res Biotechnol 1:15–20
24. Sahoo AK, Ansari AA (2007-2008) Notes on a 29. Knudson L (1922) Nonsymbiotic germination
threatened Orchid (Satyrium Sw.) in Sikkim of orchid seeds. Bot Gaz 73:1–25
Himalaya. ENVIS Quart Newslett 1: 4-5 30. Ernst R (1982) Orchid seed germination
25. Arditti J (1979) Aspects of the physiology of and seedling culture - a manual:
orchids. In: Woolhouse H (ed) Advances in Paphiopedilum. Orchid Biol Rev Persp
botanical research, vol 7. Academic Press, 2:350–353
London, pp 422–654 31. Johnson TR, Stewart SL, Dutra D, Kane ME,
26. Dutta S, Chowdhury A, Bhattacharjee B, Nath Richardson L (2007) Asymbiotic and symbi-
PK, Dutta BK (2011) In vitro multiplication otic seed germination of Eulophia alta
and protocorm development of Dendrobium (Orchidaceae) - preliminary evidence for the
aphyllum (Roxb.) CEC Fisher. Assam Univ symbiotic culture advantage. Plant Cell Tiss
J Sci Technol: Biol Environ Sci 7:57–62 Org Cult 90:313–323
 Chapter 2

In Vitro Culture and Phytochemical Analysis of Passiflora

tenuifila Killip and Passiflora setacea DC (Passifloraceae)
Jenny Sumara Sozo, Daniel Cuzziol Cruz, Ana Flavia Pavei,
Isadora Medeiros da Costa Pereira, Marcia Wolfart, Fernanda Ramlov,
Daiane Fiuza Montagner, Marcelo Maraschin, and Ana Maria Viana

Abstract
We have developed reproducible micropropagation, callus culture, phytochemical, and antioxidant analysis
protocols for the wild passion fruit species P. tenuifila, and P. setacea, native to the Brazilian endangered
biomes Atlantic Forest, Cerrado, and Caatinga, by using seeds and explants from seedlings and adult
plants. Genotype and explant origin-linked differences are visible amongst the Passiflora species concern-
ing callus production, total phenolics, and antioxidant activity. The protocols developed for screening
phytochemicals and antioxidants in P. tenuifila and P. setacea callus extracts have shown their potential for
phenolic production and antioxidant activity. The high level of phenolic compounds seems to account for
the antioxidant activity of methanolic extracts of P. tenuifila derived from 45-day-old immature seed callus.
The methanolic extracts of callus derived from P. setacea seedling leaf node and cotyledonary node explants
have shown the highest antioxidant activity despite their lower content of phenolics, as compared to coty-
ledon callus extracts. The optimized micropropagation and callus culture protocols have great potential to
use cell culture techniques for further vegetative propagation, in vitro germplasm conservation, and sec-
ondary metabolite production using biotic and abiotic elicitors.

Key words Passiflora tenuifila, Passiflora setacea, Micropropagation, Callus, Total phenolics,
Antioxidant activity

1 Introduction

Passiflora setacea and Passiflora tenuifila are endemic to the endan-

gered Brazilian biome Cerrado, Caatinga, and the Atlantic Forest.
Their fruits have great potential for commercial use by nutritional,
pharmaceutical, and cosmetic industries due to the high content of
phenolic compounds which are antioxidants, especially P. tenuifila
[1]. P. tenuifila is a potential source of resistant genes for genetic
improvement as it is resistant to the pathogens Xanthomonas axo-
nopodis pv. passiflorae and Cladosporium herbarum. The main con-
straints for plant production of several Passiflora species as P. setacea

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_2, © Springer Science+Business Media New York 2016

13
14 Jenny Sumara Sozo et al.

(occurring in Caatinga, Cerrado, Atlantic Forest) and P. tenuifila

(occurring in Cerrado and Atlantic Forest) are the low seed germi-
nation rate, slow seedling emergence, and lack of efficient seed con-
servation protocols [2–4]. In vitro propagation techniques have
been established for several Passiflora species such as P. alata, P.
caerulea, P. cincinnata, P. edulis, P. setacea, P. foetida, and
P. suberosa. These techniques have been used for the rapid multipli-
cation of healthy and disease-free elite plants, source of fruits, and
medicinal products as the antioxidants and other biologically active
compounds [5–7]. However, plant tissue culture systems for sec-
ondary metabolite and antioxidant assessment have been estab-
lished for P. quadrangularis [5] and P. alata Curtis [8, 9]. The
protocols described herein are based on efficient and reproducible
methods for P. tenuifila and P. setacea shoot culture initiation, callus
culture establishment, and evaluation of callus phenolic content and
antioxidant activity. We have optimized in vitro callus culture sys-
tems of P. tenuifila and P. setacea according to the antioxidant activ-
ity [10]. In vitro culture and antioxidant responses are genotype,
explant type, and callus age dependent. The phytochemical and
antioxidant screening carried out on P. tenuifila and P. setacea callus
extracts demonstrates potent antioxidant activity.

2 Materials

2.1 Plant Material 1. Collect seeds from stock mother plants of P. tenuifila and
P. setacea from the germplasm collection maintained at the
experimental station, Embrapa Cerrados, Empresa Brasileira
de Pesquisa Agropecuária (Embrapa), Unidade Planaltina
(Planaltina, DF, Brazil).

2.2 Culture Media 1. Murashige and Skoog [11] powder basal medium (MS), plant
cell culture tested (Table 1).
2. 59 mM Sucrose grade I, plant cell culture tested.
3. 88.5 mM D-(+)-glucose, plant cell culture tested.
4. 88.5 mM D-(−)-fructose, plant cell culture tested.
5. 2 g/L Phytagel, plant cell culture tested.
6. Plant growth regulators for plant cell culture: gibberellic acid
(GA3), indole-3-butyric acid (IBA), α-naphthaleneacetic acid
(NAA), 2,4-dichlorophenoxyacetic acid (2,4-D).

2.3 Extraction 1. Folin-Ciocalteu reagent.

and Estimation of Total 2. Gallic acid (see Notes 1 and 2).
Phenolics
3. 20 % (w/v) sodium carbonate solution: Prepare a stock solu-
tion and store at 4 °C.
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 15

Table 1
Murashige and Skoog basal medium composition

Component Concentration (mL/L)

Ammonium nitrate 1650.0
Boric acid 6.2
a
Calcium chloride (anhydrous) 332.2
Cobalt chloride·6H2O 0.025
Cupric sulfate·5H2O 0.025
Ethylenediaminetetracetic acid (disodium 37.26
salt)·2H2O
Ferrous sulfate·7H2O 27.8
b
Magnesium sulfate 180.7
Manganese sulfate 16.9
Molybdic acid (sodium salt)·2H2O 0.25
Potassium iodide 0.83
Potassium nitrate 1900.0
Potassium phosphate monobasic 170.0
Zinc sulfate·7H2O 8.6
Glycine (free base) 2.0
Myoinositol 100.0
Nicotinic acid (free acid) 0.5
Pyridoxine HCl 0.5
Thiamine HCl 0.1
a
Original formula contains calcium chloride dihydrate at 440.0 mg/L
b
Original formula contains magnesium sulfate heptahydrate at 370 mg/L

4. 80 % (v/v) methanol, high-performance liquid chromatogra-

phy (HPLC) grade.
5. Ultraviolet-visible (UV-Vis) microplate reader.

2.4 Free Radical 1. 2,2-Diphenyl-1-picrylhydrazyl (DPPH) reagent (see Note 3).

Scavenging Effect 2. 80 % (v/v/) methanol, high-performance liquid chromatogra-
of 2,2-Diphenyl-1- phy (HPLC) grade.
picrylhydrazyl
3. 3,5-Di-tert-4-butylhydroxytoluene analytical standard (BHT).
4. Ultraviolet-visible (UV-Vis) microplate reader.
16 Jenny Sumara Sozo et al.

3 Methods

3.1 Preparation 1. Prepare standard aqueous solutions of plant growth regulators

of Culture Medium (see Subheading 2.2, item 6) by adding two drops of 1 M NaOH.
2. Prepare appropriate culture medium by adding the recom-
mended concentration of the carbon source (see Tables 2, 3, 4,
5, 6, 7, and 8) together with plant growth regulators (see
Notes 4, 5, and 9).
3. Adjust medium pH to 5.8 with 1 M NaOH before adding
2 g/L Phytagel. Dispense into 25 × 150 mm glass culture tubes
(8 mL/tube) and autoclave at 121 °C for 18 min.

3.2 Culture Condition 1. Seal vessels with transparent polypropylene film (76 × 76 mm)
and maintain the cultures at 25 °C, 70 % relative humidity
(RH) under a 16-h photoperiod, photosynthetic photon flux
of 20–25 μmol/m2/s supplied by fluorescent light tubes. In all
protocols use these culture conditions.

Table 2
Composition of culture media used for shoot culture initiation and callus induction from different
explant types of Passiflora tenuifila

In vitro Explant Culture Carbon Induction Callus

process type Explant origin medium source PGR (%)a texture
Shoot Shoot tips Ex vitro-germinated MS 59 mM None 100 –
culture seedling sucrose
Adult plant MS 59 mM None 100 –
sucrose
Callus Immature Developing fruits MS 59 mM 2.5 μM 2,4-D 60 Friable
culture seeds sucrose
Shoot tips Adult plant MS 59 mM 1.25–5 μM 92 Friable
sucrose NAA
Ex vitro-germinated MS 59 mM 1.25–5 μM 100 Friable
seedling sucrose NAA
Stem Shoot cultures from MS 88.5 mM 2.5 μM NAA 100 Friable
segments adult plant sucrose
Shoot cultures from MS 88.5 mM 1.25 μM NAA 100 Friable
seedling sucrose or 2.5 μM
2,4-D
Shoot cultures from MS 88.5 mM 2.5 μM NAA 100 Friable
seedling glucose
Shoot cultures from MS 88.5 mM 2.5 μM NAA 100 Friable
seedling fructose
Note: Basic MS basal medium containing 2 mg/L Phytagel
a
Values are means of 3 replicates of 15 explants each per treatment. The photosynthetic photon flux at culture level was
20–25 μmol/m2/s
Table 3
Composition of culture media used for in vitro shoot culture growth from seedling and adult plant
shoot tips of Passiflora tenuifila

Carbon Shoot Shoot No. of

Explant Culture source PGR PGR induction Rooting No. of length leaf
origin medium (mM) type (μM) (%)x (%)x shoots y (cm)y nodesy
Seedling MS 59 mM IBA 0 40 20 a 1a 7.8 a 7a
sucrose
MS 59 mM 1.25 100 50 b 1.3 a 11.8 b 19.5 b
sucrose
MS 59 mM 2.5 100 40 b 1.8 a 8.9 a 15.8 b
sucrose
MS 59 mM 5 100 40 b 1.2 a 7.5 a 15.2 b
sucrose
Adult MS 59 mM GA3 0 100 0 2.2 a 8.5 ab 7.2 a
plant sucrose
MS 59 mM 1.25 100 0 1.6 a 13.8 b 10.8 b
sucrose
MS 59 mM 2.5 100 0 2.2 a 5.3 a 11.6 b
sucrose
MS 59 mM 5 100 40 b 2a 4.5 a 10.2 b
sucrose
Note: Basic MS basal medium containing 2 mg/L Phytagel. The photosynthetic photon flux at culture level was
20–25 μmol/m2/s
x
Values are proportions of ten replicates per treatment
y
Values (n = 15) within a single column followed by the same letter were not significantly different according to the
Tukey test (p ≤ 0.05)

Table 4
Composition of culture media used for in vitro biomass production of P. tenuifila callus derived from
different explant types cultured in light

Carbon Carbon
Culture source source PGR PGR Callus DW
Explant origin medium type (mM) type (μM) Callus FW (mg)x (mg)x
Immature seeds MS Sucrose 88.5 2,4-D 2.5 1383.8 ± 187.2 c 99.4 ± 7.5 c
Stem segments MS Sucrose 88.5 2,4-D 2.5 1021 ± 208.7 a 91.1 ± 11.19 b
Stem segments MS Sucrose 88.5 NAA 1.25 924.8 ± 185.3 a 80 ± 7.9 b b
Stem segments MS Glucose 88.5 NAA 2.5 1063.5 ± 109.7 b 55.4 ± 2.6 a
Stem segments MS Fructose 88.5 NAA 2.5 1082.4 ± 134.8 b 56.6 ± 3.8 a
Note: Basic MS basal medium containing 2 g/L Phytagel. The photosynthetic photon flux at culture level was
20–25 μmol/m2/s
FW fresh weight, DW dry weight
x
Values (n = 10) within a single column followed by the same letter were not significantly different according to the
Tukey test (p ≤ 0.05)
18 Jenny Sumara Sozo et al.

Table 5
Composition of culture media used for in vitro biomass production, total phenolics, and percentage of
DPPH* inhibition of P. tenuifila callus extracts derived from different explant types cultured in light

Carbon Carbon Culture Total phenolics DPPH*

Explant Culture source source PGR PGR period (μg GAE/g inhibition
type medium type (mM) type (μM) (days) DW)x (%)x
Immature MS Sucrose 88.5 2,4-D 2.5 45 20.41 ± 0.06 c 84 ± 0.60 c
seeds
Stem MS Sucrose 88.5 2,4-D 2.5 80 14.07 ± 0.03 a 21.72 ± 0.38
segments a
Stem MS Fructose 88.5 NAA 2.5 80 13.92 ± 0.03 a 31.83 ± 0.88
segments b
Stem MS Sucrose 88.5 2,4-D 2.5 80 17.28 ± 0.03 b 22.27 ± 0.25
segments a
Note: Basic MS basal medium containing 2 g/L Phytagel. The photosynthetic photon flux at culture level was
20–25 μmol/m2/s
GAE gallic acid equivalent, DW dry weight
x
Values (n = 5) within a single column followed by the same letter were not significantly different according to the Tukey
test (p ≤ 0.05)

Table 6
Composition of culture media used for shoot culture initiation and callus induction of Passiflora
setacea

In vitro Culture Sucrose 2,4-D Induction Callus

process Explant type Explant origin medium (mM) (μM) (%)x texture
Shoot culture Shoot tips Seedling (ex vitro) MS 59 0 100 –
initiation
Callus Root Seedling (in vitro) MS 59 5 100 Friable
culture
initiation
Hypocotyl Seedling (in vitro) MS 59 5 100 Friable
Cotyledonary Seedling (in vitro) MS 59 2.5 100 Compact
node
Leaf node Seedling (in vitro) MS 59 2.5 100 Friable
Cotyledon Seedling (in vitro) MS 59 5 100 Compact
Note: Basic MS basal medium containing 2 mg/L Phytagel
x
Values are means of three replicates of ten explants each per treatment. The photosynthetic photon flux at culture level
was 20–25 μmol/m2/s
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 19

Table 7
Composition of culture media used for in vitro shoot growth from shoot tip culture of P. setacea

Carbon Carbon
Culture source source IBA Shoot induction Rooting No. of Shoot length No. of leaf
medium type (mM) (μM) (%)x (%)x shootsy (cm)y nodesy
MS Sucrose 59 0 100 0 1.4 ab 5.4 b 12.6 b
MS Sucrose 59 1.25 100 60 1.6 b 8.5 c 17.8 c
MS Sucrose 59 2.5 100 0 1a 6.7 b 10 b
MS sucrose 59 5 100 0 1.2 a 4.2 a 5.8 a
Note: Basic MS basal medium containing 2 mg/L Phytagel. The photosynthetic photon flux at culture level was
20–25 μmol/m2/s
x
Values are proportions of ten replicates per treatment
y
Values (n = 15) within a single column followed by the same letter were not significantly different according to the
Tukey test (p ≤ 0.05)

Table 8
Composition of culture media used for in vitro biomass production, total phenolics, and percentage
of DPPH* inhibition of P. setacea callus extracts derived from different seedling explant types
cultured in light

Total
Culture phenolics DPPH*
Culture Sucrose 2,4-D period Callus Callus (μg GAE/g inhibition
Explant type medium (mM) (μM) (days) FW (mg)x DW (mg)x DW)y (%)y
Root MS 88.5 2.5 45 1822.0 ± 82.8 ± 8.47 ± 55.51 ±
271.0 c 6.7 c 0.02 a 2.00 a
Cotyledonary MS 88.5 2.5 45 1347.0 ± 64.4 ± 12.34 ± 77.66 ±
node 204.0 b 8.1 a 0.02 b 0.90 c
Hypocotyl MS 88.5 2.5 45 1044.8 ± 61.4 ± 10.11 ± 63.84 ±
163.0 ab 10.4 a 0.01 b 1.89 b
Leaf node MS 88.5 2.5 45 1107.6 ± 61.4 ± 11.10 ± 88.17 ±
200.8 b 10.4 a 0.03 b 0.50 d
Cotyledon MS 88.5 2.5 45 960.0 ± 70.2 ± 17.26 ± 52.50 ±
207.3 a 10.4 b 0.04 c 1.17 a
Note: Basic MS basal medium containing 2 g/L Phytagel. The photosynthetic photon flux at culture level was
20–25 μmol/m2/s
GAE gallic acid equivalent, FW fresh weight, DW dry weight
x
Values (n = 10) within a single column followed by the same letter were not significantly different according to the
Tukey test (p ≤ 0.05)
y
Values (n = 5) within a single column followed by the same letter were not significantly different according to the Tukey
test (p ≤ 0.05)
20 Jenny Sumara Sozo et al.

3.3 Establishment 1. Collect the seeds from fresh mature fruits of P. tenuifila imme-
of Shoot Cultures diately after harvesting.
of P. tenuifila 2. Remove the seed arils.
3.3.1 Ex Vitro Seed 3. Immerse P. tenuifila seeds completely in 2 mL 2.5 % (w/v) gib-
Germination berellic acid aqueous solution at 25 °C for 5 days (see Note 5).
4. Remove P. tenuifila seeds from the GA3 aqueous solution and
sow in 50 mL plastic cups containing 28 g soil. Add 8 mL dis-
tilled water.
5. Place plastic cups in 23.5 cm × 16.9 cm × 10 cm polystyrene
trays.
6. Maintain the trays either at 25 °C or in the greenhouse with a
natural photoperiod at 16 °C during the night and 40 °C dur-
ing the day (see Note 5).

3.3.2 Surface 1. Excise shoot tips, 3–4 cm in length comprising one apical bud
Sterilization of Seedling and two axillary buds, from 45- to 60-day-old seedlings (see
and Adult Plant Shoot Tips Fig. 1a) or greenhouse-grown 15-month-old adult P. tenuifila
plants.
2. Rinse shoot tips in 100 mL tap water, containing 2–3 drops of
commercial detergent.
3. Wash four times with distilled water.
4. Surface sterilize shoot tips of P. tenuifila seedlings for 1 min
30 s in 70 % (v/v) alcohol, rinse for 3 min in sterile distilled
water, and immerse in commercial bleach (2.5 % active chlo-
rine) with 2–3 drops of Tween 20 for 2 min 30 s.
5. Surface sterilize shoot tips of P. tenuifila adult plants for 3 min
in 70 % (v/v) alcohol, rinse for 3 min in sterile distilled water,
and immerse in commercial bleach (2.5 % active chlorine) with
2–3 drops of Tween 20 for 4 min.
6. Rinse the shoot tips three times each for 10 min in sterile dis-
tilled water.

3.3.3 Shoot Initiation 1. Place surface-sterilized shoot tips of P. tenuifila vertically on

and Multiplication the MS basal medium containing 59 mM sucrose and 2 g/L
Phytagel (see Note 5, Fig. 1b).
2. Promote in vitro shoot elongation by transferring the 30-day-
old in vitro shoots to MS basal medium with 59 mM sucrose,
2 g/L Phytagel, and either 1.25 μM IBA (P. tenuifila seedling
shoot tips) or 1.25 μM GA3 (P. tenuifila adult plant shoot tips)
(see Note 7) (Fig. 1c).
3. Evaluate the percentage of shoot formation, number of shoots,
shoot length, and number of nodes initiated per explant after
12 weeks. The results for shoot induction and growth of
P. tenuifila are shown in Tables 2 and 3.
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 21

Fig. 1 Ex vitro-germinated seedlings of Passiflora tenuifila (a). In vitro shoot cultures originated from seed-
ling shoot tip explants of Passiflora tenuifila cultured on MS basal medium with 2 mg/L Phytagel, 59 mM
sucrose (b); 59 mM sucrose and 1.25 μM GA3 (c) after 90 days; 88.5 mM glucose and 1.25 μM IBA (d) after
45 days. Bars = 25 mm

4. For shoot multiplication and shoot culture stock maintenance

remove 2 cm long shoot tips and single-leaf node explants
(ca. 1.0 cm long) from the 8-week-old P. tenuifila plantlets
originated from the shoot tips cultured according to the
procedures 1–2 (see Note 8).
22 Jenny Sumara Sozo et al.

5. Place explants vertically on the MS basal medium supple-

mented with 88.5 mM glucose, 2 g/L Phytagel, and 1.25 μM
IBA. The results for in vitro shoot growth of P. tenuifila are
shown in Fig. 1d (see Note 8).
6. Subculture after every 60-day culture cycle.

3.4 Establishment 1. Harvest immature fruits (4-week-old after anthesis) from

of Callus Cultures P. tenuifila greenhouse-grown plants.
3.4.1 Establishment 2. Rinse fruits in 100 mL tap water containing 2–3 drops of com-
of Callus Cultures mercial detergent.
from Immature Seeds 3. Surface sterilize fruits for 5 min in commercial alcohol in the
flow cabinet.
4. Remove the seeds and place them on MS basal medium
amended with 59 mM sucrose, 2 g/L Phytagel, and 2.5 μM
2,4-D (see Notes 9 and 10).
5. After 45 days evaluate the callus induction. Example results of
callus induction are shown in Table 2, Fig. 2a.
6. Subculture callus (ca. 50 mg fresh weight) every 30-day cycle
to MS basal medium containing 88.5 mM sucrose, 2 g/L
Phytagel, and 2.5 μM 2,4-D (see Note 11).
7. After 45 days evaluate callus fresh and dry mass. The results for
callus growth are shown in Table 4, Fig. 2b (see Notes 10 and 11).

3.4.2 Establishment 1. Surface sterilize shoot tips of P. tenuifila following the proce-
of Callus Cultures dures described in Subheading 3.3.2.
from Seedling and Adult 2. Place explants vertically on the MS basal medium supple-
Plant Shoot Tips mented with 59 mM sucrose, 2 g/L Phytagel, and 1.25 μM
NAA (see Note 9).
3. Evaluate the percentage of callus induction and fresh and dry
mass after 45 days. The results for callus induction are shown
in Table 2, Fig. 2c–e (see Notes 10 and 11).

3.4.3 Establishment 1. Remove stem segments (2–3 mm in length) from 60-day-old

of Callus Cultures shoot cultures of P. tenuifila established according to the pro-
from Stem Segments cedures described in Subheading 3.3.2 (Fig. 1).
of In Vitro-Formed Shoots 2. Place the explants on MS basal medium containing 88.5 mM
of either sucrose, glucose, or fructose, 2 g/L Phytagel, and
either 1.25–2.5 μM NAA or 2,4-D (see Note 9).
3. After 45 days, evaluate the percentage of callus induction,
fresh mass, and dry mass. The results for callus induction and
growth are shown in Tables 2 and 4, Fig. 2f (see Notes
10 and 11).
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 23

Fig. 2 Callus originated from immature seeds (a, b), from shoot tips of seedlings (c), adult plants (d, e), and
stem segment explants of in vitro-formed shoots (f) of Passiflora tenuifila cultured on MS basal medium
with 59 mM sucrose, 2 mg/L Phytagel, and 2.5 μM 2,4-D (a, b); 2.5 μM NAA (c–e); or 88.5 mM sucrose and
2.5 μM 2,4-D (f), after 50-day culture. Bars = 5 mm (a, b, e, f). Bars = 25 mm (c, d)

3.5 Establishment 1. Collect the seeds from fresh mature fruits of P. setacea immedi-
of Shoot Cultures ately after harvesting.
of P. setacea 2. Remove the seed arils.
3.5.1 Ex Vitro Seed 3. Sow P. setacea seeds in 50 mL plastic cups containing 28 g soil.
Germination Add 8 mL distilled water.
4. Place plastic cups in 23.5 cm × 16.9 cm × 10 cm polystyrene trays.
24 Jenny Sumara Sozo et al.

5. Keep the trays in the greenhouse with natural photoperiod and

temperatures of 16 °C during the night and 40 °C during the
day (see Note 6).

3.5.2 Shoot Initiation 1. Surface sterilize ex vitro-grown seedling shoot tips of P. setacea
and Multiplication (see Subheading 3.3.2, steps 1–4; Fig. 3a).
2. Place surface-sterilized shoot tips of P. setacea vertically on the
MS basal medium supplemented with 59 mM sucrose and
2 g/L Phytagel (see Note 5).
3. Evaluate the percentage of shoot formation, number of shoots,
shoot length, and number of nodes initiated per explant after
12 weeks. The results of shoot induction and growth are shown
in Tables 6 and 7, Fig. 3b (see Note 12).
4. For shoot elongation, multiplication and maintenance of
shoot culture stocks of P. setacea follow the procedures
described in Subheading 3.3.3, steps 4–6 (see Note 8). The
results for in vitro shoot growth of P. setacea are shown in
Fig. 3c (see Note 8).

3.6 Establishment 1. Rinse seeds of selected P. setacea plants in 100 mL tap water
of Callus Cultures with 2–3 drops of commercial detergent, and wash four times
with distilled water.
3.6.1 Seed Surface
Sterilization and In Vitro 2. Surface sterilize seeds for 10 min in commercial bleach (2.5 %
Seed Germination active chlorine). Add 2–3 drops of Tween 20.
of P. setacea 3. Rinse three times for 10 min in sterile distilled water and cul-
ture the seeds on MS basal medium supplemented with 59 mM
sucrose and 2 g/L Phytagel (see Note 6).

3.6.2 Establishment 1. Remove segments (1 cm long) of either root, hypocotyl, epi-

of Callus Cultures cotyl, cotyledonary node, or leaf node obtained from 60-day-
from Axenic Seedling old aseptically grown seedlings of P. setacea (Fig. 3d).
Explants 2. Place the explants horizontally on MS basal medium with 88.5 mM
sucrose, 2 g/L Phytagel, and 2.5 μM 2,4-D (see Note 13).
3. After 45 days, take callus fresh and dry weight. The results of
callus induction are shown in Table 6 (see Notes 11 and 12).
4. Subculture callus at 30-day interval by following the procedures
described in Subheading 3.4.1, step 6. The results for callus
growth are shown in Table 8, Fig. 4 (see Notes 10 and 11).

3.7 Phytochemical 1. Grind 1 g fresh callus material in 10 mL 80 % (v/v) methanol

Analysis and in water and leave the extract for 1 h in the darkness.
Antioxidant DPPH Test 2. Centrifuge contents at 11.76 × g for 5 min. The supernatant
3.7.1 Preparation of Callus solution is filtered under vacuum into a volumetric flask and
Extract for Estimation of the filtrate is saved.
Total Phenolic Compounds
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 25

Fig. 3 Ex vitro-germinated seedlings of Passiflora setacea (a). In vitro shoots of Passiflora setacea origi-
nated from seedling shoot tip explants cultured on MS basal medium with 2 mg/L Phytagel and either 59 mM
sucrose (b, c) or 88.5 mM glucose μM IBA (d) after 45 days. In vitro-germinated seedling of Passiflora
setacea. Bars = 25 mm

3.7.2 Estimation of Total 1. Mix 40 μL methanolic extract with 3.16 mL deionized water
Phenolics Contents and add 200 μL 10 % Folin-Ciocalteu reagent.
in the Callus Extract
26 Jenny Sumara Sozo et al.

Fig. 4 Callus originated from roots (a), hypocotyl (b), cotyledonary node (c), leaf node (d), cotyledon (e) of in
vitro-cultured seedlings of Passiflora setacea cultured on MS basal medium with 88.5 mM sucrose, 2 mg/L
Phytagel, and 2.5 μM 2,4-D, after 45-day culture. Bars = 5 mm

2. After 6 min the reaction is neutralized with 600 μL 20 %

sodium carbonate solution. The color will develop after incu-
bation for 2 h at the room temperature in the darkness.
3. 300 μL of each sample and control are transferred to 96-well
microplate and the absorbance is detected at 760 nm on a UV-
visible microplate reader. The measurements are compared to
the standard curve for gallic acid (0–1000 μg/mL) (see Notes
1 and 2).
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 27

4. The results for total phenolics are expressed as microgram of

gallic acid equivalent per gram of dry callus. The results of total
phenolic contents in callus of P. tenuifila (Table 5) and P. seta-
cea (Table 8) are shown (see Note 14).

3.7.3 Free Radical 1. Mix samples of 10 μL methanolic extract with 290 μL 0.05 mM
Scavenging Effect methanolic solution of DPPH in a 96-well microplate
on 2,2-Diphenyl-1- (see Note 3).
picrylhydrazyl 2. A DPPH blank sample, without extract, containing 10 μL
80 % methanol and 290 μL DPPH solutions is prepared and
assayed as control. The positive control is the DPPH solution
plus tert-butylhydroxytoluene (BHT).
3. After incubation in the darkness at room temperature for 2 h,
the absorbance of the reaction mixture is measured at 515 nm
using a UV-visible microplate reader.
4. The percentage decrease in the absorbance at 515 nm is
recorded for each sample and the percentage of quenching of
the DPPH* radical is calculated on the basis of the observed
decrease of the radical according to the formula DPPH* inhi-
bition percentage = [(ADPPH − AExtr)/ADPPH] × 100 where ADPPH
is the absorbance value of the DPPH blank sample (control)
and AExtr is the absorbance value in the presence of the extract.
The results for the percentage of DPPH scavenged of callus
extracts of P. tenuifila (Table 5) and P. setacea (Table 8) are
shown (see Note 15).

4 Notes

1. Prepare a stock solution of gallic acid by dissolving 100 mg

gallic acid in 100 mL deionized distilled water. Firstly dissolve
the reagent in 1 mL 80 % methanol and increase the volume to
100 mL by adding deionized distilled water. Store this stock
solution in an amber glass flask in a refrigerator to use as fresh
working standards. Stock solution should be maintained at
room temperature before use. Analyze total phenolics in the
callus extract spectrophotometrically by using Folin-Ciocalteu
reagent [12].
2. Prepare working standards of 50–1000 μg/mL standard gallic
acid solution. Total phenolics is expressed as microgram of gal-
lic acid equivalent per gram of dry extract (μg GAE/g) using a
standard curve (0–1000 μg/mL) of gallic acid.
3. Prepare fresh 0.05 mM DPPH* stock solution in 80 % metha-
nol (w/v) and store in the darkness at 4 °C in a flask, covered
with aluminum foil. DPPH radical has been widely used to
evaluate the free radical scavenging capacity (antioxidant activ-
ity) of plant and microbial extracts [13, 14].
28 Jenny Sumara Sozo et al.

4. The media and plant growth regulator solutions are prepared in

double-distilled water. Adjustment of pH is done before the addi-
tion of Phytagel. Store all the stock solutions at 4 °C until use.
5. To optimize the Passiflora tenuifila and P. setacea shoot and
callus culture protocols, determine the most appropriate con-
centration of sucrose, glucose, IBA, GA3, NAA, and 2,4-D.
The optimum culture conditions for shoot culture initiation
and growth are shown in tables (see Tables 2, 3, 6, and 7).
6. Passiflora tenuifila seeds fail to germinate in vitro. Seeds can be
germinated in soil either at 25 °C or in the greenhouse (natural
day light, minimum temperature 16 °C, maximum tempera-
ture 40 °C), after immersion for 5 days in 2.5 % GA3 aqueous
solution. The germination rates of the GA3-treated seeds are
80–90 % within 20 days and mechanical scarification was
unnecessary. We have successfully modified the originally pro-
posed P. alata seed germination method [7].
7. P. tenuifila in vitro shoots are produced in 90–100 % shoot tips
originated either from seedling or adult plant. IBA (for seed-
ling shoot tip) and GA3 (for adult plant shoot tip) are effective
promoters of in vitro shoot elongation and growth (see
Table 3). The multiplication rates varied from 10 to 20 propa-
gules per culture cycle depending on the shoot tip origin.
Rooting is achieved in 40–50 % in vitro shoots cultured in
IBA-containing medium. After 8 weeks of culture, in vitro
shoots formed highest rooting rate (see Table 3).
8. P. tenuifila and P. setacea shoot culture stocks are successfully
maintained by subculturing shoot tips and leaf node segments on
MS basal medium containing 88.5 mM glucose, 1.25 μM IBA,
and 2 g/L Phytagel for 24 months without decreasing the shoot
proliferation capacity (see Figs. 1 and 3) (8-week subculture time).
9. The best culture conditions for P. tenuifila callus induction
(Table 2) and growth (Table 4) are shown. NAA is effective for
callus induction from shoot tips while 2,4-D is effective for cal-
lus induction from immature seeds.
10. Consistent biomass (fresh and dry mass) is produced by the
callus culture systems developed for P. tenuifila and maximum
callus dry mass is obtained from immature seed-derived callus
after ca. 45-day subculture cycle (see Table 5). P. setacea callus
growth is affected by explant type and consistent callus bio-
mass (fresh and dry mass) is produced by all callus culture sys-
tems developed for P. setacea. Callus derived from root and
cotyledon segments explants shows the highest biomass accu-
mulation (see Table 8). Maximum callus biomass is obtained
after a 30–45-day subculture cycle.
11. The subculture of P. tenuifila callus cultures originated from in
vitro-formed shoot stem segments and from shoot tips, either
 Passiflora Tenuifila, Passiflora Setacea, In Vitro Culture, Phytochemical Analysis 29

from seedling or adult plants, is not as effective as the subcul-

ture of immature seed-derived callus. The maintenance of P.
tenuifila immature seed callus and P. setacea seedling explant
callus culture stocks is carried out successfully for at least 18
months through periodic subculture (30-day time) on MS
basal medium supplemented with 88.5 mM sucrose, 2.5 μM
2,4-D, and 2 mg/L Phytagel (see Tables 4 and 8).
12. P. setacea in vitro shoots are produced in 100 % explants, origi-
nated from seedling shoot tips. Addition of 1.25 μM IBA effi-
ciently promotes in vitro shoot growth (number of shoots,
shoot length, and number of nodes/micro shot) and rooting
(see Table 7). The multiplication rate is ca. 15–18 propagules
per culture cycle. Rooting is achieved in 60 % of the in vitro
shoots. Approximately 8-week time is required to achieve the
highest rooting rate from P. setacea in vitro shoots (see Table 7).
13. The best culture conditions for P. setacea callus induction
(Table 6) and growth (Table 8) are shown. Maximum callus
induction rate (100 %) was achieved from all explant types.
14. The levels of total phenolic compounds in P. tenuifila callus
extracts are shown in Table 5. Callus age and explant-type
linked differences are observed. The analysis shows that phe-
nolic compound contents are higher in 45-day-old callus origi-
nated from immature seeds of P. tenuifila. The levels of total
phenolic compounds in P. setacea callus extracts are shown in
Table 8. The phytochemical analysis of callus extracts reveals
explant-type linked differences and suggests that phenolic
compound contents are superior in callus originated from cot-
yledon segments.
15. The antioxidant activity of P. tenuifila callus extract is explant
type and callus age dependent. The highest antioxidant activity
is observed in callus originated from immature seeds which
show the highest levels of total phenolics (see Table 5). The
DPPH* test of P. setacea callus extracts also reveals explant-
type linked differences and the highest antioxidant activity is
detected in leaf node callus. Therefore, the maximum level of
antioxidant activity is not dependent on the highest content of
phenolic compounds (see Table 8).

Acknowledgement

The authors acknowledge the support of the Conselho Nacional

de Desenvolvimento Científico e Tecnológico (CNPq/Brasil), the
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
(PET/CAPES/Ministry of Education/Brazil), Embrapa Cerrados,
Empresa Brasileira de Pesquisa Agropecuária (Embrapa) (Planaltina,
DF, Brazil), and Dr. Erica E Benson for language revision.
30 Jenny Sumara Sozo et al.

References
1. Oliveira CM, Dianese AC, Frizzas MR et al establishment of cell suspension cultures of
(2014) First report on an insect pest on Passiflora alata Curtis. Sci Hortic
Passiflora tenuifila Killip (Passifloraceae). 144:42–47
Phytoparasitica 42(5):677–680 9. Lugato D, Simão MJ, Garcia R et al (2014)
2. Delanoy M, van Damme P, Scheldeman X et al Determination of antioxidant activity and
(2006) Germination of Passiflora mollissima phenolic content of extracts from in vivo
(Kunth) L. H. Bailey, Passiflora tricuspis Mast plants and in vitro materials of Passiflora alata
and Passiflora nov sp. Seeds. Sci Hortic Curtis. Plant Cell Tiss Org Cult 118:
110:198–203 339–346
3. Mediondo GM, Garcia MTA (2006) 10. Sozo JS (2014) Secondary metabolite profile
Emergence of Passiflora caerulea seeds simu- and antioxidant activity of fruits, seeds and in
lating possible natural densities. Fruits vitro cultured calluses of Passiflora setacea and
61:251–258 Passiflora tenuifila (Passifloraceae). MSc
4. Pires MV, de Almeida AAF, de Figueiredo AL Thesis, Federal University of Santa Catarina,
et al (2012) Germination and seedling growth Florianopolis, SC, Brazil (in Brazilian
of ornamental species of Passiflora under artifi- Portuguese with English summary)
cial shade. Acta Sci Agron 2:67–75 11. Murashige T, Skoog F (1962) A revised
5. Antognoni F, Zheng S, Pagnucco C et al medium for rapid growth and bioassays with
(2007) Induction of flavonoid production by tobacco tissue cultures. Physiol Plant
UV-B radiation in Passiflora quadrangularis 15:473–497
callus cultures. Fitoterapia 78:345–352 12. Rhandir R, Preethi S, Kalidas S (2002)
6. Ozarowski M, Thiem B (2013) Progress in L-DOPA and total phenolic stimulation in
micropropagation of Passifloraspp to produce dark germinated fava beans in response to pep-
medicinal plants: a mini-review. Rev Bras tide and phytochemical elicitors. Process
Farmacogn 23(6):937–947 Biochem 37:1247–1256
7. Zucolotto SM, Carize F, Reginatto FH et al 13. Kim DO, Jeong SW, Lee CY (2003)
(2012) Analysis of C-glycosyl flavonoids from Antioxidant capacity of phenolic phytochemi-
South American Passiflora species by HPLC- cals from various cultivars of plums. Food
DAD and HPLC-MS. Phytochem Anal Chem 81:231–326
23:231–239 14. Kim YK, Guo Q, Packer L (2002) Free radical
8. Pacheco G, Garcia R, Lugato D et al (2012) scavenging activity of red ginseng aqueous
Plant regeneration, callus induction and extracts. Toxicology 172:149–156
 Chapter 3

Shoot Tip Meristem Cryopreservation of Hypericum Species

Katarína Bruňáková and Eva Čellárová

Abstract
Based on our long-standing experience with in vitro culture of Hypericum perforatum, a clonal multiplica-
tion system and vitrification-based cryopreservation protocols have been applied to several Hypericum
species: H. humifusum L., H. annulatum Moris, H. tomentosum L., H. tetrapterum Fries, H. pulchrum L.,
and H. rumeliacum Boiss. The shoot tips were cryopreserved using a uniform procedure that includes
pretreatment with abscisic acid (ABA), PVS3 cryoprotection, and direct immersion into the liquid nitro-
gen (LN). The freezing-tolerant Hypericum species were pre-exposed to the cold acclimation conditions
performed by a 7-day exposure to 4 °C. The content of naphtodianthrones (hypericins) including hyperi-
cin, pseudohypericin, and their protoforms was quantified by HPLC. Ploidy of plants was determined by
both flow cytometry of leaf tissue and chromosome counts of root tip meristematic cells. We have shown
that the post-thaw recovery rate of the shoot tips, pretreated with 0.076 μM ABA for 7 days at room
temperature, led to the post-cryogenic survival from 5 % in H. tomentosum to 21 % in H. annulatum.
As compared to the untreated (control) plants, the content of hypericins in plants regenerated after cryo-
preservation remained unchanged or decreased in H. perforatum, H. humifusum, H. annulatum,
H. tomentosum, H. tetrapterum, and H. rumeliacum. However, the pre-exposition of the freezing-tolerant
H. perforatum to cold acclimation prior to excision of the shoot tips has improved the post-thaw recovery
to 45 % and resulted in threefold increase of the total hypericin content.

Key words Micropropagation, Vitrification, LN, Ploidy, Flow cytometry, HPLC, Naphtodianthrones,
Emodin

1 Introduction

The remarkably diverse genus Hypericum (Hypericaceae) com-

prises nearly 500 species inhabiting all temperate regions world-
wide and higher altitudes of the tropical mountains [1]. Due to a
long history of the use in herbal medicine, especially for the treat-
ment of wounds, burns, and psychological disorders, Hypericum
perforatum L. (St. John’s wort) is the best studied and commer-
cially used species. Among several classes of bioactive secondary
metabolites including naphtodianthrones hypericin and pseudohy-
pericin (hypericins), phloroglucinol derivatives hyperforin and
adhyperforin, flavonol glycosides rutin and hyperosid, biflavonoids,

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_3, © Springer Science+Business Media New York 2016

31
32 Katarína Bruňáková and Eva Čellárová

and essential oils [2], hypericins attract a special interest, namely

due to anticancer [3], antiviral [4], antimicrobial [5], and anti-
inflammatory activities [6].
Although the biosynthesis of hypericin is not fully understood,
the experimental evidence for a polyketide synthase-mediated
pathway to emodin, which is considered to be the precursor of
hypericin, has been established [7]. In herba Hyperici, the naphto-
dianthrones exist in various forms, including the protopigments:
under the exposure to a visible light, the protohypericin and pro-
topseudohypericin are converted into hypericin and pseudohyperi-
cin, respectively [8]. The content of these compounds in H.
perforatum is low, ranging from 0.05 to 0.30 % [9]. Within the
species, the amount of naphtodianthrones varies, depending on
the genotype, developmental stage, and plant organs, as well as the
environmental conditions, e.g., the geographic area, seasonal vari-
ation, altitude, light conditions, nitrogen supplementation, water
and carbon availability, light intensity, and biotic stressors, such as
the metal contamination, pathogens, and herbivores [10].
To study the plant-environment interactions, an efficient in
vitro clonal multiplication system has been established for H. per-
foratum [11]. Among the genetic components of the variability,
both somaclonal variation and ploidy level were shown to impact
on hypericin quantity in the model plant H. perforatum [12, 13].
To preserve the original qualities of the authentic plant indi-
viduals, the cryopreservation is often used for a long-term storage.
Although H. perforatum should be considered as a model repre-
sentative of the genus, there are many species attracting the atten-
tion due to their unique phytochemical profiles. A uniform
cryoconservation protocol comprising the ABA pretreatment,
PVS3 cryoprotection, and direct immersion of the isolated shoot
tips into the LN has been applied to several other Hypericum spe-
cies of different origin and distribution [14]. It was found that the
genetically predetermined freezing tolerance of the species may
function as an indicator for a successful cryopreservation. As shown
by our recent observation, the pre-exposition of the intact plants of
the freezing-tolerant H. perforatum to the cold acclimation, per-
formed by a 7-day exposure to 4 °C prior to the PVS3 cryoprotec-
tion of the excised shoot tips, has improved the recovery rate nearly
threefold, reaching the level of 45 % (Bruňáková, unpubl.).
In addition, a possible stimulatory effect of a “cold shock,” a
subfreezing temperature of −4 °C, for the elicitation of the naph-
todianthrone biosynthesis in H. perforatum has been found [15].
The application of the cold pre-exposure with or without the treat-
ment of the whole plants with high nonphysiological concentra-
tion of ABA during the pre-culture period resulted in a substantial,
almost threefold increase in the hypericin content recorded in H.
perforatum and H. rumeliacum (Bruňáková, unpubl.).
 Shoot Tip Meristem Cryopreservation of Hypericum Species 33

2 Materials

The experimental plant material includes Hypericum perforatum

L., H. humifusum L., H. annulatum Moris, H. tomentosum L., H.
tetrapterum Fries, H. pulchrum L., and H. rumeliacum Boiss.

2.1 Initiation and 1. The basal solid MS medium contains Murashige-Skoog’s salt
Long-Term Storage mixture [16], Gamborg’s B5 vitamins [17], supplemented
of Hypericum spp. with sucrose, myoinositol, and glycine.
2.1.1 Culture Media 2. Plant growth regulators—6-benzyladenine (BA), abscisic acid
and Cryoprotectant (ABA).
Mixtures 3. Loading solution (LS) [18].
4. PVS3 cryoprotectant mixture [18].
5. Syringe filter with 0.2 μM pore size.
6. Magnetic stirrer.

2.1.2 Initiation 1. Silver nitrate (AgNO3).

and Micropropagation 2. Sterile double-distilled water.
of Hypericum spp.
3. Test tube with polypropylene or glass stopper.
4. Culture vessels.
5. Sterile Petri dishes, tweezers.
6. Laminar flow box.

2.1.3 Cryopreservation 1. Sterile 25, 50, and 100 mL Erlenmeyer flasks, cryovials, Petri
of Hypericum spp. dishes, and filter paper.
2. Grinded ice.
3. Thermostatic cabinet with an adjustable temperature in the
range from 22 to 4 °C, 16/8-h (day/night) photoperiod, and
35 μmol/m2/s of PAR.
4. Orbital shaker.
5. Water bath with a lift-up Makrolon cover.
6. Liquid nitrogen (LN) stored in a cryogenic Dewar flask.

2.2 Chromosome 1. 8-Hydroxyquinoline.

Counts and Flow 2. Ethanol, glacial acetic acid, hydrogen chloride (HCl).
Cytometry Screen
3. Giemsa solution.
of Ploidy
4. Synthetic resin—Solacryl.
2.2.1 Cytogenetic
5. 25 mL Erlenmeyer flask, beakers.
Technique
for Chromosome Number 6. Microscopic slides, cover slips, cellophane.
Determination 7. Water bath.
8. Light microscope (Olympus BX51) equipped with a digital
camera.
34 Katarína Bruňáková and Eva Čellárová

2.2.2 Flow Cytometry 1. General-purpose buffer (GPB) [19].

for Ploidy Determination 2. Propidium iodide (PI).
3. RNase.
4. Syringe membrane filter with 0.22 μm pore size, 42 μm nylon
filters, tubes, Petri dishes.
5. Grinded ice.
6. Flow cytometer CyFlow ML equipped with a green laser
(532 nm, 150 mV), and FloMAX 2.7 software.

2.3 Determination 1. HPLC-grade methanol and acetone, Pro-UV ethanol.

of Hypericins 2. Acetonitrile (ACN).
in Hypericum spp.
3. Trifluoroacetic acid (TFA).
2.3.1 Chemicals 4. Hypericin and emodin standards.
and Standards

2.3.2 Material 1. Forced-air oven.

and Equipment 2. Plastic storage tubes with a cap, 2 mL Eppendorf tubes.
3. Milli-Q Reference Water Purification System.
4. Tissue-lyser.
5. Sonicator water bath.
6. Agilent 1260 HPLC system equipped with a DAD detector. The
stationary phase represents a reversed-phase nonpolar Poroshell
C18 column (3.0 × 50 mm i.d., 2.7 μm particle size) at 40 °C.

3 Methods

3.1 Initiation and 1. Preparation of 1 L MS basal medium: Weigh 4.4 g Murashige-

Long-Term Storage Skoog’s salt mixture [16] containing Gamborg’s B5 vitamins
of Hypericum spp. [17], 30 g sucrose, 100 mg myoinositol, and 2 mg glycine.
Dissolve in 500 mL double-distilled water by adding in an
3.1.1 Culture Media
Erlenmeyer flask, using a magnetic stirrer.
and Cryoprotectant Mixture
Preparation 2. Add 6 g agar in 400 mL double-distilled water and boil in a
microwave.
3. Add hot agar solution to the medium and raise the volume to
1 L by adding double-distilled water.
4. Adjust pH to 5.6 with NaOH and HCl before autoclaving at
121 °C and 105 kPa for 15 min.
5. Prepare 1 L MS medium containing 2.2 μM BA by adding
0.5 mg stock solution (see Note 1) before autoclaving.
6. Prepare MS liquid medium containing filter-sterilized ABA by
adding filter-sterilized ABA stock solution to the autoclaved
medium cooled at 40 °C (see Note 2).
 Shoot Tip Meristem Cryopreservation of Hypericum Species 35

7. Prepare loading solution (LS) containing 2.0 M glycerol and

0.4 M sucrose [18] by adding 184.2 g glycerol and 106.9 g
sucrose to the liquid MS basal medium. The pH is adjusted to
5.8 before autoclaving.
8. Prepare 100 mL PVS3 cryoprotectant mixture [18] by adding
50 g sucrose and 50 g glycerol into 100 mL Erlenmeyer flask
and raise volume up to 100 mL with double-distilled water.
Stir this mixture to dissolve at 90–100 °C on a magnetic stirrer
and autoclave.

3.1.2 Initiation 1. Place Hypericum seeds, free of dust and solid particles, into the
and Micropropagation test tube filled with 1 % (w/v) AgNO3 solution.
of Hypericum spp. 2. Seal test tubes with the stopper and agitate gently by tipping
over for 15 min.
3. Remove AgNO3 solution and rinse seeds three to four times
with the sterile distilled water.
4. Place sterile seeds onto the surface of solid basal MS medium
for germination.
5. After 4 weeks of germination, cut shoots into pieces contain-
ing 4–6 foliage leaves.
6. Transfer shoot cuttings to solid basal MS medium containing
2.2 μM BA. After 4 weeks, multiple shoots with minimal callus
are formed [11] (see Note 3).
7. For rooting, culture the regenerated shoots or shoot cuttings
on the solid basal MS medium without any plant growth regu-
lators [11].
8. Keep all cultures at standard conditions as follows: tempera-
ture 22 ± 2 °C, 40 % relative humidity, 16/8-h (day/night)
photoperiod, and 35 μmol/m2/s PAR (photosynthetically
active radiation).
9. Subculture shoots at 28-day interval.

3.1.3 Cryopreservation Shoot tips, 5–10 mm long, consisting of one apical and one pair of
axillary meristematic domes with surrounding leaf primordia, are
excised from the Hypericum donor plants, growing in vitro on the
solid basal MS media (see Note 4) at the standard growing
conditions.

Pretreatment The isolated shoot tips are put into the 50 mL Erlenmeyer flasks
filled with 10 mL liquid MS medium containing 2.2 μM BA (see
Note 4) and 0.076 μM ABA and pre-cultured for 10 days on the
orbital shaker at 90 rpm at 40 % relative humidity, 16/8-h (day/
night) photoperiod, and 35 μmol/m2/s of PAR (see Notes
5 and 6).
36 Katarína Bruňáková and Eva Čellárová

Cryopreservation 1. The excised shoot tips (10–12 per sample) are put into 25 mL
Procedure and Cooling Erlenmeyer flask filled with 10 mL LS and are continuously
shaken at 120 rpm for 20 min at the room temperature.
2. For subsequent dehydration, shoot tips are placed into 1.8 mL
cryovials (10–12 per one cryovial), filled with 1 mL PVS3, and
equilibrated on ice for 180 min (see Note 7).
3. Immediately, the cryovials are plunged directly into the LN
and stored for at least 24 h (see Note 8).

Post-cryogenic Conditions 1. The cryovials are thawed rapidly in a water bath at 42 °C for 2 min.
2. To remove the vitrification solution, the shoot tips are trans-
ferred from the cryovials to 25 mL Erlenmeyer flasks filled with
10 mL liquid MS medium containing 1.2 M sucrose (see Note
9) and shaken for 20 min at 90 rpm at laboratory temperature.
3. Subsequently, the shoot tips are transferred to a sterile Petri
dish and carefully rinsed with MS liquid medium followed by
moderate drying on the filter paper moistened with the MS
medium (see Note 10).
4. The shoot tips are transferred onto a semisolid regeneration
MS medium containing 2.2 μM BA and cultured for 14 days in
the darkness, then at a 10 μmol/m2/s of PAR for 7 days, fol-
lowed by the exposure to 35 μmol/m2/s of PAR.
5. The shoot tip recovery rate is observed continually during 12-week
interval after the rewarming of the shoot tips (Fig. 1). The explants
with regenerating shoots are scored. The recovery rate is expressed
in % of the total number of the cryopreserved shoots.

3.2 Chromosome 1. Sample preparation. At least five root tips per plant containing
Counts and Flow the mitotically active meristematic tissues are used (see Note
Cytometry Screen 11). When plants are growing on the solid media, the medium
of Ploidy in Several residues are gently removed by rinsing the excised root tips in
Hypericum Species the water (see Note 12).

3.2.1 Cytogenetic
2. Pretreatment. To increase the proportion of cells at metaphase
Technique
phase, the chemical pretreatment is used: the root tips,
for Chromosome Number
5–10 mm, are cut with a razor into 25 mL Erlenmeyer flask
Determination
filled with 10 mL 2 mM 8-hydroxyquinoline (see Note 13)
and kept for 4 h at room temperature. The pretreated root tips
are rinsed under a tap water for 10 min and subsequently
washed with distilled water.
3. Fixation. To preserve the natural state of the cells and tissue
constituents, a mixture of 96 % ethanol and glacial acetic acid,
ratio 3:1, is used. The objects are fixed for 16 h at room tem-
perature. Until the next processing, the material, stored in
70 % ethanol, can be kept in the refrigerator.
4. Washing. To elute the fixative and soften the tissue, the fixed
material is rinsed two to three times in a glass beaker filled with
the distilled water at room temperature.
 Shoot Tip Meristem Cryopreservation of Hypericum Species 37

Fig. 1 The initiation of Hypericum perforatum multiple shoot formation from the cryopreserved shoot tips
regenerated on the MS media containing 2.2 μM BA for 28 days (a, b) and after a 28-day subculture on the
basal MS media (c, d). Shoot tips were excised from plants pre-cultivated in liquid basal MS media supple-
mented with 76 μM ABA (a, c) or cold acclimated for 7 days at 4 °C without ABA pretreatment (b, d). Bars
represent 10 mm. Photo: K. Bruňáková

5. Acid digestion. To separate the cells in the tissue, pectic mid-

dle lamella must be destroyed. The root tips are incubated
for 6 min in 1 M HCl in the water bath at 60 °C. The
hydrolysis is completed in the cold 1 M HCl followed by
rinsing of the root tips two to three times in the distilled
water.
6. Slide preparation. The root tips are cut in a drop of 45 % acetic
acid (v/v) and the slides are prepared by a squash and smear
technique using the cellophane [20] (see Note 14).
7. Staining. After stripping of the cellophane, the slides are
stained with Giemsa solution (see Note 15) for 30 min in the
dark, air-dried, and mounted in a synthetic resin before being
covered with a cover slip.
8. The mitotic metaphases are observed and captured under
×1000 magnification. The chromosome number is deter-
mined by counting of the metaphase chromosomes (Fig. 2).
At least five root tips per plant are scored for the chromo-
some counts.
38 Katarína Bruňáková and Eva Čellárová

Fig. 2 Metaphase plates of root tip meristematic cells of Hypericum representatives including (a) H. perforatum
(2n = 2x = 16), (b) H. humifusum (2n = 2x = 16), (c) H. annulatum (2n = 2x = 16), (d) H. pulchrum (2n = 2x = 18),
(e) H. tomentosum (2n = 2x = 16), (f) H. tetrapterum (2n = 2x = 16), and (g) H. rumeliacum (2n = 2x = 16).
Photo: J. Koperdáková, M. Skyba, Z. Lacková

3.2.2 Flow Cytometry Preparation of the nuclear suspensions:

to the Determination
1. Five to ten young leaves per plant, equivalent to 40–50 mg, are
of Ploidy
excised and placed into a 60 mm Petri dish (see Note 16).
2. 1 mL GPB buffer (see Note 17) is added and the tissue is chopped
using a new razor blade for approximately 60 s (≈100 chops per
sample) to homogenize the tissues and release the nuclei.
3. The leaf tissues from both the sample and the internal refer-
ence DNA standard (see Note 18) should be chopped
simultaneously.
4. To remove the large debris, the resulting homogenate is fil-
tered through a 42 μm nylon filter into a tube and subsequently
the nuclear suspension is stained with 50 μL PI stock solution
(see Note 19).
5. For preventing the staining of a double-stranded RNA, 50 μL
RNase stock solution (see Note 20) is added to the sample
immediately.
6. The samples are incubated on ice and analyzed within 10 min.
Flow cytometry:
1. Green argon laser at 532 nm wavelength is used as a light source.
2. Optical long-pass filter is used to selectively transmit emission
wavelength of PI.
 Shoot Tip Meristem Cryopreservation of Hypericum Species 39

3. The fluorescence intensity of PI is detected and projected on a

linear scale.
4. The flow of at least 5000 nuclei is measured in each sample.
5. The ploidy level (see Note 21) is calculated according to the
formula the ploidy of the sample = the mean fluorescence intensity of
the sample/the mean fluorescence intensity of the reference sample.

3.3 Determination 1. To ensure the representative specimen for analytical testing, all
of Hypericins the plants should be of the same ploidy level (see Note 22).
in Hypericum spp. 2. Each sample contains shoots from at least four cultivation vessels.
3.3.1 Sample 3. Plant material is left to dry naturally at room temperature. The
Preparation drying is finished in a forced-air oven at 40 °C for 2 h
(see Note 23).
4. Dried plant material is homogenized at a tissue-lyser (QIAGEN,
Germany). Before further processing, the pulverized sample is
transferred to a plastic tube of an appropriate size, closed, and
stored at 4 °C in the darkness.

3.3.2 Extraction 1. Weigh 50 mg of each samples of the dried and homogenized

Procedure plant material in 2 mL Eppendorf tubes, suspend in 1.5 mL
ethanol:methanol:acetone (1:1:1, by volume) mixture, and
sonicate for 60 min at 25 °C (see Note 24).
2. Samples are centrifuged at 21,250 × g and 20 °C for 30 min.
3. The supernatant is transferred into the dark HPLC vials for
subsequent analyses (see Note 25).

3.3.3 Analytical 1. Six-step solvent gradient is applied over a 17-min period at a

HPLC Method flow rate of 1.3 mL/min (see Note 26). The mobile phase is
consisted of phase A (10 % (v/v) ACN; pH = 2.7) (see Note 27)
and phase B (100 % ACN) is started from 80:20 (A:B) to
20:80 in 8.5 min, then is changed to 0:100 in 1 min, held at this
composition for 6 min, returned to 80:20 in 1.2 min, and held
for 0.3 min. The total run time is 17 min and the equilibration
time between runs is 3 min giving a total analysis time of 20 min.
2. The calibration curves are prepared from a methanol dilution
series of the reference standard solutions (see Note 28): seven
different dilutions in the range from 0.1 to 200 μg/mL of
hypericin and from 0.1 to 50 μg/mL of emodin are prepared.
The same volume (5 μL) of each dilution is injected in a tripli-
cate and averaged. The calibration curve is constructed by
plotting the peak area versus the corresponding concentration
of the standard.
3. The injection volume of the sample is 5 μL.
4. The identification of hypericins and emodin is performed by an
HPLC-DAD analysis and comparing the retention times of the
40 Katarína Bruňáková and Eva Čellárová

peaks in the extracts with those of the reference standards. To

avoid any misidentification, the co-chromatography of the
sample with the small amounts of standards is used. The purity
of the peaks is checked by comparing the absorption spectra of
each peak with those of the reference compounds (see Note
29; Fig. 3e).
5. The peaks for hypericin, pseudohypericin, and their proto-
forms are detected at 590 nm (Fig. 3a–d); the identification of
emodin is performed at 440 nm.
6. The content of “total hypericins” and emodin (μg/mg DW) in
the samples is calculated according to the calibration curve of
the respective standards (see Note 30).

Fig. 3 The elicitation effect of the cryogenic procedure on the naphtodianthrone content in two representatives
of the genus Hypericum after cryopreservation—the HPLC chromatograms of H. perforatum (a, b) and
H. rumeliacum (c, d) extracts obtained from the untreated (control) in vitro plants (a, c) and shoots regen-
erated from the shoot tip meristems excised from plants, which were pre-cultured in the liquid media supple-
mented with 76 μM ABA for a 7-day period followed by a 7-day exposure to 4 °C; the isolated shoot tips were
dehydrated in LS and PVS3, and cryopreserved by a direct immersion to LN. The naphtodianthrones protops-
eudohypericin (1), pseudohypericin (2), protohypericin (3), and hypericin (4) were detected at 590 nm.
Hypericins are well distinguished by their characteristic UV spectra (e) at the retention times of 4.2 min for
protopseudohypericin, 4.6 min for pseudohypericin, 6.8 min for protohypericin, and 7.4 min for hypericin
 Shoot Tip Meristem Cryopreservation of Hypericum Species 41

4 Notes

1. Preparation of 2.2 μM BA stock solution: Dissolve 5 mg BA in

1 mL 1 N NaOH, raise volume up to 5 mL with distilled water
in 5 mL volumetric flask, and keep in the refrigerator.
2. As an exogenous source of ABA, the racemic (±)-ABA which is
a 1:1 mixture of (+) or S-ABA (natural form) and (−) or R-ABA
(unnatural or analogue form) is used. The 76 μM stock solu-
tion is prepared by dissolving 20 mg ABA in 1 mL 1 N NaOH
or 1 N KOH in a 5 mL volumetric flask and raise volume up to
5 mL by adding distilled water and filter-sterilize. To dissolve
ABA in NaOH or KOH, several minutes of vigorous shaking
are required. Storing of the aqueous ABA for more than 1 day
is not recommended. For the preparation of 1 L liquid MS
medium containing 0.076 and 76 μM ABA, add 5 μL and
5 mL of the stock solutions. ABA is also soluble in the organic
solvents, e.g., methanol, ethanol, acetone, aether, and chloro-
form. The solubility of ABA in these solvents is approximately
20 mg/mL. However, the use of ethanol as a solvent in the
ABA stock solution decreased freezing tolerance [21].
3. The efficient micropropagation system established for H. per-
foratum [11] is applicable to some extent or with modification
to other Hypericum species involved in this study.
4. Alternatively, the clusters of multiple shoots regenerating from
the explants cultured on the solid MS media supplemented
with 2.2 μM BA can be used as the source of the shoot tips.
Considering the fact that the long-term exposure of plants to
BA negatively impairs the regeneration capability of cryopre-
served H. perforatum meristems, the shoots originated from
the clusters should be cultivated on the basal solid MS media
for at least 14 days before the excision of the apices [22]. While
the long-term culture of plants on media supplemented with
BA may cause delay of the protective effect of ABA used as a
cryoprotectant that is reflected by a decreased rate of regenera-
tion of cryopreserved H. perforatum meristems, the presence of
the growth regulator in the media during the short-term pre-
treatment of the excised shoot tips prior to cryopreservation in
LN is necessary for the improvement of the recovery rate [22].
5. For the improvement of freezing tolerance, both method used
and ABA concentration should be considered. ABA applied to
roots is easily absorbed and translocated [23]. In H. perfora-
tum and H. canariense, no increase in the freezing tolerance
was seen after 7-day cultivation in the liquid basal MS media
supplemented with 0.076 μM ABA at 22 ± 2 °C (Bruňáková,
unpubl.). Alternatively, the intact plants with well-differentiated
roots are transferred into 100 mL Erlenmeyer flasks containing
42 Katarína Bruňáková and Eva Čellárová

30 mL liquid basal MS media supplemented with 76 μM ABA

and cultivated for 7 days at 90 rpm at 40 % relative humidity,
16/8-h (day/night) photoperiod, and 35 μmol/m2/s of PAR
(Fig. 1a, c).
6. As an alternative to ABA pre-conditioning, cold acclimation
can be used for freezing-tolerant Hypericum species. The
sealed culture vessels with 14- to 21-day-old plantlets, cultured
on basal MS media, are transferred to the cooling chamber
with temperature adjusted to 4 °C for 7 days, 40 % relative
humidity, 16/8-h (day/night) photoperiod, and 35 μmol/
m2/s of PAR [14] (Fig. 1b, d). The exposure of plants to grad-
ually decreasing temperature up to 4 °C during 21 days at the
rate of 1 °C/day is also applicable (Fig. 1b, d). As compared
with the post-thaw recovery of the shoot tips that were pre-
cultured in the liquid MS media supplemented with 0.076 μM
ABA at room temperature during a 7-day period, a 7-day
exposure of the intact plants of the freezing-tolerant H. perfo-
ratum to 4 °C at the standard light conditions resulted in a
threefold increase in the recovery rate (Bruňáková, unpubl.).
Based on our preliminary observation, the combination of the
pretreatment of the whole plants in the liquid media amended
with 76 μM ABA at room temperature, followed by the cold
acclimation, could improve the post-cryogenic recovery of the
freezing-tolerant Hypericum species (Bruňáková, unpubl.).
7. Based on the differential scanning calorimetry (DSC) of H.
perforatum shoot tips, 180 min of PVS3 exposure time was
optimal to accomplish the highest regeneration rate within
59.3–71.3 % [24].
8. Besides, on vaporization, LN displaces oxygen and may cause
asphyxiation. Therefore, the cryogenic liquid must be handled
and stored in well-aired areas. The vapors must not be inhaled.
9. MS medium containing 1.2 M sucrose is prepared by adding
380.8 g sucrose to the basal MS medium. The pH of liquid MS
medium is adjusted to 5.6 before autoclaving.
10. Meristems can easily dry and damage by the airflow in the lam-
inar flow box. Therefore, they should be handled as rapidly as
possible. In addition, the rapid temperature changes during
the process of freezing and re-warming result in producing
reactive oxygen species (ROS). To increase the post-cryogenic
survival, the photooxidative stress accompanying the cryo-
preservation procedure should be minimized. Therefore,
switching off the light in the flow box when manipulating the
cryo-samples immediately after thawing is recommended.
11. To prepare the slides of metaphase chromosomes of Hypericum
spp., the procedure developed for a karyotype study in H. per-
foratum, published by [25], is used.
 Shoot Tip Meristem Cryopreservation of Hypericum Species 43

12. The root tips must be excised from the actively growing and
healthy plants without any signs of wilting or any other dam-
age. The mitotic index is the highest when root tips are iso-
lated in the morning. Prior to processing, the excised root tips
should be held in an ice water.
13. The aqueous solution of 8-hydroxyquinoline can be stored at
room temperature for at least 1 year [26]. The chemical pre-
treatment of the plant tissue must be used with caution as its
action is to arrest cell division in the living tissue.
14. Cover root tip, size 1–2 mm, in a drop of acetic acid with a wet
square of cellophane (20 × 20 mm), soaked in distilled water.
The specimen is taped gently with a rubber tube stopper and a
tube is rolled across the cellophane. The extent of squashing
should be controlled by observing under a microscope. The
slide is blotted with a filter paper. The piece of cellophane can
be carefully removed by a moderate warming of slides.
15. The Giemsa solution is diluted at a ratio 1:9 (v/v) with a phos-
phate buffer. 100 mL phosphate buffer consists of 61.2 mL
solution A and 38.8 mL solution B with a pH adjusted to 6.8.
To prepare 100 mL aqueous A and B solutions, dissolve 2.4 g
Na2HPO4 · 12H2O and 1.0 g KH2PO4, respectively. The solu-
tion remains stable for several months, stored in the
refrigerator.
16. The procedure for isolating the nuclei was adopted from that
published by [19].
17. The isolation buffer, a general-purpose buffer (GPB) prepared
according to [19], consists of 0.5 mM spermine · 4HCl,
30 mM sodium citrate, 20 mM 4-morpholine propane sulfo-
nate (MOPS), 80 mM KCl, 20 mM NaCl, and 0.5 % (v/v)
Triton X-100, pH adjusted to 7.0.
18. As an internal standard, the young leaves of the in vitro-
cultured diploid H. perforatum L. can be used. The ploidy
level of the reference H. perforatum L. plant (2n = 2x = 16) was
verified cytogenetically: Five root tips were studied and at least
ten meristematic cells in the metaphase per root tip were scored
for the chromosome number.
19. The stock solution containing 100 μg/mL PI is prepared by
dissolving 1 mg PI in 10 mL distilled water, filtered through a
membrane filter with 0.22 μm pore size, and stored at −20 °C.
20. The stock solution containing 1 mg/mL RNase is prepared by
dissolving 10 mg RNase in 10 mL distilled water, filtered
through a 0.22 μm membrane filter, incubated at 90 °C for
15 min, and stored at −20 °C.
21. The negative correlation between the ploidy and the content
of naphtodianthrones seems to be due to an increasing
44 Katarína Bruňáková and Eva Čellárová

biomass in polyploids but genetically conserved number of

multicellular nodules, which are the hypericin-accumulating
structures in the leaves, flowers, and stems regardless of ploidy
[12]. Therefore, the determination of the chromosome num-
ber followed by the flow cytometric evaluation of the ploidy
level should be an inevitable part of the experimental design
aimed at the assessment of the secondary metabolite produc-
tion in the genus Hypericum.
22. All the plants analyzed for the content of hypericins were dip-
loid: 2n = 2x = 14 or for H. rumeliacum, 2n = 2x = 16 for H.
perforatum, H. humifusum, H. annulatum, H. tomentosum,
and H. tetrapterum, and 2n = 2x = 18 for H. pulchrum (Fig. 2).
23. The lyophilization is also a suitable method for drying the
plant material.
24. The extraction procedure is performed according to [27].
25. Hypericin is a lipophilic molecule sparingly soluble in nonpolar
organic solvents, aqueous solutions, and oil. The unstable
behavior of hypericin and pseudohypericin that are sensitive to
oxidation is caused by the exposure to the light and air.
Therefore, isolation and handling of the extracts should be car-
ried out as fast as possible. It is recommended storing the
extracts at most for 2 h before analyses. The extracts should be
kept in the dark.
26. The HPLC analytical method is performed according to (30)
with minor modifications.
27. The pH of the mobile phase consisted of 10 % (v/v) ACN and
is equilibrated to pH = 2.7 using 25 % trifluoroacetic acid
(TFA).
28. Add 1 mg hypericin powder to the 5 mL volumetric flask and
raise the volume to 5 mL with methanol preparing the hyperi-
cin stock solution. Similarly, the stock solution containing
50 μg/mL emodin is prepared by dissolving 1 mg emodin in
20 mL methanol. Both standard solutions should be stored at
4 °C in the dark.
29. Hypericins are well distinguished by their characteristic UV
spectra [27] at the retention time 4.2 min for protopseudohy-
pericin, 4.6 min for pseudohypericin, 6.8 min for protohyperi-
cin, 7.4 min for hypericin, and 4.5 min for emodin. The
modification of the HPLC method used for analyzing naphto-
dianthrones in H. perforatum separates hypericin from pseu-
dohypericin; the chromatograms also show the fully resolved
peaks for protopseudohypericin and protohypericin (Fig. 3).
The method is applicable to assess the hypericin content in
untreated (control) plants as well as regenerants after cryo-
preservation in all Hypericum species used in this study. The
 Shoot Tip Meristem Cryopreservation of Hypericum Species 45

nearly threefold increase in hypericins in shoots regenerated

from the cryopreserved shoot tip meristems in H. perforatum
(Fig. 3a, b) and H. rumeliacum (Fig. 3c, d) is shown.
30. As pseudohypericin presents the same UV spectrum as hyperi-
cin, this compound can be quantified according to the hyperi-
cin calibration curve which is also suitable for the assessment of
the amount of protopseudohypericin and protohypericin [27].

Acknowledgement

This work was supported by the Slovak Research and Development

Agency under contracts No. APVV 0040-10 and SK-BG 0012-10
and the Scientific Grant Agency of the Slovak Ministry of Education
No. 1/142/11.

References
1. Crockett SL, Robson NKB (2011) Taxonomy using metabolite inhibitors and suppression
and chemotaxonomy of the genus Hypericum. subtractive hybridization. C R Biol
Med Aromat Plant Sci Biotechnol 5:1–13 337:571–580
2. Nahrstedt A, Butterweck V (1997) Biologically 8. Poutaraud A, Di Gregorio F, Tin VCF,
active and other chemical constituents of the Girardin P (2001) Effect of light on hypericins
herb of Hypericum perforatum L. Pharmaco contents in fresh flowering top parts and in an
psychiatry 30:129–134 extract of St. John’s Wort (Hypericum perfora-
3. Roscetti G, Franzese O, Comandini A, tum). Planta Med 67:254–259
Bonmassar E (2004) Cytotoxic activity of 9. EP (2008) European pharmacopoeia, vol 2,
Hypericum perforatum L. on K562 erythro- 6th edn. Council of Europe, Strasbourg,
leukemic cells: differential effects between France, p S2958
methanolic extract and hypericin. Phytother 10. Bruni R, Sacchetti G (2009) Factors affecting
Res 18:66–72 polyphenol biosynthesis in wild and field-
4. Meruelo D, Lavie G, Lavie D (1988) grown St. John’s Wort (Hypericum perforatum
Therapeutic agents with dramatic antiretrovi- L. Hypericaceae/Guttiferae). Molecules 14:
ral activity and little toxicity at effective doses: 682–725
Aromatic polycyclic diones hypericin and pseu- 11. Čellárová E, Kimáková K, Brutovská R (1992)
dohypericin. Proc Natl Acad Sci U S A Multiple shoot formation and phenotypic
85:5230–5234 changes of R0 regenerants in Hypericum perfo-
5. Dall’Agnol R, Ferraz A, Bernardi AP, Albring ratum L. Acta Biotechnol 12:445–452
D, Nör C, Sarmento L, Lamb L, Hass M, von 12. Čellárová E, Brutovská R, Daxnerová Z,
Poser G, Schapoval EES (2003) Antimicrobial Bruňáková K, Weigel RC (1997) Correlation
activity of some Hypericum species. between hypericin content and the ploidy of
Phytomedicine 10:511–516 somaclones of Hypericum perforatum L. Acta
6. Hammer KDP, Hillwig ML, Solco AKS, Dixon Biotechnol 17:83–90
PM, Delate K, Murphy PA, Wurtele ES, Birt 13. Koperdáková J, Košuth J, Čellárová E (2007)
DF (2007) Inhibition of prostaglandin E2 Variation in the content of hypericins in four
production by anti-inflammatory Hypericum generations of seed progeny of Hypericum per-
perforatum extracts and constituents in foratum somaclones. J Plant Res 120:123–128
RAW264.7 mouse macrophage cells. J Agric 14. Petijová L, Bruňáková K, Zámečník J, Zubrická
Food Chem 55:7323–7331 D, Mišianiková A, Kimáková K, Čellárová E
7. Pillai PP, Nair AR (2014) Hypericin biosyn- (2014) Relation between frost tolerance and
thesis in Hypericum hookerianum Wight and post-cryogenic recovery in Hypericum spp.
Arn: investigation on biochemical pathways Cryo Letters 35:171–179
46 Katarína Bruňáková and Eva Čellárová

15. Bruňáková K, Petijová L, Zámečník J, Bromus inermis Leyss and Medicago sativa
Turečková V, Čellárová E (2015) The role of L. Plant Physiol 83:423–427
ABA in the freezing injury avoidance in two 22. Petijová L, Skyba M, Čellárová E (2012)
Hypericum species differing in frost tolerance Genotype-dependent response of St. John’s
and potential to synthesize hypericins. Plant wort (Hypericum perforatum L.) shoot tips to
Cell Tiss Organ Cult 122:45–56 cryogenic treatment: effect of pre-culture con-
16. Murashige T, Skoog F (1962) A revised medium ditions on post-thaw recovery. Plant Omics
for rapid growth and bio assays with tobacco J 5:291–297
tissue cultures. Physiol Plant 15:473–497 23. Chanson A, Pilet PE (1982) Transport and
17. Gamborg OL, Miller RA, Ojima K (1968) metabolism of [2-14C] abscisic acid in maize
Nutrient requirements of suspension cultures root. Planta 154:556–561
of soybean root cells. Exp Cell Res 24. Bruňáková K, Zámečník J, Urbanová M,
50:151–158 Čellárová E (2011) Dehydration status of
18. Nishizawa S, Sakai A, Amano Y, Matsuzawa T ABA-treated and cold-acclimated Hypericum
(1993) Cryopreservation of asparagus perforatum L. shoot tips subjected to cryo-
(Asparagus officinalis L.) embryogenic suspen- preservation. Thermochim Acta 525:62–70
sion cells and subsequent plant regeneration 25. Brutovská R, Kušniriková P, Bogyiová E,
by vitrification. Plant Sci 91:67–73 Čellárová E (2000) Karyotype analysis of
19. Loureiro J, Rodriguez E, Doležel J, Santos C Hypericum perforatum L. Biol Plant
(2007) Two new isolation buffers for plant 43:133–136
DNA flow cytometry: a test with 37 species. 26. Taniguchi K (1996) Plant chromosomes at
Ann Bot 100:875–888 metabolis phase. In: Fukui K, Nakayama S
20. Murín A (1960) Substitution of cellophane for (eds) Plant chromosomes: laboratory meth-
glass covers to facilitate preparation of ods. CRC Press, USA
permanent squashes and smears. Stain Technol 27. Tolonen A, Hohtola A, Jalonen J (2003) Fast
35:351–353 high-performance liquid chromatographic
21. Reaney MJT, Gusta LV (1987) Factors influ- analysis of naphthodianthrones and phloroglu-
encing the induction of freezing tolerance by cinols from Hypericum perforatum extracts.
abscisic acid in cell suspension cultures of Phytochem Anal 14:306–309
 Chapter 4

Protocols for Biotechnological Interventions

in Improvement of Vanilla (Vanilla planifolia Andrews.)
Minoo Divakaran, K. Nirmal Babu, and K.V. Peter

Abstract
Vanilla (Vanilla planifolia Andrews (syn. V. fragrans Salisb.), a native of Central America, is the primary
source of natural vanillin and plays a major role in the global economy. The gene pool of vanilla is threat-
ened by deforestation and overcollection that has resulted in disappearance of natural habitats and wild
species. Continuous vegetative propagation and lack of natural seed set and sufficient variations in the
gene pool hamper crop improvement programs. In vitro techniques, one of the key tools of plant
biotechnology, can be employed for overcoming specific problems, viz. production of disease-free clones,
inducing somaclonal variations, developing hybrids, gene pool conservation, incorporating desired traits
by distant hybridization, genetic engineering, etc. However, realization of these objectives necessitates
standardization of protocols. This chapter describes the various protocols optimized for crop improve-
ment in Vanilla species.

Key words Artificial seeds, Cryopreservation, Embryo rescue, In vitro conservation, Micropropagation,
Plant regeneration, Seed culture, Somaclones, Vanilla

Abbreviations
BA Benzyl adenine
IBA Indole-3-butyric acid
Kin Kinetin
NAA α-Naphthalene acetic acid

1 Introduction

[Vanilla planifolia Andrews (syn. V. fragrans Salisb.)], the fer-

mented and cured fruit of the orchid V. planifolia used extensively
in the flavor industry, is an important crop in the flavor industry
and a commercially important orchid spice. It is also used in per-
fumery and to some extent in medicine as a nerve stimulant.
The fragrance and flavor of vanilla beans are mainly due to vanillin.

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_4, © Springer Science+Business Media New York 2016

47
48 Minoo Divakaran et al.

The highly purified vanillin is widely used as a chemical intermedi-

ate in the synthesis of numerous pharmaceutical products [1].
Vanilla is by gram weight the world’s most valuable spice crop and
is widely employed as a flavor ingredient.
The vanilla fruit is special for many reasons, including that it is
one of the few fruit crops that combines a natural image with a high
socioeconomic value due to its traditional and sustainable mode of
production and process. Various biotechnological approaches like
micropropagation, somaclonal variation, in vitro conservation, syn-
seed technology, protoplast technology, production of flavor and
coloring components, and development of novel transgenics have
great significance in conservation, utilization, and increasing the
production and productivity of spices. Breeding of improved and
new vanilla cultivars with desirable traits like producing higher
quality fruits consistently that are resistant to biotic (fungi, viruses)
and abiotic stress (drought and heat) will significantly increase the
income that small-holder vanilla farmers can receive for their harvest.
These changes are critical for survival of vanilla cultivation and the
industry, especially with the threat of a Fusarium pandemic that is
destroying vanilla vines and jeopardizing world vanilla production,
and in the face of the accelerated threat of global warming that has
already affected the timing of Vanilla planifolia flowering and
impacted successful fertilization [2].
Although cultivated throughout the tropics, its natural popu-
lations in South Mexico—the most critical sources of novel genetic
diversity—are on the verge of disappearance [3]. The rapid destruc-
tion of vanilla natural habitats has compelled to search for alternate
methods of conservation, multiplication, and genetic variability. In
addition, a great threat of losing vanilla plantations is looming due
to common diseases of fungal origin, viz. foot rot and wilting
caused by Phytophthora meadii, Fusarium oxysporum, Calospora
vanillae, and Sclerotium rot, and lack of genetic diversity in the
available gene pool [4].
Continuous vegetative propagation, lack of natural seed set
and sufficient variations, diseases, and absence of disease-tolerant
species in the gene pool hamper crop improvement programs. In
vitro culture is an important tool of plant biotechnology, which
can be employed for overcoming specific problems, viz. production
of disease-free clones, inducing somaclonal variations, developing
hybrids, gene pool conservation, in vitro gene banks, incorporating
desired traits into cultivated vanilla, etc. These objectives can be
accomplished with the standardization of simple protocols. This
chapter describes the various protocols optimized for crop
improvement in Vanilla species [3, 5]. Cryopreservation of pollen
will help to overcome the availability of viable pollen due to asyn-
chronous flowering for interspecific hybridization while conserv-
ing the haploid gene pool. This protocol describes an efficient
plant regeneration system, a prerequisite to exploiting somaclonal
 Protocols for Biotechnological Interventions in Improvement of Vanilla… 49

variation, in vitro selection, development of novel genotypes

through transgenic pathway, etc., which was extended to micro-
propagate diverse Vanilla species overcoming the species/clonal
specific nature of various protocols.

2 Materials

2.1 In Vitro Appropriate tissues are chosen as explants, from field-grown vines
Propagation of different Vanilla species, viz. Vanilla planifolia (Fig. 1), V.
andamanica, V. aphylla, and V. pilifera, for achieving desired
2.1.1 Explant Materials
objectives. Nodal segments and shoot tips for micropropagation,
pollen for hybridization, seeds for generating segregating proge-
nies, and interspecific hybrids were chosen.

2.2 Glassware Borosilicate conical flasks (500 mL), glass bottles (250 mL), cul-
ture tubes (22 cm × 3.5 cm), and 250 mL conical flasks.

2.3 Growth Auxins—α-naphthalene acetic acid (NAA), indole-3-butyric acid

Regulators (IBA) 0–3.0 mg/L; cytokinins—6-benzylaminopurine (BA) and
6-furfurylamino purine (kinetin) (Sigma Chemicals) 0–3.0 mg/L.

2.4 Gelling Agents Bacteriological grade agar, 7.0 g/L.

2.5 Culture Medium 1. Murashige and Skoog (MS) [6] basal medium (Table 1).
2. Stocks solutions for macronutrients, micronutrients, vitamins,
amino acids, and plant growth regulators (Table 1).
3. Sucrose 20–30 g/L.
4. Adjust pH to 5.8 before adding agar, melt agar in microwave
oven before adding to the medium, and autoclave the media at
121 °C at 16 psi for 20 min.

Fig. 1 Vanilla vine with pods

50 Minoo Divakaran et al.

Table 1
Composition and stock concentration of Murashige and Skoog (MS) medium

Actual quantity per Volume of stock

Sl. Std liter of stock solution solution per
No. Ingredients mg/L (g) liter of medium
1. Macroelements
Ammonium nitrate NH4NO3 1650 33 50 mL/L
Potassium nitrate KNO3 1900 38
Magnesium sulfate MgSO4 370 7.4
Potassium dihydrogen KH2PO4 170 3.4
ortho phosphate CaCl2 330 6.6
Calcium chloride
2. Microelements
Potassium iodide KI 0.83 0.0415 10 mL/L
Boric acid H3BO3 6.2 0.318
Manganese sulfate MnSO4 22.3 1.115
Zinc sulfate ZnSO4 8.6 0.43
Sodium molybdate Na2MoO4 0.25 0.125
Copper sulfate CuSo4 0.025 0.000125
Cobalt chloride CoCl2 0.025 0.000125
3. Vitamins
Nicotinic acid C6H5NO2 0.5 0.025 10 mL/L
Pyridoxine HCl C8H12NO3HCL 0.5 0.025
Thiamine C12H17ClN4O5 0.1 0.005
Glycine C2H5NO2 2.0 0.1
4. Iron source
Iron sulfate FeSO4 27.8 1.3952 10 mL/L
Sodium EDTA Na2EDTA 37.3 1.865
5. Meso inositol C6H12O6 100 5 10 mL/L
Dissolve each constituent separately before mixing to the final stock

2.6 Incubation Incubate cultures at 22 ± 2 °C and with 14-h photoperiod,

Conditions 35 μmol/m2/s, light provided by “Philips” cool white fluorescent
tubes.

2.7 In Vitro 1. In vitro conservation: Use in vitro-regenerated shoot buds as

and Cryopreservation propagules for conservation by slow growth induction.
2. Production of synthetic seeds: Use in vitro-regenerated shoot
buds, protocorms, and callus for encapsulation. Sodium alginate
and calcium chloride for preparation of synthetic seeds.
3. Long-term storage by cryopreservation: Synseeds containing
miniaturized shoot tips, protocorms, pollen, and liquid nitrogen.
 Protocols for Biotechnological Interventions in Improvement of Vanilla… 51

3 Methods

3.1 In Vitro Seed 1. Collect 4–7-month-old mature pods, and surface sterilize under
Germination laminar airflow by dipping in 95 % ethanol and flaming it.
and Embryo Rescue 2. Split open capsules to remove seeds and transfer them to steril-
[4, 7, 8] ized culture medium.
3. Both solid and liquid media can be used for seed germination
and culture; MS-solidified medium supplemented with
0.5 mg/L kinetin, 20 g/L sucrose; and continuously rotate
liquid cultures on a rotary shaker at 200 rpm.
4. Transfer germinating seeds to multiplication medium, MS
medium supplemented with 1 mg/L BA and 0.5 mg/L IBA
(Fig. 2).

3.2 Micropropagation 1. Healthy vines of different species are identified as mother

and Multiplication plants for source material collection, from which shoot tips and
of True-To-Type nodal segments are utilized for all experiments. In the authors’
Plants [4, 9] laboratory, V. planifolia, V. aphylla, V. pilifera, and V. anda-
manica vines were included.
2. Explants should be washed and cleaned with a dilute detergent
solution, e.g., teepol (100 mL/L), and then transferred to the
laminar flow chamber for surface sterilization with 1 g/L mer-
curic chloride for 5–7 min.
3. A fresh basal cut is made after thorough washing with sterilized
double-distilled water (to remove any traces of mercuric chlo-
ride), before inoculation into MS medium supplemented with
1 mg/L BA and 0.5 mg/L IBA.
4. Subcultures to the fresh culture medium of same composition
every 20-day interval should be done to replenish exhausted
nutrients. Incubate cultures at 22 ± 2 °C and with a photope-
riod of 14 h and an irradiance of 35 μmol/m2/s, provided by
“Philips” cool white fluorescent tubes.
5. An initial period of 5–7 months is needed for culture establish-
ment, bud initiation, and multiple shoot induction in the
explants before they start multiplying in a 1:12 ratio (Fig. 3).

Fig. 2 Initiation of germination from minute black seeds, indirect and direct seed germination
52 Minoo Divakaran et al.

Fig. 3 Induction of multiple shoots and subsequent proliferation

Fig. 4 Root induction from the base as well as from the nodes

3.3 In Vitro Rooting 1. Vanilla is known to produce roots in all nodes and in vitro
and Production behavior is no different; hence a specific stage or medium is
of Plantlets not required for in vitro rooting in vanilla (Fig. 4).
2. Separate 2.0 cm long shoots from the multiplying clusters,
individually to MS medium devoid of plant growth regulators.
The rooting initiates from the third day of shoot culture.
3. Each well-rooted shoot (as mentioned below) can be trans-
ferred for next cycle of multiplication or planted out to the
field.
4. For next cycle of shoot multiplication, re-culture 2 cm long
shoots or single nodes by cutting shoots having 2–3 nodes.

3.4 Callus Induction 1. Any explants, derived from in vitro shoots, roots, or proto-
and Creating corms, can be utilized for callus induction.
Variability 2. Inclusion of auxin and cytokinin in the basal MS medium is
desirable for dedifferentiation of explants into callus. MS
medium containing 1 mg/L BA and 0.5 mg/L NAA is ideal
for all the species.
 Protocols for Biotechnological Interventions in Improvement of Vanilla… 53

Fig. 5 Different stages in plant regeneration from callus

3. Some of the explants, especially seeds and protocorms, need an

initial incubation in the dark for 2–5 days for callus induction.
4. Once initiated, subculture callus cultures to fresh culture
medium of same composition at every 3-week interval.

3.5 Plantlet 1. Transfer proliferating callus to MS medium supplemented with

Regeneration 1 mg/L BA and 0.5 mg/L IBA, for re-differentiation.
via Direct and Indirect Subculture callus onto the fresh same culture medium at
Pathways [4] 3-week interval.
2. Callus re-differentiates into protocorms and shoots with roots
in about 3–6-month time (Fig. 5).
3. Subculture callus on the same proliferation medium for main-
taining callus and utilize later for regeneration or isolation of
protoplasts. The well-developed shoots with roots are trans-
ferred ex vitro, for hardening and planting out.

3.6 Artificial Seed 1. Propagules, viz. in vitro-developed protocorms or shoot buds

Production [4] (0.5–1.0 cm), are dropped in a gel matrix of MS medium con-
taining 4 % sodium alginate (4 % w/v, Sigma).
2. Pipette out the gel matrix containing explants into calcium chlo-
ride (CaCl2·2H2O) solution (1.036 g/150 mL) using a Pasteur
pipette with a cut end for easy passage of propagules, such that
each drop that transforms into a bead contains one explant.
3. Leave explants in CaCl2·2H2O solution for 30–40 min, shaking
on a gyratory shaker (100 rpm) for proper bead formation.
4. The beads are recovered by decanting CaCl2 solution and wash
them in sterile water two times (Fig. 6).
5. The artificial/synthetic seeds or “synseeds” thus produced can
be utilized for germplasm conservation and as propagules with
more than 80 % germination rate at 22 ± 2 °C.
6. Whenever needed transfer synthetic seeds for germination in
multiplication medium (MS medium amended with 1 mg/L
BA and 0.5 mg/L IBA).
54 Minoo Divakaran et al.

Fig. 6 Synthetic seed production

3.7 Hardening 1. In vitro plantlets with well-developed roots are washed under
and Planting Out running water to remove the traces of nutrient medium on the
roots. Care should be taken to prevent any damage to roots
while cleaning roots, but remove all medium to prevent micro-
bial growth.
2. Dip them in 0.3 % Dithane-M45 for 5–10 min and transplant
in poly bags containing a mixture of garden soil, sand, and
vermiculite in equal proportions (1:1:1).
3. Keep the transplanted plantlets in a humid chamber (relative
humidity 70–80 % and light intensity 25–30 μmol/m2/s) for
3–4 weeks for hardening and establishment. Keep hardened
plants in the nursery for 1 year and finally transfer to the field.

3.8 In Vitro 1. Induce slow growth in vanilla shoots by reducing the carbon
Conservation source, reducing basal media concentration, adding mannitol,
of Vanilla Genetic and minimizing evaporation loss to increase subculture inter-
Resources [9, 10] vals substantially.
3.8.1 Medium-Term
2. Transfer in vitro-grown vanilla shoots (2 cm long) to MS
In Vitro Conservation
medium containing 15 g/L sucrose and mannitol, respectively,
by Slow Growth
without plant growth regulators.
3. Seal the culture vessels with polypropylene caps or parafilm to
minimize evaporation and maintain them at 22 ± 2 °C, 12-h
photoperiod, with reduced light intensity of 30 μmol/m2/s.
4. These shoot cultures with minimal growth can be maintained
in vitro for 7–10 years with yearly subculture on the fresh
medium (Fig. 7).
5. For normal growth, transfer plantlets in MS medium contain-
ing 1.0 mg/L BA and 0.5 mg/L IBA, 22 ± 2 °C and light
intensity of 35 μmol/m2/s.
 Protocols for Biotechnological Interventions in Improvement of Vanilla… 55

Fig. 7 In vitro conservation by slow growth. (The shorter shoots indicate minimal
growth with root system while the longer shoots show growth in normal medium
requiring frequent subcultures)

3.8.2 Long-Term Storage 1. Choose uniform-sized synthetic seeds (4–5 mm diameter) for
of Encapsulated Shoot Tips cryopreservation.
and Pollen
2. Pre-culture synseeds on MS liquid medium amended with
by Cryopreservation
increasing sucrose concentrations (0.1, 0.3, 0.5, 0.7, and
Pretreatment 1.0 M) for 5 days, with 1 day for each concentration, and then
and Dehydration dehydrate in a laminar airflow chamber at room temperature
by spreading on a sterilized filter paper for 1–10 h.
3. Germination tests were conducted to determine optimum
drying time.

Cryopreservation 1. Transfer ten dehydrated beads per 2.0 mL cryo vials.

2. Rapid freezing is done by plunging the cryo vials directly in the
liquid nitrogen.
3. Samples can be stored in liquid nitrogen for 10 years.
56 Minoo Divakaran et al.

Thawing, Post-culture, 1. Cryopreserved samples are retrieved by immersing vials for

and Regeneration 5–10 min directly in a water bath at 40 °C.
of the Whole Plant 2. The synseeds are cultured in a 90 mm petri dish containing
25 mL solidified MS medium containing 30 g/L sucrose,
1 mg/L BAP, and 0.5 mg/L IBA in the darkness initially for 7
days and then provided with a light intensity of 3000 lux for
shoots to grow. The recovery rate is 50–70 %.
3. After 2 weeks, shoot buds that emerge out from the synthetic
seed coat are subcultured on the fresh MS basal medium for
proper growth of the shoot and root system and finally plant
them for hardening and field transfer.

3.9 Pollen 1. Collect pollinia on the previous day of flower opening.

Cryopreservation 2. Culture pollen on Brewbaker and Kwack (BK) medium [11]
for Utilization in and different sucrose concentrations (5–15 %) to assess germi-
Interspecific nation and 10 % sucrose provided the most appropriate osmotic
Hybridization between potential for rapid pollen germination for the species of Vanilla
Asynchronously studied (Fig. 8). Germination counts of pollen are made after
Flowering Species 18–24 h and incubation at 25 °C in the dark.
[11, 12] 3. Cryostorage of pollen: Pollinia were subjected to different pre-
treatments, like desiccation in laminar airflow cabinet for
5–15 min and desiccation combined with chemical cryopro-
tection with 5 and 10 % of dimethyl sulfoxide (DMSO).
4. Transfer the pretreated pollen samples to cryovials and plunge
into liquid nitrogen (LN2).

Fig. 8 The different Vanilla species included in the study

 Protocols for Biotechnological Interventions in Improvement of Vanilla… 57

Fig. 9 Pollen germination in V. planifolia

5. Thaw the cryopreserved pollen by rapid thawing process by

dipping the cryovial in 40 °C water bath for 30 min after cryo-
genic storage.
6. Viability of fresh and cryopreserved pollen samples is assessed
by germination in vitro, by culturing in Brewbaker’s medium
(Fig. 9).
7. Flowers, of the desired female parent, are emasculated.
Cryopreserved pollen of another species, after thawing, is
applied on the receptive stigma. Pollinated flowers and fruit set
are marked (Fig. 10).
8. Harvest the fruits after 2–4 months and culture the seeds in
vitro, to prevent any embryo abortion.

3.10 Isolation 1. Digest leaf tissue with a mixture of macerozyme and cellulose,
of Protoplasts using one-step method of enzyme digestion.
for Somatic 2. Prepare enzyme solution in cell protoplast washing (CPW)
Hybridization [13] medium.
3. Add mannitol to maintain the osmotic strength of cytoplasm
and to prevent plasmolysis or bursting of the protoplasts.
4. Incubate leaves in CPW medium with mannitol for
pre-plasmolysis.
5. Immerse 1 g of mechanically macerated leaves from in vitro-
cultured plants in 10 mL isolation medium and incubate in the
darkness for up to 16 h.
58 Minoo Divakaran et al.

Fig. 10 Successful interspecific hybridization

6. After digestion, filter the enzyme solution containing proto-

plasts through a stainless steel mesh (60 mesh size, Sigma) to
remove larger particles of undigested tissues and cell clumps.
7. Observe sample under inverted microscope to confirm
enzymatic digestion and release of protoplasts.
8. Distribute filtrate into sterilized, screw-capped centrifuge tubes
and centrifuge in Beckman tabletop centrifuge for 10 min at
700 rpm.
9. Remove the supernatant enzyme solution using a Pasteur
pipette without disturbing the pellet. Suspend the pellet
(containing protoplasts) in CPW medium.
10. Repeat centrifugation and resuspension in fresh medium three
times so as to wash the protoplasts and remove traces of enzyme
solution, and then resuspend the pellet in 1 mL CPW medium
(Table 2) and layer on top of 9 mL floatation medium, to
centrifuge at 700 rpm for 10 min.
11. Collect live protoplasts at the interphase, with a Pasteur pipette.
12. Add two droplets of protoplast suspension each from Vanilla
planifolia and V. andamanica to another droplet of PEG solu-
tion (Table 3), and allow to mix at room temperature for
30 min.
13. Maintain as droplet cultures on glass slides and periodically
observe for fusion of protoplasts (Fig. 11), cell wall regenera-
tion, and cell division.
 Protocols for Biotechnological Interventions in Improvement of Vanilla… 59

Table 2
Composition of media used for protoplast isolation and culture in vanilla

Components (mg/L) CPW medium Floating media (mg/L) Protoplast culture media (mg/L)
(mg/L)
I II
NH4NO3 – – 1650 1650
KNO3 101.0 101.0 1900 1900
CaCl2·2H2O 1480.0 1480.0 440 440
MgSO4·7H2O 246.0 246.0 370 370
KH2PO4 27.2 27.2 170 170
KI 0.16 0.16 0.83 0.83
H3BO3 – – 6.2 6.2
MnSO4·4H2O – – 22.3 22.3
ZnSO4·7H2O – – 8.7 8.7
Na2MoO4·2H2O – – 0.25 0.25
CuSO4·5H2O 0.025 0.025 0.025 0.025
CoCl2·6H2O – – 0.025 0.025
FeSO4·7H2O – – 27.8 27.8
Na2EDTA·2H2O – – 37.3 37.3
Myoinositol – – 100.0 100.0
Nicotinic acid – – 0.5 0.5
Thiamine HCl – – 0.5 0.5
Pyridoxine HCl – – 0.5 0.5
Glycine – – 2.0 2.0
Sucrose – 21 % 2% 3%
Mannitol 7–10 % – 7% 4%
Gibberellic acid – – 0.5 0.5
BA – – 0.5 1.0
NAA – – 0.5 1.0
2,4-D – – 0.5 –

3.11 Isolation of DNA 1. Isolation of DNA: The CTAB method [13] was used for the
for Molecular Profiling isolation of genomic DNA from vanilla leaf tissue.
[14] 2. Prepare the stock solutions and buffers for DNA isolation fol-
lowing [14].
3. Develop RAPD profiles as per the method suggested by
Williams et al. [15].
60 Minoo Divakaran et al.

Table 3
Composition of PEG solutiona for protoplast fusion

Constituents Molar concentration (mM) g/L

NaCl 140 8.18
KCl 50 37
Na2HPO4 0.75 0.11
Glucose 5 0.90
CaCl2·2H2O 125 18.40
PEG (MW 4000) 400.00
a
pH was adjusted to 5.8

Fig. 11 Somatic hybridization between different species of Vanilla

4. The dNTPs, Taq polymerases, and other chemicals were pro-

cured from Sigma Aldrich, Germany.
5. Sixteen arbitrary primers were used for PCR reaction. Each
primer contained at least 60–70 % GC content and no self-
complementary ends.
6. PCR amplification reaction volumes were 25 mL PCR, each
containing the reagents added sequentially to 25 mL of assay
buffer—1, 150 mM dNTPs, 2 mM MgCl2, 1 U of Taq DNA
polymerase, 40 ng genomic DNA, and 10 pM primer.
7. Amplification employed a programmable thermal cycler (with
cycling regimes of an initial denaturation temperature of
Protocols for Biotechnological Interventions in Improvement of Vanilla… 61

94 °C for 5 min, followed by 33 repeats of a PCR core cycle

of 94 °C for 1 min, 40 °C for 1 min, and 72 °C for 1 min,
followed by a final extension cycle of 72 °C for 15 min.
8. Resolve amplicons electrophoretically alongside a 1 kb ladder,
on a 2 % agarose gel stained with 0.5 mg/mL ethidium bro-
mide in a 1 × TAE buffer. Equal volumes of the completed
reaction mix were loaded and run at 90 V for 3 h in an OWL
separating system.
9. The completed gel is documented with the help of GelDoc
1000 documentation system (Fig. 12). Test 20 arbitrary
10-mer primers and give 9 polymorphic and scorable amplified
products, and use for RAPD profiling, following the protocol
of Williams et al. [15].
10. Carry out duplicate amplification to confirm reliability of the
bands. Amplified products are listed as discrete character states
in a present (1) or absent (0) matrix.
11. Relationships among genotypes are evaluated with a phonetic
cluster analysis using the unweighted pair grouping mathe-
matical average (UPGMA) analysis and plotted in a pheno-
gram using NTSYS pc version 2.0j [16]. Consolidate
polymorphic loci, exhibited by the different genotypes, in a
chart to study the expressed loci of each genotype. Perform
Bootstrap analysis using WinBoot [17] with 1000 repetitive
sampling using Dice’s coefficient, of the data to compute
bootstrap P values.

Fig. 12 RAPD profiles of interspecific hybrids of vanilla using OPERON primer

OPB20
62 Minoo Divakaran et al.

4 Notes

1. While flaming pods, the process can be repeated to avoid

contamination and care should be taken to avoid any damage
to seeds that may have an adverse affect on seed viability.
2. Contaminated liquid culture should be completely discarded
and autoclave it before throwing away. Hence for embryo
rescue and in case of interspecific hybridization solid medium
helps in saving unaffected seeds.
3. Most vanilla stocks are infected with one or more viruses.
Therefore, use virus diagnostic kits (ELISA/RT-PCR) to
detect virus-infected stock plants.
4. Make sure that the stock plant material is completely virus free.
5. Seeds germinate directly into plantlets in the medium supple-
mented with BA (0.5 mg/L) alone, without any intervening
callus phase; hence this medium was selected for the germina-
tion of vanilla seeds.
6. Germinating seeds, axillary buds, and shoots produced multiple
shoots when cultured on MS medium supplemented with BA
(1 mg/L) and IBA (0.5 mg/L).
7. Indirect plant regeneration via callus was induced in MS
medium fortified with NAA (0.5 mg/L) and BA (1.0 mg/L)
in which 75 % of the cultures developed callus.
8. When full-strength MS medium containing 30 g/L sucrose is
used for in vitro conservation experiments, shoot cultures
grow rapidly and within 180 days culture vessels are full of
shoots; medium is exhausted; and shoot cultures dry up. For
preventing this condition, modify culture medium with
reduced sucrose concentration (10–15 mg/L) and half-
strength nutrients, and add mannitol (10–15 mg/L). This
change would result in reduced shoot growth rate (2–3 cm in
360 days) and highest survival rate of at least 80 %.
9. In vitro-regenerated shoot buds, protocorms, and regenerat-
ing calli could be encapsulated in 4 % sodium alginate and
stored in sterile water for 10 months, at 22 ± 2 °C. When
cultured on MS medium supplemented with BA (1 mg/L)
and IBA (0.5 mg/L), the synthetic seeds germinated (80 %)
after 2 weeks.
10. The pollen cryostorage described is under Indian conditions,
the moisture content of pollinia may vary in different climatic
conditions; hence it should be standardized before proceeding
for actual use in hybridization experiments.
11. Among the different treatments tried all the pollen samples
survived freezing with maximum percentage of germination in
pollen desiccated for 5 min in the air current of laminar flow
and cryoprotected with 5 % DMSO.
 Protocols for Biotechnological Interventions in Improvement of Vanilla… 63

12. The experiments conducted are in Vanilla planifolia and few

of its related species (Fig. 7).
13. Protoplasts were successfully isolated from the two species
when incubated in an enzyme solution containing macero-
zyme R10 (0.5 %) and cellulase Onozuka R10 (2 %) for 8 h at
30 °C in the dark. The protoplast yield was 2.5 × 105 per gram
and 1.0 × 105 g of leaf tissue and protoplast viability were 72 %
and 55 % in V. planifolia and V. andamanica, respectively.
14. The molecular profiles indicate variability among the seedlings
and species. Paired affinity indices were calculated to quantify
the variability which could be utilized for crop improvement
programs.

References
1. Purseglove JW, Brown EG, Green CL, Robbins 9. Divakaran M, Nirmal Babu K, Peter KV (2006)
SRJ (1981) Spices, vol 2, Tropical agricultural Conservation of Vanilla species - in vitro. Sci
series. Longman, New York, pp 644–735 Hortic 110:175–180
2. Sharman D. O’Neill, Spencer L, Alan Y, Garrett 10. Ravindran PN, Nirmal Babu K, Saji KV,
C, Ryan K, Henriette O’Geen, Monica TB, B Geetha SP, Praveen K, Yamuna G (2004)
Durbin-Johnson, Joseph F, Ian K, Juan HH, Aro Conservation of Spices genetic resources in in-
VR (2014) The Vanilla sustainability project: vitro gene banks. ICAR Project report. Indian
genomics research on Vanilla planifolia for crop Institute of Spices Research, Calicut, Kerala,
improvement and sustainable agriculture. In: India, p 81
Abst international plant and animal genome con- 11. Brewbaker JL, Kwack BH (1963) The essen-
ference XXII, San Diego, CA, p 1160, Jan 2014 tial role of calcium ion in pollen germination
3. Lubinsky P (2003) Conservation of wild and pollen tube growth. Am J Bot 50:
vanilla. In: Proc. Vanilla 2003. 1st International 859–865
Congress, Princeton, NJ, 11–12 Nov 2003 12. Divakaran M, Pillai GS, Nirmal Babu K, Peter
4. Minoo D (2002) Seedling and somaclonal vari- KV (2008) Isolation and fusion of protoplasts
ation and their characterization in Vanilla. in Vanilla species. Curr Sci 94(1):113–118
Ph.D Thesis, Calicut University, Kerala, India 13. Ausubel FM, Brent R, Kingston RE, Moore
5. Cervera E, Madrigal R (1981) In vitro propa- DD, Seidman JG, Smith JA, Smith K (1995)
gation (Vanilla planifolia A.). Environ Exp Current protocols in molecular biology, vol 1.
Biol 21:441 Wiley, NY, pp 231–237
6. Murashige T, Skoog F (1962) A revised medium 14. Sambrook J, Fritsch EF, Maniatis T (1989)
for rapid growth and bioassays with tobacco tis- Molecular cloning: a laboratory manual. Cold
sue cultures. Physiol Plant 15:473–497 Spring Harbor Laboratory Press, Cold Spring
7. Divakaran M, Nirmal Babu K, Ravindran PN, Harbor, NY
Peter KV (2006) Inter specific hybridization in 15. Williams JGK, Kubelik AR, Livak RJ, Rafalski JA,
vanilla and molecular characterization of Tingey SV (1990) DNA polymorphism amplified
hybrids and selfed progenies using RAPD and by arbitrary primers are useful as genetic markers.
AFLP markers. Sci Hortic 108:414–422 Nucleic Acids Res 8:6531–6535
8. Minoo D, Sajina A, Nirmal Babu K, Ravindran 16. Rohlf FJ (1997) NTSYS-pc numerical taxon-
PN (1997) Ovule culture of vanilla and its omy and multivariate analysis system version
potential in crop improvement. In: Edison S, 2.0. Exeter Publications, New York
Ramana KV, Sasikumar B, Nirmal Babu K, 17. Yap IV, Nelson RJ (1996) WinBoot: a program
Eapen SJ (eds) Biotechnology of spices, for performing analysis of binary data to deter-
medicinal and aromatic plants. Indian Society mine the confidence limits of UPGMA-based
for Spices, Calicut, India, pp 112–118 dendrograms. IRRI, Philippines
 Chapter 5

Assessment of In Vitro Biological Activities

of Anthocyanins-Rich Plant Species Based on Plinia
cauliflora Study Model
Heloisa S. Pitz, Adriana C.D. Trevisan, Fausto R. Cardoso,
Aline Pereira, Eduardo L.G. Moreira, Manuel A. de Prá,
Letícia Mazzarino, Maria B. Veleirinho, Rosendo A. Yunes,
Rosa M.R. do Valle, and Marcelo Maraschin

Abstract
Plinia cauliflora (jaboticaba) is a native fruit tree from Brazilian rainforest widely used in popular medicine
to prevent diarrhea, asthma, and infections. Studies have shown that the major therapeutic potential of
jaboticaba fruits is on its peel, a rich source of anthocyanins. These secondary metabolites have well-known
antioxidant and anti-inflammatory activities and have been claimed to be effective to treat diabetes, cancer,
cardiovascular diseases, and stroke. This chapter describes a series of methodologies to evaluate important
in vitro biological activities like cytotoxicity, proliferation, and migration of a hydroalcoholic extract of
jaboticaba peel on mouse fibroblast L929 line. Assays to assess total phenolic, flavonoid, and anthocyanin
contents and antioxidant activities are described as well.

Key words Plinia cauliflora, Phytochemistry, Phenolic compounds, Total flavonoids, Anthocyanins,
Biological activities, DPPH assay, MTT assay, Scratch assay, EdU assay

1 Introduction

The phytochemical analysis aims to study the chemical constituents

of plant species. When there is no chemical study on the species of
interest, the preliminary phytochemical analysis can indicate the
relevant groups of secondary metabolites in the sample material.
However, if the interest is restricted to a specific class of c­ ompounds
or substances responsible for a certain biological activity, research
should be directed to the structural elucidation and quantification
of those compounds, as well as their isolation [1].
Although thousands of compounds from plants and microor-
ganisms have already been determined, natural sources of s­ econdary
metabolites appear to be inexhaustible to medicinal chemistry [2].

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_5, © Springer Science+Business Media New York 2016

65
66 Heloisa S. Pitz et al.

The Plinia cauliflora species is a native fruit to Brazil, belonging

to the family Myrtaceae, popularly known as jaboticaba or jaboti-
caba-açu. It has been found in the Atlantic Rainforest, especially in
the southern and southeastern regions in Brazil [3]. The fruits are
usually consumed in natura, as liqueurs, wines, and jellies [4].
Chemically, jaboticaba is known as a source of tannins, vitamins
[5], and organic acids in the following order of amounts: ellagic
acid > citric acid > succinic acid > malic acid > oxalic acid > acetic acid [6].
There are many studies evaluating the biological activities of
extracts from different parts of the jaboticaba plant, e.g., leaves,
stem, bark, and seeds. The jaboticaba bark extract has shown
astringent properties and is widely used in the treatment of diar-
rhea, skin irritation, hemoptysis, and asthma, and gargled for
chronic inflammation of the tonsils [7–9]. Recent studies per-
formed in rats in a diet-induced obesity model showed that the
intake of jaboticaba bark extract decreased oxidative stress in tis-
sues, reduced circulating saturated lipids [10], increased HDL
cholesterol, and improved insulin resistance [11, 12]. On the other
hand, jaboticaba peel extract showed antiproliferative effects
against leukemic cells and prostate cancer cells [13].
Among the biological assays currently used to evaluate com-
plex matrices such as plant extracts, cytotoxicity and cell migration
and proliferation have been frequently adopted. For example,
fibroblast migration and proliferation are important steps in the
wound healing process, mainly for extracellular matrix formation
[14]. In vitro-positive results in tests evaluating these parameters
are evidence that the substance is effective to treat in vivo healing
problems.
In this context, this chapter describes a series of protocols for
the chemical analysis of the hydroalcoholic extracts of jaboticaba
fruit peels focusing on the determination of the total contents
of phenolic, flavonoid, and anthocyanin compounds. Besides, bio-
logical activity assays regarding the cytotoxicity and the cell migra-
tion and proliferation are also described using the mouse fibroblast
L929 cell line treated with hydroalcoholic extracts of jaboticaba.
For that, the MTT, scratch, and EdU assays were performed.

2 Materials

2.1 Collection 1. Jaboticaba (Plinia cauliflora) fruits were collected during the
and Preparation harvest season (spring, 2014) in Guaxupé county, Minas Gerais
of Biomass Samples state (southeastern Brazil), at a backyard format planting
system.
2. Pulper.
3. Distilled water.
4. Lyophilizer.
5. Grinder.
 Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 67

2.2 Extraction 1. Ethanol P.A.

Process 2. Distilled water.
3. 1 % Hydrochloric acid solution (v/v).
4. 50 % Ethanol solution (pH 3.6).
5. pH meter.
6. Analytical balance.
7. Microwave oven.
8. Cellulose membranes—pore size 14 μm ∅.
9. Vacuum filtration system.

2.3 Analysis 1. Ethanol P.A.

of Phenolic 2. Methanol P.A.
Compounds
3. Distilled water.
4. 95 % Methanol solution (v/v).
5. 95 % Ethanol solution (v/v).
6. 50 % Ethanol solution (pH 3.6—v/v).
7. 5 % Sodium carbonate solution (m/v).
8. 1 % Hydrochloric acid solution (v/v).
9. Folin-Ciocalteu phenol reagent.
10. Gallic acid standard.
11. Vortex.
12. Ultraviolet–visible (UV–Vis) spectrophotometer.

2.4 Analysis of Total 1. Ethanol P.A.

Flavonoids 2. Methanol P.A.
3. Distilled water.
4. 50 % Ethanol solution (pH 3.6—v/v).
5. 1 % Hydrochloric acid solution (v/v).
6. 2 % Aluminum chloride solution in methanol P.A. (m/v).
7. Quercetin standard.
8. Vortex.
9. Ultraviolet–visible (UV–Vis) spectrophotometer.

2.5 Analysis 1. Distilled water.

of Anthocyanins 2. 0.025 mol/L Potassium chloride buffer solution (pH = 1.0).
3. 0.4 mol/L Sodium acetate buffer (pH = 4.5).
4. Hydrochloric acid P.A.
5. 1 % Hydrochloric acid solution (v/v).
6. Volumetric flasks (1 L).
68 Heloisa S. Pitz et al.

7. Beakers (50 mL).

8. pH meter.
9. Ultraviolet–visible (UV–Vis) spectrophotometer.

2.6 Antioxidant 1. 2, 2-Diphenyl-2-picryl hydrazyl (DPPH).

Activity by DPPH 2. Methanol P.A.
Assay
3. Distilled water.
4. 80 % Methanol solution (v/v).
5. Volumetric flasks.
6. 96-well plates.
7. Vortex.
8. Ultraviolet–visible (UV–Vis) spectrophotometer.

2.7 MTT Assay 1. Mouse fibroblast L929 cell line.

2. Dulbecco’s modified Eagle’s medium (DMEM) supplemented
with 10 % fetal bovine serum (FBS—v/v), 1 % penicillin/­
streptomycin (m/v), 1 % l-glutamine (m/v), 1 % HEPES
(N-(2-­hydroxyethyl) piperazine-N′-(2-ethanesulfonic acid))
solution (m/v), 4.5 g glucose, 1.5 g sodium bicarbonate
(NaHCO3).
3. 96-Well plates.
4. 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bro-
mide—stock solution (5 mg/mL) in phosphate-buffered saline
(PBS, pH 7.2–7.6).
5. Dimethylsulfoxide (DMSO).

2.8 Scratch Assay 1. Mouse fibroblast L929 cell line.

2. DMEM supplemented with 10 % FBS (v/v), 1 % penicillin/
streptomycin (m/v), 1 % l-glutamine (m/v), 1 % HEPES
solution (m/v), 4.5 g glucose, 1.5 g sodium bicarbonate
­
(NaHCO3).
3. 24-Well plates.
4. 13 mm Circular cover slips.
5. Pipette tips.
6. PBS (pH 7.2–7.6).

2.9 Proliferation 1. Mouse fibroblast L929 cell line.

Assay 2. DMEM Gibco) supplemented with 10 % FBS (v/v), 1 % peni-
cillin/streptomycin (m/v), 1 % l-glutamine (m/v), 1 % HEPES
solution (m/v), 4.5 g glucose, 1.5 g sodium bicarbonate
(NaHCO3).
 Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 69

3. 24-Well plates.
4. PBS (pH 7.2–7.6).
5. 4 % Paraformaldehyde in PBS (m/v).
6. 0.5 % Triton® X-100 in PBS (v/v).
7. 1 % Bovine serum albumin (BSA) in PBS (pH 7.4) (m/v).
8. 0.1 % Tween 20 in PBS (v/v).
9. DMSO.
10. 13 mm Circular cover slips.
11. Deionized water.
12. EdU: Prepare stock solution (10 mM) by adding 2 mL DMSO
or water to EdU and then mix well. Store at ≤−20 °C.
13. Alexa fluor azide: Prepare working solution by adding 70 μL
DMSO to Alexa fluor azide and then mix well. Store working
solution at ≤−20 °C.
14. Click-iT EdU reaction buffer. Dilute one volume from Click-­iT
EdU reaction buffer to 1:10 with deionized water. Store
diluted solution at 2–6 °C.
15. Click-iT EdU buffer additive. Prepare solution before use
diluting the volume that will be used in tests of Click-iT EdU
buffer additive 1:10 with deionized water.
16. 4,6-Diamidino-2-phenylindole (DAPI) solution: Stock solu-
tion 1 mg/mL in PBS.

3 Methods

3.1 Collection 1. Fruit peels are considered as the residual biomass after the
and Preparation pulps have been collected by using a pulper apparatus and dis-
of Samples tilled water (3 V). Store the samples at −20 °C.
2. Fruit peels are lyophilized.
3. Dried biomass is ground by a grinder into jaboticaba peel flour.
4. The compounds of interest are then extracted from the jaboti-
caba peel flour (see Note 1).

3.2 Extraction 1. 1 g (dry weight) jaboticaba peel flour is added to 9 mL 50 %

Process ethanol solution (pH 3.6) (see Note 2).
2. The mixture is microwaved, i.e., three pulses of 5 s with 60-s
interval, to extract the compounds of interest.
3. The hydroalcoholic extract is recovered by filtration on cellu-
lose membranes under vacuum.
70 Heloisa S. Pitz et al.

3.3 Analysis 1. 1 mL Supernatant from the extraction process is diluted in

of Phenolic 5 mL 95 % methanol solution (see Note 3).
Compounds [15] 2. The diluted sample (1 mL) is transferred to a test tube and
added 1 mL 95 % ethanol solution, 5 mL distilled water, and
0.5 mL Folin-Ciocalteu phenol reagent.
3. Mix and incubate for 7 min.
4. After incubation, 1 mL 5 % sodium carbonate solution is
added, mixed well, and kept in the darkness for 1 h.
5. Prepare a blank solution (see Note 4).
6. The samples are vortexed and the absorbance is measured at
725 nm using a UV–Vis spectrophotometer.
7. The quantification of the total phenolic compounds is carried
out using an external standard curve of gallic acid (0–100 μg/
mL) and the amount values are expressed as μg of gallic acid
equivalents per gram (dry weight) of jaboticaba biomass.

3.3.1 External Gallic Acid 1. Add 10 mg gallic acid in 10 mL 50 % ethanol solution (pH 3.6),
Standard Curve i.e., the gallic acid solution 1 (1 mg gallic acid/mL).
2. Dilute 1 mL gallic acid solution 1 in 10 mL 50 % ethanol solu-
tion (pH 3.6), i.e., the gallic acid solution 2 (0.1 mg gallic
acid/mL).
3. Prepare the following solutions of gallic acid according to the
concentrations described in Table 1 from the gallic acid solu-
tion 2 (see Note 3).
4. 1 mL of each gallic acid solution (see Table 1 for the concentra-
tions) is transferred to a test tube and add 1 mL 95 % ethanol
solution, 5 mL distilled water, and 0.5 mL Folin-Ciocalteu
phenol reagent.

Table 1
Preparation of the gallic acid external standard curve

Concentrations of gallic acid 50 % Ethanol solution Gallic acid

solutions (pH 3.6) (μL) solution 2 (μL)
Blank 1000 0
10 μg/mL 900 100
20 μg/mL 800 200
40 μg/mL 600 400
60 μg/mL 400 600
80 μg/mL 200 800
100 μg/mL 0 1000
 Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 71

Table 2
Concentrations of gallic acid solutions and values of the arithmetic
average of the corresponding absorbance to build a standard curve

Concentrations of gallic acid solutions Absorbance average values

Blank
10 μg/mL
20 μg/mL
40 μg/mL
60 μg/mL
80 μg/mL
100 μg/mL

5. Mix and incubate for 7 min.

6. After incubation period, 1 mL 5 % sodium carbonate solution
is added, mixed well, and kept in the darkness for 1 h.
7. Prepare a blank solution (see Note 4).
8. The samples are mixed and the absorbance is measured at
725 nm using a UV–Vis spectrophotometer.
9. Calculations of the total content of phenolic compounds.
9.1 
In a spreadsheet of Excel® software, make a table (see
Table 2). In the left column (x-axis), enter the values of
the respective concentrations of the gallic acid solutions.
In the right column (y-axis), enter the values of the arith-
metic average of the corresponding absorbances.
9.2 Select the two columns with your mouse and in the top
flap of Excel® software choose the Insert, and then XY
graph (scatter). A graph will be generated.
9.3 In one of the graph points, click once with the mouse right
button and select add line trend. A new window will be
opened.
9.4 
Select the following options: set intersection, display
­equation on chart, and display R-squared value on the graph
(see Note 5).

3.4 Analysis 1. 0.5 mL Supernatant from the extraction process is added to

of Flavonoid 2.5 mL ethanol P.A. and 0.5 mL 2 % aluminum chloride solu-
Contents [16] tion (see Notes 3 and 6).
2. Mix well and incubate for 1 h.
3. Prepare a blank solution (see Note 7).
72 Heloisa S. Pitz et al.

4. The absorbance is measured at 420 nm using a UV–Vis

spectrophotometer.
5. The quantification of total flavonoids is carried out using the
external quercetin standard curve (0–200 μg/mL), as described
in Subheading 3.3.1, and the content values are expressed as
μg of quercetin equivalents per gram dry weight of jaboticaba
biomass.

3.5 Analysis Solution 1–0.025 mol/L hydrochloric acid solution (pH = 1.0)
of Anthocyanins: (see Note 8).
Differential pH
1. Dilute 1.86 g potassium chloride in 980 mL distilled water.
Measurement [17, 18]
2. Measure the pH and add hydrochloric acid P.A. in drops until
pH = 1.0.
3. Raise the volume to 1 L (use volumetric flask) with distilled
water.
Solution 2–0.4 mol/L acetate buffer solution (pH = 4.5)
(see Note 9).
1. Dilute 54.43 g sodium acetate in 960 mL distilled water.
2. Measure the pH and add 1 % hydrochloric acid solution (v/v)
in drops until pH = 4.5.
3. Raise the volume to 1 L (use volumetric flask) with distilled
water.
Assay
1. Add 1 mL supernatant from the extraction process in each
­beaker (see Note 3).
2. Add 50 mL solution 1 in each beaker.
3. Add 50 mL solution 2 in each beaker.
4. Mix thoroughly the beakers’ contents and let them stand for
30 min, protected from light, at room temperature.
5. Measure the absorbance at 510 nm and 700 nm using a UV–
Vis spectrophotometer.
6. Calculate anthocyanin contents (mg/L) using the formula
éë( Abs 510 - Abs 700 )s1 - ( Abs 510 - Abs 700 )s 2 ùû ´ MW ´ D ´ 1000 / e ,

where
Abs: absorbance
S1: Solution 1
S2: Solution 2
MW (molecular weight): cyanidin-3-glucoside = 449.2 g/mol.
ε (molar extinction coefficient): cyanidin-3-glucoside =
26,900 M/cm.
D: dilution factor = 1:50.
 Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 73

3.6 Antioxidant 1. Dissolve 20 g DPPH in 5 mL methanol P.A. This is the DPPH

Activity by the DPPH solution 1 (see Note 11).
Assay [19] 2. 1 mL DPPH solution 1 is diluted in 99 mL 80 % methanol
(See Note 10) solution. This is the DPPH solution 2.
3. Check the absorbance of DPPH solution 2 using a microplate
reader. It should be around 0.5 and 0.6 (see Note 12).
4. Pipette 290 μL DPPH solution 2 and 10 μL supernatant from
extraction process using a 96-well microplate (see Note 3).
5. Mix and incubate for 30 min.
6. After incubation, the absorbance is measured three consecu-
tive times at 531 nm using a UV–Vis microplate reader. The
final absorbance is an average of the three consecutive
readings.
7. The results are calculated according to the formula below and
expressed as inhibition percentage (%):

Inhibition ( % ) =
( Abs DPPH - AbsSample ) ´ 100
Abs DPPH
where
Abssample = absorbance of the sample
AbsDPPH = absorbance of DPPH solution 2

3.7 MTT Assay 1. Mouse fibroblast L929 cells are cultured in DMEM under
controlled conditions, at 37 °C, in a humidified 5 % CO2
atmosphere.
2. Fibroblast L929 cells are added in a 96-well plate at a density
of 5 × 103 cells per well and incubate at 37 °C in a humidified
5 % CO2 atmosphere overnight.
3. After incubation, DMEM should be replaced by medium
­culture containing 1, 5, 10, 25, 50, and 100 μg/mL jaboticaba
hydroalcoholic extract (concentrations based on yield—see
Note 13), except in control treatment where the culture
medium should be replaced by fresh DMEM (see Note 14).
4. Incubate cells for 48 h, at 37 °C, in a humidified 5 % CO2
atmosphere.
5. After this period, replace all the culture medium by 100 μL
fresh DMEM.
6. Add 10 μL MTT solution per well and incubate the cultures in
the dark for at least 3 h, at 37 °C, in a humidified 5 % CO2
atmosphere. A negative control without cells with 100 μL
DMEM and 10 μL MTT solution is required. Protect the
plates from light (see Note 15).
74 Heloisa S. Pitz et al.

Fig. 1 Scratch assay images immediately after the wounding (a) and after 12 h (b). Image B processed with
ImageJ® software, after step 9.2 (c)

7. Subsequently, remove 85 μL culture medium, add 50 μL

DMSO onto each well, and incubate for more 10 min, at
37 °C, in a humidified 5 % CO2 atmosphere.
8. Homogenize carefully to dissolve formazan crystals.
9. Measure the absorbance on an ELISA plate reader with wave-
length 540 nm.

3.8 Scratch 1. Mouse fibroblast L929 cells should be cultured as described in

Assay [20] MTT assay.
2. After hygienization (see Note 16), put cover slips at the bot-
tom of each well in a 24-well plate and seed L929 cells above
it at a density of 5 × 105 cells/well (see Note 17).
3. Allow cells to grow for 24 h, at 37 °C, in a humidified 5 % CO2
atmosphere.
4. After incubation, DMEM is completely removed and the
adherent cell layers are scratched with a yellow pipette tip
(see Note 18).
5. Wash (1×) the culture with PBS to remove cell debris
(see Note 19).
6. Add DMEM with 1, 5, 10, 25, 50, and 100 μg/mL jaboticaba
hydroalcoholic extract (concentrations based on yield), except
in control treatment where only fresh DMEM should be added
in the wells.
7. Incubate at 37 °C in a humidified 5 % CO2 atmosphere for
12 h.
8. Digital images (Fig. 1) shall be captured from the wounded
cultures at 0 h (right after to scratch - time 0) and 12 h (see
Note 20).
9. Process images on ImageJ® software.
9.1 Open ImageJ® and the file that will be analyzed
(File → Open → Select your file).
 Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 75

9.2 Go to Process → Binary → Convert to mask followed by Im

age → Adjust → Threshold → Black and White (B&W). The
background must be black (click in “Dark Background”).
9.3 
Select the area that will be measured by clicking on
Edit → Selection → Create selection (the selected area becomes
yellow).
9.4 Finally, to find out the area without cells in pixels go to
Analyse → Measure.
9.5 Decrease scratch area rate can be calculated using the fol-
lowing steps:
First, the percentage of samples area without cells must be
calculated using the formula:
Sample area without cells 12 h (in pixels) × 100/ Time 0
area without cells (in pixels)
Subsequently, subtract the result of the formula above
from 100 (%).
These results area expressed as decrease scratch area rate
after 12 hours related to time 0 (%).

3.9 Proliferation 1. Mouse fibroblast L929 cells should be cultured as described in

Assay MTT assay.
2. Plate mouse fibroblast L929 cells on cover slips (see Note 16)
at a density of 2 × 104 cells/well and then allow them to recover
overnight, at 37 °C, in a humidified 5 % CO2 atmosphere.
3. Add 1 mL/well DMEM with 1, 5, 10, 25, 50, and 100 μg/
mL jaboticaba hydroalcoholic extract (concentrations based
on yield), except in control treatment where only fresh DMEM
should be placed on the wells.
4. Incubate the cells for 48 h, at 37 °C, in a humidified 5 % CO2
atmosphere.
5. After this period, add 1 μL/well EdU solution (10 mM)
and incubate for 4 h, at 37 °C, in a humidified 5 % CO2
atmosphere.
6. Remove the culture medium and fix cells with 4 % paraformal-
dehyde (1 mL/well) for 15 min at room temperature.
7. Remove the paraformaldehyde and wash the cells with 0.1 %
Tween 20 (1 mL/well), followed by 1 % BSA (1 mL/well).
8. Discard the previous solution, add 0.5 % Triton® X-100
(1 mL/well), and then incubate at room temperature for
20 min (see Note 21).
9. Wash the cells with 0.1 % Tween 20 (1 mL/well), followed by
1 % BSA (1 mL/well).
10. Prepare Click-iT reaction cocktail adding the reagents in the
order listed in Table 3. Use this solution within 15 min of
preparation.
76 Heloisa S. Pitz et al.

Table 3
Composition of the Click-iT reaction cocktail (see Notes 22 and 23)

Components Volume (μL)

Click-iT EdU reaction buffer 43
CuSO4 2
Alexa fluor azide 0.12
Click-iT EdU buffer additive 5
Total volume per well ≅50

11. Remove BSA solution and add 50 μL Click-iT reaction c­ ocktail

above each cover slip.
12. Incubate the plate for 30 min at room temperature, protected
from light.
13. Remove the Click-iT reaction cocktail, and then wash each
well once with 1 % BSA (1 mL/well), followed by PBS (1 mL/
well).
14. Remove PBS and add 1 mL of PBS plus 1 μL DAPI per well.
15. Incubate for 30 s at room temperature, protected from light.
16. Observe and take pictures from the cells in a fluorescence
microscope (green filter for Alexa fluor 488 and blue filter for
DAPI—Fig. 2). All cell nuclei will become blue with DAPI
(using blue filter) and nuclei of cells in proliferation stage
­(during DNA replication) will become green with EdU (using
green filter) (see Note 24).
17. Take the same picture twice: one using the green filter and
the other the blue one (do not move the stage). Repeat this
procedure 3 times per well and use these results to calculate an
average.
18. Processing images from proliferation assay on ImageJ®
software.
18.1 Repeat steps 9.1 from scratch assay.
18.2 Click in Process followed by Subtract background. A
new window will be opened. In a box called “Rolling
ball radius,” put a number. Choose a number that
improves the image for your specific analysis. Lower
numbers increase the contrast of the background in the
image.
18.3 Go to Image → Adjust → Threshold → Black and White
(B&W).
18.4 Separate adjacent cells: Process → Binary → Convert to
mask and Process → Binary → Watershed.
 Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 77

Fig. 2 Cell proliferation assay images. Fluorescence microscopy for DAPI (a) and EdU (b) treatments.
Assessment of the total number of cells was performed using the ImageJ® software. Image after step 18.2
(c). After selecting the option “Show outline” and clicking ok, a new image will be opened (d) showing all the
outline of cells that were counted by the program

18.5 Finally, Analyse → Analyse particle. In a new window, ful-

fill the box “Size” with a lower and higher area of the cells
in each image (see Note 25). “Circularity” box is related
to the circle shape, where one is a perfect circle and zero
is a totally irregular circle. Choose “Show outline” and ok.
A new window with the number and area of cells will be
opened.
18.6 The percentage of proliferative cells for each treatment is
calculated using the formula:
Number of cells counted with EdU × 100/ Number of
cells counted with DAPI
78 Heloisa S. Pitz et al.

4 Notes

1. Jaboticaba peel flour is stored in freezer at −20 °C.

2. Adjust the pH of the extraction solution (50 % ethanol) using
1 % HCl solution (v/v).
3. All the procedures need to be carried out in the absence of
light and in triplicate.
4. The blank solution is prepared replacing the sample by extrac-
tion solvent, i.e., 50 % ethanol solution (pH 3.6), and adding
1 mL 95 % ethanol solution, 5 mL distilled water and 0.5 mL
Folin-Ciocalteu phenol reagent. A blank solution is used to
remove the color of the reagent set.
5. By building a graph using Excel® software, you can select the
following options:
–– S et intersection: The line that connects the points on the
graph will pass through the origin.
–– D
 isplay equation on the graph: The equation of a straight
line is usually written this way: y = a.x + b. The b variable is
the y intercept, the point where the straight line crosses the
y-axis and it should be adjusted to zero so that the line
passes through the origin (0, 0). With the adjusted equa-
tion (i.e., y = a.x) you can now use the arithmetic average
absorbance value for y and find the matching concentra-
tion value for x from the samples. The absorbance values
of the samples must be inside the absorbance range of the
standard curve. If the value is above, it is necessary to
dilute the sample and do the procedure again.
–– D
 isplay R-squared value on the graph: R-squared value
means how linear is your standard curve. The closer to 1 is
the R-squared value, the greater is the linearity.
6. 2 % Aluminum chloride solution is prepared using methanol P.A.
7. Prepare blank solution replacing the sample by the extraction
solvent, i.e., 50 % ethanol solution (pH 3.6), and add 2.5 mL
ethanol P.A. and 0.5 mL 2 % aluminum chloride solution. Use
blank solution for removing reagent set color.
8. 0.025 mol/L Hydrochloric acid solution (pH = 1.0) is stable
at room temperature. It is necessary to measure the pH
before use.
9. 0.4 mol/L Acetate buffer solution (pH = 4.5) is stable at room
temperature. Take the pH before use.
10. The 2, 2-diphenyl-2-picryl hydrazyl (DPPH) assay is a chemi-
cal method applied to determine the antioxidant capacity of a
compound to scavenge free radicals. The reduction of DPPH is
monitored by the decrease in absorbance during the reaction.
Assessment of In Vitro Biological Activities of Anthocyanins-Rich Plant… 79

11. Use volumetric flask to prepare the DPPH solution 1 and the
vortex to stir up the solution until completely solubilized.
12. Use volumetric flask to prepare the DPPH solution 2 and the
vortex to stir up until full dilution. The absorbance of DPPH
solution 2 should be around 0.5 and 0.6 to confirm that the
dilution procedure of the stock solution (DPPH solution 1)
was performed correctly.
13. Yield calculation: Put 1 mL extract on Petri dishes (accurately
weighed) and weigh. Put them in an oven at 45 °C. When the
Petri dishes with the extract reach a constant weight, calculate
yield by subtracting the weight values of extract-containing
dishes from the control (empty dishes). It is suggested to per-
form the calculation in triplicate, expressing the yield value
(mg dry extract/mL).
14. For verification that ethanol in jaboticaba hydroalcoholic
extract does not impair cells, test only similar concentration of
ethanol as used in the MTT assay. The ethanol final concentra-
tion should be kept below 0.1 % per well [21].
15. MTT is photosensitive and it is important to protect plates
from the light after adding to the culture medium.
16. For an aseptic manipulation, the cover slips should be placed in
a 24-well plate with 1 mL 70 % ethanol/well. Leave the plate
under UV light for 20 min, followed by washing the cover slips
in wells (3×) with sterile PBS.
17. Use and separate different cover slips for each treatment (con-
trol, 1, 5, 10, 25, 50, and 100 μg/mL) and time (0 and 12 h).
Once the picture has been taken, the cover slip must be dis-
carded to avoid culture contamination.
18. A glass slide could be used above the well to make a straight
line.
19. It is important to use PBS with calcium and magnesium to
keep cells attached on cover slips.
20. Remove cover slips from the plate and put them on a glass slide
with the cell surface upward. Take photographs from scratch in
40× magnification using a built-in camera in the microscope.
21. Click-iT EdU buffer additive can be prepared during this incu-
bation. This reagent must be fresh.
22. Multiply these values by the number of wells that will be used
in the experiment.
23. Use diluted Click-iT EdU reaction buffer and Click-iT EdU
buffer additive for Click-iT reaction cocktail preparation.
24. Remove cover slips from the plate and put them on a glass slide
with the cell surface downward. Put a drop of PBS between
the glass slide and the cover slip. Take a picture in 100×
magnification.
80 Heloisa S. Pitz et al.

25. Choose the smallest and the biggest cells and outline these
cells using the circular tool on ImageJ® and go to
Analyse → Measure to know the total area. Fulfill the box “Size”
with these values.

References

1. Falkenberg MB, Santos RI, Simões CMO improves insulin resistance in obese rats. Food
(2000) Introdução à análise fitoquímica. In: Res Int 49:153–160
Simões CMO, Schenkel EP, Gosmann G et al 12. Dragano NRV, Marques AC, Cintra DEC et al
(eds) Famacognosia: da planta ao medica- (2013) Freeze-dried jaboticaba peel powder
mento, 2nd edn. Editora UFRGS/Editora improves insulin sensitivity in high-fat fed
UFSC, Porto Alegre/Florianópolis mice. Br J Nutr 110:447–455
2. Yunes RA, Pedrosa RC, Cechinel Filho V 13. Leite-Legatti AV, Batista AG, Dragano NRV
(2001) Fármacos e fitoterápicos: a necessidade et al (2012) Jaboticaba peel: antioxidant com-
do desenvolvimento da indústria de fitoterá­ pounds, antiproliferative and antimutagenic
picos e fitofármacos no Brasil. Quím Nova activities. Food Res Int 49:596–603
24:147–152 14. Darby IA, Laverdet B, Bonye F et al (2014)
3. Sobral M, Proença C, Souza M et al(2014) Fibroblasts and myofibroblasts in wound
Myrtaceae. In: Lista de Espécies da Flora healing. Clin Cosmet Investig Dermatol
­
do Brasil. Jardim Botânico do Rio de Janeiro. 7:301–311
[Link] 15. Randhir R, Preethi S, Kalidas S (2002)
dobrasil/FB10828. Accessed 16 Set 2014 L-DOPA and total phenolic stimulation in dark
4. Franco LRL, Silva JF, Maia VM, Lopes PS, germinated fava bean in response to peptide
Amorim IJF, Mizobutsi EH (2010) Pegamento and phytochemical elicitors. Process Biochem
e crescimento inicial de mudas de jabuticabei- 37:1247–1256
ras “Açu” e “Sabará” submetidas a dois tipos 16. Etry RD, Ortega GG, Silva WB (2001)
de enxertia. Rev Ceres 57:535–538 Flavonoid content assay: influence of the
5. Souza-Moreira TM, Moreira RRD, Sacramento reagent concentration and reaction time on the
LVS et al (2010) Histochemical, phytochemi- spectrophotometric behavior of the aluminum
cal and biological screening of Plinia cauliflora chloride-flavonoid complex. Pharmazie 56:
(DC.) Kausel, Myrtaceae, leaves. Braz J Phar­ 465–470
macog 20:48–53 17. Rapisarda P, Fallico B, Izzo R et al (1994)
6. Lima ADJB, Corrêa AD, Dantas-Barras AM A simple and reliable method for determining
et al (2011) Sugars, organic acids, minerals and anthocyanins in blood orange juices. Agro­
lipids in jabuticaba. Rev Bras Frutic 33: chimica 38:57–164
540–550 18. Giusti MM, Wrolstad RE (2005) Charac­
7. Morton J (1987) Fruits of warm climates. Julia terization and measurement of anthocyanins by
Morton, Miami UV-visible spectroscopy. In: Wrolstad RE,
8. Lorenzi H (2000) Árvores brasileiras: manual Acree TE, Decker EA et al (eds) Handbook of
de identificação e cultivo de plantas arbóreas food analytical chemistry: pigments, colorants,
nativas do Brasil. Instituto Plantarum, Nova flavors, texture, and bioactive food. Wiley,
Odessa Hoboken
9. CRUZ AVM, KAPLAN MAC (2004) Uso 19. Kim YK, Guo Q, Packer L (2002) Free radical
medicinal de espécies das famílias Myrtaceae e scavenging activity of red ginseng aqueous
Melastomataceae no Brasil. Floresta e Ambiente extracts. Toxicology 172:149–156
11:47–52 20. Fronza M, Heinzmann B, Hamburguer M et al
10. Batista AG, Lenquiste SA, Cazarin CBB et al (2009) Determination of the wound healing
(2014) Intake of jaboticaba peel attenuates effect of Calendula extracts using the scratch
oxidative stress in tissues and reduces circulat- assay with 3T3 fibroblasts. J Ethnopharmacol
ing saturated lipids of rats with high-fat diet-­ 126:463–467
induced obesity. J Funct Foods 6:450–461 21. Negrão R, Inacio J, Lopes R et al (2007)
11. Lenquiste SA, Batista AG, Marineli RS et al Evidence for the effects of xanthohumol in dis-
(2012) Freeze-dried jaboticaba peel added to rupting angiogenic vessels, but not stable ones.
high-fat diet increases HDL-cholesterol and Int J Biomed Sci 3:279–286
 Chapter 6

Biotechnological Approaches for Biomass and Cardenolide

Production in Digitalis purpurea L.
Naivy Pérez-Alonso, Borys Chong-Pérez, Alina Capote, Anabel Pérez,
André Gerth, Geert Angenon, and Elio Jiménez

Abstract
Digitalis purpurea L. is one of the main economically viable sources of cardenolides (cardiac glycosides)
for the pharmaceutical industry. Nevertheless, production of cardenolides in plants grown by traditional
agriculture is not always an efficient process and can be affected by biotic and abiotic factors. This chapter
provides two biotechnology strategies for biomass and cardenolide production in D. purpurea. Firstly, we
report biomass production using a temporary immersion system (TIS), combined with cardenolide extrac-
tion and quantification. Secondly, an efficient protocol for genetic transformation via Agrobacterium tume-
faciens is provided. These strategies can be used independently or combined in order to increase the
content of cardiac glycosides in D. purpurea and to unravel biosynthetic pathways associated to cardiac
glycoside production.

Key words Cardenolides, Foxglove, Genetic transformation, Temporary immersion system,

Secondary metabolites

1 Introduction

Digitalis purpurea L. (foxglove) is an important medicinal plant

belonging to the family Plantaginaceae. Leaves of D. purpurea
have been used as medicine for many centuries because of the pres-
ence of cardenolides, which can increase the force of systolic con-
tractions and regulate heart rhythms in humans. Nowadays plants
are still the sole source for commercial acquisition of cardenolide
and only D. purpurea and D. lanata are of economic interest [1].
The contents of cardiotonic glycosides in Digitalis spp.
obtained through traditional agriculture are generally low and
strongly affected by climate, soil conditions, and genotype
(reviewed in ref. [1]). For these reasons, many biotechnological
strategies have been developed to enhance the production of bio-
mass and valuable cardenolides from Digitalis. Earlier studies dem-
onstrated the use of cell and tissue cultures of members of the

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_6, © Springer Science+Business Media New York 2016

81
82 Naivy Pérez-Alonso et al.

Digitalis genus for cardenolide production, such as suspension

cultures [2], embryogenic cell cultures [3], as well as root [4] or
shoot cultures [5]. However, cardenolide content in such cultures
is generally low.
Large-scale tissue culture has been considered as an alternative
to the traditional methods of culture for the production of bio-
chemicals. Bioreactors are designed for intensive culture and afford
maximal opportunity for monitoring and controlling microenvi-
ronmental conditions [6]. However, traditional bioreactors are
usually quite expensive and complex as regards cleaning, steriliza-
tion, inoculation, and harvesting [7, 8]. In order to reduce the
costs, increase simplicity of handling, and improve growth and
physiological state of the plant material, bioreactors have been
designed based on the principle of temporary immersion in liquid
medium [9, 10]. Because such temporary immersion systems (TIS)
are suitable for large-scale culture of plant organs, they also repre-
sent an attractive alternative for production of plant secondary
metabolites [11–13].
Genetic engineering is another alternative that could be used
to improve cardenolide production both in vitro and in vivo. This
tool can be used to unravel the metabolic pathway involved in
cardenolide production. Moreover, through genetic engineering
breeders can overexpress genes implicated in cardenolide biosyn-
thesis or silence genes belonging to competitive pathways, result-
ing in the increase of cardiotonic glycosides.
This chapter describes two biotechnological approaches in
Digitalis purpurea, firstly on the production of biomass and
cardenolides employing TIS. The second part describes a detailed
reproducible protocol for efficient Agrobacterium-mediated trans-
formation, providing a fast and reliable tool for metabolic engi-
neering of cardenolide production and genetic improvement of
this species.

2 Material

2.1 Biomass 1. Seeds of D. purpurea cv. Berggold as source of explants.

and Cardenolide 2. 70 % (v/v) ethanol.
Production
3. Sodium hypochlorite (NaOCl) with 5 % of active Cl.
in Temporary
Immersion Systems 4. Graduated cylinders (1000 mL).
5. 50 mL Sterile tube or similar container for disinfection
2.1.1 Plant Material
procedure.
and Surface Sterilization
6. Flasks with sterile distilled or deionized water for rinses.
7. Tissue culture facilities and tools (laminar flow cabinet, scalpel,
forceps, tool sterilizer such as vertical autoclave and glass-bead
sterilizer, culture room) and personal protective equipment
(i.e., laboratory coat).
 Biomass and Cardenolides Production 83

Table 1
Murashige and Skoog (MS) basal medium with vitamins and growth
regulators

Compounds mg/L
Macronutrients
Calcium chloride CaCl2 332.02
Potassium dihydrogen phosphate KH2PO4 170.00
Potassium nitrate KNO3 1900.00
Magnesium sulfate MgSO4 180.54
Ammonium nitrate NH4NO3 1650.00
Micronutrients
Cobalt chloride CoCl2·6H2O 0.025
Cupric sulfate CuSO4·5H2O 0.025
Iron sodium EDTA FeNaEDTA 36.70
Boric acid H3BO3 6.20
Potassium iodide KI 0.83
Manganese sulfate MnSO4·H2O 16.90
Sodium molybdate Na2MoO4·2H2O 0.25
Zinc sulfate ZnSO4·7H2O 8.60
Vitamins
Myoinositol 100
Thiamine HCl 1.0
Growth regulators (use for shoot multiplication)
6-Benzylaminopurine 6-BAP 1.0
Indole-3-acetic acid IAA 0.1
Add sucrose 3 % (w/v). Adjust the pH of the medium to 5.7 with 0.5 N KOH before
autoclaving at 1.2 kg/cm2 and 121 °C for 20 min. Add Gelrite 3.0 g/L for semisolid
medium

2.1.2 Culture Medium 1. Medium based on Murashige and Skoog (MS) salts [14]; see
medium formulations in Table 1.
2. Sucrose.
3. Growth regulators: Indole-3-acetic acid (IAA) and 6-benzyl-
aminopurine (6-BAP).
4. Gelrite.
5. Potassium hydroxide (KOH) (0.5 N).
6. Hydrochloric acid (HCl) (0.5 N).
84 Naivy Pérez-Alonso et al.

3 T 5

7 6 7

2 4

8 9

Fig. 1 Diagram of the temporary immersion system showing the different components: (1) Air compressor;
(2) reinforced PVC tubing (ID 10 mm); (3) pressure regulation station; (4) three-way solenoid electrovalve; (5)
programmable timer; (6) autoclavable silicone tubing (ID 6 mm); (7) sterilizable filter (0.22 μm, Midisart 2000,
Sartorius AG); (8) culture flask; (9) medium reservoir vessel

7. Vessels for plant tissue culture: 500 mL Polycarbonate

containers.
8. Tissue culture facilities and tools (technical and analytical bal-
ances, magnetic stirrer, pH meter, microwave oven or hot
plate, refrigerator and −20 °C freezer, autoclave) and personal
protective equipment (i.e., laboratory coat).

2.1.3 Temporary 1. TIS units of 1 L, comprising glass or plastic vessels with all
Immersion Systems components, are employed (see diagram in Fig. 1).
2. Individual shoots (1.5–2.0 cm long).
3. Tissue culture facilities and tools (laminar flow cabinet, scalpel,
forceps, tool sterilizer such as vertical autoclave and glass-bead
sterilizer, culture room) and personal protective equipment
(i.e., laboratory coat, latex gloves).

2.1.4 Determination 1. Lyophilizer.

of Cardenolide Content 2. Mortars and pestles.
in Shoots Cultured in TIS
3. Balance.
Extraction Protocol 4. Ultrasonic bath.
5. Micropipettes.
6. Centrifuge.
7. Rotary evaporator.
8. Latex gloves.
9. 500 mL Separatory funnels.
10. Funnels.
 Biomass and Cardenolides Production 85

11. Flasks with caps.

12. 50 and 500 mL evaporating flasks.
13. 250 mL Erlenmeyer flasks.
14. 100 and 500 mL graduated cylinders.
15. Whatman No. 1 filter paper.
16. 50 mL Falcon tubes.
17. Wash bottle with bi-distilled water.
18. 70 % (v/v) ethanol.
19. Pb(CH2COOH)2·2H2O (15 % w/v).
20. Na2HPO4·2H2O (10 % w/v).
21. Chloroform/isopropanol (3:2 v/v).
22. Absolute ethanol for HPLC analysis.

HPLC Analysis 1. HPLC, Agilent 1100 equipped with vacuum degasser, quater-
nary pump, auto sampler, diode array detector, and an Inertsil
ODS-3 column (150 × 4.6 mm; 5 μm).
2. Acetonitrile/water (25:75 v/v).
3. Authentic standards, HPLC-grade digoxin and digitoxin for
calibration.

2.2 Agrobacterium 1. Micropipette and sterile 1.0 mL and 200 μL pipet tips.
tumefaciens-Mediated 2. Sterile 9 cm Petri dishes.
Genetic
3. Sterile 9 cm diameter filter paper disks to remove excess
Transformation
Agrobacterium.
2.2.1 Equipment, 4. Parafilm® to seal Petri dishes.
Instruments, and Solutions
5. Sterile 250 mL Erlenmeyer flasks.
6. Sterile conical centrifuge tubes.
7. 50 mL Glass test tubes.
8. Wire loop.
9. Tissue culture chamber.
10. Flasks with bi-distilled or deionized water.
11. 70 % (v/v) ethanol.
12. Orbital shaker.
13. Centrifuge.
14. Spectrophotometer.
15. Tissue culture facilities and tools (pH meter, vertical laminar
flow cabinet, scalpel, forceps, tool sterilizer such as vertical
autoclave and glass-bead sterilizer, culture room) and personal
protective equipment (i.e., laboratory coat, latex gloves).
86 Naivy Pérez-Alonso et al.

2.2.2 Plant Material 1. Leaf segments (1.0 cm2 adaxial surface to the medium) from in
vitro plants (second to seventh subculture).

2.2.3 Culture Medium 1. Antibiotics: Spectinomycin, streptomycin, rifampicin, cefotax-

for Bacterial Culture, ime, timentin, geneticin (G-418).
Cocultivation, 2. Acetosyringone (4-acetyl-2,6-dimethoxyphenol).
and Regeneration
of Transformants
3. Luria Broth (LB) medium and YEP liquid medium for bacte-
rial culture.
4. MS basal medium (Table 1) for inoculation medium, semisolid
callus induction medium (CIM), and semisolid regeneration
medium.

2.2.4 Agrobacterium 1. Agrobacterium strain C58C1RifR containing the helper plas-

tumefaciens Strain mid pMP90 [15].
and Binary Vector 2. Binary vector pTJK136 [16] that contains an aminoglycoside
adenyltransferase marker gene (aadA), which confers bacterial
resistance to spectinomycin/streptomycin. Moreover a T-DNA
with P35S-uidAint-nos (35S RNA promoter of the cauliflower
mosaic virus, β-glucuronidase gene with potato st-ls1 intron,
nopaline synthase gene terminator) and Pnos-nptII-ocs (nopal-
ine synthase gene promoter, neomycin phosphotransferase gene,
octopine synthase gene terminator) as chimeric plant screenable
and selectable marker genes, respectively (Fig. 3a).

2.3 Histochemical 1. X-Gluc solution for histochemical analysis [17]: 1 mM

β-Glucuronidase 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc) in 0.1
Assays mM phosphate buffer (pH 7.0) containing 10 mM ethylene
diamine tetraacetic acid (EDTA), 0.5 mM potassium ferricya-
nide, 0.5 mM potassium ferrocyanide, and 0.1 % Triton X-100.
Store at −20 °C.
2. 70 % (v/v) ethanol.
3. Micropipette and sterile 1.0 mL pipet tips.
4. Sterile conical centrifuge tubes.
5. Sterile scalpels and forceps.
6. Incubator.

2.4 Molecular 1. Sterile mortars and pestles.

Analysis 2. Liquid nitrogen.
2.4.1 DNA Isolation 3. Eppendorf tubes.
from Transformed Tissue 4. Micropipettes and tips.
5. Gloves.
6. Extraction buffer: 10 mM Tris–HCl pH 8.0, 1.4 M NaCl
pH 8.0, 20 mM ethylene diamine tetraacetic acid (EDTA), 4 %
(w/v) cetyltrimethylammonium bromide (CTAB), 2 % (w/v)
 Biomass and Cardenolides Production 87

polyvinylpyrrolidone (PVP), 10 mM β-mercaptoethanol. Store

at room temperature.
7. TAE buffer (50×): Tris (242 g), glacial acetic acid (57.1 mL),
EDTA (0.5 M, pH 8.0, 100 mL), adjust pH to 8.0 and make
up volume.
8. Agarose molecular grade.
9. TE buffer (10×): 100 mM Tris, 10 mM EDTA, pH 8.0 (with
HCl).
10. 24:1 Chloroform-isoamyl alcohol.
11. 70 % (v/v) ethanol.
12. RNase solution.
13. Sodium acetate 3 M.
14. Water bath (set at 55 °C).
15. Vortexer.
16. Fume hood.
17. Spectrophotometer.

2.4.2 Polymerase 1. For the polymerase chain reaction (PCR) mix: Sterile bi-distilled
Chain Reaction water, PCR buffer mix, dNTPs, forward primer, reverse primer,
Taq DNA polymerase, MgCl2 solution, DNA template.
2. Agarose molecular grade.
3. 200 μL PCR tubes.
4. Crushed ice, ice bucket.
5. Micropipettes and tips.
6. Gloves.
7. Thermal cycler.

2.4.3 Southern 1. SacII, store enzyme at −20 °C.

Hybridization 2. Agarose molecular grade.
3. Nylon membrane: Hybond N+ (GE Healthcare).
4. Labeled probe: PCR amplification of the 488 bp nptII gene
fragment is labeled with DIG-dUTP using a DIG-High Prime
DNA Labeling and Detection Kit.
5. Micropipettes and tips.
6. X-ray film, cassette to hold X-ray film, X-ray film developer,
clingfilm.
7. Gloves.
8. Others: Materials for Southern hybridization analysis accord-
ing to standard procedures [18].
88 Naivy Pérez-Alonso et al.

3 Methods

3.1 Biomass 1. Add distilled or deionized water up to ½ the final medium

and Cardenolide volume in a beaker and mix each component of MS basal
Production medium and supplements (Table 1). MS basal medium is sup-
in Temporary plemented with 30 g/L sucrose for germination phase. For
Immersion Systems multiplication phase, this medium is also supplemented with
vitamins and growth regulators (Table 1) and named MMS.
3.1.1 Plant Material, Growth regulators are added to the culture medium prior to
Surface Sterilization, sterilization (see Note 1). Mix the solution until all compo-
and Culture Conditions nents are dissolved. Bring to the final volume with distilled or
deionized water. Adjust pH to 5.8 with 0.5 N KOH or 0.5 N
HCl.
2. Add 3.0 g/L Gelrite, heat until gelling agent is fully dissolved
before autoclaving at 1.2 kg/cm2 and 121 °C for 20 min or
add Vitrofural® as chemical sterilization (see Note 2), and dis-
pense into autoclavable containers. Use 70 mL in each 500 mL
culture vessel for germination and multiplication phases. Store
the medium in a clean and dark area at 4 °C. Use within
2 weeks.
3. Sterilize all instruments and the laminar flow cabinet before
use.
4. In the laminar flow cabinet, place the seeds (Fig. 2a) in tubes
with an aqueous solution of sodium hypochlorite (NaOCl)
with 5 % of active Cl and shake during 5 min.
5. Rinse seeds three times with sterile distilled or deionized water
(see Note 3).
6. Culture sterile seeds on an MS basal medium and incubate at
27 ± 2 °C under 16-h photoperiod and 125–150 μmol/m2/s
photosynthetic photon flux supplied by cool white fluorescent
lamps (see Note 4).
7. Grow seedlings (Fig. 2b) on MMS culture medium until they
have attained 2–4 cm length under the same culture conditions
as of step 6. Leaves and roots are eliminated. The plantlets
(Fig. 2c) are subcultured every 28 days. Divide shoots indi-
vidually, cut shoots approximately in 1.5–2.0 cm length
(Fig. 2d), and use for multiplication on semisolid medium and
TIS. Discard any contaminated shoots.

3.1.2 Temporary 1. Prepare TIS units (Fig. 2e) and connect all components as
Immersion Systems shown in Fig. 1.
2. Prior to sterilization, add to each TIS 250 mL MMS supple-
mented as described (Subheading 3.1.1, step 1) without
Gelrite (see Note 5).
 Biomass and Cardenolides Production 89

Fig. 2 In vitro propagation of Digitalis purpurea, (a) seeds as explant source, disinfected with 5 % NaOCl during
5 min, (b) seedlings after 15 days growing on MMS culture medium supplemented with 1.0 mg/L 6-BAP and
0.1 mg/L IAA, (c) in vitro plants ready for subculturing after 28 days on MMS culture medium, (d) 1.5–2.0 cm
long individual shoots, (e) temporary immersion system used for shoot multiplication, (f) hyperhydric shoots,
(g) plantlets growing on TIS under 2 min of immersion every 4 h, (h) harvested biomass from TIS after 28 days

3. Check functioning of TIS before inoculation. Program the

timer for some parameters like time and immersion frequency
(2 min every 4 h) (see Note 6).
4. Inoculate 12 individual shoots (1.5–2.0 cm long) per TIS in a
laminar flow cabinet.
5. Reconnect TIS to the installation in a culture room at 27 ± 2 °C
under 16-h photoperiod and 125–150 μmol/m2/s photosyn-
thetic photon flux supplied by cool white fluorescent lamps.
6. Collect biomass after 28 days (Fig. 2g, h), rinse with distilled
water, and thereafter blot dry on filter paper.
7. Suggested parameters to evaluate: number of hyperhydric
shoots, water content (see Note 7), length and the number of
shoots per TIS, and fresh and dry weights (g) produced per
TIS, which represent biomass production (see Notes 8 and 9).

3.1.3 Cardenolide 1. Freeze-dry biomass in a lyophilizer (see Note 10).

Content 2. Finely grind dried in vitro shoots in a mortar.
3. Extract powdered plant material sample (1.5 g) with 15 mL
ethanol (70 %, v/v) in an ultrasonic bath at 70 °C for 15 min.
4. After cooling to room temperature add 25 mL bi-distilled
water.
90 Naivy Pérez-Alonso et al.

5. Add 10 mL lead acetate (15 %) and divide extract in two 50 mL

tubes. Rinse flask twice with bi-distilled water.
6. Centrifuge at 3000 × g for 5 min.
7. Filter samples using Whatman No. 1 filter paper and rinse filter
twice with bi-distilled water in Erlenmeyer flask.
8. Add 12 mL Na2HPO4 (10 %), and dispense the extract in four
tubes.
9. Centrifuge at 3000 × g for 5 min.
10. Filter samples using Whatman No. 1 filter paper and pass
extract to a separatory funnel.
11. Add 30 mL chloroform/isopropanol (3/2) and mix.
12. Extract the organic phase to 500 mL evaporating flask (first
extraction).
13. Add 20 mL chloroform/isopropanol (3/2) to extract in sepa-
ratory funnel and mix. Extract the organic phase and repeat
again, and mix fractions (see Note 11).
14. Evaporate under reduced pressure using a rotary evaporator
equipped with a water bath held at 40 °C to approximately
1.0 mL, then rinse evaporating flask several times with warm
ethanol, transfer the extract to a 50 mL evaporating flask, and
evaporate again.
15. Dissolve solid residue with 1.0 mL warm ethanol (ultrasonic
bath) and transfer to a vial (1.5 mL) for HPLC analysis.
16. Store prepared samples at 4 °C.
17. Prepare a calibration curve by injecting standards of several
known concentrations, digoxin (0–256 μg/mL) and digitoxin
(0–625 μg/mL). Plot peak area against concentration.
18. Inject 10 μL of sample in Agilent 1100 HPLC system.
19. Use acetonitrile/water (25/75; v/v) mixture as eluent at
1.5 mL/min flow rate. Carry out measurements at 40 °C
(see Note 12).
20. Detect glycosides at 220 nm wavelength. Compare UV spectra
with authentic commercially available standards and identify
digitoxin and digoxin on the basis of their retention time.

3.2 Agrobacterium 1. Spectinomycin: Prepare stock solution in bi-distilled water by

tumefaciens-Mediated adding 100 mg/mL. Filter sterilize and store in 1.0 mL
Genetic aliquots at −20 °C.
Transformation 2. Streptomycin: Prepare stock solution in bi-distilled water by
3.2.1 Solutions adding 300 mg/mL. Filter sterilize and store in 1.0 mL ali-
and Culture Media quots at −20 °C.
3. Rifampicin: Prepare stock solution in bi-distilled water by add-
ing 50 mg/mL. Filter sterilize and store in 1.0 mL aliquots at
−20 °C.
 Biomass and Cardenolides Production 91

4. Timentin (a 15:1 mixture of ticarcillin and clavulanic acid):

Prepare stock solution in bi-distilled water by adding 200 mg/
mL. Filter sterilize and store in 1.0 mL aliquots at −20 °C.
5. Geneticin (G-418): Prepare stock solution in bi-distilled water
by adding 50 mg/mL. Filter sterilize and store in 1.0 mL
aliquots at −20 °C. Light sensitive, consequently geneticin-
containing medium should be stored in the dark.
6. Cefotaxime: Prepare stock solution in bi-distilled water by
adding 500 mg/mL. Filter sterilize and store in 1.0 mL
aliquots at −20 °C.
7. Acetosyringone (AS): Prepare stock solution in dimethylsulf-
oxide at 500 mM (e.g., 0.098 g in 1.0 mL); there is no need
to sterilize but solution should always be prepared freshly in a
laminar flow.
8. Luria Broth (LB) medium: Dissolve 10 g tryptone, 10 g of yeast
extract, and 10 g NaCl in 900 mL of bi-distilled water. Make
the volume up to 1.0 L with bi-distilled water. Adjust the pH to
7.5 and add 15 g/L of agar. Supplement with the appropriate
antibiotics (100 mg/L spectinomycin and 300 mg/L strepto-
mycin) after cooling the autoclaved medium to 50–55 °C.
Dispense 25 mL in sterile 9 cm diameter Petri dishes.
9. YEP liquid medium: Dissolve 5 g/L NaCl, 10 g/L peptone,
and 10 g/L yeast extract in bi-distilled water. Adjust pH to
7.5. Supplement with the appropriate antibiotics (100 mg/L
spectinomycin and 300 mg/L streptomycin) after cooling the
autoclaved medium to 50–55 °C. Dispense 3.0 mL into 15 mL
culture tubes and 50 mL into sterile 250 mL Erlenmeyer flasks,
according to the scale of the experiment.
10. Inoculation medium: Dissolve 100 % MS salts (Table 1),
20 g/L sucrose, 1.98 g/L D(+)-glucose, and 3.9 g/L
2-[N-morpholino]ethane sulfonic acid (MES) in bi-distilled
water and adjust pH to 5.5 before autoclaving. Supplement
with 200 μM AS just before inoculation.
11. Semisolid callus induction medium (CIM): Dissolve 100 % MS
salts (Table 1), 4.0 mg/L thiamine HCl, 100 mg/L myoino-
sitol, 30 g/L sucrose, and 3.0 g/L Gelrite in bi-distilled water.
Adjust pH to 5.8 before autoclaving.
12. Semisolid regeneration medium: Dissolve 100 % MS salts
(Table 1), 0.57 μM IAA, 4.4 μM BAP, 30 g/L sucrose, and
2.5 g/L Gelrite. Adjust pH to 5.7 before autoclaving.

3.2.2 Growth 1. Using a 200 μL pipet tip, scratch a small amount from the
of Agrobacterium Cultures surface of the frozen glycerol bacterial stock (see Note 13) and
and Cocultivation drop onto the surface of the selective semisolid LB plate. Place
back the frozen bacterial stock immediately into the freezer to
Isolation of Single
avoid thawing.
Bacterial Colonies
from a Glycerol Stock 2. Using a flamed and cooled wire loop, streak cells across the
selective semisolid LB plate to spread bacteria.
92 Naivy Pérez-Alonso et al.

3. Incubate the inoculated selective LB plate upside-down at

28 °C until single colonies are visible.

Inoculation 1. Select 2–3 isolated single colonies from the plate using sterile
with Agrobacterium pipet tips.
and Cocultivation 2. Inoculate one colony per 15 mL tube containing YEP medium
supplemented with 100 mg/L rifampicin, 100 mg/L spec-
tinomycin, and 300 mg/L streptomycin.
3. Grow Agrobacterium cultures overnight on an incubating
shaker set at 200 rpm and 28 °C. Approximate OD600nm at
harvest: 1.5–2.0.
4. Collect 50 μL of grown culture and inoculate 250 mL
Erlenmeyer flask containing YEP medium supplemented with
100 mg/L spectinomycin and 300 mg/L streptomycin.
5. Grow Agrobacterium culture overnight on an incubating
shaker set at 200 rpm and 28 °C. Approximate OD600nm at
harvest: 1.2–1.5.
6. Pellet bacterial cells by centrifugation for 10 min at 3200 × g.
7. Discard supernatant and gently wash the pellet once with inoc-
ulation medium described above (Subheading 3.2.1, step 10).
8. Discard washing medium and gently resuspend the pellet in
inoculation medium. Measure the OD600 nm and adjust with the
above medium to 0.7 units (see Note 14).
9. Place 30–40 leaf discs (1 cm2) in capped 50 mL disposable
polypropylene conical centrifuge tube containing 30–40 mL of
Agrobacterium suspension (see Note 15, Fig. 3b).
10. Incubate tubes containing Agrobacterium suspension and leaf
segments at room temperature for 15 min with gentle manual
agitation every 2 min.
11. Take away leaf segments from Agrobacterium suspension and
remove excess bacteria from explants by blotting them on ster-
ile filter paper using sterile forceps (see Note 16).
12. Transfer leaf segments (adaxial surface to the medium, five seg-
ments per plate) to cocultivation on CIM (Subheading 3.2.1,
step 11) supplemented with 200 μM AS. Incubate plates in
the dark at 21 °C for 5 days.

3.2.3 Histochemical Transient GUS expression is determined in leaf segments inocu-

β-Glucuronidase Assays lated with Agrobacterium strain.
1. After cocultivation, dip untransformed control and transgenic
leaves into X-Gluc solution and incubate at 37 °C in the dark
for 6 h or overnight.
2. After incubation, remove X-Gluc solution, add the same
volume of 70 % (v/v) ethanol, and incubate overnight to
 Biomass and Cardenolides Production 93

Fig. 3 Agrobacterium tumefaciens-mediated genetic transformation of Digitalis purpurea L. (a) T-DNA region
of a pTJK136 [16], LB and RB, left border and right border, respectively; P35S, cauliflower mosaic virus 35S
RNA promoter; uidA-intron, intron-interrupted β-glucuronidase gene; Pnos and Tnos, nopaline synthase gene
promoter and polyadenylation signal; nptII, neomycin phosphotransferase gene; Tocs, octopine synthase gene
polyadenylation signal, (b) inoculated leaf segments in tubes containing Agrobacterium suspension, (c) tran-
sient GUS expression in a leaf inoculated with C58C1RifR (pMP90) (pTJK136), (d) untransformed leaf, (e) callus
formation from untransformed leaf on CIM without antibiotics, (f) callus formation from transformed leaf seg-
ment on CIM with 70 mg/L G-418, (g) stable GUS expression in transformed callus, (h) callus from untrans-
formed segments without GUS-positive spots, (i) regenerated plants from transformed segments. Stable GUS
expression in transformed (j) plantlets and (k) leaf
94 Naivy Pérez-Alonso et al.

remove chlorophyll and other pigments prior to visual analysis

and photographing. Note blue coloration indicating transient
expression of the uidA gene (Fig. 3c, d).

3.2.4 Selection 1. Transfer inoculated leaf segments into 50 mL centrifugation

and Regeneration tubes; rinse twice with 30–40 mL sterile liquid CIM contain-
of Transformants ing 200 mg/L timentin and 500 mg/L cefotaxime.
2. Blot leaf segments dry on sterile filter paper.
3. Place leaf segments onto CIM containing 70 mg/L G-418 as
selection agent and 200 mg/L timentin to inhibit Agrobac-
terium growth (see Note 17).
4. Incubate selection plates for 8–12 weeks at 27 ± 2 °C in the
dark with subculture to fresh selective plates every 2 weeks
until calli form (Fig. 3e, f).
5. Perform histochemical β-glucuronidase assay of calli as
described above (Subheading 3.2.3, Fig. 3g). Non-transgenic
calli are simultaneously stained in the same way (Fig. 3h).
6. Transfer the individual putatively transformed callus induced
on selection medium to 9 cm Petri dishes containing regenera-
tion medium described above (Subheading 3.2.1, step 12)
and keep in a growth chamber at 27 ± 2 °C under 16-h photo-
period and 70 μmol/m2/s photosynthetic photon flux sup-
plied by cool white fluorescent lamps.
7. Transfer differentiated shoots individually (Fig. 3i) to sterile
50 mL glass test tubes containing MMS medium.
8. Stable GUS expression in regenerated plants is assessed as
described above (Subheading 3.2.3, Fig. 3j, k). Non-transgenic
regenerated plants are simultaneously stained in the same way.

3.3 Molecular Total DNA is extracted following the protocol described by Khayat
Analysis et al. [19] with minor modifications.
3.3.1 DNA Isolation 1. Take 1 g leaf tissue from a transformed Digitalis plant. Grind
from Transformed Tissue tissue to fine powder in a mortar with liquid nitrogen.
2. Add 10 mL of extraction buffer (Subheading 2.4.1, step 6)
per gram of tissue and shake vigorously using vortexer
(see Note 18).
3. Incubate the mixture at 55 °C for 30 min with occasional
inversion.
4. Cool the mixture on ice for 5 min.
5. Centrifuge at 3200 × g, for 5 min at 4 °C. Transfer the super-
natant to a new tube.
6. Remove RNA by adding RNase to a final concentration of
200 μg/mL and incubate at 37 °C for 15 min.
 Biomass and Cardenolides Production 95

Table 2
Sequence of the primers used for nptII and uidA gene fragment amplification by PCR

Sequence

Gene Forward Reverse (bp)

nptII 5′ATGATTGAACAAGATGGA 5′TGATGCTCTTCGTCC 488
TTGCACGC 3′ AGATCATC 3′
uidA 5′AACGGCAAGAAAAAGCAGTC 3′ 5′ GAGCGTCGCAGAACATTACA3′ 1031

7. Add an equal volume of chloroform-isoamyl alcohol (24:1) to

the above mixture and separate the two phases by centrifuging
at 12,857 × g for 10 min at 4 °C.
8. Transfer the upper aqueous phase to a fresh tube.
9. Add an equal volume of isopropanol and mix gently by inver-
sion. Incubate for 60 min at −80 °C or overnight at −20 °C.
10. Pellet genomic DNA by centrifugation at 18,500 × g for 15 min
at 4 °C.
11. Wash the pellet once with 1.0 mL 70 % (v/v) ethanol.
12. Centrifuge at 18,500 × g for 15 min at 4 °C and discard
ethanol.
13. Vacuum dry pellet for 5 min and dissolve in 30 μL of TE buffer
(1×).
14. Store at −20 °C.
15. Check DNA by agarose gel electrophoresis and quantify 1:10
dilutions of DNA in spectrophotometer at 260/230 and
260/280 nm. DNA can be used for either PCR or Southern
hybridization analysis.

3.3.2 PCR PCR is performed using genomic DNA of each plant as a target.
pTJK136 plasmid isolated from Escherichia coli DH5α-pTJK136
strain is used as positive control. Bacterial culture is grown over-
night on an incubating shaker set at 200 rpm and 37 °C. Plasmid
DNA is isolated using Purification kit Wizard plus SV Minipreps.
The primer sequences for analyzing tissues transformed with
nptII and uidA genes are given in Table 2.
1. Fill out a PCR worksheet with the sample identifiers of all sam-
ples to be used.
2. Label PCR tubes with sample identifier numbers from the
PCR worksheet.
3. Place PCR tubes in the freezer rack to keep cold.
96 Naivy Pérez-Alonso et al.

a b
1 2 3 4 5 6 7 8 9 10 11 12 13 (-) (+)MW

1 2 3 4 5 6 (-) (+) MW

8576bp
nptII 488 bp
6106bp
4899bp
3639bp
1 2 3 4 5 6 7 8 9 10 11 12 13 (-) H2O(+)MW 2799bp

1953bp
1515bp
uidA 1031 bp 992bp

Fig. 4 Molecular analysis of putative transformed Digitalis purpurea L. plantlets. (a) PCR analysis for the nptII
and uidA genes in transgenic tissues, lane 1–13 genomic DNA from putative transgenic lines obtained with
C58C1RifR (pMP90) (pTJK136), (−) untransformed control, (+) pTJK136 plasmid control, MW molecular weight
marker Gene Ruler™ DNA Ladder Mix (Fermentas). (b) Southern hybridization of putative transformed D.
purpurea L. PCR-positive plantlets, lanes 1–6 genomic DNA from putative transgenic lines obtained with
C58C1RifR (pMP90) (pTJK136), (−) untransformed plant, (+) pTJK136 plasmid control, MW digoxigenin-labeled
DNA molecular weight marker VII (Roche)

4. Calculate the amount of each component needed for the total

number of samples taking into account that PCR amplification
reactions are carried out in 25 μL of total volume (see Note 19).
5. Close caps of all tubes firmly and place the tubes into the ther-
mal cycler.
6. Start the program (denaturation at 94 °C for 3 min, followed
by 35 cycles of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for
30 or 60 s, with a final extension at 72 °C for 10 min).
7. After the PCR is complete, analyze amplified fragments by
electrophoresis at 100 V for 1 h on 1.0 % Tris-acetate-EDTA
agarose gel followed by staining in ethidium bromide (5 μg/
mL) and detection and photography under UV illumination.
An nptII- and uidA-specific band of 488 bp and 1031 bp,
respectively, is observed in the transformed plants while being
absent in the untransformed control plants and water (Fig. 4a,
see Note 20).

3.3.3 Southern The integration of the T-DNAs of randomly selected PCR-positive

Hybridization lines is analyzed by Southern blot hybridization (see Fig. 4b).
1. Digest 20 μg of genomic DNA with SacII.
2. Separate digested genomic DNA samples on a 0.8 % Tris-
acetate-EDTA agarose gel (w/v) run at 25 V for 12 h.
 Biomass and Cardenolides Production 97

3. Blot DNA to a Hybond-N+ nylon membrane (RPN203B; GE

Healthcare) by upward capillarity forces using 20× SSC buffer
(3 M NaCl, 0.3 M sodium citrate, pH 7.0) overnight at room
temperature.
4. Label the 488-bp nptII gene fragment, amplified from plasmid
pTJK136 with the same primers mentioned above (Table 2),
with DIG-dUTP using a DIG-High Prime DNA Labeling and
Detection Kit.
5. Perform hybridization, washing, and detection according to
the manufacturer’s instructions.
6. Expose membrane to X-ray film in the presence of an intensify-
ing screen for 30 min at room temperature.

4 Notes

1. BAP: Stock solution at 1 mM. Dissolve 22.52 mg BAP in a few

drops of 1 M sodium hydroxide, dilute to 100 mL with dis-
tilled or deionized water, and store at 4 °C. IAA: Stock solu-
tion at 1 mM. Dissolve 8.76 mg IAA in a few drops of 1 M
sodium hydroxide, dilute to 50 mL with distilled or deionized
water, and store at 4 °C.
2. It is possible to use chemical sterilization with Vitrofural®
(2-bromo-5-(2-bromo-2-nitrovinyl)-furan) 114 mg/L. Firstly,
boil full medium to dissolve Gelrite (3.0 g/L), then dissolve
this compound into 1/10 part of hot medium (~90 °C), and
immediately add to the rest boiled medium. This compound is
used by adding in culture vessels for seed germination and
shoot multiplication on semisolid medium. All the culture
vessels used in chemical sterilization with Vitrofural® are previ-
ously rinsed in sodium hypochlorite solution at 0.05 % (v/v).
Store the medium in a clean area under dark conditions at least
3 days before use. Vitrofural® has therapeutic effect [20] and
has allowed the substitution of the autoclave in the sterilization
of culture medium used for the micropropagation of banana,
plantain, potato, and sugarcane [21, 22]. However, this anti-
microbial compound has never been used in Digitalis culture.
For shoot multiplication in TIS, the use of Vitrofural® is not
convenient taking into account that TIS has several compo-
nents and that it is very difficult to completely sterilize all of
them. On the other hand, previous studies have shown that
Digitalis leaves are very sensitive to direct contact with
Vitrofural® when liquid medium is used (unpublished data).
3. Be careful, Digitalis seeds are very small and it is necessary to
use a filter when they are rinsed. It is possible to obtain
less than 1 % of contamination with this simple disinfection
protocol.
98 Naivy Pérez-Alonso et al.

4. After 15 days, seed germination rate is more than 80 %. In a

tropical location it is possible to incubate seeds and seedlings
under natural light conditions, photoperiod 13/11 h and
20–45 μmol/m2/s on average.
5. Employ physical sterilization for TIS, and autoclave at 1.2 kg/
cm2 and 121 °C for 30 min. Prepare TIS carefully before auto-
claving; all components are rinsed in sodium hypochlorite
solution at 0.05 % (v/v).
6. Duration and frequency of immersions affect nutrient supply,
composition of the internal atmosphere in the culture vessel,
and occurrence of hyperhydricity [9]. The latter phenomenon
concerns morphological, anatomical, and physiological disor-
ders. Shoots are categorized as hyperhydric shoots according
to their external appearance [23–25] (Fig. 2f shows the mor-
phology of hyperhydric shoots). Hyperhydric shoots appear
turgid, watery at their surface, and hypolignified, in some cases
less green and easily breakable. In D. purpurea, the best bio-
mass production (values for fresh (106.2 g) and dry weight
(5.82 g) per 1 L flask) and lowest percentage of hyperhydricity
were obtained using 2 min immersion every 4 h [26].
7. Dry weight is recorded after the biomass is dried to constant
weight at 60 °C. The water content is an important variable to
evaluate because it shows the shoot quality and allows deter-
mining favorable conditions to avoid hyperhydricity. Water
content (WC) is calculated as [27]

( FW - DW )
WC% = ´100
FW

8. Since cardenolide biosynthesis is basically dependent on mor-

phological differentiation [28], there are attempts to use organ
culture, which is easily produced in TIS. The protocol described
for D. purpurea biomass production in TIS is also applicable for
biomass and cardenolide production in D. lanata shoots. Yields
are different because of genotype influence. The most impor-
tant reason for the efficacy of TIS is that they combine ventila-
tion of the plant tissues and intermittent contact between the
entire surface of the tissue and the liquid medium [9], which
results in increased growth rates and biomass production.
9. Elicitation is one of the most effective methods to enhance the
production of several secondary metabolites from medicinal
plants [29]. Our results suggest that elicitation of Digitalis
shoots cultivated in TIS or semisolid medium could influence
the competition between biomass and secondary metabolite
production [30, 31]. Elicitors as Chitoplant® and Silioplant®
are effective to increase cardenolide content in shoots of
D. purpurea and D. lanata. In D. lanata, the highest accumu-
lation of lanatoside C was achieved with Chitoplant® (0.1 g/L),
 Biomass and Cardenolides Production 99

which resulted in 316 μg/g-DW, and with Silioplant®

(0.01 g/L) giving 310 μg/g-DW; this accounted for a 2.2-
fold increase in lanatoside C content compared to non-elicited
shoot cultures in TIS [30]. The optimization of elicitor treat-
ment may improve TIS performance. Also, SilioPlant® (0.01 g/L)
did not affect biomass production and at the same time
increased 3.6-fold and 6.9-fold the digoxin and digitoxin con-
tent, respectively, in D. purpurea shoots cultured in semisolid
medium [31]. Elicitors are dissolved in distilled or deionized
water and added to the culture medium before sterilization.
A set of control cultures without elicitors could be included.
10. Alternatively, dry plant material in an incubator at 60 °C during
36 h until constant weight. This drying method is less conve-
nient due to the loss of some organic compounds during the
process, although not in significant amounts.
11. Due to the minor contents of pharmaceutical agents we
extracted only twice with the 20 mL mixture. If there are high
contents, the extraction could be repeated. In order to elimi-
nate water, Na2SO4 could be added, mix it by hand, centrifuge
at 11,500 × g for 1 min, and pass the organic phase to new
flask. The solution should be clear.
12. The gradient elution profile is 4 → 34 min, A (acetoni-
trile) = 25 %; 34 → 45 min, A = 37 %; 45 → 60 min, A = 50 %;
60 → 65 min, A = 25 %.
13. Bacterial stocks are maintained in 20 % (v/v) glycerol-
containing growing medium with appropriate antibiotics and
stored at −80 °C.
14. More dense bacterial cultures may cause overgrowth during
cocultivation.
15. Include extra control samples for the transformation and
selection process and for assessing transient reporter gene
expression. In order to control the selection process place
untransformed leaf segments on antibiotic-free CIM as well as
on a medium supplemented with both geneticin and timentin.
Finally, include several control samples, which will not be
infected with Agrobacterium and are cultured on nonselective
medium to assess the callus formation and regeneration capac-
ity and to provide untransformed control plants for later
analyses.
16. Sterilize paper towels by wrapping in aluminum foil and auto-
claving for 20 min at 121 °C.
17. The selection agent used will depend on the selectable marker
gene (SMG) present on the T-DNA of the binary vector. Only
those plant cells containing the T-DNA harboring the SMG
will survive in the presence of the selection agent to which the
100 Naivy Pérez-Alonso et al.

marker provides resistance. The nptII gene is one of the most

commonly used selectable markers; it confers resistance to
kanamycin, geneticin (G-418), and paromomycin. For callus
induction in D. purpurea geneticin can be used as selective
agent at 70 mg/L. Geneticin is light sensitive, so store and
incubate selective CIM in the dark. The timentin is incorpo-
rated into the medium to kill the Agrobacterium. At a concen-
tration of 200 mg/L, timentin is effective in eradicating several
Agrobacterium strains (e.g., C58C1RifR (pMP90), LBA4404,
EHA101, EHA105) without evident damage to plant cells.
18. Add β-mercaptoethanol in fume hood just before use.
19. PCR amplification reactions contain 200 ng genomic DNA,
0.5 μM of each primer, 1.5 mM MgCl2, 200 mM dNTP, 1X
Taq polymerase reaction buffer, and 0.25 U Taq polymerase.
Prepare a master mix without template DNA in a single tube,
which can then be aliquoted into individual tubes (number of
samples +1, components are provided in excess of the required
amount to minimize the possibility of pipetting errors and to
save time). Be sure to mix the PCR master mix well before
aliquoting it into the sample tubes. Template DNA and prim-
ers are added to individual samples. Include a negative control
(PCR tube with water instead of genomic DNA) to check con-
tamination. Prepare each sample twice (one for each pair of
primers used for both genes: nptII and uidA).
20. A few non-transgenic cells are protected from the selection
agent by the high number of calli obtained per leaf segment and
escapes occurred. With this protocol, only four GUS-negative
lines obtained with strain C58C1RifR (pMP90) showed neither
uidA nor nptII genes (4.6 % escapes). Perhaps the increase of
selection pressure (e.g., by applying an antibiotic gradient)
could prevent this problem. As observed in Fig. 4a, one GUS-
negative line (lane 2) did not contain the uidA gene but the
nptII gene was present. These results indicate the integration of
a truncated T-DNA. All transgenic plants analyzed that were
positive for the presence of the uidA gene in the PCR assay also
showed constitutive GUS expression in leaves, indicating the
presence of a full functional transgene.

Acknowledgments

The authors wish to thank the support of the EU through the

ALFA Network CARIBIOTEC (project AML/B7-311/97/0666/
II-0201), the German Ministry for Education and Research
(BMBF), the Cuban Ministry of Science, Technology and Envi-
ronment (CITMA), and the Institutional University Collaboration
programme with Universidad Central “Marta Abreu” de Las Villas
funded by the Flemish Interuniversity Council (VLIR-IUC UCLV).
 Biomass and Cardenolides Production 101

References
1. Sales E, Müller-Uri F, Nebauer SG, Segura J, 12. Sankar-Thomas YD, Lieberei R (2011)
Kreis W, Arillaga I (2011) Digitalis. In: Kole C Camptothecin accumulation in various organ
(ed) Wild crop relatives: genomic and breeding cultures of Camptotheca acuminata Decne
resources plantation and ornamental crops. grown in different culture systems. Plant Cell
Springer, Berlin Heidelberg, pp 73–112 Tiss Org Cult 106:445–454
2. Kreis W, May U, Reinhard E (1986) UDP- 13. Schumann A, Berkov S, Claus D, Gerth A,
Glucose: digitoxin 16’-O-glucosyltransferase Bastida J, Codina C (2012) Production of
from suspension cultured Digitalis lanata cells. galanthamine by Leucojum aestivum shoots
Plant Cell Rep 5:442–445 grown in different bioreactor systems. Appl
3. Lindemann P, Luckner M (1997) Biosynthesis Biochem Biotechnol 167:1907–1920
of pregnane derivatives in somatic embryos of 14. Murashige T, Skoog F (1962) A revised
Digitalis lanata. Phytochemistry 46:507–513 medium for rapid growth and bioassays with
4. Shimomura K, Yoshimatsu K, Sauerwein M, tobacco tissue cultures. Physiol Plant
Christen P, Toda Y, Aoki T (1992) Production 15:473–497
of biologically active compounds by trans- 15. Koncz C, Schell J (1986) The promoter of TL-
formed cultures. In: Oono R, Hirabayashi T, DNA gene 5 controls the tissue-specific expres-
Kiruchi S, Handa H, Kahwara S (eds) Plant tis- sion of chimeric genes carried by a novel type
sue culture and gene manipulation for breed- of Agrobacterium binary vector. Mol Gen
ing and formation of phytochemicals. National Genet 204:383–396
Institute of Agrobiological Resources, Tsukuba, 16. Kapila J, De Rycke R, Van Montagu M,
Japan, pp 293–296 Angenon G (1997) An Agrobacterium-
5. Hagimori M, Matsumoto T, Obi Y (1983) mediated transient gene expression system for
Effects of mineral salts, initial pH and precur- intact leaves. Plant Sci 122:101–108
sors on digitoxin formation by shoot-forming 17. Jefferson RA, Kavanagh TA, Bevan MW
cultures of Digitalis purpurea L. grown in liq- (1987) GUS fusions: β-glucuronidase as a sen-
uid medium. Agri Biol Chem 47:565–571 sitive and versatile gene fusion marker in higher
6. Paek KY, Chakrabarty D, Hahn EJ (2005) plants. EMBO J 6:3901–3907
Application of bioreactor systems for large scale 18. Southern EM (1975) Detection of specific
production of horticultural and medicinal sequences among DNA fragments separated by
plants. Plant Cell Tiss Org Cult 81:287–300 gel electrophoresis. J Mol Biol 98:503–517
7. Takayama S, Akita M (2005) Practical aspects 19. Khayat E, Duvdevani A, Lehav E, Ballesteros
of bioreactor application in mass propagation BA (2004) Somaclonal variation in banana
of plants. In: Hvoslef-Eide AK, Preil W (eds) (Musa acuminata cv. Grande Naine). Genetic
Liquid culture systems for in vitro plant propa- mechanism, frequency, and application as a
gation. Springer, Dordrecht, pp 61–78 tool for clonal selection. In: Jain SM, Swennen
8. Jiménez E (2005) Mass propagation of tropical R (eds) Banana improvement: cellular, molecu-
crops in temporary immersion system. In: lar biology, and induced mutation. Science
Hvoslef-Eide AK, Preil W (eds) Liquid culture Publishers Inc, Plymouth, UK, pp 99–109
systems for in vitro plant propagation. Springer, 20. Blondeau JM, Castañedo N, González O,
Dordrecht, pp 197–211 Medina R, Silveira E (1999) In vitro evaluation
9. Berthouly M, Etienne H (2005) Temporary of G-1: a novel antimicrobial compound. Int
immersion system: a new concept for use liquid J Antimicrob Agents 11:163–166
medium in mass propagation. In: Hvoslef-Eide 21. Quiala E, Jimenez E, Feria M, Alvarado Y,
AK, Preil W (eds) Liquid culture systems for in Chávez M, Agramonte D, Ramírez D, Acosta
vitro plant propagation. Springer, Dordrecht, M, Pérez N, Capote A (2002) Empleo del
pp 165–195 Vitrofural en la esterilización química del endo-
10. Georgiev V, Schumann A, Pavlov A, Bley T spermo artificial de los embriones encapsulados
(2014) Temporary immersion systems in plant de Saccharum spp. Híbrido var Cuba 87-51.
biotechnology. Eng Life Sci 14:607–621 Biotechnol veg 2(4):221–226
11. Quiala E, Barbón R, Jiménez E, de Feria M, 22. Reyes M, Gómez R, Moreno L, Dion D (2014)
Chávez M, Capote A, Pérez-Alonso N (2006) Secondary multiplication of somatic embryos
Biomass production of Cymbopogon citratus in banana (Musa spp. AAA) in semisolid
(DC) Stapf., a medicinal plant, in temporary medium: effect of the type of culture vessel and
immersion systems. In Vitro Cell Dev Biol- sterilization method. J Adv Biotechnol 4:
Plant 42:298–300 352–357
102 Naivy Pérez-Alonso et al.

23. Ziv M (1990) Vitrification: morphological and 27. Bandyopadhyay T, Gangopadhyay G, Poddar
physiological disorders of in vitro plants. In: R, Mukherjee K (2004) Trichomes their diver-
Debergh PC, Zimmerman RH (eds) Micro- sity, distribution and density in acclimatization
propagation: technology and application. of Teak (Tectona grandis L.) plants grown in
Kluwe Academic Publishers, Dordrecht, The vitro. Plant Cell Tiss Org Cult 78:113–121
Netherlands, pp 45–69 28. Eisenbeiβ M, Kreis W, Reinhard E (1999)
24. Debergh P, Aitken-Christie J, Cohen D, Grout Cardenolide biosynthesis in light- and dark-
B, Von Arnold S, Zimmerman R, Ziv M (1992) grown Digitalis lanata shoot cultures. Plant
Reconsideration of the term ‘vitrification’ as Physiol Biochem 37:13–23
used in micropropagation. Plant Cell Tiss Org 29. Namdeo AG (2007) Plant cell elicitation for
Cult 30:135–140 production of secondary metabolites: a review.
25. Kevers C, Franck T, Strasser RJ, Dommes J, Pharmacog Rev 1:69–79
Gaspar T (2004) Hyperhydricity of microprop- 30. Pérez-Alonso N, Capote A, Gerth A, Jiménez
agated shoots: a typically stress-induced change E (2012) Increased cardenolides production
of physiological state. Plant Cell Tiss Org Cult by elicitation of Digitalis lanata shoots cul-
77:181–191 tured in temporary immersion systems. Plant
26. Pérez-Alonso N, Wilken D, Gerth A, Jahn A, Cell Tiss Org Cult 110:153–162
Nitzsche HM, Kerns G, Capote A, Jiménez E 31. Pérez-Alonso N, Arana F, Capote A, Pérez A,
(2009) Cardiotonic glycosides from biomass of Sosa R, Mollineda A, Jiménez E (2014)
Digitalis purpurea L. cultured in temporary Stimulation of cardenolides production in
immersion systems. Plant Cell Tiss Org Cult Digitalis purpurea L. shoot cultures by elicitors
99:151–156 addition. Rev Colomb Biotechnol 16:51–56
 Chapter 7

In Vitro Regeneration of Endangered Medicinal Plant

Heliotropium kotschyi (Ramram)
Manal Ahmed Sadeq, Malabika Roy Pathak, Ahmed Ali Salih,
Mohammed Abido, and Asma Abahussain

Abstract
Heliotropium kotschyi (Ramram) is an important endangered medicinal plant distributed in the Kingdom
of Bahrain. Plant tissue culture technique is applied for ex situ conservation study. Nodal stem segments
are cultured in modified MS media supplemented with various combination and concentration of plant
growth regulators (PGRs). Plants are regenerated via shoot organogenesis from the nodal meristems.
Plants are regenerated in three different steps: initial shoot development, shoot multiplication, and root-
ing. After 4 weeks of culture, 100 % explants respond to shoot initiation on the medium containing
8.88 μM BAP and 5.71 μM IAA. The highest frequency of shoot regeneration is observed in the same
media after second subculture of shoots. The highest rooting frequency is observed in the presence of
2.85 μM IAA. After root development, the plantlets are transferred to pots filled with soil and 60 % of
plants survived after 45 days. This plant regeneration protocol is of great value for rapid desert plant propa-
gation program.

Key words Endangered, Ex situ conservation, Heliotropium kotschyi, Organogenesis, Plant

regeneration

1 Introduction

Desert plants in dry ecosystems owe their importance to a long

history of evolution and adaptation in dry and hot deserts. They
are important as a source of good gene pool in food chain, extreme
environmental adaptability, herbal medicine for human health, etc.
Also, they prevent soil erosion for maintaining soil fertility. In
Bahrain, 81 plant species are indigenous and reported to be used
in traditional herbal medicine [1]. The importance of medicinal
plants both in drug research and genetic biodiversity conservation
is now well recognized.
Heliotropium kotschyi (local name Ramram) belongs to
Boraginaceae family, and is an endangered, important medicinal

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_7, © Springer Science+Business Media New York 2016

103
104 Manal Ahmed Sadeq et al.

plant distributed in Bahrain [2]. The plant is in general used as an

antidote for snake venom; it is used so either by drinking the water
extract of leaves or by applying leaf paste on the snake bite [3].
Global worry about the loss of valuable plant genetic resources
has stimulated many advanced programs to conserve genetic
diversity using either in situ or ex situ conservation strategies [4].
The application of in vitro culture as an important conservation
tool of the rare, threatened, and endangered plants has gained a
huge drive in the last two decades and is considered as one of the
greatly applicable program of ex situ conservation strategy [5–8].
Different techniques of plant tissue culture are used for propaga-
tion, rapid proliferation, preservation, and storage of several
medicinally important endangered and threatened plants [8, 9].
Considering the multipurpose importance of endangered desert
plants, the biotechnological tool of plant tissue culture is applied
to multiply them rapidly for conservation purposes [2, 9]. Here,
we describe a highly efficient in vitro plant regeneration protocol
for H. kotschyi.

2 Materials

2.1 Explant 1. Collection of apical shoots of 1-year-old Ramram (Heliotropium

kotschyi) plants (Fig. 1a) from Al-Areen Wildlife Park in the
Kingdom of Bahrain (see Note 1)

2.2 Chemicals 1. Murashige and Skoog (MS) medium [10] (see Note 2).
2. Stock solutions of vitamins (see Note 3).
3. Stock solutions of plant growth regulators (see Note 4).
4. 1 % (v/v) Lux solution (Soap).
5. 0.5 % mercuric chloride solution.
6. Tween 20.
7. 0.1 % Copral solution.
8. 50 % (v/v) Clorox solution.
9. 70 % (v/v) ethanol.
10. 0.1 M hydrochloric acid (HCl).
11. 0.1 M sodium hydroxide (NaOH).
12. Casein hydrolysate.
13. Sucrose.
14. Agar.

2.3 Equipment 1. Balance.

2. Measuring cylinder.
 Micropropagation of Endangered Plant Heliotropium kotschyi 105

Fig. 1 Stages of micropropagation of Heliotropium kotschyi. Field-grown plants (a); stem segment for
surface sterilization (b); explants in media 1 after 4 weeks (c); explants show shoot initiation response in
media 4 after 2 weeks (d); initiated shoots in media 4 after 4 weeks (e); multiplication of initially developed
shoot in first transferred media after 4 weeks (f); multiplication of shoots in second transferred media after 4
weeks (g); micro-shoots developing roots (h); plantlet growing in pots containing soil (i)

3. Magenta vessels.
4. pH meter.
5. Autoclave.
6. Millipore water, autoclaved.
7. Laminar flow air cabinet.
8. Refrigerator.
9. Plant culture room.
106 Manal Ahmed Sadeq et al.

3 Methods

3.1 Preparation 1. Dissolve 4.4 g MS powder in 800 ml autoclaved water and

of Culture Media supplement with 0.3 % casein hydrolysate, 3 % sucrose, 0.1 %
nicotinic acid, 0.1 % pyridoxine–HCl, 1 % thiamine–HCl.
Adjust pH of the medium to 5.8 by adding NaOH, make up
the volume to 1 L, solidify by adding 0.9 % agar, and autoclave
at 121 °C, for 20 min at 15 psi.
2. Add different concentrations and combinations of filter-
sterilized plant growth regulators (PGRs) such as
6-benzylaminopurine (BAP), kinetin (KI), 3-indoleacetic acid
(IAA), 1-naphthaleneacetic acid (NAA), indole-3-butyric acid
(IBA) in the autoclaved modified MS media for culture initia-
tion, shoot multiplication, and rooting (Tables 1 and 2).

3.2 Explant 1. Use apical shoots of H. kotschyi (Fig. 1b) for surface steriliza-
Sterilization tion (see Note 5).

3.3 Culture Initiation 1. Culture initiation experiments follow completely randomized

and Plant design (CRD) with three replicates and 3–5 explants per
Regeneration replication.
2. Transfer surface-sterilized nodal stem segments to culture ini-
tiation media containing various concentrations and combina-
tions of PGRs (Table 1).
3. Incubate cultures in culture room for 4 weeks to see the initial
response. The culture room should provide 40–50 μmol/
m2 s–1 fluorescent light intensity for 16 h photoperiod,
24 °C± 2 °C temperature, and 70–80 % relative humidity.
4. MS media without any PGRs show no shoot initiation response
(Fig. 1c).
5. The nodal explants start shoot initiation in media containing
PGRs within 2–4 weeks of culture initiation (Fig. 1d).
6. Initially developed shoots show good growth after 4 weeks of
culture and 100 % explants respond to initiate shoot develop-
ment in the presence of 8.88 μM BAP with 5.71 μM IAA after
4 weeks (Fig. 2) (see Note 6).
7. A comparison of shoot initiation frequencies in different PGRs
combinations and concentrations is shown in (Table 3) (see
Note 7). The highest shoot initiation frequency has been
noticed in the presence of 8.88 μM BAP with 5.71 μM IAA
(Fig. 1e).
8. Transfer initially developed shoots to different multiplication
media (Table 4) and observe the best performance in subcul-
ture media containing 8.88 μM BAP with 5.71 μM IAA
(Fig. 1f) (see Note 8).
 Micropropagation of Endangered Plant Heliotropium kotschyi 107

Table 1
Concentration and combination of PGRs in modified MS media for culture
initiation and multiplication

Name of media Concentration of PGRs (μM)

1 Medium without hormone
2 4.44 μM BAP + 2.85 μM IAA
3 6.66 μM BAP + 2.85 μM IAA
4 8.88 μM BAP + 5.71 μM IAA
5 13.3 μM BAP + 5.71 μM IAA
6 4.44 μM BAP + 2.68 μM NAA
7 6.66 μM BAP + 2.68 μM NAA
8 8.88 μM BAP + 5.37 μM NAA
9 13.3 μM BAP + 5.37 μM NAA
10 4.65 μM KI + 2.85 μM IAA
11 6.97 μM KI + 2.85 μM IAA
12 9.29 μM KI + 5.71 μM IAA
13 13.9 μM KI + 5.71 μM IAA
14 4.65 μM KI + 2.68 μM NAA
15 6.97 μM KI + 2.68 μM NAA
16 9.29 μM KI + 5.37 μM NAA
17 13.9 μM KI + 5.37 μM NAA
18 0.89 μM BAP
19 2.22 μM BAP
20 4.44 μM BAP
21 8.88 μM BAP

Table 2
Concentration and combination of PGRs in modified MS media for
subculture and rooting

Name of media Concentration of PGRs (μM)

22 8.88 μM BAP + 1.14 μM IAA
26 1 % charcoal + 7.4 μM IBA
27 1 % charcoal + 9.84 μM IBA
28 0.93 μM KI + 5.71 μM IAA
30 2.85 μM IAA
108 Manal Ahmed Sadeq et al.

Fig. 2 Effect of various plant growth regulators supplemented to modified MS medium on in vitro shoot initiation
from nodal segments of explants of H. kotschyi after 2 and 4 weeks of culture. PGR concentration in Table 1

Table 3
Effect of various plant growth regulators supplemented to modified MS
media on in vitro shoot initiation response from shoot apex and nodal
explants of H. kotschyi after 4 weeks of culture. Results are means of
shoots developed per explant. Means followed by the same letter are not
significantly different at P ≤ 0.05

Name of media PGR concentrations (μM) Mean

4 8.88 μM BAP + 5.71 μM IAA 10.66 A
5 13.3 μM BAP + 5.71 μM IAA 8B
3 6.66 μM BAP + 2.85 μM IAA 5.33 C
13 13.9 μM KI + 5.71 μM IAA 4D
10 4.65 μM KI + 2.85 μM IAA 3.66 D E
14 4.65 μM KI + 2.68 μM NAA 3.66 D E
9 13.3 μM BAP + 5.37 μM NAA 3DEF
11 6.97 μM KI + 2.85 μM IAA 3DEF
12 9.29 μM KI + 5.71 μM IAA 3DEF
2 4.44 μM BAP + 2.85 μM IAA 2.66 E F G
19 2.22 μM BAP 2.66 E F G
6 4.44 μM BAP + 2.68 μM NAA 2FG
15 6.97 μM KI + 2.68 μM NAA 2FG
17 13.9 μM KI + 5.37 μM NAA 2FG
20 4.44 μM BAP 2FG
continued
 Micropropagation of Endangered Plant Heliotropium kotschyi 109

Table 3
(continued)

Name of media PGR concentrations (μM) Mean

7 6.66 μM BAP + 2.68 μM NAA 1.66 G
18 0.89 μM BAP 1.66 G
8 8.88 μM BAP + 5.37 μM NAA 1H
16 9.29 μM KI + 5.37 μM NAA 1HI
21 8.88 μM BAP 1HI
1 Medium without PGRs 0I

Table 4
Effect of BAP, KI, IAA, IBA, and NAA on percentage of shoot multiplication frequency after first
transfer of H. kotschyi. PGR concentration in Tables 1 and 2

Name of media Percentage of proliferated shoot Shoot multiplication frequency

1 0 0
3→4 100 15
4→4 92.3 12.07
5→4 75 2.5
6→4 87.5 8.1
7→4 33.3 3.33
7 → 28 100 12.5
8→4 50 7.5
9→4 100 5
20 → 22 100 7.6

9. Calculate plant regeneration capacity of H. kotschyi based on

shoot initiation frequency of explants and multiplication fre-
quency of initially developed shoots after first and second
transfer (Fig. 3) (see Note 9).
10. Transfer newly formed micro-shoots, 1–2 cm long to rooting
media containing 2.85 μM IAA (Fig. 1h) (see Note 10).
11. Transfer plantlets to pots containing soil (Fig. 1i) (see
Note 11).
110 Manal Ahmed Sadeq et al.

Fig. 3 Plant regeneration capacity of H. kotschyi after 2nd transfer in media 1

while initial shoots develop from culture of nodal explants in different media [1,
4, 6–8] and their multiplication in media 4. PGR concentration in Table 1

4 Notes

1. Collect apical shoots (12–15 cm long) from 1-year-old actively

growing field-grown plants for experiments. Cut them into
pieces and store in plastic bags at 4 °C for future use.
2. Use MS powder for all experiments.
3. Make stock solutions of vitamins: 1 mg/ml nicotinic acid,
1 mg/ml pyridoxine–HCl, and 10 mg/ml thiamine–HCl,
then filter-sterilize with sterile Acrodisc 0.45 μm, and store in
a refrigerator (4 °C) until future use.
4. For the preparation of PGR stock solutions at 2 mg/ml con-
centration, weigh 100 mg IAA, NAA, IBA, KI, BAP, sepa-
rately, dissolve in 2 ml 100 mM NaOH solution, add autoclaved
water to raise the volume to 50 ml, then filter-sterilize using
sterile Acrodisc 0.45 μm. Store them at −20 °C for future use
and keep at 4 °C for routine use.
5. Surface-sterilize the stem segments by using subsequent mix-
tures of 1 % Lux solution (soap solution), 0.5 % mercuric
chloride with few drops of Tween 20, 0.1 % Copral, 50 % (v/v)
Clorox (containing 2.625 % hypochlorite), 70 % ethanol. Then
slice the stem segments into smaller segments (1–1.5 cm), each
containing one node, for use as explants for culture initiation.
6. The nodal explants initiate highest 100 % direct multiple shoot
formation on the modified MS medium containing 8.88 μM
BAP with 5.71 μM IAA after 4 weeks of culture.
 Micropropagation of Endangered Plant Heliotropium kotschyi 111

7. The results show significant differences (P ≤ 0.05 level) by

ANOVA according to Duncan’s multiple range test
(DMRT) using JMP (version 9) statistical software. After 4
weeks of culture, the highest shoot initiation frequency is
10.6 on MS medium supplemented with 8.88 μM BAP and
5.71 μM IAA.
8. 100 % shoot proliferation in association with the highest shoot
multiplication frequency of initially developed shoots is
observed during subculture in media containing 8.88 μM
BAP with 5.71 μM IAA.
9. The highest plant regeneration capacity is observed while
explants are cultured subsequently in media with higher con-
centration of BAP (8.88 μM) and lower concentration of IAA
(5.71 μM) than other combinations and concentrations of
PGRs. Similarly, several studies report that higher concentra-
tions of BAP with lower concentrations of IAA induce multi-
ple shoots in Salvia africana-lutea L. [11], Melissa officinalis
L. [12]. The stages of in vitro plantlet regeneration of H.
kotschyi are shown in Fig. 1.
10. Gently remove culture media sticking to roots by washing
with autoclaved distilled water and transfer rooted plantlets
(Fig. 1h) to plastic pots containing autoclaved compost soil
(1:1 mixture of peat substrate and potting soil); and keep
them in a small transparent covered chamber to maintain
humidity. The plants acclimatize in room conditions at
25 °C ± 3 °C, 16/8 h photoperiod and by regular watering at
3 days interval.
11. Expose gradually well-developed rooted plantlets (Fig. 1i) to
normal growing conditions and 60 % plantlets survive after 45
days.
12. This is the first report on the micropropagation of this endan-
gered plant in the Kingdom of Bahrain.
13. The establishment of in vitro culture and efficient plant regen-
eration protocol is a crucial initial step of ex situ conservation
strategy.

Acknowledgements

The work was supported by College of Graduate Studies, Desert

and Arid Zone Sciences Program, Arabian Gulf University,
Manama, Kingdom of Bahrain.
112 Manal Ahmed Sadeq et al.

References
1. El-Oqlah A, Abbas J (1994) A checklist of 7. Cruz-Cruz AC, Gonzalez-Arnao TM,
vascular plants of Bahrain. Dirasat Engelmann F (2013) Biotechnology and conser-
J 21:95–118 vation of plant biodiversity. Resources 2:73–95
2. Sadeq AM, Pathak RM, Salih AA, Abido M, 8. Pathak MR, Abido SM (2014) The role of bio-
Abahussain A (2014) Heliotropium kotschyi technology in the conservation of biodiversity.
(Ramram) in the Kingdom of Bahrain. Am J Expt Biol Agric Sci 2(4):352–363
J Plant Sci 5(5):736–747 9. Sadeq MA, Pathak MR, Ahmed AS, Abido M,
3. Al-Eisawi D (2003) Effect of biodiversity con- Abahussain A (2014) Effect of plant growth
servation on arid ecosystem with a special regulators on regeneration of the endangered
emphasis on Bahrain. J Arid Environ medicinal plant Calligonum comosum L. henry
54:81–90 in the Kingdom of Bahrain. Afr J Biotechnol
4. Cardinal B, Duffy E, Gonzalez A, Hooper D, 13(24):2513–2523
Perrings C, Venail P, Narwani A, Mace G, 10. Murashige T, Skoog F (1962) A revised
Tilman D, Wardle D, Kinzig A, Daily G, medium for rapid growth and bioassay with
Loreau M, Grace J, Larigauderie A, Srivastava tobacco tissue culture. Physiol Plant
D, Naeem S (2012) Biodiversity loss and its 15:473–497
impact on humanity. Nature 486:59–67 11. Makunga N, Staden J (2008) An efficient sys-
5. Paunescu A (2009) Biotechnology for endan- tem for the production of clonal plantlets of
gered plant conservation: a critical overview. the medicinally important aromatic plant:
Rom Biotech Lett 14(1):4095–4103 Salvia Africana-lutea L. Plant Cell Tissue
6. Khan S, Al-Qurainy F, Mohammad N (2012) Organ Cult 92:63–72
Biotechnological approaches for conservation 12. Ghiorghita GI, Mafteli DES, Nicuta DN
and improvement of rare and endangered (2005) Investigations on the in vitro morpho-
plants of Saudi Arabia. Saudi J Biotech Services genetic reaction of Melissa officinalis L. spe-
19:1–11 cies. Genet Mol Biol 5:119–125
 Chapter 8

Micropropagation and Biomass Production of True-to-Type

Stevia rebaudiana Bertoni
Arpan R. Modi, Vikas Sharma, Ghanshyam Patil, Amritpal S. Singh,
N. Subhash, and Nitish Kumar

Abstract
Here we describe an efficient micropropagation protocol for Stevia rebaudiana Bertoni. We present exper-
iments carried out to optimize the suitable media for in vitro shoot multiplication and root induction and
to study the effect of culture vessel on shoot multiplication. Among all different media tested for in vitro
shoot multiplication, hormone-free liquid medium is most suitable. The highest number of nodes per
shoot (5.4) and length of shoot (4.76 cm) at 4 weeks after subculturing are observed when single node
explants are placed on modified MS medium supplemented with 1 % sucrose and 0.7 % agar. The highest
response of multiplication rate (9.56) is observed on half strength of macroelement of MS with full
strength of microelement of MS and 170 mg/l KH2PO4, and 185 mg/l MgSO4 in plastic growth container.
Further, RAPD marker analysis of in vitro-raised plants maintained their clonal fidelity and true-to-type
without showing any somaclonal variation.

Key words Culture vessel, Genetic fidelity, Liquid culture, Micropropagation, RAPD, Stevia
rebaudiana

1 Introduction

Stevia, Stevia rebaudiana Bertoni, is a small shrub of family

Asteraceae, and valuable to the industry and pharmacy. Its leaves
contain a glycoside called stevioside, which has been used as a nat-
ural sweetener for a long time [1]. The stevioside is reported to be
over 200–300 times sweeter than sucrose [2]. This sweetener,
being non-carbohydrate in nature, does not induce tooth decay,
can be consumed safely by diabetic patients, and can also be used
in low-caloric diets to reduce human body weight. Conventional
propagation by seeds is restricted due to the poor seed viability
coupled with poor germination rate [3]. Moreover, the crop is
cross-pollinated, and to raise an elite uniform plant population
with high stevioside content is not possible. Thus, conventional

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_8, © Springer Science+Business Media New York 2016

113
114 Arpan R. Modi et al.

propagation through seeds do not produce true-to-type plants.

Vegetative propagation by rooted stem cuttings is being impracti-
cal and inadequate to meet the demand of the industry. Thereby
there is a need for a reliable and efficient micropropagation method
for the large-scale production of true-to-type plants and genetic
improvement of the species using genetic engineering techniques.
Micropropagation of S. rebaudiana with in vitro techniques
has been reported [4–7]. For developing an efficient micropropa-
gation protocol, we evaluated various factors affecting in vitro
multiplication of S. rebaudiana viz., strength of Murashige and
Skoog (MS) salt, culture vessel type, and media consistency (solid
or liquid). Considering the suitability of liquid culture systems in
scaling up of production by automation through the use of biore-
actors and reduced cost of media due to elimination of solidifying
agent and comparative analysis of in vitro multiplication on both
solid and liquid media, Modified MS salt medium [8] proved effec-
tive, and could also eliminate the cost of the macroelements to
half. In addition, scaling up of any micropropagation protocol is
severely hindered by somaclonal variation. Somaclonal variation
occurs mostly in response to the stresses imposed on the plants
under in vitro conditions [9]. Hence, a stringent quality check in
terms of genetic similarity of the tissue culture raised plants
becomes mandatory. Randomly amplified polymorphic DNA
(RAPD) based detection of genetic polymorphism [10, 11] has
been found successful application in describing somaclonal vari-
ability in micropropagated individuals of several plants species [12–
18]. This book chapter describes a simple and efficient in vitro
micropropagation method for mass propagation of true-to-type
plants and to evaluate the genetic stability of micropropagated
S. rebaudiana plants using the RAPD marker.

2 Materials
2.1 Culture 1. Axillary nodes of Stevia plants are collected from the nursery.
Establishment 2. Autoclaved deionized water.
in Liquid MS Medium
3. 1 mg/ml cefotaxime.
and Micropropagation
4. 0.5 mg/ml kanamycin.
5. 1 mg/ml Bavistin.
6. Stock solution of MS salts [19]: Nutrient salts and vitamins
stock solutions (Table 1).
7. 0.2 mg/ml 6-benzylaminopurine (BAP).
8. 0.2 mg/ml kinetin.
9. 0.2 mg/ml indole-3-butyric acid (IBA).
10. 0.1 % mercuric chloride.
 In Vitro Propagation of Stevia Rebaudiana Bertoni 115

Table 1
Required amount of components of MS medium for stock preparation

Required Weight for stock Stock

Category Chemical concentration (mg/l) (mg/l) concentration
Macroelements NH4NO3 1650 33,000 20×
KNO3 1900 38,000
CaCl2·2H2O 440 8800
MgSO4·2H2O 370 7400
KH2PO4 170 3400
Minor elements KI 0.83 166 200×
H3BO3 6.2 1240
MnSO4·2H2O 22.3 4460
ZnSO4·7H2O 8.6 1720
Na2.MoO4·2H2O 0.25 50
CuSO4·5H2O 0.025 5
CoCl2·6H2O 0.025 5
Iron source FeSO4·7H2O 27.8 5560 200×
Na2EDTA·2H2O 37.3 7460
Vitamins Myo-inositol 100 20,000 200×
Nicotinic acid 0.5 100
Pyridoxine–HCl 2 100
Thiamine–HCl 2 100
Glycine 2 400
Carbon source Sucrose 30,000 Use directly –

2.2 DNA Isolation 1. Tris–HCl 1 M (pH 8).

2. Sodium chloride (5 M).
3. EDTA (0.5 M).
4. Magnetic stirrer.
5. Deionized water.
6. Cetyl trimethyl ammonium bromide (CTAB) (2 %).
7. ß-mercaptoethanol (1 %).
8. Polyvinyl pyrrolidone (PVP) (1 %).
9. Sodium acetate (3 M).
10. TBE (Tris–borate–EDTA) electrophoresis buffer.
11. Ethanol (70 %).
12. Ethidium bromide (10 mg/ml).
116 Arpan R. Modi et al.

2.3 PCR 1. DNA 4 ng/μl.

Amplification 2. Taq DNA polymerase 0.1 U/μl.
3. dNTP mix 0.2 nmol
4. PCR buffer containing 1.5 mM of MgCl2.
5. Primer 0.4 pmol.

2.4 Gel 1. Agarose gel (1.8 %).

Electrophoresis 2. 100 ml TBE buffer (pH 8.0).
3. Ethidium bromide (10 mg/ml).

3 Methods

Prepare all solutions using ultrapure water deionized (prepared by

purifying Milli-Q water purification system) and molecular grade
reagents. Prepare and store all reagents at 4 °C temperature.

3.1 Preparation 1. Cefotaxime (1 mg/ml): 1000 mg cefotaxime powder in 1 L

of Stock Solutions autoclaved deionized water.
2. Kanamycin (0.5 mg/ml): Add 500 mg kanamycin in 1 L auto-
claved deionized water.
3. Bavistin (1 mg/ml): Add 1000 mg Bavistin in 1 L autoclaved
deionized water.
4. BAP (0.2 mg/ml): Add 20 mg BAP in 100 ml autoclaved
deionized water (see Note 1).
5. Kinetin (0.2 mg/ml): Add 20 mg kinetin in 100 ml autoclaved
deionized water (see Note 1).
6. IBA (0.2 mg/ml): Add 20 mg IBA in 100 ml autoclaved
deionized water (see Note 1).
7. Mercuric chloride (0.1 %): Add 100 mg mercuric chloride in
1 L autoclaved deionized water. Utmost precaution should be
taken while handling this chemical (see Note 2).
8. Tris–HCl 1 M (pH 8): Add 12.11 g Tris base in 100 ml auto-
claved deionized water (see Note 3).
9. Sodium chloride (5 M): Add 146.1 g NaCl in 500 ml auto-
claved deionized water (see Note 4).
10. EDTA (0.5 M): Add 181.6 g of Na2EDTA·2H2O to about
1000 ml of autoclaved deionized water (see Note 5).
11. Sodium acetate (3 M): Add 2.461 g of sodium acetate in 10 ml
autoclaved deionized water.
12. Ethanol (70 %): Add 30 ml autoclaved deionized water in
70 ml of ethanol.
 In Vitro Propagation of Stevia Rebaudiana Bertoni 117

13. TBE (Tris–borate–EDTA) electrophoresis buffer (1 L): Add

108 g Tris base (890 mM), 55 g boric acid (890 mM), and
40 ml (0.5 M EDTA, pH 8.0) in 960 ml autoclaved deion-
ized water.

3.2 Culture 1. Surface-sterilize explants with various sterilizing agents (see

Establishment Note 6) as mentioned in Table 2.
on Liquid MS Medium 2. Prepare shoot induction and proliferation MS media: Both liq-
and Micropropagation uid and solid medium containing full and half strength of MS
salts for the comparative performance. These media contain
2 mg/l kinetin and 1 mg/l BAP. Moreover, recommended
hormone-free modified MS mediums in solid and liquid condi-
tion are also taken (Table 3).
3. Culture aseptic nodal segments vertically on full, half and
modified MS medium amended with half strength of macroel-
ements and full strength of microelement and 170 mg/l
KH2PO4, and 185 mg/l MgSO4; and supplemented with or
without 1 mg/l BAP and 2 mg/l kinetin for the emergence of
shoots from auxiliary buds and shoot proliferation (Table 3).
4. Mass multiplication of shoots using different culture vessel
types: For the increased biomass production, proliferated fur-
ther multiply in different culture vessel type, viz., Flask, Bottle,
and Big sized container (2 L capacities) and growth obtained
is shown in Fig. 1 (Table 4).
5. Root induction and hardening: Root induction is carried out
in liquid medium (Table 5) containing 0.1 mg/l IBA,
100 mg/l charcoal and both with full and half strength of MS
salts (Fig. 2). Micropropagated plants further hardened on
soil–coco peat (1:1) mixture and then transferred to polythene
bags containing soil as a medium.

Table 2
Surface sterilization treatment for the establishment of axenic cultures

Treatment Concentrations Time

Tween-20 2 drops 1 min
Autoclaved deionized water – 5 min
Cefotaxime 1 mg/ml 5 min
Kanamycin 0.5 mg/ml 5 min
Bavistin 1 mg/ml 10 min
Autoclaved deionized water – 5 min
Mercuric chloride 0.1 % 8 min
Autoclaved deionized water (5 washes) – 5 min
118 Arpan R. Modi et al.

Table 3
Shoot induction media and their response on shoot growth

Treatment Length of shoot (cm) No. of nodes per shoot

½ MS + 2 mg/l Kn + 1 mg/l BAP + 3 % Sucrose + 3.46 ± 0.11 3.6 ± 0.55
0.7 % agar
½ MS + 2 mg/l Kn + 1 mg/l BAP + 3 % sucrose 3.22 ± 0.08 2.6 ± 0.89
MS + 2 mg/l Kn + 1 mg/l BAP + 3 % sucrose + 3.92 ± 0.24 4.4 ± 1.52
0.7 % Agar
MS + 2 mg/l Kn + 1 mg/l BAP + 3 % sucrose 3.70 ± 0.14 4.6 ± 0.89
Modified MS + 1 % sucrose + 0.7 % agar 4.76 ± 0.32 5.4 ± 1.14
Modified MS + 1 % sucrose 5.50 ± 0.27 7.2 ± 1.1
Modified MS = Half strength of macroelement of MS + full strength of microelement of MS + 170 mg/l
KH2PO4 + 185 mg/l MgSO4 (Source: [21])

Fig. 1 Shoot elongation in different culture vessel types: (a) flask culture; (b) glass bottle culture; and (c)
culture in big sized container (2 L capacity). (Source: [21])

Table 4
Shoot multiplication using different types of culture vessels containing
modified MS medium and 1 % sucrose

Culture vessel Media consistency Multiplication rate per node

Glass jar Solid 6.16 ± 0.94
Glass jar Liquid 6.45 ± 1.04
Glass flask Liquid 5.96 ± 0.84
Plastic growth Liquid 9.56 ± 1.08
container
Modified MS = Half strength of macroelement of MS + full strength of microelement of
MS+ 170 mg/l KH2PO4+ 185 mg/l MgSO4 (Source: [21])
 In Vitro Propagation of Stevia Rebaudiana Bertoni 119

Table 5
Observations for rooting seen under various root-inducing medium

Percentage Length of Length of Average Shoot

Media of rooting Average no. longest root shortest root length of root height No. of
code (%) of roots (cm) (cm) (cm) (cm) leaves
RI 1 33.3 4 1.0 0.3 0.5 5.75 23.1
RI 2 66.6 3 0.7 0.2 0.5 6.91 19.6
RI 3 87.5 20 1.2 0.3 0.7 7.81 22.5
RI 4 88.8 19 5.0 0.3 2.7 8.86 20.1
RI 5 100 13 4.3 0.3 3.3 9.52 28
RI 6 100 25 5.0 0.3 3.9 7.7 22.2
RI 1: MS + 0.1 mg/ml IBA; RI 2: ½ MS + 0.1 mg/ml IBA; RI 3: MS + 0.1 mg/ml IBA + 0.1 mg/ml charcoal; RI 4:
½ MS + 0.1 mg/ml IBA + 0.1 mg/ml charcoal; RI 5: MS + 0.1 mg/ml charcoal; RI 6: ½ MS + 0.1 mg/ml charcoal

Fig. 2 Root induction in micropropagation of Stevia in different liquid medium. RI 1: MS + 0.1 mg/ml IBA; RI 2:
½ MS + 0.1 mg/ml IBA; RI 3: MS + 0.1 mg/ml IBA + 0.1 mg/ml charcoal; RI 4: ½ MS + 0.1 mg/ml IBA + 0.1 mg/
ml charcoal; RI 5: MS + 0.1 mg/ml charcoal; RI 6: ½ MS + 0.1 mg/ml charcoal

3.3 DNA Extraction DNA isolation is carried out using the method described in Ref.
[20] with minor modifications.
1. Take 0.2 g of leaf tissue in liquid nitrogen and crush it to make
a fine powder of tissue.
2. Add 1 ml of CTAB extraction buffer (Table 6) prepared freshly
and keep the sample in water bath at 65 °C for 1 h and mix
gently in between at an interval of 15 min.
3. Keep the sample at room temperature for 10 min.
120 Arpan R. Modi et al.

Table 6
Components used in CTAB extraction buffer with their final concentrations

Component Final concentration Aliquot (10 ml)

Tris (1 M) 0.1 M 1.0 ml
EDTA (0.5 M) 0.04 M 0.8 ml
CTAB 2% 200 mg
PVP 1% 100 mg
ß-mercaptoethanol 1% 0.1 ml
NaCl 1.5 M 3.0 ml
Autoclaved deionized water – 5.1 ml

4. Centrifuge the sample at 2,000 × g for 5 min.

5. To the supernatant, add 1 ml of chloroform–isoamyl alcohol
(24:1) in supernatant and mix vigorously.
6. Centrifuge the sample at 11,000 × g for 8 min at 4 °C.
7. Take aqueous phase (see Note 7) and add double volume of
absolute alcohol containing 0.3 M (final concentration) of
sodium acetate.
8. Incubate at −20 °C for 4 h to overnight.
9. Centrifuge at 16,000 × g for 15 min at 4 °C.
10. Discard supernatant and wash the pellet with 80 % ethanol at
7,000 × g for 5 min at 4 °C.
11. Discard supernatant and add 0.2 ml of 1× TE buffer.
12. Quantify the DNA from sample and make the final concentra-
tion of DNA as 20 ng/μl and use it as a working solution of
DNA.

3.4 Polymerase 1. To 20 ng/μl DNA put a PCR reaction with different series of
Chain Reaction RAPD primers.
and Gel 2. Screen primers showing more than six bands (see Note 8).
Electrophoresis
3. Add PCR component as mentioned in Table 7 and put a PCR
with the cycling condition mentioned in Table 8.
4. Gel electrophoresis is performed in horizontal position on aga-
rose matrix. Prepare 1.8 % agarose gel in TBE buffer and add
3 μl EtBr per 100 ml gel. Pour the gel in gel caster and put
combs in it. Load the samples along with 100 bp DNA ladder
(Fig. 3).
 In Vitro Propagation of Stevia Rebaudiana Bertoni 121

Table 7
PCR components and their concentrations and aliquots for a reaction of
25 μl

Component Working concentration Aliquot

DNA template 20 ng/μl 5.0 μl
Taq DNA polymerase 5 U/μl 0.5 μl
PCR Buffer 10× 2.5 μl
dNTP Mix 10 mM 0.5 μl
Primer 10 pmol 2.0 μl

Table 8
Steps of PCR showing temperature, time, and cycling condition

Step Temperature Time (MM:SS) Cycle

Initial denaturation 94 °C 05:00 1
Denaturation 94 °C 01:00 40
Annealing 37 °C 01:00
Extension 72 °C 02:00
Final extension 72 °C 07:00 1
Hold 4 °C – –

Fig. 3 RAPD amplification by primer OPE-4 (5′GTGACATGCC3′) of micropropa-

gated plants of Stevia rebaudiana. M mother plant, SC1 to SC9 tissue
culture raised clones of Stevia, L 100 base pairs DNA ladder. (Source: [21])
122 Arpan R. Modi et al.

4 Notes

1. BAP, Kinetin, and IBA are hard to dissolve in water, so they are
first dissolved in 0.1 N NaOH and then final volume is raised
to 100 ml with distilled water.
2. Mercuric chloride is hard to dissolve in water because of its
larger granule size. Take mercuric chloride powder in a dry
mortar and crush it vigorously using pestle into fine powder.
3. For the preparation of Tris–HCl buffer, take 12.11 g of com-
mercially available Tris buffer powder and dissolve in 90 ml
autoclaved deionized water. Adjust the pH of the solution to
8.0 and make the final volume up to 100 ml with autoclaved
deionized water.
4. It is difficult to dissolve high concentration of NaCl in water.
Dissolve it in small amount at one time. Weigh 146.1 g NaCl,
take small quantity in a beaker, and add 300 ml autoclaved
deionized water and dissolve it by shaking or stirring on a mag-
netic stirrer, and likewise dissolve the entire amount.
5. For the preparation of 0.5 M solution, take 181.6 g of
Na2EDTA·2H2O and dissolve in 800 ml of autoclaved
deionized water. While stirring with a magnetic stirrer, adjust
the pH of solution by pellets of NaOH (approximately 20 g of
NaOH is required) and make the final volume up to 1000 ml
with autoclaved deionized water.
6. Sterilizing agents such as fungicides, bactericides, and mercuric
chloride are dissolved in autoclaved deionized water under
aseptic condition in laminar air hood while pre-sterilizing
treatment such as Tween 20 wash may be carried out without
aseptic condition.
7. Carefully take upper aqueous phase using cut-end tips so that
no DNA can be disturbed and shearing after DNA extraction
can be prevented.
8. While screening primers, choose showing six or more bright
bands. If primer is showing more number of lighter bands,
eliminate the primer to avoid any problem during analysis.

References
1. Singh SD, Rao GP (2005) Stevia: the herbal 4. Janarthanam B, Gopalakrishnan M, Lakshmisai
sugar of 21st century. Sugar Tech 7:17–24 G, Sekar T (2009) Plant regeneration from leaf
2. Brandle JE, Starratt AN, Gijzen M (1998) Stevia derived callus of Stevia rebaudiana Bertoni.
rebaudiana: Its agricultural, biological, and chemi- Plant Tissue Cult Biotechnol 19:133–141
cal properties. Can J Plant Sci 78:527–536 5. Moktaduzzaman M, Rahman SMM (2009)
3. Mitra A, Pal A (2007) In vitro regeneration of Regeneration of Stevia rebaudiana and analysis
Stevia rebaudiana (Bert.) from nodal explants. of somaclonal variation by RAPD. Biotechnology
J Plant Biochem Biotechnol 16:59–62 8:449–455
 In Vitro Propagation of Stevia Rebaudiana Bertoni 123

6. Kalpana M, Anbazhagan M, Natarajan V somaclonal variants derived from embryo cul-

(2009) Utilization of liquid medium for rapid tures of peach. Plant Cell Rep 16:624–627
micropropagation of Stevia rebaudiana 15. Venkatachalam L, Sreedhar RV, Bhagyalakshmi
Bertoni. J Ecobiotechnol 1:16–20 N (2007) Genetic analysis of micropropagated
7. Das A, Gantait S, Mandal N (2011) and regenerated plantlets of banana as assessed
Micropropagation of an elite medicinal plant: by RAPD and ISSR markers. In Vitro Cell Dev
Stevia rebaudiana Bert. Int J Agric Res 6:40–48 Biol—Plant 43:267–274
8. Akita M, Shigeoka T, Koizumi Y, Kawamura 16. Joshi P, Dhawan V (2007) Assessment of
M (1994) Mass propagation of shoots of genetic fidelity of micropropagated Swertia
Stevia rebaudiana using a large scale bioreac- chirayita plantlets by ISSR marker assay. Biol
tor. Plant Cell Rep 13:3–4 Plant 51:22–26
9. Phillips RL, Kaeppler SM, Olhoft P (1994) 17. Ahmed O, Chokri B, Noureddine D,
Genetic instability of plant tissue cultures: Mohamed M, Mokhtar T (2009) Regeneration
breakdown of normal controls. Proc Natl Acad and molecular analysis of date palm (Phœnix
Sci U S A 91:5222–5226 dactylifera L.) plantlets using RAPD markers.
10. Welsh J, McClelland M (1990) Fingerprinting Afr J Biotechnol 8:813–820
genomes using PCR with arbitrary primers. 18. Kumar N, Vijay-Anand KG, Reddy MP (2010)
Nucleic Acids Res 18:7213–7218 Shoot regeneration from cotyledonary leaf
11. Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, explants of Jatropha curcas: a biodiesel plant.
Tingey SV (1990) DNA polymorphisms ampli- Acta Physiol Plant 32:917–924
fied by arbitrary primers are useful as genetic 19. Murashige T, Skoog F (1962) A revised
markers. Nucleic Acids Res 18:6231–6235 medium for rapid growth and bioassays with
12. Isabel N, Tremblay L, Michaud M, Tremblay tobacco tissue cultures. Physiol Plant
FM, Bousquet J (1993) RAPDs as an aid to eval- 15:473–497
uate the genetic integrity of somatic embryogen- 20. Doyle JJ, Doyle JL (1990) Isolation of plant
esis-derived populations of Picea mariana DNA from fresh tissue. Focus 12:13–15
(Mill.). BSP Theor Appl Genet 86:81–87 21. Modi AR, Patil G, Kumar N, Singh AS,
13. Munthali MT, Newbury HJ, Ford-Lloyd BV Subhash N (2012) A Simple and efficient
(1996) The detection of somaclonal variants of in vitro mass multiplication procedure for
beet using RAPD. Plant Cell Rep 15:474–478 Stevia rebaudiana Bertoni and analysis of
14. Hasmi G, Huettel R, Meyer R, Krusberg L, genetic fidelity of in vitro raised plants through
Hammerschlag F (1997) RAPD analysis of RAPD. Sugar Tech 14:391–397
 Chapter 9

Panax ginseng Adventitious Root Suspension Culture:

Protocol for Biomass Production and Analysis
of Ginsenosides by High Pressure Liquid Chromatography
Hosakatte Niranjana Murthy and Kee Yoeup Paek

Abstract
Panax ginseng C.A. Meyer (Korean ginseng) is a popular herbal medicine. It has been used in Chinese and
Oriental medicines since thousands of years. Ginseng products are generally used as a tonic and an adap-
togen to resist the adverse influence of a wide range of physical, chemical and biological factors, and to
restore homeostasis. Ginsenosides or ginseng saponins are the principal active ingredients of ginseng. Since
ginseng cultivation process is very slow and needs specific environment for field cultivation, cell and tissue
cultures are sought as alternatives for the production of ginseng biomass and bioactive compounds. In this
chapter, we focus on methods of induction of adventitious roots from ginseng roots, establishment of
adventitious root suspension cultures using bioreactors, procedures for processing of adventitious roots,
and analysis of ginsenosides by high pressure liquid chromatography.

Key words Adventitious roots, Bioreactors, Ginsenoside, Herbal medicine, Panax ginseng, Saponin

1 Introduction

Panax ginseng C.A. Meyer (Korean ginseng, Araliaceae) is the

most valued medicinal plant used in Chinese and Oriental ­medicine.
It is used as a general tonic and shows various pharmacological
effects including antiaging, antidiabetic, anticancerous, anti-­
hepatitis, antioxidant, anti-inflammatory, and immune-stimulatory
activities [1]. Ginseng is also an important medicine for neurode-
generative disorders [2], cardiovascular diseases [3], and liver dis-
orders [4]. Nowadays, ginseng has gained popularity as a functional
food, nutraceutical, and dietary supplement [5, 6]. Ginsenosides
or ginseng saponins are the principal active ingredients of ginseng
and more than 38 ginsenosides have been recognized [1, 7].
Ginsenosides consist of a ganone steroid nucleus with 17 carbon
atoms arranged in four rings. The characteristic biological response
of each ginsenoside is attributed to the differences in the type,

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_9, © Springer Science+Business Media New York 2016

125
126 Hosakatte Niranjana Murthy and Kee Yoeup Paek

position and number of sugar moieties attached to glycosidic bond

at C-3 and C-6. Based on the structural differences, they are clas-
sified into three groups: the panaxadiol group (e.g., Rb1, Rb2,
Rb3, Rc, Rd, Rg3, Rh2, Rh1), the panaxatriol group (e.g., Re, Rf,
Rg1, Rg2, Rh1), and oleonic acid group (e.g., Ro). Each one of
these ginsenosides is having different pharmacological effects [1].
The production of ginseng by field cultivation is a slow process
and needs 4–6 years from planting to root harvesting stage.
Further, its production is hampered by environmental factors,
pests and diseases, and ginsenoside content varies depending on
the age of plant, season of harvest, and the extraction method
[8, 9]. Therefore, in vitro cell and organ cultures have become
alternatives for the production of ginseng biomass and ginsen-
osides [10]. Recently, bioreactor technology has become an excel-
lent tool for large-scale cultivation of plant cells and organs. These
systems control readily various important process parameters such
as mixing, aeration, temperature, pH [11, 12]. Additionally, there
is possibility for year round production of biomass with reduced
cost and time. Recently, adventitious roots have been induced
from Panax ginseng roots and successfully cultured for the produc-
tion of ginsenosides [10, 12]. This chapter describes relevant pro-
tocols for the induction of adventitious roots, establishment of
suspension cultures for biomass and metabolites production, anal-
ysis of genetic stability of adventitious roots maintained in suspen-
sion cultures through flow cytometry, processing of adventitious
root biomass and isolation and quantification of ginsenosides by
high pressure chromatography.

2 Materials

2.1 Induction 1. Panax ginseng C.A. Meyer roots collected from the wild
of Adventitious Roots (Mt. Odaesan, Gangwon province, Republic of Korea).
from Root Explants 2. Murashige and Skoog (MS) [13] medium stock solutions (MS
and Establishment stock I, II, III and IV) (Table 1). Store in the freezer or cold
of Suspension room at 4 °C (see Note 1).
Cultures 3. Stock solutions (100 μM) of 2,4-dichlorophenoxy acetic acid
(2,4-D), indole butyric acid (IBA), and kinetin and store in the
freezer at −20 °C (see Note 2).
4. Fresh solutions of methyl jasmonate (150 μM MJ) (see Note 3).
5. Gelrite.
6. 5-L and 20-L balloon type bubble bioreactors; 500-L and
1000-L balloon type bubble bioreactors, BTBB (see Note 4).
7. Polytetrafluoroethylene (PTFE) air filters: 0.20 μM PTFE
membrane filters.
 Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 127

Table 1
Chemical composition of MS mediuma

Chemical constituents Concentration (mg/L) Volume per liter (mL)

Major inorganic nutrients
NH4NO3 33,000 50
KNO3 38,000
CaCl2·2H2O 8800
MgSO4·2H2O 7400
KH2PO4 3400
Minor inorganic nutrients
KI 166 5
H3BO3 1240
MnSO4·2H2O 4460
ZnSO4·7H2O 1720
Na2.MoO4·2H2O 50
CuSO4·5H2O 5
CoCl2·6H2O 5
Iron source
FeSO4·7H2O 5560 5
Na2EDTA·2H2O 7460
Organic supplements
myo-Inositol 20,000 5
Nicotinic acid 100
Pyridoxine·HCl 100
Thiamine·HCl 100
Glycine 400
Carbon source
Sucrose As per the experiment
After dissolving all the stock solutions in enough deionized water make it up to 1 L, adjust the pH to 5.8 (add 2 g/L
a

Gelrite or 0.8 g/L agar if semisolid medium) and autoclave for 25 min at 120 °C

2.2 Flow Cytometry 1. Flow cytometer equipped with UV excitation lamp.

2. Extraction buffer and 4,6-diamidino-2-phenylindole (DAPI).
3. Nuclei which are extracted in buffer and stained with DAPI.
4. Nylon meshed sieves (50 μM pore size).

2.3 Drying 1. Air dryer.

of Ginseng 2. Heat reflux extraction unit.
Adventitious Roots
3. 80 % ethanol, high pressure liquid chromatography (HPLC)
and Extraction
grade.
of Ginsenosides
128 Hosakatte Niranjana Murthy and Kee Yoeup Paek

2.4 Estimation 1. 2 N Folin–Ciocalteu reagent. Store at 4 °C.

of Total Phenols 2. 1000 ppm Gallic acid. Store at 4 °C in the dark (see Note 5).
3. 20 % sodium carbonate stock solution. Store at 4 °C.
4. 80 % methanol, high pressure liquid chromatography (HPLC)
grade.

2.5 Estimation 1. 1000 ppm (+) catechin stock solution and store at 4 °C in the
of Total Flavonoids dark.
2. 10 % Aluminum chloride solution. Store stock solution at 4 °C.
3. 5 % Sodium nitrate solution. Store stock solution at 4 °C.

2.6 Scavenging 1. 2,2′-diphenyl-1-picrylhydrazyl (DPPH) (see Note 6).

Effect on 2. Ultraviolet (UV)–visible spectrophotometer.
2,2-Diphenyl-­1-
Picrylhydrazyl (DPPH)
Radical (Scavenging
Activity of Natural
Antioxidants)

2.7 HPLC Analysis 1. HPLC-grade acetonitrile (see Note 7).

of Ginsenosides 2. HPLC-grade water (see Note 7).
3. Standard Rb and Rg ginsenosides.

3 Methods

3.1 Induction 1. Wash roots collected from the wild thoroughly (Fig. 1a) in tap
of Adventitious Roots water.
from Root Explants 2. Immerse roots in 70 % ethanol for 30 s, and surface sterilize in
20 % sodium hypochlorite solution containing few drops of
Tween 30 detergent for 30 min (see Note 8).
3. Rinse 3× in cold, sterile water for 5 min.
4. Slice roots into 0.3 cm3 pieces under laminar flow bench and
culture individually on a semisolid MS medium supplemented
with 30 g/L sucrose, 4.5 μM 2,4-D, and 0.46 μM kinetin,
pH 5.8.
5. Incubate cultures at 25 ± 2 °C for 4 weeks in the dark. Within
8 weeks callus will develop from the root explants (Fig. 1b).
Subculture the calli to fresh medium at 6-weeks interval.
6. Culture calli on semisolid MS medium containing 30 g/L
sucrose and 24.6 μM IBA.
 Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 129

Fig. 1 Wild ginseng root used for induction of adventitious roots (a), Callus developed from ginseng roots on
MS medium supplemented with 30 g/L sucrose, 4.5 μM 2,4-D, and 0.46 μM kinetin (b), Adventitious roots
developed from callus on MS medium supplement with 30 g/L sucrose, 24.6 μM IBA (c), Proliferation of adven-
titious roots

7. Incubate cultures at 25 ± 2 °C for 4 weeks in the dark.

Adventitious roots will develop from the calli within 4 weeks
(Fig. 1c). Subculture the adventitious roots to the fresh
medium at 4-weeks interval.
8. The adventitious roots proliferate on the MS medium amended
with 30 g/L sucrose and 24.6 μM IBA. Use actively growing
adventitious roots as explants for further experiments (Fig. 1d).

3.2 Proliferation 1. Collect actively growing root lines from the semisolid cultures,
of Adventitious Roots cut them into 2-cm long segments and inoculate 5 g/L fresh
in Liquid Medium biomass into a 250-mL flask containing 100 mL MS liquid
medium supplemented with 30 g/L sucrose and 24.6 μM IBA
(see Note 9).
2. Incubate cultures in dark at 25 ± 2 °C and shake at 100 rpm.
Maintain cultures by regular subculturing at 4 weeks interval.

3.3 Suspension 1. Collect roots in the exponential phase or stationary phase

Cultures and initiate suspension cultures for the production of
for the Production ginsenosides.
of Ginsenosides 2. Inoculate 5 g/L fresh 2-cm long root biomass in a 500-mL
Erlenmeyer flask containing 200 mL MS medium supple-
mented with 50 g/L sucrose and 24.6 μM IBA.
130 Hosakatte Niranjana Murthy and Kee Yoeup Paek

Fig. 2 Adventitious root cultures in 20 L balloon type bubble bioreactors

3. Incubate cultures in the dark at 25 °C on a rotary shaker at

100 rpm. At these conditions, adventitious roots grow and
multiply at faster rate.
4. After 7 weeks of culture, assess the growth of adventitious
roots in terms of fresh weight, dry weight, growth ratio and
amounts of phenols, flavonoids and ginsenosides.

3.4 Establishment 1. Culture 5 g/L adventitious roots in 5 L or 20 L (Fig. 2) or

of Suspension 500 L or 1000 L (Fig. 3a) capacity balloon type bubble biore-
Cultures actors containing MS medium amended with 50 g/L sucrose
for the Production and 24.6 μM IBA.
of Ginsenosides 2. Maintain bioreactor cultures in the dark at 20 °C. Aerate cul-
in a Bioreactor tures, air flow of 0.1 vvm (air volume/culture volume/min).
This favors profuse growth and multiplication of adventitious
roots (Fig. 3b) (see Note 10).
3. Supplement bioreactor cultures with 100 μM methyl jasmo-
nate (MJ) after 40 days of culture. Maintain the cultures for
another 10 days after MJ treatment.
4. After 50 days of culture, assess growth of adventitious roots in
terms of fresh weight, dry weight, growth ratio and amount of
phenols, flavonoids and ginsenosides.

3.5 Flow Cytometry Flow cytometry assessment of ginseng adventitious roots is carried
out after completion of 10 cultivation cycles. The stepwise meth-
odology for flow cytometry analysis [14] of ginseng adventitious
roots can be carried out as follows.
1. Use Partec PAS II flow cytometer, equipped with a mercury
HBO 100-W lamp, a dichroic mirror (TK 420) and a built-in
program for the data analysis.
Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 131

Fig. 3 500 L and 1000 L balloon type commercial bioreactors (a), adventitious
root biomass in 1000 L bioreactor (b)

2. Take roots of mother plant (wild Korean ginseng) and ginseng

adventitious roots and chop a 10 mm root tissue in 400 μL
nuclei extraction buffer diluted with 1600 μL staining buffer.
3. Sieve nuclei suspension through a 50-μm mesh and transfer
into 2.5 mL eppendorf tubes.
4. For each measurement, count a minimum of 2500 nuclei. Take
observations as a linear scale on a real-time graph with nuclei
size (intensity of the epifluorescence emitted) on abscissa, and
count the number of nuclei on ordinates.
5. Prior to use, calibrate cytometer with barley leaves (Hordeum
vulgare L.; Fig. 4a) a standard [15] (see Note 11).
6. Compare the peak of ginseng adventitious roots (Fig. 4b) with
mother plant (wild ginseng root, Fig. 4c).
132 Hosakatte Niranjana Murthy and Kee Yoeup Paek

Fig. 4 Typical flow cytometry profile of Hordeum vulgare cv. Sultan (used for calibration of instrument) (a),
Profile of cultivated ginseng (Panax ginseng C.A. Meyer) (b), Profile of ginseng adventitious roots (c; four peaks
as identical to mother plant)
 Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 133

3.6 Estimation 1. Filter cultures through a stainless steel sieve of pore size
of Root Biomass 40 mesh (420 μm) to separate the roots from the culture
medium.
2. Wash roots thoroughly in sterile water and blot excessive sur-
face water. Root biomass produced in bioreactors is shown in
Fig. 5a.

Fig. 5 Ginseng adventitious roots harvested from bioreactors (a), Drying of ginseng adventitious roots in forced
air dryer (b)
134 Hosakatte Niranjana Murthy and Kee Yoeup Paek

3. Record dry weight after drying of roots at 50 °C for 10 h in a

forced air unit (see Subheading 3.7 for details) to attain a con-
stant weight.
4. Growth ratio is determined by using the formula: GR = har-
vested dry biomass (g) − inoculated dry biomass (g)/inocu-
lated dry biomass (g).

3.7 Drying 1. Adventitious roots are dried in forced air-drying unit (Fig. 5b)
of Adventitious Roots at 50 °C for 10 h. The dried roots can be stored at room
and Preparation ­temperature (20–35 °C) for a longer duration without deterio-
of Root Extract ration [16].
for Analyzing 2. Take 2 g dried roots and carry out extraction at 80 °C for 6 h
Bioactive Compounds using 40 mL 70 % ethanol (Rotary evaporator) [17].
3. Filter the extract through double layers of Whatman no. 1 fil-
ter paper.
4. Re-extract the residue as in steps 1 and 2 and make up the final
volume to 100 mL using 70 % ethanol.

3.8 Estimation The amount of total phenols in adventitious root extract is ana-
of Total Phenol lyzed spectrophotometrically by using Folin–Ciocalteu reagent.
Content
1. Mix 100 μL ethanolic extract with 2.5 mL deionized water and
in Adventitious add 0.1 mL 2-N Folin–Ciocalteu reagent. Mix the contents
Root Extract well and allow to stand for 6 min.
2. After 6 min, add 0.15 mL 20 % sodium carbonate solution.
After incubation at room temperature for 30 min the purple
color will develop.
3. Working standards of 20, 50, 100, 150, and 200 ppm of gallic
acid are used for plotting standard calibration curve.
4. The absorbance of solutions is detected at 760 nm on a UV–
visible spectrophotometer. The measurements are compared
with the standard curve for gallic acid. The results are expressed
as mg of gallic acid equivalent per gram of dry roots.

3.9 Estimation The amount of total flavonoids in adventitious root extracts

of Total Flavonoid analyzed spectrophotometrically by aluminum chloride method
­
Contents (see Note 12).
in Adventitious 1. Mix 0.25 mL ethanolic root extract and a (+) catechin stan-
Root Extract dard solution with 1.25 mL deionized water. Add 75 μL 5 %
sodium nitrate solution and allow it to stand for 6 min.
2. After 6 min, add 0.15 mL 10 % aluminum chloride solution
and allow the mixture to stand for 5 min and then add 0.5 mL
1 M sodium hydroxide and mix the contents thoroughly.
3. Measure the absorbance immediately at 510 nm on a spectro-
photometer. The results should be expressed as mg of (+) cat-
echin equivalents per gram of dry roots.
 Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 135

3.10 Scavenging 1. For the analysis of antioxidants, mix 0.5-mL aliquots of each
Effect on 2, extract with 300 μL 1 mM methanolic solution of DPPH in a
2-Diphenyl-1-­ 4 mL cuvette. Make the total volume to 3.0 mL by adding
Picrylhydrazyl methanol (see Note 13).
(DPPH) Radical 2. After incubation in the dark at room temperature for 15 min,
assay the reaction mixture at 517 nm using UV–visible spec-
trophotometer (see Note 13).
3. For eliminating the interference with the DPPH reaction by
extract pigments, assay the blanks of the extracts using 300 μL
methanol. Prepare and assay a DPPH blank sample containing
2.7 mL methanol and 300 μL DPPH daily. All experiments
should be carried out in duplicate and should be repeated at
least 2 times.
4. Record the percentage decrease in absorbance at 517 nm for
each concentration and calculate percentage of quenching of
the DPPH radical on the basis of the observed decrease of the
radical. The inhibition percentage can be calculated according
to the formula:
Inhibition percentage = éë( ADPPH - AExtr ) / ADPPH ùû ´ 100

where ADPPH is the absorbance value of the DPPH blank ­sample

and AExtr is evaluated as the difference between the absorbance
value of the test solution and that of its blank. Curves showing
inhibition percentage/μL of extract are used to find the con-
centrations at which 50 % radical scavenging occurred (EC50).

3.11 HPLC Analysis 1. Carry out extraction of ginsenosides as described in the

of Ginsenosides Subheading 3.7. Filter all the extracts through a 0.45 PTEE
filter into an HPLC vial and cap the vial.
2. Initially wash/run the chromatography system consisting of
vacuum degasser, quaternary pump, auto sampler, thermo-­
stated column compartment, and diode array detector (DAD)
with water twice.
3. Analyze ginsenosides with XTerra RP 18 column, particle size
3.0 μm, 150 mm × 3 mm. The mobile phase should be (a)
water and (b) acetonitrile. The ginsenosides fractions are sepa-
rated by gradient elution as follows: initial 25 % acetonitrile for
10 min; 37 % acetonitrile for last 25 min, at a flow rate of
1.2 mL/min. The detector monitors the eluent at 203 nm.
Adjust the column temperature to 30 °C. and inject 20 μL
sample. Three injections of each sample can be used.
4. Peaks are identified on the basis of their retention time values
and UV spectra in comparison with the standard (Fig. 6). Peak
identity can also be confirmed by spiking the extracts with pure
standards (see Note 14).
 136
Hosakatte Niranjana Murthy and Kee Yoeup Paek

Fig. 6 HPLC profiles of standard ginsenosides (a), adventitious roots (b)

 Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 137

5. Eluted experimental samples were detected by photo diode

array detector coupled to the HPLC system, by comparing the
UV spectra of each peak with those of authentic reference
samples.
6. Prepare stock standard solutions of each ginsenoside as fol-
lows: 2.0 mg of each compound accurately weighed and placed
into a 5-mL volumetric flask. Then dilute stock solutions with
methanol to yield a series of standard solutions with different
concentrations for linearity validation.

4 Notes

1. The most efficient way of preparing MS medium (Table 1) is

to prepare stock solutions of major inorganic nutrients, minor
inorganic nutrients, iron source, vitamins, and individual
growth regulators. The vitamins are stored in small batches at
−20 °C and other stock solutions at 4 °C. Do not store inor-
ganic stock solutions more than 1 month. It is advisable to
prepare 100 μL stocks of growth regulators fresh for each
batch of media. Any changes in the concentration of stock
solutions due to precipitation can seriously affect growth of
the cultures. Alternatively, stock solutions of macroelements,
microelements, vitamins are commercially available.
2. Add filter-sterilized IBA to the culture medium after autoclav-
ing and cooling to below 40 °C.
3. Methyl jasmonate should be filter-sterilized before adding to
the medium. Methyl jasmonate as an elicitor boosts the accu-
mulation of ginsenosides.
4. With small scale bioreactors (5 and 20 L capacity), silicon tubes
connected to incoming air filters, and outgoing air filters
should be chipped air tight and sealing of the lid should be
checked thoroughly before and after autoclaving. Air filters
should be of high quality, 0.20 μm PTEE membrane filters,
and should be changed after using 3–4 times.
5. Gallic acid is prepared by weighing 1005 mg gallic acid powder
and by dissolving it in 1 L deionized distilled water. The addi-
tion of 1 mL ethanol will help in the dissolution. Store stock
solution in an amber glass container in a refrigerator.
6. Before use, prepare fresh stock solution (1 mM methanolic
solution) of DPPH and should be stored in the dark at 4 °C in
an amber-colored bottle (exposure to light should be avoided).
7. Use all solvents of HPLC grade; solvents and solutions to be
analyzed should be filtered through 0.45 μm polytetrafluoro-
ethylene (PTFE) filters before use.
138 Hosakatte Niranjana Murthy and Kee Yoeup Paek

8. Sometimes explants cultured on the medium are prone to

infection and in such cases stringent surface sterilization
of explants is needed; the explants should be sterilized for
10–15 min by using 0.1 % mercuric chloride. Subsequently the
explants should be washed thoroughly with sterilized distilled
water and are cultured on the nutrient medium.
9. Use actively growing roots with root meristem during the ini-
tiation of first batch of cultures. Such root explants grow well
and proliferate quickly. After one to two subcultures, adventi-
tious roots are randomly cut into 2-cm long explants, and
roots with or without root tips can proliferate successfully.
10. Adventitious root biomass accumulation in bioreactor cultures
is dependent on physical factors, such as culture conditions
other than chemical composition of the medium. For example,
inoculum density, aeration volume, light–dark photoperiod,
and temperature conditions have to be developed over several
series of experiments. Alteration of these parameters could
severely affect the biomass production and accumulation of
secondary metabolites.
11. Carry out initial flow cytometric measurements with flow of
solution, i.e., buffer and DAPI dye solution with nuclei at
lower level (~2 μL/s). If the flow of solutions is too high, peaks
in the histograms tend to become wider and hence accuracy
decreases. DAPI specifically binding to the adenine and
­thymine bases of DNA is excited under UV (at 372) and emits
(at 456 nm) fluorescence that is proportional to the relative
DNA content per nucleus.
12. The principle of aluminum chloride method is as follows:
Aluminum chloride forms acid stable complex with C-4 keto
group and either the C-3 or C-5 hydroxy group of flavones
and flavonols [18].
13. A fresh DPPH solution is prepared before use, store in the dark
at 4 °C in a bottle covered with aluminum foil. The DPPH radi-
cal has widely been used to evaluate the free radical scavenging
activity of natural antioxidants [19]. Purple colored DPPH
solution turns yellow product after being reduced by an antioxi-
dant, DPPH + antioxidant → Yellow non-radical product.
14. Standard ginsenosides can be procured from reputed chemical
suppliers.

Acknowledgements

This work was supported by Ministry of Science, ICT and Planning

(MSIP), Republic of Korea. Dr. H.N. Murthy is thankful to the
Ministry of Education, Science and Technology, Republic of Korea
for the award of Brain Pool Fellowship (131S-4-3-0523).
 Panax ginseng Adventitious Root Suspension Culture: Protocol for Biomass… 139

References
1. Choi KT (2008) Botanical characteristics, tious roots for production of ginsenosides. Adv
pharmacological effects and medicinal compo- Biochem Eng Biotechnol 113:151–176
nents of Korean Panax ginseng C A Meyer. 11. Murthy HN, Lee EJ, Paek KY (2014)
Acta Pharmacol Sin 29:1109–1118 Production of secondary metabolites from cell
2. Kim HJ, Kim P, Shin CY (2013) A comprehen- and organ cultures: strategies and approaches
sive review of the therapeutic and pharmaco- for biomass improvement and metabolite accu-
logical effects of ginseng and ginsenosides in mulation. Plant Cell Tiss Org Cult.
central nervous system. J Ginseng Res 37: doi:10.1007/s11240-014-0467-7
8–29 12. Murthy HN, Georgiev MI, Kim YS, Jeong CS,
3. Kim JH (2012) Cardiovascular diseases and Kim SJ, Park SY, Paek KY (2014) Ginsenosides:
Panax ginseng: a review on molecular mecha- prospective for sustainable biotechnological
nisms and medical applications. J Ginseng Res production. Appl Mirobiol Biotechnol.
36:16–26 doi:10.1007/s00253-014-5801-9
4. Tung NH, Uto T, Morinaga O, Kim YH, 13. Murashige T, Skoog F (1962) A revised
Shoyama Y (2012) Pharmacological effects of medium for rapid growth and bioassays with
ginseng liver functions and diseases: a minire- tobacco tissue cultures. Physiol Plant 15:
view. Evid Based Complement Alternat Med. 473–497
doi:10.1155/2012/173297 14. Ochatt SJ (2008) Flow cytometry in Plant
5. Neale C, Camfield D, Reay J, Stough C, breeding. Cytometry A 73A:581–598
Scholey A (2013) Cognitive effects of two 15. Johanston JS, Bennett MD, Rayburn L,
nutraceuticals ginseng and bacopa bench- Galbraith DW, Price HJ (1999) Reference
marked against modafinil: a review and com- standards for determination of DNA content
parison of effect sizes. Br J Clin Pharmacol of plant nuclei. Am J Bot 86:609–613
75:728–737 16. Kim SJ, Murthy HN, Hahn EJ, Lee HL, Paek
6. Kennedy DO, Scholey AB (2003) Ginseng: KY (2008) Effect of processing methods on the
potential for enhancement of cognitive perfor- concentrations of bioactive components of gin-
mance and mood. Pharmacol Biochem Behav seng (Panax ginseng C. A. Meyer) adventitious
75:687–800 roots. LWT-Food Sci Technol 41:959–964
7. Park JD, Rhee DW, Lee YH (2005) Biological 17. Kim SJ, Murthy HN, Hahn EJ, Lee HL, Paek
activities and chemistry of saponin from Panax KY (2007) Parameters affecting the extraction
ginseng C. A. Meyer. Phytochem Rev 4: of ginsenosides from the adventitious roots of
159–175 ginseng (Panax ginseng C.A. Meyer). Separ
8. Liberti LE, Der Mardersian A (1978) Eval­ Purif Technol 56:401–406
uation of commercial ginseng products. 18. Mabry TJ, Markham KR, Thomas MB (eds)
J Pharm Sci 10:1487–1489 (1970) The systematic identification of flavo-
9. Phillipson JD, Anderson LA (1984) Ginseng-­ noids. Springer, New York
quality, safety and efficacy? Pharm J 232: 19. Brand-Williams W, Couvelier ME, Berset C
161–165 (1995) Use of a free radical method to evaluate
10. Paek KY, Murthy HN, Hahn EJ, Zhong JJ antioxidant activity. LWT-Food Sci Technol
(2009) Large scale culture of ginseng adventi- 28:25–30
 Chapter 10

Immobilization of Rubia tinctorum L. Suspension Cultures

and Biomass Production
Pınar Nartop

Abstract
Plants are natural sources of valuable secondary metabolites used as pharmaceuticals, agrochemicals,
flavors, fragrances, colors, biopesticides, and food additives. There is an increasing demand to obtain these
metabolites through more productive plant tissue applications and cell culture methods due to the impor-
tance of secondary metabolites.
Immobilization of plant cells is a method used in plant cell cultures to induce secondary metabolite
production. In this method, plant cells are fixed in or on a supporting material or matrix such as agar,
agarose, calcium alginate, glass, or polyurethane foam. In the present study, three natural lignocellulosic
materials, loofah sponge, and the long fibers of sisal and jute, were used to immobilize suspended R. tinc-
torum cells.

Key words Immobilization, Plant cells, Suspension culture, Biomass, Lignocellulosic matrices,
Loofah, Sisal, Jute, Secondary metabolite production

1 Introduction

The immobilization of plant cells is one of the secondary metabolite-

inducing techniques used in cell cultures of many plant species.
This technique comprises the fixation of cells onto a solid support,
a membrane or into a solid matrix to increase the stability of the
cells (Fig. 1). Most reports have indicated that immobilized cul-
tures may induce the yields of secondary metabolite production 16
times more in comparison to cell suspension cultures. Due to the
secretion of metabolites to the culture medium, the cells are not
only disturbed but also may carry on secondary metabolite pro-
duction [1, 2].
Plant cells are often in the form of aggregates; they both
cling to each other and surfaces as well; therefore, agitation is
needed for plant cell culturing. On the other hand, agitation is
detrimental to plant cells because of their low tolerance to shear
stress. Furthermore, cell-to-cell contact is another important

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_10, © Springer Science+Business Media New York 2016

141
142 Pınar Nartop

Callus tissue formation on

Sterile R. tinctorum plantlets stem explants
obtained from seeds

Cell suspension cultures

in liquid medium
Callus cultures on
semi-solid medium

Loofa Sisal

Immobilized cells on lignocellulosic

materials in liquid medium
Jute
Screening of immobilized cells

Enhanced
Accumulation of
Secondary Metabolites
and Biomass
Fig. 1 Steps of immobilization procedure from plantlets to immobilized cells and enhanced accumulation of
secondary metabolites and biomass
 Immobilization of Rubia tinctorum L. Suspension Cultures and Biomass Production 143

point in cell metabolism which allows metabolites to move from

one cell to another. Secondary metabolite production is usually
higher in slow growing or non-growing cultures [3, 4]. The
immobilization of plant cells addresses all of these factors and
may be the best approach for increasing secondary metabolite
production. This technique offers the potential for dealing with
the limitations of secondary metabolite production in liquid
plant cell cultures.
In order to immobilize cells, ideally grown suspension cultures
at exponential phase must be obtained firstly. The suspension cul-
tures are started from callus or protoplast cultures of the plant spe-
cies of interest (Fig. 1).
Although there is no ideal immobilization matrix for plant cell
cultures, cell carriers should have some features in order to ease the
production of biomass and secondary metabolites. The most com-
mon matrices used for plant cell immobilization are calcium algi-
nate [1] and reticulate polyurethane foam [2]. Besides these
matrices, agar and agarose [5], polyester [6] glass [7] fibers, hybrid
sol–gel matrices [7], loofah sponge, jute and sisal fibers [8] have
also been utilized for immobilization.
We used lignocellulosic materials (loofah, sisal, and jute) in
order to immobilize suspended cells of Rubia tinctorum L.
(Fig. 2). Immobilizing cells from R. tinctorum L. on lignocellu-
losic materials provided around three times higher biomass pro-
duction in comparison to suspension cultures. Alizarin and
purpurin contents of immobilized cells were 6 and 23 times
higher in inoculated cells, respectively. In this chapter, the meth-
ods for establishing an ideally grown suspension culture and
immobilization of suspended cells on lignocellulosic materials are
discussed.

Fig. 2 Natural lignocellulosic materials used for immobilization of plant cell cultures
144 Pınar Nartop

2 Materials

2.1 Laboratory 1. Laminar flow cabinets.

Materials 2. Bunsen burner.
and Equipment
3. Dissecting forceps and scalpel.
4. Beakers.
5. Cylinders.
6. pH-meter.
7. Analytical balance.
8. Stirrer with hot plate.
9. Culture vessels containing semisolid media.
10. 250 ml Erlenmeyer flasks for use as culture vessels for liquid
medium.
11. 250 or 500 ml bottles for storage of liquid cultures.
12. Orbital shaker.
13. A digital camera fitted on a compact stereomicroscope.
14. Autoclave.
15. Incubator at 170 °C.
16. Autoclavable 30 mesh sieve.
17. Filter paper.
18. Sterile petri dishes to weigh callus on an analytical balance in
laminar flow cabinet (sterile aluminum foil can also be used
instead of petri dishes).
19. Funnel.
20. Distilled water sterilized by autoclaving (121 °C for 30 min at
a pressure of 1.2 kg/cm2).

2.2 Plant Material 1. Internode parts of shoots, which were grown from the shoot
tips of clonally micropropagated plantlets in micropropagation
medium (Table 1).

2.3 Immobilization 1. Loofah (mature and dried fibrous fruit of Luffa cylindrica)
Materials (Fig. 2a).
2. Sisal (fibers of Agave sisalana leaves) (Fig. 2b).
3. Jute (fibers of Corchorus olitorius leaves) (Fig. 2c).

2.4 Stock Solutions, 1. Stock solutions (1 mg/100 ml) of 2,4-dichlorophenoxy acetic

Semisolid and Liquid acid (2,4-D), indole-3-butyric acid (IBA), and kinetin and
Media store in the freezer at 4 °C.
2. Stock solutions of Murashige and Skoog (MS) medium [9]
(Table 2).
 Immobilization of Rubia tinctorum L. Suspension Cultures and Biomass Production 145

Table 1
Contents of micropropagation, callus initiation (CI), and liquid CI (L-CI) media

Media composition

Medium name Basal medium Growth regulators Sucrose Agar pH

Micropropagation medium MS 0.5 mg/l IBA 3% 0.7 % 5.8
Callus initiation medium MS 0.1 mg/l 2,4-D 3% 0.7 % 5.8
(CI) 0.5 mg/l BA
0.5 mg/l Kinetin
Liquid CI medium (L-CI) MS 0.1 mg/l 2,4-D 3% – 5.8
0.5 mg/l BA
0.5 mg/l Kinetin

Table 2
Composition of MS medium

MS mediuma

Stock solutions g/l g/l for 100 ml stock solutionb Stock code
KI 0.00083 0.0166 MS1
MgSO4·7H2O 0.37 7.4 MS2
MnSO4·4H2O 0.0223 0.446
ZnSO4·7H2O 0.0086 0.172
CuSO4·5H2O 2.5E-05 0.0005
KH2PO4 0.17 3.4 MS3
CaCl2·2H2O 0.44 8.8 MS4
H3BO3 0.0062 0.124 MS5
Na2MoO4·2H2O 0.00025 0.005
CoCl2·6H2O 2.5E-05 0.0005
Na2·EDTA 0.0373 0.746 MS6
FeSO4·7H2O 0.0278 0.556
Nicotinic acid 0.0005 0.01 MS7
Pyridoxine·HCl 0.0005 0.01
Thiamine·HCl 0.0001 0.002
Glycine 0.002 0.04 MS8
NH4NO3 1.65 No stock solution –
KNO3 1.9 No stock solution –
a
Dissolve all the stock solutions, NH4NO3, and KNO3 in enough deionized water and make it up to 1 L. Adjust the pH
to 5.8 (if necessary, add agar at this step) and autoclave for 15 min at 121 °C at a pressure of 1.2 kg/cm
b
Use 5 ml stock solution for 1 L medium
146 Pınar Nartop

3. Micropropagation medium (semisolid MS medium): MS com-

ponents, 0.5 mg/l IBA, 3 % sucrose, 0.7 % agar, pH 5.8
(Table 1).
4. Callus initiation medium (CI) (semisolid MS medium): MS
components, 0.1 mg/l 2,4-D, 0.5 mg/l BA, 0.5 mg/l kinetin,
3 % sucrose, 0.7 % agar, pH 5.8 (Table 1).
5. Liquid CI medium (L-CI): MS components, 0.1 mg/l 2,4-D,
0.5 mg/l BA, 0.5 mg/l kinetin, 3 % sucrose, pH 5.8 (Table 1)
(see Notes 1 and 2).

2.5 HPLC Analyses 1. Ultrasonic device.

of Samples 2. SpeedVac concentrator.
3. Thermo Hypersil C-18 100 μm × 2.1 μm × 3 μm column.
4. HPLC-grade trifluoroacetic acid (TFA).
5. HPLC-grade acetonitrile.
6. HPLC-grade methanol.
7. HPLC-grade alizarin and purpurin (reference compounds).
8. HPLC-Grade HCl.
9. HPLC-Grade Na2CO3.
10. HPLC-grade ethyl acetate.

3 Methods

3.1 Stability Tests 1. Place pieces (approximately 2 g DW) of each immobilization

of Immobilization material (loofah sponge and fibers of sisal and jute) into glass
Materials beaker (see Note 3).
2. In the first stability test, autoclave samples three times for
15 min at 121 °C at 1.2 kg/cm2. There should be no change in
physical characteristics after the last autoclaving (see Note 4).
3. In the second stability test, put samples into incubator and
subject them at 170 °C for 60 min three times. Avoid any
change in physical characteristics except a little browning after
the last incubation (see Note 4).

3.2 Preparation 1. Cut loofah sponge transversely in 1 cm sections (approximately

of Immobilization 2 g DW). Place two grams (DW) of sisal and jute fibers and
Materials loofah sponge into 250 ml flasks such that they fill the bottom
area (see Note 3).
2. Wash fibers under tap water for 15 min. Soak them in boiling
water for 30 min and wash them again three times with 200 ml
distilled water. Close flask’s mouth with cotton and cover it
with aluminum foil (see Note 5).
 Immobilization of Rubia tinctorum L. Suspension Cultures and Biomass Production 147

3. After the washing process, place fibers into an incubator for

drying and sterilization for 60 min at 170 °C. Soak them with
sterile distilled water (approximately 5–10 ml) before addition
of suspended cells (see Note 6).

3.3 Screening 1. Use a digital camera fitted on a compact stereomicroscope and

of Immobilized Cells take images of immobilized cells on immobilization material.
on Natural
Lignocellulose
Materials

3.4 Immobilization 1. Cut internodes of shoots grown from the shoot tips of clonally
of R. tinctorum L. Cell micropropagated plantlets, in 1 cm sections and place them
Suspension Cultures into CI medium (Fig. 1). Incubate them at 26 ± 1 °C in the
darkness (see Note 7).
2. After 4 weeks, subculture calli grown on internode explants to
fresh CI medium for producing more callus biomass. Incubate
them at 26 ± 1 °C in the darkness (see Note 8).
3. Subculture callus cultures at least four times at 2-week interval
to obtain friable callus. This step will facilitate in obtaining
suspended cells in the liquid medium (see Note 9).
4. At the end of the fourth week of callus culturing, weigh 2 g
(fw) callus for each flask and inoculate into 50 ml L-CI medium
in 250 ml flasks in laminar flow cabinet under sterile conditions
(see Note 10).
5. Four weeks later, filter liquid medium with cell clumps and
suspended cells through a 30 mesh sieve. Dilute 25 ml filtrate
(consisting of only suspended cells, not clumps) (8 × 105 living
cells/ml) to 50 ml with L-CI medium and subculture four
times at 14-day interval (see Note 11).
6. Adjust 25 ml of these suspension cultures to 50 ml, 75 ml, and
100 ml with L-CI medium (inoculation ratio 1/2, 1/3, and
1/4, respectively) and pour onto the sterilized immobilization
materials in 250 ml flasks with two replicates (Fig. 3). Cultivate
immobilized cells on an orbital shaker at 100 rpm and 26 ± 1 °C
in the darkness (see Note 12).

3.5 Determination 1. At the fourth week of the immobilized cells culturing, filter the
of Fresh and Dry biomass through a funnel and normal filter paper. Remove cell
Weights and Relative clumps from the immobilization materials and measure the
Dry Weight Ratios total fresh weights (g) of biomass for each flask (see Note 13).
2. After freeze-drying, calculate dry weights (g) and relative dry
weight ratios (dry weight/fresh weight) (see Note 14).
148 Pınar Nartop

Fig. 3 Immobilization of Rubia tinctorum L. suspension cultures on lignocel-

lulosic materials
 Immobilization of Rubia tinctorum L. Suspension Cultures and Biomass Production 149

3.6 HPLC Analysis 1. Extract the samples three times for 10 min with 5 ml metha-
of Samples nol. Filter each extract, combine and evaporate them to dry-
ness under vacuum at 60 °C (see Note 15).
2. Hydrolyse the residues by refluxing with 10 ml 5 % HCl for
1 h. Neutralize the samples with 1 M Na2CO3 and extract
them four times with 10 ml ethyl acetate. Combine each
extract and evaporate them to dryness under vacuum at 60 °C
(see Note 16).
3. Dissolve all samples with 10 ml methanol and analyze them
with Thermo Hypersil C-18 100 μm × 2.1 μm × 3 μm column.
The mobile phase should be 0.01 % TFA in water (solvent A)
and acetonitrile (solvent B) with gradient elution of 27 % B for
2.38 min; from 27 % B to 50 % B in 4.83 min; to 55 % B in
2.46 min; hold at 95 % B for 1.2 min and finally return to ini-
tial condition (27 % B) for 1.2 min respectively (see Note 16).
4. The flow rate during analysis should be 750 μl/min and inject
5 μl for each sample. The detector monitors the fluent at
250 nm.
5. Establish calibration curves by dissolving 10 mg reference
compounds (alizarin and purpurin) with 100 ml HPLC grade
methanol. Construct the calibration curves by plotting the
peak areas of alizarin and purpurin versus their concentrations
(see Note 17).

4 Notes

1. Nutrient medium should be autoclaved for 15 min at 121 °C

at a pressure of 1.2 kg/cm2 and then should be stored in dark-
ness at last for 1 month. Liquid media should be shacked
before use.
2. Adjust pH of the media to 5.8 with 0.5 M NaOH and 0.5 M
HCl. Instead of NaOH, solutions like KOH can be used to
adjust pH. If the volume of the medium is low (e.g., 100–
200 ml), try to use solutions at lower concentrations
(0.1–0.5 M).
3. Immobilization material should cover bottom of the flask as
much as possible to obtain homogeneity in cultures.
4. Stability tests should be done prior to study. Once the tests are
performed, there is no need to repeat them again before every
experiment.
5. Among the other factors, cotton and aluminum foil are the most
important factors to keep the culture sterile during culture
period. Use tight cotton plug in flask without any space.
Aluminum foil should cover the neck of flask completely (Fig. 3).
150 Pınar Nartop

6. It is very important to soak immobilization materials with

5–10 ml distilled water before addition of suspended cells. In
failing to do so, they will absorb nutrient medium and the vol-
ume of culture medium will be decreased.
7. Explants can be cut smaller than 1 cm up to 2 mm. If the
desired metabolite is synthesized in light, then the cell culture
should be incubated in light conditions.
8. Subculturing period is a tentative parameter for callus cultures.
For fast growing callus, the subculture period should be
shorter. In contrast, some callus types grow more rapidly and
need to be subcultured more frequently (e.g., every 7–10
days).
9. In order to enhance the quality of cell cultures, subculture cal-
lus tissues at least four times before transferring to the liquid
medium. The number of subcultures of friable callus can be
reduced.
10. Biomass amount for inoculation should be optimized prior to
the study. Optimum callus biomass amount for inoculation
varies depending on the plant species. Some callus types adapt
to liquid medium much easier than the others. It is very impor-
tant to shorten the lag phase. If the culture enters to log phase
quickly, this means the culture is in a good condition and the
cells have started to divide. Callus biomass amount for inocula-
tion can be reduced to 0.5 g/50 ml liquid medium in these
cases. However, in some cases, 2 g callus is not enough to initi-
ate cell culture otherwise up to 3–4 g callus is used to initiate
suspension cultures. Conditioned medium can be a solution in
these situations. The liquid medium in which cells are grown
can be diluted (1/10 or 1/5) with fresh medium and can be
used as a conditioned medium. This application will help to
shorten the lag phase.
11. Use sieves with different mesh sizes (30–100) for obtaining
suspended cells. If sieve mesh size is smaller, suspension cul-
ture will have smaller suspended cells/aggregates. However,
cell suspension will contain lower number of cells per ml that
would take longer lag phase. Therefore, sieve mesh size is
amongst the most important factors for determining the qual-
ity of cell suspension culture and should be optimized prior to
the study.
12. Reduce cell inoculums of fast growing cells to 1/10. Lag phase
duration can also be used as a parameter here.
13. Before weighing, wash biomass with 50 ml distilled water to
remove culture medium leftovers at the filtering step. Fresh
and dry weights of filter papers should also be determined
prior to filtration.
 Immobilization of Rubia tinctorum L. Suspension Cultures and Biomass Production 151

14. Freeze-drying is not necessary to determine dry weight.

Incubation in an oven at 50–60 °C or air-drying can also be
used. However, if the desired metabolite is unstable, freeze-
drying is the most suitable method.
15. Powder the samples before extraction.
16. Use HPLC grade chemicals and solutions.
17. Prepare calibration curves by serially diluting the stock solu-
tions of alizarin and purpurin twofold with methanol (100 mg/
ml; 50 mg/ml; 25 mg/ml; 12.5 mg/ml; 6.25 mg/ml;
3.125 mg/ml).

References
1. Brodelius P, Mosbach K (1982) Immobilized by adhesion to glass fibres. Appl Microbiol
plant cells. Appl Biochem Biotechnol 7:31–34 Biotechnol 35:382–392
2. Premjet D, Tachibana S (2004) Production of 6. Facchini PJ, DiCosmo F (1991) Plant cell biore-
podophyllotoxin by immobilized cell cultures of actor for the production of protoberberine alka-
Juniperus chinensis. Pak J Biol Sci loids from immobilized Thalictrum rugosum
7(7):1130–1134 cultures. Biotechnol Bioeng 37(5):397–403
3. Mavituna F, Park JM (1985) Growth of immo- 7. Campostrini R, Carturan G, Caniato R, Piovan A,
bilised plant cells in reticulate polyurethane foam Filippini R, Innocenti G, Cappelletti EM (1996)
matrices. Biotechnol Lett 7(9):637–640 Immobilization of plant cells in hybrid sol–gel
4. Soderquist R, Lee MJ (2005) Plant cell immo- materials. J Sol-Gel Sci Technol 7:87–97
bilisation applications. In: Nedovic V, Willaert R 8. Nartop P, Akay Ş, Gürel A (2013) Immobilization
(eds.) Applications of cell immobilisation tech- of Rubia tinctorum L. suspension cultures and
nology. Hofman M, Anne J (Series eds.). its effects on alizarin and purpurin accumulation
Springer, Dordrecht, Berlin, Heidelberg, and biomass production. Plant Cell Tiss Org
New York, pp 469–477 112(1):123–128
5. Facchini PJ, DiCosmo F (1991) Secondary 9. Murashige T, Skoog F (1962) A revised medium
metabolite biosynthesis in cultured cells of for rapid growth and bioassay with tobacco tissue
Catharanthus roseus (L.) G. Don immobilized cultures. Physiol Plant 15:473–497
 Chapter 11

In Vitro Propagation and Conservation

of Bacopa monnieri L.
Neelam Sharma, Rakesh Singh, and Ruchira Pandey

Abstract
Bacopa monnieri L. (common name brahmi) is a traditional and renowned Indian medicinal plant with
high commercial value for its memory revitalizer potential. Demand for this herb has further escalated due
to popularization of various brahmi-based drugs coupled with reported anticancer property. Insufficient
seed availability and problems associated with seed propagation including short seed viability are the major
constraints of seed conservation in the gene banks. In vitro clonal propagation, a prerequisite for in vitro
conservation by enhanced axillary branching was standardized. We have developed a simple, single step
protocol for in vitro establishment, propagation and medium-term conservation of B. monnieri. Single
node explants, cultured on Murashige and Skoog’s medium supplemented with BA (0.2 mg/L), exhibited
shoot proliferation without callus formation. Rooting was achieved on the same medium. The in vitro
raised plants were successfully transferred to soil with ~80 % survival. On the same medium, shoots could
also be conserved for 12 months with high survival and genetic stability was maintained as revealed by
molecular markers. The protocol optimized in the present study has been applied for culture establish-
ment, shoot multiplication and medium-term conservation of several Bacopa germplasm, procured from
different agro-ecological regions of India.

Key words Bacopa monnieri, Brahmi, Clonal propagation, Genetic stability, ISSR, In vitro conservation,
In Vitro Genebank, Medicinal plant, RAPD

1 Introduction

Bacopa monnieri L. (synonym B. monniera), commonly known as

“brahmi,” “jalanimba,” or “the thinking man’s herb” is an ancient
and important “Medhyarasayana” drug in the traditional system of
Indian medicine—the Ayurveda. In India, it grows in damp areas
up to 1320 m. It forms an important ingredient of a number of
Ayurvedic preparations, such as “Brahmighrit,” “Brahmi-
rasayana,” “Sarasvatarisht,” and “Brahmivati.” The whole plant
is used as a drug to cure epilepsy, relieve mental stress, improve
intelligence and memory power, and anxiety neurosis [1, 2].
Besides having anti-inflammatory, analgesic, and antipyretic

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_11, © Springer Science+Business Media New York 2016

153
154 Neelam Sharma et al.

properties, the plant is known to also have anticancer and antioxi-

dant properties. The saponins—bacoside A and B have been indi-
cated for nervine tonic properties. Additionally, it has a good
market especially for Brahmi oil due to its high medicinal value.
The demand for Bacopa has further escalated owing to populariza-
tion of brahmi-based drugs like “Mentat,” “Memory Plus,” and
“Memory Perfect” in the Indian and global market, and the recent
report of anticancer activity of the herb extracts using Sarcosoma
cell culture. Lack of concerted efforts regarding its cultivation/
improvement, coupled with high demand of this medicinal herb by
pharmaceutical companies has led to collection of material from
wild population. A large amount of plant material is required for
drug extraction primarily due to drug content of the plant being
very low (~0.2 %). Further, the plant requires very specific growing
conditions. Thus conservation of this precious herb needs immedi-
ate attention to ensure its availability and sustainable utilization
now, and in future [3].
Despite the medicinal potential and high commercial value and
realization of the need for conservation, there are no reports
regarding conservation of this precious herb in the natural habitat.
Application of seed conservation methods is constrained due to
insufficient seed availability, difficult seed propagation and short
seed viability. Thus, use of in vitro techniques, increasingly applied
for rapid clonal propagation and conservation of valuable and
threatened germplasm of medicinal importance with varying
degrees of success [4, 5], appeared to be a viable conservation
strategy for this plant. Standardization of efficient in vitro propaga-
tion protocol is an essential prerequisite for application of in vitro
conservation. We have developed a method for in vitro clonal mul-
tiplication and medium-term conservation of Bacopa [2, 6].
There are few published reports on regeneration of Bacopa
from various explants through axillary bud break, adventitious
shoot formation, somatic embryogenesis and/or callus regenera-
tion [2, 7–10]. For conservation, enhanced axillary branching is
the preferred mode of regeneration as it ensures genetic stability of
the conserved germplasm. However, genetic stability of the con-
served cultures needs to be tested, while developing new protocol
for conservation, using available molecular tools. This chapter
describes various steps of a reliable in vitro clonal propagation and
conservation protocol developed in our laboratory [2, 6]. This
protocol would be of great commercial uses and for large-scale
production of high-quality planting material and/or secondary
metabolite production as also for conservation of this valuable
medicinal species.
 In Vitro Propagation and Conservation of Bacopa monnieri L. 155

2 Materials

2.1 Plant Material Healthy young shoots of Bacopa plants maintained in pots in
the net house for culture initiation and young leaves for genetic
stability studies.

2.2 Media 1. Equipment: Magnetic stirrer cum hot plate, Weighing bal-
Preparation ances, Analytical balance to weigh from 0.1 mg up to a few
grams, Top pan balance from few to hundreds of grams,
Microwave, Gas stove, pH meter, Micropipettes, Autoclave,
Refrigerator.
2. Chemicals/reagents: Salts required for Murashige and Skoog’s
(MS) [11] medium (see Table 1) and distilled/reverse osmosis
(RO) water.
4.0, 7.0 and 9.2 pH buffers and 1 N NaOH/HCl for setting
pH of medium, ethanol.
3. Glassware/plasticware: Reagent bottles, conical flasks (250,
1000 ml capacity), beakers, measuring cylinders (varying
capacities), culture tubes (25 × 150 mm), culture tube enclo-
sures (cotton plug/plastic caps/screw caps), glass rods.

2.3 Surface 1. Equipment: Laminar air flow, Bead sterilizer.

Sterilization Tissue culture tool kit comprising 8″ to 12″ rust proof stain-
and Inoculation less steel forceps, surgical scalpels with supply of removable
sterile surgical blades (straight and sharp), tissue paper, cotton
wool, etc.
2. Chemicals/reagents: 0.01–0.1 % Mercuric chloride (HgCl2),
teepol, 80 % ethanol, sterile distilled water, culture medium.
3. Glassware/plasticware: Conical flasks (100, 250 ml capacity),
beakers (250 ml capacity), sterile petri dishes.

2.4 Hardening 1. Chemicals/reagents: Water, bavistin, ½ strength MS (liquid

and Transfer Out without sucrose).
2. Glassware/plasticware: Large petri dishes, forceps 12″, brush
to remove agar, plastic and earthen pots, polythene bags, pot-
ting mix, soil.

2.5 In Vitro 1. Equipment: Same as listed in Subheadings 2.2, item 1 and 2.3,
Conservation item 1, culture incubation chambers at different low tempera-
tures (4, 10, 15, 20, 25 °C), stereo microscope.
2. Chemicals/reagents: Culture medium (see Subheading 2.2,
item 2), 80 % ethanol, mannitol, alginic acid (low viscosity),
calcium chloride (CaCl2).
3. Glassware/plasticware: Conical flasks (100 ml capacity), bea-
kers (250 ml capacity), sterile petri dishes, cryovials.
156 Neelam Sharma et al.

Table 1
Media composition for Murashige and Skoog’s [11] for stock preparation

Quantity
for stock Volume of Volume
Designated Concentration solution solution required
stock Compound Formula (mg/L) (g/20 L) (ml) for 1 L
Major
A (Macro 1) Ammonium nitrate NH4NO3 1650 33 1000 50
Potassium nitrate KNO3 1900 38
Magnesium sulfate MgSO4·7H2O 370 7.4
Potassium KH2PO4 170 3.4
dihydrogen
phosphate
B (Macro 2) Calcium chloride CaCl2·2H2O 440 8.8 1000 50
C Minor
Manganese sulfate MnSO4·4H2O 22.3 0.446 200 10
Zinc sulfate ZnSO4·7H2O 8.6 0.172
Boric acid H3BO3 6.2 0.124
Potassium iodide KI 0.83 0.0166
Sodium molybdate Na2MoO4·2H2O 0.25 0.005
Copper sulfate CuSO4·5H2O 0.025 0.0005
Cobalt chloride CoCl2·6H2O 0.025 0.0005
D Iron
Ferrous sulfate FeSO4·7H2O 27.8 0.556 200 10
EDTA disodium Na2EDTA·2H2O 37.2 0.744
E Vitamins
Nicotinic acid 0.5 0.01 20 1
Pyridoxine 0.5 0.01
hydrochloride
Thiamine 0.1 0.002
hydrochloride
Glycine 2 0.04
F Meso-inositol 100 2 200 10
Sucrose 30 g/L
Agar 8 g/L
 In Vitro Propagation and Conservation of Bacopa monnieri L. 157

2.6 Genetic Stability 1. Equipment: High speed centrifuge, Microfuge, Autopipettes

Assessment (2–20 μl, 20–200 μl, 200–1000 μl), Water bath, −20 °C Deep
freezer, Refrigerator, Freeze-drier (optional), Fume hood.
2.6.1 DNA Isolation
2. Chemicals/reagents: CTAB (Cetyl Trimethyl Ammonium
Bromide) Buffer [1.4 M NaCl, 100 mM Tris, 20 mM EDTA
(Ethylene diamine tetra acetic acid), 0.2 % β-Mercaptoethanol,
1.5 % CTAB, 1 % PVP (Polyvinyl pyrrolidone)], Isopropanol,
Saturated phenol, NaOAc (Sodium acetate), Chloroform–iso-
amyl alcohol (24:1) mixture, 10:1 TE (10 mM Tris 1 mM
EDTA), RNase A (10 mg/ml), 70 % ethanol.
3. Glassware/plasticware: Conical flasks, beakers, centrifuge tubes
(50 ml), Eppendorf tubes, mortar and pestle, liquid nitrogen.

2.6.2 Randomly 1. Equipment: DNA Thermocycler, Microfuge, Autopipettes of

Amplified Polymorphic DNA range: 2–20 μl, 20–200 μl, 200–1000 μl, DNA electrophoresis
(RAPD) Analysis unit with power supply, −20 °C Deep Freezer, Refrigerator,
Laminar air flow.
2. Chemicals/reagents: 50× TAE, pH 8.0 (2 M Tris–acetate,
pH 8.0, 0.05 M EDTA, pH 8.0); 10× Loading Buffer
(Bromophenol Blue: 0.25 % Xylene Cyanol FF: 0.25 %
Glycerol: 50 % TAE: 1×); Ethidium bromide stock 10 mg/ml
ethidium bromide in double distilled water; AmpliTaq DNA
Polymerase, MgCl2, Primers, Reaction buffer.
3. Glassware/plasticware: conical flasks, beakers, PCR tubes.

2.7 Intersimple 1. Equipment: Same as item 1 in Subheading 2.6.2.

Sequence Repeats 2. Chemicals/reagents: Same as item 2 in Subheading 2.6.2.
(ISSR) Analysis

3 Methods

3.1 Media Media is generally prepared by diluting concentrated stock

Preparation solutions.

3.1.1 Stock Solution Prepare and store separate stock solutions for macronutrients,
Preparation micronutrients, iron and vitamins (Tables 1 and 2, Note 1). Weigh
and dissolve each medium component in a small quantity of water
and make up the final volume by adding distilled water.
1. For preparation of iron stock, dissolve Na2EDTA·2H2O in
100 ml hot water. Add FeSO4·7H2O and shake well till iron
gets properly dissolved and forms a clear light yellow solution.
Add distilled water to make final volume.
2. Stock of plant growth regulator is prepared by dissolving BAP
(a cytokinin) in a minimum volume of 0.5 N NaOH or NAA
(an auxin) in 0.5 N NaOH/ethanol and then making up the
volume with distilled water.
158 Neelam Sharma et al.

Table 2
Recommended storage duration of stock solutions (see Note 1)

Stock Storage period (Months) Storage temperature (°C)

A Macro 1 6 4
B Macro 2 6 4
C Micro 6 −20
D Iron 6 4
E Vitamins 2 −20
F Myo-inositol 2 −20
G Auxin/cytokinin 1 4

3.1.2 Preparation Protocol to make 1 L MS medium (see Note 4).

and Sterilization of Media
1. Pour 500 ml distilled water in a 1-L flask with a magnetic stir-
ring bar.
2. Add 30 g sucrose and dissolve.
3. Add required stock solutions in the order (see Table 1).
4. Add aliquot of auxin stock/cytokinin stock solution (as per
requirement).
5. Adjust the pH to 5.8 using pH meter and 1 N NaOH or HCl,
with constant stirring.
6. After adjusting the pH, makeup the volume to 1 L using a
graduated cylinder or graduated beaker, pour back in to flask;
add 8.0 g agar and keep for melting.
7. Dispense about 15–20 ml medium per culture tube and cap
the tube (see Note 5).
8. Autoclave at 121 °C with a pressure of 15 psi (1.06 kg/cm2),
for 15 min (see Notes 2–4).
9. Take out from autoclave and allow the medium to cool at
room temperature. For preparing slants, keep the tubes tilted
(at an angle of 45°) during cooling.
The powdered medium is dissolved in distilled water (10 % less
than the final volume), and after adding sugar and other supple-
ments, the final volume is made up with distilled water (see Note 5).

3.2 Explant 1. Collect healthy young shoots with three to four nodes, from
Preparation plants maintained in the net house (Fig. 1a), in a beaker con-
taining distilled water.
2. Remove leaves and wash in 1 % (v/v) Labolene detergent for
10 min on a magnetic stirrer.
3. Wash these thoroughly under running tap water for 2 h.
 In Vitro Propagation and Conservation of Bacopa monnieri L. 159

Fig. 1 (a–d) In vitro propagation of Bacopa monnieri. (a) Source of explants; (b) In vitro establishment and
shoot multiplication on MS + 0.2 mg/L BAP (L–R); (c) 8-week-old cultures of some accessions showing mul-
tiple shoots and roots on MS + 0.2 mg/L BAP; (d) Plantlets established in pots

3.3 Surface 1. Disinfect the surface of the laminar flow with 75 % alcohol
Sterilization after UV light exposure for 15 min.
and Establishment 2. Arrange surface sterilized culture containers and tools on the
of In Vitro Cultures bench.
3. Dip forceps/scalpels in ethanol followed by flaming after each
operation.
4. Sterilize the stem segments with 0.1 % (w/v) mercuric chlo-
ride for 10 min under laminar air flow followed by rinsing (5
times) with sterile de-ionized water (see Notes 6 and 7).
5. Using sterilized forceps, transfer the explants into a sterile con-
tainer and rinse 2–3 times with sterile water.
6. Transfer the segment to a sterile petri plate and with the help
of a scalpel (with sterile blade), cut the edge (exposed ends) of
the explants.
7. Trim single node segments to ca. 0.8 cm and culture on MS
medium supplemented with 0.2 mg/L BAP.
160 Neelam Sharma et al.

8. Inoculate single explant in each culture tube and incubate at

25 ± 2 °C under 16/8 h photoperiod (30 μmol/m2/s) light/dark
provided by cool white fluorescent lamps (see Notes 8 and 9).

3.4 Shoot For shoot multiplication contamination-free cultures are sub-

Multiplication cultured every 4–6 weeks on shoot multiplication medium (Fig. 1b)
and Rooting (see Notes 10 and 11).
1. Gently take the cultures out of culture tube and dissect nodal
explants to required size, on a petri plate using sterile surgical
blade and forceps.
2. Using aseptic forceps, transfer the explants vertically onto
shoot multiplication medium.
3. Hold the opening of the tube in the flame for few seconds, and
then cap it.
4. Label appropriately using a standardized format and seal with
Para film.
5. Maintain cultures at 25 ± 2 °C, 16/8 h photoperiod (30 μmol/
m2/s) light/dark provided by cool white fluorescent tubes
under controlled relative humidity of 50 to 60 %.
6. Monitor the cultures periodically for contamination, hyperhy-
dricity or growth abnormalities (after each subculture cycle).
On shoot multiplication medium 100 % cultures form roots
hence avoid separate rooting medium (Fig. 1b, c).

3.5 Acclimatization 1. Transfer the rooted shoots (after 8 weeks of culture) to pots
and Transfer Out for hardening.
2. Gently remove well-rooted plantlets from the culture tubes,
keeping the roots intact.
3. Wash off the adhering agar from roots very carefully with a
brush, under running tap water.
4. Moisten the sterile vermiculite in plastic pots (7.5 cm diame-
ter), transfer plantlets to pots and water lightly.
5. Cover with perforated polythene bags to maintain high humid-
ity (~90 %).
6. Water the plants every 3 days with half-strength MS salt solu-
tion (pH 5.8) for 3 weeks.
7. Remove the polythene bags after 3 weeks and transfer the
plants to earthen pots (20 cm diameter) containing garden
soil, after 4–6 weeks and allow the plants to adjust to ambient
conditions (Fig. 1d) (see Notes 12 and 13).

3.6 In Vitro 1. Use cultures multiplied for three passages as source of explants
Conservation: Slow 2. Transfer single nodal segment (0.8 cm) from 8-week-old cul-
Growth tures to glass tubes (25 × 150 mm) containing 15 ml of shoot
multiplication medium solidified with 0.8 % agar.
 In Vitro Propagation and Conservation of Bacopa monnieri L. 161

Fig. 2 (a–g) In vitro conservation of Bacopa monnieri using slow growth strategies. (a) A view of the In Vitro
Genebank at NBPGR, India conserving multi-crops including Bacopa. Effect of various slow growth strategies
(b–f). (b) Effect of culture tube enclosure; (c) Effect of mineral oil; (d) Effect of minimal media; (e) Regrowth of
conserved cultures; (f) Storage of encapsulated shoot tips in a cryovial without nutrient medium; (g) Conserved
shoot cultures of various accessions after 12 months on MS + 0.2 mg/L BAP

3. Incubate all the cultures in culture room for 10 days to detect

and eliminate contamination (Fig. 2a).
4. To standardize the most suitable strategy for conservation of
germplasm in a gene bank, the following slow growth strate-
gies (see Note 14) (Fig. 2a–f) are tested:
(a) To study effect of enclosures, close the tubes with either
cotton plugs or polypropylene caps. Maintain cultures in
the culture room.
(b) For low temperature storage, transfer healthy cultures to
low temperature, 10, 15, and 20 °C to select optimum
responding temperature (see Note 15).
(c) To test the effect of media modifications, various osmotica
(sucrose, mannitol) are included in the media. Maintain
cultures under culture room conditions.
162 Neelam Sharma et al.

(d) To test the effect of mineral oil, culture single node in

each culture tube, and using a micropipette, pour ca. 3 ml
mineral oil (10 mm depth) (autoclaved separately and
cooled to 25 °C) over the explants to cover the explants
completely. Maintain cultures in the culture room.
(e) To test the effect of storing encapsulated shoot tips in vials
without any nutrient medium,
● Collect apical shoot tips from the shoot culture of the
same subculture age (8 weeks after last subculture).
● Using fine forceps and scalpel dissect out shoot tips
(1–2 mm) under the stereomicroscope, in a laminar
air flow cabinet. The explants should contain the api-
cal meristem dome along with one to three non-
expanded leaf primordia.
● Make encapsulated shoot tips (referred as beads) by
using 3 % sodium alginate as gel matrix and 100 mM
calcium chloride (CaCl2·H2O) for complexation.
Suspend excised shoot tips for ~20 min in sodium algi-
nate (low viscosity alginic acid in liquid MS medium
without calcium, pH 5.7). Explant along with sodium
alginate are sucked (aspirated) into a sterile disposable
Pasteur pipette and dropped one by one into calcium
chloride solution. Allow beads to stand in the solution
for 30 min with gentle shaking, for polymerization.
Then take them out by decanting off calcium chloride
solution, rinsing with sterile water followed by surface
drying on sterile filter paper.
● Transfer five uniform beads with one explant each, in
a cryovial without any medium, and maintain them
under culture room conditions.
5. Periodically assess survival of cultures by visual examination
and/or by the ability of explant to resume growth on fresh
medium (Figs. 2 and 3) (see Notes 15–20).
6. For testing regrowth of conserved beads, transfer the beads
onto shoot multiplication medium periodically after 2 weeks
and score for emergence of shoots.

3.7 Genetic Stability 1. Add calculated amount of CTAB, NaCl, EDTA, Tris–HCl,
Assessment and Polyvinyl pyrrolidone PVP in 200 ml of water and make
the final volume to 1 L.
3.7.1 Preparation
of Extraction Buffers 2. Adjust pH to 8.0 with HCl and autoclave before use.
3. Warm at 60 °C in a water bath for 30 min.
4. Add 0.2 % β-mercaptoethanol to the extraction buffer under
fume hood
 In Vitro Propagation and Conservation of Bacopa monnieri L. 163

100
90
80
70

Survival (%)
60
50
40
30
20
10
0

Accessions
Fig. 3 Survival of some accessions of Bacopa monnieri after conservation for 12
months on MS + 0.2 mg/L BA, under culture room conditions (see Note 21)

3.7.2 Plant DNA Isolation Method for Total genomic DNA extraction [12] (see Note 21):
and Purification
1. Weigh 5 g of clean young leaf tissue and grind to fine powder
with a pestle and mortar after freezing in liquid nitrogen.
2. Transfer to 50 ml centrifuge tube with 20 ml CTAB buffer
maintained at 60 °C in a water bath.
3. Mix vigorously or vortex. Incubate at 60 °C for one hour. Mix
intermittently.
4. Add 20 ml chloroform: isoamyl alcohol. Mix gently by invert-
ing for 5 min.
5. Spin at 34,541 × g for 10 min with SS34 rotor in Sorval RC-5C
centrifuge at 25 °C Transfer aqueous phase to a fresh centri-
fuge tube.
6. Add equal amount of isopropanol and let the DNA to settle
down for 20 min.
7. Spool out the DNA or spin at 17,210 × g for 15 min and drain
liquid phase.
8. Add 0.5 ml 70 % ethanol. Mix gently and incubate for 30 min.
9. Spin at 17,210 × g for 15 min and decant and repeat the 70 %
ethanol treatment.
10. Decant off and dry the pellet under vacuum. Dissolve DNA in
minimum volume of 10:1 TE buffer.
164 Neelam Sharma et al.

11. Add RNAse (0.2 ml) and incubate at 37 °C for 1 h. Add pro-
teinase (0.2 ml) and incubate at 37 °C for 1 h (see Note 22).
12. Add equal volume of phenol–chloroform (1:1), mix properly
for at least 2 min and spin for 5 min.
13. Take out the DNA supernatant and after this perform two
chloroform: isoamyl alcohol extractions as before. Spin at
17,210 × g for 15 min after each extraction.
14. Precipitate DNA by adding 1/10 volume of 3 M NaOAc and
2.5 times of the total volume chilled ethanol.
15. Mix and spool out the DNA. Remove extra salts by two wash-
ings with 70 % ethanol.
16. Dry under vacuum. Add minimum volume of TE (10:1).
17. Dissolve at room temperature. Store frozen at −20 °C.

3.7.3 Randomly 1. Switch on the thermocycler at least 15 min earlier.

Amplified Polymorphic DNA 2. Pipette out accurately using appropriate autopipettes into ster-
(RAPD) Analysis (See ile 0.5 ml microtubes the reagents in the following order:
Note 23)
dd H2O: 13.80 μl
10× Reaction buffer: 2.50 μl
25 mM MgCl2: 2.50 μl
10 μM Primer: 1.00 μl
10 mM mix of dNTPs: 2.50 μl
Taq DNA polymerase (5 U/μl): 0.2 μl
Template DNA (10 ng/μl): 2.50 μl
Total reaction volume: 25.00 μl
3. Mix by repeated pipetting.
4. Spin down the contents (2–5 s).
5. Place the tubes firmly in the wells.
6. Start thermocycler.
The temperature cycling conditions are:
Step 1. Denature at 94 °C for 4 min Step
Step 2. Denature at 94 °C for 1 min Step
Step 3. Annealing at 37 °C for 1 min Step
Step 4. Polymerization at 72 °C for 2 min
Step 5. Repeat from step 2–4: 39 times
Step 6. Extended polymerization at 72 °C for 8 min
Step 7. Refrigerate.
7. At the end of the run take out the tubes and add 2.5 μl 10×
loading dye. Spin for 2–5 s. Store at 4 °C till electrophoresis.
 In Vitro Propagation and Conservation of Bacopa monnieri L. 165

8. Agarose Gel Electrophoresis: The amplified products in RAPD

analysis are usually smaller than 4 kb size. Hence, they are sepa-
rated by electrophoresis in 1.4–1.8 % agarose gels and visualized
by staining with ethidium bromide and viewing under UV light.
(a) Prepare the gel tray by taping the open ends. Place the
comb and level the tray.
(b) Boil and prepare 1.4 % agarose gel in 1× TAE buffer. Cool
to 60 °C. Pour into gel tray avoiding air bubbles. Allow
setting for 30–40 min.
(c) Remove the adhesive tapes. Place in electrophoresis tank
filled with 1× TAE buffer. Remove the comb carefully.
Pour 1× TAE buffer till the gel is fully immersed.
(d) Load the samples carefully. Take care to load suitable
DNA size markers (about 200 ng). Connect the leads and
start electrophoresis run at constant 60 V.
(e) Stop the run when bromophenol blue dye has traveled less
than 2/3 the length of gel.
(f) Stain in 0.5–1 μg/ml ethidium bromide in distilled water
for 30–40 min. Wash briefly in distilled water (see Note 24).
(g) View under UV light. Photograph the gel (see Note 24).
(h) Score the amplified products across the lanes comparing
their respective molecular weight (Fig. 4). The data can be
analyzed statistically using suitable packages (see Note 25).

Fig. 4 Representative RAPD profiles (primer OPC-15) generated from culture

(1–4) and ex vitro transferred plants (5–9) of Bacopa monnieri, L—denotes
GeneRuler™ 100 bp DNA ladder
166 Neelam Sharma et al.

3.7.4 Intersimple 1. Switch on the thermocycler at least 15 min earlier (Table 2).
Sequence Repeats (ISSR) 2. Pipette out accurately using appropriate autopipettes into ster-
Analysis (See Note 26) ile 0.5 ml microtubes the reagents in the following order:
H2O: 14.30 μl
10× Reaction buffer: 2.50 μl
25 mM MgCl2: 1.00 μl
5 μM Primer: 3.00 μl
2.5 mM mix of dNTPs: 2.00 μl
Taq DNA polymerase (5 U/μl): 0.20 μl
Template DNA (10 ng/μl): 2.00 μl
Total reaction volume: 25.00 μl
3. Mix by repeated pipetting.
4. Spin down the contents (2–5 s).
5. Place the tubes firmly in the wells.
6. Start thermocycler.
The following general thermocycling steps are followed
Step 1: Initial denaturation at 94 °C for 5.0 min
Step 2: Denaturation at 94 °C for 1.0 min
Step 3: Primer annealing at 52–59 °C (depending upon primer)
for 45 s
Step 4: Primer extension at 72 °C for 2.0 min
Step 5: Go to step 2, 39 times
Step 6: Final extension at 72 °C for 7 min
Step 7: 4 °C for ever
7. After the run is completed turn off the machine and remove the
samples. Add 2.5 μl gel loading dye in each tubes and carry out
electrophoresis or store samples at 4 °C until electrophoresis.
8. Agarose gel electrophoresis and analysis (Fig. 5): same as RAPD.

4 Notes

1. Store iron stock, preferably in an amber-colored bottle, at

4–10 °C in a refrigerator. However, prolonged storage of aux-
ins is not recommended due to photo-oxidative degradation.
2. Media are generally sterilized by autoclaving at 121 °C with a
pressure of 15 (1.06 kg/m2). The time required for sterilization
is dependent on the quantity of medium and type of container.
A slow exhaust follows sterilization, as quick decompression
will cause the medium to boil off the vessels.
 In Vitro Propagation and Conservation of Bacopa monnieri L. 167

Fig. 5 Representative ISSR profiles (primer UBC-808) generated from culture

(1–5) and ex vitro transferred plants (6–10) of Bacopa monnieri, L—denotes
GeneRuler™ 100 bp DNA ladder

3. Media constituents (such as antibiotics) subject to modifica-

tion by heat can be added to the autoclaved medium following
filter-sterilization (passing through pre-autoclaved bacteria-
proof membrane filtration unit).
4. Contamination can occur in the stock solutions of vitamins
and growth regulators as well as in the media which are inad-
equately sterilized.
5. When using ready-made powdered media, it is essential that
the powder is completely dissolved. Any turbidity of the solu-
tion indicates that one or more of the ingredients is not dis-
solved, and thus not available to the plant cells.
6. Explants are sterilized normally by treating with 3–5 % sodium
hypochlorite or 0.05–0.1 % mercuric chloride solution for
5–15 min. When working with explants of a new genotype, it
is better to run preliminary screening tests to determine the
exposure time tolerated by explants.
7. If the explants turn brown or white, they are over-sterilized
and the cells are dead. It is recommended to reduce the length
of time or the concentration of sterilizing agent. In contrast, if
the surface sterilization treatment does not yield clean cultures
then the procedure needs to be more stringent: increase time
or concentration of the sterilant.
8. It is recommended to check inoculated cultures for contamina-
tion every 2–4 days for at least 10 days. Contaminated cultures
should be immediately removed and autoclaved before washing.
9. The standardized protocol for surface sterilization resulted in
60–100 % aseptic culture establishment at initiation stage.
168 Neelam Sharma et al.

However, minor time adjustment may be required in some

genotypes. Inclusion of 0.1 % streptomycin was beneficial in
some accessions exhibiting bacterial contamination during cul-
ture initiation.
10. Propagation methods may require modification depending
upon the genotypes/accessions/diverse collections to be con-
served, in the Genebank.
11. Amongst various combinations of plant growth regulators
tested, MS supplemented with 0.2 mg/L was most suitable
(see [2]). The described protocol has been adopted for in vitro
establishment and propagation of more than 20 accessions
(genotypes) collected from different agro-ecological regions of
India. Though there was significant variation with respect to
rate of multiplication, a minimum of 11 shoots/explants were
obtained in the least responding accession [2].
12. Usually the most critical step of in vitro propagation is the
establishment of plantlets in the soil. As the plantlets are prop-
agated in vitro under high relative humidity with little or no
photosynthesis, the acclimatization during the transition from
culture to soil conditions must be gradual. Watering the plants
is very critical as too little water may lead to permanent wilt,
while too much water may lead to decay.
13. This protocol has the potential application for the conserva-
tion of germplasm using slow growth and cryopreservation
techniques [2, 6, 14] and also for bulking up material for sec-
ondary metabolite production.
14. Slow growth strategy is based on optimizing subculture dura-
tion without risking germplasm loss and genetic stability through
stressful treatments. It is important to note that genotype
response to growth limiting treatments can be highly variable.
15. Various methods such as change of enclosure, media modifica-
tion, low temperature incubation etc. have been employed to
achieve slow growth in a large number of crops. Amongst sev-
eral slow growth strategies and different type of explants
experimented upon in Bacopa, subculture duration could be
enhanced to 14 months with mannitol, 12 months with
sucrose, 15 months with minimal media, and 18–24 months
with mineral oil overlay, using polypropylene caps as closures,
under culture room conditions. Incubation of cultures at low
temperature (4 and 10 °C) was not successful.
16. Amongst various storage temperatures, the optimum tempera-
ture at which encapsulated shoot tips, conserved in a cryovial
without nutrient medium, remained viable for 6 months was
25 °C. On transfer to medium for regrowth, thus conserved
shoot tips, developed into normal shoots. This methodology
has the potential for exchange of germplasm, as being free of
 In Vitro Propagation and Conservation of Bacopa monnieri L. 169

nutrient medium, problems related to melting of agar and con-

tamination are minimized.
17. This simple single step protocol is suitable for the propagation
and conservation of a total of 22 accessions of Bacopa germ-
plasm, on MS + 0.2 mg/L BAP. They have been maintained in
the In Vitro Genebank at NBPGR, India, for more than 10
years with subculture duration of 10–16 months, depending
upon the accession.
18. One of the limitations of germplasm maintenance in the In
Vitro Genebank, especially in the tropical region, has been the
contamination of cultures during various stages. Under ideal
situation it is best to discard contaminated cultures and start
fresh from mother plants. However, in case of non availability of
mother plant, as an emergency measure, cultures can be rescued
following resterilization of explants using 0.05 or 0.1 % (w/v)
mercuric chloride + 0.1 % (w/v) streptomycin for 5–8 min.
19. In the In Vitro Genebank, periodic monitoring of cultures for
survival, chlorosis, hyperhydricity and contamination must be
done. Subculture of stored cultures should be carried out when
30 % cultures are dead/dried/contaminated. It is recom-
mended not to subculture all cultures of an accession at one go
(on the same day) to rule out the possibility of losing the pre-
cious germplasm due to contamination/ technical/equipment
error/mislabeling.
20. Monitoring genetic stability is an integral part of any in vitro
conservation program. In Bacopa, no morphological, molecular
or biochemical variation was detected in selected accessions using
a few strategies [6]. Hence, the described in vitro conservation
strategy can be safely implemented for medium-term conserva-
tion of Bacopa germplasm, especially the elite lines till effective
long-term conservation protocols are available [13–16].
21. The isolation of DNA from plant cells essentially involves two
steps—(1) The lysis of plant cells and solubilisation of DNA and
(2) Enzymatic or chemical methods to remove contaminating
protein, RNA and other macromolecules. Isolation and purifica-
tion of DNA is an important step because pure and high molec-
ular weight DNA is essential for the reliability of DNA for
molecular biology techniques. Any impurities in the genomic
DNA can inhibit enzymatic reactions, electrophoresis and quan-
tification and in turn their downstream applications. For plant
cells with a rigid cell wall, the disruption of cells usually requires
that the tissue is ground using a pestle and mortar after thor-
oughly freezing them in liquid nitrogen. The powdered plant
tissue is then transferred to an extraction buffer that contains
detergent to disrupt the membranes. The extraction buffer also
contains a reducing agent (β-mercaptoethanol) and a chelating
agent (ethylenediamine tetra acetic acid, EDTA). This helps to
170 Neelam Sharma et al.

inactivate nucleases that are released from the plant cell which
can cause serious degradation of the genomic DNA.
22. Dissolve RNase A in 10 mM Tris–Cl, pH 7.5, 15 mM NaCl.
Heat at 100 °C for 15 min. Cool to room temperature. Store
as aliquots at −20 °C.
23. The RAPD technique is based on the polymerase chain reaction
(PCR). A DNA sequence is exponentially amplified with the
help of arbitrary primers and a thermostable DNA polymerase.
The reaction involves repeated cycles, each consisting of a dena-
turation, a primer annealing and an elongation step. In the first
step the DNA is made single stranded by increasing the tem-
perature up to 94 °C (denaturing step) in the second step, lower
the temperature to about 37 °C results in prime annealing to
their target sequences on the template DNA (annealing step).
For the third step temperature is chosen where the activity of the
thermostable polymerase is optimal, i.e., usually 72 °C. The
polymerase now extends the 3′ ends of the DNA-primer hybrids
towards the other primer-binding site. Since this happens at
both primer-annealing sites on both the DNA strands, the target
fragment is completely replicated. Repeating these three step
cycles 35–45 times results in the exponential amplification of the
target between the 5′ ends of the two primer binding sites.
Amplification products are separated by gel electrophoresis and
visualized by ethidium bromide staining (Fig. 4).
24. Ethidium bromide is a mutagen and a probable carcinogen.
Wear gloves when working with ethidium bromide solutions.
Also use care not to contaminate the work area with the solu-
tion. UV light is damaging and must be used with caution. UV
light causes burns and can damage the eyes.
25. For genetic stability assessment, for each marker system, score
the strong amplified fragments for their presence (1), absence
(0) and missing data (9). Compute genetic similarity values
based on Jaccard’s coefficient using NTSYS-PC version 2.11a.
Perform cluster analyses based on similarity matrices for com-
bined scores of RAPD and ISSR using unweighted pair group
method with arithmetical averages (UPGMA)—a method used
for constructing phylogenetic tree using similarity matrix.
26. ISSRs are semi arbitrary markers amplified by PCR in the pres-
ence of one primer complementary to a target microsatellite.
Amplification in the presence of non-anchored primers also has
been called microsatellite-primed PCR, or MP-PCR. Such
amplification does not require genome sequence information
and leads to multi-locus and highly polymorphous patterns.
Each band corresponds to a DNA sequence delimited by two
inverted microsatellites (Fig. 5). Like RAPDs, ISSRs markers
are quick and easy to handle, but they seem to have the repro-
ducibility of SSR markers because of the longer length of their
primers. ISSR technique differs from the RAPD in the sense
 In Vitro Propagation and Conservation of Bacopa monnieri L. 171

that here longer primer sequences are used and hence the
annealing temperature is also higher which together provide
more stringency to the technique. Consequent to higher strin-
gent conditions, ISSR markers are more reproducible as com-
pared to the RAPD markers.

Acknowledgements

The authors thank Director, NBPGR for facilities and encourage-

ment. Financial support provided by the Department of
Biotechnology, Ministry of Science and Technology, is also grate-
fully acknowledged.

References

1. Anonymous (1988) The wealth of India: raw different explants of Brahmi [Bacopa monniera
materials, vol 2. Council of Scientific and (L.) Wettst.]. Plant Cell Rep 17:538–543
Industrial Research, New Delhi, India 10. Tiwari V, Tiwari KN, Singh BD (2000)
2. Sharma N, Satsangi R, Pandey R, Vimala Devi Comparative studies of cytokinins on in vitro
S (2007) In vitro clonal propagation and propagation of Bacopa monniera. Plant Cell Tiss
medium term conservation of Brahmi [Bacopa Org Cult 66:9–16
monnieri (L.) Wettst.]. J Plant Biochem 11. Murashige T, Skoog F (1962) A revised
Biotechnol 16:139–144 medium for rapid growth and bioassays with
3. Sharma N, Vimala Devi S, Satsangi R (2007) tobacco tissue cultures. Physiol Plant
Biotechnological approaches in multiplication 15:473–497
and conservation of plants of medicinal value. 12. Saghai-Maroof MA, Soliman KM, Jorgensen
In: Shukla PK, Chaubey OP (eds) Threatened RA, Allard RW (1984) Ribosomal DNA
wild medicinal plants: assessment, conserva- spacer-length polymorphisms in barley:
tion and management. Anmol Publications Pvt Mendelian inheritance, chromosomal location,
Ltd., New Delhi, India, pp 248–257 and population dynamics. Proc Natl Acad Sci
4. Chandel KPS, Shukla G, Sharma N (1996) U S A 81:8014–8018
Biodiversity in medicinal and aromatic plants 13. Sharma N, Pandey R (2011) Cryopreservation
in India. National Bureau of Plant Genetic studies on medicinal plants at NBPGR in
Resources, New Delhi, India India. In: Abstract of the 48th Annual
5. Sharma N, Pandey R (2013) Conservation of Meeting of the Society for Cryobiology
medicinal plants in tropics. In: Normah MN, (CRYO 2011) at Corvallis, USA, 24–27 July
Chin HF, Reed BM (eds) Conservation of 2011, p 80
tropical plant species. Springer, New York, 14. Sharma N, Satsangi R, Pandey R (2011)
pp 437–487 Cryopreservation of shoot tips of Bacopa mon-
6. Sharma N, Satsangi R, Pandey R, Singh R, nieri (L.) Wettst by vitrification technique.
Kaushik N, Tyagi RK (2012) In vitro conser- Acta Hortic 908:283–288
vation of Bacopa monnieri (L.) using mineral 15. Sharma N, Satsangi R, Pandey R (2012)
oil. Plant Cell Tiss Org Cult 11:291–301 Cryopreservation in medicinal plants—a case
7. Ceasar AS, Maxwell SL, Prasad KB, Karthigan study. In: Abstracts of 5th Indian Horticulture
M, Ignacimuthu S (2010) Highly efficient shoot Congress 2012—an international meet, PAU,
regeneration of Bacopa monnieri (L.) using a Ludhiana, India, 6–9 Nov 2012, p 418
two stage culture procedure and assessment of 16. Sharma N, Pandey R, Tyagi RK (2014)
genetic integrity of micropropagated plants by Cryopreservation studies on a commercially
RAPD. Acta Physiol Plant 32:442–452 important medicinal plant Bacopa monnieri
8. Shrivastava N, Rajani M (1999) Multiple shoot (L.) Wettst. In: Abstracts of freezing biological
regeneration and tissue culture studies on time—50th anniversary celebration, Annual
Bacopa monnieri (L.) Pennell. Plant Cell Rep Scientific Conference & AGM, Society for
18:919–923 Low Temperature Biology, at The Royal
9. Tiwari V, Singh BD, Tiwari KN (1998) Shoot Botanic Gardens, Kew, London, UK, 8–10
regeneration and somatic embryogenesis from Oct 2014, p 35
 Chapter 12

Establishment, Culture, and Scale-up of Brugmansia

candida Hairy Roots for the Production of Tropane Alkaloids
Alejandra Beatriz Cardillo, Julián Rodriguez Talou,
and Ana María Giulietti

Abstract
Brugmansia candida (syn. Datura candida) is a South American native plant that produces tropane alkaloids.
Hyoscyamine, 6β-hydroxyhyoscyamine (anisodamine), and scopolamine are the most important ones due
to their anticholinergic activity. These bioactive compounds have been historically and widely applied in
medicine and their demand is continuous. Their chemical synthesis is costly and complex, and thereby,
these alkaloids are industrially produced from natural producer plants. The production of these secondary
metabolites by plant in vitro cultures such as hairy roots presents certain advantages over the natural source
and chemical synthesis. It is well known that hairy roots produced by Agrobacterium rhizogenes infection
are fast-growing cultures, genetically stable and able to grow in hormone-free media. Additionally, recent
progress achieved in the scaling up of hairy root cultures makes this technology an attractive tool for indus-
trial processes. This chapter is focused on the methods for the induction and establishment of B. candida
hairy roots. In addition, the scaling up of hairy root cultures in bioreactors and tropane alkaloid analysis is
discussed.

Key words Brugmansia candida, Agrobacterium rhizogenes, Hairy root cultures, Stirred tank biore-
actor, Hyoscyamine, Scopolamine, 6β-hydroxyhyoscyamine

1 Introduction

Hyoscyamine, 6β-hydroxyhyoscyamine (also named anisodamine)

and scopolamine are tropane alkaloids produced by Solanaceous
plants [1, 2]. These compounds have a long history of application
in medicine according to their anticholinergic activity [3].
In addition, 6β-hydroxyhyoscyamine is useful in medicine for
the treatment of microvascular diseases, glomerulonephritis, rheu-
matoid arthritis, gastrointestinal colic, hemorrhagic necrotic enter-
itis, and eclampsia as well as for the control of toxic and septic
shock and organophosphate poisoning [4–8].
According to the well-established use of these compounds in
medicine, their demand is continuous [9–12]. For this reason,

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_12, © Springer Science+Business Media New York 2016

173
174 Alejandra Beatriz Cardillo et al.

much effort has been invested in the development of cost-effective

strategies for their production.
Nowadays, tropane alkaloids are industrially produced by the
isolation from plants belonging to the Solanaceae family including,
Hyoscyamus niger L., Anisodus tanguticus, several Datura species,
Scopolia tangutica Maxim, and Atropa belladonna [13–15]. In addi-
tion, tropane alkaloids can be isolated from Brugmansia candida
(syn. Datura candida), a South American native plant [16, 17].
Although tropane alkaloids can be chemically synthesized, the
chemical synthesis is costly and time consuming [18]. Thus, the
isolation of tropane alkaloids from natural sources such as plants
grown in greenhouses is still the strategy of choice [14].
The application of in vitro cultures, such as micropropagated
plants or hairy roots, is becoming a very interesting system for
large-scale secondary metabolite production. This strategy guaran-
tees a stable and uniform year-round supply, independent of the
weather and soil conditions [13, 19–21].
Additionally, the recent progress achieved for the scaling up of
hairy root processes makes this technology an attractive tool for
industrial processes [22, 23]. As mentioned above, the production
of tropane alkaloid in bioreactors, instead of their isolation from
plants is an interesting strategy because it guarantees that the pro-
cess will be carried out under defined and controlled conditions,
thus preventing or reducing the variations in the product quality
and alkaloid yield [24].
This chapter describes the protocols related to the induction
and establishment of hairy root cultures of B. candida plants. In
addition, it describes the methodologies for the analysis of the
hairy roots produced, the scaling up of the cultures in a modified
stirred tank bioreactor, and the analysis of the secondary
metabolites.

2 Materials

2.1 Sterilization of 1. Brugmansia candida seeds collected from the Jardín Botánico
B. candida Seeds of Buenos Aires, Argentina.
and Seedling Growth 2. Seed sterilization solutions: 70 % (v/v) ethanol, 10 % (v/v)
hypochlorite solution, sterile deionized water.
3. Gibberellic acid 0.1 % solution prepared with deionized water
and sterilized by filtration trough a 0.22 μm pore membrane.
4. Gamborg B5/2 medium (half concentration of mineral salts),
supplemented with sucrose 20 g/L and agar 8 g/L [25] (see
Note 1) (Table 1).
5. Agar, petri dishes, Erlenmeyer flasks, and culture flasks.
 Brugmansia Candida Hairy Roots 175

Table 1
Chemical composition of the stock solutions of Gamborg B5 medium

10× major inorganic nutrient solution Stock volume: 1000 mL

NaH2PO4 1.3 g
KNO3 25 g
(NH4)2SO4 1.34 g
MgSO4 1.22 g
Cl2Ca 1.14 g
1000× minor inorganic nutrient solution Stock volume: 100 mL
MnSO4·H2O 1000 mg
H3BO3 300 mg
CoCl2·6H2O 2.5 mg
CuSO4·5H2O 2.5 mg
Na2MoO4·2H2O 25 mg
ZnSO4·7H2O 200 mg
100× Fe-EDTA solution Stock volume: 200 mL
FeSO4·7H2O 556 mg
Na2EDTA 746 mg
2000× KI Stock volume: 100 mL
KI 150 mg
1000× vitamins solution Stock volume: 100 mL
Thiamine·HCl 1g
Pyridoxine 0.1 g
Nicotinic acid 0.1 g

2.2 Agrobacterium 1. Agrobacterium rhizogenes LBA 9402 culture or cryopreserved

rhizogenes: Growth glycerol stock.
and Maintenance 2. Yeast mannitol broth (YMB): 0.4 g/L yeast extract, 10 g/L
mannitol, 0.5 g/L K2HPO4, 0.2 g/L MgSO4·2H2O, 0.1 g/L
NaCl, pH 7.0. For solid YMB medium add 15 g/L agar.
Autoclave at 1 atm, 121 °C for 20 min.
3. Antibiotic stock solution: 100 mg/mL rifampicin.
4. Glycerol, cryovials.

2.3 Induction 1. Petri dishes containing: (1) 8 g/L agar-water, (2) Gamborg
and Establishment B5/2 supplemented with 1 g/L ampicillin and (3) Gamborg
of B. candida Hairy B5/2 without ampicillin.
Roots 2. Scalpel, ampicillin.
176 Alejandra Beatriz Cardillo et al.

2.4 Verification 1. CTAB extraction buffer: 100 mM Tris–HCl (pH 7.5), 700 mM
of the Transgenic NaCl, 50 mM EDTA (pH 8), 1 % CTAB, 140 mM
Nature of B. candida β-mercaptoethanol (see Note 2).
Hairy Roots 2. Chloroform–isoamyl alcohol (24:1 v/v), isopropyl alcohol,
ethanol absolute, 70 % ethanol.
3. RNase 10 mg/mL.
4. TE buffer: 10 mM Tris–HCl (pH 7.5), 1 mM EDTA (pH 8).
5. PCR reagents, oligonucleotide primers (Table 2), dNTPs, aga-
rose, ethidium bromide.
6. Mortar and pestle, liquid N2, conical tubes, PCR tubes, water
bath, thermocycler, electrophoresis equipment.

2.5 Hairy Root 1. Stirred tank bioreactor. Plastic mesh. Gamborg B5/2 medium
Culture in a 1.5-L (see Subheading 2.1).
Modified Stirred Tank
Bioreactor

2.6 Tropane 1. Chloroform, 0.2 M H2SO4, 1 N NaOH, methanol–water

Alkaloids Extraction (50:50 v/v), gaseous N2, hyoscyamine, 6β-hydroxyhyoscyamine,
and HPLC Analysis and scopolamine standards.
2. HPLC Shimadzu LC-20AT system equipped with an UV–Vis
detector, column oven.
3. Li-ChroCART 125-4 column with LiChrospher 60 RP-select
B (Merck), particle size 5 μm.
4. Mobile phase: octanesulfonic acid (0.01 M, pH 3)–methanol
(65:35 v/v).
5. Conical tubes, amber vials, 0.45 μm nylon membrane.

Table 2
Primers used for the verification of the transgenic nature of hairy roots by
PCR

Gene Primers Amplicon size (bp)

rolB 5′-AGTTCAAGTCGGCTTTAGGC-3′ 770
5′-TCCACGATTTCAACCAGTAG-3′
rolC 5′-TAACATGGCTGAAGACGACC-3′ 534
5′-AAACTTGCACTCGCCATGCC-3′
aux1 5′-TTCGAAGGAAGCTTGTCAGAA-3′ 350
5′-CTTAAATCCGTGTGACCATAG-3′
virD 5′-ATGTCGCAAGGCAGTAAGCCC-3′ 438
5′-GGAGTCTTTCAGCATGGAGCAA-3′
 Brugmansia Candida Hairy Roots 177

3 Methods

3.1 Sterilization of B. 1. Hydrate B. candida seeds for 3–5 days under tap water.
candida Seeds 2. After hydration remove the brown seed coat (Fig. 1).
and Seedling Growth
3. Surface-sterilize the seeds by immersing them into a 70 % (v/v)
ethanol solution for 30 s. Transfer them immediately to a 10 %
(v/v) hypochlorite solution in a closed sterile flask.
4. Incubate the material for 30 min at room temperature, stirring
the flask every 10 min.
5. Rinse the seeds with abundant sterile water for 5 min. Repeat
this step 4–5 times.
6. Incubate the sterilized seeds in 0.1 % gibberellic acid at
24 ± 1 °C for 16 h in order to facilitate and accelerate the ger-
mination of B. candida seeds.
7. Transfer the seeds to petri dishes containing Gamborg B5/2
medium (4–5 seeds/petri dish) and incubate them until ger-
mination at 24 ± 1 °C, under a 16 h photoperiod using cool
fluorescent lamps at a light intensity of approximately 90 μmol/
m2/s (PAR).
8. Check the plates the subsequent days to discard any contami-
nation. If contamination is found, transfer the uncontaminated
seeds to fresh medium.
9. Subculture the germinated seeds to fresh Gamborg B5/2
medium for seedling growth. Incubate the culture flasks in the
same conditions as described above for 4–6 weeks.

3.2 Agrobacterium 1. Inoculate a plate or 5 mL of YMB medium supplemented with

rhizogenes Growth 100 μg/mL rifampicin for growth of A. rhizogenes LBA 9402
for Hairy Root (see Note 3). The inocula can be done using a single colony
Induction previously grown on YMB plates or from a stock sample cryo-
preserved with glycerol.
2. Incubate the plates or flasks for 24–48 h at 28 °C, 180 rpm.

Fig. 1 (a) B. candida seeds, (b) Peeled seed

178 Alejandra Beatriz Cardillo et al.

3. Subculture the bacteria in YMB-rifampicin plates and incubate

them for 24 h at 28 °C for Agrobacterium-mediated transfor-
mation (see Note 4).

3.3 A. rhizogenes 1. Agrobacterium strains can be maintained by continuous sub-

Maintenance culturing on YMB-rifampicin plates or by preparing glycerol
stocks.
2. For cryopreservation, grow the bacteria in liquid YMB medium
supplemented with the antibiotic for 24–48 h at 28 °C,
180 rpm.
3. Mix 800 μL of the grown culture with 300 μL of glycerol. Mix
the tubes thoroughly by vortexing and store immediately at
−80 °C.

3.4 Induction 1. 4–6 week old seedlings are used for hairy root production
and Establishment (Fig. 2a). The youngest leaves are harvested in order to pro-
of Hairy Roots vide explants for Agrobacterium transformation (see Note 5).
by Agrobacterium 2. Under laminar flow, cut the leaves into small pieces (1 cm2
rhizogenes-Mediated approximately) and make incisions especially in the major veins
Transformation by using a scalpel blade (see Note 6).
3. Coat the sectioned surface of the explants with the 24–48 h
Agrobacterium culture. Scrape the surface of the plant tissue
with a scalpel saturated with the bacteria.
4. Transfer the infected explants to agar-water plates (2–3
explants/plate). Place explants adaxial side down (see Note 7).
5. Incubate the infected explants in darkness at 24 ± 1 °C for 3 days.

Fig. 2 B. candida (a) In vitro plant (b) Hairy root culture

 Brugmansia Candida Hairy Roots 179

6. Transfer the explants to Gamborg B5/2 medium supple-

mented with 1 g/L ampicillin to inhibit A. rhizogenes growth.
7. Incubate the infected explants at 24 ± 1 °C under a 16-h pho-
toperiod using cool fluorescent lamps at light intensity of
90 μmol/m2/s (PAR).
8. Subculture explants at a 20-day interval. Repeat this step at
least three times maintaining 1 g/L ampicillin to eliminate
Agrobacterium and then gradually reduce the concentration of
the antibiotic.
9. Aseptically excise the root tips that appear at the infection sites
and transfer to individual culture flasks containing Gamborg
B5/2 medium supplemented with ampicillin (Fig. 3). After
three to four passages, roots should be cleared of Agrobacterium.
It is frequently observed that A. rhizogenes remains associated
to the hairy root for a long time.
10. Subculture roots into liquid Gamborg B5/2 medium (Fig. 2b).
If the bacteria are eliminated remove ampicillin from the cul-
ture medium.

3.5 Verification 1. Grind the hairy roots (0.2–0.3 g) to a fine powder with liquid
of the Transgenic N2 (see Note 8).
Nature of B. candida 2. Add 2 mL CTAB buffer and transfer to a 15-mL conical tube.
Hairy Roots Incubate at 65 °C for 1 h 30 min.
3. Remove the sample from the water bath and let it cool.
3.5.1 DNA Isolation
from Hairy Root Cultures 4. Add 3 mL of chloroform–isoamyl alcohol (24:1) and mix by
inversion for 10 min.
5. Centrifuge at 1,500 × g for 10 min at room temperature
(see Note 9).

Fig. 3 B. candida root tips growing at the infection sites after Agrobacterium-mediated transformation
180 Alejandra Beatriz Cardillo et al.

6. Transfer the aqueous phase to a new tube and repeat steps

4–6.
7. Add 10 μL of 10 mg/mL RNase, mix and incubate at room
temperature for 30 min.
8. Add 3 mL of isopropyl alcohol, mix and incubate for 10 min at
room temperature.
9. Centrifuge at 10,000 rpm for 10 min and discard the superna-
tant carefully.
10. Add 200 μL absolute ethanol and transfer to a 1.5-mL micro-
centrifuge tube. Rinse the sample for 1 min and centrifuge.
11. Discard the supernatant carefully; add 200 μL 70 % ethanol.
Rinse the sample for 5 min and centrifuge.
12. Air-dry the DNA pellet and dissolve with 500 μL TE buffer.
Store DNA at −20 °C.

3.5.2 PCR Analysis 1. For PCR reactions, use 5 μL of the template (see
of rolB, rolC, auxI, and virD Subheading 3.5.1) in a 25-μL reaction containing 5 μL of 5×
Genes PCR Buffer, 1 μL of 25 mM MgCl2, 0.5 μL of 10 mM dNTPs,
0.5 μL of each 10 μM primer (Table 2), 0.6 U of Taq poly-
merase, and sterile water to a final volume of 25 μL.
2. Add all reaction components on ice. Gently mix the reaction
and collect all liquid to the bottom of the tube by a quick spin
if necessary. Transfer the reactions to the thermocycler.
3. PCR conditions used for rolB, rolC, auxI, and virD amplifica-
tion are: initial denaturation at 94 °C for 2 min, 30 cycles of
94 °C for 30 s, 58 °C for 1 min, and 72 °C for 1 min and a final
extension at 72 °C for 5 min (see Note 10).
4. Visualize the results by gel electrophoresis in 1 % agarose gels
stained with ethidium bromide.

3.6 Hairy Root 1. Inoculate 250-mL Erlenmeyer flasks containing 50 mL of

Culture in a 1.5-L Gamborg B5/2 medium with 0.2–0.3 g fresh weight (FW)
Modified Stirred Tank hairy roots.
Bioreactor 2. Incubate hairy root cultures at 24 ± 1 °C, 100 rpm under a
16 h photoperiod for 15–20 days. These cultures are used as
inocula for the bioreactor.
3. Place a plastic mesh forming a zigzag arrangement around the
baffles in order to increase the surface area where the roots
could be trapped (Fig. 4c) (see Note 11).
4. For a 1.5-L bioreactor capacity, fill the vessel with 1–1.2 L of
Gamborg B5/2 culture medium.
5. Inoculate the bioreactor with 10 g FW of 15- to 20-days-old
hairy roots previously grown in Erlenmeyer flasks as described
above (see Note 12).
 Brugmansia Candida Hairy Roots 181

Fig. 4 (a) Bioreactor configuration, (b) top view (c, d) lateral view of the plastic mesh arrangement

6. Maintain the airflow rate at 0.5 vvm and the temperature of the
bioreactor vessel at 24 ± 2 °C.
7. Harvest the roots 20 days after inoculation (Fig. 5) and ana-
lyze the samples to estimate FW, growth index (GI) and con-
tent of tropane alkaloids (see Note 13).
8. To estimate FW, vacuum-filter hairy roots, dry between two
sheets of filter paper, and weigh.
9. Calculate the GI using the formula: (Wf − Wi)/Wi, where Wf is
the final FW at 20 days, and Wi is the initial FW of the
culture.
182 Alejandra Beatriz Cardillo et al.

Fig. 5 B. candida hairy root cultures at the day of harvest of the modified stirred tank bioreactor

3.7 Hairy Root 1. Grind hairy root samples to a fine powder with liquid N2.
Processing 2. Incubate the powder (0.3–0.8 g FW) for 2 h in 5 mL 0.2 M
and Organic Extraction H2SO4 on an orbital shaker at 100 rpm.
of Tropane Alkaloids
3. Filter the mixture and alkalinize the aqueous phase up to
pH 12 with 1 N NaOH (see Note 14).
4. Extract the alkaloids from the alkalinized aqueous phase with
5 mL chloroform. Agitate samples by vortexing for 2 min (see
Note 15).
5. Transfer the organic phase to an amber vial.
6. Repeat steps 4 and 5.
7. Evaporate the organic phase under gaseous N2.
8. Dissolve the residue in methanol–water (50:50 v/v) and filter
through a 0.45-μm-pore nylon membrane.

3.8 HPLC Analysis 1. Analyze and quantify tropane alkaloids with a Li-ChroCART
of Tropane Alkaloids 125-4 column with LiChrospher 60 RP-select B (Merck), par-
ticle size 5 μm.
2. Elute the alkaloids isocratically using as mobile phase octane-
sulfonic acid (0.01 M, pH 3)–methanol (65:35 v/v) at a flow
rate of 1 mL/min (solvent quality for HPLC). Detection is
carried out at 220 nm.
3. Adjust the column temperature to 40 °C using a column oven
and inject 20-μL samples.
4. Identify peaks by comparing the retention times of sample
peaks with standards (Fig. 6).
 Brugmansia Candida Hairy Roots 183

a
a. Scopolamine
b. 6b-hydroxyhyoscyamine
100 c. Hyoscyamine
a b c
mAU

50

0 5 10 15 20 25
Minutes
b
30

20

a b c
mAU

10

0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0

Minutes

Fig. 6 Typical chromatograms of the organic extracts. (a) Alkaloid profile of hairy root samples (b) Alkaloid
profile of culture media samples

5. For the standard curve: prepare stock standard solutions of

hyoscyamine, 6β-hydroxyhyoscyamine or scopolamine in meth-
anol–water (50:50 v/v) in a final concentration of 1000 ppm.
6. Dilute the stock solution with methanol–water (50:50 v/v) to
prepare a series of standard solutions of 500, 250, 125, 50, and
12.5 ppm.

4 Notes

1. For the preparation of Gamborg B5/2 medium, add 50 mL

10× Major inorganic nutrient solution, 0.5 mL 1000× Minor
inorganic nutrient solution, 5 mL 100× Fe-EDTA solution,
0.25 mL of 2000× KI solution, 100 mg/L myo-inositol, 1 mL
of 1000× vitamins, water to 1000 mL final volume. For the
composition of stock solutions see Table 1. Adjust pH to 5.5–
5.6 and autoclave at 1 atm, 121 °C for 20 min.
2. Add β-mercaptoethanol to CTAB buffer the day of DNA
extraction. Once added, the half-life of the buffer is just 2–3
days. It is preferable to use it within the day.
184 Alejandra Beatriz Cardillo et al.

3. B. candida can be successfully transformed using not only A.

rhizogenes LBA 9402 but also A. rhizogenes 15834 and A.
tumefaciens C58C1 strains. For simplicity, the protocol
described mentions only A. rhizogenes LBA 9402.
4. Agrobacterium mediated-transformation of B. candida plants
can be done using solid or liquid cultures of the bacteria.
However, the methodology is more efficient when the trans-
formation is carried out with solid cultures.
5. The top young leaves are chosen as explants for transformation
because the lower ones and those obtained from flowering
plants have inferior transformation efficiency.
6. B. candida hairy roots can also be initiated from the stem of in
vitro plants by wounding the organ with a scalpel saturated
with the bacteria (Fig. 2a). However, the rate of adventitious
roots generated by this approach is higher than that obtained
using leaves as explants for transformation.
7. Ensure that the infected area of the plant tissue does not con-
tact the agar surface to prevent the excessive growth of A. rhi-
zogenes over the explants and culture medium. This complicates
the elimination of the bacteria.
8. Keep the ground tissue frozen in order to improve DNA
recovery
9. The CTAB-DNA complex precipitates under 15 °C. Avoid
using refrigerated centrifuges.
10. The transgenic nature of B. candida hairy roots can be verified
by PCR analysis for amplification of the rolB, rolC, and auxI
genes. In addition, the virD gene can be analyzed by PCR to
confirm the elimination of the bacteria from plant tissues.
Hairy roots grow fast and vigorously in media without the
addition of growth regulators. This is a good indication of the
transgenic nature of the roots. However, the characteristic
phenotype of hairy roots is caused by integration and expres-
sion of the aux and rol genes from the root-inducing (Ri) plas-
mid in plant cells infected by A. rhizogenes [26, 27]. Vir genes
are not transferred to the plant genome. The amplification of
virD indicates the presence of the bacteria associated to the
tissue under analysis. For this purpose, it is necessary to ensure
the elimination of the bacteria from the samples to avoid false
positive results.
11. The system includes a plastic mesh to facilitate the root arrange-
ment inside the vessel and its aeration by a stainless steel sparger
located below the turbine (Fig. 4).
12. In order to obtain a uniform distribution of roots within the
vessel, the culture is initially agitated at 50 rpm for 10 min after
the inoculation process.
 Brugmansia Candida Hairy Roots 185

13. B. candida hairy root culture in the modified stirred tank bio-
reactor is finished on day 20 when the root biomass reaches the
maximum capacity of the vessel (Fig. 5).
14. This step is critical. It is important to work quickly in order to
minimize the hydrolysis of tropane alkaloids after alkaliniza-
tion of samples.
15. Continuous vortexing for 2 min improves the transfer of the
alkaloids to the organic phase.

Acknowledgements

This work was supported by the Universidad de Buenos Aires,

Consejo Nacional de Investigaciones Científicas y Técnicas,
Argentina (CONICET), and Agencia Nacional de Promoción
Científica y Tecnológica, Argentina (ANPCyT), by grants UBACyT
181, PIP 0156, and PICT 2125. A.B.C., J.R.T., and A.M.G. are
researchers from CONICET.

References

1. Oksman-Caldentey KM (2007) Tropane and in phosphatidylglycerol. FEBS Lett 332(1–2):

nicotine alkaloid biosynthesis-novel approaches 193–196
towards biotechnological production of plant- 7. Wang H, Lu Y, Chen HZ (2003) Differentiating
derived pharmaceuticals. Curr Pharm effects of anisodamine on cognitive ameliora-
Biotechnol 8(4):203–210 tion and peripheral muscarinic side effects
2. Bedewitz MA, Gongora-Castillo E, Uebler JB, induced by pilocarpine in mice. Neurosci Lett
Gonzales-Vigil E, Wiegert-Rininger KE, 344(3):173–176
Childs KL, Hamilton JP, Vaillancourt B, Yeo 8. Sheng CY, Gao WY, Guo ZR, He LX (1997)
YS, Chappell J, DellaPenna D, Jones AD, Buell Anisodamine restores bowel circulation in burn
CR, Barry CS (2014) A root-expressed shock. Burns 23(2):142–146
l-phenylalanine:4-hydroxyphenylpyruvate ami- 9. Kursinszki L, Hank H, Laszlo I, Szoke E (2005)
notransferase is required for tropane alkaloid Simultaneous analysis of hyoscyamine, scopol-
biosynthesis in Atropa belladonna. Plant Cell amine, 6beta-hydroxyhyoscyamine and apoatro-
26(9):3745–3762 pine in Solanaceous hairy roots by reversed-phase
3. Hashimoto T, Yamada Y (1986) Hyoscyamine high-performance liquid chromatography.
6beta-hydroxylase, a 2-oxoglutarate-dependent J Chromatogr A 1091(1–2):32–39
dioxygenase, in alkaloid-producing root cul- 10. Palazón J, Moyano E, Cusidó RM, Bonfill M,
tures. Plant Physiol 81(2):619–625 Oksman-Caldentey K, Piñol MT (2003)
4. Poupko JM, Baskin SI, Moore E (2006) The Alkaloid production in Duboisia hybrid hairy
pharmacological properties of anisodamine. roots and plants overexpressing the h6h gene.
J Appl Toxicol 27(2):116–121 Plant Sci 165(6):1289–1295
5. Wang TN, Yang HJ, Gu-Ling, Li JY, Zheng XX 11. Zhang L, Ding R, Chai Y, Bonfill M, Moyano
(2005) Advanced measurement and quantita- E, Oksman-Caldentey KM, Xu T, Pi Y, Wang Z,
tive appraise of anisodamine on calcium trig- Zhang H, Kai G, Liao Z, Sun X, Tang K (2004)
gered in cardiac myocyte. In: Engineering in Engineering tropane biosynthetic pathway in
medicine and biology 27th annual conference, Hyoscyamus niger hairy root cultures. Proc Natl
Shanghai, China, 1–4 Sept 2005. Proceedings Acad Sci U S A 101(17):6786–6791
of the 2005 IEEE. pp 7710–7713 12. Dehghan E, Hakkinen ST, Oksman-Caldentey
6. Wang PY, Chen JW, Hwang F (1993) KM, Shahriari Ahmadi F (2012) Production of
Anisodamine causes acyl chain interdigitation tropane alkaloids in diploid and tetraploid
186 Alejandra Beatriz Cardillo et al.

plants and in vitro hairy root cultures of 20. Diwan R, Malpathak N (2008) Novel tech-
Egyptian henbane (Hyoscyamus muticus L.). nique for scaling up of micropropagated Ruta
Plant Cell Tiss Org Cult 110(1):35–44 graveolens shoots using liquid culture systems:
13. Samuelsson G (ed) (1999) Drugs of natural a step towards commercialization. N Biotechnol
origin, 4th edn. Gunnar Samuelsson and 25(1):85–91
Apotekarsocieteten-Swedish Pharmaceutical 21. Georgiev MI, Pavlov AI, Bley T (2007) Hairy
Society, Swedish Pharmaceutical Press, Sweden root type plant in vitro systems as sources of
14. Palazon J, Navarro-Ocana A, Hernandez- bioactive substances. Appl Microbiol
Vazquez L, Mirjalili MH (2008) Application of Biotechnol 74:1175–1185
metabolic engineering to the production of 22. Jaremicz Z, Luczkiewicz M, Kokotkiewicz A,
scopolamine. Molecules 13(8):1722–1742 Krolicka A, Sowinski P (2014) Production of
15. Naumann A, Kurtze L, Krahmer A, Hagels H, tropane alkaloids in Hyoscyamus niger (black
Schulz H (2014) Discrimination of Solanaceae henbane) hairy roots grown in bubble-column
taxa and quantification of scopolamine and and spray bioreactors. Biotechnol Lett 36(4):
hyoscyamine by ATR-FTIR spectroscopy. 843–853
Planta Med 80(15):1315–1320 23. Guillon S, Tremouillaux-Guiller J, Pati PK,
16. Roses OE, Miño J, Villamil EC (1988) Acción Rideau M, Gantet P (2006) Hairy root
farmacodinámica de las flores de Brugmansia research: recent scenario and exciting pros-
candida. Fitoterapia 59:120–127 pects. Curr Opin Plant Biol 9(3):341–346
17. Giulietti AM, Parr AJ, Rhodes MJ (1993) 24. Eibl R, Eibl D (2008) Design of bioreactors
Tropane alkaloid production in transformed suitable for plant cell and tissue cultures.
root cultures of Brugmansia candida. Planta Phytochem Rev 7:593–598
Med 59(5):428–431 25. Gamborg OL, Miller RA, Ojima K (1968)
18. Wu YF, Lü W, Lu Q, Zhang WS (2005) Nutrient requirements of suspension cultures of
Asymmetric synthesis of anisodine. Chin Chem soybean root cells. Exp Cell Res 50(1):151–158
Lett 16(10):1287–1289 26. Bulgakov VP (2008) Functions of rol genes in
19. Cardillo AB, Otalvaro Alvarez AM, Calabro plant secondary metabolism. Biotechnol Adv
Lopez A, Velasquez Lozano ME, Rodriguez 26(4):318–324
Talou J, Giulietti AM (2010) Anisodamine 27. Nemoto K, Hara M, Suzuki M, Seki H, Oka A,
production from natural sources: seedlings and Muranaka T, Mano Y (2009) Function of the
hairy root cultures of Argentinean and aux and rol genes of the Ri plasmid in plant cell
Colombian Brugmansia candida plants. Planta division in vitro. Plant Signal Behav 4(12):
Med 76(4):402–405 1145–1147
 Chapter 13

Micropropagation, Acclimatization, and Greenhouse

Culture of Veratrum californicum
Sarah A. White, Jeffrey Adelberg, Jacqueline Naylor-Adelberg,
David A. Mann, Ju Yeon Song, and Youping Sun

Abstract
Micropropagation and production of Veratrum californicum is most successful when using a premixed
Murishage and Skoog basal medium with vitamins and a 5-week subculture cycle at 16 °C for multiplication.
These culture conditions provide the best percent survival after acclimatization in the greenhouse. However,
clone response to temperature and light quality within culture conditions varies. Micropropagated plants
have mass and morphology similar to 2- or 3-year-old seedlings. Acclimatized plantlets can then be grown
in the greenhouse using sub-irrigation (ebb and flood) to maintain substrate volumetric water content > 44 %.
Growth cycle in the greenhouse must be about 100 days, followed by dormancy for 5 months at 5 °C.

Key words Veratrum californicum, Cyclopamine, Dormancy, Low-temperature propagation,

Chilling, Ebb-and-flood irrigation

1 Introduction

Veratrum californicum produces cyclopamine, a compound with

therapeutic potential [1, 2]. Micropropagation of this rhizoma-
tous, perennial species, which is adapted to alpine wet meadows, is
challenging due to its slow growth rate and the genotypic diversity
of wild propagative material [3]. Fixing genetic diversity is desir-
able for therapeutic purposes, as some of the clonal lines produce
greater concentration of cyclopamine. However, micropropaga-
tion tends to minimize genetic diversity via selection of clonal lines
that adapt well to culture conditions and quickly multiply.
Therefore one could inadvertently lose desirable clonal lines
through simple propagative selection. Validation of the micro-
propagation protocol included acclimatizing hundreds of plantlets
in the greenhouse. Determination of culture and acclimatization
conditions was key components of developing a propagation sys-
tem for this difficult species.

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_13, © Springer Science+Business Media New York 2016

187
188 Sarah A. White et al.

The micropropagation and greenhouse production method-

ologies detailed below encompass five years of research with V.
californicum. Plants collected from the wild were stored for up to
6 months at 5 °C, disinfected, initiated (stage I), subcultured
(stage II), stably multiplied (stage III), and then transferred to the
greenhouse for acclimatization and assessment of survival ratios
(stage IV; Fig. 1). Over 1250 plantlets (35 %) of those transferred
from laboratory survived transfer to the greenhouse [3]. For plant-
lets grown using the methods detailed below survival ratios
increased to 55 %.

2 Materials

When water is mentioned below, we are referring to double-

distilled, deionized (DDI) water unless another water source is
specifically stated.

2.1 Agar The pH of solutions is adjusted using 1 M NaOH.

and Nutrient Support
1. Stirring hot plate.
2. Magnetic spin bar.
3. 1 M NaOH solution.
4. 10 mM benzyladenine (BA) stock.
5. Fixed speed vortex mixer (single tube).
6. 1 mM 1-naphthaleneacetic acid (NAA) stock.
7. Tri-scale culture medium (see Note 1, Tables 1 and 2).
8. Root-promoting culture medium (see Note 1, Tables 1 and 2).
9. Dispensing peristaltic pump.
10. Tray sized to hold vessels.
11. GA-7 (6 cm × 6 cm × 10 cm), polycarbonate vessel with lid.
12. Parafilm M or polyethylene vessel sealing film.
13. Autoclave.

2.2 Tissue Handling 1. Sterilization solution I: Tween 80 (Table 3).

2. Sterilization solution II: Ethanol (EtOH) solution (Table 3).
3. Sterilization solution III: 50 % bleach solution (Table 3).
4. Sterilization solution IV: 10 % bleach solution (Table 3).
5. 70 % EtOH solution (140 proof, laboratory grade).
6. Spray bottle (300 mL).
7. Alcohol burner, with wick and 95 % ethanol.
8. Utensils: scalpel and forceps.
9. Glass test tube (34 mL capacity).
 Micropropagation, Acclimatization, and Greenhouse Culture of Veratrum californicum 189

Fig. 1 Stages of micropropagation: (a) explant tri-scale for initiation, (b) shoot induction, (c) shoot proliferation
and (d) shoots (e) divided for (f) stable multiplication, (g) rooting of plantlets, (h) plantlet with agar washed from
roots prior to (i) planting in 72 cell tray and acclimatization, and (j) plantlet after growth in the greenhouse
190 Sarah A. White et al.

Table 1
Mineral components and vitamins within the Murishage and Skoog (MS)
Basal Medium with Vitamins as detailed by supplier and combined into
concentrated stock powder, from which nutrient solutions are prepared
as detailed by Murishage and Skoog [5]

Chemical composition mg/L

Ammonium nitrate 1650
Boric acid 6.2
Calcium chloride, anhydrous 332.2
Cobalt chloride·6H2O 0.025
Cupric sulfate·5H2O 0.025
Na2EDTA·2H2O 37.26
Ferrous sulfate·7H2O 27.8
Magnesium sulfate, anhydrous 180.7
Manganese sulfate·H2O 16.9
Molybdic acid (sodium salt)·2H2O 0.25
Potassium iodide 0.83
Potassium nitrate 1900
Potassium phosphate, monobasic 170
Zinc sulfate·7H2O 8.6
Glycine (free base) 2
myo-Inositol 100
Nicotinic acid (free acid) 0.5
Pyridoxine·HCl 0.5
Thiamine·HCl 0.1

10. Tri-fold paper toweling.

11. Laminar flow hood, positive pressure room (see Note 2).

2.3 Micro- 1. Positive pressure culture room (see Note 2). Temperature
propagation maintained at 24 °C.
Conditions 2. Cool white fluorescent (ambient) light: 20 μmol/m2 s photo-
synthetic photon flux density (PPFD).
3. Low temperature chambers with light emitting diode (LED)
light source: 20 μmol/m2/s monochromatic red (peak at
660 nm), 20 μmol/m2/s blue (peak at 480 nm), 20 μmol/
m2/s red–blue (1:1), and 40 μmol/m2/s red–blue (3:1, Fig. 2).
 Micropropagation, Acclimatization, and Greenhouse Culture of Veratrum californicum 191

Table 2
Specific components of tri-scale culture medium and root-promoting culture mediuma

Culture media Components Mass/volume

Tri-scale MS Basal Medium with Vitamins 4.43 g
Sucrose 30 g
Micropropagation Type II Agar 7g
10 mM BA stock 2.3 mL
Root-promoting MS Basal Medium with Vitamins 4.43 g
Sucrose 30 g
Micropropagation Type II Agar 7g
1 mM NAA stock 5.0 mL
a
2-L glass cylinder or flask (see Note 1), dispense 1-L water and add MS basal medium with vitamins, sucrose, agar, and
growth regulator, then adjust pH. Melt agar on stirring hot plate and dispense prior to boiling

Table 3
Sterilization solutions for sanitizing tissuesa

Sterilization solution Components Mass/volume

I Tween 80 2 drops
DI (deionized) water 200 mL
II 95 % EtOH (190 proof, laboratory grade) as needed
III Bleach (5.25 % sodium hypochlorite, NaOCl) 50 mL
Water 50 mL
IV Bleach 10 mL
Water 90 mL

4. Shelving systems with fluorescent or LED lights 30 cm from

surface of containers.

2.4 Greenhouse 1. Potting substrate Fafard 3B mix: 45 % Canadian sphagnum

Conditions peat moss, 25 % processed pine bark, 15 % perlite, 15 % ver-
miculite, starter nutrients (40–230 mg/L N; 5–30 mg/L P;
40–200 mg/L K, Ca, and S; 25–80 mg/L Mg), wetting agent,
dolomitic limestone.
2. 300 mg/L Subdue® [25.1 % Metalaxyl: N-(2,6-
dimethylphenyl)-N-(methoxyacetyl) alanine methyl ester,
74.9 % inert ingredients; 7.6-L (#3) plastic container].
3. 72 cell tray (53.3 cm × 27 cm × 5.7 cm) with clear-plastic dome lid.
192 Sarah A. White et al.

Fig. 2 Light emitting diodes in controlled environment room providing desired light qualities for culturing
Veratrum californicum plantlets. 20 μmol/m2/s monochromatic blue (a), 20 μmol/m2/s red (b), 20 μmol/m2/s
red–blue (c), and 40 μmol/m2/s red–blue (d)

4. Controlled environment room (CER) with relative humidity

and temperature control.
5. Mist-bed. Greenhouse bench outfitted with misting emitters
to mist water over plants at regimented intervals.
6. Square trays (60 cm × 60 cm) that are 10 cm deep.
7. LI-90 Quantum light sensor.
8. 1000-W metal halide lamp.
9. Soil moisture sensors.
10. Dayton® utility pump.
11. Orbit® signature timer control.
12. Honeywell drain valve.
13. 190-L tank.
14. Drip irrigation line and tubing with emitters (3.78 L/min).
 Micropropagation, Acclimatization, and Greenhouse Culture of Veratrum californicum 193

3 Methods

3.1 Preparation 1. Prepare tri-scale or root promoting culture media in 2-L glass
of Agar and Nutrient beaker. Place beaker on a hot plate and stir with a magnetic
Support Recipes spin bar while heating until all compounds are dissolved.
2. Dispense 50 mL aliquots of solution into individual vessels
using the peristaltic pump, place lids on the vessels. Prime the
peristaltic pump with manufacturer recommended volume of
solution prior to dispensing measured aliquots of solution
(see Note 3).
3. Autoclave vessels filled with culture medium for 25 min at
15–20 atm and 121 °C.
4. Transfer sterilized vessels to positive pressure culture room
(see Note 2), and transfer plantlets into the containers under
laminar flow hood to minimize contamination. Seal vessels
with Parafilm or polyethylene sealing film.

3.2 Plant Handling 1. Veratrum californicum rhizomes with attached bulbs were col-
Prior to Initiation lected in Heber Valley and Bolger Canyon, Utah and shipped
of Micropropagation overnight to the greenhouse.
2. Rhizomes with attached bulbs were immediately sorted and
potted into #3 plastic containers with Fafard 3B substrate
(see Note 4) and drenched with Subdue® to limit potential for
root rot.
3. Containers with plants were then placed in a CER at 10 °C and
70 % relative humidity (RH) for 2 weeks, and then CER tem-
perature was reduced to 5 °C with a RH of 65 % and rhizomes
with attached bulbs were chilled up to 6 months.

3.3 Micro- 1. Remove containers with dormant bulbs from the CER. Remove
propagation: Stage bulb and rhizome from the container. Excise the bulb from the
I—Initiation via rhizome and roots, and wash with tap water to remove soilless
Tri-scale substrate (see Note 5, Fig. 3a). Remove sheath and several lay-
ers of the outer scales.
2. Soak bulbs in Sterilization Solution I, stir (on a stir-plate with
a magnetic spin bar) for 10 min, and rinse with DDI water
three times (Fig. 3b).
3. Surface-sterilize bulbs by soaking in Sterilization Solution II
for 2 min (Fig. 3c).
4. Transfer bulbs to Sterilization Solution III for 2 min and rinse
in sterile DDI water (Fig. 2d).
5. Peel outer scales from bulb and crosscut into wedge-shaped
pieces.
6. Sterilize utensils between cuts using the flame burner as
needed. Hood surfaces should be sterilized using spray bottle
filled with 70 % EtOH between each bulb cutting event, and
194 Sarah A. White et al.

Fig. 3 Bulbs (a) were detached from rhizomes, soaked in distilled water with Tween 80 (b, Sterilization Solution
I), rinsed and placed in 95 % ethanol (c, Sterilization Solution II), and then transferred to 50 % commercial
bleach solution (d, Sterilization Solution III). Outer layers were peeled off (e) and bulb was placed in 10 %
bleach solution (f, Sterilization Solution IV), the tissue wedge (g) was then sliced into sections leaving leaf
scales connected to basal plate (h) and inserted into a vessel for shoot induction (i)

utensils sterilized again by placing them in test-tube with 95 %

EtOH and flaming.
7. After cutting pieces into wedges, soak in Sterilization Solution
4 (10 % bleach) for 10 min, and then rinse in sterile DDI water
(Fig. 3e).
8. In laminar-flow hood, further split the sterilized tissue wedges
(Fig. 3f) into tri-scale sections by slicing (scalpel) tissue, leave
 Micropropagation, Acclimatization, and Greenhouse Culture of Veratrum californicum 195

a minimum of three leaf scales connected through the basal

plate (see Note 6, Fig. 3g).
9. Place each tri-scale explant (clone) in GA7 Vessel filled with
tri-scale culture medium.
10. Incubate explants in the dark at 16 °C for 4–5 weeks to facili-
tate adaptation to culture conditions. Discard contaminated
explants and transfer only “clean” explants (see Note 7).
11. After a 4–5 week interval, trim necrotic tissues from clean
explants, if necessary. Transfer explants to fresh tri-scale culture
medium and place under light in plant growth chamber at
16 °C (see Note 8). Adjust light intensity, regardless of source,
to between 20 and 40 μmol/m2/s (see Note 9) with a 16 h
light–8 h dark cycle.
12. Subculture cycle duration will range from 4 to 6 weeks,
depending upon clone [3]. Shoots form 5–6 weeks after trans-
fer, depending upon clone (see Note 10).
13. Calculate multiplication ratios by counting the number of
shoots per vessel at the conclusion of each subculture cycle and
dividing by the initial number of shoots when explant placed
within a new vessel.
14. Once stable (Stage-II) multiplication rates are attained, trans-
fer plantlets to GA7 vessels containing 50 mL root-promoting
culture medium and place in low temperature chamber at
16 °C. Light intensity for rooting is 40 μmol/m2/s provided
by red–blue LED light, with a 16 h light–8 h dark cycle
(Fig. 2d).
15. Once roots have formed, generally after 5 weeks in the root-
promoting culture medium, remove plants from the culture
medium, wash the agar sticking to the roots under running tap
water, and transfer plantlets into 72 cell plastic trays.
16. Transfers for acclimatization or growth in the greenhouse
should be carried out during fall or winter, when average day
temperature is below 22 °C (see Note 11)

3.4 Acclimatization 1. Water plants in 36 cell tray (see Note 12), cover with a plastic
of Plantlets dome, and place in a mist-bed for 10 days.
and Greenhouse 2. After 10 days, remove the plastic domes from the trays. Leave
Production the trays in the mist bed for an additional 20 days.
3. Transfer well-acclimatized plants (see Note 13) to a non-
misted bench.
4. Use an ebb-and-flood irrigation system to irrigate plantlets
(see Note 14), and maintain average soil moisture above 44 %
to promote the healthiest growth (see Note 15).
196 Sarah A. White et al.

5. Light levels in the greenhouse should be > 100 W/m2, supply

supplemental light (1000-W metal halide lamp), as needed.
Monitor light levels with a quantum sensor, and log light level
readings over time, provide supplemental light when needed.
6. When leaves senesce, let plants dry, treat with Subdue fungi-
cide, and place in CER.

4 Notes

1. MS medium prepared within a container that is at least 0.2-L

larger than desired final volume, as medium must be stirred
and agar melted prior to distribution in culture containers. For
1-L water and add 4.43 g Murishage and Skoog (MS, Table 1)
basal medium with vitamins. Weigh 30 g sucrose and transfer
to cylinder. Weigh 7 g agar (Micropropagation Type II) and
transfer to cylinder. Add 2.3 mL 10 mM BA stock (23 μM BA
final concentration). Melt agar on stirring hot plate and dis-
pense prior to boiling.
2. A positive pressure culture room maintains a flow of air out of
the room, protecting the plantlets from possible fungal or bac-
terial pathogens that could otherwise contaminate the
cultures.
3. Prior to dispensing growth medium solutions, we prime our
peristaltic pump with at least 300 mL solution, and also peri-
odically calibrate the unit to ensure accuracy of volumes dis-
pensed into tissue culture vessels.
4. Veratrum rhizomes with attached bulbs should be planted
high within containers, with 1/3 to 1/2 of bulb above the
substrate surface, similar to Amaryllis container production, to
minimize potential for rot [1].
5. Handling of rhizomes and bulbs prior should occur in an area
separate from culture rooms, where cross-contamination of
other cultures is not a concern. When handling the propaga-
tive materials, the soil was washed from all roots in the head
house of the greenhouse, and relatively clean material were
then transferred to a laboratory for subsequent sterilization
procedures.
6. A section of the basal plate remained attached to each of the
pieces of the wedge as it was sliced. Each tri-scale consisted of
a minimum of three-scales in each explant piece [4].
7. Contamination occurred if microbial or fungal growth within
the vessel was supported on sugar-containing medium, despite
efforts to sterilize the tissue. Contamination rates averaged
78 % for first transfer and 42 % for the second transfer from
Micropropagation, Acclimatization, and Greenhouse Culture of Veratrum californicum 197

greenhouse grown V. californicum bulbs, while bulbs initiated

into culture, directly after harvest with no chilling interval,
averaged 4 % contamination for the first transfer and 12 % for
the second transfer.
8. Three different culture temperatures 10, 16, and 24 °C were
evaluated. 16 °C was the ideal temperature for proper plant
acclimatization and growth in the greenhouse. Veratrum cali-
fornicum is unique and requires low temperature during mul-
tiplication to affect apparent quality in subsequent culture
cycles or upon acclimatization in the greenhouse.
9. Light quality during initiation and multiplication stage did not
affect all clones in a similar manner, thus we cannot recom-
mend a single light quality as “best” as clones reacted in a dif-
ferential manner [3].
10. Genotypic differences of clonal lines initiated resulted in stag-
gered subculture cycles, with some cycling and needing trans-
fer after only 4 weeks, with others needing transfer only after
6 weeks.
11. Because V. californicum is a high-alpine plant species, it is
adapted to cooler day temperatures (15–20 °C) and a dip in
night temperature to 5 or 10 °C. Thus, when transfers to the
greenhouse for acclimatization and growth occur, schedule
timing so that a minimum of 100 days are available before
average day temperatures excessively (+5 °C) exceed 20 °C and
while minimum night temperatures still dip to 15 °C.
12. When watering in plantlets, be sure that the substrate is watered
evenly and that minimal “gouging” of the surface occurs. A
water wand or other tool that allows the water to be applied as
a spray, in a relatively even manner over the substrate surface,
is the best way to water these delicate plantlets.
13. Acclimatized plantlets are those with green leaves and a fleshy
base (primary rhizome) that is turgid after 6 weeks in the
greenhouse.
14. We developed an automated ebb-and-flood watering system
based on time intervals. Water began to fill the trays, in which
plants were placed, at 1800 in the evening and drained out at
0600 the following day. These time intervals were chosen to
minimize potential for algal growth in recycled irrigation
solutions. The ebb-and-flood system consisted of the square
tray on the greenhouse bench, fitted with a drain valve (Fig. 4).
The irrigation system cycled on at 1800, and water from the
sub-irrigation tank (190-L tank) was pumped into the tray for
5 min, until the water level in the tray was approximately
2.8 cm deep. At 0600 the next day, the drain valve opened and
198 Sarah A. White et al.

Fig. 4 Overview of ebb and flood sub-irrigation system. Square trays (a) which held either propagative stock
plants or micropropagated seedlings. Drip lines (b) dispensed solutions from the stock tank (c) on a regulated
basis. The Honeywell motorized valve (d) closes and opens at the drain valve (e) on a timed basis as regulated
by the controller (f). The Dayton pump (g) was powered on by the power start relay (h) when the controller sent
the signal

Fig. 5 Decagon 10-HS soil moisture sensors (a) inserted into #3 containers (b) to monitor soil moisture in situ

the solution drained back into the sub-irrigation tank. This

flood duration, permitted the substrate to become saturated
with water, and provided enough water to the plants for growth
the following day.
15. We used Decagon 10-HS soil-moisture sensors, inserted into
soilless substrate within the trays, to monitor soil moisture
(Fig. 5). We determined that an ebb-and-flood event on a daily
basis maintained the soil moisture more consistently around
44 %, which was preferred by V. californicum [2].
 Micropropagation, Acclimatization, and Greenhouse Culture of Veratrum californicum 199

Acknowledgement

We gratefully acknowledge the support of Infinity Pharmaceuticals,

Inc. that allowed us to conduct the work.

References
1. Sun YP, White SA, Mann DA, Adelberg J (2012) Veratrum californicum, a native medicinal spe-
Chilling requirements to break dormancy of cies, for micropropagation. In Vitro Cell Dev
Veratrum californicum. HortSci 47(12):1710– Biol—Plant 50:337–344
1713 4. Ulrich MR, Davies FT, Koh YC, Duray SA,
2. Sun YP, White SA, Mann DA, Adelberg J (2013) Egilla JN (1999) Micropropagation of Crinum
Photosynthetic characteristics of Veratrum cali- ‘Ellen Bosanquet’ by tri-scales. Sci Hortic
fornicum in a greenhouse environment. J Med 82:95–102
Active Plants 1(4):134–142 5. Murishage T, Skoog F (1962) A revised medium
3. Song JY, Naylor-Adelberg J, White SA, Mann for rapid growth and bioassays with tobacco tis-
DA, Adelberg J (2014) Establishing clones of sue cultures. Physiol Plant 15:473–497
 Chapter 14

In Vitro Propagation of Withania somnifera (L.) Dunal

Pritika Singh, Rupam Guleri, and Pratap Kumar Pati

Abstract
Withania somnifera (L.) Dunal known as Ashwagandha is commonly used in traditional Indian medicine
system. It possesses immense therapeutic value against a large number of ailments such as mental diseases,
asthma, inflammation, arthritis, rheumatism, tuberculosis, and a variety of other diseases including cancer.
The therapeutic potential of W. somnifera is due to the presence of secondary metabolites mainly, tropane
alkaloids and withanolides (steroidal lactones). The growing realization of commercial value of the plant
has initiated a new demand for in vitro propagation of elite chemotypes of Withania. Micropropagation
which is an important tool for rapid multiplication requires optimization of number of factors such as nutri-
ent medium, status of medium (solid and liquid), type of explant, and plant growth regulators. Similarly, an
efficient and reproducible in vitro regeneration system which is a prerequisite for the development of
genetic transformation protocol requires precise manipulation of various intrinsic and extrinsic factors.

Key words Withania somnifera, In vitro propagation, Shoot multiplication, Liquid culture medium,
Shoot regeneration, Rooting, Secondary metabolites

1 Introduction

In recent years there has been renewed interest in natural medicines

that are obtained from plant parts or plant extracts. Herbal medi-
cines have attracted global attention due to their safety and efficacy.
At present about 75–80 % of the population in developing coun-
tries depends on herbal medicines for primary health care [1].
Withania somnifera (L.) Dunal is highly reputed in the Indian tra-
ditional medicine systems of Ayurveda and Unani [2]. It is com-
monly known as Ashwagandha and belongs to the family Solanaceae.
It also appears in World Health Organization (WHO) monographs
on selected medicinal plants [3]. The plant is widely distributed in
Indian subcontinent as well as in Asia, Africa, Mediterranean region,
and Middle East [4]. W. somnifera is well known for its antistress,
anti-inflammatory, antitumor, antibacterial, antioxidative, analge-
sic, antiarthritic, anticoagulant, immunomodulatory, cardioprotec-
tive, and neuroprotective properties [2, 5, 6]. The pharmacological
properties are mainly attributed to the presence of secondary

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_14, © Springer Science+Business Media New York 2016

201
202 Pritika Singh et al.

metabolites such as withanolides (withaferin A, withanone, witha-

nolide A, and withanolide D) and tropane alkaloids (isopelletierine,
anaferine, tropine, pseudotropine) [7].
Biotechnological tools are important to select, multiply, con-
serve, and engineer the critical genotypes of W. somnifera. In vitro
propagation of plants holds tremendous potential for the rapid
production of high-quality plant-based medicines. Developing an
efficient in vitro propagation system would ensure steady supply of
uniform, healthy plant material throughout the year for the health
sector and would also be instrumental in understanding basic phys-
iological aspects of secondary metabolite production, accumula-
tion, and transport. The present chapter describes various protocols
for in vitro propagation and regeneration of W. somnifera from
different explants. We also report for the first time a reproducible
protocol for somatic embryogenesis in W. somnifera.

2 Materials

2.1 Micro- 1. Seeds and nodal explants of W. somnifera collected from the field.
propagation of W. 2. 0.4 % (v/v) sodium hypochlorite solution.
somnifera
3. 70 % ethanol.
4. Stock solutions of Murashige and Skoog (MS) [8] medium (MS
stock I, II, III, and IV) (Table 1). Store at 4 °C (see Notes 1 and 2).
5. Sucrose.
6. Stock solutions (5 mM) 6-benzylaminopurine (BAP), kinetin
(KN), thidiazuron (TDZ), 1-naphthalene acetic acid (NAA),
indole acetic acid (IAA), and indole butyric acid (IBA)
(Table 2). Store the stock solutions at 4 °C (see Note 3).
7. 1 N NaOH and 1 N HCl.
8. Agar.
9. Beakers, measuring cylinders, Erlenmeyer flasks (250 ml), cul-
ture tubes (8.9″ × 1″), glass jars (350 ml), and petri dishes
(90 mm).
10. Micropipettes (2–20 μl, 20–200 μl, 100–1000 μl).

2.1.1 Hardening 1. In vitro raised microshoots.

of Plantlets 2. Sterile mix of sand and soil (1:1).
3. Earthen pots.

2.2 In Vitro 1. Seeds from field grown plants and leaf explant from in vitro
Regeneration of W. raised plants.
somnifera 2. Stock solutions (5 mM) of 6-benzylaminopurine (BAP),
2,4-dichlorophenoxy acetic acid (2,4-D), and indole acetic
acid (IAA) (Table 2). Store at 4 °C (see Note 3).
Table 1
Preparation of MS stock solutions and MS medium

Concentration Concentration of stock Volume per

Constituents (mg/l) solution (mg/l) liter (ml)
Macroelements stock-I NH4NO3 1650 33,000 50
KNO3 1900 38,000
CaCl2·2H2O 440 8800
MgSO4·7H2O 370 7400
KH2PO4 170 3400
Microelements KI 0.83 166 5
stock-II
H3BO3 6.2 1240
MnSO4·4H2O 22.3 4460
ZnSO4·7H2O 8.6 1720
Na2MoO4·2H2O 0.25 50
CuSO4·5H2O 0.025 5
CoCl2·6H2O 0.025 5
Iron stock stock-III FeSO4·7H2O 27.85 5560 5
Na2EDTA 37.25 7460
Vitamins stock-IV Meso inositol 100.0 20,000 5
Glycine 2.0 400
Nicotinic acid 0.5 100
Pyridoxine–HCl 0.5 100
Thiamine–HCl 0.1 20

Table 2
Preparation and storage of various plant growth regulators used for in vitro propagation and
regeneration of W. somnifera

Preparation and storage

Growth regulator Molecular weight Solvent Diluent Storage

2,4 D 221.0 Ethanol/1 N NaOH Water 0–4 °C
IAA 175.2 Ethanol/1 N NaOH Water 0–4 °C
IBA 203.2 Ethanol/1 N NaOH Water 0–4 °C
NAA 186.2 1 N NaOH Water 0–4 °C
BAP 225.3 1 N NaOH Water 0–4 °C
TDZ 220.2 DMSO Water 0–4 °C
KN 215.2 1 N NaOH Water 0–4 °C
204 Pritika Singh et al.

2.3 Histological 1. Fixative: FAA (formaldehyde–acetic acid–50 % alcohol) (1:1:18).

Evidence of In Vitro 2. Rectified alcohol.
Regeneration in W.
3. tert-butyl alcohol (TBA).
somnifera
4. Paraffin wax.
5. Xylene.
6. Gelatine (1 % (w/v) solution in distilled water).
7. Safranin stain (1 % (w/v) solution in distilled water).
8. Fast green stain (0.25 % (w/v) solution in 50 % clove oil pre-
pared in absolute ethanol).
9. Clove oil.
10. DPX mountant.
11. Rotary microtome.
12. Slide warmer.

3 Methods

3.1 Micro- 1. Mix the MS stock solutions as mentioned in Table 1. Add

propagation sucrose at a final concentration of 3 % (w/v).
3.1.1 Preparation 2. Add the desired PGR in the required amount and adjust pH of
of MS Medium the medium to 5.8 using either 1 N HCl or 1 N NaOH.
3. Prepare solid medium by adding agar (0.8 % w/v), whereas use
no gelling agent for making liquid medium.
4. Sterilize the medium by autoclaving it for 20 min at 1.1 kg/
cm2 pressure and 121 °C.

3.1.2 Initiation of Aseptic 1. Wash thoroughly the explants (seeds and nodal segments) col-
Cultures of W. somnifera lected from the field with Tween 20 solution. Treat the explants
with 70 % ethanol for 5 min.
2. Perform the surface sterilization of explants with 0.4 % (v/v)
sodium hypochlorite solution containing two to three drops of
Tween 20 for 20–30 min (see Note 4) and wash properly 3–4
times with sterile double distilled water till the traces of Tween
20 are removed completely.
3. Cut the exposed ends from both the sides of nodes and inocu-
late the segments in tubes containing solid basal MS medium
and 3 % sucrose (w/v), pH 5.8 (see Notes 5 and 6).
4. For seed germination, give a small incision to seeds and inocu-
late them in petri dishes containing MS basal medium and 1 %
sucrose (w/v), pH 5.8.
5. Incubate the cultures in culture room at 25 °C and photon
flux density (PFD) of 40 μmol/m2/s provided by cool, white
fluorescent lamps. Maintain the photoperiod of 16 h in 24 h
light–dark cycle.
 In Vitro Propagation of Withania somnifera (L.) Dunal 205

6. After 4 weeks of culture, seeds start to germinate and multiple

shoots form from the nodal segments. Use actively growing
shoots and seedlings for further experimentation.

3.1.3 Shoot Proliferation 1. Excise the in vitro growing shoots and inoculate them in flasks
containing MS medium supplemented with different concen-
trations of cytokinins, viz. BAP (0–15 μM), KN (0–15 μM),
and TDZ (0–15 μM). Proliferate the shoots both in solid (0.8 %
agar) and static liquid culture (Fig. 1) (see Notes 7 and 8).

Fig. 1 Schematic representation of micropropagation protocol of W. somnifera

206 Pritika Singh et al.

2. Incubate the cultures for 4 weeks at 25 °C, photon flux density

(PFD) of 40 μmol/m2/s, and photoperiod of 16 h in 24 h
light–dark cycle.

3.1.4 Rooting of Shoots 1. Excise the shoots of 2–4 cm length and inoculate them in cul-
ture tubes containing agar-gelled and liquid MS medium sup-
plemented with different concentrations of auxins, viz. IBA
(0–15 μM), IAA (0–15 μM), and NAA (0–15 μM) (Fig. 1).
2. Incubate the cultures for 4 weeks at 25 °C and photon flux
density (PFD) of 40 μmol/m2/s. Maintain the photoperiod of
16 h in 24 h light–dark cycle.

3.1.5 Hardening 1. Take out the plantlets from the culture tubes and wash them
of Microshoots properly so that agar is completely removed.
2. Transfer the plantlets to earthen pots containing sterile mix-
ture of sand and soil (1:1).
3. Cover the pots with fluorescent sheets and maintain them in
greenhouse under controlled light and humidity conditions for
acclimatization (see Note 9).
4. Once they acclimatize remove the florescent sheets.

3.2 Regeneration 1. Excise the young leaves from in vitro growing shoots and inocu-
of W. somnifera late them in tubes containing MS medium supplemented with dif-
ferent concentrations of BAP (0–15 μM) and 3 % (w/v) sucrose.
3.2.1 Direct
Regeneration from Leaf 2. Incubate the cultures at 25 °C in white fluorescent light
Explant (40 μmol/m2/s) with 16 h day length for 4 weeks.
3. After 4 weeks of culture multiple shoots start to emerge from
the petiole and base of leaves (Fig. 2).
4. Proliferate the shoots in flasks containing MS medium and
BAP (2.5 μM).
5. For in vitro rooting, inoculate the shoots formed above in cul-
ture tubes containing MS medium supplemented with IBA
(10 μM) (Fig. 2).
6. After 4 weeks of culture harden the in vitro raised plantlets in
earthen pots containing sand soil mix (1:1) as described in
Subheading 3.1.5.

3.2.2 Indirect 1. Cut the young leaves from in vitro growing shoots and inocu-
Regeneration from Leaf late them in tubes containing MS medium supplemented with
Explant different concentrations of BAP (0–15 μM).
2. Callus and shoot buds start to form from cut edge of leaves
after 4 weeks of culture. Subculture the callus in the same
medium for further proliferation (Fig. 3).
3. Incubate the cultures at 25 °C in white fluorescent light
(40 μmol/m2/s) with 16 h day length for 4–6 weeks. Observe
the shoot bud formation under the stereomicroscope.
 In Vitro Propagation of Withania somnifera (L.) Dunal 207

Fig. 2 Schematic representation of protocol for direct regeneration from in vitro

leaves of W. somnifera

4. To further proliferate shoots emerging from the shoot buds,

inoculate the shoot buds in flasks containing MS medium and
BAP (2.5 μM).
5. For in vitro rooting, inoculate the shoots in culture tubes con-
taining MS medium and IBA (10 μM). Harden the in vitro raised
plantlets after 4 weeks of culture in earthen pots containing sand
208 Pritika Singh et al.

Fig. 3 Schematic representation of protocol for indirect regeneration from in vitro leaves of W. somnifera
 In Vitro Propagation of Withania somnifera (L.) Dunal 209

soil mix (1:1). Once the plants acclimatize they are shifted to
greenhouse.

3.2.3 Somatic 1. Inoculate sterilized seeds in petri dishes containing MS medium

Embryogenesis from Seed supplemented with different concentrations of 2,4-D
Derived Tissue of W. (0–15 μM) and sucrose (1–9 % w/v).
somnifera 2. After 2–3 weeks of culture, the seeds germinate and cotyledon-
ary leaves begin to appear.
3. Embryogeneic calli start to form after 21 days from cotyledon-
ary leaves in same medium.
4. Somatic embryos begin to emerge from the calli after 6 weeks
of culture (Fig. 4). For further proliferation transfer the
embryos in MS medium supplemented with different concen-
trations of 2,4-D (2.5 μM) and 3 % (w/v) of sucrose.
5. Somatic embryos regenerate to form shoots and roots in MS
basal medium without any PGR after two subcultures each at
an interval of 4 weeks.

3.2.4 Histological In order to study the structure and origin of regenerated struc-
Evidence for Regeneration tures, histological studies are carried out as follows [9].
in W. somnifera

Fixation and Dehydration 1. Fix the sample in FAA (formaldehyde–acetic acid–50 % alco-
of Samples hol) (1:1:18) for 1 week.
2. Transfer the material to 70 % alcohol overnight.
3. Carry out the sequential dehydration in TBA (t-butyl alcohol)
as described in Table 3 (see Note 10). Keep the tissue in each
grade for 2–3 h except for grade “c” where it is left overnight.

Waxing 1. Keep the glass vials containing material in pure TBA in dry
oven pre-set at 60 °C for 15–20 min to equilibrate TBA with
oven temperature.
2. Add a few flakes of solid paraffin wax to the vials after every
15–20 min and caps of the vials should be left open. Ensure
that sample is never left dry.
3. Carry the whole procedure for 48–72 h till wax infiltrates com-
pletely in the sample and all the TBA evaporates (see Note 11).

Block Preparation 1. Melt fresh wax at 60 °C and prepare rectangular or square

and Section Cutting blocks using a holder (see Note 12). Place the sample carefully
in the block in correct orientation.
2. Allow the block to solidify overnight and cut 10–12 μm sec-
tions with the help of a rotary microtome.
Fig. 4 Schematic representation of protocol for somatic embryogenesis from seeds of W. somnifera

Table 3
Different gradations for dehydration of tissue for histological preparations

Gradations Rectified alcohol (ml) TBA (ml)

a 30 20
b 50 20
c 50 35
d 45 55
e 25 75
f – 100
 In Vitro Propagation of Withania somnifera (L.) Dunal 211

Mounting and Stretching 1. Clean the glass slides thoroughly by dipping them in xylene
of Ribbon overnight and dry them the next day.
2. Coat 1 % gelatine solution on the slides and allow them to dry
for 15–20 min (see Note 13).
3. After cutting the ribbon, put two to three drops of water on
the slides and place the ribbon containing the sections on it.
4. Stretch the ribbon by warming the slide on a slide warmer
maintained at 60 °C (see Note 14). Keep the slides overnight
in a dust-free environment.

Dewaxing and Staining 1. Put the glass slides in Coplin jars containing xylene for 1–2 h.
Subsequently pass the slides through different gradations of
xylene and ethanol (Table 4).

Table 4
Staining procedure for histological samples

a 75 ml xylene 25 ml ethanol
b 50 ml xylene 50 ml ethanol
c 25 ml xylene 75 ml ethanol
d – Rectified alcohol
e 25 ml water 75 ml ethanol
f 50 ml water 50 ml ethanol
g 75 ml water 25 ml ethanol
h 1 % (w/v) Safranin (6–24 h)
i 75 ml water 25 ml ethanol
j 50 ml water 50 ml ethanol
k 25 ml water 75 ml ethanol
l – Rectified alcohol
m – Rectified alcohol
n – Rectified alcohol
o Clove oil in 25 % ethanol
p Clove oil in 50 % ethanol
q Fast green (prepared in 50 % clove oil)
r Clove oil in 50 % xylene
s Clove oil in 25 % xylene
t Xylene (30 min)
u Xylene (30 min)
212 Pritika Singh et al.

2. Keep the slides in each grade for 2–3 min unless otherwise
mentioned (see Note 15).
3. Mount the slides with DPX mountant and observe under the
compound microscope (see Notes 16 and 17).

4 Notes

1. Prepare MS medium stocks by carefully weighing each compo-

nent. MS stock III should be prepared and stored in amber bot-
tle as it is light sensitive. pH of the medium should be set at 5.8.
2. 100 ml medium is poured in 250 ml flasks for preparing solid
medium and 20 ml for liquid medium. 20–25 ml medium is
poured in the tubes.
3. Prepare the PGR stocks by dissolving it in solvent first as mentioned
in Table 2 and then make up the volume with distilled water.
4. Tween 20 added in sterilizing agents acts as a surfactant and
helps in removing the surface contaminants.
5. Overheating of the medium should be avoided as it leads to
degradation of PGRs.
6. All the glassware and instruments should be properly sterilized
to avoid any contamination.
7. Volume of the liquid medium should be optimized to reduce
the hyperhydricity of shoots.
8. Prolonged subculture of shoots in BAP medium leads to vitri-
fication of shoots and yellowing of leaves. Hence, in order to
reduce the residual effect of BAP, shoots are subcultured in
low concentration of auxin (IAA 0.5 μM) followed by subcul-
ture in basal MS medium before transferring them to prolifera-
tion medium.
9. Ensure that during hardening process water content of plants
is maintained. Plants should not be allowed to dry.
10. Volume of each grade should be made up to 100 ml. Keep the
tissue in grade “c” overnight.
11. Slow penetration of wax in the tissue should be carried out.
TBA should be removed completely.
12. While performing histology wax should not be reheated often
as it destroys the wax’s properties.
13. Gelatine should be allowed to dry completely otherwise the
sections may be lost during staining.
14. Do not overheat the slides to stretch the ribbon as it would
lead to melting of wax and destruction of sample.
 In Vitro Propagation of Withania somnifera (L.) Dunal 213

15. Keep the sections in each grade during staining for 2–3 min.
The sections should be kept in safranin stain for 6–24 h. Filter
the safranin stain using Whatman filter paper to remove the
granular particles.
16. While transferring the slides from one grade to another the
solution should be added slowly so that sections do not wash
away.
17. The sections should not be allowed to dry.

Acknowledgements

The authors acknowledge the support of the Department of

Biotechnology, Government of India under DBT-AIST, Japan col-
laboration program, and DST-INSPIRE programme.

References

1. Haq I (2004) Safety of medicinal plants. PJMR 6. Wadhwa R, Singh R, Gao R, Shah N, Widodo
43:203–210 N, Nakamoto T, Ishida Y, Terao K, Kaul SC
2. Mishra LC, Singh BB, Dagenais S (2000) (2013) Water extract of Ashwagandha leaves has
Scientific basis for the therapeutic use of Withania anticancer activity: identification of an active
somnifera (ashwagandha): a review. Altern Med component and its mechanism of action. PLoS
Rev 5(4):334–346 One 8(10):1–11
3. Mirjalili MH, Moyano E, Bonfill M, Cusido 7. Chatterjee S, Srivastava S, Khalid A, Singh N,
RM, Palazon J (2009) Steroidal lactones from Sangwan RS, Sidhu OP, Roy R, Khetrapal CL,
Withania somnifera, an ancient plant for novel Tuli R (2010) Comprehensive metabolic finger-
medicine. Molecules 4(7):2373–2393 printing of Withania somnifera leaf and root
4. Pati PK, Sharma M, Salar RK, Sharma A, Gupta extracts. Phytochemistry 71:1085–1094
AP, Singh B (2008) Studies on leaf spot disease of 8. Murashige T, Skoog F (1962) A revised medium
Withania somnifera and its impact on secondary for rapid growth and bioassays with tobacco tis-
metabolites. Indian J Microbiol 48:432–437 sue cultures. Physiol Plant 15:473–497
5. Singh RH, Narsimhamurthy K, Singh G (2008) 9. Pati PK (2002) Tissue, cell and protoplast culture
Neuronutrient impact of Ayurvedic Rasayana ther- studies in Rosa damascena Mill. and Rosa bourbo-
apy in brain aging. Biogerontology 9:369–374 niana Desp. Utkal University, Bhubaneswar, India
 Chapter 15

In Vitro Propagation of Sambong (Blumea balsamifera Linn.)

Thelma L. Soriano and Evangelina C. Cangao

Abstract
Terminal shoot tips of sambong (Blumea balsamifera Linn.) are cultured to initiate and regenerate shoots
on Murashige and Skoog (MS) medium containing 1.0 mg/L benzyl adenine (BA). After 1 month,
shoots, usually 4.5 cm long are separated and subcultured for multiplication. Regenerated shoots, about
6 cm long are rooted on MS medium supplemented with 1.0 mg/L naphthalene acetic acid (NAA).
Exposure of shoots to high humidity for the first 2 weeks and equal proportion (1:1:1) of sterile sand,
compost, and coir dust as potting mix favors the development of whole sambong plants. Young shoots
from in vitro-derived sambong plants could also be used for propagation.

Key words Acclimatization, Explant, In vitro, In vivo, Shoot tip, Stolon, Subculture, Transplantation

1 Introduction

Sambong (Blumea balsamifera Linn.), a coarse and strong aro-

matic herb belongs to the family Compositae. It is one of the ten
herbs that have been screened and approved by the Department of
Health (DOH), Philippines, for the treatment of certain health
disorders [1]. Different forms and mode of preparation of sam-
bong leaves are used for the treatment of unopened wound, colds,
back pains, rheumatism, chronic pus, discharge of the eye, diar-
rhea, stomach pains, hypertension, and uterine discharge and even
to eliminate intestinal worms [2]. Sambong is also known as a
diuretic and is used in cases of hypertension and mild to moderate
congestive heart failure. A 250 mg tablet in foil strip which was
formulated by DOH from powdered sambong leaves is now being
promoted to cure urinary tract pain and burn sensations [3].
In Philippines, sambong is not commercially cultivated.
Sambong plant cannot be produced rapidly because it is conven-
tionally propagated from root cuttings and stolons (with three or
more leaves) taken from the sides of the main plant. The rising
demand for sambong as a herbal medicine calls for increased
production of this plant. Interest in Philippine medicinal plant

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_15, © Springer Science+Business Media New York 2016

215
216 Thelma L. Soriano and Evangelina C. Cangao

industry has been revived and plant species such as sambong are
used as key ingredients. The resurgence of public interest in plant-
based medicine, coupled with the rapid growth of the pharmaceu-
tical industry has brought about the need for the increased
production of herbal medicine.
In vitro culture is an alternative method for propagation and is
widely used for the commercial cultivation of a large number of
plant species, including many medicinal plants [4]. In Philippines,
multiplication of a large number of medicinal plants especially sam-
bong through in vitro culture offers a possibility to solve the poor
natural propagation by means of root cuttings and stolons. So far,
a method for rapid propagation of sambong has not been reported.
This study aimed to develop sambong in vitro culture protocol
for mass propagation of planting materials and develop potting out
technique.

2 Materials

2.1 Initiation 1. Terminal shoots of sambong (Blumea balsamifera) collected

and Regeneration from Bureau of Plant Industry San Andres, Malate, Manila
of Cultures (see Note 1).
2. Murashige and Skoog [5] medium (Table 1) (see Note 2).
3. Stock solutions of 100 ppm benzyl adenine (BA) and naphtha-
lene acetic acid (NAA) (see Note 3).
4. 0.1 M hydrochloric acid (HCl) or 0.1 M potassium hydroxide
(KOH) solutions.
5. pH meter.
6. Autoclave.
7. Sterile water.
8. Clorox (disinfectant).
9. Tween 20.
10. Sterilized paper.
11. Laminar flow air bench (see Note 4).
12. Plant growth room provided with fluorescent lights, light
intensity 20 μmol/m2/s, 8 h photoperiod daily, 24–25 °C.
13. Culture bottles (8 oz bottle jars with plastic cap).

2.2 Plantlet 1. Benches in the greenhouse.

Acclimatization 2. Soap.
3. Fungicide (benlate) at 5 g/gallon.
4. Transparent plastic containers (175 mm × 145 mm × 60 mm).
 In Vitro Propagation of Sambong (Blumea balsamifera Linn.) 217

Table 1
Stock solutions for preparation of Murashige and Skoog’s (MS) mediuma

Chemical constituents Concentration

Macro salt content mg/L
KNO3 1900
NH4NO3 1650
CaCl2·2H2O 440
MgSO4·2H2O 370
KH2PO4 170
Micro salt content mg/L
KI 0.83
H3BO3 6.2
MnSO4·2H2O 22.3
ZnSO4·7H2O 8.6
Na2.MoO4·2H2O 0.25
CuSO4·5H2O 0.025
CoCl2·6H2O 0.025
Iron source mg/L
FeSO4·7H2O 27.8
Na2EDTA·2H2O 37.3
Vitamins mg/100 ml
Nicotinic acid 50
Pyridoxine·HCl 50
Thiamine·HCl 10
Glycine 200
Organic supplements mg/L
myo-Inositol 100
a
After dissolving all the stock solutions in 1 L distilled water, adjust the pH to 5.8 by add-
ing solutions of either hydrochloric acid (HCl) or potassium hydroxide (KOH) solution
and add 20 g/L sugar and 7 g/L agar and autoclave at 120 °C at 15 psi for 15 min

5. A 1:1:1 (v/v) of potting mix of sand, coir dust, and compost.

6. Barbecue stick.
7. Masking tape.
8. Pot (8.89 cm wide and 11.43 cm tall having five drain holes).
218 Thelma L. Soriano and Evangelina C. Cangao

3 Methods

3.1 Initiation 1. Wash shoots of sambong (Fig. 1) thoroughly with soapy water
and Regeneration (see Note 5).
of Cultures 2. Disinfect/sterilize shoots with 15 % Clorox mixed with two to
three drops of Tween 20 for 10 min followed by three times
rinsing with sterile water.
3. Excise shoots on a sterilized paper under the laminar flow air
bench.
4. Strip off side leaflets to obtain a small shoot tip portion (Fig. 2)
(see Note 6).
5. Initiate cultures in Murashige and Skoog medium (Table 1)
containing 1.0 mg/L benzyl adenine (BA) (Fig. 3).
6. Subculture in MS medium supplemented with 1.0 mg/L BA
for multiplication culture (Figs. 4 and 5) and 1.0 mg/L naph-
thalene acetic acid (NAA) for plantlet regeneration (Fig. 6)
(see Note 7).

Fig. 1 Terminal shoot as a source of explant of sambong (Blumea balsamifera L.)

Fig. 2 Excised shoot tip of sambong for initial culture

Fig. 3 Sambong shoot tip cultured in Murashige and Skoog medium

220 Thelma L. Soriano and Evangelina C. Cangao

Fig. 4 Regenerated sambong (Blumea balsamifera L.) shoots in MS medium

Fig. 5 Sambong (Blumea balsamifera L.) shoots ready for subculture

 In Vitro Propagation of Sambong (Blumea balsamifera Linn.) 221

Fig. 6 Adventitious shoot proliferation on medium with 1.0 mg/L BA

Fig. 7 Growth of sambong shoots after 1 month of culture

7. Transfer cultures under light conditions in plant growth room

provided with fluorescent light tubes, 20 μmol/m2/s, 8 h pho-
toperiod daily, 24–25 °C, until rooting.
8. One month after inoculation, subculture shoots or split into
five groups for shoot multiplication.
9. Subculture multiple shoots in four to six cycles in preparation
for potting out. Multiply shoot cultures and regenerate plantlets
using MS media containing 1.0 mg/L BA (optimized medium)
and 1.0 mg/L NAA, respectively (Fig. 7) (see Note 8).
222 Thelma L. Soriano and Evangelina C. Cangao

Fig. 8 Sambong cultures transferred to greenhouse for acclimatization

3.2 Plantlet 1. Place the plantlets in jars on benches inside the greenhouse for
Acclimatization a period of 1 week (Fig. 8) (see Note 9).
2. Pull out gently the plantlets and wash off the agar particles
adhering to the root section (Fig. 9) (see Note 10).
3. Treat with fungicide (Benlate) at 5 g/gallon the in vitro devel-
oped plantlets prior to potting in transparent plastic containers
(175 mm × 145 mm × 60 mm) containing a potting mix (1:1:1)
of equal proportion of sand, coir dust, and compost.
4. Carefully set up the young and tender plantlets in plastic
containers containing a potting mix of sand, coir dust, and
compost, which has been previously dibbled by a barbecue
stick, and firmly press the soil around the stem (Fig. 10)
(see Note 11).
5. Enclose the plastic containers with another plastic of the same
size and seal with a masking tape (Fig. 11).
6. After growing 2 weeks in enclosed plastic containers, allow
the plants to acclimatize by loosening the plastic cover
around the plastic container to allow greater air circulation
(see Note 12).
7. Three weeks after acclimatization (Fig. 12), transfer plants to
individual pots containing an equal potting mix (1:1:1) of gar-
den soil, compost, and coir dust on the greenhouse bench
(Fig. 13) (see Note 13).
 In Vitro Propagation of Sambong (Blumea balsamifera Linn.) 223

Fig. 9 Newly removed sambong plantlets from jars ready for potting out

Fig. 10 Tissue-cultured sambong plantlets in potting media

224 Thelma L. Soriano and Evangelina C. Cangao

Fig. 11 Sambong tissue-cultured plants enclosed in a plastic container

Fig. 12 Sambong plants after 2 weeks in the potting medium (a) basal parts with
developed roots, (b) terminal parts

Fig. 13 Individually potted plants ready for field planting

 In Vitro Propagation of Sambong (Blumea balsamifera Linn.) 225

Fig. 14 Conventionally propagated sambong plants from in vitro derived shoot

cuttings

3.3 Conventional 1. Collect very young shoots, 10–12 cm long from in vitro
Method Using Shoot derived sambong plants.
Cuttings from In vitro 2. Place in a medium containing a combination (1:1) of moist
Derived Plants compost and garden soil for rooting.
(See Note 14) 3. The environment in the greenhouse should be humid by wet-
ting down the floors with gravel and sand.
4. Rooting of in vitro derived sambong plants takes 1 month
(Fig. 14).
5. After 2 months in the potting medium, transfer the in vitro
derived sambong plants to the field.

4 Notes

1. Terminal shoots, about 8–10 cm length, in their active vegeta-

tive growth stage were obtained from healthy vigorous
sambong plants, grown in the experimental station, Bureau of
Plant Industry, San Andres Malate Manila.
2. Dissolve chemicals one by one in doubled distilled water for
preparing stock solutions of macro salts, micro salts, iron, vita-
mins, and organic supplements; store them at low temperature
(5 °C) in dark bottles. Use appropriate amount of stock solu-
tions and raise desirable volume with distilled water. Prolonged
storage of media should be avoided.
3. To prepare 1 mg/ml stock solutions of NAA and BA, dissolve
100 mg of each plant growth regulator by adding 2–5 ml
KOH in 100 ml volumetric flask and store in dark bottles at
low temperature (5 °C).
226 Thelma L. Soriano and Evangelina C. Cangao

4. Before washing with soapy water, some of the side leaves cov-
ering the terminal shoots are stripped off to keep 5.0–7.0 cm
shoot length and excise further up to 1–1.5 cm long.
5. Do not pinch or squash the delicate shoot with forceps and
scalpel.
6. After 1 month, 3–6 cm long shoots are separated and subcul-
tured in a fresh MS medium for multiplication and plantlet
regeneration.
7. Subculture shoot cultures in fresh MS medium at a 4-week
interval.
8. Regenerated shoots, about 4–8 cm tall are rooted on MS medium
supplemented with 1.0 mg/L naphthalene acetic acid (NAA).
9. The 8 oz bottle jars containing five plantlets are transferred to
the greenhouse under the shade provided either with two to
three layers of agricultural net or with plastic sheets for a period
of 1 week.
10. Transfer in vitro plantlets with five to eight leaflets into soil by
removing agar adhering to the roots by keeping under mild
running water for 10 min. This step is carried out to prevent
infection of molds.
11. Thirty young, tender, and 2-month-old plantlets are trans-
planted in a plastic container containing a potting mix of gar-
den soil, compost, and coir dust, and kept in the greenhouse.
After transplantation, water the plantlets regularly.
12. Plastic covers of the culture vessels are loosened to allow
greater air circulation and to adjust to a more natural environ-
mental condition.
13. Individual potted plants in the greenhouse are watered by
misting every day.
14. Shoots, 10–12 cm long, taken from in vitro-derived sambong
plants. growing in the greenhouse, are divided into two parts (ter-
minal and basal), about 5.5–6.0 cm long, comprising three to five
leaflets on each part and potted in vivo in a potting mix of moist
compost and garden soil in a transparent plastic container for 2
months. It is important that each part has intimate contact with
the potting mix, and soil should be firmly pressed around the
stem. Water the transplanted young shoots every alternate day.

Acknowledgment

The authors are thankful to Mrs. Alicia Acoba for her technical
support, Mesdames Sheeb Kaiserin M. Quiaonza and Sheng A.
Leoncio of BPI-Plant Quarantine Service for their assistance and
to our families for their encouragement and moral support.
 In Vitro Propagation of Sambong (Blumea balsamifera Linn.) 227

References
1. [Link] 4. Rout GR, Samantarsy DP (2000) In vitro
doh_herbs.htm manipulation and propagation of medicinal
2. Gutierrez HG (1980) An illustrated manual of plants. Biotechnol Adv 18:91–120
Philippine materia, medica, vol 1. National 5. Murashige T, Skoog F (1962) A revised medium
Research Center of the Philippines, Bicutan, for rapid growth and bioassays with tobacco tis-
Taguig, Metro Manila sue cultures. Physiol Plant 15:473–497
3. [Link]/pitahc/sambong_Tablehtm
 Chapter 16

Production of Gymnemic Acid from Cell Suspension

Cultures of Gymnema sylvestre
Praveen Nagella, Vijayalaxmi S. Dandin, and Hosakatte Niranjana Murthy

Abstract
Gymnema sylvestre R. Br. is a popular herbal medicine. It has been used in ayurvedic system of medicine for
thousands of years. It is popularly called as “Gur-mar” for its distinctive property of temporarily destroying
the taste of sweetness and is used in the treatment of diabetes. The leaves of gymnema possess antidiabetic,
antimicrobial, anti-hypercholesterolemic, anti-sweetener, anti-inflammatory, and hepatoprotective proper-
ties and have traditional uses in the treatment of asthma, eye complaints, and snake bite. The leaves contain
triterpene saponins such as gymnemic acid which is an active ingredient of Gymnema. Since the cultivation
of G. sylvestre is a very slow process and the content of gymnemic acid depends on the environmental fac-
tors, cell suspension culture is sought as an alternative means for the production of Gymnema biomass and
to enhance the gymnemic acid content. In this chapter, the methods employed for the induction of callus
and subsequent establishment of cell suspension cultures for the production of biomass and analysis of
gymnemic acid using high performance liquid chromatography are described.

Key words Antioxidant activity, Cell suspension cultures, Gymnema sylvestre, Gymnemagenin,
Gymnemic acid, Herbal medicine, Triterpenoid saponin

1 Introduction

Gymnema sylvestre [Link]., a woody climber of the Asclepiadaceae

family, has been known for many years for its medicinal value and it
has a key place in ayurvedic medicine. It is popularly called as “Gur-
mar” for its distinctive property of temporarily destroying the taste
of sweetness and is used in the treatment of diabetes [1]. It possesses
potent antidiabetic properties and has traditional use in the treat-
ment of asthma, eye complaints, and snake bite. It also possesses
antimicrobial, anti-hypercholesterolemic, and hepatoprotective
properties [2]. The leaf extract of this plant is used as stomachic,
stimulant, laxative, diuretic, anti-sweetener [3], and possesses antivi-
ral and anti-inflammatory [4] activities. The leaves of the species
contain triterpene saponins such as gymnemic acid, deacyl gym-
nemic acid, gymnemagenin [5, 6], 23-hydroxylnogispinogenin, and

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_16, © Springer Science+Business Media New York 2016

229
230 Praveen Nagella et al.

gymnestrogenin [7, 8] belonging to the oleanane and dammarene

classes, the former being the gymnemic acid and gymnemasaponins,
and the latter gymnemaside. The aglycone of gymnemic acid is
known as gymnemagenin.
The antidiabetic components of the plant are identified as a
group of closely related gymnemic acids following their successful
isolation and purification from the leaves [9]. Recently, gymnemic
acid formulations have been found to be useful against obesity [1].
In folk medicine, these compounds are obtained as extracts or
infusions from G. sylvestre wild or cultivated plants, causing a dras-
tic decrease in this plant population. The production of gymnema
by field cultivation is a very slow process and needs 4–6 years from
planting to the harvesting stage. Further, its production is hin-
dered by environmental factors, pests, and diseases, and the quan-
tity of gymnemic acid, the active principle in Gymnema leaves, is,
however, variable among accessions from different ecoclimatic
regions [10]. A way to mitigate this problem is by developing plant
tissue culture techniques for this species, since plant cell/organ
cultures are not limited by environmental, ecological, and climatic
conditions, and thus, cells/organs can be preferred to proliferate at
higher growth rates than whole plant in cultivation [11]. Therefore,
in vitro cell suspension cultures have become an alternative source
for the production of Gymnema biomass and gymnemic acid.
Additionally, there is possibility for year round production of
biomass with reduced cost and time. In the present chapter, the
relevant methods employed for the induction of callus from leaf
explants of in vitro grown G. sylvestre seedlings using Murashige
and Skoog (MS) medium supplemented with various growth regu-
lators and subsequent proliferation of the callus in the MS medium
are described, and the establishment of cell suspension cultures for
the production of biomass and analysis of gymnemic acid using
high performance liquid chromatography are discussed.

2 Materials

2.1 Induction 1. Gymnema sylvestre R. Br. seeds were collected from the botani-
of Callus from Leaf cal garden of Karnatak University campus, Dharwad, Karnataka,
Explants of In Vitro India (Fig. 1a).
Grown Seedlings 2. Murashige and Skoog (MS) [12] medium stock solutions (MS
and Establishment stock I, II, III, and IV) (Table 1). Store in the cold room or in
of Suspension the refrigerator at 4 °C (see Note 1).
Cultures 3. Stock solutions (10 mg/10 ml) of 2,4-dichlorophenoxy acetic
acid (2,4-D) and kinetin. Store in the deep freezer at −20 °C.
4. Agar-agar to be used at 8 g/L.
 Production of Gymnemic Acid from Cell Suspension Cultures… 231

Fig. 1 Habit of the Gymnema sylvestre plant with fruits (a), 4-week-old in vitro
grown seedling (b), callus developed from gymnema leaf on MS medium supple-
mented with 30 g/L sucrose, 2.0 mg/L 2,4-D, and 0.1 mg/L kinetin (c), prolifera-
tion of cell suspension in liquid medium (d)

2.2 Drying 1. Hot air oven.

of Gymnema Cell 2. Heat reflux extraction unit.
Suspension Culture
3. Extraction solvent (1:1 volume of methanol–water).
and Extraction
of Gymnemic Acid 4. Potassium hydroxide (11 %).
5. Concentrated HCl.
6. Nylon filter (0.45 μm).

2.3 Estimation 1. 0.2 N Folin–Ciocalteu (FC) reagent. Store at 4 °C.

of Total Phenols 2. 1000 ppm gallic acid stock solution. Store at 4 °C in dark con-
dition (see Note 2).
3. 15 % sodium carbonate solution. Store at 4 °C.
4. 80 % methanol, HPLC grade.
232 Praveen Nagella et al.

Table 1
Chemical composition of MS mediuma

Chemical constituents Concentration (mg/L) Volume per liter (ml)

Major inorganic nutrients
NH4NO3 33,000 50
KNO3 38,000
CaCl2·2H2O 8800
MgSO4·2H2O 7400
KH2PO4 3400
Minor inorganic nutrients
KI 166 5
H3BO3 1240
MnSO4·2H2O 4460
ZnSO4·7H2O 1720
Na2.MoO4·2H2O 50
CuSO4·5H2O 5
CoCl2·6H2O 5
Iron source
FeSO4·7H2O 5560 5
Na2EDTA·2H2O 7460
Organic supplements
myo-Inositol 20,000 5
Nicotinic acid 100
Pyridoxine·HCl 100
Thiamine·HCl 100
Glycine 400
Carbon source
Sucrose 30 g/L
a
Dissolve all the stock solutions of appropriate volume in distilled water and make it up to 1 L, adjust the pH to 5.8 (add
8 g/L agar for semisolid medium) and autoclave for 20 min at 121 °C

2.4 Estimation 1. 1000 ppm quercetin stock solution. Store at 4 °C in the dark
of Total Flavonoids condition (see Note 3).
2. 10 % aluminum chloride solution. Store at 4 °C.
3. 1 M potassium acetate solution. Store at 4 °C.

2.5 Radical 1. 2,2′-diphenyl-1-picrylhydrazyl (DPPH).

Scavenging Effect 2. Ultraviolet (UV)–visible spectrophotometer.
on 2,2-Diphenyl-1-
Picrylhydrazyl (DPPH)

2.6 Total Reducing 1. 200 mM sodium phosphate buffer (pH 6.6).

Power Ability 2. 1 % potassium ferricyanide.
3. 10 % trichloroacetic acid.
 Production of Gymnemic Acid from Cell Suspension Cultures… 233

4. 0.1 % ferric chloride.

5. Deionized water.
6. 1000 mg/L vitamin C.
7. Ultraviolet (UV)–visible spectrophotometer.

2.7 Phosphomolyb- 1. Reagent solution (0.6 M sulfuric acid, 28 mM sodium phos-

denum Activity phate, and 4 mM ammonium molybdate).
2. Ultraviolet (UV)–visible spectrophotometer.

2.8 HPLC Analysis 1. HPLC-grade acetonitrile (see Note 4).

of Gymnemagenin 2. HPLC-grade water (see Note 4).
3. Standard gymnemagenin.

3 Methods

3.1 Induction 1. Wash Gymnema sylvestre seeds thoroughly under running

of Callus from Leaf tap water for 30 min followed by several rinses in distilled
Explants water (5×).
2. Surface-sterilize seeds in 2 % sodium hypochlorite solution
containing few drops of Tween 20 detergent for 20 min.
3. Carry out the final step of sterilization in a horizontal laminar
air flow chamber by rinsing the seeds in sterile distilled water
(2×), followed by 0.5 % mercuric chloride solution for 5 min.
4. Finally rinse seeds several times (5×) in sterile distilled water.
5. Inoculate seeds onto MS basal medium (Murashige and Skoog
[12]) for germination.
6. Inoculate leaf explants from 4-week-old germinated seedling
(Fig. 1b) on MS medium containing 30 g/L sucrose and
medium supplemented with 2.0 mg/L 2,4-D and 0.1 mg/L
kinetin (KN), pH 5.8.
7. Incubate the cultures at 25±2 °C, with a 16 h photoperiod
(40 mmol/m2/s) provided with 40-W white fluorescent lamps.
Within 4 weeks callus will develop from the leaf explants
(Fig. 1c).
8. Culture the callus obtained on semisolid MS medium contain-
ing 30 g/L sucrose, 2.0 mg/L 2,4-D, and 0.1 mg/L kinetin
(KN), pH 5.8 for proliferation.
9. Transfer the cultures to a fresh medium at 2-week intervals.
Use actively growing cell line as explants for further
experiments.
234 Praveen Nagella et al.

3.2 Proliferation 1. Inoculate actively growing friable cell lines from the semisolid
of Cell Suspension cultures (5 g/L fresh biomass) into a 250 ml Erlenmeyer flask
in the Liquid Medium containing 50 ml MS liquid medium supplemented with
30 g/L sucrose, 2.0 mg/L 2,4-D, and 0.1 mg/L kinetin (KN)
(Fig. 1d).
2 Incubate cultures at 16-h photoperiod of cool-white fluo-
rescent light (40 μmol/m2/s) and 25 ± 2 °C and agitate at
110 rpm. Maintain cultures by regular subculturing at 2-week
intervals.

3.3 Cell Suspension 1. Collect the cells at exponential growth phase and initiate the
Cultures suspension cultures for the production of gymnemic acid.
for the Production 2. Inoculate 5 g/L fresh cell biomass in a 250 ml Erlenmeyer
of Gymnemic Acid flask containing 50 ml MS medium supplemented with 30 g/L
sucrose, 2.0 mg/L 2,4-D, and 0.1 mg/L kinetin (KN).
3. Incubate cultures at 16-h photoperiod of cool-white fluo-
rescent light (40 μmol/m2/s) and 25 ± 2 °C and agitate at
110 rpm on a rotary shaker. The cells at these conditions will
grow and multiply at a faster rate.
4. After 4 weeks of culture, assess the growth of cell suspensions
in terms of fresh weight, dry weight, growth ratio, and amounts
of phenolics, flavonoids, and gymnemic acid content.

3.4 Estimation 1. Filter the cell suspensions through a stainless steel sieve of pore
of Cell Biomass size 0.45 μm to separate cells from the culture medium.
2. Wash the cells thoroughly in sterile water and blot excessive
surface water. Record the fresh weight of cells.
3. Record the dry weight after drying the cells at 50 °C for 24 h
in a hot air oven to attain a constant weight.
4. Growth ratio can be determined by using the formula:
GR = harvested dry biomass (g) − inoculated dry biomass (g)/
inoculated dry biomass (g).

3.5 Preparation 1. Dry the cells in a hot air oven unit at 50 °C for 24 h. The dried
of Cell Extract cells can be stored at room temperature (20–35 °C) for a lon-
for Analyzing ger duration in the vacuum desiccator.
Bioactive Compounds 2. Take 2 g dried powder and perform the extraction at 40 °C for
6 h using 25 ml of 80 % methanol (rotary shaker).
3. Filter the extract through a double layer of Whatman No. 42
filter paper.
4. Re-extract the residue as in steps 2 and 3 and mix the extracts.
5. Evaporate the solvent using vacuum rotary evaporator.
6. To the residue add 10 ml of 80 % methanol.
 Production of Gymnemic Acid from Cell Suspension Cultures… 235

3.6 Estimation The amount of total phenol extracted from cell culture extract is
of Total Phenolic analyzed spectrophotometrically by using Folin–Ciocalteu reagent.
Content in Cell Culture
1. Mix 500 μl methanolic extract with 2.5 ml 0.2 M freshly pre-
Extract
pared Folin–Ciocalteu reagent. Mix the contents well and
allow to stand for 6 min.
2. After 6 min, add 2.0 ml 20 % sodium carbonate solution. After
incubation at room temperature for 2 h the purple color will
develop.
3. Working standards of 20, 40, 60, 80, and 100 ppm of gallic
acid are used to plot the standard calibration graph.
4. The absorbance of test solutions is detected at 760 nm on UV–
visible spectrophotometer. The readings are compared with
the standard graph for gallic acid. The results are expressed as
mg of gallic acid equivalent per 100 g dry weight. All the
experiments should be carried out in triplicates and each assay
should be repeated at least 2 times.

3.7 Estimation The amount of total flavonoid present in the cell culture extract
of Total Flavonoid can be analyzed spectrophotometrically by following the alumi-
Content in Cell Culture num chloride method.
Extract 1. Mix 500 μl methanolic extract with 0.1 ml of 10 % aluminum
chloride, 0.1 ml of 1 M potassium acetate, and 4.3 ml of deion-
ized water and incubate at room temperature for 30 min.
2. After incubation, the absorbance of the test solutions is mea-
sured on a UV–visible spectrophotometer at 430 nm.
3. Working standards of 20, 40, 60, 80, and 100 ppm of querce-
tin are used to plot the standard calibration graph.
4. The readings are compared with the standard graph for quer-
cetin. The results are expressed as mg of quercetin equivalent
per 100 g dry weight. All the experiments should be carried
out in triplicates and each assay should be repeated at least
2 times.

3.8 Radical 1. For the analysis of the antioxidant activity, mix 100 μl aliquots
Scavenging Activity of the extract and make up the volume to 1.0 ml with
on 2,2-Diphenyl-1- methanol.
Picrylhydrazyl (DPPH) 2. To this sample solution add 2.0 ml of 0.06 M methanolic solu-
tion of DPPH.
3. Incubate the sample solutions in dark at room temperature for
30 min and assay the reaction mixture at 517 nm using UV–
visible spectrophotometer.
4. For eliminating the interference with the DPPH reaction by
extract, a blank sample has to be assayed. For the blank (nega-
tive control), 1.0 ml of methanol has to be taken, to which add
236 Praveen Nagella et al.

2.0 ml of 0.06 M methanolic solution of DPPH and incubate

as mentioned above. Carry out all the experiments in triplicate
and each assay should be repeated at least 2 times.
5. Record the decrease in percentage of absorbance at 517 nm for
the extracts and calculate the percentage of radical scavenging
activity of DPPH on the basis of observed decrease in the radi-
cal. The inhibition percentage or radical scavenging activity
can be calculated by using the following formula:

%Inhibition or %Radical scavenging activity = éë( Ab - As ) / Ab ùû ´ 100

where Ab is the absorbance of blank (has the highest value),

As is the absorbance of sample (has the lowest value). Curves
showing inhibition percentage/μl of the extract are used to
determine the concentration at which 50 % radical scavenging
occurs (IC50).

3.9 Total Reducing 1. Mix 100 μl aliquots of the extract and make up the volume to
Power Ability 1.0 ml with methanol.
2. Then, add 2.5 ml of 200 mM sodium phosphate buffer
(pH 6.6), and 2.5 ml of 1 % potassium ferricyanide and incu-
bate at 50 °C for 20 min.
3. After incubation, add 2.5 ml of 10 % trichloroacetic acid and
centrifuge at 2000 × g for 10 min.
4. Mix the upper layer in each tube (2.5 ml) with 2.5 ml of deion-
ized water and 0.5 ml of 0.1 % ferric chloride.
5. Measure the absorbance at 700 nm against a blank. Carry out
all the experiments in triplicate and repeat each assay at least
2 times.
6. The reducing power increases with the increase in absorbance.
The total reducing power of the extract is compared to vitamin
C as a positive control and the results are expressed as vitamin
C equivalent (mM).

3.10 Phosphomolyb- 1. Mix 100 μl aliquots of the extract combined with 1 ml of the
denum Activity reagent solution.
2. Cap the tubes tightly and incubate in boiling water bath at
95 °C for 90 min.
3. After 90 min, cool the tubes to room temperature.
4. Prepare a blank solution using 1 ml of reagent solution instead
of sample.
5. Measure the absorbance of the sample and the blank at 693 nm.
Carry out all the experiments in triplicate and repeat each assay
at least 2 times.
 Production of Gymnemic Acid from Cell Suspension Cultures… 237

3.11 HPLC Analysis 1. Weigh 500 mg dried sample powder and add 50 ml extraction
of Gymnemic Acid solvent (1:1 volume of methanol–water) and 10 ml of 11 %
potassium hydroxide solution in a 500 ml round bottom flask.
Reflux the mixture for an hour; add 9 ml HCl and reflux again
for 1 h. Cool the mixture to room temperature, filter the
extract through 0.45 μm nylon filter and make the volume to
100 ml with extraction solvent and use the clean supernatant
for HPLC analysis.
2. Initially wash the chromatographic equipment consisting of
degasser, pump, auto sampler, thermostated column compart-
ment, and diode array detector (DAD) with HPLC grade
water twice.
3. Carry out the analysis of the gymnemic acid using C18 (5 μm)
column. Use acetonitrile–water (80:20) as the mobile phase.
The column temperature should be maintained at 27 °C. The
injection volume should be 20 μl. The detection of the eluent
is measured at 210 nm. Maintain a running time of 30 min and
a flow rate of 1 ml/min. For analysis, use three separate injec-
tions of each sample.
4. The gymnemagenin can be identified on the basis of the reten-
tion time values and the absorbance of the UV spectra in
comparison with the standard gymnemagenin (Fig. 2). The
confirmation of the peak can also be performed by spiking the
extract with the pure standard gymnemagenin.
5. Eluted samples can be detected with a variable dual wavelength
detector coupled to the HPLC system, by comparing the UV
spectra of the peak with those of authentic reference samples.
6. Prepare standard stock solutions of gymnemagenin as follows:
weigh 10.0 mg standard gymnemagenin accurately and dis-
solve in 10 ml of HPLC grade methanol in 10 ml volumetric
flask. Then, dilute stock solutions with methanol to prepare a
series of standard solutions with concentrations of 25, 50, 100,
and 150 μg/ml for linearity validation.
The conversion of gymnemagenin to gymnemic acid is done
using the formula:
Molecular weight conversion of gymnemagenin to gymnemic
acid (809.0/506.7) = conversion.

4 Notes

1. Prepare stock solutions of major, minor inorganic nutrients,

iron source, vitamins, and individual plant growth regulators
(Table 1). Store stock solutions at 4 °C, except vitamins which
is stored at −20 °C. Avoid storage of the stock solutions for
longer durations (not more than 2 months) as they may get
238 Praveen Nagella et al.

Fig. 2 HPLC profiles of standard gymnemagenin (a), cell suspension culture (b)

contaminated or precipitated. Prepare fresh plant growth

regulator solutions every time. Any color change in the stock
solutions may be due to precipitation which can seriously affect
the growth of cultures. Alternatively, stock solutions of macro-
elements, micro-elements, vitamins, and the ready-to-use MS
medium are commercially available.
2. Standard gallic acid is prepared by weighing 1000 mg gallic
acid powder and by dissolving it in 1 L distilled water. The
addition of 1 ml DMSO or ethanol will readily dissolve the
 Production of Gymnemic Acid from Cell Suspension Cultures… 239

compound. Store the stock solution in an amber-colored bottle

at 4 °C.
3. Quercetin is prepared by weighing 1000 mg quercetin powder
and dissolving in 1 L deionized distilled water. Add 1 ml
DMSO or ethanol to make the quercetin powder to dissolve
readily. Store the stock solution in an amber-colored bottle
at 4 °C.
4. Prepare fresh solution of 0.06 M methanolic solution of DPPH
and store in darkness at 4 °C in an amber-colored bottle
(DPPH reacts with light). All the solutions should be prepared
freshly and stored in the refrigerator at 4 °C. All the solvents
used for the HPLC analysis should be of HPLC grade and fil-
tered through 0.45 μm polytetrafluoroethylene (PTFE) filters
before use.

Acknowledgements

Dr. Praveen Nagella would like to thank Center for Research—

Projects, Christ University for the financial assistance (MRPDSC-
1414).

References
1. Agarwal SK, Singh SS, Verma S, Lakshmi V, 8. Yoshikawa M, Murakami T, Matsuda H (1997)
Sharma A, Kumar S (2000) Chemistry and Medicinal foodstuffs. X. Structures of new trit-
medicinal uses of Gymnema sylvestre [Gur-Mar] erpene glycosides, gymnemosides-c, -d, -e, and
leaves—a review. Indian Drugs 37: -f, from the leaves of Gymnema sylvestre [Link].:
354–360 influence of gymnema glycosides on glucose
2. Jachal SM (2002) Herbal drugs as antidiabet- uptake in rat small intestinal fragments. Chem
ics: an overview. CRIPS 3:9–11 Pharm Bull 45:2034–2038
3. Yoshikawa K, Arihara S, Matsuura K, Miyase T 9. Liu HM, Kiuchi F, Tsuda Y (1992) Isolation
(1992) Dammarane saponins from Gymnema and structure elucidation of gymnemic acids,
sylvestre. Phytochemistry 31:237–241 antisweet principles of Gymnema sylvestre [Link].
4. Satdive RK, Abhilash P, Fulzele DP (2003) Chem Pharm Bull 40:1366–1375
Antimicrobial activity of Gymnema sylvestre leaf 10. Yokota T, Mizutani K, Okada K, Tanak O
extract. Fitoterapia 74:699–701 (1994) Quantitative analysis of gymnemic
5. Subbarao G, Joseph ES (1971) Constituents acids by high performance liquid chromatogra-
from Gymnema sylvestre leaves VIII: isolation, phy. J Jpn Soc Food Sci Technol 41:202–205
chemistry and derivatives of gymnemagenin 11. Nagella P, Chung IM, Murthy HN (2011) In
and gymnestrogenin. J Pharm Sci 60:190–192 vitro production of gymnemic acid from cell
6. Gooper D (1887) An examination of the leaves suspension cultures of Gymnema sylvestre [Link].
of Gymnema sylvestre [Link]. Nature 35: Eng Life Sci 11:537–540
565–567 12. Murashige T, Skoog F (1962) A revised
7. Sahu NP, Mahato SB, Sarkar SK, Poddar G medium for rapid growth and bioassays with
(1996) Triterpenoid saponins from Gymnema tobacco tissue cultures. Physiol Plant 15:
sylvestre. Phytochemistry 41:1181–1185 473–497
 Chapter 17

Scale-Up of Agrobacterium rhizogenes-Mediated Hairy

Root Cultures of Rauwolfia serpentina: A Persuasive
Approach for Stable Reserpine Production
Shakti Mehrotra, Vikas Srivastava,
Manoj K. Goel, and Arun K. Kukreja

Abstract
Roots of Rauwolfia serpentina, also known as “Sarpagandha” possess high pharmaceutical value due to
the presence of reserpine and other medicinally important terpene indole alkaloids. Ever increasing
commercial demand of R. serpentina roots is the major reason behind the unsystematic harvesting and
fast decline of the species from its natural environment. Considering Agrobacterium rhizogenes-medi-
ated hairy root cultures as an alternative source for the production of plant-based secondary metabo-
lites, the present optimized protocol offers a commercially feasible method for the production of
reserpine, the most potent alkaloid from R. serpentina roots. This end-to-end protocol presents the
establishment of hairy root culture from the leaf explants of R. serpentina through the infection of A.
rhizogenes strain A4 in liquid B5 culture medium and its up-scaling in a 5 L bench top, mechanically
agitated bioreactor. The transformed nature of roots was confirmed through PCR-based rol A gene
amplification in genomic DNA of putative hairy roots. The extraction and quantification of reserpine in
bioreactor grown roots has been done using monolithic reverse phase high-performance liquid chroma-
tography (HPLC).

Key words Bioreactor, Hairy roots, HPLC, Rauwolfia serpentina, Reserpine, Up-scaling

1 Introduction

Rauwolfia serpentina, a distinguished member of family

Apocynaceae, has drawn special attention all over the world because
of its high medicinal importance. The plant is known to produce
medicinally important terpenoid indole alkaloids (TIAs) such as
reserpine, ajmalicine, ajmaline, serpentine, vomiline, and yohim-
bine. [1]. Among other TIAs, reserpine, a 3,4,5-trimethyl benzoic
acid ester of reserpic acid, is the most potent alkaloid with remark-
able antihypertensive properties. The alkaloids are concentrated
mostly in the plant roots, reported to yield about 85–90 % of the
total alkaloid content of the whole plant [2]. Presence of these

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_17, © Springer Science+Business Media New York 2016

241
242 Shakti Mehrotra et al.

TIAs contributes to the medicinal properties of Rauwolfia roots

which are strong antihypertensive, laxative, anthelmintic, and
diuretic in nature. The root extract is present as a major ingredient
in a variety of commercially available drugs that are used for the
treatment of hypertension, high blood pressure, mental illness, and
problems related to central nervous system (CNS). The crude
extract is also used in sedatives, aphrodisiac and antispasmodic
medicines. Further, hypoglycemic and hypolipidemic activities are
also reported from the root extract of other species of Rauwolfia
[3]. The only source for the procurement of Rauwolfia roots for
medicinal purposes is the natural reserves which due to unsystem-
atic exploitation are fast declining. The International Union for the
Conservation of Nature and Natural Resources (IUCN) enlisted
this species among those endangered plants for which cultivation
and conservation are prioritized through conventional and alterna-
tive methods in India (NMPB; [Link]).
The Agrobacterium rhizogenes-mediated hairy root cultures
are known as an alternative source for the production of plant-
based secondary metabolites under laboratory conditions [4].
Regular demand of R. serpentina roots for commercial medicinal
uses and limited supply from natural resource have laid the back-
ground for the establishment and use of A. rhizogenes-mediated
hairy root cultures (HRCs) for TIA production [5, 6]. The hairy
root cultures of various species of Rauwolfia represent a rich repos-
itory of a range of alkaloids as they produce noticeable amounts of
these TIAs [6]. These easily manageable hairy root cultures can be
a promising source for the production of reserpine and other valu-
able alkaloids. In the development and progress of techniques for
commercial production of hairy root-based secondary metabolites,
the up-scale culture of roots in bioreactors is the definitive step.
Keeping the pharmaceutical importance of reserpine in mind, the
present protocol was developed to establish Agrobacterium
rhizogenes-mediated R. serpentina hairy root cultures for high
reserpine biosynthesis and up-scaling of these hairy root cultures in
a bench top, mechanically agitated 5 L capacity bioreactor. Before
up-scaling in bioreactor, the transformed nature of hairy root line
was confirmed through PCR based rol A gene amplification. The
accumulation of reserpine was detected by high performance liq-
uid chromatography.

2 Materials

2.1 Media 1. Stock solutions of Gamborg’s B5 and Murashige and Skoog

Preparation (MS) medium (see Table 1) (see Notes 1 and 2).
2. Agar.
3. Beakers, measuring cylinders, and glass rods (see Note 3).
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 243

Table 1
Components of MS and B5 growth medium

Concentration (mg/L)

Designated stock Constituents of stock MS B5

A NH4NO3 1650 –
(NH4)2SO4 – 134
B KNO3 1900 2500
MgSO4·7H2O 370 250
MnSO4·4H2O 22.3 10
C ZnSO4·7H2O 8.6 2
CuSO4·5H2O 0.025 0.025
CaCl2·H2O 440 –
KH2PO4 170 150
D NaH2PO4 – 3
H3BO3 6.2 0.75
KI 0.83 0.25
Na2MoO4·2H2O 0.25 0.025
CoCl2·6H2O 0.025 –
F FeSO4·7H2O 27.85 27.85
Na2EDTA 37.35 37.35
Thiamine HCl 0.1 10
Pyridoxine HCl 0.5 10
G Nicotinic acid 0.5 1
Glycine 2 –
Folic acid – –
Biotin – –

4. 0.1–10 ml pipettes and/or 0.5–100 μl micropipettes.

5. 1 N NaOH/1 N HCl.
6. 250 ml narrow-neck Erlenmeyer flasks.

2.2 Bacterial Stock 1. Agrobacterium rhizogenes strain A4 (pRA4).

Culture 2. Yeast Mannitol Broth (YMB) and Yeast Mannitol Agar (YMA)
and Suspension [7] (Table 2 see Note 4).
3. Disposable petri plates (90 mm).
244 Shakti Mehrotra et al.

Table 2
Composition of YMA/YMB

Constituents Concentration (g/L)

KH2PO4 0.5
MgSO4·7H2O 2
NaCl 0.1
Mannitol 10
Yeast extract 0.4
Agar-agar 1.50 %

4. Streaking loops.
5. Sample tubes with screw top (10 ml;) (see Note 5).

2.3 Infection, 1. Culture medium (semisolid MS in petri plates and liquid B5 in

Co-cultivation, culture flasks).
and Establishment 2. In vitro maintained 6–8-week-old stock multiple shoot cul-
of Hairy Root Cultures tures of R. serpentina [8] (see Note 6).
3. Disposable syringes (1 ml).
4. Sterile distilled water.
5. Autoclaved scissors and 8–12″ rust-proof stainless steel forceps.
6. Sporidex antibiotic (Ranbaxy; India).

2.4 Confirmation 1. Mortar and pestle.

of Transformed Nature 2. Liquid nitrogen.
of Hairy Roots
3. Autoclaved eppendorf tubes.
2.4.1 Isolation 4. Buffers (Table 3, see Notes 7 and 8).
and Quantification
5. Chloroform–isoamyl alcohol (24:1; v/v).
of Genomic DNA of Normal
and Putative Hairy Roots 6. 5 M NaCl in water.
7. Isopropanol (Propane-2-ol).
8. Desiccators with vacuum pump.
9. Milli-Q water.
10. Ethidium bromide stock (1 %) in water.
11. Agarose.
12. 6× loading dye (see Note 9).

2.4.2 Polymerase Chain 1. PCR tubes (see Note 10).

Reaction (PCR) for Gene 2. Template DNA.
Amplification
3. PCR master mixture (2×, Fermentas) (see Note 11).
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 245

Table 3
Composition of buffers

Extraction buffer High salt TE TAE buffer (50×; 1 L)

1.4 M NaCl 1 M NaCl 0.5 M EDTA (100 ml)
100 mM Tris–HCl 10 mM Tris–HCl Tris base 242 g
20 mM EDTA 1 mM EDTA 57.1 ml Glacial acetic acid
2.5 % CTAB
0.2 % β-mercaptoethanol
1 % PVP

4. Gene specific (rol A) primer(s). In the present study, to con-

firm the transformed nature of roots, rol A amplification is per-
formed. However, for this purpose any of the rol genes (A, B,
C) or even TL sequence (left border sequence from bacterial
plasmid which is essential for hairy root induction) from the
bacterial origin can be amplified in host genome with their
respective primers. Primer sequence for rol A:
Forward 5′-GGAATTAGCCGGACTAAACG-3′ and
Reverse 5′-CCGGCGTGGAAATGAATCG-3′
5. Marker DNA (Quick load 100 bp, NEB)
6. Milli-Q water.
7. Ice bath.
8. Thermal power PCR cycler (iCycler).

2.5 Up-Scaling 1. Bioreactor setup (in the present protocol, model Bio flow
of Hairy Roots 3000, M/s New Brunswick Scientific, USA; modified air lift
in Bioreactor with top driven mechanical agitation through marine blade
impeller is used). The reactor setup is also fitted with probes
for dissolved oxygen (DO), pH, and temperature.
2. 4–6-week-old stock hairy root cultures maintained in shake
flasks [6] (see Note 12).
3. Gamborg’s Liquid B5 culture medium.
4. Ethanol for surface sterilization.
5. Sterile forceps.

2.6 Chemical 1. Dried root samples.

Analysis 2. Chloroform–methanol, 3:1 (v/v).
2.6.1 Extraction 3. Distilled water.
of Alkaloids and High- 4. Hydrochloric acid.
Performance Liquid
Chromatography
5. Rotavapor R-144 (Buchi).
for Reserpine 6. RP-18e Chromolith HPLC Columns (4.6 × 100 mm).
246 Shakti Mehrotra et al.

7. Glacial acetic acid.

8. Di-sodium-di-hydrogen orthophosphate.
9. HPLC-grade acetonitrile (Merck; Darmstadt, Germany)
10. HPLC-grade water (Sigma-Aldrich, USA).
11. Standard reserpine (Sigma-Aldrich, USA).

3 Methods

3.1 Preparation 1. Use MS and B5 stock solutions to prepare the culture medium
of Medium (see Notes 1 and 2; Table 1)
2. For semisolid medium melt the calculated amount of agar sep-
arately. Normally 7.5–8 % agar is used in the protocol or unless
otherwise stated.
3. Mix the required volume of stock solutions, Sucrose (30 g/l)
and myoinositol (0.1 g/l) medium. In the case of semisolid
medium add the aforementioned to the molten agar by stir-
ring. In the case of liquid B5 medium do not add agar. Make
the final volume of culture medium as per requirement.
4. Adjust the medium pH at 5.86 ± 0.02 with the help of 1 N
NaCl/1 N HCl.
5. Dispense the medium in appropriate culture vessels. Use cot-
ton plugs to seal the vessels.
6. Sterilize the medium at 121 °C at 15 lb pressure for 15–20 min.
7. Pour lukewarm semisolid MS medium in petri plates and allow
it to solidify under laminar air flow.
8. Store the culture medium at 25 °C.

3.2 Maintenance 1. Prepare the stock bacterial culture by streaking single cell bac-
of Stock Bacterial terial colonies on semisolid YMA and incubate the cultures at
Culture 28 ± 2 °C. New bacterial colonies develop within 48 h incuba-
and Preparation tion. Store the cultures at 4 °C and maintain the stock cultures
of Bacterial by regular subculturing on to the same medium at every 6–8
Suspension week interval (see Note 13).
2. Take 5 ml liquid YMB medium in sterile sample tubes.
3. Inoculate the medium with single cell colonies from stock bac-
terial cultures with the help of sterile streaking loops.
4. Incubate the culture at 28 ± 2 °C; 75–80 rpm on a rotary
shaker for 48 h (see Fig. 1a).

3.3 Infection 1. Excise juvenile (3–5-week-old) leaf explants from in vitro

and Co-cultivation maintained shoot cultures of R. serpentina under the laminar
of Leaf Explants flow.
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 247

Fig. 1 Stock bacterial culture (a; inset 48-h-old suspension culture); Co-cultivation in leaf explants (b)

2. Prick the leaf explants with sterile needle dipped in 48 h-old

bacterial suspension (see Note 14).
3. Leaf explants pricked with the sterile needle dipped in sterile
water can be treated as control.
4. Place the infected explants on MS medium in petri plates for
co-cultivation.
5. Incubate the petri plates in 40 μmol/m2/s light intensity at
25 ± 2 °C.
6. Check the excessive growth of bacteria by transferring the
explants on MS medium containing antibiotic (Sporidex,
1 mg/ml culture medium; see Note 15) after every 2–3 days
till the vestige bacterial growth disappears (see Fig. 1b).

3.4 Disinfection 1. Within 12 days of infection roots emerge at infection sites of

and Establishment leaf explants. Single root emerging from an infection site can
of Root Cultures be considered as an individual putative hairy root line (see
Fig. 2a).
2. Excise the individual putative hairy roots (≥1 cm) emerging
from the leaves.
3. Inoculate individual root lines separately on B5 semisolid
medium containing antibiotic.
4. Incubate the petri plates in light at 25 ± 2 °C (see Note 16).
5. Upon growth, transfer the root lines individually (approxi-
mately 200 mg fresh tissue weight) in 250 ml Erlenmeyer flasks
containing 30 ml liquid B5 growth medium. Incubate the
liquid cultures on a rotary shaker at 60 rpm; 25 ± 2 °C in con-
tinuous light (see Fig. 2b).
6. Maintain the root cultures in shake flasks through regular sub-
culturing at every 6-week interval in the same medium and
similar culture conditions.
248 Shakti Mehrotra et al.

Fig. 2 Emergence of roots at infection sites of leaf explants (a; inset emergence of single root line); axenic root
culture in liquid B5 medium (b)

3.5 Confirmation 1. Isolation of genomic DNA is done by modified CTAB

of Transformed Nature method [9].
of Roots 2. Prepare the extraction buffer by mixing calculated amounts of
3.5.1 Isolation cetyl trimethyl ammonium bromide (CTAB), 5 M NaCl, eth-
of Genomic DNA ylene diamine tetraacetic acid (EDTA; pH 8.0), Tris–HCl
from Different Root Lines (pH 8.0), and polyvinyl pyrrolidone (PVP) (see Table 3).
3. Make the final volume by adding sterile distilled water and
warm the extraction buffer at 60 °C in water bath for 30 min.
4. Add β-mercaptoethanol to the extraction buffer prior to use
(see Note 17).
5. Grind approximately 0.2–0.5 g fresh root tissue of putative
root lines (six in present case) along with normal roots grown
in vitro (control) to a fine powder in liquid nitrogen.
6. Immediately transfer the powdered tissue to sterile eppendorf
tubes (1.5 ml micro centrifuge tubes) containing pre-warmed
(55–60 °C) 1 ml extraction buffer (see Note 18). Inversely mix
or gently shake the mixture to form slurry.
7. Incubate them at 60–65 °C in a water bath for 1 h for lysis of
plant cell. Mix regularly at every 20 min interval.
8. Add equal volumes of chloroform–isoamyl alcohol (24:1) and
gently mix by inversion for 10 min to form an emulsion.
9. Centrifuge the tubes for 10 min at 10,000×g at 25 °C.
10. Pipette out the upper aqueous layer (~800 μl) containing
mostly nucleic acid.
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 249

11. Add 5 M NaCl (300 μl) solution and propanol-2-ol (0.6 vol-
ume of the total solution). Gently mix by inversion and allow
this mixture to stand for 1–2 h at room temperature.
12. Centrifuge for 10 min at 10,000 rpm at 25 °C.
13. Discard the supernatant and wash the pellet with 80 % ethanol
by centrifugation for 5 min at 10,000×g at 25 °C. Discard the
supernatant and dry the pellet under vacuum for 1–2 min to
remove the traces of alcohol.
14. Dissolve the pellet in high salt TE (400 μl) buffer (see Table 3).
It may take some time to dissolve.
15. Add RNAse A (5 μl) and incubate at 37 °C in a water bath for
30 min.
16. Extract with equal volume chloroform–isoamyl alcohol (24:1)
to remove the remaining proteins and other impurities by gentle
inversion and centrifugation for 10 min at 10,000×g at 25 °C.
17. Transfer the upper aqueous layer to sterile eppendorf tube and
add double volume of ice cold ethanol. Incubate at −20 °C for
1–2 h for the precipitation of DNA.
18. Centrifuge this mixture at 10,000×g for 10 min at 4 °C. Discard
the supernatant and wash the pellet with 80 % ethanol at
10,000×g for 5 min at 25 °C.
19. After vacuum drying dissolve the pellet in 50 μl Milli-Q water
and store at −20 °C for further use.

3.5.2 Quantification 1. The DNA yields can be measured either by spectrophotometer

of DNA and PCR (at 260 nm) or by agarose gel (0.8 %) electrophoresis and its
Amplification visualization under transilluminator (Preparation of agarose
gel is described below. For loading of gel see Note 19; Fig. 3a).
2. To use appropriate amount of sample DNA and ease of pipet-
ting, the DNA dilutions are required. Normally, single PCR
reaction mix requires 20–25 ng of DNA. The dilution of DNA
should be made with sterile Milli-Q water in such a way that
1 μl should contain approximately 20–25 ng of DNA.
3. Polymerase chain reaction: Prepare the PCR reaction mixture
by adding sample DNA (1 μl), forward and reverse rol A gene
primers (1 μl each from 10 pM stock), PCR master mix
(12.5 μl). Make up the volume to 25 μl by adding Milli-Q
water (see Note 20).
4. Prepare the PCR reaction mixture on ice bath.
5. Spin the PCR tube containing PCR mix for few seconds for
proper mixing.
6. Place the tubes in thermal cycler for amplification. Set the con-
ditions for amplification as:
250 Shakti Mehrotra et al.

Fig. 3 Quantification of DNA obtained from normal roots and putative hairy root lines 1–6 (a); amplification of
Rol A gene in genomic DNA of A. rhizogenes strain A4 (b), normal roots (NR) and hairy root lines 1–6. M = marker
DNA; hairy root cultures of R. serpentina (c)

(a) Initial denaturation at 94 °C for 5 min;

(b) 35 cycles each consisting of a denaturation at 94 °C for
1 min, primer annealing at 55 °C for 1 min, amplification
at 72 °C for 2 min;
(c) Final extension at 72 °C for 5 min followed by storage of
reaction at 4 °C for infinite period.
7. Gel electrophoresis: To prepare agarose gel (0.8–1.2 %), add
measured quantity of agarose powder to the required volume of
1× TAE buffer. Boil and gently swirl the solution till agarose get
completely melts. Allow it to cool to 45–50 °C. Add EtBr when
the temperature of gel remains lukewarm (see Notes 21 and 22).
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 251

8. In a pre-prepared gel casting tray fitted with desired comb,

pour the molten agarose gently by avoiding any bubble forma-
tion. Allow the gel to solidify. As the gel solidifies carefully
remove the comb and submerge the gel tray in the gel reser-
voir containing 1× TAE buffer.
9. Load the amplified DNA on 1.2 % agarose gel stained with
0.5 μg/ml EtBr in 1× TAE buffer (see Note 23).
10. Turn on the power supply. Take note of polarities (red-to-red,
black-to-black) as the DNA in gel runs from negative to posi-
tive end (see Note 24). Run the loaded gel for 2 h and visualize
the bands on a gel documentation system (see Fig. 3b).

3.6 Up-Scaling 1. The bioreactor used for the present study is of 5 L capacity,
of Hairy Roots modified air lift type. The thick glass culture vessel consists of
in Bioreactor top driven mechanical agitation through marine blade impeller.
3.6.1 Bioreactor Setup 2. The culture vessel is fitted with probes for dissolved oxygen
and Culture (DO), pH, and temperature to control and optimize the
respective culture conditions.
3. In this protocol, an autoclavable nylon mesh (pore size 200 µm)
is manually fabricated in the center of the vessel that divides
the culture vessel into two halves. In upper half of the vessel,
mesh provides anchorage surface to the inoculated and grow-
ing tissue and rescues them from getting sunk in the medium
during growth phase. The lower half of the vessel consists of a
single sparger and a marine blade impeller provided for aera-
tion and agitation respectively (see Fig. 4).
4. A hydrophobic membrane filter (Whatman, USA; 0.22 μm) is
used to pass the influent air from sparger into the medium.
5. All the parts of the reactors are thoroughly washed and then
surface-sterilized with ethyl alcohol prior to assembling the
unit and lubricated with silicon grease to make the unit
airtight.
6. Pour the liquid B5 medium supplemented with 3 % w/v
sucrose into the assembled reactor culture vessel.
7. In present protocol, the complete air tight unit filled with
growth medium (2.5 L; pH adjusted to 5.86 ± 0.02) is steril-
ized by autoclaving at 120 °C and 15 lbs pressure for 15 min.
8. The sterile culture vessel is inoculated on a clean laminar bench
provided with HEPA filters with 5–6-week-old hairy root cul-
tures (see Note 25). A fast growing hairy root line (whose
transformed nature has been confirmed through rol gene
amplification) is selected for the cultivation in reactor.
9. The impeller speed is maintained at 75 rpm throughout the cul-
ture duration. The experiment is conducted at 25 ± 2 °C in con-
tinuous light provided externally by compact fluorescent lamps.
252 Shakti Mehrotra et al.

Fig. 4 Diagrammatic presentation of reactor configuration

10. The bioreactor is operated for 11 weeks. During this culture

period rapid growth of roots resulted in the formation of root
clumps (see Fig. 5a; [10]). This has led to the depletion of dis-
solved oxygen in the medium and an increased oxygen demand.
Therefore, the air supply is increased from 0.25 to 1.0 L/min.

3.6.2 Harvesting 1. Harvest the cultured roots from the reactor vessel (see Fig. 5b).
of Roots Carefully separate the thick clumps of roots from the baffle
assembly. Wash the roots in running tap water to remove the
traces of medium.
2. Dry the roots on filter paper towel to remove excess water.
3. Dry the harvested roots in hot air oven at 50 °C.

3.7 Chemical 1. Grind 1.0 g oven-dried R. serpentina hairy roots into fine
Analysis powder.
3.7.1 Extraction of Indole 2. Extract the root powder thrice with (3 × 10 ml) chloroform
Alkaloids and HPLC and methanol (3:1) over night at room temperature.
Analysis 3. Pool the extracts and dry under vacuum, 417 bars at 40 °C in
a Rotavapor (R-144) (Buchi).
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 253

Fig. 5 Growth performance of R. serpentina hairy root culture in bioreactor. Dense root growth during culture
(a), arrows indicate the position of nylon mesh; Hairy root biomass harvested after 11 weeks of culture (b);
HPLC chromatogram of standard reserpine (c) and in hairy roots grown in bioreactor (d)

4. Redissolve the dried extract in small amount of chloroform

and methanol (3:1) and transfer to small glass tube and allow
the solvent to evaporate and dry in desiccators and store in
refrigerator at 4 °C. This extract can be used for quantitative
analysis of reserpine and other indole alkaloids through HPLC.
5. Before analysis redissolve the dried extract in acidic methanol
i.e., methanol:HCl—98:2 (v/v) through ultrasonication.
Centrifuge the dissolved extract (equivalent to 1 g/ml on tis-
sue dry weight basis) at 10,000 rpm for 30 min.
6. Stock solution of standard reserpine: dissolve 1 mg standard
reserpine in 1 ml of methanol.
7. Filter the sample extract and standard reserpine solutions
through HPLC millipore filter paper (0.45 mm).
8. Analyze the samples through an analytical HPLC system. In
present method, the HPLC system consists of a LC-20 AD
solvent delivery pump, a DGU-20A 5 degasser, a CTO-20A
column oven, a 10AF auto sampler, and a SPD-M 20A photo-
diode array detector.
254 Shakti Mehrotra et al.

9. Quantitative estimation of reserpine is done using reversed-

phase HPLC gradient method with photodiode array (PDA)
detection method.
10. A gradient program (pump A acetonitrile and pump B 0.01 M
phosphate buffer containing 0.5 % glacial acetic acid; pH 3.5)
is used. The samples are run at a flow rate of 1.0 ml/min at
26 ± 2 °C. A chromolith RP-18e HPLC column, 4.6 × 100 mm,
is used for all the analyses.
11. Data acquisition is performed on Lab Solution 3.21 at a wave-
length of 254 nm.
12. The reserpine identity in the sample run is confirmed by Rf
comparison. The area under respective peak is recorded and
used for percent content of the alkaloid in the R. serpentina
hairy root sample (see Fig. 5c, d).

4 Notes

1. Store the stock solutions of basal growth medium in refrigerator.

Avoid contamination in stock solutions while using. Always pre-
pare iron stock by dissolving FeSO4 and Na EDTA separately to
overcome problem of iron insolubility. Na EDTA is used to get
iron in chelated form (Na Fe–ethylene-diamine tetraacetic acid).
2. Prepare the stock solutions of the growth medium using the
following equation:
N1V1 =N2V2
Where: N1 = concentration of stock solution
N2 = required concentration of the solution in the medium
V1 = volume of the stock solution needed
V2 = final volume of the medium
3. All glassware should be cleaned with a liquid detergent and
thoroughly washed with tap water. Rinse the glassware with
double distilled water and dry in hot air oven at 150 °C for 2 h
before use.
4. Alternatively, this can be prepared by the Yeast Mannitol Agar/
Broth (YMA/YMB) salt mixture which is also commercially
available. Adjust the medium’s pH at 7.0.
5. As an alternative to sample tubes, test tubes can also be used to
prepare bacterial suspension.
6. Multiple shoot cultures of R. serpentina can be established and
maintained easily in hormone-supplemented MS medium
under standard in vitro conditions [8].
7. Add water to make the required volume of 1 × TAE buffer.
Maintain the buffer at pH 8.0.
Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 255

8. Use autoclaved bottles to store the TE and TAE buffers to

avoid any contamination during DNA isolation and gel
electrophoresis.
9. Prepare 6× loading dye by mixing glycerol (30 % in water),
0.25 % bromophenol blue, and 0.25 % xylene cyanol. Store the
dye at −20 °C.
10. Autoclave the PCR tubes prior to use to avoid any contamina-
tion during the procedure as contamination at this stage may
affect the results.
11. Commercially available PCR master mix is a 2× concentrated
mixture of Taq DNA polymerase, dNTPs, and all other compo-
nents required for PCR, except DNA template and primers. Use
of readymade PCR master mix reduces contamination and han-
dling errors during pipetting. Individual components can also be
mixed separately to prepare PCR reaction mix with Milli-Q water.
12. Morphological variations can be seen in different hairy root
clones of R. serpentina [10]. Any visibly healthy (free from cal-
lus and browning) and fast growing hairy root line can be
selected for up-scaling.
13. Careful subculturing and maintenance of bacterial stock cul-
ture is required as these cultures get easily contaminated which
ultimately lead to the loss of original culture. Ensure the main-
tenance of original bacterial culture by cross-checking the pres-
ence of rol gene through PCR.
14. While pricking the leaf explants care should be taken. A slight
break in epidermal layer of leaf surface would be sufficient for
bacterial cells to infect and transform wounded host cells.
Little extra pressure during pricking can result in the death of
leaf cells which ultimately leads to an unsuccessful exercise.
15. Dissolve the powder content of a 500 mg Sporidex capsule in
10 ml distilled water (50 mg antibiotic in 1 ml water). Dissolve
it and filter through Whatman filter paper. Filter-sterilize the
antibiotic solution under laminar flow with the help of syringe
filters before mixing in the medium. Store the sterile antibiotic
solution in sterile tubes in refrigerator.
16. After the establishment of axenic root cultures, gradually
remove the antibiotic from the culture medium.
17. β-mercaptoethanol is added to the extraction buffer just before
use. Care should be taken while using the chemical as it is con-
sidered toxic.
18. Avoid delay in transferring the powdered tissue to the extrac-
tion buffer. Do not let thawing of tissue.
19. Loading of gel for DNA quantification: Mix well the DNA
sample (2 μl), loading 6× dye (2 μl), and Milli-Q water (8 μl).
Load the 12 μl mixture in the wells of gel carefully.
256 Shakti Mehrotra et al.

20. Alternatively, the PCR reaction mix can be prepared by adding

individual components. For this, add sample DNA (1 μl), 10×
Reaction buffer (2.5 μl), 10 mM dNTPs (1 μl, i.e., 0.25 μl
each dNTP), reverse and forward primers (1 μl of 10 pM
stock), and Taq DNA polymerase (0.2–0.3 μl). Make up the
volume to 25 μl by adding Milli-Q water.
21. There can be a significant loss of solution volume due to evap-
oration of water while melting the agarose. This can cause
change in the concentration of agarose as well as will increase
the concentration of buffer. The simplest way to get rid of this
problem is to replenish the amount of water lost by
evaporation.
22. The final concentration of ethidium bromide in gel should be
0.5 μg/ml.
23. Avoid contact of body parts with β-mercaptoethanol and EtBr.
These chemicals are highly mutagenic and carcinogenic.
24. Check the gel regularly to prevent the samples from running
off the gel.
25. Before inoculating the reactor vessel switch on the UV light
for 30 min. and surface-sterilize the laminar bench with alco-
hol. Wipe the head plate of reactor with alcohol and inocula-
tion port should also be heated to avoid contamination while
inoculation. Care should also be taken while aseptic transfer of
root tissue as any contact with inoculation port can damage the
tissue due to heat.

Acknowledgement

The authors are grateful to Director, CIMAP (CSIR) for providing

the necessary facilities to carry out the work. Postdoctoral
Fellowship provided by Department of Science and Technology
(DST), Govt. of India to S.M is acknowledged.

References
1. Harisaranraj R, Suresh K, Saravanababu S aurantium, and methods of using same. US
(2009) Evaluation of the chemical composi- Patent 749395 B2
tion Rauwolfia serpentina and Ephedra vul- 4. Pistelli L, Giovannini A, Ruffoni B, Bertoli A,
garis. Adv Biol Res 3(5–6):174–178 Pistelli L (2010) Hairy root cultures for sec-
2. Pathania S, Randhawa V, Bagler G (2013) ondary metabolites production. Adv Exp Med
Prospecting for novel plant-derived molecules Biol 698:167–184
of Rauvolfia serpentina as inhibitors of aldose 5. Mehrotra S, Goel MK, Rahman LU, Kukreja
reductase, a potent drug target for diabetes AK (2013) Molecular and chemical character-
and its complications. PLoS One 8, e61327 ization of plants regenerated from Ri mediated
3. Campbell-Tofte J (2006) Anti-diabetic extract hairy root cultures of Rauwolfia serpentina.
isolated from Rauvolfia vomitoria and Citrus Plant Cell Tiss Organ Cult 114:31–38
 Reserpine Biosynthesis by Rauvolfia Serpentina Hairy Root Cultures… 257

6. Goel MK, Goel S, Banerjee S, Shanker K, reserpine, ajmaline, and ajmalicine. In: Jain
Kukreja AK (2010) Agrobacterium rhizogenes- SM, Saxena PK (eds) Protocols for in vitro cul-
mediated transformed roots of Rauwolfia ser- tures and secondary metabolite analysis of aro-
pentina for reserpine biosynthesis. Med matic plants, vol 547, Methods in molecular
Aromat Plant Sci Biotechnol 4:8–14 biology. Humana Press, Springer, USA,
7. Hooykass PJJ, Klapwijk PM, Nuti PM, pp 17–33
Shilperoot RA, Rorch A (1977) Transfer of the 9. Khanuja SPS, Shasany AK, Srivastava A, Kumar
Agrobacterium tumefaciens Ti plasmid to avir- S (1998) Assessment of genetic relationship in
ulent Agrobacteria and Rhizobium ex planta. Mentha species. Euphytica 111:121–125
J Gen Microbiol 98:477–484 10. Mehrotra S, Goel MK, Srivastava V, Rahman
8. Goel MK, Mehrotra S, Kukreja AK, Shanker LU (2015) Hairy root biotechnology of
K, Khanuja SP (2009) In vitro propagation of Rauwolfia serpentina: a potent approach for
Rauwolfia serpentina using liquid medium, the production of pharmaceutically important
assessment of genetic fidelity of micropropa- terpenoid indole alkaloids. Biotechnol Lett.
gated plants, and simultaneous quantitation of doi:10.1007/s10529-014-1695-y
 Chapter 18

In Vitro Shoot Cultures and Analysis of Steroidal Lactones

in Withania coagulans (Stocks) Dunal
Rohit Jain, Sumita Kachhwaha, and S.L. Kothari

Abstract
Withania coagulans (Stocks) Dunal (Solanaceae), also known as ‘Panir Bandh’ is an important medicinal
plant that is extensively used as a home remedy for several diseases in the Indian subcontinent. The plant
possesses specific steroidal lactones known as withanolides which show high level of pharmaceutical activity
against a broad spectrum of microorganisms. Natural propagation of the plant occurs through Seed but
due to unisexual nature of the flowers; chances of Seed setting are very limited and the plant is on the verge
of extinction because of overexploitation and reproductive failure. Plant tissue culture techniques offer
opportunities for ex situ conservation and mass multiplication of endangered plant species through micro-
propagation and also enhancement of in vitro biosynthesis of bioactive compounds. In this chapter we
present protocols for the mass multiplication of W. coagulans, assessment of clonal fidelity by RAPD, and
estimation of bioactive compounds (withanolides) by thin layer chromatography (TLC) and reverse phase
HPLC developed in our laboratory.

Key words Withania coagulans, Micropropagation, Withanolides, Clonal fidelity, RAPD, HPLC

1 Introduction

W. coagulans (Stocks) Dunal (synonym: Puneeria coagulans

Stocks), commonly known as Indian rennet, is distributed in the
warmer and drier parts of India [1]. The plant is native of the Asia-
temperate (Western Asia: Afghanistan) and Asia-tropical regions. It
is a rare and endangered medicinal plant restricted to the Northern
part of Indian subcontinent and observed only twice in Rajasthan
in the vegetative state only [2]. The plant has a long tapering light
brown root, it is surmounted by a knotty crown from which spring
several shrubby, flexose round branches, 1–5 ft in length
(see Fig. 1). The whole plant is covered with small branched and
pointed white hairs, which give it a hoary appearance. The odor is
pungent and disagreeable like horse’s urine. The chromosome
number is 2n = 48.

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_18, © Springer Science+Business Media New York 2016

259
260 Rohit Jain et al.

Fig. 1 Withania coagulans plant growing in field

The plant has diverse pharmacological properties, including

anti-inflammatory, anticancer, chemoprotective, hepatoprotective,
immunomodulatory, antifungal and antibacterial, hypoglycemic,
hypolipidemic, antihyperglycemic, cardiovascular, and central ner-
vous system related activities [3–5]. W. coagulans is commercially
important also because of its ability to coagulate milk due to the
presence of an enzyme in the fruits of the plant. The concentrated
enzyme can successfully be used in place of animal rennet to pre-
pare soft cheese like cheddar. The essential oil of the plant is found
to be active against Micrococcus pyogenes var. aureus and Escherichia
coli [6]. This plant is well recognized in the native system of medi-
cine for the treatment of ulcers, rheumatism, dropsy, consumption,
sensile debility, asthma, biliousness, strangury, dyspepsia, flatulent
colic, and other intestinal infections. In the Indian subcontinent,
the fruits are used as blood purifier and the twigs of the plant are
chewed for cleaning teeth [7].
The chemistry of W. coagulans has been comprehensively stud-
ied and several groups of chemical constituents such as steroidal
lactones, alkaloids, flavonoids, and tannin have been identified,
extracted, and isolated [8, 9]. The major chemical constituents of
the plant, withanolides, are mainly localized in leaves and roots
[9]. The withanolides are a group of naturally occurring C-28
steroidal lactones built on an intact or rearranged ergostane frame-
work, in which C-22 and C-26 are appropriately oxidized to form
a six-membered lactone ring. The basic structure is designated as
the withanolide skeleton (see Fig. 2) [10–12].
The withanolide skeleton is a 22-hydroxyergostan-26-oic acid-
26, 22-lactone structure. There are many structural alternatives of
withanolides with modifications either of the carbocyclic skeleton
or the side chain and these have been described as modified witha-
nolides or ergostane type steroids related to withanolides. The
characteristic feature of withanolides and ergostane type steroids is
one C8 or C9-side chain with a lactone (either six-membered or
five-membered) or lactol ring, fused with the carbocyclic part of
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 261

28

27
24
23 25
21 22 26

18 O O
20

12
19 17
11 13
16
14 15
1 9
2 10 8
3 5 7
4 6

Fig. 2 Basic withanolide skeleton

the molecule through a carbon–carbon bond or through an oxy-

gen bridge. Appropriate oxygen substituents may lead to forma-
tion of new bonds, aromatization of rings, and many other kinds of
rearrangements resulting in compounds with novel structures [11,
13, 14].
According to Mishra et al. [15] W. coagulans is phytochemi-
cally unique in predominantly producing the neuroactive metabo-
lite withanolide A in aerial parts of the plant, implying relatively
easier and economical harvest of the withanolide. Naturally, W.
coagulans propagates through seeds but seed setting is limited due
to unisexual nature of flowers. Reproductive failure and overex-
ploitation have rendered the species highly vulnerable to complete
extinction [16]. Therefore, there is an urgent need of ex situ con-
servation of this important medicinal plant through micropropaga-
tion techniques.

2 Materials

2.1 Media 1. Stock solutions of Murashige and Skoog (MS) medium (Table 1).
Preparation: 2. Agar.
(See Notes 1–3)
3. Beakers, measuring cylinder.
4. 1 N HCl/1 N NaOH.
5. Stock solutions of different plant growth regulators.
6. Sucrose.
262 Rohit Jain et al.

Table 1
Composition of MS basal medium

Final concentration in
medium

Nutrient Weight in stock solution (mg) mg/L mM

A NH4NO3 33,000 1650 20.6
B KNO3 38,000 1900 18.8
C KH2PO4 6800 170 1.25
KI 33.2 0.83 5 × 10−3
H3BO3 248 6.2 0.1
D Na2MoO4·2H2O 50 0.25 1.03 × 10−3
CoCl2·6H2O 5 0.025 0.11 × 10−3
E CaCl2·2H2O 17,600 440 2.99
F MgSO4·7H2O 14,800 370 1.5
MnSO4·H2O 676 16.9 0.1
ZnSO4·7H2O 344 8.6 29.91 × 10−3
G CuSO4·5H2O 5 0.025 0.1 × 10−3
H FeSO4·7H2O 1114 27.8 0.1
Na2EDTA 1490 37.3 0.1
I Thiamine–HCl 10 0.1 0.3 × 10−3
Pyridoxine–HCl 50 0.5 2.43 × 10−3
Nicotinic acid 50 0.5 4.06 × 10−3
Glycine 200 2 26.64 × 10−3
J Myo-inositol 2000 100 0.56

2.2 Surface 1. “Extran” liquid detergent.

Sterilization 2. Mercuric chloride.
3. Distilled water.

2.3 Analysis 1. Leaf samples: 2 g fresh leaves.

of Clonal Fidelity 2. Cetyl trimethyl ammonium bromide (CTAB) extraction buffer
by RAPD (100 ml): 2 % (w/v) CTAB, 1.4 M NaCl, 20 mM EDTA,
2.3.1 Genomic DNA 100 mM Tris–HCl pH 8.0 (see Note 4).
Isolation 3. Tris EDTA (TE) buffer (100 ml): 10 mM Tris–HCl (pH 8.0),
1 mM EDTA (pH 8.0) (see Note 5).
4. Ice-cold isopropanol.
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 263

5. Chloroform–isoamyl alcohol (24:1 v/v).

6. Sodium acetate (3.0 M) pH 5.2 (Adjust pH with glacial acetic
acid).
7. Ethanol (100 % and 70 %).
8. RNAse A: 10 mg/ml (see Note 6).
9. Milli-Q Water.

2.3.2 PCR for DNA 1. Template DNA.

Amplification 2. PCR tubes (see Note 7).
3. dNTP mix.
4. RAPD primer.
5. Taq DNA Polymerase.
6. Taq Buffer solution (with MgCl2).
7. Milli-Q Water.

2.3.3 Gel Electrophoresis 1. Gel electrophoresis setup unit.

2. Agarose (1.2 % w/v) (see Note 8).
3. TAE buffer (50×) (see Note 9).
4. Ethidium bromide (1 % w/v in Milli-Q water) (see Note 10).
5. Gel loading dye (6×) (see Note 11).

2.4 Analysis 1. Plant material (shoot buds and leaves, 2 g).

of Secondary 2. Mortar and pestle.
Metabolites
3. Methanol (25 % (v/v) in water).
(Withanolides) by TLC
and HPLC 4. Separatory funnel.
5. n-hexane.
2.4.1 Secondary
Metabolite Extraction 6. Chloroform.

2.4.2 Thin Layer 1. TLC plates (precoated Silica Gel G-60 plates).
Chromatography 2. Solvent system (see Note 12).
3. Anisaldehyde reagent (see Note 13).
4. Standard withanolides.

2.4.3 HPLC Analysis 1. Methanol (HPLC grade).

2. Deionized water (HPLC grade).
3. Acetic acid (HPLC grade).
4. Reverse-phase (RP) column (Eclipse XDB c-18, particle size
1.8 μm, 4.5 mm × 250 mm).
5. Authentic withanolide standards.
264 Rohit Jain et al.

3 Methods

3.1 Micropropagation Basal medium used in the present study is MS (Murashige and
of W. coagulans Skoog, 1962) medium [17].
3.1.1 Preparation 1. Prepare stock solutions of various inorganic and organic nutri-
of Medium ents of MS medium (Table 1). To prepare stock solutions of
growth regulators, dissolve auxins (IAA, IBA, PAA, NAA) in
few drops of absolute alcohol and cytokinins (BA, Kn) in few
drops of 1 N HCl, and make up the final volume by adding
distilled water (20 mg/100 ml) (see Note 1).
2. Prepare the medium by mixing all the mineral nutrients,
sucrose (3 %, w/v), and growth regulators in appropriate
quantities (see Notes 2 and 3).
3. Adjust the pH to 5.8 by 1 N HCl/NaOH.
4. Weigh appropriate amount of agar (0.9 %) and mix in the
medium followed by heating in a microwave oven until the
agar is dissolved (see Note 8).
5. Stir the medium and dispense approximately 40 ml or 20 ml
into 100 ml Erlenmeyer flask or culture tubes, respectively.
6. Plug the culture vessels with non-absorbent cotton and wrap
with paper prior to autoclaving at 121 °C and 1.06 kg/cm2
pressure for 20 min.
7. Use the autoclaved medium after solidification.

3.1.2 Aseptic 1. Autoclave all other accessories such as conical flasks, measuring
Manipulations cylinders, reagent bottles, Petri plates, forceps, and scalpel
blades.
2. Measured volume of distilled water required for surface steril-
ization of field explants should also be sterilized by
autoclaving.
3. Clean the laminar air flow cabinet with spirit and put all the
required accessories along with the culture vessels containing
medium and distilled water.
4. Irradiate the cabinet with UV rays for 25–30 min.
5. After irradiation open the cabinet and start the surface steril-
ization process under a continuous airflow (see Note 14).

3.1.3 Surface 1. Excise the explants from mature plants and wash with liquid
Sterilization, Explant detergent “Extran” (5 %, v/v) for 5–10 min and rinse 4–5
Culture, and Incubation times thoroughly with sterile distilled water.
2. For surface sterilization dip the explants in mercuric chloride
(0.1 %, w/v) solution in laminar airflow cabinet for 3 min and
wash with distilled water 3–4 times.
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 265

3. Inoculate the explants in the medium with the help of forceps

and scalpel on a spirit lamp/burner in the cabinet (see Note 15).
4. Place the nodal segments having axillary buds and shoot tips
with apical meristem separately in the culture vessel containing
shoot induction medium (see Note 2a) in such a way that the
cut end of the explant remains in contact with the medium.
5. Inoculate the horizontally excised leaf explants of appropriate
size (2–3 cm long), with petiolar end abaxially on the shoot
induction medium (see Note 2b).
6. Incubate the cultures in the growth chamber at 26 ± 1 °C
under 16/8 h photoperiod with 25 μmol/m2/s photosyn-
thetic photon flux density provided by white fluorescent tubes.

3.1.4 Subculture 1. Within 3 weeks of incubation bud break occurs from the nodal
of Shoot Buds segments and shoot tips (see Fig. 3a, b).
2. Transfer the primary shoots to fresh medium after 4–5 weeks
of culture incubation.
3. Excise the shoot buds induced from the explant into groups
each having 3–4 shoot buds.
4. Inoculate these clusters on the first stage shoot proliferation
medium (see Note 2c).
5. Within 3–4 weeks the multiplication of shoot buds occurs
(see Fig. 3c). Transfer the developed shoots on second stage
shoot proliferation medium for further growth and elongation
of shoots (see Note 2d).
6. Within 2 weeks of culture elongation occurs in the shoots
(see Fig. 3d).

3.1.5 Rooting, 1. Excise and inoculate the elongated shoots (>3 cm) on first step
Hardening, and Field rooting medium (R1) for pulse treatment for 7 days (see Note 3a).
Transfer of Plantlets 2. Transfer the shoots on second step rooting medium (R2)
(see Note 3b).
3. The roots emerge from the shoot after 3 weeks of culture
(see Fig. 3e).
4. Carefully take out the regenerated plantlets with well-devel-
oped shoot and root systems and wash thoroughly with tap
water to remove agar clinging to roots.
5. Prepare earthen pots containing mixture of garden soil and
vermiculite (1:1) and transfer the plantlets in the pots followed
by transfer to green house at 26 ± 1 °C temperature and 85 %
humidity.
6. After acclimatization transfer the plants to field conditions (see
Fig. 3f).
266 Rohit Jain et al.

Fig. 3 Morphogenic response of Withania coagulans cultured on MS medium

supplemented with various growth regulators. (a) Bud break from nodal explant,
(b) Bud break from shoot tip explant, (c) Multiplication response of shoot buds,
(d) Elongation of shoot buds, (e) Rooting response of in vitro-regenerated shoots,
(f) Field-transferred plant
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 267

3.2 Analysis CTAB method of Doyle and Doyle [18] as described below is used
of Clonal Fidelity to isolate genomic DNA.
by RAPD
1. Collect young leaf samples from at least 15–20 tissue culture
3.2.1 Genomic DNA raised plants growing in the field condition.
Isolation from Mother Plant 2. Grind 100 mg of frozen plant material to fine powder with
and Tissue Culture Raised mortar and pestle using liquid nitrogen.
Plantlets
3. Transfer the powder immediately to 5 ml of pre-warmed
(65 °C) CTAB extraction buffer and 2 μl RNase A.
4. Incubate the mixture for 1 h at 65 °C in a water bath and mix
gently after every 10 min.
5. Add equal volume of chloroform–isoamyl alcohol (24:1, v/v)
to the mixture and centrifuge the resultant slurry at 12,000 rpm
(18,500 × g) at 4 °C for 10 min.
6. Separate the upper aqueous phase after centrifugation and
transfer to test tubes.
7. Add 2 μl RNase A to each tube at this step and incubate at
room temperature for 30 min.
8. To each test tube, add 0.6 volume of ice-cold isopropanol to
the aqueous phase followed by gentle but thorough mixing by
inverting the tubes several times. At this stage, the DNA-
CTAB complex is precipitated out. Centrifuge the precipitate
containing DNA by centrifugation at 6000 rpm at 4 °C for
10 min.
9. Wash the pellet with 70 % ethanol by gentle agitation followed
by centrifugation (10 min, 5000 rpm, 4 °C).
10. Discard the ethanol and allow to air-dry the pellet obtained
after centrifugation and add 100 μl of TE buffer and leave
overnight for dissolving the DNA.
11. The concentration of purified DNA in the solution is estimated
on 0.8 % (w/v) agarose gel electrophoresis by comparing with
uncut lambda DNA of known concentration.

3.2.2 Molecular Analysis 1. PCR amplification: Prepare the PCR reaction mixture on ice
Using RAPD bath in 25 μl volume by mixing all the components given in
Table 2.
2. Spin the PCR tube containing reaction mixture for few sec-
onds and place the tubes in the thermal cycler for PCR ampli-
fication. Set the PCR amplification conditions as follows:
Initial denaturation at 94 °C for 4 min followed by 40 cycles of
94 °C for 45 s, 37 °C for 45 s and 72 °C for 2 min, and a final
extension at 72 °C for 10 min.
3. Gel electrophoresis: Prepare the 1.2 % (w/v) agarose gel
(100 ml) using l× TAE gel running buffer.
268 Rohit Jain et al.

Table 2
Composition of PCR reaction mixture

Components Volume
Taq buffer (with MgCl2) 2.5 μl
dNTP mix 0.5 μl
DNA 1 μl (25 ng/μl)
Primer 2 μl
Taq polymerase 0.25 μl (3 Units/μl)
Molecular water 18.75 μl

4. Mark the height of the level of buffer with a mark on the out-
side of the flask. Boil the solution in microwave to dissolve the
agarose completely; swirl flask occasionally to mix. Check the
height of the liquid level in the flask. If necessary, add sterile
distilled water to bring the liquid back to the original level.
5. Allow the dissolved agarose to cool to about 45–50 °C and
add 2–3 μl EtBr solution (1 mg/ml) and mix.
6. Pour the agarose into a gel casting tray after sealing properly
the ends and placing appropriate comb to make the gel wells.
Allow the gel to solidify. This can take 15–20 min, depending
on the agarose concentration.
7. Once the gel is solidified, remove the comb from the gel. To
aid in removing the comb, pour a small amount of 1× TAE
running buffer around the comb before loosening the comb
(see Note 16).
8. Transfer the gel on the gel tray to the gel tank. Add 1× TAE
running buffer to immerse the gel completely (see Note 9).
9. Prepare DNA samples in eppendorf tubes to be loaded on the
gel. Add 1.0 μl of gel loading buffer for every 5 μl of DNA
sample. Mix the sample and loading buffer completely.
10. Carefully load the samples in the gel wells. In the very first well
of the gel load the appropriate DNA molecular marker (0.1 Kb
or 1.0 Kb). Record which samples are loaded in which lane.
11. Connect the apparatus to the power pack and allow electro-
phoresis to proceed at 5 V/cm of the gel.
12. When tracing dye reaches the end of the gel, turn-off the
power, remove the gel from the casting tray, and visualize the
bands on gel documentation system.
13. Analyze the RAPD banding pattern for monomorphic and
polymorphic bands present in the gel and the size of the bands
by comparing with the 0.1 Kb and 1 Kb DNA molecular
weight marker (see Fig. 4a, b).
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 269

Fig. 4 Agarose gel electrophoresis of RAPD fragments. (a) Banding profile amplified by RAPD primer OPT-8, (b)
Banding profile amplified by RAPD primer OPF-6

3.3 Estimation 1. Extract 2 g freshly harvested plant material from W. coagulans

of Secondary three times with 20 ml extraction system containing 25 % meth-
Metabolites by TLC anol (v/v, in distilled water) in Erlenmeyer flask on a platform
and HPLC shaker at 30–40 rpm for 1 h in each extraction (see Note 17).
3.3.1 Extraction
2. Filter the solvent composition and recover the extract. Pool all
of Withanolides from
the three filtrates and put in the separating funnel for liquid–
W. coagulans
liquid partition chromatography.
3. At first, treat the extract with equal amount of n-hexane in the
separating funnel to remove the pigments and fatty acids (see
Note 18).
4. Discard the lower n-hexane layer and repeat the process three
times.
5. Treat the defatted and depigmented extract with chloroform
(equal volume, three times) to recover withanolides in the
chloroform layer.
6. Pool the chloroform fractions of each extract and allow to dry
at room temperature.
270 Rohit Jain et al.

7. Dissolve the residue in known volume (1 ml) of HPLC grade

methanol and filter through a 0.45 μm membrane filter prior
to TLC and HPLC.

3.3.2 Qualitative Analysis Qualitative withanolide profiling is done through TLC as described
of Withanolides by TLC by Jain et al. [19].
1. Fill the chromatography chamber with the solvent system and
cover the chamber with glass lid for saturation (see Note 12).
2. Meanwhile load 10 μl sample on the preactivated silica gel
G-60 plate along with the authenticated withanolide standards
(see Note 19).
3. Place the plate in the saturated chamber and allow the solvent
to run. Remove the plate after completion of the solvent run
on the plate and air-dry the plate.
4. Develop the plate by spraying anisaldehyde reagent followed
by heating at 110 °C (see Note 13).
5. Mark the spots visible after development with reference to the
standard withanolides.

3.3.3 Quanitative Quanitative withanolide profiling was done through HPLC as

Analysis of Withanolides described by Jain et al. [19].
by HPLC
1. In the present study the quantification of extracts is analyzed
through an analytical HPLC system having solvent reservoir
bottles, solvent delivery pumps, degasser, autosampler, column
oven, reverse phase column (Eclipse XDB c-18, particle size
1.8 μm, 4.5 mm × 250 mm), and UV-Diode Array Detector.
2. A gradient program with HPLC grade water (pump A) and
HPLC grade methanol (pump B) each containing 0.1 % acetic
acid is used (see Note 20).
3. Set the solvent gradient as A:B, 60:40 to 25:75, 0 to 45 min;
10:90, 45 to 60 min at a flow rate of 0.6 ml/min with a refer-
ence wavelength of 227 nm.
4. Load the sample vial in the autosampler tray and set the injec-
tion volume to 10 μl in the program.
5. Set the column temperature at 27 °C during the run.
6. Use the authenticated withanolide standards to ascertain their
discrete resolution from each other under these conditions.
7. Data acquisition is done on the Agilent Chemstation 2.0. For
computation of withanolide concentration in the samples pre-
pare a calibration curve of concentration versus detector
response (peak area) and regression equation (Y = mX + C) for
each standard separately, using different concentrations (50–
1000 ng/μl) of standard solution (1.0 mg/ml) in HPLC grade
methanol.
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 271

Fig. 5 HPLC chromatogram of shoot cultures of W. coagulans. (a) Standard withaferin A, (b) Standard witha-
nolide A, (c) Standard withanone, (d) Chromatogram of extract isolated from shoot cultures of W.
coagulans

8. Calculate the concentration of different withanolides present

in the extract by using the detector response of HPLC chro-
matogram for each withanolide peak at the same retention
time as in the standard withanolide chromatogram and the
regression equation (see Fig. 5).

4 Notes

1. Label all the stocks and store in refrigerator. Use stock solu-
tions within a week of preparation. Mix thermostable chemi-
cals with other ingredients of the media before autoclaving,
while filter-sterilized thermolabile chemicals are added to the
autoclaved media in the laminar air flow cabinet.
2. Use following concentrations and combinations of PGRs in
the medium for shoot bud induction and proliferation.
(a) Shoot induction medium for shoot tip and nodal seg-
ments: N-6-benzyladenine (BA) 2.2 μM in the MS
medium.
(b) Adventitious shoot induction medium for leaf explant:
Combination of BA 22.2 μM and kinetin (Kn) 2.3 μM in
MS medium.
(c) First stage shoot proliferation medium: Combination of
BA 2.2 μM and Kn 2.3 μM in MS medium.
(d) Second stage shoot proliferation medium: Combination
of BA 2.2 μM, Kn 2.3 μM, and phloroglucinol (PG)
3.9 μM in MS medium.
272 Rohit Jain et al.

3. Use following concentrations and combinations of PGRs in

the medium for rooting.
(a) First step rooting medium (R1): choline chloride (CC)
71.6 μM, PG 3.9 μM in half-strength MS medium.
(b) Second step rooting medium (R2): indole-3-butyric acid
(IBA) 1.2 μM, phenylacetic acid (PAA) 3.6 μM, CC
(71.6 μM), and PG (3.9 μM) in half-strength MS medium.
4. Autoclave Tris–HCl, NaCl, and EDTA. CTAB should be
added after autoclaving and extraction buffer should be pre-
heated (65 °C) before using.
5. Dissolve and make up to 100 ml with distilled water, autoclave
and store at 4 °C.
6. Dissolve RNase A in TE and boil it for 15 min at 100 °C to
destroy DNase and store at −20 °C.
7. Autoclave the PCR tubes to avoid any contamination during
the reaction.
8. When using the microwave, be sure to use cotton gloves (tem-
perature proof) to pick up hot flasks. Do not swirl a flask to mix
the contents of the flask until the flask has cooled briefly. Point
the mouth of the flask away from you. Swirling an overheated
flask may cause the liquid inside to “boil out” of the hot flask.
9. To prepare 50× TAE, mix Tris 242 g, glacial acetic acid 57.1 ml,
0.5 M EDTA pH 8.0 in 100 ml distilled water. Make up the
volume to 1000 ml and autoclave. Add 2 ml of 50× TAE in
98 ml of distilled water to prepare 1× gel running buffer.
10. Always wear nitrile gloves while handling EtBr as it is
carcinogenic.
11. Mix 30 % (v/v) glycerol in water and add 0.25 % (w/v) bro-
mophenol blue and 0.25 % (w/v) xylene cyanol. Store the dye
at −20 °C.
12. Prepare the solvent system by mixing chloroform, ethyl ace-
tate, methanol, and toluene (74:4:8:30; v/v) in a chromatog-
raphy chamber and cover the chamber with lid for saturation.
13. 250 μl anisaldehyde in a mixture of 20 ml acetone, 80 ml
water, and 10 ml 60 % perchloric acid.
14. Make sure that the UV light is turned off before opening the
cabinet.
15. The accessories should be properly heated on the spirit lamp
and hands should also be properly wiped with spirit. Special
care must be taken to avoid the tissue being touched by hot
forceps/scalpels as it reduces the viability of the tissue.
16. When removing the comb, do not disturb the wells since
deformed wells may affect the proper mobility of the DNA.
 Micropropagation of Withania Coagulans and Secondary Metabolite Production 273

17. Filter the extract and collect the filtrate in a separate flask.
Extract again with fresh extraction system (25 % methanol
(v/v, in water).
18. Shake vigorously the separating funnel containing extract and
n-hexane and remove the vapors by inverting the funnel and
opening the tap.
19. Let the sample dot dry after each drop of extract is added. The
drying keeps the pigment dot from spreading out too much.
20. All the solvents to be used for HPLC must be filtered by the
0.45 μm membrane filter to avoid any contamination during
the run.

References
1. Kirtikar KR, Basu BD (1999) Indian medicinal 11. Glotter E (1991) Withanolides and related
plants. International Book Distributors, ergostane-type steroids. Nat Prod Rep
Dehradun 8:415–440
2. Bhandari MM (1995) Flora of the Indian des- 12. Alfonso D, Bernardinelli G, Kapetanidis
ert. MPS Repros, Jodhpur, India I (1993) Withanolides from Iochroma coc-
3. Gupta GL, Rana AC (2007) Withania som- cineum. Phytochemistry 34:517–521
nifera (Ashwagandha): a review. Phcog Rev 13. Kirson I, Glotter E, Lavie D, Abraham A
1:129–136 (1971) Constituents of Withania somnifera
4. Maurya R, Akanksha J (2010) Chemistry and Dun. XII. The withanolides of an Indian che-
pharmacology of Withania coagulans: an motype. J Chem Soc (C) 2032–2044
Ayurvedic remedy. J Pharm Pharmacol 14. Mirjalili MH, Moyano E, Bonfill M, Cusido
62:153–160 RM, Palazon J (2009) Steroidal lactones from
5. Jain R, Kachhwaha S, Kothari SL (2012) Withania somnifera, an ancient plant for novel
Phytochemistry, pharmacology, and biotech- medicine. Molecules 14:2373–2393
nology of Withania somnifera and Withania 15. Mishra S, Sangwan RS, Bansal S, Sangwan NS
coagulans: a review. J Med Plants Res (2012) Efficient genetic transformation of
6:5388–5399 Withania coagulans (Stocks) Dunal mediated
6. Hemalatha S, Wahi AK, Singh PN, Chansouria by Agrobacterium tumefaciens from leaf
JPN (2004) Hypoglycemic activity of explants of in vitro multiple shoot culture.
Withania coagulans Dunal in streptozotocin Protoplasma 250:451–458
induced diabetic rats. J Ethnopharmacol 16. Jain R, Sinha A, Kachhwaha S, Kothari SL
93:261–264 (2009) Micropropagation of Withania coagu-
7. Atta-ur-Rahman A, Dur-e-Shahwar NA, lans (Stocks) Dunal: a critically endangered
Choudhary MI (2003) Withanolides from medicinal herb. J Plant Biochem Biotechnol
Withania coagulans. Phytochemistry 18:249–252
63:387–390 17. Murashige T, Skoog F (1962) A revised
8. Atta-ur-Rahman A, Abbas S, Dur-e-Shawar medium for rapid growth and bioassays with
NA, Jamal AS, Choudhary MI (1993) New tobacco cultures. Physiol Plant 15:473–497
withanolides from Withania spp. J Nat Prod 18. Doyle JJ, Doyle JL (1990) Isolation of plant
56:1000–1006 DNA from fresh tissue. Focus 12:13–15
9. Kapoor LD (2001) Handbook of Ayurvedic 19. Jain R, Sinha A, Jain D, Kachhwaha S, Kothari
medicinal plants. CRC Press, Boca Raton, FL SL (2011) Adventitious shoot regeneration
10. Tursunova RN, Maslennikova VA, Abubakirov and in vitro biosynthesis of steroidal lactones
NK (1977) Withanolides in the vegetable in Withania coagulans (Stocks) Dunal. Plant
kingdom. Chem Nat Comp 13:131–138 Cell Tiss Org Cult 105:135–140
 Chapter 19

In Vitro Propagation of Cannabis sativa L. and Evaluation

of Regenerated Plants for Genetic Fidelity
and Cannabinoids Content for Quality Assurance
Hemant Lata, Suman Chandra, Ikhlas A. Khan, and Mahmoud A. ElSohly

Abstract
Cannabis sativa L. (Marijuana; Cannabaceae), one of the oldest medicinal plants in the world, has been
used throughout history for fiber, food, as well as for its psychoactive properties. The dioecious and alloga-
mous nature of C. sativa is the major constraint to maintain the consistency in chemical profile and overall
efficacy if grown from seed. Therefore, the present optimized in vitro propagation protocol of the selected
elite germplasm via direct organogenesis and quality assurance protocols using genetic and chemical profil-
ing provide an ideal pathway for ensuring the efficacy of micropropagated Cannabis sativa germplasm.
A high frequency shoot organogenesis of C. sativa was obtained from nodal segments in 0.5 μM thidiazuron
medium and 95 % in vitro rhizogenesis is obtained on half-strength MS medium supplemented with
500 mg/L activated charcoal and 2.5 μM indole-3-butyric acid. Inter Simple Sequence Repeats (ISSR)
and Gas Chromatography-Flame Ionization Detection (GC-FID) are successfully used to monitor the
genetic stability in micropropagated plants up to 30 passages in culture and hardened in soil for 8 months.

Key words Cannabis sativa L., Micropropagation, Nodal explants, Genetic fidelity, ISSR markers,
GC-FID

1 Introduction

Cannabis sativa L. is an open pollinated crop belonging to the

family Cannabaceae. It is an important medicinal plant well known
for its pharmacologic and therapeutic potency that contains a
unique class of terpenophenolic compounds (the cannabinoids),
which accumulates mainly in the glandular trichomes of the female
plant [1]. At present, 104 cannabinoids have been identified
from this plant but most of the biological and pharmacological
activities are attributed to the psychoactive compound, Δ9-
tetrahydrocannabinol (THC) [2]. Medicinally, THC possesses
analgesic, anti-inflammatory, appetite stimulant, and antiemetic
properties, making this cannabinoid a very promising drug for
therapeutic purposes [3].

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_19, © Springer Science+Business Media New York 2016

275
276 Hemant Lata et al.

Due to the dioecious (male and female flowers on different

plants) and allogamous (cross fertilization) nature of C. sativa, it is
difficult to maintain the consistency in its chemical profile and can-
nabinoid content if grown from seeds. Since the seeds of C. sativa
are highly heterozygous and are thus of limited interest for the
conservation of particular genotypes, the use of plant tissue culture
techniques offer advantages for multiplication and large-scale pro-
duction of true-to-type Cannabis plants. Several medicinal plants
such as Rauvolfia tetraphylla [4]; Picrorhiza kurroa [5]; Withania
somnifera [6]; Pterocarpus marsupium [7]; Acacia sinuata [8];
Cimicifuga racemosa [9], and Veronica anagallis-aquatica [10]
have been multiplied through various strategies of micropropaga-
tion. In addition to being an alternative means of plant improve-
ment, micropropagation techniques can also potentially overcome
many factors limiting traditional approaches to C. sativa improve-
ment [11]. Research on in vitro regeneration of Cannabis has
resulted in several protocols [12–16]; however, considerable varia-
tion has been reported in the response of cultures and in the mor-
phogenic pathway. Since our goal is to develop a secure and stable
in vitro clonal repository of elite medicinal plants germplasm that
will assure future availability of desirable pharmacological active
chemotypes, the present protocol has been developed covering the
following objectives: (a) propagation of the quality plant material
that will allow large-scale clonal production, and (b) comparison of
micropropagated plants with the mother plant for consistency in
terms of genetic and chemical profiles. This approach of propaga-
tion of C. sativa would provide a rapid and reliable system for the
production of large number of genetically uniform disease-free
plantlets and would be a promising tool for commercial level prop-
agation of high-yielding elite varieties for the pharmaceutical use.

2 Materials

2.1 Equipment 1. Autoclaves.

and Apparatus 2. Laminar flow hoods (see Notes 1 and 2).
3. Water demineralizer.
4. Water distilling unit.
5. Refrigerator.
6. Analytical balance to weigh from 0.1 or 0.01 mg to a few
grams.
7. pH meter.
8. Stirrer with hot plate.
9. Water bath.
10. Vacuum pump.
11. Filter units, 0.22 μm.
 In Vitro Propagation of Cannabis sativa L. and Evaluation… 277

Table 1
Plant growth regulators used

Plant growth regulators Solubility Sterilization Storage

Auxin
Indole-3-butyric acid (IBA) 1 N NaOH Filter sterilize 4 °C
Cytokinin
Thidiazuron (TDZ) 1 N NaOH Filter sterilize 4 °C

2.2 Media 1. Murashige and Skoog (MS) Basal Salts Mixture.

Preparation 2. Phytohormones (see Table 1).
3. pH buffers, 4.0, 7.0, and 10.0.
4. 1 N NaOH.
5. 1 N HCl.
6. Sterile beakers, 250 ml and 1000 ml (see Note 3).
7. Measuring cylinders 100, 250, and 1000 ml.
8. Micropipettes 20–1000 μl.

2.3 Sterilization 1. 0.1 % Tween 20.

and Establishment 2. 0.5 % NaOCl (15 % w/v bleach).
of In Vitro Cultures
3. Sterile distilled water.
4. Stainless steel forceps 8–12″.
5. Razor blade # 10 and scalpel.
6. Sterile petri dishes, 100 × 25 mm.
7. Culture sealant, Parafilm.
8. Culture vessels, baby food jars with Magenta B caps (4 cm
diameter × 9.5 cm high).
9. Thermocol cups.
10. Coco Natural growth medium.
11. Sterile potting mix—Fertilome (Canna Continental).
12. Plastic pots 2″, 5″, 10″.
13. Incubator/tissue culture room with light and temperature
control.

2.4 Quality 1. Eppendorf tubes 2 ml.

Assurance 2. Mixer Mill MM 2000.
of Micropropagated
3. DNeasy plant mini kit.
Plants: Assessing
Genetic Fidelity 4. NanoDrop 1000 spectrophotometer.
5. Liquid nitrogen.
2.4.1 Isolation of Plant
Genomic DNA
278 Hemant Lata et al.

Table 2
Nucleotides sequences of primers used for ISSR analysis

Primer Sequence
UBC 807 5′-AGAGAGAGAGAGAGAGT-3′
UBC 808 5′-AGAGAGAGAGAGAGAGC-3′
UBC 811 5′-GAGAGAGAGAGAGAGAC-3′
UBC 812 5′-GAGAGAGAGAGAGAGAC-3′
UBC 817 5′-CACACACACACACACAA-3′
UBC 826 5′-ACACACACACACACACC-3′
UBC 834 5′-AGAGAGAGAGAGAGAGYT-3′
(GGC)6W 5′-GGCGGCGGCGGCGGCGGCW-3′
(AAG)6Y 5′-AAGAAGAAGAAGAAGAAGY-3′
(GGAT)4H 5′-GGATGGATGGATGGATH-3′
(GGGGT)3M 5′-GGGGTGGGGTGGGGTM-3′
UBC 836 5′-AGAGAGAGAGAGAGAGYA-3′
UBC 842 5′-GAGAGAGAGAGAGAGAYG-3′
UBC 845 5′-CTCTCTCTCTCTCTCTRG-3′

6. 5 mg/ml ethidium bromide (EB) stock in water.

7. Agarose.
8. 6× loading dye.

2.4.2 PCR Amplification 1. Template DNA.

2. Taq DNA polymerase.
3. Deoxyribonucleoside triphosphates (dNTPs) mix (dATP;
dTTP and dGTP; dCTP).
4. 10× polymerase buffer.
5. 1.5 mm MgCl2.
6. Primers (see Table 2).
7. Polymerase chain reaction (PCR) tubes.
8. Milli-Q water.
9. Ice.
10. DNA ladder 1 Kb plus.
11. 2 % TAE agarose gel.
12. Bio-Rad gel imaging system.
 In Vitro Propagation of Cannabis sativa L. and Evaluation… 279

2.4.3 Assessment 1. Chloroform.

of the Cannabinoids Profile
2. Methanol.
and Content
3. 4-androstene-3,17-dione.
4. Erlenmeyer flask 25 ml.
5. Metal sieve No. 14 (opening 0.0555 in.).
6. Screw cap vial, 3.7 ml.
7. GC vials 2 ml.
8. Pipettes 5–10 ml.
9. Micropipettes.

2.4.4 Gas Chromato- 1. Column: DB-1, 15 m × 0.25 mm, with 0.25 μm film thickness.
graphic Analysis 2. Helium gas as carrier gas.
3. Varian CP-3380 Gas chromatograph equipped with a Varian
CP-8400 automatic liquid sampler.

3 Methods

Different steps involved in the micropropagation of Cannabis

sativa through direct organogenesis are shown in Figs. 1 and 2.

3.1 Media 1. Prepare the Murashige and Skoog’s medium [17] as per the
Preparation directions on the bottle.
2. Add 3 % (w/v) sucrose. Make the final volume of culture
medium as required. Set the pH 5.7.
3. Add 0.8 % (w/v) type E agar.
4. Autoclave the media at 121 °C at 105 kPa for 30–45 min
(see Notes 4, 5 and 6).
5. Cool the medium and swirl the solution as it cools.
6. Add Murashige and Skoog vitamins.
7. For shoot multiplication semisolid medium (SM), add Thidia-
zuron (TDZ) at a concentration ranging from 0.05 to 9.0 μM.
8. For root induction, semisolid medium (RI), add the auxin
indole-3-butyric acid (IBA) at 2.5–5.0 μM concentration sup-
plemented with 500 mg/L activated charcoal.
9. Dispense the sterile medium (25 ml) in glass culture vessel (4 cm
diameter × 9.5 cm height baby food jars with magenta B caps).

3.2 Explant 1. Prepare the explants by cutting 1.0–1.5 cm long nodal seg-
Preparation ments containing at least one axillary bud with the help of a
sharp blade.
2. Thoroughly wash the explants in continuous flow of tap water
for 1 h, followed by soaking in solution of 0.1 % Tween 20,
then rinsing in tap water for 10 min.
280 Hemant Lata et al.

Nodal segment from a mother plant

Induction of shoots MS + 0.5 µM TDZ

Elongation of shoots MS + 0.5 µM TDZ + 7.0 µM

GA3

In vitro rooting MS/2 + 500 mgL-1AC +2.5

µM IBA

Primary hardening

Coco natural growth medium

in thermocol cups

Secondary hardening

Potting mix – Fertilome,

in large pots with 95% survival

Field planting

Fig. 1 Schematic diagram of in vitro propagation of Cannabis sativa

3.3 Surface 1. Sterilize the explants surface using 0.5 % NaOCl (15 % v/v
Sterilization bleach) and 0.1 % Tween 20 for 20 min under a laminar hood.
and Establishment 2. Wash the explants in sterile distilled water by rinsing 3 times
of In Vitro Cultures for 5 min each.
3. Soak the explants in 0.1 % mercuric chloride for 2 min, fol-
lowed by distilled water (see Subheading 4) (see Note 7).
4. Slice off the exposed end slightly using a sterilized blade prior
to inoculation on the culture medium (see Note 8).
5. Inoculate single nodal explants in the culture vessel containing
the SM media and incubate in the culture room at 25 ± 2 °C
with 16-h photoperiod under fluorescent light with a photon
flux of 52 μmol/m2/s and 60 % relative humidity.
 In Vitro Propagation of Cannabis sativa L. and Evaluation… 281

Fig. 2 Micropropagation of Cannabis sativa. (a) Shoot formation on MS + 0.5 μM TDZ (b) Rooting on ½ MS
medium supplemented with 500 mg/L activated charcoal and 2.5 μM IBA (c, d) Well-rooted plantlet (e) A well-
rooted plant at soil acclimatization stage (f) Fully acclimatized Cannabis sativa plants

6. Observe the cultures weekly. Note any morphological changes

and growth responses in the cultured tissue. Record the fol-
lowing data:
(a) The time of emergence of shoots from axillary buds.
(b) The frequency of axillary branches per responding culture.
(c) The number of shoots per culture.
7. After in vitro establishment, these cultures can be multiplied
by inoculating 2–3 nodal segments per vessel. The culture may
be used as a source of inocula for further multiplication.
282 Hemant Lata et al.

3.4 Root Induction 1. Transfer isolated or two shoots to semisolid root induction
medium.
2. Observe the cultures weekly for root initiation. Record the fol-
lowing data:
(a) The time of root emergence.
(b) Frequency of shoot developing from roots derived from
each explants.
(c) The number of roots per shoot.
3. Carefully remove the in vitro-developed plantlets (Fig. 2) after
6 weeks and clean the roots very gently removing agar using
tap water (see Note 9).

3.5 Acclimatization 1. Wash the rooted plantlets thoroughly in running water to

remove all traces of medium.
2. Preincubate the plantlets in Coco Natural growth medium in
Thermocol cups.
3. Cover the cups with polyethylene bags to maintain humidity
and keep in the indoor growth room for at least 1 week (Fig. 2).
4. Transfer the in vitro-hardened plantlets in large pots contain-
ing sterile potting mix Fertilome. Keep the plantlets under
similar environmental conditions maintaining 16-h photope-
riod, 25–30 °C temperature, and 60 % relative humidity.
5. After 30–40 days as new leaves start appearing and the plants
appear robust, transfer the plants to the field conditions (see
Note 10).

3.6 Quality Total genomic DNA is extracted using a DNeasy Plant Mini Kit.
Assurance Protocol for DNA Extraction using DNeasy Plant Mini Kit
of Micropropagated
1. Finely powder the plant sample.
Plants: Assessing
Genetic Fidelity 2. Weigh 20 mg (0.02 g) in a preweighed 2 ml sterile tube.
Immediately put the tube on ice (crushed). Powder sample in
3.6.1 Isolation of Plant a mixer mill (30 s., amplitude max = 100).
Genomic DNA
3. Add 600 μl API buffer into powder sample tube. Vortex upside
and down (both sides) 15 s. Add 4 μl RNase A and vortex for
20–30 s.
4. Incubate the mixture for 10 min at 65 °C. Mix 2 or 3 times
during incubation by inverting tubes.
5. Add 195 μl AP2 Buffer to the lysate and vortex for 20–30 s.
Incubate on ice for 5 min.
6. Centrifuge the lysate for 5 min at 18,000 × g.
7. Pipette the lysate into QIA shredder mini spin column (pur-
ple/lilac) placed in a 2 ml collection tube. Centrifuge for 2 min
at 14,000 rpm.
 In Vitro Propagation of Cannabis sativa L. and Evaluation… 283

8. Transfer the flow-through from the previous step into a new

2 ml tube without disturbing the cell debris pellet. (At this point
check the amount of lysate obtained after centrifugation).
9. For 500 μl lysate obtained, add 750 μl AP3 Buffer. Mix by
pipetting.
10. Use the white DNeasy Mini Spin column for this step. Pipette
650 μl of the mixture (may include any precipitate), into the
DNeasy Mini Spin column placed in a 2 ml collection tube.
Centrifuge for 1 min at 800 rpm. Discard the flow-through.
Reuse the collection tube for the next step.
11. Repeat the previous step with the remaining sample. Discard
the flow-through and collection tube.
12. Place the DNeasy Mini Spin column into a new 2 ml collection
tube.
13. Add 500 μl AW Buffer. Centrifuge for 1 min at 800 rpm.
Discard the flow-through and reuse the collection tube for the
next step.
14. Add 500 μl AW Buffer to DNeasy Mini Spin columns.
Centrifuge for 2 min at 14,000 rpm (to dry the membrane).
Discard the flow-through and reuse the collection tube.
15. Add 500 μl AW Buffer to DNeasy Mini Spin columns.
Centrifuge for 2 min at 14,000 rpm (to dry the membrane).
Discard the flow-through and reuse the collection tube.
16. Transfer the DNeasy Mini Spin column to a 1.5 ml microcen-
trifuge tube (let the tube be open). Pipette 50 μl AE Buffer
onto the DNeasy membrane. Incubate for 5 min at room tem-
perature (15–25 °C), centrifuge for 1 min at 8000 rpm to
elute.
17. Again pipette 50 μl AE Buffer to the membrane. Incubate for
5 min at room temperature. Centrifuge for 1 min at 8000 rpm
to elute.
18. DNA is obtained (about 100 μl) in an eppendorf tube. Store
on ice and switch to −80 °C.

3.6.2 Quantification 1. The DNA can be quantified by running on 1 % agarose gel and
of DNA checking the absorbance at 260 nm (see Note 11).
2. Agarose gel: Mix 2 ml 50× TAE Buffer to a final volume of
100 ml. Add 1 g agarose, boil in a microwave, and cool to
50–60 °C. Carefully add EB. Seal the free ends of gel tray, fix
the combs, and dispense the molten gel. Allow it to solidify.
Remove the comb and put the gel tray in the gel reservoir con-
taining 1× TAE Buffer. Make sure the gel is fully submerged
(see Note 12).
284 Hemant Lata et al.

3. Mix the DNA sample, loading 6× dye, and Milli-Q water

(1 + 2 + 9 μl) by repeated pipetting. Load in the wells of gel
carefully.
4. Close the lid of the gel reservoir and turn on the power supply.
The gel runs from the negative pole (black) towards positive
pole (red). Check after few minutes if the gel is running. Check
the gel regularly to prevent the samples from running off the gel
(see Note 13).
5. For PCR, 20 ng amount of DNA is sufficient per reaction and
therefore dilution of DNA should be made with sterile Milli-Q
water in such a way that 1 μl contains approximately 20–25 ng
of DNA (see Notes 14 and 15).

3.6.3 PCR for DNA 1. Amplification reaction is performed using MJ Research PTC-
Amplification 225 gradient cycler.
2. PCR is carried out in a total volume of 25 μl for each reaction
in 0.2 ml PCR tube.
3. Set up the PCR reaction mixture using 14 primers (see Table 2),
based on the criterion of the generation of distinct bands that
are reproducible between samples. Each PCR reaction con-
tains 0.1 μM of each primer, 1 unit Platinum Taq DNA poly-
merase, 200 μM of each dNTP, 1.5 mM MgCl2, 20 ng template
DNA, and PCR buffer (see Note 16).
4. Taq polymerase should be added at the end.
5. All this should be carried out in ice.
6. Transfer this reaction mixture in PCR tube and spin it for few
seconds for uniform mixing.
7. Carry out the PCR in thermal cycler using the following
conditions:
(a) Initial denaturation at 94 °C for 3 min.
(b) Followed by 45 cycles each consisting of a denaturation
step at 94 °C for 30 s, primer annealing step at 50 °C for
30 s, and amplification at 72 °C for 3 min.
(c) Final extension at 72 °C for 7 min followed by arresting
the reaction at 4 °C for infinite period.
8. Load the amplified DNA on 2 % agarose gel in 1× TAE Buffer
stained with 0.5 μg/ml EB. Scan the gel with Bio-Rad Gel
Imaging System and analyze with Quantity One Analysis
Software Version 4.3.0 (see Notes 17 and 18).
9. Run the amplified products on the gel with molecular size
standard 1 kb plus DNA ladder.
10. Score only the well separated bands in size range of 0.1–3.0 kb
as present or absent for ISSR markers.
 In Vitro Propagation of Cannabis sativa L. and Evaluation… 285

3.7 Quality 1. Take the biomass samples from apical segments (flowering
Assurance buds) of the mother plant, in vitro-propagated and vegeta-
of Micropropagated tively propagated plants in triplicates.
Plants: Cannabinoids 2. Dry the samples at 120 °F in oven overnight and individually
profile and Content manicure by hand.
3.7.1 Harvesting

3.7.2 Extraction 1. Manicure all the samples in a 14 mesh (0.0555 in. opening)
metal sieve to remove seeds and stems.
2. Extract the powdered/sieved material (triplicated samples
0.1 g sample each) with 3 ml of internal standard/extracting
solution (100 mg of 4-androstene-3, 17-dione + 10 ml chloro-
form + 90 ml ethanol) at room temperature for 1 h.
3. Withdraw the extracts into disposable transfer pipettes through
cotton plugs for filtration and transfer into GC vials, cap the
vials, and place on auto sampler. This extract can be used for
quantitative analysis of the cannabinoids through GC/FID.

3.7.3 Gas 1. Quantitative estimation of cannabinoids is carried out by gas

Chromatography-Flame chromatography analyses following Ross et al. [18] using Varian
Ionization Detection CP-3380 gas chromatograph, equipped with Varian CP-8400
(GC-FID) automatic liquid sampler, a capillary injector, and a dual flame
ionization detector (see Note 19).
2. The column used is 15 mm × 0.25 mm DB-1, 0.25 μ film
3. Data is recorded using a Dell OptiPlex GX1 computer and
Varian Star workstation software (version 6).
4. Helium is used as a carrier gas and detector makeup gas, with
an upstream indicating moisture trap and a downstream indi-
cating oxygen trap.
5. The following parameters are used:
(a) Air—30 psi (400 μl/min).
(b) Hydrogen—30 psi (30 ml/min).
(c) Column head pressure—14 psi (1.0 ml/min).
(d) Split flow rate—50 ml/min.
(e) Split ratio—50:1.
(f) Septum purge flow rate—5 ml/min.
(g) Makeup gas pressure—20 psi (20 ml/min).
(h) Injector temperature—240 °C.
(i) Detector temperature—260 °C.
(j) Initial oven temperature—170 °C.
(k) Initial temperature hold time—1 min.
(l) Temperature rate—10 °C/min.
286 Hemant Lata et al.

(m) Final oven temperature—250 °C and final temperature

hold time—3 min.
6. The concentration of a specific cannabinoid is calculated as
follows:
Cannabinoid ( % ) = {GC area ( cannabinoid ) / GC area ( ISTD )}
´ {Volume ( ISTD ) / Amount ( sample )} ´ 100

4 Notes

1. It is very important to work on a surface that is free of dust and

other potential contaminants.
2. Regularly check the air flow gauge of laminar air flow chamber.
Switch on the UV light for 30 min. Before starting any activity
in the laminar air flow bench, wipe the surface of the laminar
air bench with alcohol frequently during any aseptic operation.
Fumigate the entire transfer room.
3. Before using, soak all the glassware overnight in Clorox solu-
tion and powdered detergent. Thoroughly wash with tap water
to remove the last trace of detergent. Finally, rinse glassware
with double distilled demineralized water and dry in hot air
oven at 150 °C for 2 h.
4. While autoclaving, allow sufficient air volume in the flask to
prevent the media from boiling over.
5. Make sure that the volume of the autoclaved medium plus the
volume of the added filter-sterilized compound sum to the
final volume of the prepared medium.
6. The standard conditions for autoclaving media are 121 °C at
105 kPa for 20 min. For larger volumes the time should be
increased: for 500 ml, 30 min; for 1000 ml, 40 min. Prior test-
ing of the 40-min autoclaving is recommended, unless sugars
are autoclaved separately.
7. Avoid contact of body parts with HgCl2, β-mercaptoethanol,
and EB as all these chemicals are highly mutagenic, carcino-
genic, and hazardous. As a precaution, wear gloves while han-
dling and dispose of the chemicals properly!
8. Possible source of danger exists if a person, after flaming an
instrument reinserts the hot instrument into the alcohol dip.
Caution: Ethanol is flammable! One should be very careful.
9. In vitro roots are delicate, so do not let them break.
10. Disposal of the cannabis plant material should be done strictly
following DEA regulations.
11. Alternatively, DNA yield may also be checked
spectrophotometrically.
 In Vitro Propagation of Cannabis sativa L. and Evaluation… 287

12. While preparing the agarose gel, take care that the final volume
should never be reduced due to evaporation during boiling.
Take care: do not entrap any air bubble.
13. Clean the gel tray, gel reservoir, combs, and other materials
with ethanol properly before and after use.
14. While loading the sample, do not let the sample spill out.
Wear gloves during the entire operation and prevent
contamination.
15. Pay attention to the quality of DNA-band when there are
many fragments.
16. To minimize the error and for convenience mix all the dNTPs
in equal amounts and make a stock in advance, and then take
1 μl for each PCR reaction.
17. If the DNA does not dissolve at room temperature or at 37 °C,
incubate at 65 °C for 1 h.
18. Insufficient denaturing of the target genomic DNA in the
initial cycle is a common cause of PCR reaction failure. The
incubation time for primer extension at 72 °C varies according
to the length of the target DNA sequence to be amplified. For
most purposes, 2 min is usually sufficient.
19. The method used for the analysis should be precise, accurate,
robust, and validated. The general steps of chromatography
should be followed. Carefully record all the observations of the
experiment.

Acknowledgements

This work was supported in part through the National Institute

on Drug Abuse (NIDA), National Institute of Health (NIH),
Department of Health and Human Services, USA, contract no.
N01DA-10-7773.

References

1. Hammond CT, Mahlberg PG (1977) its potential in biotechnology. Curr Pharm

Morphogenesis of capitate glandular hairs of Biotechnol 8:237–243
Cannabis sativa (Cannabaceae). Am J Bot 4. Faisal M, Anis M (2002) Rapid in vitro propa-
64:1023–1031 gation of Rauvolfia tetraphylla L.—an endan-
2. ElSohly MA, Gul W (2014) Constituents gered medicinal plant. Physiol Mol Biol Plants
of Cannabis sativa. In: Pertwee RG (ed) 8(2):295–299
Handbook of Cannabis. Oxford University 5. Patial V, Devi K, Sharma M, Bhattacharya A,
Press, Oxford, pp 3–22 Ahuja PS (2012) Propagation of Picrorhiza
3. Sirikantaramas S, Taura F, Morimoto S, kurroa Royle ex Benth: an important medicinal
Shoyama Y (2007) Recent advances in Can- plant of Western Himalaya. J Med Plant Res
nabis sativa research: biosynthetic studies and 6(34):4848–4860
288 Hemant Lata et al.

6. Sivanesan I (2007) Direct regeneration from vitro biotransformation of phenolics. Z Pflan-

apical bud explants of Withania somnifera zenphsiol: 395–400
Dunal. Indian J Biotechnol 6:125–127 13. Richez-Dumanois C, Braut-Boucher F, Cosson
7. Husain MK, Anis M, Shahzad A (2007) In L, Paris M (1986) Multiplication vegetative
vitro propagation of Indian kino (Pterocarpus in vitro du chanvre (Cannabis sativa L.). Appli-
marsupium Roxb.) using Thidiazuron. In cation a la conservation des clones selectionnes.
Vitro Cell Dev Biol Plant 43:59–64 Agronomie 6:487–495
8. Shahzad A, Ahmad N, Anis M (2006) An 14. Mandolino G, Ranalli P (1999) Advances in
improved method of organogenesis from coty- biotechnological approaches for hemp breed-
ledonary callus of Acacia sinuate (Lour.) Merr. ing and industry. In: Ranalli P (ed) Advances in
using Thidiazuron. J Plant Biotechnol 8: hemp research. Haworth Press, New York,
15–19 pp 185–208
9. Lata H, Bedir E, Hosick A, Ganzera M, Khan 15. Slusarkiewicz-Jarzina A, Ponitka A, Kaczmarek
IA, Moraes RM (2002) In vitro plant regene- Z (2005) Influence of cultivar, explant source
ration from leaf-derived callus in Black cohosh and plant growth regulator on callus induction
(Cimicifuga racemosa). Planta Med 68: and plant regeneration of Cannabis sativa
912–915 L. Acta Biol Cracov Bot 47(2):145–151
10. Shahzad A, Parveen S, Fatema M (2010) 16. Bing X, Ning L, Jinfeng T, Nan G (2007)
Development of a regeneration system via Rapid tissue culture method of Cannabis sativa
nodal segment culture in Veronica anagallis- for industrial uses. CN 1887043 A 20070103
aquatica L.—an amphibious medicinal plant. Patent. pp 9
J Plant Interact 5:115–121 17. Murashige T, Skoog F (1962) A revised medium
11. Lata H, Chandra S, Khan IA, ElSohly MA for rapid growth and bioassays with tobacco tis-
(2009) Thidiazuron induced high frequency sue cultures. Physiol Plant 15:473–497
direct shoot organogenesis of Cannabis sativa 18. Ross SA, Parker M, Arafat R, Lovett K, ElSohly
L. In Vitro Cell Dev Biol Plant 45:12–19 MA (1996) The analysis of confiscated mari-
12. Loh WHT, Hartsel SC, Robertson W (1983) juana samples for different cannabinoids using
Tissue culture of Cannabis sativa L. and in GC/FID. Am Lab:16–17
 Chapter 20

Transcript Quantification of Genes Involved in Steviol

Glycoside Biosynthesis in Stevia rebaudiana Bertoni by
Real-Time Polymerase Chain Reaction (RT-PCR)
Arpan Modi, Nitish Kumar, and Subhash Narayanan

Abstract
Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as
steviol glycosides which are 200–300 times sweeter than sucrose (0.4 % solution). They are synthesized
mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway).
Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the
quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA prepa-
ration, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been
illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative
gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0
(Control), T1, T2, T3, and T4.

Key words Real-time PCR, Transcript quantification, Secondary metabolism, Stevia, Stevioside,
Steviol glycosides

1 Introduction

Steviol glycosides (SG) are found predominantly in Stevia rebaudi-

ana, Stevia phlebophylla, and Rubus suavissimus (a Chinese sweet
tea) [1]. They are low caloric sweeteners. Major steviol glycosides
are stevioside, rebaudioside, steviolmonoside, steviolbioside, and
duclosides. These steviol glycosides along with other secondary
metabolites like alkaloids, phenols, and flavonoids in S. rebaudiana
make such plants suitable for medicinal use and food additives [2].
Steviol glycosides share a common pathway with gibberellic
acid (GA3) as they are terpenoids and both are derived from
2-C-methyl-D-erythrose-4-phosphate (MEP) pathway operated
within plastids and as a result these glycosides are synthesized
abundantly in the leaves and in very minute quantities are found in
other organs of the plant [3]. The concentrations of steviol glyco-
sides are 10,000 times higher than gibberellic acid which shows the

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_20, © Springer Science+Business Media New York 2016

289
290 Arpan Modi et al.

dedication of this plant towards SGs in view of MEP pathway.

Major steviol glycosides are steviolmonoside, steviolbioside, stevio-
side, and rebaudioside-A among which stevioside is most abundant
and has 143 times higher sweetening power than normal sugar
whereas rebaudioside-A is up to 320 times sweeter but lower in
concentration as compared to stevioside [1, 4]. All terpenoids are
derived from the five-carbon precursor isopentenyl diphosphate
(IPP) and its isomer dimethylallyl diphosphate (DMAPP).
According to carbon numbers 5, 10, 15, 20, 30, and 40 they are
called hemiterpenes, monoterpenes, sesquiterpenes, diterpenes, tri-
terpenes, and tetraterpenes, respectively. The most abundant plant
pigment after chlorophyll is carotenoid which is a tetraterpene.
In 1950s, mevalonic acid pathway for the production of iso-
prenoids in yeast and animals was reported but few years later, MVA
independent pathway, called MEP pathway was detected in bacteria
and plants. Efforts were made to upregulate the genes of MEP path-
way in plants so that respective metabolites can be enhanced [5, 6].
Biosynthesis of steviol glycoside pathway (MEP pathway) highlights
many secondary metabolites some of which are commercially and
biologically important to the plants. Moreover, microbes can be uti-
lized in the enhancement and production of natural compounds.
Strategies to achieve this goal include increasing the precursor sup-
ply, overexpressing or increasing the efficiency of respective enzymes,
altering the regulation of gene expression, reducing flux towards
unwanted by-products or competing pathways, and reconstituting
the entire pathway in a heterologous host [7]. In view of cloning
and characterization of the genes involved in MEP pathway, cloning
of full length cDNA of seven genes of the pathway has been reported
[8]. The present scenario implies that the elucidation of secondary
metabolite pathway is carried out by evaluating upregulation and
downregulation by measuring transcript levels of genes involved,
quantitatively [9] and one of the techniques, through which such
quantification may be possible in a precise, reproducible, and reli-
able manner, is an application of real-time PCR.
Therefore, in the present protocol, we describe the method for
the relative transcript quantification of candidate genes involved in
stevioside biosynthesis pathway. In the present protocol, detailed
information about plant treatments is not given and the treatments
are mentioned only as T1, T2, T3, and T4.

2 Materials

2.1 Plant Growth 1. Tissue culture-raised uniform plants (Fig. 1) are cultivated in a
1:1 mixture of soil–vermicompost [10] (see Note 1).
2. Control as well as treated plants should be uniform and sam-
pling should be done from the same stage from the same axial
positioned leaf of control and treated plants [8] (see Note 2).
 Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis… 291

Fig. 1 Tissue culture-raised uniform plantlets of Stevia after secondary

hardening

2.2 In Silico Three endogenous controls are selected for the relative gene
Procedures expression study, viz., actin, ubiquitin, and glyceraldehyde-3-
phosphate dehydrogenase. Primer blast tool is used to design primers
2.2.1 Primer Design
for three endogenous control as well as other target genes. Gene
for Endogenous Control
sequence for the primer design of actin (act) has been reported
Selection
and has been obtained from NCBI website. For the ubiquitin
(ubq) and glyceraldehyde-3-phosphate dehydrogenase (gapdh), gene
sequence from model organism is taken.

2.2.2 Primer Design The list of all the 15 candidate genes with their accession numbers
for Candidate Genes is mentioned in Table 1. Gene sequence and ESTs of the candidate
genes are reported in the public domain of NCBI. Reported
sequences of ESTs in Stevia are taken for the primer design.

2.2.3 Primer Design Intronic region of reported actin sequence in Stevia is taken to
for Confirmation of DNA design primers for checking DNA contamination in extracted sam-
ple of total RNA.

2.3 RNA Extraction The following chemicals and consumables are required for RNA
extraction:
1. DEPC-treated water (see Note 3).
2. Extraction buffer (see Note 4).
3. Chloroform.
4. Isopropanol.
5. Ethanol.
6. Chloroform-treated, autoclaved vials (1.5 and 2.0 ml) and tips
(10, 100 and 1000 μl) (see Note 5).

2.4 cDNA From the total RNA, first strand cDNA synthesis is carried out
Preparation from the Fermentas First Strand cDNA synthesis kit according to
292 Arpan Modi et al.

Table 1
Details of the genes of the steviol biosynthetic pathway, their accession numbers and percentage
identity/similarity with others

Accession Percentage identity/similarity

Gene number Reported as with other accession numbers References
DXS AJ429232 Characterized 74/86 to Q38854 [13]
DXR AJ429233 Characterized 79/89 to AAF73140 [13]
CMS DQ269452 Putative 82/91 to NP_565286.1 –
CMK DQ269453 Putative 70/80 to NP_180261.1 –
MCS DQ631427 Putative 77/87 to NP_850971 –
HDS DQ768749 Putative 82/92 to AAM19840 –
HDR DQ269451 Putative 79/89 to AAN87171 –
GGDPS DQ432013 Putative 63/80 to P34802 –
CDPS AF034545 Characterized 53/69 to NP_192187 [1]
KS AF097310 Characterized 52/69 to AAC39443 [1]
KO AY364317 Characterized 60/79 to NP_197962 [14]
KAH – Characterized 52/72 to NP_188087.1 Unpublished
UGT85C2 AY345978 Characterized 47/67 to NP_173652.1 [15]
UGT74G1 AY345982 Characterized 44/63 to NP_973682.1 [15]
UGT76G1 AY345974 Characterized 45/62 to NP_196207.1 [15]

manufacturer’s instruction. Kit components and other materials

are as follows:
1. Template RNA.
2. DEPC-treated water.
3. Reverse transcriptase.
4. dNTPs.
5. Buffer.
6. MgCl2.
7. Oligo d(T)18 primers.
8. RiboLock RNase inhibitor.

2.5 Real-Time PCR Real-time PCR is performed using SYBR Green chemistry and
relative gene expression is studied. The following chemicals are
used while performing real-time PCR run.
1. Fast SYBR Green Master Mix.
2. cDNA template.
3. Gene specific primers.
 Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis… 293

4. Nuclease-free water.
5. Fast plate.
6. Plate seal.

2.6 DNA Extraction Following chemicals and consumables are required for RNA
extraction.
1. Autoclaved water.
2. Extraction buffer (see Note 6).
3. Chloroform.
4. Isoamyl alcohol.
5. Absolute alcohol.
6. 3 M sodium acetate.
7. 0.3× TE Buffer.
8. Autoclaved tips (10, 100, and 1000 μl) and vials (1.5 and
2.0 ml).

3 Method

3.1 Primer Design For the sequences that are not reported (ubq and gapdh), sequence
of the respective gene from model organism is taken in primer blast
tool of NCBI. BLAST is done against reported ESTs of Stevia. The
parameters for the BLAST are mentioned (see Note 7).
For the act and other candidate genes, primers are designed
directly from the primer blast tool with the parameters mentioned
(see Note 8).
Primers are supplied to make the stock solution 100 pmol with
0.3× TE buffer and for the PCR master mix preparation it is fur-
ther diluted to 10 pmol and used (1.0 μl each for DNA confirma-
tion and 0.2 μl each for real-time experiments in 25.0 μl and 20 μl
systems, respectively).

3.2 RNA Extraction Total RNA extraction from various medicinal plants has been
reported [11], and here, RNA isolation is carried out using the
same protocol with minor modifications as described below:
1. Take 200 mg leaf tissue and grind it with mortar and pestle in
liquid nitrogen (see Note 9).
2. Under chilled conditions, add 3.0 ml extraction buffer and
grind further till the liquid state appears.
3. Allow the homogenate to stand for 10 min (see Note 10).
4. Add 400 μl chloroform, mix gently, and allow it to stand for
10 min.
5. Centrifuge the sample at 17,949 × g for 10 min at 4 °C.
294 Arpan Modi et al.

6. Take the upper aqueous phase and add 0.6th volume of iso-
propanol to it.
7. Keep the sample at 4 °C for 10 min.
8. Centrifuge the sample at 17,949 × g for 10 min at 4 °C.
9. Discard the supernatant and wash the pellet with 500 μl of
70 % ethanol.
10. Centrifuge the sample at 6,797 × g for 2 min at 4 °C.
11. Discard the supernatant, air-dry the pellet, and resuspend it in
30–50 μl DEPC-treated water (see Note 11).

3.3 cDNA 1. Take 0.1–5 μg total RNA and 1.0 μl primer (Oligo d(T)18) in
Preparation a sterile tube.
2. Make the volume of the reaction up to 11.0 μl with nuclease-
free water.
3. Incubate the mixture at 65 °C for 5 min and chill on ice
(see Note 12).
4. Add 4.0 μl 5× reaction buffer, 2.0 μl 10 mM dNTP mix, and
1.0 μl RNase inhibitor in it.
5. Incubate at 37 °C for 5 min.
6. Add 40 units of M-MuLV reverse transcriptase and incubate
the reaction mixture at 37 °C for 60 min.
7. Terminate the reaction by incubating it at 70 °C for 5 min.
8. Chill on ice.
9. Dilute the sample to 100 μl with nuclease-free water
(see Note 13).

3.4 DNA Extraction DNA is extracted according to the method widely used [12] with
and Primer Validation minor modifications as described below:
1. Take 200 mg leaf sample and crush it in liquid nitrogen using
mortar and pestle.
2. Take the sample powder in 2.0 ml autoclaved vial and add 1 ml
of pre-warmed extraction buffer in the sample.
3. Keep the sample at 65 °C for 60–90 min with occasional
mixing.
4. Centrifuge the sample at 2,655 × g for 5 min at 4 °C and take
the aqueous phase.
5. Add equal volume of chloroform–isoamyl alcohol (24:1) to
the sample (800 μl approx.).
6. Centrifuge the sample at 10,000 rpm for 8 min at 4 °C and
take 600 μl of aqueous phase from it.
7. Transfer the aqueous phase in 2.0 ml autoclaved vial and add
equal volume of chloroform–isoamyl alcohol (24:1) to it.
 Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis… 295

8. Centrifuge the sample at 10,621 × g for 8 min at 4 °C and take

500 μl of the aqueous phase from it.
9. Transfer the aqueous phase in 1.5 ml autoclaved vial and add
1.0 ml absolute alcohol containing 10 % 3 M sodium acetate to it.
10. Keep the sample at −20 °C for 3 h.
11. Centrifuge the sample at 15,294 × g for 15 min at 4 °C.
12. Wash the pellet with 80 % ethanol (at 8000 rpm for 10 min
4 °C).
13. Air-dry the pellet and resuspend it in 100 μl of 0.3× TE
buffer.
14. Quantify the DNA and make the working solution of 20 ng/
μl for PCR.

3.5 Primer Validation 1. Take cDNA of the control sample and run it in real-time PCR
through Melt Curve using all the primers.
2. Select melt curve analysis in the study and add PCR steps
before the melt curve.
3. Adjust cycling condition as mentioned (see Note 14).
4. Analyze the melt curve (Fig. 2).

3.6 Confirmation 1. DNA, extracted from the leaf sample, was taken to put PCR
of Absence of DNA reaction with the primer synthesized from intronic region with
the cycling condition as mentioned (see Note 15).
2. Take all the treated as well as control sample template and per-
form PCR reaction using the primer designed from intronic
region and gene specific primer (actin). Thus, this reaction is a
multiplexing.
3. Cycling conditions are the same as mentioned above (see
Note 15).
4. Run the product on an agarose gel.
5. Analyze the gel image (Fig. 3).

3.7 Relative Gene 1. Put one plate for the selection of endogenous control.
Expression 2. Note down threshold cycle for each and every treatment and
through Real-Time gene.
PCR
3. Calculate standard deviation.
4. Select the gene having the least standard deviation value.
5. Put the qPCR reaction with selected endogenous control and
all the target genes with control and treated samples. Cycling
condition is mentioned (see Note 16).
6. Save data in .txt or .xls format and analyze the file in Data
Assist tool (Fig. 4) (see Note 17). The resulting data will be
seen as fold change in expression of genes of treated plants as
compared to untreated plants (control).
296 Arpan Modi et al.

1.2

1.0
Derivative Reporter (–Rn)

0.8

0.6

0.4

0.2

65.0 70.0 75.0 80.0 85.0 90.0 95.0

Tm:80.37
Temperature (°C)

Fig. 2 Validation of designed primers through melt curve analysis. Peaks having different Tm values represent
different gene products involved in steviol glycoside biosynthetic pathway

4 Notes

1. Uniformity of the plants is very critical condition in gene

expression analyses. Plants, like Stevia, are greatly influenced
by external environmental conditions. Care should be taken in
maintenance of the plants until any treatment is given to them.
2. Axial position of leaf on the plant also matters in terms of sec-
ondary metabolite synthesis. In Stevia, the stevioside content
 Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis… 297

Fig. 3 Validation of DNA amplifying marker by normal PCR in (a) in which 250 bp product represents the pres-
ence of DNA and the same is not found in different experiments (b). Here, 100 bp band is a product of actin
gene which represents success of PCR

Fig. 4 Relative quantification (RQ) plot of all the genes in all the treatments of one of the experiments con-
ducted. Here, T0 represents control (untreated) plants and T1–T4 represent treatments
298 Arpan Modi et al.

varies significantly from leaf to leaf. Thus, while sampling, they

should be taken from the same axial position from all the
treatments.
3. Diethylpyrocarbonate (DEPC) is a potent inhibitor of RNase.
In RNA extraction and cDNA preparation experiments, water
should be treated with DEPC, for which, 0.5 ml of commer-
cially available DEPC is taken and added in 500 ml distilled
water. It is kept at 37 °C for 2 h and then the water is auto-
claved. Keep the bottle cap slightly open so that evaporated
carbon dioxide and ethanol from DEPC on heating can be
released. No sweet smell of ethanol should be there after
autoclaving.
4. Extraction buffer is composed of 200 μl 0.5 M EDTA, 8.7 ml
10 mM Tris saturated phenol, 1.0 ml 3 M sodium acetate, and
100 μl 10 % sodium dodecyl sulfate in 10 ml buffer solution.
5. Chloroform is a potent denaturing agent of all the proteins
and enzymes. To make the tubes and tips DNase, RNase, and
protease free, they are washed gently with chloroform and
dried completely in oven. No residue of chloroform should
remain in tubes and tips, otherwise it may also hinder the
downstream processes. Completely dried consumables are
then autoclaved and may be used.
6. Extraction buffer (10 ml) for DNA isolation is composed of
300 mg cetyl trimethyl ammonium bromide (CTAB), 100 mg
polyvinylpyrrolidone (PVP), 3 ml 5 M NaCl, 0.8 ml 0.5 M
EDTA, 1.0 ml 1 M Tris, 0.1 ml of β-mercaptoethanol and the
final volume is adjusted to 10.0 ml with autoclaved water.
7. Sequences of some endogenous control are not reported, and
thus, sequences from the reported model organisms are que-
ried with the available ESTs of our organism of interest.
Sequence information of ubq and gapdh is obtained from
Arabidopsis and BLAST is performed with default parameters
except database and organism input. Database is set with EST
from other organisms and organism is set as S. rebaudiana. To
this query, megablast is performed.
8. Those genes whose sequence information is available are used
to design primers directly from primer blast tool. Accession
number or gene sequence is put on query sequence information
and melting temperature is set at 60 °C with ±1 °C variation.
Product range is set from 70 to 130 bp and other parameters
remain the same as mentioned in default page. Select the primer
which has the least 3′ self complement ability.
9. Mortar and pestle are also treated with chloroform and auto-
claved as tips and tubes. In a chilled condition 200 mg leaf
sample is crushed in liquid nitrogen and after making fine pow-
der of the sample 2 ml extraction buffer is added in it which
will freeze at a time. Break the frozen buffer and make fine
Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis… 299

powder of the buffer and eventually allow the slurry to attain

liquid state. Add 1 ml DEPC-treated water, collect the sample
with 1 ml tip, and distribute it in two vials.
10. Homogenate is kept in ice for 10 min in horizontal position. In
this position crushed sample will have maximum contact with
extraction buffer which helps to increase the final product.
11. While drying the vials, take remaining ethanol left at bottom of
the tube by tips carefully without disturbing the RNA pellet.
12. RNA sample contains GC-rich sequences or secondary struc-
ture and thus the sample is put at this temperature. Moreover,
the samples should not be incubated more than 5 min at this
temperature, otherwise RNA may get degraded.
13. Dilution of sample depends on transcript quantity of the target
gene. Usually five times dilution is sufficient. In a separate tube
five times dilution is made and taking that cDNA as a template,
end point PCR is performed; if a faint band appears, then dilu-
tion may be reduced accordingly as higher dilution may result
in higher CT value in real-time PCR.
14. In Applied Biosystems 7500 Fast Real-Time PCR, select melt
curve mode for the run which contains only melt curve stages as
default steps. Add PCR steps before melt curve. PCR parameters
are the same as that for relative gene expression analysis. Since it
is a melt curve analysis, data is recorded only in the melt curve
stage and during PCR, only temperature plot will be visible.
15. In a sample containing cDNA, if DNA is present, then it may
be amplified by primers designed from intronic region. Here,
gene sequence from actin is selected and from the intronic
region primers are designed as mentioned previously except
the product size is from 200 to 250 base pairs. To the cDNA
sample, PCR is performed using this primer and absence of
product determines confirmation of DNA-free cDNA samples.
Cycling conditions are as follows:

Holding Cycling Holding Holding

(1X) (40X) (1X) (1X)

94 °C for 1 94 °C for 60 °C for 72 °C for 72 °C for 1 4 °C for

minute 10 seconds 10 seconds 30 seconds minute ∞
300 Arpan Modi et al.

16. Cycling conditions for primer validation and relative gene

expression are given below:

Holding Cycling Melt curve stage

(1X) (40X)

94 ˚C 94 ˚C

60 ˚C 60 ˚C

94 ˚C for 94 ˚C for 60 ˚C for

5 10 30
seconds seconds seconds

17. After completion of real-time PCR run, save all data in .txt
format and open Data Assist tool. Select new study and add
description of the study. Select the saved .txt formatted file and
click OK. In sample design menu (the upper left corner of the
window), all the treatments will be displayed from which any
unwanted treatment may be omitted. The target as well as
endogenous control genes will be seen in the upper middle
part of the window. Here also any uninterested gene may be
omitted. Select the endogenous control having the least stan-
dard deviation value as selected control from the drop-down
menu. In the analysis setting menu (upper right corner),
choose endogenous control as a normalization method and
reference sample. Click on perform analysis. At the bottom of
the window graphical results will be shown from which click
on RQ plot. Select “RQ vs. Target” as plot type and “Linear”
as graph type. The next window will be as same as Fig. 4.

Acknowledgements

All the authors are thankful to Dr. R. S. Fougat, Unit Officer and
Head, Dept. of Agricultural Biotechnology, Anand Agricultural
University, Anand for providing laboratory as well as poly house facil-
ities and fund for consumables and chemicals with the project enti-
tled “Establishment of Department of Agricultural Biotechnology”
with the budget number BH 12011.
 Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis… 301

References
1. Richman SA, Gijzen M, Starratt AN et al viol glycosides biosynthesis pathway in Stevia
(1999) Diterpene synthesis in Stevia rebaudi- rebaudiana (Bertoni). Gene 492(1):276–284
ana: recruitment and up-regulation of key 9. Ghazi YA, Bouro S, Arioli T et al (2009)
enzymes from the gibberellin biosynthetic Transcript profiling during fiber development
pathway. Plant J J19:411–421 identifies pathways in secondary metabolism
2. Tadhani MB, Patel VH, Subhash R (2007) In and cell wall structure that may contribute to
vitro antioxidant activities of Stevia rebaudi- cotton fiber quality. Plant Cell Physiol
ana leaves and callus. J Food Compos Anal 50(7):1364–1381
27:323–329 10. Modi AR, Patil G, Kumar N et al (2012) A sim-
3. Bondarev NI, Sukhanova MA, Reshetnyak OV ple and efficient in vitro mass multiplication pro-
et al (2003) Steviol glycoside content in differ- cedure for Stevia rebaudiana Bertoni and
ent organs of Stevia rebaudiana and its dynam- analysis of genetic fidelity of in vitro raised plants
ics during ontogeny. Biol Plantarum through RAPD. Sugar Tech 14(4):391–397
47(2):261–264 11. Ghawana S, Paul A, Kumar H et al (2011) An
4. Brandle JE, Telmer PG (2007) Steviol glyco- RNA isolation system for plant tissues rich in
sides biosynthesis. Phytochemistry secondary metabolites. BMC Res Notes
68:1855–1863 4:85–89
5. Walter MA, Hans J, Strack D (2000) Two dis- 12. Doyle JJ, Doyle JL (1990) Isolation of plant
tantly related genes encoding 1-deoxy-D- DNA from fresh tissue. Focus 12:13–15
xylulose-5-phosphate synthases: differential 13. Totte N, Ende WVD, Damme EJMV et al
regulation in shoots and apocarotenoid- (2003) Cloning and heterologous expression of
accumulating mycorrhizal roots. Plant early genes in gibberellin and steviol biosynthe-
J J31(3):243–253 sis via the methylerythritol phosphate pathway
6. Veau B, Courtois M, Oudin A et al (2000) in Stevia rebaudiana. Can J Bot 81:517–522
Cloning and expression of cDNAs encoding 14. Humphrey TV, Richman AS, Menassa R et al
two enzymes of the MEP pathway in (2006) Spatial organization of four enzymes
Catharanthus roseus. Biochim Biophys Acta from Stevia rebaudiana that are involved in
1517:159–163 steviol glycoside synthesis. Plant Mol Biol
7. Pickens LB, Tang T, Choi YH (2011) 61:47–62
Metabolic engineering for the production of 15. Richman A, Swanson A, Humphrey T et al
natural products. Annu Rev Chem Biomol (2005) Functional genomics uncovers three
Eng 2:211–236 glucosyltransferases involved in the synthesis
8. Kumar H, Kaul K, Gupta SB et al (2011) A of the major sweet glucosides of Stevia rebau-
comprehensive analysis of fifteen genes of ste- diana. Plant J 41:56–67
 Chapter 21

In Vitro Propagation and Conservation of Withania

somnifera (Dunal) L.
Nigar Fatima, Naseem Ahmad, and Mohammad Anis

Abstract
Plant tissue culture offers several techniques for rapid clonal propagation, germplasm conservation, regen-
eration of genetically manipulated superior clones, production of phyto-constituents, and ex vitro conser-
vation of valuable phytodiversity. An improved and efficient micropropagation protocol for Withania
somnifera (L.), a drug-producing medicinal plant, using juvenile explants (nodal explants) has been devel-
oped. Highest multiplication and subsequent elongation of shoots is observed on MS medium containing
BA and NAA. The regenerated microshoots roots best on ½ MS medium containing NAA, established in
earthen pots containing garden soil and are maintained in the greenhouse with 95 % survival rate. Genetic
uniformity of micropropagated plants is confirmed by PCR-based DNA fingerprinting techniques, viz.,
RAPD and ISSR. No variation is observed in DNA fingerprinting patterns among the micropropagated
plants, which are similar to that of the donor plant illustrating their genetic uniformity.

Key words Aseptic seedlings, Clones, Conservation, Clonal fidelity, Juvenile explants, DNA finger-
printing, Micropropagation, Genetic stability, Genetic diversity, PCR amplifications, Stratification,
Germplasm conservation, Phytohormones, Soilrite, Phytodiversity

1 Introduction

Withania somnifera (L.) Dunal (Solanaceae), commonly known as

“Ashwagandha” and “Winter Cherry,” is widely distributed
throughout the drier and subtropical parts of India [1]. The genus
has high medicinal value and is extensively used in Ayurvedic for-
mulations as “Rasayana” [2]. Its roots and leaves are used in
numerous medical preparations, for their anti-inflammatory [3],
antimicrobial [4], antitumor and radio-sensitizing [5, 6], immuno-
logical [7], and antioxidant properties [8], besides promoting
vigor and stamina [9]. Ashwaganda’s pharmacological activity has
been attributed to two main metabolites, viz., withaniferin A and
withanolide. The herb has been identified by National Medicinal
Plant Board of India as one of the 32 selected priority medicinal
plants, which are in great demand in the domestic and international

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_21, © Springer Science+Business Media New York 2016

303
304 Nigar Fatima et al.

markets [10]. A long time gap between planting and harvesting,

excessive exploitation of natural resources, non-availability of pro-
cedures for synthetic production of withanolides, and ever-
increasing demand–supply ratio are reasons enough to apply
modern bio-techniques for the plant.
Ashwagandha propagates through seeds; moreover, the plant
does not possess the natural ability for vegetative propagation [11].
However, the commercial exploitation for the production of phar-
maceuticals and conventional propagation is hampered due to its
poor seed viability [12]. In addition, low germination rate restricts its
propagation through seeds even after stratification [13], making the
long term seed storage futile [14]. Moreover, the genetic diversity of
the species in India is now getting degraded [15] at an alarming rate.
Lack of proper cultivation, ruinous harvesting practices for the pro-
duction of medicines, loss of habitats, and the illegal, indiscriminate
collection of the plant material from its natural habitat pose a serious
threat to its existence in the wild. Owing to the immense importance
of the plant, several researchers have reported in vitro regeneration in
W. somnifera using various explants [16–22].
The present study describes an efficient and rapid propagation
protocol [23] and evaluation of clonal fidelity of micropropagated
plantlets through molecular techniques in W. somnifera [24].

2 Materials

2.1 Media 1. The formulation of Murashige and Skoog’s (MS) salts (see
Preparation for Plant Table 1) [25].
Cell Culture 2. Double distilled water.
3. Stock solutions of micronutrients, macronutrients, iron, and
vitamins (see Notes 1).
4. Sucrose.
5. Agar.

2.2 Plant Growth 1. Phytohormones (see Table 2).

Regulators

2.3 Plant Materials 1. Seeds procured from mature fruits of W. somnifera.

2.3.1 Surface 1. 5 % Labolene.

Sterilization of Seeds 2. 0.1 % HgCl2.

2.3.2 Inoculation 1. Laminar air flow hood.

2. Sterilized forceps, scalpels, sterile blades, burner, petri plates,
glass bead sterilizer (Dent-eq, BS 1000), 70 % ethanol, mercu-
ric chloride.
Rapid In Vitro Plant Regeneration Protocol for Ashwagandha (Withania Somnifera L. Dunal) 305

Table 1
Nutritional components of Murashige and Skoog (MS) medium

Stocks solution
Components Compositions (mg/L) (mg/L)
Macronutrients (20×)
MgSO4·7H2O 370 7440
KH2PO4 170 3400
KNO3 1900 38,000
NH4NO3 1650 33,000
CaCl2·2H2O 440 8800
NaH2PO4·H2O – –
(NH4)2·SO4 – –
Micronutrients (200×)
H3BO3 6.2 1240
MnSO4·4H2O 22.3 4460
MnSO4·H2O – –
ZnSO4·7H2O 8.6 1720
Na2MoO4·2H2O 0.25 50
CuSO4·5H2O 0.025 5.0
CoCl2·6H2O 0.025 5.0
Kl 0.83 166
Stock solution III (100×)
FeSO4·7H2O 27.8 2780
Na2EDTA·2H2O 37.3 3730
Organic supplements (100×)
Thiamine HCl 0.5 50
Pyridoxine HCl 0.5 50
Nicotinic acid 0.5 50
Myo-inositol 100 10,000
Others
Glycine 2.0 200
Sucrose (g) 3% 30
306 Nigar Fatima et al.

Table 2
Details of plant growth regulators

Plant growth regulators Molecular weight Solubility Sterilization Storage

Auxin
α-napthalene acetic acid (NAA) 186.21 g/mol 1 N NaOH Co-autoclave 4°C
Cytokinin
6-Benzyladenine (BA) 225.25 g/mol 1 N NaOH Co-autoclave 4°C

2.3.3 Establishment 1. Half-strength MS medium with 3 % sucrose, 0.8 % agar,

of Seedlings pH 5.8.

2.3.4 Culture of Explants 1. MS medium with BA and NAA.

2.4 In Vitro Rooting 1. Half-strength MS medium containing NAA.

2.5 Acclimatization 1. Sterilized Soilrite, garden soil, vermicompost.

and Field Transfer 2. Diluted MS salts, Thermacol cups, transparent polythene bags.
of Rooted Plantlets

2.6 Genetic Fidelity 1. Leaves collected from ten randomly selected micropropagated
Evaluation plantlets and mother plants are used for genetic homogeneity
analysis.

2.6.1 Plant Genomic 1. Genomic DNA.

DNA Isolation

2.6.2 Reagents 1. DNA extraction buffer: 2.5 % cetyl trimethyl ammonium bro-
mide (CTAB), 0.5 M ethylenediaminetetraacetic acid (EDTA)
5 M NaCl, 0.5 M Tris–HCl, pH 8.0.
2. 5× TBE Buffer: 1 M Tris–HCl, 0.5 M EDTA, mQ water.
3. Isopropanol.
4. Gel loading dye (6×): 30 mg bromophenol blue dye, 80 %
glycerol, 30 mg xylene-cyanol, 300 μl EDTA.

2.6.3 PCR Amplification 1. Genomic DNA.

2. Primers: RAPD (OPB and OPC Kit) and ISSR.
3. PCR amplification mixture (20 μl): 10× buffer (2 μl), 25 mM
MgCl2 (1.2 μl), 10 mM dNTPs (0.4 μl), 2 μM primers
(ISSR/RAPD), 3 Unit Taq DNA polymerase (0.2 μl), and
40 ng template DNA.
4. Agarose.
Rapid In Vitro Plant Regeneration Protocol for Ashwagandha (Withania Somnifera L. Dunal) 307

5. Ethidium bromide.
6. 6× dye (bromophenol blue dye).
7. Marker: λ DNA/EcoR1 + HindIII.
8. Milli-Q water.

2.7 Glassware 1. 25 × 150 mm rimless culture tubes, 250 ml wide-mouth

Erlenmeyer flasks, beakers, measuring cylinders, pipettes (0.1–
10 ml), glass rods, petri dishes, conical flasks.
2. PCR tubes, eppendorf tubes.

3 Methods

3.1 Media 1. To avoid precipitation, store stock solutions at 4 °C.

Preparation 2. MS stock is prepared as categorized (see Table 1) (see Notes 1
and 2).
3. Mix properly the required volume of stock solutions, sucrose,
and agar to make the final volume of culture medium as
required. To prepare cytokinin stock solution, weigh the hor-
mone and dissolve it in a few drops of NaOH (1 N) and make
up the final volume with double distilled water.
4. Prepare auxin stocks solution by dissolving amount of auxin in
minimum amount of ethanol and raise to required volume by
double distilled water.
5. Adjust pH of the medium to 5.8 with 1 N NaOH and 1 HCl,
before dispensing the media into culture vessels.
6. Pour 20 ml culture medium into test tubes, 50 ml into culture
flasks, and 80 ml into glass bottles (see Note 3).
7. Use cotton plugs to cap test tubes and flasks and transparent
polypropylene lids bearing a plugged with non-absorbent
cotton.
8. Autoclave the media at 121 °C and 1.05 kg/cm2 pressure for
15 min.

3.2 In Vitro 1. Collect mature and healthy seeds from 6-month-old W. som-
Regeneration nifera plant.
from Juvenile Explants 2. Wash the seeds thoroughly under running tap water for
30 min, treat with 5 % Labolene for 20 min followed by a thor-
ough washing under running tap water for 15 min.
3. Surface-sterilize the seeds with 0.1 % HgCl2 solution for 5 min
in the laminar flow cabinet (see Notes 4 and 5), Rinse thrice
with sterile distilled water to remove traces of the HgCl2.
4. Culture disinfected seeds on half-strength MS basal medium
(3 % sucrose and 0.8 % agar).
308 Nigar Fatima et al.

5. Excise nodal segments from 15-day-old aseptic seedlings and

culture on MS medium containing BA with 3 % sucrose and
0.8 % agar for multiple shoot induction (see Fig. 1a).

3.3 Shoot 1. Highest multiplication and subsequent elongation of shoots is

Regeneration achieved on BA and NAA (see Fig. 1b).
and Multiplication 2. Establish proliferating shoot cultures by repeatedly subcultur-
ing onto the fresh culture medium at a 3-week interval (see
Note 8).

3.4 Rooting 1. Transfer shoots (3–4 cm long) into half-strength MS aug-

mented with NAA (see Fig. 1c).

3.5 Acclimatization 1. Remove rooted plantlets from the rooting medium and wash
and Hardening thoroughly under running tap water to remove all traces of
agar attached to it (see Note 9).
2. Acclimatize plantlets in Soilrite inside the growth room sub-
strate for 4 weeks and establish in garden soil (see Fig. 1d).

3.6 Assessment 1. Isolate total genomic DNA from fresh leaf tissues of micro-
of Clonal Fidelity propagated plantlets and mother plant using modified cetyl
of Tissue trimethyl ammonium bromide (CTAB) method [26].
Culture-Raised Plants 2. Freeze 1 g fresh leaf tissues using liquid nitrogen and grind the
frozen samples thoroughly into fine powder using chilled mor-
tar and pestle.
3. Add 3 ml pre-warmed (65 °C) CTAB extraction buffer with
0.2 % (v/v) β-mercaptoethanol to the homogenized plant
samples.
4. Mix thoroughly and incubate the samples at 65 °C in water bath
for 1 h with occasional shaking. Add equal volume of chloro-
form–isoamylalcohol (24:1) to samples and mix well to avoid
any protein contamination, debris, and interphase materials.
Centrifuge (Hettich) the sample at 15,000 rpm (32953 × g) at
4 °C for 10 min.
5. Transfer the supernatant to eppendorf tube containing 170 μl
sodium chloride solution and double volume of chilled isopro-
panol (to precipitate the DNA). Mix the samples well and
incubate at room temperature for 30 min.
6. Resuspend the pellet in 300 μl (TE) buffer and 3 μl RNAse and
incubate at 65 °C in a water bath for 30 min.
7. Pellet the precipitated DNA by centrifugation at 10,000 rpm
for 10 min at 4 °C.
8. Decant the supernatant and air-dry the pellet properly.
9. Dissolve the pellet in 100 μL Milli-Q water.
10. Store the DNA at −20 °C.
Rapid In Vitro Plant Regeneration Protocol for Ashwagandha (Withania Somnifera L. Dunal) 309

Fig. 1 (a) Multiple shoot induction from nodal explants on MS medium amended
with BA (2.5 μM), 8 weeks; (b) Multiplication and subsequent proliferation of
shoots on MS medium amended with BA (2.5 μM) + NAA (0.5 μM), 8 weeks; (c)
Rooting of in vitro microshoots on ½ MS + NAA (0.5 μM), 4 weeks; (d) Well-
established hardened plant in pot containing soil, 2 months old

3.6.1 Quantification 1. Quantify the DNA by running the DNA on 1 % agarose gel.
of Genomic DNA Measure the optical density at 260 nm using nanophotometer.
2. Use RAPD or ISSR primers for screening (see Tables 3 and 4).
3. Perform PCR amplifications using thermocycler.

3.6.2 PCR Assay 1. Prepare the reaction buffer (3 μl of 10× buffer): 0.75 μl MgCl2
(25 mM), 0.75 μl dNTPs (10 mM each of dATP, dGTP, dTTP,
and dCTP), 1.5 μl primers (RAPD/ISSR), 0.15 μl Taq DNA
polymerase, and 18.85 μl mQ water.
310 Nigar Fatima et al.

Table 3
Nucleotide sequences of randomly amplified polymorphic DNA primers (RAPD)

S. no. Kit B Kit C

Primers Sequence (5′–3′) Primers Sequence (5′–3′)
1 OPB01 GTTTCGCTCG OPC01 TTCGAGCCAG
2 OPB02 TGATCCCTGG OPC02 GTGAGGCGTC
3 OPB03 CATCCCCCTG OPC03 GGGGGTCTTT
4 OPB04 GGACTGGAGT OPC04 CCGCATCTAC
5 OPB05 TGCGCCCTTC OPC05 GATGACCGCC
6 OPB06 TGCTCTGCCC OPC06 GAACGGACTC
7 OPB07 GGTGACGCAG OPC07 GTCCCGACGA
8 OPB08 GTCCACACGG OPC08 TGGACCGGTG
9 OPB09 TGGGGGACTC OPC09 CTCACCGTCC
10 OPB10 CTGCTGGGAC OPC10 TGTCTGGGTG
11 OPB11 GTAGACCCGT OPC11 AAAGCTGCGG
12 OPB12 CCTTGACGCA OPC12 TGTCATCCCC
13 OPB13 TTCCCCCGCT OPC13 AAGCCTCGTC
14 OPB14 TCCGCTCTGG OPC14 TGCGTGCTTG
15 OPB15 GGAGGGTGTT OPC15 GACGGATCAG
16 OPB16 TTTGCCCGGA OPC16 CACACTCCAG
17 OPB17 AGGGAACGAG OPC17 TTCCCCCCAG
18 OPB18 CCACAGCAGT OPC18 TGAGTGGGTG
19 OPB19 ACCCCCGAAG OPC19 GTTGCCAGCC
20 OPB20 GGACCCTTAC OPC20 ACTTCGCCC

2. Set the DNA amplification program of 45 cycles: (1) initial

denaturation at 94 °C for 5 min, (2) annealing at 35 °C for
1 min and elongation at 72 °C for 1 min, (3) extension at
72 °C for 10 min.
3. Fraction DNA amplification products by electrophoresis in
0.8 % (w/v) agarose gels and stain with 4 μl ethidium bromide
in (100 ml) 1× TBE buffer (pH 8.0).

3.6.3 Agarose Gel 1. Warm agarose solution and allow melting resulting in a clear
Electrophoresis solution; cool at around 60 °C and add 4 μl ethidium bromide
to it.
Rapid In Vitro Plant Regeneration Protocol for Ashwagandha (Withania Somnifera L. Dunal) 311

Table 4
Nucleotide sequences of Inter Simple Sequence Repeat (ISSR) primers

S. no. Name of primers Primers sequences (5′–3′)

1 UBC-801 (AT)8T
2 UBC-811 (GA)8C
3 UBC-825 (AC)8T
4 UBC-827 (AC)8G
5 UBC-834 (AG)8YT
6 UBC-841 (GA)8YC
7 UBC-855 (AC)8YT
8 UBC-866 (CTC)6
9 UBC-868 (GAA)6
10 UBC-880 (GGGGT)3G
11 UBC-889 DBDA(CA)6C
12 UBC-891 HVHT (GT)6G
13 UBC-900 ACTTCCCCACAGGTTAACAC

2. Seal the gel casting tray with adhesive tape and arrange the gel
mold with the comb placed in a manner such that it does not
touch the base of the mold (see Note 10).
3. Pour carefully the molten agarose into the mold, avoiding for-
mation any air bubble.
4. After solidification, remove the comb and sealing tape carefully
and place the gel in the electrophoresis tank, and properly fill
up with TBE buffer.
5. Load the first well of the gel (lane M) with 10 μl λ 1 kb ladder.
6. Add 5 μl loading dye to each PCR amplification product and
load the entire volume into the well.
7. Run the gel at 50 V for 2 h.
8. Visualize and photographs of gel using gel documentation sys-
tem (see Figs. 2a, b and 3a, b).

3.6.4 Data Scoring 1. Only distinct, reproducible, and well-resolved fragments are
and Analysis taken in the analysis.
312 Nigar Fatima et al.

Fig. 2 Profile of polymerase chain reaction (PCR) amplification products from lane 1–10 micropropagated
plants of W. somnifera using randomly amplified polymorphic DNA (RAPD) primers. (a) primer OPB 04 (b)
primer OPC 08

4 Notes

1. Sterilization of glassware, culture media, and instruments

should be carried out by autoclaving at 121 °C and 1.05 kg/
cm2 pressure.
2. Calibrate the pH meter before taking the medium pH. Adjust
pH of the medium using 1 N NaOH or 1 N HCl.
3. Dipense 20 ml medium in 25 mm × 150 mm culture tubes and
close them with the cotton plugs made with double layered
muslin cloths stuffed with non-absorbent cotton.
4. Regularly check the air flow gauge of laminar air flow chamber.
Switch on the UV light for 15 min before starting inocula-
Rapid In Vitro Plant Regeneration Protocol for Ashwagandha (Withania Somnifera L. Dunal) 313

Fig. 3 A profile of polymerase chain reaction (PCR) amplification products from lane 1–10 micropropagated
plants using Inter Simple Sequence Repeat (ISSR) primer (a) UBC 866; (b) primer UBC 891. M = Marker (DNA/
EcoR1 + HindIII indicated in bp); P = Donor plant; Lane 1–10 = Micropropagated plants

tion/subculturing activity in the laminar air flow hood. The

bench is wiped with alcohol frequently during any aseptic
operations.
5. Precautions should be taken while using chemicals like HgCl2,
β-mercaptoethanol, ethidium bromide as they are highly carci-
nogenic, mutagenic, and hazardous.
6. Ethanol is inflammable. Therefore, one should be very careful
while flaming an instrument.
7. Ultraviolet (UV) irradiation poses serious health risk.
314 Nigar Fatima et al.

8. Subculturing of shoots is carried out at a regular interval of 3

weeks. During subculturing the larger sized shoot clusters
obtained at the end of each multiple cycle are further divided
into smaller clusters.
9. The in vitro regenerated roots are very soft and delicate in
nature. Therefore, physical handling should be done with
utmost care.
10. Clean the gel tray, combs, and other materials properly before
and after use to prevent contamination. Wear gloves during the
entire operation.

Acknowledgment

The financial assistance in the form of Dr. D.S. Kothari Postdoctoral

Fellowship, University Grants Commission (UGC) to Dr. Nigar
Fatima and The award of SERB, Young Scientist scheme (SB/YS/
LS-145/2013), Department of Science and Technology (DST),
Government of India, New Delhi to Dr. Naseem Ahmad is greatly
acknowledged. Research support from The Department of Science
and Technology (Govt. of India) New Delhi under the DST-FIST
II (2011) and UGC-SAP (2009) Programme is also
acknowledged.

References
1. Hooker JD (1885) Flora of British India, vol and other pharmacological effects.
4. Reeve and Co, London, p 228 Phytomedicine 8:492–494
2. Chadha YR (1976) Withania somnifera L. 7. Ganasoundari A, Zare SM, Devi UP (1997)
(Dunal) (Ashwagandha). In: The wealth of Modification of bone marrow radiosensitivity
India-raw materials, vol X. Council of Scientific by medicinal plant extracts. British J Radiol
and Industrial Research, New Delhi, India, 70:599–602
pp 580–585 8. Govindarajan R, Vijaykumar M, Pushpagandan
3. Sahni YP, Srivastava DN (1995) Role of P (2005) Antioxidant approach to disease
inflammatory mediators in anti-inflammatory management and the role of ‘Rasayana’ herbs
activity of Withania somnifera on chronic of Ayurveda. J Ethnopharmacol 99:165–178
inflammatory reaction. Indian Vet Med 9. Furmanova M, Gajdzis-Kuls D, Ruszkowska J,
J 19:150–153 Czamocki Z, Obidoska G, Sadowska A, Rani
4. Budhiraja RD, Sudhir S (1987) Review of bio- R, Upadhyaya SN (2001) In vitro propagation
logical activity of withanolides. J Sci Ind Res of Withania somnifera and isolation of witha-
46:488–491 nolides with immune-suppressive activity.
5. Devi UP, Akagi K, Ostapenko V, Tanaka Y, Planta Med 67:146–149
Sugahara T (1996) Withaferin A: a new radio- 10. Prajapati ND, Purohit SS, Sharma AK, Kumar
sensitizer from the Indian medicinal plant T (2003) A handbook of medicinal plants—a
Withania somnifera. Int J Radiat Biol complete source book. Agrobios, Jodhpur,
69:193–197 India
6. Singh DD, Dev CS, Bhutani KK (2001) Down 11. Sen J, Sharma AK (1991) Micropropagation
regulation of p34cdc2 expression with aque- of Withania somnifera from germinated seeds
ous fraction from Withania somnifera for a and shoot tip. Plant Cell Tiss Org Cult
possible molecular mechanism of anti-tumor 26:71–73
Rapid In Vitro Plant Regeneration Protocol for Ashwagandha (Withania Somnifera L. Dunal) 315

12. Rani G, Grover IS (1999) In vitro callus 19. Sivanesan I, Murugesan K (2008) An efficient
induction and regeneration studies in regeneration from nodal explants of Withania
Withania somnifera. Plant Cell Tiss Org Cult somnifera Dunal. Asian J Plant Sci 7:551–556
57:23–27 20. Ghimire BK, Seong ES, Kim EH, Lamsal K,
13. Dewir YH, Chakrabarty D, Lee SH, Hahn EJ, Yu CY, Chung IM (2010) Direct shoot organ-
Paek KY (2010) Indirect regeneration of ogenesis from petiole and leaf discs of Withania
Withania somnifera and comparative analysis somnifera (L.) Dunal. African J Biotechnol
of withanolides in vitro and greenhouse grown 9:7453–7461
plants. Biol Planta 54:357–360 21. Logesh P, Settu A, Thangavel K, Ganapathi A
14. Farroqi AA, Sreeramu BS (2004) Cultivation (2010) Direct in vitro regeneration of
of medicinal plants. University Press (India) Withania somnifera (L.) Dunal through leaf
Private Limited, Hyderguda, Hyderabad, disc culture. Int J Biol Technol 1:1–4
pp 1–524 22. Kumar OA, Jyothironayee G, Tata SS (2011)
15. Antonisamy R, Manickam VS (1999) Multiple shoot regeneration from nodal
Conservation through micropropagation and explants of Ashwagandha (Withania somnifera)
restoration of selected rare and endangered L Dunal. Asian J Exp Biol Sci 2:636–640
medicinal plants of South India. In XVI. Int. 23. Fatima N, Anis M (2012) Role of growth reg-
Bot. Cong, held on 1–7 Aug. Saint Louis, ulators on in vitro regeneration and histologi-
Missouri, USA cal analysis in Indian ginseng (Withania
16. Kulkarni AA, Thengane SR, Krishnamurthy somnifera L.) Dunal. Physiol Mol Biol Plants
KV (2000) Direct shoot regeneration from 18:59–62
node, internode, hypocotyl and embryo 24. Fatima N, Ahmad N, Anis M, Ahmad I (2013)
explants of Withania somnifera. Plant Cell Tiss An improved in vitro encapsulated protocol,
Org Cult 62:203–209 biochemical analysis and genetic integrity
17. Kulkarni A, Thengane SR, Krishnamurthy KV using DNA based molecular markers in regen-
(2006) Direct shoot regeneration from node, erated plants of Withania somnifera
internode, hypocotyl and embryo explants of L. Industrial Crops Products 50:468–477
Withania somnifera. Plant Cell Tiss Org Cult 25. Murashige T, Skoog F (1962) A revised medium
3:203–209 for rapid growth and bioassays with tobacco tis-
18. Sivanesan I (2007) Direct regeneration from sue cultures. Physiol Plant 15:473–497
apical bud explants of Withania somnifera 26. Doyle JJ, Doyle JL (1990) Isolation of plant
Dunal. Indian J Biotechnol 16:125–127 DNA from fresh tissue. Focus 12:13–15
 Chapter 22

Construction of Hypericin Gland-Specific cDNA Library via

Suppression Subtractive Hybridization
Rupesh Kumar Singh, Weina Hou, and Gregory Franklin

Abstract
Hypericin, an important determinant of the pharmacological properties of the genus Hypericum, is consid-
ered as a major molecule for drug development. However, biosynthesis and accumulation of hypericin is not
well understood. Identification of genes differentially expressed in tissues with and without hypericin accu-
mulation is a useful strategy to elucidate the mechanisms underlying the development of the dark glands and
hypericin biosynthesis. Suppression Subtractive Hybridization (SSH) is a unique method for PCR-based
amplification of specific cDNA fragments that differ between a control (driver) and experimental (tester)
transcriptome. This technique relies on the removal of dsDNA formed by hybridization between a control
and test sample, thus eliminating cDNAs of similar abundance, and retaining differentially expressed or vari-
able in sequence cDNAs. In our laboratory we applied this method to identify the genes involved in the
development of dark glands and accumulation of hypericin in Hypericum perforatum. Here we describe the
complete procedure for the construction of hypericin gland-specific subtracted cDNA library.

Key words Hypericum perforatum, Suppression subtractive hybridization, Dark glands, Hypericin
biosynthesis, Polymerase chain reaction, Gene sequencing

1 Introduction

Hypericum perforatum is an important medicinal plant used

worldwide to treat several ailments [1]. Many of the pharmaceu-
tical properties of this species have been attributed to hypericin,
a natural product structurally belonging to the chemical class of
naphthodianthrones. Hypericin exhibits anticancer, anti-HIV,
and neurorestorative characteristics while having reduced side
effects, making it as an emerging multifunctional lead drug mol-
ecule in new therapies [2, 3]. Especially, its photoexcitation prop-
erties are under intensive investigation as a molecule for
fluorescent diagnosis and photodynamic therapy (PDT) in the
treatment of a variety of tumors [4]. In spite of several applications

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_22, © Springer Science+Business Media New York 2016

317
318 Rupesh Kumar Singh et al.

in the pharmaceutical industry, hypericin biosynthesis is poorly

understood, mainly due to the lack of information about the
genes involved in this pathway.
Hypericin is produced only in Hypericum species (e.g., H. per-
foratum) that contain characteristic dark glands (also known as
hypericin glands). These glands are mainly distributed in the aerial
parts of the plants such as leaves, stem, and flowers. Accumulation
of hypericin in the dark glands is considered as a mechanism to
avoid the potential toxicity of this light-sensitive compound to
plant tissues [5]. A clear positive correlation between the presence
of dark glands and hypericin accumulation is evidenced by our own
[6, 7] and other studies [8, 9]. For instance, H. perforatum cell
suspension cultures do not possess dark glands and cannot synthe-
size or accumulate hypericin [6]. Similarly, H. perforatum green
organogenic nodules [10] and the calli derived from its thin sec-
tions do not have dark glands or hypericin synthesis in the initial
stages of development [11]. Moreover, Hypericum species with
and without dark glands, namely, H. perforatum, H. undulatum
and H. androsaemum, H. heterophyllum, H. scabrum etc., synthe-
size and do not synthesize hypericin, respectively [1, 12], establish-
ing a clear correlation between the presence of dark glands and
hypericin synthesis. This hypothesis is further emphasized by the
presence of HpPKS1 and HpPKS2, the two genes known to be
involved in hypericin biosynthesis, in the dark glands [13].
Taking advantage of this strong correlation between the pres-
ence of dark glands and hypericin accumulation, we performed
subtraction between cDNAs of tissues with and without hypericin
glands to construct a hypericin gland-specific cDNA library. This
would help us to understand the complex phenomenon of dark
gland formation and hypericin biosynthesis. Here, we describe the
protocol for the construction of dark gland-specific cDNA library
via SSH technique.

2 Materials

2.1 In Vitro Seed 1. H. perforatum (cv. Helos) seeds.

Germination 2. Tween 20 (Sigma, USA).
3. Sterile water.
4. 70 % ethyl alcohol.
5. 1.5 % active chlorine.
6. Sterile filter paper.
7. Water–agar medium.
 Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 319

2.2 RNA Isolation 1. Plant material: The tissues for RNA extraction can be obtained
and mRNA Purification as described in Subheading 3.2.
2. RNA extraction buffer: 2 % CTAB, 2 % PVP, 25 mM EDTA
pH 8.0, 100 mM Tris–HCl, pH 8.0, 2 M NaCl, 0.5 g/L sper-
midine, 2 % β-mercaptoethanol (βMe). Prepare in RNase-free
water and store at 4 °C.
3. 3.0 M sodium acetate: adjust to pH 5.5, autoclave, and store
at 4 °C.
4. 24:1 mixture of chloroform and isoamyl alcohol (Sigma-
Aldrich, USA).
5. Isopropanol.
6. TE buffer pH 8.0, autoclave and store at 4 °C.
7. 8 M LiCl, autoclave and store at 4 °C.
8. 96 % ethyl alcohol.
9. RNase-free water.
10. RiboMinus™ Plant Kit for RNA-Seq (Invitrogen, USA).

2.3 cDNA Synthesis 1. 2 μg Poly A+ RNA from tester and driver.

2. 10 μM cDNA synthesis primer.
3. 100 units/μL SMARTScribe™ Reverse Transcriptase
(Clontech, USA).
4. 3 U/μL T4 DNA Polymerase (Clontech, USA).
5. 5× first strand buffer: 250 mM Tris–HCl, pH 8.3, 30 mM
MgCl2, 375 mM KCl.
6. 5× second strand buffer: 500 mM KCl, 50 mM ammonium
sulfate, 25 mM MgCl2, 0.75 mM ß-NAD, 100 mM Tris–HCl,
pH 7.5, 0.25 mM BSA.
7. 20× Second Strand Enzyme Cocktail: 6 U/μL DNA poly-
merase I, 0.25 U/μL RNase H, 1.2 U/μL E. coli DNA ligase.
8. 10 mM dNTP mix.
9. 20 mM DTT (dithiothreitol).
10. Sterile distilled water.
11. EDTA–glycogen mix: 0.2 M EDTA, 1 mg/mL glycogen
(Clontech, USA).
12. 24:1 mixture of chloroform and isoamyl alcohol (Sigma-
Aldrich, USA).
13. 4 M ammonium acetate.
14. 100 % ethyl alcohol.
15. 70 % ethyl alcohol.
320 Rupesh Kumar Singh et al.

2.4 cDNA 1. Tester and driver cDNA.

Subtraction 2. PCR-Select™ cDNA Subtraction Kit (Clontech, USA).
3. 400 U/μL T4 DNA ligase with 3 mM ATP (Clontech, USA).
4. 5× DNA Ligation Buffer: 250 mM Tris–HCl, pH 7.8, 50 mM
MgCl2, 10 mM DTT, 0.25 mM BSA.
5. 10 μM adaptor 1.
6. 10 μM adaptor 2R.
7. 10 U/μL RsaI restriction enzyme (Clontech, USA).
8. 10× RsaI restriction buffer: 100 mM Bis-Tris Propane-HCl,
pH 7.0, 100 mM MgCl2, 1 mM DTT.
9. 4× hybridization buffer (Clontech, USA).
10. Dilution buffer: 20 mM HEPES, pH 8.3, 50 mM NaCl,
0.2 mM EDTA, pH 8.0.
11. 10 μM PCR primer 1—5′CTAATACGACTCACTATA-
GGGC3′.
12. 10 μM Nested PCR primer 1—5′TCGAGCGGCCGCCC-
GGGCAGGT3′.
13. 10 μM Nested PCR primer 2R—5′AGCGTGGTCGCGGC-
CGAGGT3′.
14. 10 mM dNTP mix.
15. 20× EDTA–glycogen mix: 0.2 M EDTA, 1 mg/mL
glycogen.
16. 4 M ammonium acetate.
17. Taq DNA polymerase (Fermentas, USA).
18. QIAquick PCR Purification kit (QIAGEN, Germany).

2.5 Cloning 1. pGEM-T Easy Vector system (Promega, USA).

of Subtracted cDNA 2. DH5 α E. coli strain (Invitrogen, USA).
3. 100 mM CaCl2 solution, autoclave and store at 4 °C.
4. 50 mg/mL ampicillin (Calbiochem, USA).
5. 0.2 M IPTG, filter-sterilize and store at −20 °C.
6. 20 mg/mL X-Gal, filter-sterilize and store at −20 °C.
7. 10 U/μL T4 DNA ligase (Fermentas, USA).
8. 10× ligation buffer—pH 7.8: 400 mM Tris–HCl, 100 mM
MgCl2, 100 mM DTT, 5 mM ATP.
9. LB medium solidified with 1.5 % agar.
 Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 321

2.6 Screening 1. E. coli transformed with T vector containing subtracted cDNA

of Subtracted cDNA fragments.
Library 2. PCR components: universal 10 μM M13 F and M13 R primers,
5 U/μL Taq DNA polymerase (Fermentas, USA), 10 mM
dNTP mix, 10× PCR buffer.
3. Thermocycler (Mastercycler gradient®, Eppendorf, Germany).

3 Methods

3.1 In Vitro Seed 1. Take approximately 50–100 H. perforatum seeds in an

Germination Eppendorf tube.
2. Add 1 mL sterile water and a drop of Tween 20.
3. Mix well and keep in dark at 4 °C overnight.
4. Discard the solution and rinse twice with sterile distilled water
(see Note 1).
5. Decontaminate the seeds with 1 mL 70 % (v/v) ethyl alcohol
for 60 s followed by commercial bleach containing 1.5 % (v/v)
active chlorine for 3 min (see Note 2).
6. Wash the seeds three times in sterile distilled water and blot-
dry on a sterile filter paper.
7. Gently transfer the disinfected seeds onto WA medium.
8. Incubate the cultures in culture room at 25 °C under photope-
riodic condition for germination.

3.2 Collection 1. After 2 weeks of germination, seedlings would have a pair of

of Tissues cotyledonary leaves without hypericin glands and a pair of
with and Without primary leaves with hypericin glands (Fig. 1).
Hypericin Glands

Fig. 1 H. perforatum seedling germinated on water–agar medium showing coty-

ledonary leaves without dark glands and primary leaves with dark glands
322 Rupesh Kumar Singh et al.

2. Transfer the seedlings aseptically to a sterile petri dish contain-

ing sterile distilled water.
3. Excise the cotyledonary and primary leaves with scalpel blade
and collect into separate Falcon tubes placed in liquid nitrogen.
4. Freeze the tissues in liquid nitrogen and store at −80 °C until
RNA extraction.

3.3 Total RNA 1. Grind 0.5 g of frozen tissue from each sample (with and with-
Isolation (High Quality) out glands) into fine powder in liquid nitrogen with a sterile
mortar and pestle (see Note 3).
2. Collect the ground tissues into 15 mL Falcon tubes.
3. Warm RNA extraction buffer to 60 °C and add 3 mL to each
tube (see Note 4).
4. Vigorously vortex the tubes to mix the samples.
5. Incubate the tubes at 60 °C for 10 min in a water bath.
6. Cool down to room temperature and add 3 mL chloroform–
isoamyl alcohol (24:1).
7. Vigorously vortex the tubes to mix the samples.
8. Centrifuge the tubes at 12,000 × g for 10 min at 4 °C.
9. Carefully transfer the top aqueous phase into new tubes.
10. Add ½ volume of ice-cold ethyl alcohol 96 % (v/v) and mix
well by gentle inversion.
11. Incubate the tubes on ice for 30 min to precipitate
polysaccharides.
12. Centrifuge the tubes at 10,000 × g for 10 min at 4 °C.
13. Collect the supernatant to new tubes and add equal volume of
8 M LiCl.
14. Incubate the tubes at −20 °C overnight for RNA precipitation
(see Note 5).
15. Centrifuge the tubes at 12,000 × g for 30 min at 4 °C to pellet
precipitated RNA.
16. Discard the supernatant and wash the pellets with 5 mL of
96 % (v/v) ice-cold ethyl alcohol.
17. Dry and dissolve the pellet in 50 μL of TE buffer (see Note 6).
18. Check for RNA quantity and purity in a NanoDrop (see Note 7).
19. Resolve 1–2 μL sample to check the RNA quality and integrity
on 1.2 % (w/v) agarose gel (Fig. 2).

3.4 mRNA 1. We have used RiboMinus™ Plant Kit for RNA-Seq for mRNA
Purification purification from total RNA (see Note 8).
2. Transfer 10 μg of total RNA isolated from tissues with and
without glands to different Eppendorf tubes and make up the
volume to 10 μL using RNase-free water.
Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 323

Fig. 2 Total RNA isolated from leaf tissues resolved on 1.2 % agarose gel. Lane
1. Total RNA from leaf tissues having hypericin glands and Lane 2. Total RNA from
leaf tissues without hypericin glands

3. Incubate the tubes at 60 °C for 3 min.

4. Add 100 μL hybridization buffer pre warmed to 37 °C and
10 μL RiboMinus probe—both supplied with the RiboMinus
kit (see Note 9).
5. Incubate the tube at 70 °C for 5 min in a hot water bath to
disrupt all the secondary structures of RNA (see Note 10).
6. Cool down the tube to 37 °C (see Note 11).
7. Add 200 μL of streptavidin RiboMinus™ Magnetic Beads pre-
viously suspended in hybridization buffer (see Note 12).
8. Incubate the tube at 37 °C for 15 min in water bath (see Note
13).
9. Place the tube on magnetic separator to pellet the magnetic
beads to the bottom (see Note 14).
10. Collect the supernatant containing mRNA.
11. Repeat the steps 7–10 with 250 μL of streptavidin RiboMinus™
Magnetic Beads to purify mRNA further.
12. Transfer the final supernatant to a new tube.
13. Add 1 μL of 20 μg/μL glycogen, 30 μL of 3 M sodium ace-
tate, and 750 μL of 96 % ethyl alcohol.
14. Mix by simple inversion and incubate at −80 °C for 30 min to
precipitate mRNA.
15. Centrifuge the tube at 12,000 × g for 15 min at 4 °C to pellet
down mRNA.
16. Discard the supernatant and wash the pellet with 500 μL ice-
cold 70 % ethyl alcohol.
324 Rupesh Kumar Singh et al.

17. Dry the pellet and dissolve mRNA in 5 μL of nuclease-free

water.
18. Check the concentration and purity of mRNA in a NanoDrop
(see Note 15).
19. Now, the mRNA (poly A+ RNA) is ready for cDNA synthesis
(see Note 16).

3.5 First Strand 1. Take 2 μg of poly A+ RNA from each sample in separate PCR
cDNA Synthesis tubes and make up their volumes to 4 μL (see Note 17).
2. Add 1 μL of 10 μM cDNA synthesis primer and incubate the
tubes at 70 °C for 5 min in a thermocycler.
3. Cool on ice for 5 min and centrifuge the tubes briefly to bring
the samples to the bottom.
4. Add the following components to each tube (see Note 18):

5× first strand buffer 2 μL

10 mM dNTP mix 1 μL
20 mM DTT 1 μL
SMARTScribe™ reverse transcriptase 1 μL

5. Incubate the tubes at 42 °C in a thermocycler.

6. After 2 h, terminate the reaction by snap cooling the tubes on
ice.
7. Proceed to second strand cDNA synthesis.

3.6 Second Strand 1. To each first strand cDNA synthesis reaction tube, add the
cDNA Synthesis following components to reach the final volume of 80 μL:

5× second strand buffer 16 μL

10 mM dNTP mix 1.6 μL
20× second strand enzyme cocktail 4 μL
Sterile distilled water 48.4 μL

2. Incubate the tubes at 16 °C in a thermocycler for 2 h.

3. Add 1 μL T4 DNA Polymerase to the tubes and continue the
incubation at 16 °C for 1 h.
4. Add 4 μL of EDTA–glycogen mix to terminate the reaction.
5. Transfer the reaction mixtures to Eppendorf tubes, add equal
volume of chloroform–isoamyl alcohol (24:1) and mix gently
by pipetting up and down (see Note 19).
6. Centrifuge the tubes at 12,000 × g for 10 min at room
temperature.
 Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 325

7. Collect the top aqueous layer in a new tube, add 100 μL of

chloroform–isoamyl alcohol (24:1) and mix (see Note 19).
8. Centrifuge the tubes at 12,000 × g for 10 min at room tem-
perature and collect the upper aqueous layer in a new tube.
9. Add 25 μL 4 M ammonium acetate, 187.5 μL 100 % ethyl
alcohol and mix gently to precipitate cDNA.
10. Pellet down the cDNA by centrifugation at 14,000 × g for
10 min at room temperature.
11. Discard the supernatant and wash the pellet with 100 μL of
70 % ethyl alcohol.
12. Air-dry and dissolve the pellet in 50 μL sterile distilled water.
13. To ensure the quality and quantity, check the cDNA in a
NanoDrop (see Note 20).

3.7 Subtraction 1. Digest tester and driver cDNA with RsaI restriction enzyme to
of cDNA generate shorter blunt ended ds cDNA fragments.
3.7.1 RsaI Digestion 2. Set up the reaction for each tester and driver as below in PCR
tubes.

cDNA 43.5 μL
10× RsaI restriction buffer 5 μL
10 U/μL RsaI restriction enzyme 1.5 μL

3. Mix the components by pipetting up and down.

4. Incubate the tubes at 37 °C for 2 h in a thermocycler.
5. Terminate the reaction by adding 2.5 μL of EDTA–glycogen
mix to the tubes.
6. Add 50 μL chloroform–isoamyl alcohol (24:1) and mix thor-
oughly by pipetting up and down (see Note 19).
7. Centrifuge the tubes at 12,000 × g for 10 min at room
temperature.
8. Collect the top aqueous layer in fresh tubes and repeat the
steps 6 and 7 once again.
9. Carefully transfer the upper aqueous layer to sterile Eppendorf
tubes.
10. Add 25 μL of 4 M ammonium acetate, 187.5 μL of 100 %
ethyl alcohol and mix gently to precipitate.
11. Pellet down the digested cDNA by centrifugation at 14,000 × g
for 10 min at room temperature.
12. Remove the supernatant and wash the pellet with 70 % ethyl
alcohol.
13. Air-dry and dissolve the pellet in 5.5 μL of sterile water
( see Note 21).
326 Rupesh Kumar Singh et al.

14. To ensure the quality and quantity, check the digested cDNA
in a NanoDrop (see Note 22).
15. Store the RsaI-digested cDNA at −20 °C.

3.7.2 Adaptor Ligation 1. Dilute 1 μL RsaI-digested tester cDNA to 4 μL using sterile

of Tester cDNA distilled water.
2. Aliquot 2 μL of the diluted tester cDNA in 2 PCR tubes (Tube
1 and Tube 2) for ligating adaptors 1 and 2R respectively.
3. Set up the reaction in Tube 1 and Tube 2 as below (see Note 18):

Tube 1 Tube 2
Diluted tester cDNA 2 μL 2 μL
10 μM Adaptor 1 2 μL –
10 μM Adaptor 2R – 2 μL
5× Ligation buffer 2 μL 2 μL
400 U/μL T4 DNA ligase 1 μL 1 μL
Sterile water 3 μL 3 μL

4. Incubate the tubes at 16 °C in a thermocycler for 12 h.

5. Add 1 μL of EDTA–glycogen mix to the tubes to terminate
the reaction.
6. Inactivate the enzyme by heating the tubes to 72 °C for 5 min
in thermocycler.
7. Now adaptor ligated tester cDNAs are ready and can be stored
at −20 °C (see Note 23).

3.7.3 First Hybridization 1. RsaI-digested cDNA from tissues without hypericin glands (as
described in Subheading 3.7.1) is used as driver.
2. In the first hybridization, an excess of driver cDNA is hybrid-
ized with tester cDNA ligated to adaptor 1 and 2R in two
reactions.
3. Set up first hybridization reaction in two PCR tubes (Tube 1
and Tube 2) as described below:

Tube 1 Tube 2
RsaI-digested Driver cDNA 1.5 μL 1.5 μL
Tester cDNA ligated to adaptor 1 1.5 μL –
Tester cDNA ligated to adaptor 2R – 1.5 μL
4× hybridization buffer 1 μL 1 μL
Final volume 4.0 μL 4.0 μL
 Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 327

4. Incubate the tubes in a thermocycler for 2 min at 98 °C for

denaturation followed by 6–12 h at 68 °C for annealing (see
Note 24).
5. Now the first hybridization is over and the samples are ready
for second hybridization.

3.7.4 Second 1. Prepare more driver cDNA to be used in the second hybridiza-
Hybridization tion by mixing the following in a PCR tube:

RsaI-digested driver cDNA 1 μL

4× hybridization buffer 1 μL
Sterile water 2 μL

2. Heat at 98 °C for 2 min for denaturation of driver cDNA.

3. Mix the two first hybridization samples at 68 °C, add the
denatured driver cDNA, and mix by pipetting up and down
(see Note 25).
4. Continue incubation at 68 °C, overnight.
5. After overnight incubation, add 200 μL of dilution buffer to
the tube and continue incubation at 68 °C for further 5 min
(see Note 26).
6. Store the subtracted product at −20 °C.

3.7.5 First Nested PCR 1. Prepare reactions in 7 PCR tubes, each with the following
components:

Subtracted product 1 μL
10 mM dNTP mix 0.5 μL
10 μM PCR primer 1 1 μL
10× PCR buffer 2.5 μL
Taq DNA polymerase 1U

2. Adjust the final volume of reaction mixture to 25 μL using

sterile distilled water. Mix well by pipetting up and down
gently.
3. Perform the PCR reaction: 5 min at 75 °C for end filling,
followed by 27 cycles of denaturation (94 °C, 30 s), annealing
(66 °C, 30 s), and extension (72 °C, 2 min) in the thermocy-
cler (see Note 27).
4. Resolve 8 μL of PCR product in 2 % (w/v) agarose gel electro-
phoresis. This will give a very faint smear and some bands in
between (Fig. 3).
328 Rupesh Kumar Singh et al.

Fig. 3 First and second PCR amplification of subtracted cDNA. M—marker-TriDye™ 100 bp DNA Ladder

3.7.6 Second PCR 1. Prepare template for second PCR amplification by diluting
Amplification 3 μL of PCR product from each first amplification reaction to
30 μL with sterile distilled water (see Note 28).
2. Set up second PCR reaction in 7 PCR tubes as described below
(see Note 18):

Diluted product from 1st PCR 1 μL

10× PCR buffer 2.5 μL
10 mM dNTP mix 0.5 μL
10 μM nested PCR primer 1 1 μL
10 μM nested PCR primer 2R 1 μL
Taq DNA polymerase 1U

3. Adjust the final volume of reaction mixture to 25 μL using

sterile distilled water.
4. Perform PCR amplification: 30 cycles of denaturation (94 °C,
30 s), annealing (66 °C, 30 s), and extension (72 °C, 2 min) in
the thermocycler.
5. Purify the subtracted PCR product using QIAquick PCR
Purification kit.
6. Resolve 8 μL of PCR product in 2 % (w/v) agarose gel electro-
phoresis (see Note 29).
7. Here the subtracted cDNA is ready for cloning (Fig. 3).
 Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 329

3.8 Construction 1. Mix the following components in a sterile tube (see Note 18).
of Subtracted cDNA
Library Purified subtracted PCR product 100 ng

3.8.1 Ligation 10× T4 DNA ligase buffer 1 μL

of Subtracted Product pGEMT easy cloning vector 250 ng
10 U/μL T4 DNA ligase enzyme 1 μL

2. Adjust the reaction volume to 10 μL with sterile distilled water.

3. Incubate at 16 °C for 24 h in a thermocycler for ligation.

3.8.2 Transformation 1. Thaw an Eppendorf tube containing 200 μL of competent E. coli

of E. coli cells on ice.
2. Add 5 μL of the ligation product to the bacterial suspension
and mix gently by pipetting up and down.
3. Incubate the tube on ice for 30 min.
4. After incubation, give a brief heat shock to the cells in a water
bath at 42 °C for 90 s.
5. Place the tube on ice for 5 min.
6. Add 800 μL LB medium and incubate the culture at 37 °C
with shaking at 100–150 rpm/min for 1 h.
7. Spread 50 μL aliquots of bacterial suspension on LB agar plates
prepared for blue–white colony screening (see Note 30).
8. Incubate the plates at 37 °C. Blue and white colonies normally
appear after overnight incubation (Fig. 4).

Fig. 4 Blue and white colonies on LB agar plates containing IPTG and X-Gal after
24 h incubation at 37 °C
330 Rupesh Kumar Singh et al.

Fig. 5 Colony PCR of white colonies showing varying amplicon size. M—marker-TriDye™ 100 bp DNA Ladder,
P—positive control and lanes 1–21 are bacterial colonies

3.8.3 Screening 1. Prepare a master mix cocktail sufficient for the desired number
of Library by Colony PCR of reactions, each containing the following components and
enough water to bring the volume to 50 μL (see Note 18).

M13 F 1 μL
M13 R 1 μL
dNTPs 1 μL
Taq buffer 5 μL
Taq polymerase 0.2 μL

2. Carefully pick the white colonies using toothpick and transfer

to the PCR tubes containing 50 μL PCR reaction mixture.
3. Mix well by pipetting up and down gently.
4. Amplify the inserts with a hot start at 94 °C for 3 min, fol-
lowed by 35 cycles of denaturation (94 °C, 30 s), annealing
(55 °C, 30 s) and extension (72 °C, 1.5 min), with a final
extension of 5 min at 72 °C in the thermocycler.
5. Resolve 4 μL PCR product on 0.8 % agarose gel to roughly
estimate the insert size (Fig. 5).
6. Store the remaining PCR product at −20 °C which may be
used for sequencing.

3.9 Sequencing 1. Choose clones having equal to or more than 500 bp amplicon
and Sequence size (see Note 31).
Analysis 2. Purify PCR product using QIAquick PCR Purification kit.
3. Purified PCR product can be directly sequenced (see Note 32).
4. We have sequenced the PCR products using M13 F universal
primer in an ABI Prism automated DNA sequencer by single
pass reading.

3.10 Hypothetical 1. Clean up vector sequence and other impurities such as adaptor
Functional Annotation and primer sequences using VecScreen ([Link]
of Genes [Link]/tools/vecscreen/).
 Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 331

Fig. 6 Pie chart depicting functional classification of expressed transcripts identified from the hypericin gland-
specific subtracted library

2. Edited sequences are then analyzed by BLASTx and BLASTn

to assign putative functions on the basis of sequence similar-
ity to genes or proteins of known function in GenBank
([Link]).
3. Assemble the sequences into clusters based on the presence of
overlapping, identical or similar sequences.
4. In our case, a total of 300 ESTs were analyzed in GenBank and
their putative functions are assigned.
5. Some sequences do not give any homology with the available
database and these are treated as unknown/novel genes.
6. All these ESTs with significant homology with previously
reported genes and others with unknown functions are sum-
marized in a pie diagram (Fig. 6).

4 Notes

1. Steps 4–7 should be carried out inside the laminar airflow

chamber.
2. Avoid skin contact to bleach. Commercial bleach can vary in
active chlorine content. Make sure to check the product label
and adjust dilution to obtain a 1.5 % (v/v) final concentration
of active chlorine.
3. Before use, mortar and pestle must be wiped with 70 % ethyl
alcohol, cleaned properly with RNAse-free water, and dried in
hot air oven overnight to avoid contamination.
332 Rupesh Kumar Singh et al.

4. Ensure to add 2 % βMe to the pre-warmed buffer. After adding

βMe, all the steps should be performed inside fume hood
chamber to avoid spillage in air.
5. Alternatively, RNA can be precipitated by incubating the tubes
at −80 °C for 4 h.
6. Once dissolved, take 1–2 μL from each sample in another tube
for quantification. Rest of the samples must be frozen quickly
in liquid nitrogen and stored immediately at −80 °C to avoid
degradation.
7. For our samples, the ratio of absorbance at 260/280 nm was
2.1, which represent an excellent quality of RNA. Generally,
the concentration is about 2 μg/μL. When RNA concentra-
tion is too high, it is better to dilute the sample and then cal-
culate the quantity accordingly.
8. For this method of mRNA purification, the total RNA concen-
tration must be more than 1 μg/μL. Although other methods
of mRNA purification are possible, using this method would
result in mRNA devoid of rRNA contamination, which is good
for downstream sequencing.
9. RiboMinus probe is specific for conserved regions of the large
cytosolic and chloroplast rRNA transcripts. Each probe is sin-
gle stranded and contains 3′ LNA™ (Locked Nucleic Acid)
monomers incorporated at specific locations. The incorpora-
tion of LNA into the oligonucleotide probe increases the
rRNA-probe stability.
10. This would facilitate the binding of RiboMinus probe to cyto-
solic and chloroplast rRNA transcripts.
11. Do not cool down by keeping the tubes on ice. Changing the
temperature of the water bath to 37 °C without disturbing the
tubes would allow the samples to cool gradually.
12. Follow the manufacturer’s protocol for the preparation of
beads suspended in hybridization buffer.
13. As the 5′ end of each RiboMinus probe is conjugated to biotin,
rRNA/probe complexes bind to streptavidin RiboMinus™
Magnetic Beads. To facilitate binding of more rRNA/probe
complexes to the beads, incubation time may be increased to
20 min and the tubes can be gently tapped every 5 min during
incubation.
14. Large cytosolic and chloroplast rRNA transcripts bound with
RiboMinus probes are now precipitated with magnetic beads.
15. For our preparation, the 260/280 ratio is 2.0 and the concen-
tration is 500 ng/μL.
16. Proceed to cDNA synthesis immediately because mRNA may
degrade very fast. Therefore, it is always recommended to con-
vert mRNA into cDNA before storing.
Construction of Hypericin Gland-Specific cDNA Library via Suppression Subtractive… 333

17. It is important to maintain the volume of 4 μL. If needed, use

RNase-free water to make up the volume.
18. Enzyme should be added finally. After adding enzyme, mix the
reaction mixture gently by pipetting up and down and bring
the solution to the bottom by brief centrifugation.
19. This should be performed inside the fume hood chamber to
avoid spillage in air.
20. For our preparation, the 260/280 ratio was 1.8 and the con-
centration was 35 ng/μL for each sample.
21. Make sure that no trace of ethyl alcohol is left in the tube.
22. For our preparation, the 260/280 ratio was 1.8 and the con-
centration was 250 ng/μL for each sample.
23. If proceeding to hybridization immediately, the tubes can be
maintained on ice.
24. Annealing results in tester–tester homohybrid, tester–driver het-
erohybrid, double-stranded driver, single-stranded driver, and
single-stranded tester in both reactions. Due to the second order
of hybridization kinetics, generating homohybrid and heterohy-
brid cDNAs is faster for more abundant molecules than anneal-
ing of the less abundant cDNAs that remain single-stranded.
25. Mixing of first hybridization samples with denatured drivers
should be very quick. Under these conditions, only single
stranded type cDNAs are able to reassociate and form tester–
tester homohybrids, tester–driver heterohybrids, and new tes-
ter–tester heterohybrids. The later hybrids are double-stranded
tracer molecules with different single-stranded ends, one of
which corresponds to adaptor 1 and another to adaptor 2R.
26. Here the subtraction process is over and the subtracted prod-
uct has the genes specific to hypericin glands.
27. After filling in the ends, the differentially expressed tester
sequences will have different primer binding at 5′ and 3′ ends
28. Store the rest of the PCR product at −20 °C for future use.
29. Show a clear smear with some bands in between.
30. Prepare LB medium with 1.5 % agar. Once the medium reached
about 60 °C, add 50 mg/L ampicillin and pour 20 mL medium
in each petri dish. Once solidified, spread 10 μL of IPTG and
40 μL of X-Gal on the surface of the medium. IPTG and X-Gal
should be spread at least 10 min before plating bacteria so that
they will be absorbed properly by the medium.
31. Inserts of 300–500 bp size are good for sequencing. Since
amplification with M13 universal primer includes approxi-
mately 150 bp from the vector sequence, the clones having
more than 500 bp amplicon must carry 250 bp from the
cDNA.
32. Alternatively plasmids can be isolated and sequenced.
334 Rupesh Kumar Singh et al.

Acknowledgment

This work was supported by Fundação para a Ciência e a Tecnologia

project (PTDC/AGR-GPL/119211/2010). We acknowledge Dr
Caroline J Sheeba, ICVS, University of Minho for critically reading
and commenting on the manuscript.

References
1. Guedes AP, Franklin G, Ferreira MF (2012) and antimicrobial protection upon biotic
Hypericum sp.: essential oil composition and stress. Phytochemistry 70:60–68
biological activities. Phytochem Rev 8. Zobayed SMA, Afreen F, Goto E, Kozai T
11:127–152 (2006) Plant–environment interactions: accu-
2. Karioti A, Bilia AR (2010) Hypericins as mulation of hypericin in dark glands of
potential leads for new therapeutics. Int J Mol Hypericum perforatum. Ann Bot 98:793–804
Sci 11:562–594 9. Kornfeld A, Kaufman PB, Lu CR, Gibson
3. Nafee N, Youssef A, Hanan EG, Heba A, DM, Bolling SF, Warber SL, Chang SC,
Sherif K (2013) Pharmaceutical nanotechnol- Kirakosyan A (2007) The production of
ogy antibiotic-free nanotherapeutics: hypericin hypericins in two selected Hypericum perfora-
nanoparticles thereof for improved in vitro and tum shoot cultures is related to differences in
in vivo antimicrobial photodynamic therapy black gland structure. Plant Physiol Biochem
and wound healing. Int J Pharm 454: 45:24–32
249–258 10. Franklin G, Oliveira M, Dias ACP (2007)
4. Cole WR, Mostofsky SH, Larson JC, Denckla Production of transgenic Hypericum perfora-
MB, Mahone EM (2008) Age-related changes tum plants via particle bombardment-medi-
in motor subtle signs among girls and boys ated transformation of novel organogenic cell
with ADHD. Neurology 71:1514–1520 suspension cultures. Plant Sci 172:1193–1203
5. Bruni R, Sacchetti G (2009) Factors affecting 11. Franklin G, Dias ACP (2011) Chlorogenic
polyphenol biosynthesis in wild and field acid participates in the regulation of shoot,
grown St. John’s Wort (Hypericum perforatum root and root hair development in Hypericum
L. Hypericaceae/Guttiferae). Molecules 14: perforatum. Plant Physiol Biochem 49:
682–725 835–842
6. Conceição LFR, Ferreres F, Tavares RM, Dias 12. Ayan AK, Cirak C, Kevseroglu K, Ozen T
ACP (2006) Induction of phenolic com- (2004) Hypericin in some Hypericum species
pounds in Hypericum perforatum L. cells by from Turkey. Asian J Plant Sci 3:200–202
Colletotrichum gloeosporioides elicitation. 13. Karppinen K, Hokkanen J, Mattila S, Neubauer
Phytochemistry 67:149–155 P, Hohtola A (2008) Octaketide producing
7. Franklin G, Conceição LFR, Kombrink E, type III polyketide synthase from Hypericum
Dias ACP (2009) Xanthone biosynthesis in perforatum is expressed in dark glands accu-
Hypericum perforatum cells provides antioxidant mulating hypericins. FEBS J 275:4329–4342
 Chapter 23

In Vitro and Cryopreservation Techniques

for Conservation of Snow Mountain Garlic
Ritu Mahajan

Abstract
Garlic is an important medicinal herb of culinary value by imparting its flavors and odors to the food.
Allicin, a notable flavonoid in garlic, is a powerful antibiotic and antifungal compound. Due to poor bio-
availability, garlic is of limited use for oral human consumption. Being sexually sterile, propagation of garlic
is done by individual cloves from a bulb which increases the chances of transfer of viral diseases. In this
chapter, an efficient and improved regeneration protocol for explant establishment and shoot multiplica-
tion under in vitro conditions is described. A high rate of shoot multiplication is obtained on MS medium
supplemented with 0.5 mg/l BAP, 1.0 mg/l KN, and 2.0 mg/l GA3. Addition of 1.0 mg/l NAA to MS
medium resulted in rooting at the shoot bases. A detailed method for encapsulation of explant in sodium
alginate beads and their cryopreservation using encapsulation-dehydration is also described.

Key words Garlic, In vitro, Micropropagation, Conservation, Cryopreservation, Encapsulation

1 Introduction

Garlic (Allium sativum), belonging to family Alliaceae, is a poten-

tial herb of nutraceutical value and is widely cultivated for its
medicinal importance, which is due to the presence of number of
secondary metabolites [1]. It is used to enhance the flavor of foods
and also to prevent age-related problems like cardiovascular and
Alzheimer’s disease [2]. The plant has antibiotic, antiaging, antitu-
mor, and antiantherosclerosis value, besides having antioxidant,
antifungal, and antibacterial properties [3, 4]. The antimicrobial
property is due to the presence of allicin (allyl 2-propene thiosul-
finate) which is formed by the action of allinase enzyme [5, 6].
Besides being rich in phenolics and flavonoids, garlic also contains
some sulfur-containing compounds such as alliin, S-allylcysteine,
and diallylsulfide [7, 8].
Snow Mountain Garlic (also called as Kashmiri garlic), an
important herb, is found in the snow-covered mountains of the
Himalayas at high altitudes (6000 ft). It can survive at extremely

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_23, © Springer Science+Business Media New York 2016

335
336 Ritu Mahajan

low temperatures of −10 °C. In ancient times, this garlic was used
by the mountaineers to raise their energy levels and also to detoxify
their body in extreme cold weather conditions. It is generally con-
sumed by local people as a remedy for rheumatoid arthritis.
Garlic is sexually sterile, so the conventional method of multi-
plication is through vegetative propagation which is less efficient as
the rate of the propagation is low (approx. 5–10 %). The method is
labor intensive as it takes many years to produce sufficient number
of seed bulbs for the cultivation of a new variety [9]. This necessi-
tates establishment of a protocol for in vitro propagation for shoot
induction and proliferation. This method is an important tool in
conservation as it produces a large number of genetically alike
plants that can be cultivated from only one single plant stock [10,
11]. Ex situ conservation techniques like cryopreservation is a safe
strategy for long-term preservation so as to avoid chilling injury
and dehydration injury to the plants that remain viable for a short
time and also for plant species that are endangered and threatened
[12–14].

2 Materials

2.1 Plant Material Cloves of snow mountain garlic are collected from Kashmir Valley
and used for all the experiments (Fig. 1).

2.2 Equipments 1. Hot plate.

and Apparatus 2. PH meter.
3. Autoclave.
4. Laminar flow chamber.

Fig. 1 Cloves of snow mountain garlic

 In Vitro and Cryopreservation Techniques for Conservation of Snow Mountain Garlic 337

5. Water distillation unit.

6. Water Millipore system.
7. Refrigerator.
8. Deep freezer (−20 °C).
9. Water bath.
10. Cryocan (50 L).
11. Analytical weighing balance (milligram to few grams).
12. Incubator shaker.

2.3 Preparation Prepare all the reagents of analytical grade at room temperature
of Reagents using autoclaved double distilled water and store them in the
refrigerator (4 °C).

2.3.1 Media Preparation 1. MS media (see ref. 15), (see Table 1) (see Notes 1 and 2).
2. Stock solutions of BAP (benzyl amino purine), kinetin
(6-furfuryl amino purine), NAA (naphthalene acetic acid),
GA3 (gibberellic acid).
3. Autoclaved flasks (250 ml, 500 ml, and 1000 ml).
4. Autoclaved reagent bottles (100 ml, 250 ml, and 500 ml).
5. Measuring cylinders (100 ml, 500 ml, and 1000 ml).
6. Micropipettes (0.5–100 μl, 20–1000 μl).
7. Sterilized microtips.
8. Cotton plugs.
9. Buffers (pH 4.0, 7.0, 9.0).
10. 1.0 N NaOH/1.0 N HCl.
11. Glass rod.
12. Lab markers.

2.3.2 Explant Preparation 1. Stainless steel sterile forceps (7 ″ and 11″).

and In Vitro Multiplication 2. Scalpel handle (No. 3; 5 in.).
3. Sterile surgical blades (11 No.).
4. Sterile petri plates (100 × 20 mm).
5. Autoclaved flasks 250 ml.
6. Autoclaved beakers (100 ml).
7. Autoclaved culture tubes (20 × 150 mm).
8. 0.2 % Tween 20.
9. 0.5 % mercuric chloride.
10. 70 % ethanol.
11. KMnO4 1 ppm.
338 Ritu Mahajan

Table 1
Composition of Murashige and Skoog medium [15]

Macrosalts (mg/lit)
(NH4)NO3 1650
KNO3 1900
CaCl2·2H2O 440
MgSO4·7H2O 370
KH2PO4 170
Microsalts
FeSO4·7H2O 27.8
Na2EDTA·2H2O 37.2
MnSO4·4H2O 22.3
ZnSO4·7H2O 8.6
H3BO3·7H2O 6.2
KI 0.83
Na2MoO4·2H2O 0.25
CuSO2·5H2O 0.025
CoCl2·6H2O 0.025
Vitamins
Glycine 2.0
Nicotinic acid 0.5
Pyridoxine HCl 0.5
Thiamine HCl 0.1
Myo-inositol 100
Sucrose 30,000
Agar 7%

12. Disinfectant for hand sanitization.

13. Thermocol cups.
14. Test tube stand.
15. Plastic pots 5″.

2.3.3 Cryopreservation 1. Liquid MS media.

Components 2. 3 % sodium alginate (w/v) in liquid MS media at pH 5.7 (see
Note 3).
3. Shoot tips from 8-week-old in vitro-grown snow mountain
garlic plants.
 In Vitro and Cryopreservation Techniques for Conservation of Snow Mountain Garlic 339

4. 100 mM CaCl2.
5. 0.4 M sucrose.
6. Recovery media (MS medium without growth regulators).
7. Autoclaved forceps and scalpel handle with sterilized blade.
8. Cryovials (2.0 ml).
9. Cryostrips.
10. Cryogloves.
11. Sterile petri plates (60 × 15 mm).
12. Liquid nitrogen.
13. 70 % ethanol.
14. Parafilm.
15. Whatman No. 1 filter paper.
16. Thermometer.
17. Timer.
18. Double distilled water.
19. Cryobox (4 °C).

3 Methods

3.1 MS Medium 1. Mix all the stock solutions (macro nutrients, micronutrients,
for Micropropagation Fe-EDTA, and vitamins) in 600 ml distilled water in 1 L flask
and Organogenesis (see Note 1; Table 1).
2. Add 100 mg myoinositol and 30 gm sucrose in the flask. Stir
with a glass rod.
3. Make the final volume to 1 L with distilled water.
4. Adjust the pH to 5.8 by adding 0.1 N HCl or 0.1 N NaOH.
5. Add 7 % agar, mix well, and boil the solution till it becomes
homogeneous.
6. For liquid MS medium agar is not added.
7. For shoot multiplication, add BAP (0.1 mg/l, 0.5 mg/l, and
1.0 mg/l) and kinetin (0.1 mg/l, 0.5 mg/l, and 1.0 mg/l) to
solid MS medium. The concentration of GA3 is kept constant
(2.0 mg/l).
8. For root induction add NAA (0.1 mg/l, 0.5 mg/l, and
1.0 mg/l) to solid MS medium.
9. Dispense the medium in flask and test tubes, seal them with
cotton plugs, and autoclave (see Note 2).
10. After autoclaving store the culture vessels (flasks and test tubes)
at 25 °C in dust-free closed cabinet.
340 Ritu Mahajan

3.2 Preparation 1. Wipe the floor of the laminar flow chamber with ethanol, keep
of Explant all the glassware (culture vessels, flasks, petri plates, and bea-
kers), forceps, and scalpel with surgical blades inside the cham-
ber, and switch on the UV light for 15–20 min.
2. Remove the outer, dry, papery bulb scales of the healthy cloves
using forceps.
3. Wash the cloves with two to three drops of Tween 20 in 100 ml
distilled water for 10–15 min and then rinse them twice for
5–10 min with distilled water in laminar flow chamber.
4. Surface-sterilize cloves by washing them in 70 % ethanol for
20–30 sec, KMnO4 (1 ppm for 2 min) and then with 0.5 %
HgCl2 for 3 min, containing two drops of Tween 20 per
100 ml in an autoclaved beaker. Again wash the cloves three
times for 2 min in autoclaved distilled water.

3.3 Establishment 1. Excise the shoot bases of the cloves aseptically inside a laminar
of Aseptic Cultures flow chamber, with sterile surgical blades (see Note 4).
2. Inoculate the explants on basal MS media (without growth hor-
mones) in the flasks for their initial establishment (Fig. 2a, b).
3. Incubate the cultures in the flasks at 25 ± 2 °C and 50–60 μmol/
m2/s (light intensity) for 3–4 weeks and monitor them for the
presence of any contamination.

3.4 Shoot 1. After the initial aseptic establishment of cultures, transfer the
Multiplication shoot cultures on to MS medium containing 0.5 mg/l BAP,
1.0 mg/l KN, and 2.0 mg/l GA3 (see Note 5).
2. After 4 weeks shoot multiplication will occur (Fig. 3a, b).
Record the data. Maintain the shoot cultures by regular sub-
culturing at an interval of every 2–3 weeks. Take every possible
care to prevent any further contamination.

3.5 Rooting 1. Separate the shoots (7–8 cm) and culture them singly on the
and Acclimatization MS medium containing 1.0 mg/l NAA in the test tubes for
root induction (Fig. 4a).
2. After 4 weeks, take out the plants having well developed roots
(Fig. 4b) and wash them gently with running tap water so as to
remove all the media sticking to them.
3. Place plants on the cotton, dipped in autoclaved distilled water,
on a tray and keep them in the culture room for 1 week at
25 ± 2 °C.
4. Transfer the rooted plantlets in the pots containing autoclaved
sand and soil in the ratio 1:3 and cover the plants with glass jars
so that around 60–70 % humidity is maintained (see Note 6).
5. Keep the plants in the glasshouse and after 2 weeks remove the
jars. Allow the plants to grow further for 7–8 weeks in the
glasshouse and subsequently transfer them to the field.
 In Vitro and Cryopreservation Techniques for Conservation of Snow Mountain Garlic 341

Fig. 2 (a) Shoot initiation from the explant inoculated on basal MS medium. (b) Shoot elongation on MS
medium supplemented with growth hormones

Fig. 3 Shoot multiplication in (a) MS medium supplemented with 0.1 mg/l BAP, 0.1 mg/l KN (b) MS medium
supplemented with 0.5 mg/l BAP, 1.0 mg/l KN, and 2.0 mg/l GA3
342 Ritu Mahajan

Fig. 4 (a) Root initiation from the shoots on MS medium supplemented with 1.0 mg/l (b) Well developed roots
after 4 weeks

3.6 Encapsulation- 1. Excise the shoot tips from 8-week-old in vitro-grown plants of
Dehydration snow mountain garlic in laminar flow chamber.
2. Encapsulate the explants (shoot tips) into alginate beads in 3 %
sodium alginate (w/v) in liquid MS media at pH 5.7 (see
Fig. 4a, see Note 7).
3. Allow the beads to polymerize in MS medium for 30 min with
100 mM CaCl2 solution. Pretreat the beads with liquid MS
medium containing 0.4 M sucrose solution for 48 h in a rotary
shaker (50 rpm) at 25 °C (see Note 8).
4. Blot the beads dry on sterile Whatman’s filter paper and desic-
cate them for 6 h (approx. 20 % moisture content) in a glass
petri plate under laminar flow (0.6 m/s) at 24–25 °C and
35 ± 2 % relative humidity (see Note 9).
5. Place the dried beads into 1.2 ml autoclaved cryovials (10
beads per cryovial). Plunge the cryovials directly into liquid
nitrogen (see Note 10).
6. Thaw the cryovials at 45 °C in distilled water maintained at
25 °C for 1 min in a water bath (see Note 11). Shake the cryo-
vials vigorously during thawing for 1.5 min so as to prevent
crystal formation.
 In Vitro and Cryopreservation Techniques for Conservation of Snow Mountain Garlic 343

Fig. 5 (a) Explants encapsulated in alginate beads (b) Shoots emerging from encapsulated explant in the petri
plate containing MS media with 0.5 mg/l BAP and 0.5 mg/l KN

7. Wipe the cryovials to remove excess water and then wipe them
with 70 % ethanol.
8. Transfer the cryopreserved beads in liquid MS medium and
rehydrate them for 5 min.
9. Transfer the beads onto recovery medium in petri plates.
10. Keep the petri plates in diffused light 36 μmol/m2s for 5 days
at 25 ± 2 °C and then transfer them to normal light conditions
(see Note 12).
11. Check the petri plates for the greening of explants after 2 weeks
of post culture.
12. After 3 weeks transfer the beads with green explants to flasks
containing MS media supplemented with BAP (0.5 mg/l) and
KN (0.5 mg/l) (Fig. 5b).
13. Subculture the elongated shoots for shoot multiplication on
MS medium containing 0.5 mg/l BAP and 1.0 mg/l kinetin.

4 Notes

1. MS media is most commonly used as solid, semisolid, and liq-

uid. Prepare stock solutions of all macronutrients, micronutri-
ents, Fe-EDTA, and vitamins in reagent bottles (250 ml) and
store at 4 °C. Similarly prepare the stock solutions of plant
growth regulators (stock 1 mg/L) in 100 ml reagent bottles
and store at 4 °C. Some medium components such as amino
acids and vitamins are heat labile and get destroyed on auto-
claving, so sterilize them by filtration through filter membranes
(0.22–0.45 μm).
2. Autoclaving is highly effective and the commonly used method
for sterilization of culture medium, glassware, distilled water, and
344 Ritu Mahajan

tissue culture tools. The intense heat generated from steam kills
all bacteria, viruses, fungal spores by hydrolyzing their proteins.
3. Both 3 % sodium alginate and 100 mM CaCl2 are most suit-
able for bead formation. When sodium alginate is added to
CaCl2 solution, the calcium ions cross-link the polymers of
alginate. This cross-linking creates a soft solid gel bead. Beads
formed using lower concentration of sodium alginate (1.5 %)
and 50 mM CaCl2 are too fragile to handle, while beads formed
from a high concentration of sodium alginate (5.0 %) are too
hard for conversion of explants to plantlets.
4. A totipotent explant should be taken for in vitro culture which
can be from any part of the plant including portions of shoots,
leaves, stems, flowers, roots, and single, undifferentiated cells,
as the aerial parts are highly contaminated with soil microflora.
In present work both shoot disk, which is full of meristematic
tissue, and whole garlic clove are used as explants.
5. Different concentrations and combinations of plant growth regu-
lators are used in plant tissue culture for both shoot initiation and
shoot multiplication. In our experiment we get best results for
shoot multiplication when the MS media is supplemented with
0.5 mg/l BAP, 1.0 mg/l KN, and 2.0 mg/l GA3 (see ref. 16).
6. When shoots or plantlets are transplanted from culture room
to the greenhouse conditions, they may desiccate or wilt rap-
idly and can die due to the change in environment. So the
rotted plants are covered with the jar so as to maintain the
humidity (see Ref. 17).
7. Suspend the explants in alginate solution and then pick a single
explant along with some alginate solution using a sterile pipette
and slowly dispense it in 100 mM CaCl2 solution. The explant
gets encapsulated in alginate beads. Allow the beads to polym-
erize for 30 min and dispense them in hormone-free liquid MS
medium containing 0.4 M sucrose.
8. The beads are treated with different concentrations of sucrose
solution prior to cryopreservation so that its accumulation will
increase the stability of cell membrane during severe dehydra-
tion conditions (see ref. 18). In our experiment, the highest
survival rate is obtained by treating the beads with 0.4 M
sucrose solution (see ref. 16).
9. The beads are dehydrated in the air current of laminar flow or
the beads are kept in air-tight container containing silica gel or
in a stream of compressed air (see ref. 19) so as to remove the
excess of water from the tissues. The cells have to be suffi-
ciently dehydrated as too much dehydration increases the tox-
icity as internal solutes become concentrated (see ref. 20).
10. Rapid cooling of cryovials in the liquid nitrogen results in the
formation of microcrystals (from internal solutes of the tissue
 In Vitro and Cryopreservation Techniques for Conservation of Snow Mountain Garlic 345

or cell) that maintains the integrity and osmotic balance of the

tissues (see ref. 21).
11. Rapid thawing is necessary so as to avoid the re-crystallization
of the solutes present internally and which can damage the cell
membranes (see ref. 22).
12. The petri plates containing beads are kept in the darkness or
diffused light for 5–7 days after cryopreservation for prevent-
ing photo-oxidation of the explants which could be harmful to
the plant material (see ref. 23).

Acknowledgement

This work was supported by School of Biotechnology, University

of Jammu, Jammu, India

References

1. Okigbo RN, Anuagasi CL, Amadi JE, Ukpabi 10. Musallam I, Duwayri M, Shibli RA (2011)
UJ (2009) Potential inhibitory effects of some Micropropagation of caper (Capparis spinosa
African tuberous plant extracts on Escherichia L.) from wild plants. Funct Plant Sci Biotechnol
coli, Staphylococcus aureus and Candida albi- 5:17–21
cans. Int J Integrat Biol 6:91–98 11. Qudah TS, Shibli RA, Alali FQ (2011) In vitro
2. Borek C (2006) Garlic reduces dementia and propagation and secondary metabolites in wild
heart-disease risk. J Nutr 136:810S–812S germander (Teucrium polium L.). In Vitro
3. Dhawan V, Jain S (2005) Garlic supplementa- Cell Dev Biol 47:496–505
tion prevents oxidative DNA damage in essential 12. Sakai A, Engelmann F (2007) Vitrification,
hypertension. Mol Cell Biochem 275:85–94 encapsulation-vitrification and droplet-
4. Chung LY (2006) The antioxidant properties vitrification. Cryo Letters 28:151–172
of garlic compounds: allyl cysteine, alliin, alli- 13. Reed BM (2008) Cryopreservation—practical
cin, and allyl disulfide. J Med Food considerations. In: Reed BM (ed) Plant cryo-
9:205–213 preservation: a practical guide. Springer,
5. Ankri S, Mirelman D (1999) Antimicrobial New York, pp 3–13
properties of allicin from garlic. Microbes 14. Kaviani B (2011) Conservation of plant
Infect 1:125–129 genetic resources by cryopreservation. Am
6. Ross ZM, Maslin DJ, Hill DJ (2000) The J Crop Sci 5:778–800
effect of steam distilled garlic oil on lactic acid 15. Murashige T, Skoog F (1962) A revised medium
and other enteric bacteria. Fourth symposium for rapid growth and bioassays with tobacco
on European microbiological societies. FEMS tissue cultures. Physiol Plant 15:473–497
Microbiol Rev 12:137 16. Mahajan R, Sharma K, Bandryal S, Jamwal P,
7. Hughes J, Tregova A, Tomsett AB, Jones MG, Billowria P (2013) In vitro propagation and
Cosstick B, Collin HA (2005) Synthesis of the cryopreservation of Snow Mountain Garlic
flavour precursor, alliin, in garlic tissue cul- endemic to Himalayan region. Int J Adv
tures. Phytochemistry 66:187–194 Biotechnol Res 4:372–379
8. Olusanmi MJ, Amadi JE (2009) Studies on 17. Kumar K, Rao IU (2012) Morphophysiological
the antimicrobial properties and phytochemi- problems in acclimatization of micropropa-
cal screening of garlic (Allium sativum) gated plants in—ex vitro conditions—a review.
extracts. Ethnobot Leaflets 13:1186–1196 J Ornamental Hort Plants 2:271–283
9. Nagakubo T, Nahasaga A, Ohkawa H (1993) 18. Crowe JH, Crowe LM, Chapman D (1984)
Micropropagation of garlic through in vitro Preservation of membranes in anhydrobiotic
bulblet formation. Plant Cell Tiss Org Cult organisms: the role of trehalose. Science
32:175–183 223:701–703
346 Ritu Mahajan

19. Engelmann F (2000) Importance of cryopreser- 22. Muldrew K, Acker JP, Elliot JAW, McGann LE
vation for the conservation of plant genetic (2004) The water to ice transition: implica-
resources. In: Engelmann F, Takagi H (eds) tions for living cells. In: Fuller BJ, Lane N,
Cryopreservation of tropical plant germplasm: Benson EE (eds) Life in the frozen state. CRC
current research progress and application. Press LLC, Florida, pp 67–108
JIRCAS/IPGRI, Tsukuba/Rome, pp 8–20 23. Benson EE, Harding K, Smith H (1989)
20. Engelmann F (1991) In vitro conservation of Variation in recovery of cryopreserved shoot-
tropical plant germplasm—a review. Euphytica tips of Solanum tuberosum exposed to different
57:227–243 pre- and post-freeze light regimes. Cryo
21. Sharma SD (2005) Cryopreservation of Letters 10:323–344
somatic embryos—an overview. Indian
J Biotechnol 4:47–55
 Chapter 24

In Vitro Callus Induction and Plant Regeneration from Stem

Explants of Ceropegia noorjahaniae, a Critically
Endangered Medicinal Herb
Jaykumar J. Chavan and Mahendra L. Ahire

Abstract
An efficient protocol has been developed for in vitro regeneration of a large number of plantlets of
Ceropegia noorjahaniae Ansari via indirect organogenesis from stem explants excised from in vitro-
germinated seedlings. The callus was efficiently induced from the stem explants using Murashige and
Skoog (MS) medium supplemented with auxins and their combinations. The highest number of shoots
(16.0 ± 0.2) and shoot length (5.5 ± 0.1 cm) was achieved when the callus was subcultured to MS medium
supplemented with 6-benzylaminopurine, BAP (2.0 mg/l) and indole-3-acetic acid, IAA (0.2 mg/l). The
in vitro-developed shoots were rooted well in half-strength MS medium supplemented with 1.0 mg/l of
indole-3-butyric acid (IBA) and 0.3 mg/l of α-naphthalene acetic acid (NAA). The plantlets were success-
fully hardened with 82 % survival rate. This is the first report on the regeneration of plants through indi-
rect shoot organogenesis from stem derived calli of C. noorjahaniae.

Key words Acclimatization, C. noorjahaniae, Callus culture, Critically endangered, Medicinal herb,
Organogenesis

1 Introduction

Ceropegia L. (Apocynaceae, APG III-2009) is one of the largest

genera with more than 220 species distributed in tropical and sub-
tropical regions of the world [1]. The maximum diversity of
Ceropegia occurs in South Africa followed by Kenya, Madagascar,
and Indian subcontinent [2]. In India, there seems to be two
major distribution zones for this genus, viz., the Himalayan region
and the Western Ghats, two mega-biodiversity centers of the
world. The species of Ceropegia as a whole are under threat, owing
to either destructive collection or habitat degradation. Most of
the Ceropegia species have morphologically unique flowers and
hence few of them are cultivated in Europe and the USA [3, 4].
Tubers of Ceropegias are storehouse of starch, sugars, gum,
albuminoids, fats, crude fiber, and other valuable phytoconstituents.

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_24, © Springer Science+Business Media New York 2016

347
348 Jaykumar J. Chavan and Mahendra L. Ahire

The starchy tubers are a good source of nutritive tonic [ 5 ].

The pharmacological importance of the genus is also due to the
presence of a pyridine alkaloid, cerpegin which has several pharma-
cological properties [6].
Ceropegia noorjahaniae Ansari is one of endemic and critically
endangered species of the Western Ghats, India. The plant is well
known for its edible tubers and ornamental flowers. A typical habi-
tat of this plant is found along the slopes of Western Ghats in well-
drained rocky-gravelly soil above 1000 m altitude. Being endemic,
scarcity of pollinators and poor seed setting are the chief causes in
its declining numbers, leading to a continuous reduction of its
natural population [7]. High frequency multiplication through
plant tissue culture technique would minimize the damage to rem-
nant populations. There are several reports on direct shoot organ-
ogenesis in Ceropegia species (including C. noorjahaniae) using
nodal explants [8]. However, very little work has been carried out
on indirect shoot organogenesis of Ceropegia spp. In this context,
an efficient indirect shoot organogenesis and plant regeneration
system has been developed using stem explants of in vitro-
germinated seedlings of C. noorjahaniae.

2 Material

2.1 Plant Material 1. The mature follicles of C. noorjahaniae are collected directly
from the plants growing along the hilly slopes in the northern
Western Ghats.

2.2 In Vitro Seed 1. Fresh Tween 20 solution (1 % Tween 20) (see Note 1).
Germination 2. Fresh mercuric chloride solution (0.1 % HgCl2) (see Note 2).
3. Murashige and Skoog (MS) [9] medium stock solutions
(Table 1). Store in the freezer or cold room at 4 °C (see Note 3).
4. Agar (plant tissue culture grade).

2.3 Callus Induction 1. Stock solutions (10 mg/100 ml) of 6-benzylaminopurine

and Shoot (BAP), 2,4-dichlorophenoxy acetic acid (2,4-D), indole
Regeneration butyric acid (IBA), and NAA (α-naphthaleneacetic acid) (see
Note 4) and store in the freezer at −20 °C.

2.4 Rooting 1. One plastic pots (4.5 cm high).

and Acclimatization 2. Coco peat (see Note 5).
3. Fine-sieved sterilized sand (see Note 6).
4. Polythene bags (15 × 8 cm) filled with garden soil (see Note 7).
 In Vitro Callus Induction and Plant Regeneration from Stem Explants of Ceropegia… 349

Table 1
Chemical composition of Murashige and Skoog’s basal medium for plant tissue culture

Sr. no Constituents MS medium (mg/l) Stock (mg/100 ml) Stock required for 1 L
I Macronutrient stock
NH4NO3 1650 16,500 10 ml
KNO3 1900 19,000
MgSO4·7H2O 370 3700
KH2PO4 170 1700
II CaCl2 stock
CaCl2·2H2O 440 4400 10 ml
III KI stock
KI 0.83 83 10 ml
IV Micronutrient stock
H3BO3 6.2 620 1 ml
MnSO4·4H2O 22.3 2230
ZnSO4·7H2O 8.6 860
CuSO4·2H2O 0.025 2.5
CoCl2·6H2O 0.025 2.5
V Na2MoO4 stock
Na2MoO4 0.25 25 1 ml
VI Iron stock
Na2EDTA 37.6 752 10 ml
FeSO4·7H2O 27.8 556
VII Vitamins + Amino acids stock
Glycine 2.0 40 5 ml
Nicotinic acid 0.5 10
Pyridoxine HCl 0.5 10
Thiamine HCl 0.1 4

3 Methods

3.1 Plant Material 1. Collect mature follicles of C. noorjahaniae and separate seeds
and Seed Germination from the follicles.
2. Air-dry the seeds and store in paper bags at 23–25 °C and
30–50 % relative humidity (RH).
3. Place the seeds in 100 ml flask, wash with liquid detergent
(1 %, Tween 20) for 10 min with constant shaking followed by
repeated rinsing with distilled water.
4. Treat the seeds with 0.1 % HgCl2 for 5 min followed by rinsing
thrice with sterilized distilled water (see Note 8).
5. Transfer individual seeds in culture tubes containing
phytohormone-free Murashige and Skoog (MS) [9] medium
(Fig. 1a).
350 Jaykumar J. Chavan and Mahendra L. Ahire

Fig. 1 Callus induction and plant regeneration in C. noorjahaniae; (a) In vitro seed germination (1/2 MS basal
medium); (b) callus induction and proliferation from internode explants on MS + 2,4-D (2.0 mg/l); (c, d) shoot
induction and multiplication on MS + BAP (2.0 mg/l) + IBA (0.2 mg/l); (e) in vitro rooting on ½ MS + IBA
(1.0 mg/l) + NAA (0.3 mg/l) and (f) hardened plants

3.2 Callus Induction 1. Use stem segments (internodes) from in vitro-grown shoots as
and Proliferation a source of explant for callus induction and proliferation.
2. Cut explants into appropriate sizes (1 cm) and culture on MS
medium with 2.0 mg/l 2,4-D.
3. Subculture calli at 4-week interval on to the same or other
medium for further proliferation (Fig. 1b; Table 2).
 In Vitro Callus Induction and Plant Regeneration from Stem Explants of Ceropegia… 351

Table 2
Effect of various concentrations and combinations of 2,4-D and BAP on
callus induction from stem explants of C. noorjahaniae

Callus induction
2,4-D (mg/l) BAP (mg/l) frequency (%) Remark
0.0 0.0 0.0 No callus induction
0.5 0.0 55 Cream yellow, compact
1.0 0.0 60 Cream yellow, compact
1.5 0.0 75 White, friable
2.0 0.0 80 Yellowish green, friable
2.5 0.0 60 Brownish, compact
3.0 0.0 53 Brownish, compact
2.0 0.2 70 Yellowish, soft
2.0 0.4 75 Pale yellow, soft
2.0 0.6 50 Pale yellow, semihard
2.0 0.8 50 Pale yellow, semihard

3.3 Adventitious 1. To evaluate the effect of plant growth regulators (PGRs) on

Shoot Induction shoot regeneration, transfer callus (approx. 200 mg), devel-
and Multiplication oped on optimum proliferation medium (2.0 mg/l 2,4-D), to
MS medium containing different concentrations of BAP
(2.0 mg/l) in combination with IBA (0.2 mg/l; see Note 9;
Fig. 1c, d) and maintain the cultures at 25 ± 2 °C with a 16 h
photoperiod and 35 μmol/m2/s light intensity from cool fluo-
rescent tubes (Philips, India).
2. Record observations on shoot induction frequency, mean
number of shoots per culture, and mean shoot length (Table 3).

3.4 In Vitro Rooting 1. Separate well-developed shoots (4–6 cm in height) and trans-
fer for rooting on MS basal medium containing auxins
1.0 mg/l IBA in combination with 0.3 mg/l NAA or medium
lacking growth regulators (Fig. 1e).
2. Record observations on root induction frequency, mean num-
ber of roots per shoot, and mean root length (Table 4).

3.5 Hardening 1. Remove shoots with well-developed roots from culture tubes,
and Field Transfer wash under running tap water and transfer to small plastic pots
of In Vitro- containing sterile sand and coco peat (1:1; Fig. 1f).
Regenerated Plantlets 2. After 35 days, transfer the hardened plantlets to the poly-bags
(10 × 15 cm) containing garden soil and grow in the glasshouse
Table 3
Effects of various concentrations and combinations of BAP and IBA on shoot regeneration
from stem-derived callus of C. noorjahaniae

Shoot induction No. of shoots Length of

Sr. no. BAP (mg/l) IBA (mg/l) frequency (%) per culture shoot (cm)
1. 0.0 0.0 0.0 0.0 0.0
2. 0.5 0.0 33 1.2 ± 0.2* 2.3 ± 0.4**
3. 1.0 0.0 45 3.3 ± 0.7** 3.0 ± 0.7**
4. 1.5 0.0 45 4.0 ± 0.4** 3.0 ± 0.1**
5. 2.0 0.0 65 7.4 ± 0.1** 3.2 ± 0.7**
6. 2.5 0.0 50 7.0 ± 0.1** 2.8 ± 0.3**
7. 2.0 0.1 68 11.3 ± 0.3** 4.7 ± 0.4**
8. 2.0 0.2 78 16 ± 0.2** 5.5 ± 0.1**
9. 2.0 0.3 75 7.3 ± 0.4** 5.0 ± 0.1**
10. 2.0 0.4 58 4.5 ± 0.1** 5.2 ± 0.3**
11. 2.0 0.5 55 4.6 ± 0.5** 4.3 ± 0.3**
Values represent mean ± standard error of 20 replicates per treatment in three repeated experiments. The values are
significantly different at *P < 0.05 and **P < 0.01 level when compared by Dunnett multiple comparisons test

Table 4
Effect of auxins on in vitro root induction in microshoots obtained from
indirect regeneration of C. noorjahaniae

PGRs (mg/l)
Root induction Number of Length of
IBA NAA frequency (%) roots/shoot root (cm)
0.0 0.0 0.0 0.0 0.0
0.5 0.0 60 2.2 ± 0.2** 0.7 ± 0.3ns
1.0 0.0 68 4.0 ± 0.3** 1.6 ± 0.6*
1.5 0.0 71 3.7 ± 0.5** 2.0 ± 0.1**
2.0 0.0 69 3.1 ± 0.1** 2.3 ± 0.5**
2.5 0.0 63 2.8 ± 0.1** 1.9 ± 0.1**
1.0 0.1 65 2.6 ± 0.4** 3.2 ± 0.4**
1.0 0.2 60 6.3 ± 0.1** 3.7 ± 0.4**
1.0 0.3 75 11.2 ± 0.4** 3.4 ± 0.3**
1.0 0.4 73 6.3 ± 0.3** 1.2 ± 0.3*
1.0 0.5 70 5.8 ± 0.2** 1.1 ± 0.4*
Values represent mean ± standard error of 20 replicates per treatment in three repeated
experiments. The values are significantly different at ns—nonsignificant, *P < 0.05 and
**P < 0.01 level when compared by Dunnett multiple comparisons test
 In Vitro Callus Induction and Plant Regeneration from Stem Explants of Ceropegia… 353

conditions (humidity 65 %; temperature 32 °C; photoperiod

16 h with 50 μmol/m2/s).
3. The hardened plantlets are shifted to the nursery and eventu-
ally to the field.

4 Notes

1. Measure 1 ml Tween 20 and mix in 50 ml sterilized distilled

water and raise the final volume to 100 ml with sterilized dis-
tilled water.
2. Weigh 100 mg HgCl2 and dissolve in 50 ml sterilized distilled
water. Make the final volume to 100 ml with sterilized distilled
water.
3. For the preparation of MS medium, prepare stock solutions of
major inorganic nutrients, minor inorganic nutrients, sodium
molybdate, iron source, vitamins, and amino acids (Table 1).
The vitamins and amino acids stock solution is stored in small
batches at −20 °C and other stock solutions at 4 °C. Do not
store inorganic stock solutions more than 1 month as it leads
to precipitation which affects the growth of culture. Nowadays
ready-mix MS medium is commercially available in different
combinations, like MS with sucrose and agar; MS without
agar; and MS with CaCl2, sucrose, and agar.
For preparation of 1000 ml MS medium, desired quanti-
ties of nutrient ingredient stocks of MS media are added in a
conical flask containing 400–500 ml DW in the following
sequence: Macronutrients: calcium chloride; potassium iodide;
Micronutrients: sodium molybdate; iron stock; Vitamins.
Myo-inositol (100 mg/l) and sucrose (3 % w/v) are weighed
separately at the time of media preparation and dissolved in it.
When required, concentrations of plant growth regulators are
added before sterilization (or otherwise specified). Make the
final volume of the medium to 1000 ml with DW. Adjust pH
of the medium to 5.8 with 0.1 N NaOH and 0.1 N HCl. Add
8 g agar (0.8 %) in the medium. Keep the flasks in microwave
oven to digest the agar. When agar is uniformly homogenized,
15 ± 2 ml of the medium is poured in each culture tube. Plug
the culture tubes with non-absorbent cotton and sterilize at
121 °C for 15 min.
4. 6-benzylaminopurine (BAP), 2,4-dichlorophenoxyacetic acid
(2,4-D), indole-3-butyric acid (IBA), α-naphthalene acetic
acid (NAA): Weigh 10 mg of plant growth regulator (BA, 2,4-
D, IBA, and NAA) separately and dissolve in 2 ml 1 N NaOH
and gradually dilute to 100 ml with sterilized distilled water in
a volumetric flask separately and store at 4 °C.
354 Jaykumar J. Chavan and Mahendra L. Ahire

5. Commercially coco peat is available in blocks; cut the coco

peat into small pieces and ground it into a fine powder and
sterilize the coco peat in an autoclave at 121 °C for 20 min.
6. Locally available sand is sieved through the 600 MCIS mesh
and this sieved sand is sterilized in an autoclave at 121 °C for
20 min.
7. Fill the polythene bags with garden soil and farmyard manure.
The garden soil and farmyard manure is mixed in 1:1 propor-
tion and the mixture is filled in the polythene bags and watered
with tap water.
8. Seeds cultured on the medium carry seed-borne fungi and bac-
teria. These seeds are prone to infection and in such cases sur-
face sterilization of seeds is necessary; such seeds should be
washed thoroughly in water and then surface sterilization is
carried for 10–15 min by using 0.1 % mercuric chloride. After
sterilization wash the seeds thoroughly with sterilized distilled
water followed by drying on sterile tissue paper or blotting
paper and culture on the nutrient medium. All these proce-
dures should be carried out under aseptic conditions.
9. Add desired quantity of filter-sterilized IBA from stock solu-
tion to the culture medium after autoclaving and cooling to
below 40 °C.

Acknowledgement

The authors are grateful to the Principal, Yashavantrao Chavan

Institute of Science, Satara and the Head, Department of Botany
for providing necessary facilities for conducting the research work.
Dr. N.A. Ghanawat, In-charge of the Botanical Garden,
Yashavantrao Chavan Institute of Science, Satara is duly acknowl-
edged for procurement of plant materials.

References
1. APG III (2009) An update of the angiosperm 4. Reynolds S (2006) [Link]
phylogeny group classification for the orders and com/cero/[Link]
families of flowering plants. Bot J Linnean Soc 5. Kirtikar KR, Basu BD (1935) Indian medicinal
161:105–121 plants, vol 3. Bishen Singh Mahendra, New
2. Murthy SRK, Kondamudi R, Reddy MC, Delhi
Karuppusamy S, Pullaiah T (2012) Check-list and 6. Sukumar E, Gopal RH, Rao RB, Viswanathan S,
conservation strategies of the genus Ceropegia in Thirugnanasambantham P, Vijayasekaran V
India. Int J Biodivers Conserv 4(8):304–315 (1995) Pharmacological actions of cerpegin, a
3. Hodgkiss RJ (2004) [Link] novel pyridine alkaloid from Ceropegia juncea.
[Link]/[Link] Fitotherapia 66(5):403–406
 In Vitro Callus Induction and Plant Regeneration from Stem Explants of Ceropegia… 355

7. Yadav SR, Kamble MY (2006) Threatened an endemic and critically endangered medici-
Ceropegias of the Western Ghats and strategies nal herb of the Western Ghats. Physiol Mol
for their conservation. [Link] Biol Plants. doi:10.1007/s12298-014-
in/envis/threatened-plants/[Link] 0236-4
8. Chavan JJ, Nalawade AS, Gaikwad NB, Gurav 9. Murashige T, Skoog F (1962) A revised medium
RV, Dixit GB, Yadav SR (2014) An efficient in for rapid growth and bioassays with tobacco tis-
vitro regeneration of Ceropegia noorjahaniae: sue cultures. Physiol Plant 15:473–497
 Chapter 25

Somatic Embryogenesis of Date Palm (Phoenix

dactylifera L.) Through Cell Suspension Culture
Poornananda M. Naik and Jameel M. Al-Khayri

Abstract
Date palm (Phoenix dactylifera L.) is the oldest and most economically important plant species distributed
in the hot arid regions of the world. Propagation of date palm by seeds produces heterogeneous offspring
with inferior field performance and poor fruit quality. Traditionally, date palm is propagated by offshoots,
but this method is inefficient for mass propagation because of limited availability of offshoots. Plant regen-
eration through tissue culture is able to provide technologies for the large-scale propagation of healthy
true-to-type plants. The most commonly used technology approach is somatic embryogenesis which pres-
ents a great potential for the rapid propagation and genetic resource preservation of this species. Significant
progress has been made in the development and optimization of this regeneration pathway through the
establishment of embryogenic suspension cultures. This chapter focuses on the methods employed for the
induction of callus from shoot tip explants, establishment of cell suspension culture, and subsequent
somatic embryogenesis and plant regeneration.

Key words Callus, Cell suspension culture, In vitro regeneration, Phoenix dactylifera, Somatic
embryogenesis

1 Introduction

Date palm (Phoenix dactylifera L.) is a dioecious fruit tree native

to the hot arid regions of the world, mainly grown in the Middle
East and North Africa. Since ancient times this majestic plant has
been recognized as the tree of life because of its integration into
human settlement, well-being, and food security in hot and bar-
ren parts of the world, where only a few plant species can flourish
[1]. Dates represent a high energy source besides being rich in
dietary fibers [2, 3]. Their carbohydrate content range is
44–88 %, while proteins represent 2.3–5.6 % and fats 0.2–9.3 % [4].
Date fruits were found to be rich in phenolics. The phenolics
present in dates are known to exhibit various pharmacological
activities including antiaging, anticancerous, antioxidant, antivi-
ral, and antimicrobial properties, making them a remedy for certain

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_25, © Springer Science+Business Media New York 2016

357
358 Poornananda M. Naik and Jameel M. Al-Khayri

diseases and prevention of chronic inflammations. They also pre-

vent oxidative damages caused as a result of phagocytosis activity
of invasive pathogens and pests by lymphocytes [5]. Phenolics
are known to reduce blood pressure and have antithrombotic
and anti-inflammatory effects [6, 7]. In addition, phenolics
inhibit α-amylase and α-glucosidase activities behind the post-
prandial increase in blood glucose level, which is often mani-
fested in type-II diabetes [5, 8, 9]. Conventionally, this plant is
propagated from offshoots and their availability is often limited.
However, it produces only about 20 offshoots during the first
10–15 years of the tree life, but plant regeneration through tis-
sue culture is able to provide technologies for the large-scale
propagation of healthy true-to-type plants. Plant tissue culture is
also an essential tool for plant breeding programs [10] and the
conservation of plant genetic resources [11].
Research in date palm tissue culture has received increasing
interest, resulting in plant regeneration protocols for a number
of commercial date palm cultivars. The literature indicated that
plant regeneration of date palm was achieved via somatic embryo-
genesis depending upon the genotype and the composition of
the culture medium. Date palm somatic embryogenesis was
improved using biotin [12], abscisic acid (ABA) supplement
[13, 14], and coconut water additive [15, 16]. Moreover, the
stimulation of direct somatic embryo regeneration from shoot
tip explants using N-phenyl N′-1,2,3-thiadiazol-5-ylurea (TDZ)
was achieved by Sidky and Zaid [17]. Somatic embryogenesis,
which leads to embryonic differentiation from somatic cells and
not from fertilized ovules, is often employed because of its
numerous advantages [18]. Embryogenic cells are used for the
isolation of protoplasts with a highly regeneration capacity [19],
genetic engineering [20], and the cryopreservation of plant
genetic resources [21].
Cell suspension culture and somatic embryo genesis provide a
number of avenues for the date palm genetic improvement based
on mutagenesis and in vitro selection studies [22–26]. For the date
palm, Al-Khayri [27] successfully determined the suspension
growth curve, optimum plating efficiency, and influence of liquid
medium on somatic embryogenesis.
The protocol explained here is based on induction of callus
from shoot tip explants and somatic embryo genesis via cell sus-
pension culture which has been shown to be widely applicable to
numerous commercially important date palm cultivars [12, 15,
27–30]. Procedures including explant preparation, callus induc-
tion, cell suspension culture, somatic embryo development, plant
formation, and acclimatization are described.
 Somatic Embryogenesis of Date Palm 359

2 Materials

2.1 Explant 1. Date palm offshoots.

and Media Preparation 2. Murashige and Skoog (MS) [31] medium stock solutions (MS
stock I, II, III and IV) (Table 1). Store in the freezer or cold
room at 4 °C (see Note 1).
3. Beakers, measuring cylinders, and glass rods (see Note 2).
4. 0.1–10 mL pipettes and/or 0.5–100 μL micropipettes.

Table 1
Chemical composition of the modified MS medium (After dissolving all the
stock solutions in the deionized water make up the volume to 1 L, adjust
the pH of the medium to 5.8 with 0.1 N HCl/0.1 N NaOH and add 7 g/L
agar-agar and autoclave the media for 20 min at 121 °C)

Concentration Volume per

Chemical constituents (mg/L) liter (mL)
Major inorganic nutrients
NH4NO3 33,000 50
KNO3 38,000
CaCl2·2H2O 8800
MgSO4·2H2O 7400
KH2PO4 3400
NaH2PO4·H2O 3400
Minor inorganic nutrients
KI 166 5
H3BO3 1240
MnSO4·2H2O 4460
ZnSO4·7H2O 1720
Na2.MoO4·2H2O 50
CuSO4·5H2O 5
CoCl2·6H2O 5
Iron source
FeSO4·7H2O 5560 5
Na2EDTA·2H2O 7460
Organic supplements
myo-Inositol 25,000 5
Glutamine 40,000
Nicotinic acid 200
Pyridoxine·HCl 200
Thiamine·HCl 5000
Glycine 400
Carbon source
Sucrose 30 g/L
360 Poornananda M. Naik and Jameel M. Al-Khayri

5. 1 N NaOH/1 N HCl.
6. Activated charcoal, used at 1.5 g/L.
7. Agar-agar, used at 7 g/L.

2.2 Induction of 1. Stock solutions of 2,4-dichlorophenoxyacetic acid (2,4-D)

Callus from Shoot (10 mg/L), 2-isopentenyladenine (2iP) (1 mg/L), and naph-
Tip Explants and thalene acetic acid (NAA) (1 mg/L) are prepared and stored in
Establishment of Cell the freezer at −20 °C.
Suspension Cultures

2.3 Packed Cell 1. Graduated centrifuge tube.

Volume (PCV) 2. Centrifuge machine.

2.4 Plating 1. Hemocytometer.

Efficiency (PE) 2. Petri dishes.
3. Illuminated colony counter.

2.5 Somatic Embryo 1. Hormone-free MS medium.

Development 2. Rotary shaker.

2.6 Plant Formation 1. Embryo.

2.7 Hardening 1. Peat.

and Acclimatization 2. Vermiculite.
3. Sand.
4. Dehydrated cow manure.

3 Methods

3.1 Explant 1. 3–4-year-old date palm offshoots are isolated from mother
Preparation trees and the outer leaves removed, exposing the shoot tip
regions which are excised and immediately placed in a chilled
antioxidant solution consisting of ascorbic acid and citric acid,
150 mg/L each, to prevent oxidation-induced browning.
2. Shoot tip tissues of about 8 cm long are surface-sterilized in
70 % ethanol for 1 min followed by 15 min in 1.6 % (w/v)
sodium hypochlorite solution (30 % v/v Clorox, commercial
bleach) containing three drops of Tween 20 per 100 mL
solution.
3. The tissue is rinsed 4 times in sterilized distilled water for
5 min.
4. The tissue surrounding the shoot tips is removed until the
shoot tip terminal is exposed, about 1 cm long, which is excised
and sectioned longitudinally into 6–12 small sections under
the laminar flow bench/clean bench (Fig. 1a).
 Somatic Embryogenesis of Date Palm 361

Fig. 1 Stages of date palm cell suspension culture and embryogenesis: (a) Explant preparation, (b) Culture
initiation, (c) Callus induction, (d) Callus proliferation, (e) Cell suspension culture, (f) Embryo formation, (g)
Rooting, (h) Transplanted plant. (Source: Part figures (c), (f), (g), (h) are taken from Al-Khayri JM (2012) Date
palm Phoenix dactylifera L. In: Jain SM, Gupta PK (eds) Protocols of somatic embryogenesis in woody plants.
Springer, Berlin, pp 309–318)

3.2 Induction 1. These explants are placed on the surface of semisolid MS

of Callus from Shoot medium supplemented with 30 g/L sucrose, 100 mg/L 2,4-
Tip Explants D, 3 mg/L 2iP, and 1.5 g/L activated charcoal, pH 5.8 for
culture initiation (Fig. 1b; Table 2).
2. Incubate cultures at 24 °C ± 3 °C for 12 weeks in the dark.
Within 8–10 weeks callus will develop from the shoot tip
explants.
3. Culture the resultant callus on semisolid MS medium contain-
ing 30 g/L sucrose, 6 mg/L 2iP, 10 mg/L NAA, and 1.5 g/L
activated charcoal, pH 5.8 for culture proliferation (Fig. 1c, d;
Table 2).
4. Transfer cultures to a fresh medium at 3-week intervals. Use
actively growing cell line as explants for the further experiments.

3.3 Proliferation 1. Collect actively growing friable cell lines from the semisolid
of Cell Suspension cultures and inoculate 1 g fresh biomass into a 250 mL
in the Liquid Medium Erlenmeyer flask containing 50 mL MS liquid medium supple-
mented with 30 g/L sucrose, 1.5 mg/L 2iP, and 10 mg/L
NAA (see Table 2). Incubate cultures at 16-h photoperiod of
362 Poornananda M. Naik and Jameel M. Al-Khayri

Table 2
Hormonal and activated charcoal supplements to the culture medium used for date palm callus
induction and cell suspension

Culture phase

Callus
Media additives Culture initiation proliferation Cell suspension
2,4-Dichlorophenoxyacetic acid (2,4-D) 100 mg/L – –
2-Isopentenyladenine (2iP) 3 mg/L 6 mg/L 1.5 mg/L
Naphthalene acetic acid (NAA) – 10 mg/L 10 mg/L
Activated charcoal 1.5 g/L 1.5 g/L –

cool-white florescent light, 40 μmol/m2/s, and 23 ± 2 °C and

agitated at 150 rpm. Maintain cultures by regular subculturing
at 2-week interval (Fig. 1e).

3.3.1 Packed Cell 1. To estimate the PCV, place 5 mL cell suspension in a sterile
Volume (PCV) graduated centrifuge tube and centrifuge at 2000 × g for 5 min.
2. Record the packed cell volume as percentage cell mass of the
total centrifuged volume and then the samples are returned to
the original cultures.
3. Measurements are taken weekly for 12 weeks. Plot the PCV
values in relation to time, to construct a growth curve reflect-
ing various phases of cell growth (Fig. 2).

3.3.2 Plating 1. Dilute cell suspension concentration to give initial cell density
Efficiency (PE) of 100, 500, 1000, 5000, 10,000, 50,000, and 100,000 cells/
mL with hemocytometer.
2. Mix samples of cell suspensions with melted agar medium after
letting the autoclaved medium to cool down to 30–35 °C.
3. The medium used is similar to the cell suspension medium, but
contains 7 g/L agar, and is dispensed in 15 × 100 mm petri
dishes, at 20 mL per dish (see Note 3).
4. Mix the cell suspension and molten medium and evenly spread
in the plate to solidify, forming a fixed thin layer of cells.
5. To assess the recovery potential of cell suspension to form cell
colonies in relation to the initial cell concentration, count the
colonies using an illuminated colony counter (Figs. 3 and 4;
see Note 4).

3.4 Somatic Embryo 1. Induce cell suspension cultures together with friable callus to
Development undergo somatic embryogenesis by transferring them to a
hormone-free medium.
 Somatic Embryogenesis of Date Palm 363

Fig. 2 The cell growth of date palm suspension culture, showing PCV in relation to time as it pertains to each
of the growth phases (lag phase, exponential phase, linear phase, progressive deceleration phase, and station-
ary phase). (Source: This figure is taken from Al-Khayri JM (2012) Determination of the date palm cell suspen-
sion growth curve, optimum plating efficiency, and influence of liquid medium on somatic embryogenesis.
Emir J Food Agric 24(5): 444–455)

Fig. 3 The cell growth of date palm suspension culture, expressed in the number of colonies, recovered after
plating on a semisolid medium at various cell densities. (Source: This figure is taken from Al-Khayri JM (2012)
Determination of the date palm cell suspension growth curve, optimum plating efficiency, and influence of
liquid medium on somatic embryogenesis. Emir J Food Agric 24(5): 444–455)
364 Poornananda M. Naik and Jameel M. Al-Khayri

Fig. 4 The cell growth of date palm suspension culture, expressed in plating efficiency, recovered after plating
on a semisolid medium at various cell densities. (Source: This figure is taken from Al-Khayri JM (2012)
Determination of the date palm cell suspension growth curve, optimum plating efficiency, and influence of
liquid medium on somatic embryogenesis. Emir J Food Agric 24: 444–455)

2. MS liquid medium supplemented with 30 g/L sucrose

3. Incubate cultures at 16-h photoperiod of cool-white florescent
light (40 μmol/m2/s) and 23 ± 2 °C and agitate at 150 rpm.
Maintain cultures by regular subculturing at 2-week intervals
up to 12 weeks (Fig. 1f).

3.5 Plant Formation 1. To accelerate the complete plant formation, transfer mature or
germinating embryos to rooting medium (Fig. 1g; see Note 5).

3.6 Hardening 1. Remove the plantlets nearly 5 cm in length with shoot and
and Acclimatization root from culture tubes and gently rinse under a slow stream of
water to remove residual agar media from the root region.
2. Plantlets are transferred to pots with peat–vermiculite mixture
of 2:1 ratio in Styrofoam cups of uniform size (Fig. 1h).
3. The plantlets are initially covered with polythene bag to main-
tain high humidity to prevent the plants from dehydration and
are maintained in the plant growth room.
4. Perforate the polythene bags and gradually remove them in a
span of 3 weeks.
5. The hardened plants are transferred to potting mixtures con-
sisting of 1:1:1 peat, sand, and dehydrated cow manure in pots
(12 in.) and are maintained in the greenhouse under natural
light at 27 ± 2 °C and 50–60 % relative humidity.
 Somatic Embryogenesis of Date Palm 365

4 Notes

1. The most efficient way of preparing MS medium (Table 1) is

to prepare stock solutions of major, minor inorganic nutrients,
iron source, vitamins, and separate growth hormones. The
stock solutions are stored at 4 °C except for the vitamins which
is stored in small batches at −20 °C. Do not store the stock
solutions for longer periods (not more than 2–3 months). It is
always recommended to prepare the growth regulators fresh
for each batch of media. Any color changes in the stock solu-
tions may be due to precipitation, which can seriously affect
the growth of cultures. Alternatively, stock solutions of macro-
elements, microelements, vitamins, and the ready-to-use MS
medium are commercially available.
2. All the glassware should be cleaned with a liquid detergent and
be thoroughly washed with tap water. Rinse the glassware with
double distilled water and dry in hot air oven at 150 °C for 2 h
before use.
3. Autoclave the petri dishes prior to use to avoid any contamina-
tion during the procedure as contamination at this stage may
affect the results.
4. The plating efficiency is determined using the following equation:

PE = ( final number of colonies per plate / initial number of cellular units per plate ) ´100.

5. Half-strength MS medium supplemented with 0.2 mg/L NAA

and 0.7 g/L agar.

References
1. Al-Khayri JM (2007) Date palm Phoenix dacty- 6. Gerritsen ME, Carley WW, Ranges GE, Shen
lifera L. micropropagation. In: Jain SM, CP, Phan SA, Ligon GF, Perry CA (1995)
Haggman H (eds) Protocols for micropropa- Flavonoids inhibit cytokine induced endothe-
gation of woody trees and fruits. Springer, lial cell adhesion protein gene expression. Am
Berlin, pp 509–526 J Pathol 147:278–292
2. Biglari F, Al-Karkhi AFM, Easa AM (2008) 7. Muldoon MF, Kritchvesky SB (1996) Flavonoids
Antioxidant activity and phenolic content of and heart disease. BMJ 312:458–459
various date palm (Phoenix dactylifera L.) 8. Andlauer W, Furst P (2003) Special character-
fruits from Iran. Food Chem 107:1636–1641 istics of non-nutrient food constituents of
3. El Hadrami A, Al-Khayri JM (2012) plants—phytochemicals. Introductory lecture.
Socioeconomic and traditional importance of Int J Vitam Nutr Res 73:55–62
date palm. Emir J Food Agric 24:371–385 9. McCue PP, Shetty K (2004) Inhibitory effects
4. El Hadrami I, El Hadrami A (2009) Breeding of rosmarinic acid extracts on porcine pancre-
date palm. In: Jain SM, Priyadarshan PM (eds) atic amylase in vitro. Asia Pac J Clin Nutr
Breeding plantation tree crops. Springer, 13:101–106
New York, pp 191–216 10. Parveez GH, Masri MM, Zainal A, Majid NA,
5. Vayalil PK (2012) Date fruits (Phoenix dacty- Yunus AM, Fadilah HH, Rasid O, Cheah SC
lifera Linn): an emerging medicinal food. Crit (2000) Transgenic oil palm: production and
Rev Food Sci Nutr 52:249–271 projection. Biochem Soc Trans 28:969–972
366 Poornananda M. Naik and Jameel M. Al-Khayri

11. Engelmann F, Dussert S (2000) 22. Jain SM (2005) Major mutation-assisted plant
Développement de la cryoconservation pour la breeding programmes supported by FAO/
conservation des ressources génétiques végé- IAEA. Plant Cell Tiss Org Cult 82:113–123
tales. Agric 9:237–244 23. Jain SM (2007) Recent advances in date palm
12. Al-Khayri JM (2001) Optimization of biotin tissue culture and mutagenesis. Acta Horticult
and thiamine requirements for somatic embryo- 736:205–211
genesis of date palm (Phoenix dactylifera L.). In 24. Jain SM (2010) Mutagenesis in crop improve-
Vitro Cell Dev Biol Plant 37:453–456 ment under the climate change. Rom
13. Sghaier B, Kriaa W, Bahloul M, Jorrín-Novo Biotechnol Lett 15(2):88–106
JV, Drira N (2009) Effect of ABA, arginine 25. Abohatem M, Zouine J, El Hadrami I (2011)
and sucrose on protein content of date palm Low concentrations of BAP and high rate of
somatic embryos. Sci Hort 120:379–385 subcultures improve the establishment and
14. Sghaier-Hammami B, Jorrín-Novo JV, multiplication of somatic embryos in date
Gargouri-Bouzid R, Drira N (2010) Abscisic palm suspension cultures by limiting oxidative
acid and sucrose increase the protein content browning associated with high levels of total
in date palm somatic embryos, causing changes phenols and peroxidase activities. Sci Hort
in 2-DE profile. Phytochemistry 130:344–348
71:1223–1236 26. Sidky RA, Gadalla EG (2013) Somatic
15. Al-Khayri JM (2010) Somatic embryogene- embryogenesis in Phoenix dactylifera: matura-
sis of date palm (Phoenix dactylifera L.) tion, germination and reduction of hyperhy-
improved by coconut water. Biotechnology dricity during embryogenic cell suspension
9:477–484 culture. Arab J Biotech 16(1):119–130
16. Khierallah HSM, Hussein NH (2013) The 27. Al-Khayri JM (2012) Determination of the
role of coconut water and casein hydrolysate in date palm cell suspension growth curve, opti-
somatic embryogenesis of date palm and mum plating efficiency, and influence of liquid
genetic stability detection using RAPD mark- medium on somatic embryogenesis. Emir
ers. Res Biotechnol 4(3):20–28 J Food Agric 24(5):444–455
17. Sidky RA, Zaid ZE (2011) Direct production 28. Badawy EM, Habib AM, El-Banna AA, Yousry
of somatic embryos and plant regeneration GM (2009) Effect of some factors on somatic
using TDZ and CPPU of date palm (Phoenix embryos formation from callus suspensions cul-
dactylifera L.). Int J Acad Res 3:792–796 tures in Phoenix dactylifera L. cv. Sakkoty. In:
18. Carlos M, Martinez FX (1998) The potential Proceedings of 4th conference on recent tech-
uses of somatic embryogenesis in agroforestry nologies in agriculture, Faculty of Agriculture.
are not limited to synthetic seed technology. Cairo University, Cairo, pp 593–599
Rev Bras Fisiol Veg 10:1–12 29. Al-Khayri JM (2013) Factors affecting somatic
19. Ling JT, Iwamasa M (1994) Somatic hybrid- embryogenesis in date palm (Phoenix dacty-
ization between Citrus reticulata and Citroptis lifera L.). In: Junaid A, Srivastava PS, Sharma
gabunensis through electrofusion. Plant Cell MP (eds) Somatic embryogenesis and genetic
Rep 13:493–497 transformation in plants. Narosa Publishing
20. Cabrera PJL, Vegas GA, Herrera M (1996) House, New Delhi, pp 15–37
Regeneration of transgenic papaya plants via 30. Al-Khayri JM (2005) Date palm Phoenix dacty-
somatic embryogenesis induced by lifera L. In: Jain SM, Gupta PK (eds) Protocols
Agrobacterium rhizogenes. In Vitro Cell Dev of somatic embryogenesis in woody plants.
Biol Plant 32:86–90 Springer, Berlin, pp 309–318
21. Engelmann F (2004) Plant germplasm cryo- 31. Murashige T, Skoog F (1962) A revised medium
preservation: progress and prospects. In Vitro for rapid growth and bioassays with tobacco tis-
Cell Dev Biol Plant 40:427–433 sue cultures. Physiol Plant 15:473–497
 Chapter 26

Protocols for Improvement of Black Pepper

(Piper nigrum L.) Utilizing Biotechnological Tools
K. Nirmal Babu, Minoo Divakaran, G. Yamuna, P.N. Ravindran,
and K.V. Peter

Abstract
Black pepper, Piper nigrum L., the “King of spices” is the most widely used spice growing in the South-
Western region of India. The humid tropical evergreen forest bordering the Malabar Coast (Western Ghats
is one of the hot spot areas of plant bio-diversity on earth) is its center of origin and diversity. However,
the crop faces constraints like rampant fungal and viral diseases, lack of disease free planting material, hence
biotechnological tools can be utilized to address these problems and strides have been made successfully.
The standardization of micropropagation, somatic embryogenesis, in vitro conservation, protoplast isola-
tion, and genetic transformation protocols are described here. The protocols could be utilized to achieve
similar goals in the related species of Piper too.

Key words Artificial/synthetic seeds, Cryopreservation, Embryo culture, Genetic transformation,

In vitro conservation, Micropropagation, Plant regeneration, Somatic embryogenesis, Suspension
cultures

Abbreviations
BA Benzyl adenine
IBA Indole-3-butyric acid
Kin Kinetin
MS Murashige and Skoog
NAA α-naphthalene acetic acid
SH Schenk and Hildebrandt
TDZ Thiaduzuron
WPM Woody plant medium

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_26, © Springer Science+Business Media New York 2016

367
368 K. Nirmal Babu et al.

1 Introduction

Black pepper, Piper nigrum L., is the most important spice of the
world accounting for 40 % of export earnings from spices. India is the
major producer and exporter of this spice and being the native home
of black pepper, collection, cataloguing, and conservation of the pre-
cious genetic resources of this crop [1], development of resistant vari-
eties are the major thrust areas in improvement of black pepper.
Molecular markers have been used in resolving complex phylo-
genetic problems in pepper and many reports on molecular charac-
terization of Piper are available [2, 3]. Conserving and fingerprinting
the genetic diversity in pepper and development of resistant varieties
to “Phytophthora foot rot” are few areas that seek immediate solu-
tions. In the past few years protocols utilizing biotechnological meth-
ods for commercial propagation, protoplast culture, genetic
transformation and molecular profiling, conserving the genetic
resources in in vitro and cryo banks have been developed [2, 4–6].
Genetic stability of micropropagated plants of Piper longum was vali-
dated using RAPD markers [3]. Similarly RAPD profiles for many
cultivars of black pepper for identification of varieties have been stud-
ied [12]. The ability to manipulate and study plant tissues has led to
the appreciation of role played by plant biotechnology in improving
a crop species. Black pepper is no exception and the protocols devel-
oped for addressing crop-specific problems are reported.

2 Materials

2.1 Plant Material Shoot tips, leaf segments, and nodal segments of Piper nigrum
(Fig. 1) for all experiments and seeds for somatic embryogenesis.

Fig. 1 Black pepper vine

 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 369

2.2 Surface 1. Diluted detergent, viz., two to three drops of Tween 20 in

Sterilization 50 ml distilled water.
of Capsules 2. Copper oxychloride as fungicide.
3. 0.1 % mercuric chloride.
4. 70 % ethanol.
5. Sterilized double distilled water.

2.3 Culture Vessels 1. Borosil test tubes and conical flasks.

2. Closures made of non-adsorbent cotton in gauze cloth.

2.4 Chemicals Murashige and Skoog [7] medium (Table 1) for all in vitro culture
methods.

2.5 Hardening 1. Potting mixture composed of sterilized vermiculite, garden

of Plantlets soil, and sand (1:1:1) in equal proportions.
2. Micro-cups, polythene bags, and pots.

2.6 Molecular 1. 2× extraction buffer: (2 % cetyltrimethylammonium bromide

Profiling (CTAB), 100 mM Tris–HCl, pH 8, 20 mM ethylenediamine-
tetraacetic acid (EDTA), pH 8, 1.4 M NaCl, 1 % polyvinylpo-
2.6.1 Genomic DNA
lypyrrolidone (PVPP)).
Isolation
2. Chloroform–isoamyl alcohol (24:1).
3. 100 % ethanol or isopropanol, 70 % alcohol.
4. TE buffer (10 mM Tris, 0.1 mM EDTA, pH 8).
5. RNAse A (10 mg/ml).
6. 50× Tris–Acetate–EDTA (TAE) buffer (pH 8).
7. Agarose.
8. Ethidium bromide (10 mg/ml).
9. 6× loading dye (30 % glycerol, 5 mM EDTA, 0.15 % bromo-
phenol blue, 0.15 % xylene cyanol).
10. 1000 bp DNA ladder.

2.6.2 For RAPD PCR 1. Taq DNA polymerase with 10× buffer.
2. 10 mM dNTPs: 10 mM each of dATP, dCTP, dGTP, and dTTP.
3. 25 mM MgCl2.
4. 10 μM primers.

3 Methods

3.1 Micro- Micropropagation protocol is used to multiply adequate planting

propagation material of black pepper (Fig. 2).
370 K. Nirmal Babu et al.

Table 1
Composition of tissue culture media (mg/l) used in the study

Murashige and Skoog Schenk and Hildebrandt Woody plant medium

NH4NO3 1650 – 400.00
(NH4)2 SO4 – – –
NH4H2PO4 – 300 –
CaCl2·2H2O 440 200 96.00
Ca(NO3)2·4H2O – – 556.00
MgSO4·7H2O 370 400 370.00
KCl – – –
KNO3 1900 2500 –
KH2PO4 170 – 170.00
K2SO4 – – 990.00
NaH2PO4H2O – – –
Na2SO4 – – –
CoCl2·6H2O 0.025 0.1 –
CuSO4·5H2O 0.025 0.2 0.25
FeSO4·7H2O 27.85 15.0 27.80
Na2-EDTA 37.25 20.0 37.30
MnSO4·4H2O 22.3 10.0 22.30
KI 0.83 1.0 –
Na2MoO4·2H2O 0.25 0.1 0.25
ZnSO4·7H2O 8.6 1.0 8.60
H3BO3 6.2 5.0 6.2
Inositol 100 1000 100
Nicotinic acid 0.5 5.0 0.50
Pyridoxine–HCl 0.5 0.5 0.50
Thiamine–HCl 0.1 5.0 1.0
Glycine 2.0 – 2.00

3.1.1 Preparation Murashige and Skoog (MS) basal medium is used for culture.
of Culture Media Prepare separate stocks for macronutrients, micronutrients, vita-
mins, amino acids, and plant growth regulators separately.
1. Mix the stocks as mentioned, add 30 g/l sucrose, dissolve well,
and make up to 1 L.
2. Adjust the pH to 5.8 and add 6 g/l agar.
 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 371

Fig. 2 Production of multiple shoots in vitro

3. Transfer it to culture tubes and flasks in the required quantity
and autoclave at 121 °C for 20 min.

3.1.2 Establishment 1. Explants (shoot tips) from hygienically maintained source

of In Vitro Culture plants are collected into conical flask containing a fungicide
solution of copper oxychloride with a dilute detergent
( see Notes 1–3).
2. Surface-sterilize the explants with 0.1 % mercuric chloride
(HgCl2) in laminar flow hood and wash with three changes of
sterile double distilled water.
3. Dry them on sterile filter papers and cut to the required size.
4. Inoculate in the culture tubes containing nutrient media and
incubate them in growth room at 25 ± 2 °C with 16 h photo-
period, light intensity 33.8 μmol/m2 s.
5. MS medium fortified with BA (0.5 mg/l for bud break, and
3 mg/l for multiple shoots) and hormone free MS with or
without charcoal (2 %) for rooting is standardized as the ideal
medium (Fig. 3).
6. Transfer the well-developed plants to a potting mixture and
maintain at high humidity (>85 %) either in the nursery or
hardening facility for 15–30 days and slowly bring them to
open conditions.

3.2 Somatic 1. Mature and ripe seeds of black pepper are squeezed so as to
Embryogenesis remove the pericarp, followed by thorough washing under
from Mature Seeds running tap water.
2. Surface-sterilize the seeds inside a laminar flow by treating with
0.1 % mercuric chloride for 10 min, followed by rinsing with
three to four changes of sterile double distilled water.
3. Inoculate the seeds on solid SH [8] basal medium (Table 1)
with 30 g/l sucrose, gelled with 0.8 % agar.
372 K. Nirmal Babu et al.

Fig. 3 (a, b) In vitro cultures of black pepper (activated charcoal is incorporated in the medium, whenever
phenolics exudation into the medium is observed)

Fig. 4 Somatic embryogenesis in black pepper

4. Incubate the cultures under complete darkness at 25 ± 1 °C,

and observe the cultures for germination at weekly intervals.
5. After germination of majority of seeds (30–40 days), subcul-
ture them with micropylar region in contact with fresh medium.
6. Maintain the cultures and regularly observe for somatic embryo-
genesis from the micropylar ring tissue (usually occurs between
60 and 120 days after culture initiation in 10–25 % seeds).
7. Once somatic embryo induction is observed, allow five to ten
embryos to form on the explants (Fig. 4).
 Fig. 5 RAPD profiles of plantlets developed through somatic embryogenesis

8. Transfer the explants with somatic embryos to the medium of

same composition for proliferation combined with maturation
or to SH medium supplemented with 15 g/l sucrose for more
proliferation (Culture conditions remain the same).
9. Germinate the somatic embryos in agitating liquid SH medium
containing 30 g/l sucrose at 110 rpm in the dark.
10. After complete formation of plants allow them to grow under
light in the same flask (with medium replenishment once in 15
days) or transfer to individual tubes containing static liquid
medium for better growth [9, 10].
11. After the formation of at least four leaves keep the cultures
outside the culture room for 10 days
12. Transfer plants to 350 ml plastic cups filled with autoclaved
river sand and cover with polythene bags having a few holes,
till the emergence of fresh leaf growth.
13. Molecular profiles of these plants show absolute genetic uni-
formity (Fig. 5).

3.2.1 Somatic 1. Prepare culture medium supplemented with BA (0.05–1 mg/l)

Embryogenesis from Leaf and TDZ (0.05–1 mg/l).
Explants 2. Select very young leaves (preferably the freshly opened leaf of
1–2 cm size) from established aseptic cultures.
3. Culture the leaf explants in the medium prepared above and
keep them in the dark for 15–20 days.
4. Keep the petiole of the leaf intact and in contact with the
medium.
5. Cultures with callus growth are eliminated. Observe for direct
somatic embryos from leaves, which occur only in 3–5 %
cultures.
374 K. Nirmal Babu et al.

6. Transfer the leaf explants with somatic embryos very carefully

to medium of same composition.
7. Observe for proliferation of somatic embryos by budding
(see Note 4).
8. Culture bigger and mature embryos on solidified growth
regulator free medium for development of plantlets.

3.3 Establishment 1. Supplement the basal MS medium with 2,4-D (0.5 mg/l) and
of Cell Suspension BA.
Cultures 2. Select leaf/stem/root explants from established aseptic cul-
tures. Explants from aseptically germinated seedlings and
embryos can also be used.
3. Culture the explants in the prepared medium and keep them in
the dark for 15–20 days. Periodically observe for in vitro
responses.
4. Cut explants into smaller pieces and callus growth from the cut
ends would be observed. The majority of callus developed will
be hard which can be transferred to regeneration medium for
organogenesis and plant regeneration.
5. Separate friable and loose callus from the hard callus and put
into the liquid medium of the same composition and agitate
in orbital shakers at 100–150 rpm to establish suspension
cultures.
6. Use these suspension cultures for radiation/mutation/in vitro
selection studies.
7. Plate the selected calli on solidified regeneration medium for
development of hard callus and plant regeneration. Addition
of TDZ to the culture medium will enhance plant regeneration
and sometimes somatic embryogenesis.
8. Transfer the hard callus into regeneration medium for plant
development. Observe cultures periodically under the micro-
scope for growth and differentiation and transfer to the suit-
able medium.

3.4 Production 1. 3 % sodium alginate is incorporated into MS medium as the

of Synthetic Seeds encapsulation matrix.
2. The explants are mixed into the above medium, dropped into
calcium chloride solution (1.036 g in 100 ml) and rotated gen-
tly for bead formation.
3. The solution is decanted and beads or Synseeds thus retrieved
can be stored up to 9 months in sterile water with over 80 %
viability (Fig. 6).

3.5 Protoplast 1. Source tissue: Leaves/callus is cut into small pieces to ensure proper
Isolation enzymatic digestion, as it is difficult to peel off the epidermis.
 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 375

Fig. 6 Recovery and growth of cryopreserved “synthetic seeds” of Piper

Table 2
Composition of enzyme solutions (ES) for isolation of protoplastsa

Code Mannitol (%) Macerozyme R-10 (%) Hemicellulase (%) Onozuka cellulase R-10 (%)
ES-1 10 0.5 – 1
ES-2 9 0.5 – 1
ES-3 8 0.5 – 1
ES-4 7 0.5 – 1
ES-5 6 0.5 – 1
ES-6 5 0.5 – 1
ES-7 10 0.5 0.5 2
ES-8 9 0.5 0.5 2
ES-9 8 0.5 0.5 2
ES-10 7 0.5 0.5 2
ES-11 6 0.5 0.5 2
ES-12 5 0.5 0.5 2
ES-13 10 1 – 3
ES-14 9 1 – 3
ES-15 8 1 – 3
ES-16 7 1 – 3
ES-17 6 1 – 3
ES-18 5 1 – 3
a
Enzyme solutions are prepared in CPW medium

2. Enzymatic digestion: Enzyme digestion method is used to

release the protoplasts by digesting the tissue with a mixture of
macerozyme and cellulase (Table 2). Prepare enzyme mixture
in Cell Protoplast Washing (CPW) medium (Table 3). The
enzymes are filter-sterilized using Milli-Q filtration unit.
376 K. Nirmal Babu et al.

Table 3
Composition of media used for protoplast isolation and culture

Protoplast culture media (mg/l)

Cell protoplast washing Floating
Components (CPW) medium (mg/l) media (mg/l) I II
NH4NO3 – – 1650 1650
KNO3 101 101 1900 1900
CaCl2·2H2O 1480 1480 440 440
MgSO4·7H2O 246 246 370 370
KH2PO4 27.2 27.2 170 170
KI 0.16 0.16 0.83 0.83
H3BO3 – – 6.2 6.2
MnSO4·4H2O – – 22.3 22.3
ZnSO4·7H2O – – 8.7 8.7
Na2MoO4·2H2O – – 0.25 0.25
CuSO4·5H2O 0.025 0.025 0.025 0.025
CoCl2·6H2O – – 0.025 0.025
FeSO4·7H2O – – 27.8 27.8
Na2EDTA·2H2O – – 37.3 37.3
Myo-inositol – – 100 100
Nicotinic acid – – 0.5 0.5
Thiamine HCl – – 0.5 0.5
Pyridoxine HCl – – 0.5 0.5
Glycine – – 2 2
Sucrose – 21 % 2% 3%
Mannitol 7–10 % – 7% 4%
Gibberellic acid – – 0.5 0.5
BA – – 0.5 1
NAA – – 0.5 1
2,4-D – – 0.5 –

3. Osmoticum: Osmotic pressure of the medium is adjusted by

addition of mannitol at different concentrations (8 %, 9 %, and
10 %) (see Note 5).
4. Incubation conditions for protoplast isolation: One gram
mechanically macerated leaves from in vitro cultured plants is
immersed in 10 ml isolation medium for pre-plasmolysis and
incubated in the dark for 16 h.
 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 377

Table 4
Composition of PEG solutiona for protoplast fusion

Constituents Molar conc. g/l

NaCl 140 mM 8.18
KCl 5 mM 0.37
Na2HPO4 0.75 mM 0.11
Glucose 5 mM 0.90
CaCl2·2H2O 125 mM 18.40
PEG (MW 4000) 400.00
a
pH is adjusted to 5.8

5. Protoplast purification: A combination of filtration, centrifuga-

tion, washing, and floatation centrifugation is used to purify
the protoplasts (see Notes 6 and 7). Observation under
inverted microscope (Leica) confirms enzymatic digestion and
release of protoplasts.
6. PEG-mediated hybridization/fusion: Two droplets of proto-
plast suspension from the two species to be fused are added to
another droplet of PEG solution (Table 4), and allowed to mix
at room temperature for 30 min. They are maintained as drop-
let cultures on glass slides and observed periodically for fusion
of protoplasts.
7. Protoplast culture: Culture protoplasts initially in the liquid
medium in petri dishes and incubate in the dark at 25 °C. Fresh
culture medium with 3 % sucrose and 7 % mannitol is added
after every 7 days to replenish the nutrients. The samples are
periodically observed for cell wall regeneration and cell divi-
sion. After 40–60 days of culture they are plated on 0.25 %
agarose medium and monitored for microcallus formation and
further development.

3.6 Molecular In this protocol, fresh and healthy leaves from in vitro conserved
Marker Profiling plants maintained in the in vitro gene bank are used for DNA
to Assess the Genetic isolation.
Diversity
3.6.1 Isolation of DNA

3.6.2 DNA Extraction CTAB method [11] is used for the isolation of genomic DNA. Stock
Procedure solutions and buffers are prepared as in Tables 5 and 6.
1. Grind 2 g leaf tissue in the liquid nitrogen to a fine powder
using prechilled mortar and pestle.
2. Transfer the powder to 50 ml oak ridge containing 10 ml pre-
heated CTAB + β mercaptoethanol.
378 K. Nirmal Babu et al.

Table 5
Composition of various stock solutions for DNA isolation

Solutions Method of preparation

1 M Tris–HCL (pH 8.0) 60.55 g Tris base + 300 ml distilled water
500 ml Adjust pH to 8, make up the volume to 500 ml. Dispense into reagent
bottles and sterilize by autoclaving
0.5 M EDTA pH 8.0 93.05 g EDTA-disodium salt + 300 ml water
Adjust pH to 8, make up volume to 500 ml. Dispense into reagent
bottles and autoclave
5 M NaCl 146.1 g NaCl + 200 ml water. Adjust the final volume to 500 ml.
500 ml Dispense into reagent bottles and autoclave
3 M sodium acetate (pH 5.2) 61.523 g anhydrous sodium acetate + 200 ml water. Adjust the pH to
250 ml 5.2 with glacial acetic acid (99–100 %). Autoclave
Ethidium bromide 1 g ethidium bromide + 100 ml distilled water. Dissolve on magnetic
10 mg/ml, 100 ml stirrer. Dispense into amber colored reagent bottle and store at 4 °C
70 % ethanol, 500 ml 360 ml ethanol + 140 ml distilled water. Store at 4 °C
Chloroform–isoamyl alcohol Measure 450 ml chloroform and 20 ml isoamyl alcohol. Mixed and
(24:1), 500 ml stored in room temperature
1 M MgCl2, 100 ml Weigh 20.33 g MgCl2, dissolve in double distilled water, make up to
100 ml, autoclave

Table 6
Composition of various buffers used for DNA isolation

Buffer Method of preparation

1 CTAB Extraction Buffer: for 1 L Measure 100 ml Tris (1 M), 280 ml NaCl, 40 ml
100 mM Tris–HCl (pH 8.0) EDTA (0.5 M). Mix with about 400 ml of hot
20 mM EDTA (pH 8.0) distilled water, add 20 g CTAB to this. Adjust
1.4 M NaCl final volume to 1 L. Dispense into reagent
2 % CTAB (w/v) Merck bottles and autoclave. Just before use, add
0.2 % β-mercaptoethanol (v/v)-Merck 0.2 % β-mercaptoethanol
2 TE (0.1 mM) buffer: for 100 ml Take 1 ml Tris–HCl (1 M), 20 ml EDTA (0.5 M).
100 mM Tris–HCl (pH 8.0) Mix with 99 ml sterile distilled water taken in a
0.1 mM EDTA (pH 8.0) reagent bottle, mix thoroughly, autoclave
3 TAE buffer 10×: for 1 L Weigh 48.4 g of Tris base; add 20 ml EDTA
(0.5 M); 11.42 ml glacial acetic acid and
around 150 ml distilled water. Dissolve the salt
and adjust volume to 1 L. Autoclave
4 Gel loading buffer (6×): for 100 ml Dissolve 0.25 g BPB in 99 ml 30 % glycerol. Keep
0.25 % bromophenol blue on magnetic stirrer for several hours to get the
30 % glycerol dye completely dissolved. Dispense into reagent
bottles and keep in 4 °C
 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 379

3. Incubate the sample at 65 °C for 30–60 min with occasional

mixing by gentle shaking.
4. Add equal volume of chloroform–isoamyl alcohol (24:1). Spin
at 38,638 × g, for 15 min, at 4 °C Transfer the aqueous phase
to fresh tubes with cut tips.
5. Add 2/3 volume of ice-cold isopropanol and mix by gentle
shakings.
6. Incubate at 4 °C for half an hour.
7. Centrifuge at 38,638 × g, for 15 min, at 4 °C.
8. Discard supernatant, add 70 % ethanol, and wash the precipi-
tate by gentle swirling for 3–4 min.
9. Spin at 26,832 × g, for 10 min at 4 °C. Pour off supernatant,
invert the tubes for 15 min to drain off excess alcohol, and
vacuum-dry the pellet.
10. To the dried pellet, add 500 μl TE to redissolve the DNA and
transfer the solution to 1 ml sterile microfuge tubes.

3.6.3 Purification 1. Add 2 μl DNase-free RNase (10 mg /ml) and incubate at

Procedure 37 °C for 1 h.
2. Extract with equal volume of phenol–chloroform–isoamyl
alcohol (25:24:1), by spinning at 26,832 × g and transferring
aqueous phase to fresh tubes.
3. Extract twice with equal volume of chloroform–isoamyl alco-
hol (24:1), by spinning at 26,832 × g and transferring aqueous
phase to fresh tubes.
4. Add 1/10th volume of 3 M sodium acetate (pH 5.2) and 0.8
volumes of ice-cold isopropanol and mix by gentle shaking to
precipitate the DNA.
5. Centrifuge at 26,832 × g for 5 min.
6. Decant supernatant carefully. Wash the pellet with 70 % cold
ethanol.
7. Air-dry the pellet and dissolve in 250 μl TE (pH 8).

3.6.4 Quality 1. Prepare 0.8 % agarose gel in 1× TAE buffer, add ethidium bro-
Analysis of DNA mide (10 mg/ml), and cast the gel.
2. Load 3 μl DNA sample mixed with 2 μl gel loading buffer (6×).
3. The gel is run at 60 V, for 2 h.
4. Visualize the image under UV Transilluminator in Bio-Rad
Gel Doc 1000 system and take a printout.

3.6.5 PCR Amplification 1. Amplify 20–50 ng of genomic DNA in a reaction mix contain-
ing 1.0 U Taq DNA polymerase, 1 μM primer, 1.5–2.0 mM
MgCl2, and 0.125 mM each of dNTPs, and 1× Taq DNA poly-
merase buffer.
380 K. Nirmal Babu et al.

2. The amplification profile consists of an initial denaturation of

3 min at 94 °C followed by 35–40 cycles of denaturation for
1 min at 94 °C, annealing for 37 °C for 1 min, and extension
at 72 °C for 2 min and final extension for 6 min at 72 °C.

3.6.6 Gel Electrophoresis 1. The amplified RAPD products are separated by horizontal
electrophoresis in 1.5 % (w/v) agarose gel, with 1× TAE buf-
fer, stained with ethidium bromide (0.5 μg/ml), and analyzed
under ultraviolet (UV) light.
2. The length of the DNA fragments is estimated by comparison
with DNA ladder.
3. Variability is then scored as the presence or absence of a specific
amplification product. Each gel is analyzed by scoring the pres-
ent (1) or absent (0) polymorphic bands in individual lanes.
4. The binary matrix is transformed into similarity matrix using
Dice similarity (NTSYS-PC 2.01; Numerical Taxonomy System
of Multivariate Programs).

3.7 Genetic 1. Cut off the healthy young leaves from a sterile plant in the
Transformation laminar flow hood and place them in a petri dish with sterile
water. Place 3 Whatman 1 filter papers cut in circles (sterile) in
a petri dish. Wet them with sterile water and place two leaves
over the filter paper. Cut out disks (about 5 mm diameter)
using a cork borer. Using a bacterial loop, transfer each disk
from water to a piece of dry Whatman 1 paper. Blot the disk
dry and then place it inverted on MS medium. Incubate for
two days in a tissue culture room.
(a) 2 ml culture of the Agrobacterium tumefaciens strain
(pBZ 100) (Kan 50/μml, 28 °C) (see Notes 8 and 9).
2. Day 2: Inoculate 20 ml YEP culture with 0.1, 0.2, 0.4, and
0.6 ml of the starting culture containing A. tumefaciens, in
separate flasks.
3. Monitor the cultures by measuring the O.D. at 600 nm. Use a
culture that has an optical density value of 1 at 600 nm.
Transfer 5 ml culture to a sterile petri dish. Using a bacterial
loop, transfer the leaf disks to Agrobacterium suspension.
Leave for two minutes and then blot dry on a Whatman 1
paper. Place the leaf disks on MS medium (Table 1) and incu-
bate for 2 more days.
4. Transfer the leaf disks on to the selection medium containing
kanamycin in which only plant cells transformed with neomy-
cin phosphotransferase would grow. This medium also con-
tains carbenicillin, which would kill Agrobacterium (Fig. 7).
Among the antibiotics concentrations tried, tolerance and
survival is better in 25–100 mg/ml [12].
5. Callus appears around the edges of the leaf disks. The leaf disk
can be selected on the antibiotic-amended MS medium with
 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 381

Fig. 7 Regeneration from Agrobacterium treated tissues of black pepper in

selection medium

2,4-D 1 mg/l, NAA 1 mg/l, sucrose 30 g/l, 8 g/l agar, kana-

mycin (<100 mg/l), and carbenicillin (<100 mg/l).
Regeneration of the transformed cells can be carried out subse-
quently in the shoot multiplication (WPM supplemented with
3 mg/l BA and 1 mg/l Kin) and rooting in basal WPM media
(see Note 10). After the development of roots, the plants are
transferred to moist vermiculite in pots and transferred to
growth chambers and subsequently to the greenhouse.

3.8 In Vitro 1. Shoot tips (2–3 cm long) are collected from 3-year-old plants,
Conservation [13] thoroughly washed in running tap water and then wiped with
70 % ethanol.
3.8.1 In Vitro Storage
by Minimal Growth 2. The explants are surface-sterilized in 0.1 % mercuric chlo-
ride for 3 min, followed by rinsing in sterile distilled water
three times.
3. Shoot tips are cultured on the WPM supplemented with 3 mg/l
BA + 1 mg/l Kin for the induction of multiple shoots [6, 8, 10].
This is used as the base material for further studies.
4. The cultures could be stored up to 360 days with 80 % survival
in half WPM (Woody Plant Medium) medium supplemented
with 15 g/l each of sucrose and mannitol in sealed culture ves-
sels and the growth rate was also reduced.
5. For encapsulation of axenic shoot tips (1–2 mm) different con-
centrations of sodium alginate are tried and 4 % is the optimum
concentration. Encapsulated shoot tips are cryopreserved
using vitrification technique.
6. In encapsulation-vitrification method, the encapsulated shoot
tips are pre-cultured on MS medium supplemented with
0.3 M, 0.5 M, and 0.7 M sucrose (pH 5.8) for three days fol-
lowed by dehydration with PVS2 (containing 30 % (w/v) glyc-
erol, 15 % (w/v) ethylene glycol, and 15 % (w/v) DMSO
mixed in MS medium containing 0.4 M sucrose) solution
(100 %) at pH 5.8, and 0 °C for 3 h. After dehydration, the
382 K. Nirmal Babu et al.

beads (ten beads containing shoot tips), are immersed in

0.8 ml PVS2 solution in a 1.5 ml cryo-tube, and are frozen
rapidly by direct immersion into liquid nitrogen (−196 °C) and
kept for 1 hour.
7. After 1 hour the samples are thawed at 40 °C for 90 s in a
water bath. PVS2 solution is decanted and the beads are
washed thrice with 1.2 M sucrose (2 min/washing).
8. For recovery, the encapsulated shoot tips are re-cultured on
medium containing 0.5 mgl–1 BAP and kept in the dark for 2
weeks under a 16 h light–8 h dark photoperiod.
9. Subsequent subculture is done every 20 days. Six-month-old
plants are hardened.

3.8.2 Cryopreservation 1. Embryos are extracted from the surface-sterilized seeds and
of Zygotic Embryos placed on Murashige and Skoog medium with 2 M glyc-
erol + 0.4 M sucrose in the dark at 22 ± 2 °C for 3 days before
being used for freezing experiments.
2. Zygotic embryos are cryopreserved using the vitrification tech-
nique. Zygotic embryos are incubated for 3 h at 0 °C in a load-
ing solution containing ice cold PVS2 vitrification solution.
3. Zygotic embryos are frozen rapidly by direct immersion in
liquid nitrogen after direct treatment with full-strength vitrifi-
cation solution. About ten embryos can be immersed in 1 ml
PVS2 solution/1.8 ml cryotube.
4. After storage at −196 °C the embryos could be retrieved by
thawing. This is done by plunging the cryotubes for 90 s in a
water bath at 40 °C.
5. The PVS2 solution is eliminated by washing the embryos twice
with medium containing 1.2 M sucrose.
6. Embryos are then transferred on MS basal media with 0.1 M
sucrose. Survival is measured by assessing the percentage of
embryos having germinated [3]. Around 80 % recovery of
cryopreserved embryos can be obtained (see Note 11).

4 Notes

1. Endogenous bacterial contamination is a major problem affect-

ing black pepper cultures. Initial inoculation of explant con-
taining antibiotics will help in reducing the bacterial
contamination. But these cultures could not be retained in
antibiotic containing medium as the antibiotics will affect further
growth and multiplication, and hence they must be shifted to
fresh culture medium without antibiotics within one week.
2. Initial reduction of sucrose to 15 g/l will help to reduce the
growth of bacterial contamination. These initial aseptic
Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 383

cultures will be the source explants (leaves, shoot tips, nodal

segments, and roots) for callus induction, plant regeneration,
establishment of embryogenic suspension cultures, and genetic
transformation experiments.
3. The micro shoots, embryos derived from aseptic cultures will
be the starting materials for all cryopreservation experiments.
This will increase the efficiency of cryopreservation and recov-
ery of cryopreserved propagules.
4. Transfer the somatic embryos to plant growth regulator free
liquid medium and agitate on orbital shaker at 100 rpm for
production of large number of somatic embryos. These opera-
tions in the dark enhance adventive embryogenesis and matu-
ration of embryos.
5. During protoplast isolation osmotic strengths of cytoplasm
and the isolation medium need to be balanced, to prevent plas-
molysis or bursting of the protoplasts.
6. After digestion, the enzyme solution containing protoplasts is
filtered through a stainless steel mesh (60 mesh size from Sigma)
to remove larger particles of undigested tissues and cell clumps.
7. The filtrate is distributed into sterilized screw capped centrifuge
tubes and centrifuged in Beckman tabletop centrifuge for 10 min
at 700 rpm. The protoplasts form a pellet at the bottom of the
tube. The supernatant enzyme solution is removed using a
Pasteur pipette without disturbing the pellet. The pellet is sus-
pended in Cell Protoplast Washing (CPW) medium.
Centrifugation and resuspension in fresh medium is repeated
three times so as to wash the protoplasts and remove traces of
enzyme solution. After washing, the pellet of protoplasts is resus-
pended in 1 ml CPW medium and layered on top of 9 ml floata-
tion medium (Table 4) and centrifuged at 700 rpm for 10 min.
The live protoplasts form a band at the interphase, which is col-
lected with a Pasteur pipette and transferred to culture medium.
8. Black pepper leaf tissues could be transformed using
Agrobacterium tumefaciens. The construct used contained
gene for osmotin, a PR protein known to induce Phytophthora
resistance, and kanamycin as antibiotic selection marker [10].
Leaf explants from both juvenile as well as mature tissues and
zygotic embryos are used as explants. Among the different
variables tested, while performing transformation, viz., co-
cultivation period, pre-culture of explants, temperature, and
pH, co-cultivation of 48 h is efficient. Use leaf explants from
both juvenile as well as mature tissues and zygotic embryos as
explants for transformation.
9. The treated tissues are transferred in the selection medium
(WPM with BAP 1 mg/l + Kinetin 1 mg/l + Cefotaxime
250 mg/l + Kanamycin 50 mg/l). Putative transgenics shoots
are regenerated from leaf disks treated with Agrobacterium
containing osmotin.
384 K. Nirmal Babu et al.

10. MS [7] and WPM [14] medium can be used for in vitro cul-
tures in Piper species.
11. Black pepper cultures could be stored under minimal growth
conditions up to 360 days in half WPM or MS medium supple-
mented with 15 g/l each of sucrose and mannitol in sealed cul-
ture vessels. The cultures could be retrieved with 80 % survival.
The conservation of genetic resources in in vitro gene bank uti-
lizing medium and long -term cryopreservation methods has led
to development of a conservation strategy (Fig. 8), which can be
used as a safe alternative to germplasm conservation.

Fig. 8 Schematic representation of the in vitro conservation strategy adopted in black pepper
 Biotechnology for Multiplication, Conservation and Crop Improvement of Black Pepper 385

References
1. Ravindran PN, Nirmal Babu K, Peter KV, 8. Schenk RU, Hildebrandt AC (1972) Medium
Abraham Z, Tyagi RK (2005) Spices. In: and techniques for induction and growth of
Dhillon BS, Tyagi RK, Saxena S, Randhawa GJ monocotyledonous and dicotyledonous plant
(eds) Plant genetic resources: horticultural cell cultures. Can J Bot 50:199–204
crops. Narosa Publishing House, New Delhi, 9. Nair RR, Gupta SD (2003) Somatic embryo-
pp 190–227 genesis and plant regeneration in black pepper
2. Ravindran PN, Nirmal Babu K, Sasikumar B, (Piper nigrum L.): direct somatic embryogen-
Krishnamoorthy KS (2000) Botany and crop esis from tissues of germinating seeds and
improvement of black pepper. In: Ravindran ontogeny of somatic embryos. J Hortic Sci
PN (ed) Black pepper, Piper nigrum. Harwood Biotech 78(3):416–421
Academic Publishers, Amsterdam, The 10. Nair RR, Dutta Gupta S (2006) High fre-
Netherlands, pp 23–142 quency plant regeneration through cyclic sec-
3. Nirmal Babu K, Asha S, Saji KV, Parthasarathy ondary somatic embryogenesis in black pepper
VA (2011) Black pepper. In: Singh HP, (Piper nigrum L.). Plant Cell Rep
Parthasarathy VA, Nirmal Babu K (eds) 24:699–707
Advances in horticulture biotechnology, vol 3, 11. Ausubel FM, Brent R, Kingston RE et al
Molecular markers and marker assisted (1995) Current protocols in molecular biol-
selection-fruit crops, plantation crops and ogy, vol 1. Wiley, Hoboken, NJ,
spices. Westville Publishing House, New pp 2.3.1–2.3.7
Delhi, pp 247–260 12. Sinoj J, Sheeja TE, Bhai RS et al (2014)
4. Nirmal Babu K, Rema J, Pillai GS et al (1992) Somatic embryogenesis and transgenic devel-
Micropropagation of betel vine (Piper betle opment in black pepper for delayed infection
L.). J Spices Aromatic Crops 1(2):160–162 and decreased spread of foot rot caused by
5. Nirmal Babu K, Rema J, John CZ et al (1996) Phytophthora capsici. J Plantation Crops
Plant regeneration from tissue culture of Piper 42(1):20–28
colubrinum Link. J Plantation Crops 13. Nirmal Babu K, Yamuna G, Praveen K et al
24:594–596 (2012) Cryopreservation of spices genetic
6. Nirmal Babu K, Rema J, Sree Ranjini DP et al resources. In: Katkov II (ed) Current frontiers
(1996) Micropropagation of an endangered in cryobiology. InTech-Open Access Publisher,
species of Piper, P. barberi Gamble and its con- Croatia, pp 457–484. ISBN
servation. J Plant Genet Resour 978-953-51-0191-8
9(1):179–182 14. Lloyd G, McCown BH (1980) Commercially
7. Murashige T, Skoog F (1962) A revised feasible micropropagation of mountain lau-
medium for rapid growth and bioassays with rel, (Kalmia latifolia) by use of shoot tip
tobacco tissue culture. Physiol Plant culture. Int Plant Prop Soc Comb Proc
15:473–497 30:421–427
 Chapter 27

Protocols for In Vitro Propagation, Conservation, Synthetic

Seed Production, Microrhizome Production, and Molecular
Profiling in Turmeric (Curcuma longa L.)
K. Nirmal Babu, Minoo Divakaran, Geetha S. Pillai, V. Sumathi,
K. Praveen, Rahul P. Raj, H.J. Akshita, P.N. Ravindran, and K.V. Peter

Abstract
Turmeric is a rhizomatous herbaceous perennial but cultivated as annual, belonging to the family
Zingiberaceae. It is a native of India and South East Asia. The tuberous rhizomes or underground stems
of turmeric are used from antiquity as condiments, a dye and as an aromatic stimulant in several medicines.
Turmeric is an important crop in India and it is used as a spice, food preservative, coloring agent, cosmetic
as well as for its medicinal properties. Propagation is done vegetatively with rhizome bits as seed materials.
It is plagued by rhizome rot diseases most of which are mainly spread through infected seed rhizomes.
Micropropagation will help in production of disease-free seed. Sexual reproduction is rare in turmeric,
making recombinant breeding very difficult. In vitro technology can thus become the preferred choice and
it can be utilized for multiplication, conservation of genetic resources, generating variability, gene transfer,
molecular tagging, and their utility in crop improvement.

Key words Conservation, Cryopreservation, Embryo rescue, In vitro conservation, Micropropagation,

Microrhizome production, Molecular profiling, Plant regeneration, Somaclonal variation, Synthetic
seeds, Turmeric

Abbreviations
BA Benzyl adenine
IBA Indole-3-butyric acid
Kin Kinetin
NAA α-naphthalene acetic acid
MS Murashige and Skoog

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_27, © Springer Science+Business Media New York 2016

387
388 K. Nirmal Babu et al.

1 Introduction

Turmeric (Curcuma longa L.) is an important spice crop belong-

ing to the family Zingiberaceae and known for its varied medicinal
properties (Fig. 1). Turmeric is a native of India and South East
Asia and is used since ancient times as a spice and a dye and culti-
vated extensively in China, India, Indonesia, and Thailand and
throughout the tropics, including tropical regions of Africa and
America. It is extensively used in Chinese, Ayurvedic, Unani, and
Siddha systems of medicine and as a home remedy for various ail-
ments. The coloring principle of turmeric “curcumin” is responsi-
ble for many medicinal properties [1] and used in cheese, spices,
mustard, cereals, pickles, potato flakes, soups, ice creams, yogurts
and also in pharmacy, confectionery, and food industries. Recent
research is focused on turmeric’s antioxidant, hepatoprotective,
anti-inflammatory, anticarcinogenic, and antimicrobial properties,
in addition to its use in cardiovascular disease and gastrointestinal
disorders. India is the world’s largest producer, consumer, and
exporter of turmeric with an annual production of about 9,86,690
tonnes from an area of 1,94,330 ha during 2012–2013.
Turmeric rarely sets seeds, hampering recombination breed-
ing. Conventionally propagated through rhizomes, its cultivated

Fig. 1 Turmeric plant

 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 389

types exhibit much morphological variations probably due to accu-

mulated vegetative mutations. The past few years have seen the
solutions of many breeding bottlenecks being solved by the use of
biotechnological tools. Somaclonal variation, anther and proto-
plast culture, rDNA techniques, etc. are successfully utilized for
production of disease-free planting material, conservation and
improvement of genetic resources. Protocols for various tech-
niques have been standardized and are summarized below.
Morphological and molecular variations among micropropagated
and callus-regenerated plants were studied and variations were
found in both but with higher percentage of variation in callus-
regenerated somaclones [2, 3]. In vitro plants developed through
microrhizome exhibited least amount of variations. The study
inferred that this is due to the accumulated vegetative mutations
(mosaic) in turmeric. The genetic fidelity studies of turmeric germ-
plasm conserved in in vitro gene bank using RAPD profiling
showed their genetic integrity [4].

2 Materials

2.1 Explant Vegetative bud explants from rhizomes.

Materials

2.2 Glassware Borosilicate conical flasks (500 ml), glass bottles (250 ml), culture
tubes (22 cm × 3.5 cm), and 250 ml conical flasks, culture vessels,
tubes, bottles, and flasks. Cotton plugs (made of non-absorbent
cotton covered with cheese cloth), aluminum foil, or polypropyl-
ene caps.

2.3 Growth Auxins—α-naphthalene acetic acid (NAA), indole-3-butyric acid

Regulators (IBA) 0–1.0 mg/l;
Cytokinins—6-benzylaminopurine (BA) and 6-furfurylamino
purine (kinetin) 0–3.0 mg/l.

2.4 Gelling Agents Bacteriological grade agar, 7–8.0 g/l.

2.5 Culture Medium ● Murashige and Skoog (MS) basal medium (Table 1).
● Stock solutions for macronutrients, micronutrients, vitamins,
vamino acids, and plant growth regulators (Table 2).
● Sucrose—30 g/l for multiplication and 90 g/l for microrhi-
zome induction.

2.6 Culture Rhizomes from potted plants.

Establishment

2.7 Culture Initiation MS medium supplemented with 3 % sucrose and 0.5 mg/l Kinetin.
390 K. Nirmal Babu et al.

Table 1
Composition of Murashige and Skooga basal medium

Composition Concentration (mg/l)

Macronutrients
Ammonium nitrate NH4NO3 1650.00
Potassium nitrate KNO3 1900.00
Calcium chloride CaCl2·2H2O 440.00
Potassium orthophosphate KH2PO4 170.00
Magnesium sulfate MgSO4.7H2O 370.00
Micronutrients Na2EDTA 37.30
Sodium EDTA FeSO4·7H2O 27.80
Ferrous sulfate H3BO3 6.20
Boric acid MnSO4.4H2O 22.30
Manganese sulfate KI 0.83
Potassium iodide ZnSO4·7H2O 8.60
Zinc sulfate Na2MoO4·2H2O 0.25
Sodium molybdate CuSO4·5H2O 0.025
Copper sulfate CoCl2·6H2O 0.025
Cobalt chloride
Vitamins
Myo-inositol C6H12O6 100.00
Thiamine HCl C12H17CIN4OS·HCl 0.10
Nicotinic acid C6H5NO2 0.50
Pyridoxine HCl C8H11NO3·HCl 0.50
Amino acid
Glycine C2H5NO2 2.00

a
Murashige and Skoog [8]

2.8 In Vitro In vitro regenerated shoot buds.

Conservation

2.9 Production In vitro regenerated shoot buds, protocorms, and callus; sodium
of Synthetic Seeds alginate, and calcium chloride.

2.10 Long-Term Synseeds containing miniaturized shoot tips, pollen are used as
Storage explants, and are immersed in liquid nitrogen.
by Cryopreservation
In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 391

Table 2
Details of various stock solutions for MS medium

Stock Composition Stock strength Quantitya

A Macronutrients ×20 50 ml
NH4NO3
KNO3
CaCl2·2H2Ob
KH2PO4
MgSO4·7H2O
B Micronutrients ×100 10 ml
H3BO3
MnSO4·4H2O
KI
ZnSO4·7H2O
Na2MoO4·2H2O
CuSO4·5H2Oa
CoCl2·6H2Oa
C Micronutrients ×100 10 ml
Na2EDTAa
FeSO4·7H2Oa
D Vitamins ×100 10 ml
Thiamine HCl
Nicotinic acid
Pyridoxine HCl
E Amino acid ×100 10 ml
Glycine
F Myo-inositol ×100 10 ml
Growth regulators
2,4-D 50 mg/200 ml
NAA 50 mg/200 ml
BA 50 mg/200 ml
Kinetin 50 mg/200 ml
a
For preparation of 1 L medium. Make up the remaining is double distilled water
up to 900 ml adjust the pH and add the remaining water to 1000 ml
b
Dissolved separately before mixing in the final stock
392 K. Nirmal Babu et al.

3 Methods

3.1 Micropropagation 1. Newly sprouting buds are used as a source of explants for the
and Multiplication culture.
of True-to-Type Plants 2. Wash the explants under running tap water for 15 min fol-
3.1.1 Establishment
lowed by detergent solution (Tween 20) for 10–15 min.
of Cultures in Turmeric 3. Surface-sterilize using copper oxychloride, Bavistin (10 min
(Fig. 2) each), 70 % ethanol (30–40 s) and wash with sterile distilled
water for 3–4 min to remove the remnants of the fungicide.
4. Before starting inoculation, clean/treat the laminar flow with
ethyl alcohol (70 %) for 30–60 s, wash the explants again in
sterile double distilled water followed by treatment with 0.1 %
HgCl2 for 3–5 min and rinse with sterile distilled water for 3–4
times.
5. Cut the sterilized buds into small pieces suitable for inocula-
tion and dissect the sprouts and remove the outer leaf sheaths
under aseptic condition.
6. Inoculate the explants in test tubes containing half-strength
MS media supplemented with 3 mg/l BA and 1 mg/l NAA.

3.1.2 Multiplication 1. Use 1-week-old, contamination-free cultures for multiplica-

of Contamination-Free tion. Explants are taken out carefully under sterile conditions
Cultures in Turmeric and transferred into multiplication medium MS medium con-
(Fig. 3) taining 5 mg/l BA and 1.0 mg/l NAA.
2. Use 7- to 8-week-old cultures for subculturing and for further
multiplication. 20–25 plants can be harvested from 8-week-
old culture.

3.2 Direct 1. Collect immature, 1- to 10-day-old inflorescence (during

Regeneration flowering season) and sterilize.
of Plantlets 2. Remove the outer bracts under aseptic condition and transfer
from Immature remaining inflorescence to culture medium.
Inflorescence

Fig. 2 (a, b) Explant sources of turmeric

 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 393

Fig. 3 (a–c) Stages of culture establishment and in vitro multiplication in turmeric

Fig. 4 (a–d) Stages in microrhizome induction and in vitro rhizome formation in turmeric

3. Use MS medium amended with 10 mg/l BA and 0.2 mg/l

2,4-D.
4. MS liquid medium having 1 mg/l NAA enhances rooting.

3.3 In Vitro Rooting 1. Turmeric cultures do not require separate culture medium for
and Production rooting. Once the shoots become around 3–4 cm they auto-
of Plantlets matically root in the media used.
2. MS liquid medium with 1 mg/l NAA can be used to improve
rooting before transplanting to the soil.

3.4 Microrhizome Technology for microrhizome development in turmeric was stan-

Induction (Fig. 4) dardized [5].
1. Microrhizome formation will be noticed in MS medium sup-
plemented with 90 g sucrose after 90–100 days of inoculation
and reaches maturity by 120 days.
2. Plant out microrhizomes directly in micro-cups or in the field
for normal rhizome development.

3.5 Callus Culture, Technology for plant regeneration from various tissues in turmeric
Plant Regeneration is available, and used to exploit somaclonal variation for increasing
from Callus, variability in this crop [6].
and Inducing 1. Wash new buds under running tap water followed by washing
Variability (Fig. 5) with 0.1 % HgCl2 for 5–10 min. Rinse the explants 3–4 times
to wash away the traces of HgCl2.
394 K. Nirmal Babu et al.

Fig. 5 Different stages of plant regeneration in turmeric, (a) Explant, (b) organogenesis from callus, (c) embryo-
genesis, (d) well-developed plantlets

2. Remove the outer leaf primordial under aseptic condition and

place a small segment of bud on MS media supplemented with
13.6 μm 2,4-D and 16 μm NAA for callus induction.
3. Subculture 2-month-old callus on MS medium containing
0.2 mg/l 2,4-D and 10 mg/l BAP for organogenesis and plant
regeneration.

3.6 Hardening 1. Take out healthy and well-rooted in vitro plantlets from the
and Planting Out culture media and wash carefully to remove the traces of cul-
ture medium.
2. Transfer to polythene bags containing garden soil, sand, and
farmyard manure in equal proportions and keep in humid
chamber.
3. Maintain 90–100 % relative humidity for 20–30 days for hard-
ening and establishment.

3.7 Encapsulation 1. Suspend in vitro grown shoots/somatic embryos in MS basal

and Synthetic Seed medium supplemented with 4 % (w/v) Na alginate, 2 M glyc-
Production erol, and 0.4 M sucrose.
2. Drop the mixture containing micro-shoots, with a sterile
pipette into 0.1 M CaCl2 solution containing 2 M glycerol and
0.4 M sucrose and leave for 20 min to form beads 4 mm in
diameter, each bead containing at least one shoot.
3. Store the beads in sterile containers for 6–8 months [7].
4. Transfer to MS medium amended with 1 mg/l BAP + 0.5 mg/l
NAA for regrowth.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 395

3.8 Conservation 1. Use vegetative bud explants and establish cultures in MS [8]
of Genetic Resources basal medium containing 0.5 mg/l kinetin.
3.8.1 Medium Term 2. Multiply established shoot cultures on MS medium supple-
In Vitro Conservation mented with 0.5 mg/l NAA and 1.0 mg/l BAP with an aver-
by Slow Growth age of 8 shoots per culture in 90 days of culture.
3. The in vitro developed shoots are maintained on half-strength
In Vitro Storage by Minimal
MS medium amended with 15 g/l each of sucrose and man-
Growth (Fig. 6)
nitol in sealed culture tubes up to 12 months with 80 %
survival.
4. Maintain cultures the same medium with yearly subculture up
to 7 years.
5. The miniaturized in vitro stored cultures can be recovered to
normal size by transferring to the multiplication medium
(MS + 1 mg/l BAP + 0.5 mg/l NAA), thereby resuming growth
and multiplying normally in 3 weeks of culture. Multiple
shoots and roots are produced in the same medium.
6. Transfer the rooted plantlets to nursery cups and maintain at
90–100 % relative humidity for 20–30 days for hardening and
establishment with 80–90 % survival [9, 10].

3.8.2 Long-Term Storage 1. Initiate the rhizomes excised from field-grown plants on MS
of Encapsulated Shoot Tips medium supplemented with 0.5 mg/l kinetin, 20 g/l sucrose,
by Cryopreservation 0.7 % agar in tissue culture tubes at 22 ± 20 °C under 278 cd
for a period of 2 weeks. Adjust pH 5.8 of the medium prior to
Cryopreservation (Fig. 7)
autoclaving at 121 °C for 15 min. Multiply the plantlets
obtained through initiation culture in MS medium containing
BAP (1.0 mg/l) and NAA (0.5 mg/l). Excise apical shoot tips
with two leaf primordial (about 1–2 mm in size) for
cryopreservation.
2. For osmoprotection suspend the excised shoot tips in 0.3 M
sucrose for a period of 3 days in the dark.
3. Dehydrate the osmoprotected shoot tips with ice-cold PVS2
solution at 0 °C for 3 h. PVS2 solution contains 30 % (w/v)

Fig. 6 In vitro storage by minimal growth in turmeric

396 K. Nirmal Babu et al.

Fig. 7 Various stages in cryopreservation of turmeric

 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 397

glycerol, 15 % (w/v) ethylene glycol, and 15 %(w/v) DMSO

in MS medium supplemented with 0.4 M sucrose (pH 5.8).
After dehydration, suspend 10 shoot tips in 1 ml PVS2 solu-
tion in a 1.8 ml cryo-tube and then plunge into liquid nitrogen
for 1 h.

Thawing and Regrowth 1. Thaw by rapidly immersing the cryotubes in water bath at
40 °C for 1 min
2. For encapsulation-vitrification method, PVS2 is drained off
from the vitrified samples, and replaced with 1.2 M sucrose
solution twice at 10 min intervals.
3. Propagules after thawing are placed on MS + BA (1 mg/l) and
NAA (0.5 mg/l) medium in petri dishes and maintained at the
same culture conditions as stock explants.
4. Around 80 % recovery of cryopreserved shoots can be
obtained [11].

3.9 Molecular There are various protocols for isolation of DNA from plant tis-
Profiling [11, 12] sues. For turmeric CTAB method was used [13]. The protocol
used for extraction of DNA from turmeric leaf tissues is as follows
3.9.1 Isolation of DNA
(Tables 3 and 4)
1. Grind 5 g young leaves in the liquid nitrogen with a mortar
and pestle and add 25 ml preheated (65 °C) CTAB buffer. Add
0.2 % β-mercaptoethanol prior to use.
2. Incubate at 60 °C for 30 min.
3. Extract with equal volume of chloroform–isoamyl alcohol
(24:1) at 26,832 × g for 10 min at room temperature.
4. Take the aqueous phase and add 2/3rd volume of ice-cold
isopropanol.
5. Incubate at −20 °C for 2 h and centrifuge at 26,832 × g for
15 min at 4 °C.
6. Discard the supernatant and invert the tube on paper towel for
few minutes.
7. Dissolve the pellet and add 1.5 ml TE buffer. Store at room
temperature.
8. Add 10 μg/ml RNase A and incubate at 37 °C for 30 min.
9. Add equal volume of Tris saturated phenol, mix it well and
centrifuge at 26,832 × g for 10 min.
10. To the aqueous phase, add equal volume of phenol–chloro-
form–isoamyl alcohol (25:24:1), shake and centrifuge at
26,832 × g for 10 min.
11. Take the aqueous phase and add equal volume of chloroform–
isoamyl alcohol (24:1), shake and centrifuge at 26,832 × g for
10 min.
398 K. Nirmal Babu et al.

Table 3
Composition of various stock solutions for DNA isolation

Solutions Method of preparation

1 M Tris–HCl (pH 8.0) 500 ml Dissolve 60.55 g Tris base (Sigma) in 300 ml distilled water. Adjust
pH to 8 by adding concentrated HCl. Adjust volume to 500 ml.
Dispense into reagent bottles and sterilize by autoclaving
0.5 M EDTA Dissolve 93.05 g f EDTA-disodium salt (sigma) in 300 ml water.
pH 8.0 Adjust pH to 8 by adding NaOH pellets. Adjust volume to
500 ml. Dispense into reagent bottles and autoclave
5 M NaCl Weigh 146.1 g NaCl (Merck) add 200 ml water and mix well.
500 ml When the salts get completely dissolved, adjust the final volume
to 500 ml. Dispense into reagent bottles and autoclave
3 M Sodium acetate (pH 5.2) Dissolve 61.523 g anhydrous sodium acetate (Qualigens) in 200 ml
250 ml water and mix well. When dissolved completely adjust the pH of
the solution to 5.2 with glacial acetic acid (99–100 %). Autoclave
Ethidium bromide Add 1 g ethidium bromide to 100 ml distilled water. Keep on
10 mg/ml, 100 ml magnetic stirrer to ensure that the dye has dissolved completely.
Dispense into amber colored reagent bottle and store at 4 °C
70 % ethanol, 500 ml Take 360 ml ethanol; mix with 140 ml distilled water. Dispense
into reagent bottle and store at 4 °C
Chloroform–isoamyl alcohol Measure 450 ml chloroform and 20 ml isoamyl alcohol. Mixed and
(24:1), 500 ml stored in room temperature
1 M MgCl2, 100 ml Weigh 20.33 g MgCl2, dissolve in double distilled water, make up
RNase A (10 mg/ml) to 100 ml, autoclave.
Make up 10 mg/ml RNase in distilled water. Boil for 10 min to
destroy DNase. Divide into 1 ml aliquots and store at −20 °C

12. To the aqueous phase add one-tenth volume of 3 M sodium

acetate (pH 5.2) and 2.5 volumes of ethanol and incubate at
−20 °C for 1 h or at −70 °C for 30 min
13. Centrifuge at 26832 × g for 10 min and wash the pellet in 70 %
ethanol (26,832 × g for 5 min).
14. Air-dry the pellet and dissolve in 1.5 ml TE and estimate the yield.
15. Estimate DNA amount using Scanning Shimadzu
Spectrophotometer. DNA shows a clear absorbance peak at
260 nm and value of 1.0 OD260 is calculated equivalent to
50 μg/ml. DNA solution is considered to be pure if the value
of OD260:OD280 is 1.8. The DNA is visualized on (0.8 %) aga-
rose gel for its quality and stored at −20 °C.

3.9.2 Molecular Profiling 1. Perform amplification in a total volume of 25 μl including

Using ISSR (Fig. 8) 2.5 μl 10× Taq DNA polymerase Buffer, 50 ng DNA, 0.15 mM
and SSR Primers dNTP, 1.5 mM MgCl2, 0.4 μM primers, and 1U Taq DNA
polymerase primers.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 399

Table 4
Composition of various buffers used for DNA isolation

Buffer Method of preparation

1 CTAB Extraction Buffer: for 1 L Measure 100 ml Tris (1 M), 280 ml NaCl, 40 ml EDTA
100 mM Tris–HCl (pH 8.0) (0.5 M). Mix with about 400 ml of hot distilled water, add
20 mM EDTA (pH 8.0) 20 g CTAB to this. Adjust final volume to 1 L. Dispense
1.4 M NaCl into reagent bottles and autoclave. Just before use, add
2 % CTAB (w/v) Merck 0.2 % β-mercaptoethanol
0.2 % β-mercaptoethanol
(v/v)-Merck
2 TE (0.1 mM) buffer…for 100 ml Take 1 ml Tris–HCl (1 M), 20 ml EDTA (0.5 M). Mix with
100 mM Tris–HCl (pH 8.0) 99 ml sterile distilled water taken in a reagent bottle, mix
0.1 mM EDTA (pH 8.0) thoroughly, autoclave
3 TAE buffer 10×: for 1 L Weigh 48.4 g Tris base; add 20 ml EDTA (0.5 M); 11.42 ml
glacial acetic acid and around 150 ml double distilled water.
Dissolve the salt and adjust volume to 1 L. Autoclave
4 10× DNA loading dye Ficoll (Type 400) 25 % (w/v), bromophenol blue 0.4 %
(w/v) and xylene cyanol FF 0.4 % (w/v). Dissolve 0.25 g
of BPB in 99 ml 30 % glycerol. Keep on magnetic stirrer
for several hours to get the dye completely dissolved.
Dispense into reagent bottles and keep in 4 °C

Fig. 8 ISSR profiling of released varieties of turmeric (Lanes 1–7 represent turmeric varieties Suvarna, Suguna,
Sudharsana, Prabha, Prathiba, Alleppey Supreme, and Kedaram) (a) Using the primer UBC 834a 5′-AGAGAGAG
AGAGAGAGCT-3′ and (b) Using primer 815 (5′-CTC TCT CTC TCT CTC TG-3′)

2. employ Amplification in a programmable thermal cycler with

cycling regimes of an initial denaturation at 94 °C for 5 min,
followed by a 33 repeats of a PCR core cycle of 94 °C for
1 min, 50 °C for 1 min and 72 °C for 1 min, followed by a final
extension cycle of 72 °C for 10 min.
400 K. Nirmal Babu et al.

Table 5
ISSR primers for DNA profiling of turmeric varieties

Sl no Primer name Sequence

1 UBC 810 5′-GAG AGA GAG AGA GAG AT-3′
2 UBC 811 5′-GAG AGA GAG AGA GAG AC-3′
3 UBC 812 5′-GAG AGA GAG AGA GAG AA-3′
4 UBC 815 5′-CTC TCT CTC TCT CTC TG-3′
5 UBC 834a 5′-AGAGAGAGAGAGAGAGCT-3′
6 UBC 835a 5′-AGAGAGAGAGAGAGAGCC-3′
7 UBC 844b 5′-CTCTCTCTCTCTCTCTGC-3′
8 UBC 850a 5′-GTGTGTGTGTGTGTGTCC-3′
9 UBC 864 5′-ATGATGATGATGATGATG-3′

3. Use the ISSR Primers listed in Table 5.

4. Resolve amplicons electrophoretically alongside a 1 kb ladder,
on a 1.5–2 % agarose gel stained with 0.5 mg/ml ethidium
bromide in a 1× TAE buffer (pH 8.0), and run at 90 V for 3 h
in an electrophoresis unit.
5. Carry out duplicate amplification to confirm reliability of the
bands. Amplified products are listed as discrete character states
in a present (1) or absent (0) matrix.
6. Relationship among genotypes is evaluated using the Unweight
Pair Grouping Mathematical Average (UPGMA) analysis and
plotted to produce a dendrogram using NTSyS software.

4 Notes

1. The explant source and stage are the most important criteria
for establishing contamination-free cultures with good in vitro
responses.
2. Disease- and virus-free source material must be used and the
individual plants are also checked to be free from symptoms.
3. Plant the rhizome bits in the greenhouse under protected con-
ditions with 4–5 in. of sand on top and periodically (once in 20
days) spray/drench 0.3 % copper oxychloride/Bavistin/
Dithane M-45 to minimize contamination.
4. Since explants from underground are used, there will be a high
chance of contamination. To minimize the costs only small
amounts (5 ml) of half-strength MS media are used.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Turmeric 401

5. Fungal and bacterial contamination appears within 5–10 days

and the contaminated cultures are discarded.
6. An initial period of 25–30 days is required for the explants to
accustom to the nutrient medium before exhibiting the first
signs of growth and bud break.
7. The shoot tips show signs of growth in 3–4 weeks and within
5–6 weeks axillary shoot buds also emerge.
8. After activation of rhizome buds, the newly sprouted buds are
excised and transferred to fresh media.
9. MS medium [8] is best suited for turmeric. Adjust the pH to
5.8 before adding agar. Agar is melted to ensure uniform dis-
tribution in the medium, which is autoclaved at 121 °C at
16 psi for 20 min.
10. For microrhizome induction, use sufficiently grown plants
under in vitro conditions. Under sterile conditions separate the
well-grown plants and use them for the induction of microrhi-
zome. Trim the roots and shoot before transferring into micro-
rhizome induction media.

References
1. Purseglove JW, Brown EG, Green CL, Robin Nirmal Babu K, Eapen SJ (eds) Biotechnology
SRJ (1981) Turmeric. In: Spices, vol 2. of spices, medicinal and aromatic plants. Indian
Longman, New York, pp 532–580 Society for Spices, Calicut, pp 65–69
2. Nirmal Babu K, Geetha SP, Minoo D et al 8. Murashige T, Skoog F (1962) A revised
(1999) In vitro conservation of germplasm. medium for rapid growth and bioassays with
In: Ghosh SP (ed) Biotechnology and its appli- tobacco tissue cultures. Physiol Plant
cation in horticulture. Narosa Publishing 15:473–493
House, New Delhi, pp 106–129 9. Geetha SP (2002) In vitro technology for
3. Nirmal Babu K, Ravindran PN, Peter KV (eds) genetic conservation of some genera of
(1997) Protocols for micropropagation of Zingiberaceae. PhD thesis, Calicut University
spices and aromatic crops. Indian Institute of 10. Nirmal Babu K, Shiva KN, Sabu M et al (2011)
Spices Research, Calicut, Kerala, p 35 Turmeric. In: Singh RJ (ed) Genetic resources
4. Ravindran PN, Nirmal Babu K, Shiva KN chromosome engineering and crop improve-
(2007) Botany and crop improvement of tur- ment, medicinal plants, vol 6. CRC Press,
meric. In: Ravindran PN, Nirmal Babu K, Boca Raton, pp 451–511
Sivaraman K (eds) Turmeric—the genus 11. Nirmal Babu K, Yamuna G, Praveen K et al
Curcuma. CRC Press, Boca Raton, pp 15–70 (2012) Cryopreservation of spices genetic
5. Nirmal Babu K, Minoo D, Geetha SP et al (2007) resources. In: Katkov II (ed) Current frontiers
Biotechnology of turmeric and related species. In: in cryobiology. InTech-Open Access Publisher,
Ravindran PN, Nirmal Babu K, Sivaraman K Croatia, pp 457–484. ISBN
(eds) Turmeric—the genus Curcuma. CRC 8-953-51-0191-8
Press, Boca Raton, pp 107–125 12. Syamkumar S, Sasikumar B (2007) Molecular
6. Sumathi V (2007) Studies on somaclonal vari- marker based genetic diversity analysis of
ation in Zingiberaceous crops. PhD thesis, Curcuma species from India. Sci Hortic
University of Calicut, Kerala, India 112:235–241
7. Sajina A, Minoo D, Geetha P et al (1997) 13. Ausubel FM, Brent R, Kingston RE et al
Production of synthetic seeds in few spice (1995) Current protocols in molecular biol-
crops. In: Edison S, Ramana KV, Sasikumar B, ogy, vol 1. Wiley, New York, pp 2.3.1–2.3.7
 Chapter 28

Protocols for In Vitro Propagation, Conservation, Synthetic

Seed Production, Embryo Rescue, Microrhizome
Production, Molecular Profiling, and Genetic
Transformation in Ginger (Zingiber officinale Roscoe.)
K. Nirmal Babu, K. Samsudeen, Minoo Divakaran, Geetha S. Pillai,
V. Sumathi, K. Praveen, P.N. Ravindran, and K.V. Peter

Abstract
Ginger is a rhizomatous plant that belongs to the family Zingiberaceae. It is a herbaceous perennial but
cultivated as annual, with crop duration of 7–10 months. Ginger is native to India and Tropical South Asia.
The tuberous rhizomes or underground stems of ginger are used as condiment, an aromatic stimulant, and
food preservative as well as in traditional medicine. Ginger is propagated vegetatively with rhizome bits as
seed material. Cultivation of ginger is plagued by rhizome rot diseases, most of which are mainly spread
through infected seed rhizomes. Micropropagation will help in production of disease-free planting mate-
rial. Sexual reproduction is absent in ginger, making recombinant breeding very impossible. In vitro tech-
nology can thus become the preferred choice as it can be utilized for multiplication, conservation of
genetic resources, generating variability, gene transfer, molecular tagging, and their utility in crop improve-
ment of these crops.

Key words Anther culture, Artificial/synthetic seeds, Cryopreservation, Embryo rescue, In vitro
conservation, Micropropagation, Molecular profiling, Plant regeneration, Protoplast isolation,
Somaclonal variation, Somatic embryogenesis, Transgenics, Ginger, Zingiber officinale

Abbreviations
BA Benzyl adenine
IBA Indole-3-butyric acid
Kin Kinetin
NAA α-Naphthalene acetic acid
MS Murashige and Skoog

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_28, © Springer Science+Business Media New York 2016

403
404 Nirmal Babu K. et al.

1 Introduction

Ginger, one of the oldest and most important spices, is being culti-
vated in Tropical Asia for over 3000 years and is the underground
rhizome of Zingiber officinale Rosc (Fig. 1a) belonging to the
family Zingiberaceae [1]. Ginger is an essential part of Indian food
system and is known for its aromatic as well as medicinal proper-
ties. India is a leading producer of ginger in the world and during
2012–2013 the country produced 6, 69,350 tons of the spice from
an area of 1, 34,430 ha. Ginger is widely used as a spice in various
forms: fresh ginger (green), dried ginger or dry powdered ginger
and preserved ginger, ginger paste, ginger oleoresin, ginger oil, etc.
Fresh ginger is widely used in cooking to make ginger products
and drinks in South-East Asia. Ground dried ginger and preserved
ginger are used worldwide for domestic culinary purposes and also
in flavoring of processed foods, especially in bakery and confection-
ary. Ginger oleoresin which has the flavor, aroma, and pungency
of the spices is used for flavoring and also in pharmaceuticals. The
essential oil from ginger, which has the aroma and flavoring but
lacks pungency, is used in flavoring beverages, in cosmetics, confec-
tionary, perfumes, and pharmaceuticals. Ginger is used in medicines

Fig. 1 Ginger
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 405

especially as carminative, stimulant of the gastrointestinal tracts,

rubefacient, diaphoretic, diuretic, anti-inflammatory, antiemetic,
sialagogic emmenagogue, abortifacient, and vermifuge [2].

Lack of seed set in ginger leads to narrow genetic base hamper-

ing crop improvement programs and vegetative propagation by
rhizomes results in spread of diseases like rhizome rot (caused by
Pythium aphanidermatum) and bacterial wilt (caused by Ralstonia
solanacearum). The in vitro techniques and protocols standardized
and described below can help solve these major bottlenecks in
breeding and cultivation

2 Materials

2.1 Explant Vegetative bud explants from rhizomes.

Materials

2.2 Glassware Borosilicate conical flasks (500 ml), glass bottles (250 ml), cul-
ture tubes (22 cm × 3.5 cm), and 250 ml conical flasks, culture
vessels, tubes, bottles and flasks, cotton plugs (made of non-
absorbent cotton covered with cheese cloth), aluminum foil, or
polypropylene caps.

2.3 Growth Auxins—α-naphthalene acetic acid (NAA), indole-3-butyric acid

Regulators (IBA) 0–1.0 mg/l;

Cytokinins—6-Benzylaminopurine (BA) and 6-furfurylamino

purine (kinetin) (Sigma Chemicals) 0–3.0 mg/l.

2.4 Gelling Agents Bacteriological grade agar, 7–8.0 g/l.

2.5 Culture Medium ● Murashige and Skoog (MS) [3] basal medium (Tables 1 and 2).
● Stock solutions for macronutrients, micronutrients, vitamins,
amino acids, and plant growth regulators (Table 2).
● Sucrose—30 g/l for multiplication and 90 g/l for microrhi-
zome induction.

2.6 Culture Healthy rhizomes, collected from potted plants.

Establishment

2.7 Equipment Laminar airflow, autoclave, MilliQ filter sterilization unit, Leica
inverted microscope, PCR machine, electrophoresis unit, refriger-
ated centrifuge, He-driven particle delivery system (PDS).
406 Nirmal Babu K. et al.

Table 1
Composition of Murashige and Skooga basal medium

Concentration
Composition (mg/l)
Macronutrients
Ammonium nitrate NH4NO3 1650.00
Potassium nitrate KNO3 1900.00
Calcium chloride CaCl2·2H2O 440.00
Potassium orthophosphate KH2PO4 170.00
Magnesium sulfate MgSO4·7H2O 370.00
Micronutrients
Sodium EDTA Na2EDTA 37.30
Ferrous sulfate FeSO4·7H2O 27.80
Boric acid H3BO3 6.20
Manganese sulfate MnSO4·4H2O 22.30
Potassium iodide KI 0.83
Zinc sulfate ZnSO4·7H2O 8.60
Sodium molybdate Na2MoO4·2H2O 0.25
Copper sulfate CuSO4·5H2O 0.025
Cobalt chloride CoCl2·6H2O 0.025
Vitamins
Myoinositol C6H12O6 100.00
Thiamine HCl C12H17CIN4OS·HCl 0.10
Nicotinic acid C6H5NO2 0.50
Pyridoxine HCl C8H11NO3·HCl 0.50
Amino acid
Glycine C2H5NO2 2.00
a
Murashige and Skoog, 1962

3 Methods

3.1 Micro- 1. Rhizomes with buds/sprouts can be used as explants.

propagation 2. Select the rhizome cuttings or newly sprouting buds. In the
3.1.1 Establishment laminar airflow hood, wash the explants thoroughly with sterile
of Cultures in Ginger double-distilled water and dry on sterile filter paper.
(Fig. 2) 3. Wash the explants under running tap water for 15 min fol-
lowed by detergent solution (Tween 20) for 10–15 min.
4. Surface sterilize using copper oxychloride, bavistin (10 min
each), and 70 % ethanol (30–40 s) and wash with sterile dis-
tilled water for 3–4 min to remove the remnants of the
fungicide.
5. Before inoculation, the laminar flow should be cleaned with
ethyl alcohol (70 %) for 30–60 s.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 407

Table 2
Details of various stock solutions for MS medium

Stock Composition Stock strength Quantitya

A Macronutrients ×20 50 ml
NH4NO3
KNO3
CaCl2·2H2Ob
KH2PO4
MgSO4·7H2O
B Micronutrients ×100 10 ml
H3BO3
MnSO4·4H2O
KI
ZnSO4·7H2O
Na2MoO4·2H2O
CuSO4·5H2Ob
CoCl2·6H2Ob
C Micronutrients ×100 10 ml
Na2EDTAb
FeSO4·7H2Ob
D Vitamins ×100 10 ml
Thiamine HCl
Nicotinic acid
Pyridoxine HCl
E Amino acid ×100 10 ml
Glycine
F Myoinositol ×100 10 ml
Growth regulators 50 mg/200 ml
2,4-D
NAA 50 mg/200 ml
BA 50 mg/200 ml
Kinetin 50 mg/200 ml
a
For preparation of 1 l medium. Make up the remaining in double-distilled water up to 900 ml, adjust the pH, and add
the remaining water to 1000 ml
b
Dissolved separately before mixing in the final stock

Fig. 2 Explant sources of ginger

408 Nirmal Babu K. et al.

Fig. 3 Stages of culture establishment and in vitro multiplication—ginger (a–c)

6. In the laminar airflow hood, wash the explants again in sterile

double-distilled water followed by treatment with 0.1 % HgCl2
for 3–5 min and rinse with sterile distilled water 3–4 times.
7. Sterilized buds can be cut to required size usually 1 cm with
2–3 dormant buds or 3–4 mm with growing vegetative bud
and inoculate to the initiation medium.
8. Inoculate the explants in test tubes containing half-strength
MS media supplemented with 3 mg/l BA and 1 mg/l NAA.
Adjust pH to 5.8 before adding agar melt to ensure uniform
distribution in the medium, and autoclave the media at 121 °C
at 16 psi for 20 min.

3.1.2 Multiplication 1. One-week-old, contamination-free, cultures can be used for

(Fig. 3) multiplication. Explants taken out carefully under sterile con-
ditions transfer into multiplication MS medium supplemented
with 5 mg/l BA and 1.0 mg/l NAA.
2. Use 7–8-week-old cultures for sub-culturing and for further
multiplication. 20–25 plants can be harvested from 8-week-
old culture [4].

3.2 Direct 1. Collect immature, 1–10-day-old inflorescence (during flowering

Regeneration season) and sterilize.
of Plantlets 2. Remove the outer bracts under aseptic condition and transfer
from Immature remaining inflorescence to culture medium.
Inflorescence (Fig. 7a) 3. Use MS medium supplemented with 10 mg/l BA and
0.2 mg/l 2,4-D.
4. Use of MS liquid medium with 1 mg/l NAA enhances
rooting [5].

3.3 In Vitro Rooting 1. Ginger cultures do not require separate culture medium for
and Production rooting.
of Plantlets (Fig. 3) 2. Shoots 3–4 cm long automatically root in the media used.
3. Use MS liquid medium containing 1 mg/l NAA to improve
rooting before transplanting to the soil.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 409

Fig. 4 Stages in microrhizome induction and in vitro rhizome formation in ginger; (a) In vitro development of
plantlets; (b) induction of microrhizomes, in vitro; (c) in vitro rhizomes ready for planting; (d) shoot develop-
ment and microrhizome proliferation

3.4 Microrhizome 1. In vitro-developed plantlets (4–5 cm) with well-formed roots

Induction (Fig. 4) are used for microrhizome induction.
2. Separate the well-grown plants under sterile condition and use.
Roots and shoots should be trimmed before transferring into
microrhizome induction media.
3. Microrhizome formation will be noticed in MS medium sup-
plemented with 90 g sucrose after 90–100 days of inoculation
and reaches maturity in 120 days.
4. These microrhizomes can be directly planted out in bags or in
the field for normal rhizome development.

3.5 Callus Culture 1. Wash the explants under running tap water followed by wash-
and Inducing ing with 0.1 % HgCl2 for 5–10 min. Rinse the explants 3–4
Variability times to wash away the traces of HgCl2.
3.5.1 Plant Regeneration 2. Outer leaf sheaths can be removed under aseptic condition and
from Leaf-Derived Callus [4] place a small segment of innermost leaf tissue on MS media
supplemented with 2,4-D and NAA. Callus is formed in the
medium containing 0.2 mg/l 2,4-D and 0.5 mg/l NAA.
3. Two-month-old callus can be sub-cultured in MS medium
containing 0.2 mg/l 2,4-D and 10 mg/l BAP for organogen-
esis and plant regeneration.

3.5.2 Plant Regeneration 1. Collect 7–15-day-old inflorescence for inoculation.

from Ovary-Derived Callus 2. Disinfect by washing with 5 % teepol solution for 20 min fol-
(Fig. 5) lowed by sterile water. Surface sterilization can be done with
0.1 % HgCl2 solution for 5–7 min and rinse 4–5 times with
sterile water.
3. Excise ovaries from individual flowers under aseptic condition
and culture in MS medium containing 30 g/l bacteriological
grade agar supplemented with 0.2 mg/l 2,4-D and
10 mg/l BAP for inducing somatic embryogenic cultures [6].
4. Culture somatic embryoids in MS medium containing 1 mg/l
NAA for further growth and development of plantlets.

3.5.3 Plant Regeneration 1. Collect the inflorescence, wash under running tap water, and
from Anther-Derived Callus keep at 0 °C for 1–9 days for cold treatment.
Cultures (Fig. 6)
410 Nirmal Babu K. et al.

Fig. 5 Different stages of plant regeneration in ginger, (a) explant, (b) callus, (c) organogenesis, (d) embryogenesis,
(f) and (g) repeated budding after organogenesis from ovary-derived callus cultures and plant development from
them and (g) well-developed plantlets

Fig. 6 Uni-nucleate pollen (a) from ginger and plant regeneration (b) from anther-derived callus

2. Individual flowers are excised from inflorescence and surface

sterilize with 0.1 % mercuric chloride for 10 min followed by
3–4 times washing with sterile water.
3. For organogenesis and plant regeneration, dissect flowers
and anthers with uninucleate microspores (determined by
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 411

Fig. 7 (a) Inflorescence culture and plant development and (b) embryo rescue and fruit development in
ginger

acetocarmine staining, where a distinct nucleus was visible)

could be inoculated in MS medium supplemented with
0.2 mg/l 2,4-D and 10 mg/l BAP [7, 8].

3.6 Hardening 1. Take out healthy and well-rooted in vitro plantlets, and wash
and Planting Out carefully to remove the traces of culture medium.
2. Transfer to polythene bags containing garden soil, sand, and
farmyard manure in equal proportions and keep in humid
chamber.
3. 90–100 % relative humidity should be maintained for
20–30 days for hardening and establishment.

3.7 Embryo Rescue 1. Select aseptic flowers from preculture inflorescences.

and Fruit Development 2. Keep the single flowers along with ovary, stigma, and the
in Ginger (Fig. 7b) [5, 6] anther around the style without damage on MS medium sup-
plemented with BA.
3. Disrupt the anther so that pollen will come out of it and assist
the pollen so that it reaches the stigma.
4. In about 15–30 days the ovary will show the signs of growth
and fruit development.
5. Dissect the seeds from the mature fruit and culture them in the
same medium for plantlet development.
6. This technique can be very useful to assist recombination
breeding in ginger.

3.8 Encapsulation 1. Use in vitro-developed shoots/embryoids 1–3 mm in size

and Synthetic Seed consisting of the apical dome for developing synseeds (Fig. 8).
Production
412 Nirmal Babu K. et al.

Fig. 8 Synthetic seeds (encapsulated micro shoots/somatic embryos) of ginger

2. Suspend in vitro-grown shoots/somatic embryos in MS basal

medium supplemented with 4 % (w/v) Na alginate, 2 M glyc-
erol, and 0.4 M sucrose.
3. Drop the mixture containing micro-shoots, with a sterile
pipette into 0.1 M CaCl2 solution containing 2 M glycerol and
0.4 M sucrose, and leave for 20 min to form beads about 4 mm
in diameter, each bead containing at least one shoot.
4. Store the beads in sterile containers for 6–8 months.
5. Transfer to MS medium with 1 mg/l BAP + 0.5 mg/l NAA for
regrowth [9].

3.9 Conservation 1. Use vegetative bud explants to establish cultures in MS basal

of Genetic Resources medium amended with 0.5 mg/l kinetin.
3.9.1 Medium-Term 2. Multiply shoot cultures on MS medium supplemented with
In Vitro Conservation 0.5 mg/l NAA and 1.0 mg/l BAP with an average of eight
by Slow Growth (Fig. 9) shoots per culture in about 90 days of culture.
3. Maintain in vitro shoots on half-strength MS medium supple-
mented with 15 g/l each of sucrose and mannitol in sealed
culture tubes which induces slow growth and they can be
stored for up to 12 months with 80 % survival.
4. The cultures can thus be maintained on the same medium with
yearly subculture for up to 7 years.
5. The miniaturized in vitro-stored cultures can be recovered to
normal size by transferring to the multiplication medium
(MS + 1 mg/l BAP + 0.5 mg/l NAA), resume growth, and
multiply normally in 3 weeks of culture. Multiple shoots and
roots are produced in the same medium.
6. Transfer rooted plantlets to the nursery cups and maintain at
90–100 % relative humidity for 20–30 days for hardening and
with 80–90 % survival.

3.9.2 Long-Term Storage In vitro-maintained shoot buds (0.5–1.0 mm in length) of ginger

of Encapsulated Shoot Tips consisting of the apical dome with 3–4 leaf primordial are used.
by Cryopreservation
Fig. 9 Different stages of conservation of ginger genetic resources through in vitro and cryoconservation
414 Nirmal Babu K. et al.

Pretreatment 1. Preculture the encapsulated shoots—stepwise—on MS

and Dehydration medium enriched with different concentrations of sucrose,
0.3, 0.5, 0.75, and 1.0 M, for 4 days with 1 day on each.
2. Place the precultured beads on sterile fitter paper in petri dishes
(diameter 90 mm) and dehydrate by air-drying on a flow bench
(at room temperature and humidity) for 0–10 h to determine
the optimal dehydration time.
3. Transfer the dehydrated beads into a 2 ml cryovial (ten beads
per tube) and directly immerse in the liquid nitrogen for 24 h.
4. The beads can be subjected to thawing by rapidly immersing in
a water bath at 40 °C for 1 min.

Cryopreservation Vitrification procedure (Fig. 10).

1. Shoot tips (0.5–1.0 mm) are precultured in 0.3 M sucrose for
72 h and then immersed for 20 min at room temperature in a
series of five cryo-protectant mixtures containing 5 % DMSO;
10 % DMSO; 5 % glycerol; 10 % glycerol; or 5 % DMSO + 5 %
glycerol.
2. Further, treat the shoots with loading solution (2 M glyc-
erol + 0.4 M sucrose) for 20 min at 25 °C.
3. Pretreated and osmoprotected shoots can be dehydrated in
20 ml PVS2 in a 50 ml Erlenmeyer flask on a rotary shaker
(60 rpm) at 25 °C for 0–60 min.
4. After dehydration shoots can be suspended in 1 ml PVS2 in
cryotubes and plunged into LN for 24 h.

Thawing and Regrowth 1. Thawing can be done by rapidly immersing the cryotubes in a
water bath at 40 °C for 1 min for all three treatments.
2. For encapsulation-vitrification- and vitrification-treated sam-
ples, PVS2 solution is drained from the cryotubes and replaced
twice with 1.2 M sucrose solution at 10-min interval.
3. Place thawed propagules directly on MS medium supple-
mented with BA (1 mg/l) and NAA (0.5 mg/l) in petri dishes,
maintain initially for 2 days in the darkness, and transfer to
light with intensity of 33.8 μmol/m2/s2.
4. Around 80 % recovery of cryopreserved shoots can be obtained
[10–13].

3.10 Protoplast Technology for isolation and culture of ginger and turmeric proto-
Culture in Ginger plasts is available [13].

3.10.1 Isolation 1. Mesophyll tissues of in vitro-derived leaves or actively growing

of Protoplasts (Tables 3 callus tissue from 5- to 7-day-old suspension culture can be
and 4) used for protoplast isolation.
2. The lower surface of the leaves is punctured for enzymatic
digestion.
Fig. 10 Different stages in cryopreservation of ginger micro shoots through vitrification
416 Nirmal Babu K. et al.

Table 3
Composition of enzyme solutions (ES) for isolation of protoplastsa

Mannitol Macerozyme Hemi- Onozuka cellulase

Code (%) R-10 (%) cellulase (%) R-10 (%)
ES-1 10 0.5 – 1.0
ES-2 9 0.5 – 1.0
ES-3 8 0.5 – 1.0
ES-4 7 0.5 – 1.0
ES-5 6 0.5 – 1.0
ES-6 5 0.5 – 1.0
ES-7 10 0.5 0.5 2.0
ES-8 9 0.5 0.5 2.0
ES-9 8 0.5 0.5 2.0
ES-10 7 0.5 0.5 2.0
ES-11 6 0.5 0.5 2.0
ES-12 5 0.5 0.5 2.0
ES-13 10 1.0 – 3.0
ES-14 9 1.0 – 3.0
ES-15 8 1.0 – 3.0
ES-16 7 1.0 – 3.0
ES-17 6 1.0 – 3.0
ES-18 5 1.0 – 3.0
a
Enzyme solutions were prepared in CPW medium

3. Suspension cultures are centrifuged and use 1 g pelleted callus

for enzymatic digestion.
4. Mixture of macerozyme, cellulase, and Onozuka 10 at different
combinations is used.
5. Enzyme solution is prepared in CPW medium with osmoticum
(9 % mannitol).
6. Induce pre-plasmolysis by incubating tissues in the above
medium.
7. Immerse 1 g each of mechanically macerated in vitro leaves
and calli in 10 ml each of the enzyme solution and incubate in
the dark.
8. Incubate leaf tissues for 16 h (10 h at 15 °C followed by 6 h at
30 °C) and callus for 18 h (10 h at 15 °C followed by 8 h
at 30 °C) with gentle shaking at 53 rpm.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 417

Table 4
Composition of media used for protoplast isolation and culture in ginger

Protoplast culture media

(mg/l)
Cell protoplast washing Floating media
Components (CPW) medium (mg/l) (mg/l) I II
NH4NO3 – – 1650 1650
KNO3 101.0 101.0 1900 1900
CaCl2·2H2O 1480.0 1480.0 440 440
MgSO4·7H2O 246.0 246.0 370 370
KH2PO4 27.2 27.2 170 170
KI 0.16 0.16 0.83 0.83
H3BO3 – – 6.2 6.2
MnSO4·4H2O – – 22.3 22.3
ZnSO4·7H2O – – 8.7 8.7
Na2MoO4·2H2O – – 0.25 0.25
CuSO4·5H2O 0.025 0.025 0.025 0.025
CoCl2·6H2O – – 0.025 0.025
FeSO4·7H2O – – 27.8 27.8
Na2EDTA·2H2O – – 37.3 37.3
Myoinositol – – 100.0 100.0
Nicotinic acid – – 0.5 0.5
Thiamine HCl – – 0.5 0.5
Pyridoxine HCl – – 0.5 0.5
Glycine – – 2.0 2.0
Sucrose – 21 % 2% 3%
Mannitol 7–10 % – 7% 4%
Gibberellic acid – – 0.5 0.5
BA – – 0.5 1.0
NAA – – 0.5 1.0
2,4-D – – 0.5 –
418 Nirmal Babu K. et al.

9. Purification is done with a combination of filtration, centrifu-

gation, washing, and floating centrifugation.
10. Undigested tissues and cell clumps should be filtered and
cleaned.
11. Separate the released protoplasts by centrifugation at 700 rpm
for 10 min and remove supernatant carefully without disturb-
ing the pelleted protoplasts.
12. Pellet can be suspended in CPW medium and repeat the cen-
trifugation three times to remove the traces of enzyme
solution.
13. After washing, suspend protoplasts in 1 ml CPW medium and
layer it on 9 ml floating medium (Table 4) and centrifuge at
700 rpm for 10 min. The protoplasts will form a layer at the
interphase.

3.10.2 Protoplast Culture 1. Isolated protoplasts can be cultured in the liquid medium in
(Fig. 11) petri dishes.
2. Five drops of the culture medium containing protoplast can be
incubated in the dark at 25 °C in well-sealed petri plates.
3. Fresh culture medium can be poured periodically to avoid
nutrient depletion and observe for cell wall regeneration and
cell division, under Leica inverted microscope.
4. 40–60-day-old culture can be plated on 0.25 % agarose
medium for further development and micro callus formation.

3.11 Molecular CTAB method was used [14]. The protocol is used for DNA
Profiling extraction from leaf tissues (see Tables 5 and 6).
3.11.1 Isolation of DNA 1. Grind 5 g young leaves in liquid nitrogen with a mortar and
pestle and add 25 ml preheated (65 °C) CTAB buffer. Add
0.2 % β-mercaptoethanol prior to use.
2. Incubate at 60 °C for 30 min.
3. Extract with equal volume of chloroform:isoamyl alcohol
(24:1) at 26,832 × g for 10 min at room temperature.
4. Take the aqueous phase and add 2/3rd volume of ice-cold
isopropanol.
5. Incubate at −20 °C for 2 h and centrifuge at 26,832 × g for
15 min at 4 °C.
6. Discard the supernatant and invert the tube on paper towel
for few minutes.
7. Dissolve the pellet and add 1.5 ml of TE buffer. Store at room
temperature.
8. Add 10 μg/ml of RNase A and incubate at 37 °C for 30 min.
9. Equal volume of Tris-saturated phenol is added, mix well, and
centrifuge at 26,832 × g for 10 min.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 419

Fig. 11 Protoplasts in ginger (a) and micro calli (b) derived from the protoplasts

Table 5
Composition of various stock solutions for DNA isolation [16]

Solutions Method of preparation

1 M Tris (pH 8.0) 500 ml Dissolve 60.55 g Tris base (Sigma) in 300 ml distilled water. Adjust
pH to 8 by adding concentrated HCl. Adjust volume to 500 ml.
Dispense to reagent bottles and sterilize by autoclaving
0.5 M EDTA pH 8.0 Dissolve 93.05 g of EDTA-disodium salt (sigma) in 300 ml of water.
Adjust pH to 8 by adding NaOH pellets. Adjust volume to 500 ml.
Dispense into reagent bottles and autoclave
5 M NaCl 500 ml Weigh 146.1 g NaCl (Merck), add 200 ml of water, and mix well.
When the salts get completely dissolved, adjust the final volume to
500 ml. Dispense into reagent bottles and autoclave
3 M Sodium acetate Dissolve 61.523 g of anhydrous sodium acetate (Qualigens) in 200 ml
(pH 5.2) 250 ml of water and mix well. When dissolved completely adjust the pH of
the solution to 5.2 with glacial acetic acid (99–100 %). Autoclave
Ethidium bromide 10 mg/ Add 1 g. ethidium bromide to 100 ml of distilled water. Keep on
ml, 100 ml magnetic stirrer to ensure that the dye has dissolved completely.
Dispense to amber-colored reagent bottle and store at 4 °C
70 % ethanol, 500 ml Take 360 ml of ethanol; mix with 140 ml of distilled water. Dispense
to reagent bottle and store at 4 °C
Chloroform:isoamyl alcohol Measure 450 ml of chloroform and 20 ml of isoamyl alcohol. Mixed
(24:1), 500 ml and stored in room temperature
1 M MgCl2, 100 ml Weigh 20.33 g of MgCl2, dissolve in double-distilled water, make up
to 100 ml, autoclave
RNase A (10 mg/ml) Make up 10 mg/ml RNase in distilled water. Boil for 10 min to
destroy DNase. Divide into 1 ml aliquots and store at −20 °C

10. To the aqueous phase add equal volume of

phenol:chloroform:isoamyl alcohol (25:24:1), shake, and
centrifuge at 26,832 × g for 10 min.
11. Take the aqueous phase and add equal volume of
chloroform:isoamyl alcohol (24:1), shake, and centrifuge at
26,832 × g for 10 min.
420 Nirmal Babu K. et al.

Table 6
Composition of various buffers used for DNA isolation [16]

Buffer Method of preparation

1 CTAB extraction buffer: for 1 l Measure 100 ml Tris (1 M), 280 ml of NaCl,
100 mM Tris–HCl (pH 8.0) 40 ml of EDTA (0.5 M). Mix with about
20 mM EDTA (pH 8.0) 400 ml of hot distilled water, add 20 g of
1.4 M NaCl CTAB to this. Adjust final volume to 1 l.
2% CTAB (w/v) Merck Dispense to reagent bottles and autoclave. Just
0.2% B-mercapto ethanol before use, add 0.2 % β-mercaptoethanol
(v/v)-Merck
2 TE (0.1 mM) buffer: for 100 ml Take 1 ml of Tris–HCl (1 M), 20 ml of EDTA
100 mM Tris–HCl (pH 8.0) (0.5 M). Mix with 99 ml of sterile distilled
0.1 mM EDTA (pH 8.0) water taken in a reagent bottle, mix thoroughly,
autoclave
3 TAE buffer 10×: for 1 l Weigh 48.4 g of Tris base; add 20 ml of EDTA
(0.5 M); 11.42 ml of glacial acetic acid and
around 150 ml [Link]. Dissolve the salt and
adjust volume to 1 l. Autoclave
4 10× DNA loading dye Ficoll (Type 400) 25 % (w/v), bromophenol blue
0.4 % (w/v), and xylene cyanol FF 0.4 % (w/v).
Dissolve 0.25 g of BPB in 99 ml of 30 %
glycerol. Keep on magnetic stirrer for several
hours to get the dye completely dissolved.
Dispense to reagent bottles and keep at 4 °C

12. To the aqueous phase add one-tenth volume of 3 M sodium

acetate (pH 5.2) and 2.5 volumes of ethanol and incubate at
−20 °C for 1 h or at −70 °C for 30 min.
13. Centrifuge at 26,832 × g for 10 min and wash the pellet in 70 %
ethanol (26,832 × g for 5 min).
14. Air-dry the pellet and dissolve in 1.5 ml TE and estimate the
yield.
15. Estimate DNA amount using Scanning Shimadzu
Spectrophotometer. DNA shows a clear absorbance peak at
260 nm and value of 1.0 OD260 is calculated equivalent to
50 μg/ml. DNA is considered to be pure if the value of
OD260:OD280 is 1.8. DNA is visualized on (0.8 %) agarose gel
for its quality and stored at −20 °C.

3.11.2 Molecular 1. Amplification is carried out in a total volume of 25 μl including

Profiling Using ISSR 2.5 μl × Taq DNA polymerase buffer, 50 ng DNA, 0.15 mM
and SSR Primers dNTP, 1.5 mM MgCl2, 0.4 μM primers, and 1 U Taq DNA
polymerase primers. Amplification employs a programmable
thermal cycler (with cycling regimes of an initial denaturation
temperature of 94 °C for 5 min, followed by 33 repeats of a PCR
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 421

core cycle of 94 °C for 1 min, 50 °C for 1 min, and 72 °C for

1 min, followed by a final extension cycle of 72 °C for 10 min).
2. Use the ISSR primers listed in Table 7.
3. Resolve amplicons electrophoretically alongside a 1 kb ladder,
on a 1.5–2 % agarose gel stained with 0.5 mg/ml 1× ethidium
bromide in a 1× TAE buffer(pH 8.0), and run at 90 V for 3 h
in an electrophoresis (Fig. 12).

Table 7
ISSR and SSR primers for DNA profiling of ginger varieties

Sl no Primer name Sequence

ISSR
1 UBC 807 5′-AGAGAGAGAGAGAGAGT-3′
2 UBC 808 5′-AGAGAGAGAGAGAGAGC-3′
3 UBC 810 5′-GAG AGA GAG AGA GAG AT-3′
4 UBC 811 5′-GAG AGA GAG AGA GAG AC-3′
5 UBC 815 5′-CTC TCT CTC TCT CTC TG-3′
6 C1 5′-AGCACACACACACACAC
7 C 10 5′-ACCTCCTGCAGATTCGTGTC-3′
8 UBC 840a 5′-GAGAGAGAGAGAGAGACT-3′
9 UBC 841 a 5′-GAGAGAGAGAGAGAGACC-3′
10 UBC 844b 5′-CTCTCTCTCTCTCTCTGC-3′
SSR
11 GB-ZOM-040 F 5′-AGGGGGCAGTGGAGAG-3′
R 5′-ACGTTCCTGCACTTGACG-3′
12 GB-ZOM-103 F 5′-GCTGCGGACTAAATGCTG-3′
R 5′-ACGCTAGGGAACAGGGAG-3′

Fig. 12 ISSR profiling of high-yielding varieties of ginger using primer UBC 810 and UBC 811. Lane 1 repre-
sents ginger varieties Varada, lane 2: Rejatha, lane 3: Mahima, lane 4: Suprabha, lane 5: Suruchi, lane 6: Athira,
lane 7: Karthika, and lane 8: OCP 1222
422 Nirmal Babu K. et al.

4. Carry out duplicate amplification to confirm reliability of the

bands. Amplified products are listed as discrete character states
in a present (1) or absent (0) matrix.
5. Relationships among genotypes are evaluated with a phonetic
cluster analysis using the unweighted pair grouping mathemat-
ical average (UPGMA) analysis and plotted in a phenogram
using many available software based on suitability.

3.12 Genetic A simple approach [2, 11] for transient expression of β-glucuronidase
Transformation (GUS) gene in ginger embryogenic callus with “BioRad” helium-
in Ginger (Fig. 13) driven PDS-1000/He system is presented here.
3.12.1 Transient Gene
Expression Studies Using
Helium-Driven PDS-1000/
He Biolistic System

3.12.2 Preparation 1. Transfer freshly growing embryogenic calli to petri dishes, as

of Embryogenic Calli thin layers, with MS medium containing 0.25–0.75 % mannitol,
Culture 0.25 % phytagel, or 0.9 % agarose and devoid of plant growth
regulators.
2. Incubate cultures in the darkness for 12 h before subjecting to
particle bombardment.

3.12.3 Preparation 1. Use plasmid vector pHAC 25(25) containing ubiquitin-β-

of Plasmid DNA glucuronidase (Ubi-GUS).
2. Isolate ubiquitin-phosphinothricin-acetyl transferase (Ubi-BAR)
from E. coli XL1-Blue using alkaline lysis method ( 22 )
followed by ethanol precipitation.
3. The GUS gene in this construct is expressed from the maize
ubiquitin promoter.
4. The concentration of DNA is quantified by Hitachi U 2000
Spectrophotometer.

Fig. 13 Transient expression of GUS in embryogenic callus of ginger

 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 423

3.12.4 Microcarrier For 120 bombardments use 500 μg gold particles per bombardment.
(Gold/Tungsten Particles)
1. In a 1.5 ml microfuge tube, weigh out 60 mg microparticles.
Preparation
2. Add 1 ml 70 % ethanol, freshly prepared.
3. Vortex on a platform vortexer for 3–5 min.
4. Incubate for 15 min.
5. Pellet the micro-particles by spinning for 5 s in a microfuge.
6. Remove the liquid and discard.
7. Add 1 ml sterile water. Vortex for 1 min.
8. Allow the particles to settle for 1 min. Pellet the micro-particles
by spinning for 2 s in a microfuge. Remove the liquid and
discard (repeat it three times).
9. Add sterile 50 % glycerol to bring the micro-particle concen-
tration to 60 mg/ml (assume no loss during preparation).
10. Store the micro-particles at room temperature for up to 2
weeks.

3.12.5 Coating DNA The following procedure can be adopted for six bombardments, if
onto Microcarriers fewer bombardments are needed; prepare enough microcarriers by
reducing all volumes as required. When removing aliquots of micro-
carriers, it is important to vortex the tube containing the microcar-
riers continuously in order to maximize uniform sampling.
1. Vortex the microcarriers prepared in 50 % glycerol (60 mg/ml)
for 5 min on a platform vortexer to resuspend and disrupt
agglomerated particles.
2. Remove 50 μl (3 mg) microcarriers to a 1.5 ml microfuge
tube.
3. While vortexing vigorously, add in order:
5 μl DNA (1 μg/μl).
50 μl CaCl2 (2.5 M).
20 μl spermidine (0.1 M).
4. Continue vortexing for 2–3 min.
5. Allow the microcarriers to settle for 1 min.
6. Pellet the microcarriers by spinning for 2 s in a microfuge.
7. Remove the liquid and discard.
8. Add 140 μl of 70 % ethanol without disturbing the pellet.
9. Remove the liquid and discard.
10. Add 140 μl 100 % ethanol without disturbing the pellet.
11. Remove the liquid and discard.
12. Add 48 μl 100 % ethanol.
424 Nirmal Babu K. et al.

13. Gently resuspend the pellet by tapping the side of the tube
several times, and then by vortexing at low speed for 2–3 s.
14. Remove 6 μl aliquots of microcarriers and transfer them to the
center of the macrocarrier. An effort is made to remove equal
amounts (500 μg) of microcarriers each time and to spread
them evenly over the central 1 cm of the microcarrier using the
pipette tip. Desiccate immediately.

3.12.6 Sterilization 1. Sterilize macrocarriers, rupture discs, and stopping screens in

of Macrocarriers 70 % alcohol.
2. Sterilize macrocarriers and dry in the laminar airflow hood
before spreading the microcarriers over them.

3.12.7 Biolistic 1. Bombard the embryogenic callus cultures with DNA coated
Transformation with 1 μm gold particles.
2. Use 900–1100 psi rupture disc to regulate the helium pres-
sure, at the target distance of 6–9 cm.
3. The following parameters may be kept constant:

Chamber vacuum 28″ Hg (0.06 atm)

Gap distance ¼″
Macrocarrier travel distance 8 mm (stopping screen at middle level)
Microcarriers/ 500 μg
bombardment
DNA/bombardment 833 ng

4. Seal the petri plates containing bombarded calli with parafilm

and heal by incubating them at 30 °C in the dark for 24 h.
5. Test a portion of the bombarded calli for GUS expression assay.
6. For plant regeneration, subculture the remaining calli into
fresh MS medium supplemented with 1.0 mg/l BAP, and
0.5 mg/l NAA, at 22 ± 2 °C, 12-h photoperiod of
33.8 μmol/m2/s2 [15].

3.12.8 GUS 1. The location of GUS expression is visualized using a histo-

Expression Assay chemical reaction [16].
2. The cells are analyzed for GUS expression, 24–48 h after
bombardment.
3. For GUS analysis, the bombarded calli are transferred to plates
containing 2 ml GUS assay buffer (0.5 mg/ml 5-bromo-4-
chloro-3-indoyl-β-D-glucuronic acid, 0.1 M sodium phos-
phate buffer, pH 7.0, 0.5 mM potassium ferrocyanide and
0.5 mM potassium ferricyanide, 0.1 % Triton X 100).
4. Incubate at 37 °C for 24 h and wash in 70 % alcohol.
 In Vitro Technology for Multiplication, Conservation and Crop Improvement of Ginger 425

5. Blue color sectors are observed under the stereomicroscope

after 24 h and evaluate GUS expression.
6. Count the number of spots per cm2 for estimating the transfor-
mation efficiency.

4 Notes

1. Explant source and stage is the most important step for estab-
lishing contamination-free cultures with good in vitro responses.
2. The explants are to be collected from disease- and virus-free
plantations and the individual plants are also checked to be free
from symptoms.
3. Plant the rhizome bits in the greenhouse under protected con-
ditions with 4–5 in. of sand on top and periodically (once in 20
days) spray/drench copper oxychloride/bavistin/dithane
M-45 at 0.3 % to minimize the contamination.
4. Select the newly sprouting buds and use as a source of explant
for the culture. Collect the explants from field directly into
0.3 % copper oxy chloride/bavistin solution and keep for
10–15 min before surface sterilization.
5. Since explants from underground are used, still chances of
contamination remain high. Use 5 ml half-strength MS
medium supplemented with 3 % sucrose and 0.5 mg/l kinetin
and gelled with 0.67 % bacteriological grade agar.
6. Fungal and bacterial contamination appears within 5–10 days
and the contaminated cultures are discarded.

References
1. Purseglove JW (1972) Tropical Crops. officinale Rosc.) by tissue culture. J. Spices and
Monocotyledons Wiley p 533–554 Aromatic Crops 1:43–48
2. Nirmal Babu K, Sabu M, Shiva KN et al (2011) 6. Nirmal Babu K, Samsudeen K, Ratnambal M,
Ginger. In: Singh RJ (ed) Genetic resources, Ravindran PN (1996) Embryogenesis and
chromosome engineering and crop improve- plant regeneration from ovary derived callus
ment, medicinal plants, vol 6. CRC Press, cultures of ginger (Zingiber officinale Rosc.).
Boca Raton USA, pp 393–450 J Spices Aromatic Crops 5(2):134–138
3. Murashige T, Skoog F (1962) A revised 7. Samsudeen K, Nirmal Babu K et al (2000)
medium for rapid growth and bioassays with Plant regeneration from anther derived callus
tobacco tissue culture. Physiol Plant cultures of ginger (Zingiber officinale Rosc.).
15:473–497 J Hort Sci Biotechnol 75(4):447–450
4. Nirmal Babu K, Samsudeen K, Ratnambal MJ 8. Nirmal Babu K, Samsudeen K, Minoo D et al
(1992) In vitro plant regeneration from leaf (2005) Tissue culture and Biotechnology of
derived callus in ginger. Zingiber officinale Ginger. In: Ravindran PN, Nirmal Babu K
Rosc Plant Cell Tiss Org Cul 29:71–74 (eds) Ginger – The genus Zingiber. CRC
5. Nirmal Babu K, Samsudeen K, Ravindran PN Press, Boca Raton, USA, pp 181–210
(1992) Direct regeneration of plantlets from 9. Nirmal Babu K, Geetha SP, Minoo D et al
immature inflorescence of ginger (Zingiber (1999) In vitro conservation of germplasm.
426 Nirmal Babu K. et al.

In: Ghosh SP (ed) Biotechnology and its appli- cryobiology. InTech-Open Access Publisher,
cation in Horticulture. Narosa Publishing Croatia, pp 457–484. ISBN 978-953-51-0191-8
House, New Delhi, pp 106–129 13. Geetha SP, Nirmal Babu K, Rema J et al
10. Yamuna G, Sumathi V, Geetha SP et al (2007) (2000) Isolation of protoplasts from carda-
Cryopreservation of in vitro grown shoots of mom (Elettaria cardamomum Maton.) and
ginger (Zingiber officinale Rosc.). Cryo Letters ginger (Zingiber officinale Rosc.). J Spices and
28(4):241–252 Aromatic Crops 9(1):23–30
11. Nirmal Babu K, Minoo D, Parthasarathy VA 14. Ausubel FM, Brent R, Kingston RE et al
(2011) Ginger. In: Singh HP, Parthasarathy VA, (1995) Current protocols in molecular biol-
Nirmal Babu K (eds) Regeneration systems – fruit ogy, vol 1. Wiley, New York, pp 2.3.1–2.3.7
crops, plantation crops and spices, vol 1, Advances 15. Nirmal Babu K, Suraby EJ, Cissin J et al
in horticulture biotechnology. Westville (2013) Status of Transgenics in Indian Spices.
Publishing House, New Delhi, pp 421–442 J Tropical Agriculture 51:135–151
12. Nirmal Babu K, Yamuna G, Praveen K et al 16. Jefferson RA (1987) Assaying chimeric plant
(2012) Cryopreservation of spices genetic genes: The GUS fusion system. Plant Mol Biol
resources. In: Katkov II (ed) Current frontiers in Rep 5:387–405
 Chapter 29

Hairy Root Cultures of Gymnema sylvestre

R. Br. to Produce Gymnemic Acid
J. Rajashekar, Vadlapudi Kumar, V. Veerashree, D.V. Poornima,
Torankumar Sannabommaji, Hari Gajula, and B. Giridhara

Abstract
Gymnema sylvestre R. Br. (Asclepiadaceae) is an endangered species extensively used in the management of
diabetes, obesity, and treatment of various diseases. Uncontrolled exploitation to meet the increasing
demand and low seed viability hastens the disappearance of the plant from its natural habitat. Hairy root
culture provides a suitable alternative for the enhanced production of active principles. The current proto-
col provides the optimized culture conditions for the establishment of hairy root cultures and elicitation
studies and also confirmation of stable integration of A. rhizogenes plasmid T-DNA into host genetic mate-
rial by PCR and RT-PCR. Furthermore, it also discusses the suitable methods for the extraction proce-
dures, and qualitative and quantitative analysis of gymnemic acid by HPTLC and HPLC.

Key words Gymnema sylvestre, Gymnemic acid, Agrobacterium rhizogenes, Hairy root cultures,
Elicitors, HPLC

1 Introduction

Gymnema sylvestre [Link]. (Asclepiadaceae) is a valuable and multi-

purpose medicinal plant. It is a slow-growing, perennial woody
climber of tropical and subtropical region. The plant is popularly
known as “gur-mur” or “madhunashini” for its distinctive prop-
erty of temporarily destroying the taste of sweetness. G. sylvestre is
used in the treatment of asthma, eye complaints, inflammations,
and snake bites and also acts as feeding deterrent. In the manage-
ment of diabetes mellitus G. sylvestre brings about glucose homeo-
stasis through repair and regeneration of pancreatic β-cells or repair
and stimulation of enzymes responsible for uptake of glucose and
utilization [1, 2], stimulation of insulin release [3, 4], and finally
increased glucose tolerance [5]. The medicinal property of G. syl-
vestre is due to the presence of a group of triterpenoid saponins
known as “gymnemic acid” and gymnemosides, which fall under

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_29, © Springer Science+Business Media New York 2016

427
428 J. Rajashekar et al.

oleanane and dammarene type of saponins, respectively [6, 7], that

have been investigated by various groups [8–10].
G. sylvestre is fast disappearing from the wild habitat, and had
become endangered not only because of its overexploitation to
meet the requirements of demand, but also owing to low seed
viability, slow rate of germination, and poor rooting ability which
hamper the conventional propagation. Plant tissue cultures pro-
vide promising alternatives for the enhanced production of sec-
ondary metabolites. There have been many strategies in the
published literature for the product enhancement in plant cell and
tissue cultures. Establishment of hairy root cultures has been one
of the strategies for the secondary metabolite production and for
their overproduction hairy roots are elicited with various elicitors.
Hairy root culture is produced by infecting the explants with
A. rhizogenes and nurturing on growth regulator-free medium,
exploiting the advantage of naturally occurring hair root disease in
dicotyledons for the production of metabolites. Their ease of
maintenance, short doubling time, higher genetic stability, and
autotrophicity to plant growth regulators make them advanta-
geous over cell suspension cultures. This chapter focuses on recent
advances in the optimization of culture conditions for successful
establishment of callus, regeneration cultures, and hairy root cul-
tures and their elicitation for the production of “gymnemic acid”
and also describes the validated methods for the qualitative and
quantitative analysis of gymnemic acid.

2 Materials

2.1 Explants The meristematic tissue like apical buds, hypocotyls, meristematic
for In Vitro Culture leaf tissue, and cotyledonary leaf segments of 3.0–4.0 cm is used
Establishment for the callus induction. Cotyledons and leaves (5 × 5 mm explants)
are used for the establishment of hairy root cultures.

2.2 Reagents 1. 2 % Tween-20 (v/v) or 1 % laboline (v/v) and 0.06–0.08 %

for Surface cetrimide.
Sterilization 2. 0.05 % H2O2 (v/v) or 0.1 % HgCl2 (w/v).
3. 0.01 % (w/v) citric acid or 0.01 % ascorbic acid (w/v) and
0.01 % PVP (w/v).
4. Double-distilled water.

2.3 Culture Medium 1. Murashige and Skoog (MS) medium: Macronutrients, micro-
nutrients, iron source, and vitamins are prepared as respective
stock solutions [11] and stored at 4 °C (Table 1).
2. Prepare (1 mg/ml) stock solutions of NAA, IAA, IBA, piclo-
ram, and 2,4--D as auxins, and BAP and kinetin as cytokinins,
and store at 4 °C.
 Strategies for the Enhanced Production of Gymnemic Acid… 429

Table 1
Composition of MS (Murashige and Skoog, 1962) medium

Concentration (mg/l)

Constituents Actually required Concentrated (×)

Stock solution—I (macronutrients) (10×)
MgSO4·7H2O 370 3700
KH2PO4 170 1700
KNO3 1900 19,000
NH4NO3 1650 16,500
CaCl2·2H2O 440 4400
Stock solution—II (micronutrients) (100×)
H3BO3 6.2 620
MnSO4·4H2O 22.3 2230
ZnSO4·7H2O 8.6 860
Na2MoO4·2H2O 0.25 25
CuSO4·5H2O 0.025 2.5
CoCl2·6H2O 0.025 2.5
KI 0.83 83
Stock solution—III (iron source) (10×)
FeSO4·7H2O 27.8 278
Na2EDTA·2H2O 37.3 373
Stock solution—IV (vitamins and organic supplements (100×)
Thiamine HCl 0.5 50
Pyridoxine HCl 0.5 50
Nicotinic acid 0.5 50
Myoinositol 100 10,000
Glycine 2.0 200

3. Overnight-grown culture of Agrobacterium rhizogenes strain

KCTC 2703.
4. 100 mg/l Kanamycin sulfate and 400 mg/l cefotaxime in ster-
ile distilled water (kanamycin sulfate and cefotaxime exclusively
insoluble in organic solvents).

2.4 PCR 1. DNA isolation kit (Fermentas, GlenBurnie, MD, USA) and
RNA isolation kit (Fermentas, Glen Burnie, MD, USA).
2. GeneAmp PCR System DNA thermal cycler.
3. Primers.
4. PCR master mix.
5. Distilled water.
6. 1.0 % Agarose.
7. Gel electrophoresis unit.
430 J. Rajashekar et al.

8. Hind III-digested λDNA.

9. 0.5 μg/ml of ethidium bromide (see Note 1).
10. Gel documentation system.

2.5 Elicitation 1. Hairy root cultures.

Studies 2. Oleic acid and linolenic acid at respective concentrations.
3. 250 ml Conical flasks.
4. MS nutrient broth.

2.6 Extraction 1. Homogenized tissue.

Procedures 2. Reflux condenser.
2.6.1 Conventional 3. Heating mantle.
Method 4. 50 ml of 50 % ethanol (v/v).
5. 10 ml of 11 % KOH (w/v) in water and 9 ml of concentrated
HCl.
6. 0.45 and 0.22 μm PVDF syringe-driven filters.

2.7 Phytochemical 1. Silica gel G60 F254 is coated onto the carrier glass plates with
Screening dimension of 20 × 10 cm.
2.7.1 Thin-Layer 2. Chloroform:methanol:acetic acid (5:1:1) as mobile phase.
Chromatography 3. Vanillin-sulfuric acid reagent, 1 % vanillin in ethanol contain-
ing 5 ml of acetic anhydride and sulfuric acid.

2.7.2 HPTLC 1. The pre-coated Silica gel 60 F254 layered (10 × 10 cm) on alu-
minum support sheets.
2. Toluene:ethyl acetate:methanol (2:7:1) as mobile phase.
3. Camag Linomat V (Switzerland) sample applicator.

2.7.3 HPLC 1. 0.45 and 0.22 μm PVDF syringe-driven filters.

2. HPLC-grade acetonitrile and Milli Q water.
3. 0.1 % Trifluoroacetic acid (v/v) HPLC grade.
4. Gymnemagenin standard.

3 Methods

3.1 Explant Surface 1. Pre-soak the explants in distilled water for 2–3 h, and wash
Sterilization under running tap water for 10 min.
2. Wash with detergent 2 % Tween-20 (v/v), 0.06–0.08 % cet-
rimide (w/v), and fungicide (0.12 % w/v bavistin) for 3–4 min.
Rinse explants with sterile distilled water 4–5 times with fre-
quent shaking to remove the traces of detergent.
 Strategies for the Enhanced Production of Gymnemic Acid… 431

3. Treat the explants with 75 % ethanol for 30 s and rinse 3–4

times with sterile distilled water. Surface-sterilize the explants
with 0.05 % H2O2 (v/v) and wash 3–4 times with sterile dis-
tilled water in a laminar airflow cabinet to remove traces of
H2O2.
4. Finally wash the explants in filter-sterilized antioxidant solu-
tion containing ascorbic acid (0.01 % w/v), citric acid (0.01 %),
and PVP (0.01 %) for about 3 min.
5. Surface-sterilized explants are used directly for inoculating
onto basal growth medium.

3.2 Establishment 1. Add the required proportions of MS medium stock solutions,

of Callus Culture 3 % sucrose, 0.8 % agar, and plant growth regulators like BAP
(2 mg/l), NAA (2 mg/l), picloram (0.2 mg/l), and/or 2,4-D
(0.5 mg/l) in sequence into glass beaker, and adjust pH to
5.6–5.8 with 0.1 N NaOH/0.1 N HCl before autoclaving
(see Note 2).
2. Suspend agar (0.8 %) into the medium, subject for melting by
heating, distribute into culture vessels, and autoclave at
121 °C/15 lbs pressure. Cool the vessels and transfer to lami-
nar airflow cabinet.
3. By trimming the edges of surface-sterilized explants aseptically,
directly inoculate onto culture medium supplemented with
2,4-D/picloram at required concentration (Fig. 1).
4. Observe after 15–20 days for the callus induction.

3.3 Establishment 1. For regeneration inoculate the surface-sterilized explants by

of Regeneration cutting at edges, onto MS medium enriched with 2 mg/l BAP,
Culture 0.5 mg/l kinetin, and 0.05 mg/l NAA (see Note 3).
2. After 15 days of incubation observe for the shoot induction
(Fig. 2b).
3. Excise the individual shoot and transfer to rooting medium,
i.e., MS half-strength medium fortified with 3 mg/l IBA and
0.05 % activated charcoal.
4. After 10–15 days observe for the root induction (Fig. 2c).

3.4 Establishment 1. Use overnight-grown cultures of A. rhizogenes strain KCTC

of Hairy Root Cultures 2703 (at OD600 = 1) for infecting the explants (cotyledons/
leaves/stem segments) for an incubation period of 30 min [12].
2. Blot the explants between sterile tissue paper layers, dry on
Whatman No. 1 filter paper, and place on MS semisolid
medium (0.8 % agar) without any growth regulators in petri
dishes (see Note 4).
432 J. Rajashekar et al.

Fig. 1 Callus induction MS + 0.5 mg/l BP and 2 mg/l NAA (a), callus induction MS + 0.5 mg/l 2,4-D (b), callus
induction MS + 0.2 mg/l picloram (c), callus induction MS + 0.5 mg/l BP (d), callus induction MS + 2mg/l NAA
(e), callus induction MS + 0.5 mg/l 6-AP + 0.5 mg/l 2,4-D/0.2 mg/l picloram +2 mg/l NAA (f)

3. Maintain control set of explants inoculated in a similar way, but

devoid of bacterial infection.
4. After 3 days of incubation, transfer the explants onto MS semi-
solid medium (0.8 % agar) containing bacteriostatic antibiotics
cefotaxime (400 mg/l) and kanamycin sulfate (100 mg/l) in a
petri dish (see Note 5).
5. Subculture the explants for every 2 weeks onto fresh medium
in petri dish with similar composition. Observe for the root
protuberances developed in the explants after two subcultures
(4 weeks) (Fig. 3).
 Strategies for the Enhanced Production of Gymnemic Acid… 433

Fig. 2 Regeneration in nodal explants (a), multiple shoot induction in nodal explants (b), elongation of regener-
ated shoot (c), rooting and hardening (d)

6. Transfer 500 mg of developed roots into Erlenmeyer’s flask

containing 50 ml of MS liquid medium (with antibiotics) and
maintain in orbital shaker (100 rpm) with successive subcultur-
ing for every 28 days of incubation period.
7. Gradually decrease the cefotaxime and kanamycin sulfate for
each subculture and finally completely omit the cefotaxime
after 8 weeks, but still maintain kanamycin sulfate [13].
8. Maintain the growth conditions of 16-h photoperiod and tem-
perature 25 ± 2 °C throughout the culture period.

3.5 Characterization 1. PCR and RT-PCR analysis of transformant DNA confirms the
of Hairy Roots by PCR stable integration of the T-DNA into the host genetic
and RT-PCR material.
2. The conventional PCR is carried out in order to detect the
presence of T-DNA in the genomic DNA of host cell, while
RT-PCR (reverse transcriptase) is carried out to confirm the
size of target DNA-amplified product.
434 J. Rajashekar et al.

Fig. 3 Induction of hairy roots following inoculation of leaf explants of G. sylvestre with A. rhizogenes strain
KCTC 2703 (a), Agrobacterium-induced hairy roots of G. sylvestre in MS-based liquid medium lacking growth
regulators after 25 days of culture (b), PCR analysis of the rolC gene in the hairy root lines of G. sylvestre. Lane
M marker, lane 1 roots from a non-transformed plant (negative control), lane 2 plasmid DNA (positive control),
lanes 3–8 root clones induced by A. rhizogenes (c), RT-PCR analysis of the rolC gene in the hairy root lines of
G. sylvestre. Lane M marker, lane 1 roots from a non-transformed plant (negative control), lane 2 plasmid DNA
(positive control), lanes 3–8 root clones induced (d). Primers for amplification of rolC gene by PCR 5′-ATG-GCT-
GAA-GAC-GAC-CTG-TGT-T-3′ and 5′-TTA-GCC-GAT-TGC-AAA-CTT-GCA-C-3′. Primers for rolC gene for RT-PCR
5′-ATGGCT-GAA-GAC-GAC-CTG-TGT-T-3′ and 5′-TTA-GCCGAT-TGC-AAA-CTT-GCA-C-3′

3. For the PCR reaction, isolate the genomic DNA by using plant
genomic DNA isolation kit (Fermentas, GlenBurnie, MD,
USA) following the manufacturer’s instructions (see Note 6).
4. Polymerase chain reaction: Prepare the master mix by add-
ing l μl of 1 Unit Taq polymerase, 2.5 μl of 100 nM dNTP,
1 μl of 20 pM primer, 1 μl of 20 ng/μl template DNA, and
2.5 μl of 10× reaction buffer; it was made up to 25 μl by
sterile distilled H2O.
 Strategies for the Enhanced Production of Gymnemic Acid… 435

5. Spin the reaction mixture for few seconds (30 s).

6. Set the following program for the amplification in the thermal
cycler:
(a) Denature for 4 min at 94 °C.
(b) Annealing of primer for 1 min at 60 °C.
(c) Amplification for 2 min at 72 °C.
Final extension of the amplified DNA for 5 min at 72 °C.
7. Separate the DNA amplicon by agarose gel electrophoresis
along with λDNA Hind III-digest marker, stain with ethidium
bromide, and document in a gel documentation system.
8. Similarly, confirm the expression of gene insert in the host
chromosomal DNA by RT-PCR analysis using a kit and fol-
lowing the manufacturer’s instructions provided.
9. Isolate total RNA from selected fast-growing root clones of G.
sylvestre using RNA isolation kit (Fermentas, Glen Burnie,
MD, USA) (see Note 6).
10. Initially synthesize template strand from RNA isolate and
amplify by using Fermentas Revert First Strand Complementary
DNA (cDNA) Synthesis Kit (Fermentas, USA) following the
manufacturer’s instructions.
11. Separate the obtained DNA (cDNA) by agarose gel electro-
phoresis along with λDNA Hind III-digest marker, stain with
ethidium bromide, determine the cDNA size, and document
in a gel documentation system.

3.6 Elicitation 1. Inoculate 500 mg of established hairy root cultures into

of Hairy Root Cultures 250 ml conical flask containing 50 ml of liquid MS medium
for Product without any growth regulators.
Enhancement 2. Add the elicitors like oleic acid and linolenic acid to the culture
flasks at the respective concentrations on day 15 [14].
3. Observe the influence of different elicitors on growth rate and
gymnemic acid production from day 20 onwards (see Note 7).
4. Maintain the culture conditions under continuous agitation at
100 rpm in an orbital shaker and at 25 ± 2 °C, with a 16-h
photoperiod (40 μmol/m2/s) as the root cultures grow and
multiply at faster rate.
5. After 8 weeks of culture, assess the growth of root cultures in
terms of fresh weight/dry mass, growth ratio, and total sapo-
nin content and also for the amount of gymnemic acid
produced.
6. Determine the amount of gymnemic acid by HPLC analysis
after deglycosylation (to obtain sapogenin “gymnemagenin”)
by treating with KOH and HCl, by comparing with retention
time of the “gymnemagenin” standard (see Subheading 3.7).
436 J. Rajashekar et al.

7. Use molecular weight corrections for the determination of

gymnemic acid produced in the form of gymnemagenin by
using the formula (809.0/506.7) [15].

3.7 Extraction 1. For the extraction of “gymnemic acid” follow the conventional
of Gymnemic acid method of extraction.
2. Dry the fresh mass of hairy roots at 50 °C and make into pow-
der. Suspend 500 mg of this powder into 10 ml of 50 % etha-
nol (v/v) with frequent shaking at room temperature. Subject
this extract for total saponin content determination and thin-
layer chromatography (TLC) analysis.
3. Subject the saponin extract for deglycosylation (to convert
gymnemic acid to gymnemagenin) for alkali and acid hydroly-
sis. To the ethanol extract, add 10 ml of 11 % KOH and heat
in a boiling water bath under reflux for 1 h to carry out alkaline
hydrolysis, and cool to room temperature. Further, add 1.8 ml
of concentrated HCl and heat in a boiling water bath under
reflux for 1 h to carry out acid hydrolysis.
4. After cooling to room temperature, adjust the pH to 7.5–8.5
with 1 N KOH and dilute the solution with 50 % ethanol (v/v)
or methanol up to 100 ml, filter through 0.45 μm nylon filter,
and use for the chromatography analysis [15].

3.8 Phytochemical Dissolve 10 mg gymnemagenin into 10 ml of 50 % methanol to

Screening obtain 1 mg/ml stock solution.
3.8.1 Preparation
of the Reference Standard

3.8.2 Thin-Layer 1. Separate analytes present in extract filtrate on 20 cm × 10 cm

Chromatography TLC plates with silica gel G60 F254 as stationary phase spread
with a thickness of 0.25 and 2 mm for analytical and prepara-
tive purposes, respectively. Develop the chromatogram using
chloroform:methanol:acetic acid (5:1:1) as mobile phase in a
pre-saturated development tank (see Notes 8 and 9).
2. After air-drying detect the analytes on chromatogram by spray-
ing with vanillin-sulfuric acid reagent followed by oven drying
at 100 °C for 15 min. Observe for the “gymnemic
acid/gymnemagenin (deglycosylated form)” that appears as
purple-colored spots (Fig. 4).
3. Confirm the presence of gymnemagenin by comparing with
reference standard Rf values.

3.8.3 HPTLC 1. Use commercially available HPTLC plates. Wash the plates
with methanol and activate at 60 °C for 5 min in an oven and
use for the chromatographic separation by using Camag
Linomat V (Switzerland) sample applicator.
 Strategies for the Enhanced Production of Gymnemic Acid… 437

Fig. 4 TLC chromatogram of gymnemic acid. T: Callus extract; R: reference

standard

2. Apply 10 μl of the extract aliquots and standard separately onto

the HPTLC plate, develop up to 80 mm with mobile phase
toluene:ethyl acetate:methanol (2:7:1), and detect by scanning
UV reflectance mode at 210 nm.
3. Determine the amount of gymnemagenin in the sample with
the help of calibration curve obtained for reference standard
gymnemagenin (Fig. 5) [16].

3.8.4 HPLC 1. Inject 20 μl of the filtered extract with manual injector.

2. Use C18 column (4.6 × 250 mm 5 μm) and acetonitrile:water
(1:3 ratio with 0.1 % trifluoroacetic acid) for HPLC separa-
tion and detect the separated analytes at 210 nm using diode
array detector (DAD) (see Note 10). Maintain the tempera-
ture at 30 °C.
3. Determine the amount of gymnemic acid in the extract with
the help of retention time of reference standard “gymnema-
genin” and by interpretation from HPLC data in terms of
area under the peaks of test sample and reference standard
(Fig. 6).
438 J. Rajashekar et al.

AU 100
a
90

80
70
1
60
50

40
30
20
10
0
0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0

AU 100
b
90
80

70
60
1
50
40
5
30
2
4
20 3
10

0
0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0

Fig. 5 HPTLC chromatograms of standard gymnemagenin (a), leaf extract of Gymnema sylvestre hydrolyzed
according to the described method (b). Peak 1 = gymnemagenin

0.12

0.10

0.08

0.06
AU

0.04

0.02

0.00

0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00
Minutes

Fig. 6 HPLC chromatogram of gymnemagenin standard

 Strategies for the Enhanced Production of Gymnemic Acid… 439

4 Notes

1. Ethidium bromide is highly carcinogenic and should be han-

dled using gloves.
2. Cytokinins and auxins at their varied concentrations differently
influence the callus-inducing response (Table 2).
3. The ratios of growth regulators influence the morphogenesis
of the explants into undifferentiated callus/shooting and root-
ing response. High cytokinin to auxin promotes the shooting
(Table 3), while high auxin to cytokinin promotes the rooting
in the explants (Table 4).
4. Hairy root cultures have advantages over other types of in vitro
cultures, in having higher genetic stability and relatively fast
growth rates compared to undifferentiated tissue (callus); fur-
ther it is not required to supplement growth regulators in the
culture medium.
5. Cefotaxime is an antibiotic used for the complete elimination
of background Agrobacterium after cocultivation, while kana-
mycin sulfate is used in order to select the putative transformed
hairy roots.
6. Conventionally DNA from the plant tissues is isolated by
CTAB method [17]; alternatively total RNA is isolated
by phenol:chloroform:isoamyl alcohol method [18].
7. The growth rate is determined as GR = (harvested dry weight-
inoculated dry weight)/inoculated dry weight.
8. In order to remove water and any other contaminant materials
on the adsorbent, the TLC plates are activated.
9. The saturation of the development tank is performed for
the prevention of edge effect, i.e., where solvent front in
the middle of TLC plate moves faster than the edge,
which leads to distorted and irregular separation of the
compounds.
10. Peak tailing is reduced at lower pH conditions, for which tri-
fluoroacetic acid is added to the mobile phase, so as to obtain
the better resolution and peak shape of the chromatogram. In
addition to this, trifluoroacetic acid also has least UV cutoff
(205 nm) and does not interfere with absorption of the light
source.
440 J. Rajashekar et al.

Table 2
Effect of different auxins and cytokinins on leaf callus growth

Auxins (mg/l) Cell biomass

2,4-D NAA IBA IAA Picloram FW DW
0.2 – – – – 10.64 ± 0.3 0.94 ± 0.02
0.5 – – – – 12.83 ± 0.12 1.46 ± 0.14
1 – – – – 11.14 ± 0.28 1.28 ± 0.11
2 – – – – 10.8 ± 0.15 0.96 ± 0.01
5 – – – – 09.76 ± 0.14 0.85 ± 0.01
10 – – – – 08.12 ± 0.28 0.78 ± 0.01
– 0.2 – – – 07.73 ± 0.12 0.65 ± 0.006
– 0.5 – – – 07.56 ± 0.08 0.63 ± 0.015
– 1 – – – 07.72 ± 0.31 0.67 ± 0.006
– 2 – – – 08.22 ± 0.11 0.7 ± 0.005
– 5 – – – 08.08 ± 0.05 0.68 ± 0.017
– 10 – – 07.36 ± 0.20 0.81 ± 0.008
– – 0.2 – – 05.32 ± 0.06 0.49 ± 0.01
– – 0.5 – – 05.82 ± 0.11 0.58 ± 0.01
– – 1 – – 05.62 ± 0.09 0.52 ± 0.01
– – 2 – – 05.05 ± 0.10 0.50 ± 0.01
– – 5 – – 04.71 ± 0.11 0.53 ± 0.008
– – 10 – – 04.13 ± 0.15 0.4 ± 0.005
– – – 0.2 – 04.43 ± 0.14 0.40 ± 0.01
– – – 0.5 – 04.92 ± 0.15 0.44 ± 0.01
– – – 1 – 05.33 ± 0.20 0.47 ± 0.017
– – – 2 – 05.86 ± 0.08 0.52 ± 0.01
– – – 5 – 05.16 ± 0.12 0.49 ± 0.008
– – – 10 – 04.42 ± 0.08 0.39 ± 0.008
– – – – 0.02 05.43 ± 0.12 0.59 ± 0.005
– – – – 0.05 06.03 ± 0.17 0.61 ± 0.006
– – – – 0.10 8.5 ± 0.1 0.96 ± 0.005
– – – – 0.20 7.03 ± 0.08 0.75 ± 0.008
– – – – 0.50 6.63 ± 0.13 0.64 ± 0.006
– – – – 1.00 7 ± 0.05 0.68 ± 0.008
(continued)
 Strategies for the Enhanced Production of Gymnemic Acid… 441

Table 2
(continued)

Cytokinins (mg/l) Cell biomass

BAP Kinetin FW DW
0.2 – 4.58 ± 0.01 0.31 ± 0.01
0.5 – 5.23 ± 0.17 0.36 ± 0.01
1 – 5.53 ± 0.08 0.44 ± 0.02
2 – 6.96 ± 0.08 0.54 ± 0.01
5 – 6.12 ± 0.25 0.48 ± 0.008
10 – 5.68 ± 0.08 0.46 ± 0.01
– 0.2 4.56 ± 0.03 0.40 ± 0.08
– 0.5 4.83 ± 0.08 0.42 ± 0.01
– 1 4.26 ± 0.14 0.36 ± 0.01
– 2 4.46 ± 0.14 0.39 ± 0.01
– 5 3.92 ± 0.05 0.35 ± 0.01
– 10 3.56 ± 0.14 .33 ± 0.003

Table 3
Effect of cytokinins on morphogenesis in Gymnema sylvestre nodal explants

Cytokinin Concentration (mg/l) % of response Days to bud sprout No. of shoots per explant
– – – –
BAP 0.2 38.67 ± 0.88 20.75 ± 1.57 1.0 ± 0.23
0.5 55.33 ± 2.20 20.33 ± 0.88 1.0 ± 0.32
1 70.86 ± 1.85 18.86 ± 1.02 1.67 ± 0.33
2 72.86 ± 1.85 15.67 ± 1.45 2.0 ± 0.24
5 64.24 ± 1.0 15.56 ± 1.20 1.33 ± 0.33
10 60.0 ± 2.08 12.00 ± 1.52 1.33 ± 0.67
Kinetin 0.2 46.21 ± 1.02 21.56 ± 0.97 1.30 ± 0.33
0.5 45.33 ± 1.75 21.33 ± 1.25 1.0 ± 0.28
1 36.55 ± 1.33 20.55 ± 0.88 1.0 ± 0.24
5 35.67 ± 0.89 18.16 ± 1.95 1.0 ± 0.05
10 30.33 ± 0.66 17.28 ± 1.45 1.0 ± 0.03
2-iP 0.2 29.85 ± 0.95 21.69 ± 1.70 1.0 ± 0.06
0.5 37.67 ± 1.22 21.26 ± 1.02 1.0 ± 0.02
1 40.33 ± 1.74 21.11 ± 1.17 1.0 ± 0.03
2 35.86 ± 1.66 20.89 ± 1.33 1.0 ± 0.06
5 20.75 ± 1.46 18.55 ± 1.67 1.0 ± 0.04
10 20.46 ± 1.57 18.33 ± 1.25 1.0 ± 0.03
442 J. Rajashekar et al.

Table 4
Effect of different auxins on rooting

Concentration Rooted Mean no. of Mean root Plant

Auxin (mg/l) shoots (%) roots/shoot length (cm) survival (%)
NAA 1 25.61 ± 1.22 2.55 ± 0.55 0.81 ± 0.63 9.77 ± 1.56
2 31.55 ± 1.02 4.13 ± 0.78 1.21 ± 0.49 20.11 ± 1.41
3 60.23 ± 0.98 5.75 ± 1.11 2.35 ± 1.06 30.14 ± 1.71
4 65.71 ± 0.88 7.21 ± 1.63 6.62 ± 1.22 33.88 ± 0.88
5 57.42 ± 1.02 5.96 ± 1.45 4.52 ± 1.09 32.79 ± 1.06
IBA 1 34.71 ± 0.86 4.66 ± 1.21 1.15 ± 0.88 20.76 ± 1.02
2 40.32 ± 1.02 9.74 ± 0.99 2.94 ± 0.95 35.31 ± 1.22
3 71.95 ± 0.67 15.79 ± 0.56 8.26 ± 0.56 60.11 ± 0.95
4 74.33 ± 1.11 15.12 ± 1.65 7.78 ± 1.02 52.46 ± 1.78
5 75.51 ± 1.26 14.45 ± 1.21 7.31 ± 1.29 50.12 ± 1.56
IAA 1 22.62 ± 0.95 1.43 ± 0.88 0.52 ± 1.55 7.12 ± 0.55
2 28.66 ± 1.22 3.66 ± 0.95 0.97 ± 0.86 9.99 ± 1.23
3 45.23 ± 1.05 5.24 ± 1.09 3.54 ± 1.11 22.56 ± 1.45
4 50.51 ± 1.45 5.54 ± 1.02 2.72 ± 1.02 30.15 ± 0.89
5 52.92 ± 0.79 5.10 ± 1.56 1.43 ± 0.55 30.95 ± 1.22

Acknowledgement

Authors are thankful to Department of Biotechnology, Ministry of

Science and Technology, Government of India, for the financial
support.

References
1. Baskaran K, Ahamath B, Shanmugasundaram compound derived from Gymnema sylvestre
ER, Shanmugasundaram KR (1990) Anti- leaves in streptozotocin-diabetic mice. J Asian
diabetic effect of a leaf extract from Gymnema Nat Prod Res 2:321–327
sylvestre in non-insulin-dependent diabetes 5. Kar A, Choudhary BK, Bandyopadhyay NG
mellitus patients. J Ethnopharmacol 30: (1999) Preliminary studies of the inorganic
295–300 constituents of some indigenous hypoglycae-
2. Shanmugasundram ERB, Rajeswari G, mic herbs on oral glucose tolerance test.
Baskaran K, Rajeshkumar BR, Radha KS, J Ethnopharmacol 64:179–184
Ahamath K (1990) Use of Gymnema sylvestre 6. Maeda M, Iwashita T, Kurihara Y (1989)
leaf extract in the control of blood glucose in Studies on taste modifiers II. Purification
insulin–dependent diabetes mellitus. and structure determination of Gymnemic
J Ethnopharmacol 30:281–294 acids, anti-sweet active principle from
3. Persaud SJ, Al-Majed H, Raman A, Jones PM Gymnema sylvestre leaves. Tetrahedron Lett
(1999) Gymnema sylvestre stimulates insulin 30:1547–1550
releases in vitro by increased membrane per- 7. Yoshikawa K, Arihara S, Matsuura K, Miyase T
meability. J Endocrinol 163:207–212 (1992) Dammarane saponins from Gymnema
4. Sugihara Y, Nojima H, Matsuda H, Murakami sylvestre. Phytochemistry 31:237–241
T, Yoshikawa M, Kimura I (2000) Anti- 8. Chakravarti D, Debnath NB (1981) Isolation
hyperglycemic effects of gymnemic acid IV, a of gymnemagenin, the sapogenin of Gymnema
 Strategies for the Enhanced Production of Gymnemic Acid… 443

sylvestre R. Br. (Asclepiadaceae). J Inst Chem 14. Praveen N, Thiruvengadam M, Yang YS, Kim
(India) 53:155–158 SH, Murthy HN, Chung IM (2014)
9. Liu HM, Kiuchi F, Tsuda Y (1992) Isolation Production of gymnemic acid from hairy root
and structure elucidation of gymnemic acids, cultures of Gymnema sylvestre R. Br. as influ-
anti-sweet principles of Gymnema sylvestre. enced by polyunsaturated fatty acids (PUFAs)
Chem Pharm Bull 40:1366–1375 and their antioxidant activity. Ind Crops Prod
10. Yoshikawa K, Kondo Y, Arihara S, Matsuura K 54:54–61
(1993) Anti-sweet natural products. IX struc- 15. Veerashree V, Anuradha CM, Kumar V (2012)
tures of gymnemic acids XV-XVIII from Elicitor-enhanced production ofgymnemic
Gymnema sylvestre R Br. Chem Pharm Bull acid in cell suspension cultures of Gymnema
40:1779–1782 sylvestre R. Br. Plant Cell Tiss Org Cult
11. Murashige T, Skoog F (1962) A revised 108:27–35
medium for rapid growth and bioassays with 16. Raju VS, Kannababu S, Subbaraju GV (2006)
tobacco tissue culture. Physiol Plant 15: Standardisation of Gymnema sylvestre [Link]. by
473–497 high-performance thin-layer chromatography:
12. Nagella P, Thiruvengadam M, Jung SJ, Murthy an improved method. Phytochem Anal 17:
HN, Chung IM (2013) Establishment of 192–196
Gymnema sylvestre hairy root cultures for the 17. Doyle JJ, Doyle JL (1987) A rapid DNA isola-
production of gymnemic acid. Acta Physiol tion procedure for small quantities of fresh leaf
Plant 35:3067–3073 tissue. Phytochem Bull 19:11–15
13. Murthy HN, Dijkstra C, Anthony P, White 18. Kam-Lock Chan, Chai-Ling Ho, Parameswari
DA, Davey MR, Power JB, Hahn EJ, Paek KY Namasivayam and Suhaimi Napis (2007) A
(2008) Establishment of Withania somnifera simple and rapid method for RNA isolation
hairy root cultures for the production of with- from plant tissues with high phenolic com-
anolide A. J Integr Plant Biol 50:975–981 pounds and polysaccharides. Nat Protoc 184
 Chapter 30

In Vitro Mass Propagation of Cymbopogon citratus Stapf.,

a Medicinal Gramineae
Elisa Quiala, Raúl Barbón, Alina Capote, Naivy Pérez, and Elio Jiménez

Abstract
Cymbopogon citratus (D.C.) Stapf. is a medicinal plant source of lemon grass oils with multiple uses in the
pharmaceutical and food industry. Conventional propagation in semisolid culture medium has become a
fast tool for mass propagation of lemon grass, but the production cost must be lower. A solution could be
the application of in vitro propagation methods based on liquid culture advantages and automation. This
chapter provides two efficient protocols for in vitro propagation via organogenesis and somatic embryo-
genesis of this medicinal plant. Firstly, we report the production of shoots using a temporary immersion
system (TIS). Secondly, a protocol for somatic embryogenesis using semisolid culture for callus formation
and multiplication, and liquid culture in a rotatory shaker and conventional bioreactors for the mainte-
nance of embryogenic culture, is described. Well-developed plants can be achieved from both protocols.
Here we provide a fast and efficient technology for mass propagation of this medicinal plant taking the
advantage of liquid culture and automation.

Key words Lemon grass, Medicinal plant, Organogenesis, Somatic embryogenesis, Temporary
immersion system

1 Introduction

Plant propagators have been developing cost-effective organogenesis

and somatic embryogenesis methods for the in vitro propagation
of different plant species using liquid culture medium [1]. Because
of liquid culture advantages for commercial propagation of plants,
different technologies have been developed for complete or
semiautomation of the in vitro propagation process. Temporary
immersion system (TIS) and conventional bioreactors have become
efficient techniques for mass production of organs and somatic
embryos in several medicinal plants [2–5].
Lemon grass [Cymbopogon citratus (D.C.) Stapf.] is a peren-
nial and medicinal herb belonging to the Poaceae family. It has
been widely cultivated in tropical and subtropical countries to
produce lemon grass oil, which fundamentally contains citral,

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7_30, © Springer Science+Business Media New York 2016

445
446 Elisa Quiala et al.

farnesol, nerol, citronellal, and myrcene. Citral is the essential oil

component, located mainly in the leaves and primarily used to fla-
vor food [6]. It is also known that the essential oil of this vegetable
species is the chief component in the multiple medicinal uses that
are popularly attributed to this plant due to its anti-inflammatory,
anti-microbial action and anti-mutagenic properties [7–9].
Although the propagation of lemon grass has been conven-
tionally carried out by suckering [10], this method is time consum-
ing, and the rate of propagation is rather low. Rapid in vitro
propagation via organogenesis and somatic embryogenesis using
simple and conventional bioreactors could remedy this problem.
In consequence, TIS have been applied for the production of not
only biomass [11, 12] but also secondary plant metabolites [13].
In the in vitro biomass of C. citratus the presence of citrals is only
detected in shoots, and majorly in TIS than semisolid culture,
although the yield of the in vitro biomass is lower than plants on
field condition [14].
This chapter describes a detailed reproducible protocol for the
organogenesis and somatic embryogenesis of Cymbopogon citratus
Stapf. using TIS and conventional bioreactors.

2 Material

2.1 Organ Culture 1. Last portion of the stem, comprising the apical shoots of the
C. citratus (Fig. 1a), collected from field plants.
2.1.1 Surface
Sterilization of Shoots 2. Sodium hypochlorite (NaOCl) with 3 % of active Cl.
and Culture Conditions 3. Sterilized distilled or deionized water for rinses.
4. Tissue culture facilities and tools: Laminar flow cabinet, scal-
pel, forceps, tool sterilizer such as vertical autoclave and glass-
bead sterilizer, culture room, and personal protective
equipment (i.e., laboratory coat).

2.1.2 In Vitro 1. Liquid culture medium based on Murashige and Skoog (MS)
Establishment salts [15] for in vitro establishment of apical shoot (named
MS-I); see medium formulations in Table 1.
2. Growth regulators: 6-Benzylaminopurine (6-BAP).
3. Vessels for plant tissue culture: Test tubes (25 mm × 150 mm).
4. Filter paper as explant support (Fig. 1b, see Note 1).

Fig. 1 (continued) every 4 h, 3 weeks after culture on MS-I medium; (h) shoots growing in 10 L TIS under 3 min
of immersions every 4 h, 4 weeks after culture; (i) multiple shoots from 10 L TIS; (j) rooted shoots (plantlets),
3 weeks after transfer to rooting medium MS-II (MS + without growth regulators); (k) plantlets during acclima-
tization ready for field plantation, 6 weeks after transfer to organic matter and zeolite (4:1, v/v)
Fig. 1 In vitro propagation of Cymbopogon citratus in temporary immersion system, (a) the apical region of the
stem from field plants (named spindle); (b) apical shoot culture in MS-I medium (MS + 0.89 μM BA); (c) 2.5–
3.0 cm long individual shoots; (d, e) shoots growing in RITA under 1 min of immersion every 4 h, 3 weeks after
culture on MS-I medium (MS + 0.89 μM BA); (f, g) shoots growing in 1 L TIS under 2 min of immersion
Table 1
The basal media used in tissue culture of Cymbopogon citratus

Component (mg/L) MS-I MS-II CI CM IEC DSE GSE

CaCl2 332.02 332.02 332.02 332.02 332.02 332.02 332.02
KH2PO4 170.00 170.00 170.00 170.00 170.00 170.00 170.00
KNO3 1900.00 1900.00 1900.00 1900.00 1900.00 1900.00 1900.00
MgSO4 180.54 180.54 180.54 180.54 180.54 180.54 180.54
NH4NO3 1650.00 1650.00 1650.00 1650.00 1650.00 1650.00 1650.00
CoCl2·6H2O 0.025 0.025 0.025 0.025 0.025 0.025 0.025
CuSO4·5H2O 0.025 0.025 0.025 0.025 0.025 0.025 0.025
Na2EDTA·2H2O 36.70 36.70 36.70 36.70 36.70 36.70 36.70
H3BO3 6.20 6.20 6.20 6.20 6.20 6.20 6.20
KI 0.83 0.83 0.83 0.83 0.83 0.83 0.83
MnSO4·H2O 16.90 16.90 16.90 16.90 16.90 16.90 16.90
Na2MoO4·2H2O 0.25 0.25 0.25 0.25 0.25 0.25 0.25
ZnSO4·7H2O 8.60 8.60 8.60 8.60 8.60 8.60 8.60
Myoinositol 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Thiamine HCl 1.00 1.00 1.00 1.00 1.00 1.00 1.00
Nicotinic acid – – – 0.50 0.50 0.50 –
Pyridoxine HCl – – – 0.50 0.50 0.50 –
Glycine – – – 2.00 2.00 2.00 –
l-Arginine – – – – 50.00 50.00 –
l-Cysteine – – – – 10.00 10.00 –
Citric acid – – – – 50.00 – –
Malt extract – – – – 50.00 100.00 –
Casein hydrolyzate – – – – 1000 200.00 –
Sucrose 30,000 40,000 20,000 40,000 40,000 80,000 20,000
6-BAP (μM) 0.890 – – – – – –
2,4-D (μM) – – 22.52 22.52 13.57 4.52 –
Indole-3-acetic acid – – – 7.30 – – –
(μM)
Kinetin (μM) – – – 4.10 – – –
Coconut milk (mL/L) – – 180.00 100.00 50.00 50.00 180.00
Agar – – 7000 8000 – 9000 7000
The basal media used for in vitro establishment and shoot multiplication (MS-I), shoot rooting (MS-II), callus initiation
(CI), callus multiplication and induction of embryogenic culture (CM), maintenance of embryogenic culture (IEC),
development of somatic embryos (DSE), and germination (GSE) based on modification of MS medium (Murashige and
Skoog, 1962) proposed by Payán et al. [17] and Heinz and Mee [18]
Adjust the pH of the medium to 5.6 with 0.5 N KOH before autoclaving at 1.2 kg/cm2 and 121 °C for 20 min
 Automation in Cymbopogon 449

2.1.3 Shoot 1. RITA units with all components.

Multiplication in RITA 2. TIS units of 1 L, comprising glass vessels (Erlenmeyers) with
and 1 L Temporary all components.
Immersion Systems
3. Individual shoots (2.5–3.0 cm long) (Fig. 1c).
4. Liquid culture medium similar to in vitro establishment of api-
cal shoot (named MS-I); see medium formulations in Table 1.

2.1.4 Scale-Up of Shoot 1. TIS units of 10 L, comprising plastic vessels with all
Multiplication in 10 L TIS components.
2. Individual shoots (2.5–3.0 cm long) (Fig. 1c, see Note 2).
3. Liquid culture medium for shoot multiplication similar to
establishment medium (named MS-I); see medium formula-
tions in Table 1.

2.1.5 Rooting 1. Liquid culture medium for shoot rooting (named MS-II); see
of In Vitro Shoots medium formulations in Table 1.
2. Vessels for plant tissue culture: 250 mL glass flask.

2.1.6 Acclimatization 1. Compost and zeolite (4:1, v/v) (see Note 3).
of Plantlets 2. Multipots of 70 hole (50 cm × 70 cm).

2.2 Somatic 1. Leaf segment (0.5 cm) of the most internal leaves classified as
Embryogenesis A and B [16] of field plants of C. citratus as source of explants.
2.2.1 Callus Initiation 2. Semisolid culture medium based on modified [17] medium
(named CI); see medium formulations in Table 1.
3. Growth regulators: 2,4-Dichlorophenoxyacetic acid (2,4-D).
4. Coconut milk.
5. Vessels for plant tissue culture: 250 mL glass flask.

2.2.2 Callus 1. Semisolid culture medium based on modified [18] medium

Multiplication (named CM); see medium formulations in Table 1.
and Induction 2. Growth regulators: 2,4-D, kinetin (Kin), indole-3-acetic acid
of Embryogenic Culture (IAA).
3. Coconut milk.
4. Vessels for plant tissue culture: 250 mL glass flask.

2.2.3 Maintenance 1. Liquid culture medium based on modified MS medium [15]

of Embryogenic Culture (named IEC); see medium formulations in Table 1.
2. Vessels for plant tissue culture: 100 mL Erlenmeyer flask.
3. Growth regulators: 2,4-D.
4. Coconut milk.
5. Rotatory shaker.
450 Elisa Quiala et al.

2.2.4 Proliferation 1. Bioreactor unit, comprising 1.8 L glass vessels with controlled
of Embryogenic Culture atmosphere.
in Bioreactors
2. Liquid culture medium IEC; see medium formulations in
Table 1.
3. Growth regulators: 2,4-D.
4. Coconut milk.

2.2.5 Development 1. Semisolid culture medium based on modified MS medium

of Somatic Embryos [15] (named DSE); see medium formulations in Table 1.
2. Growth regulators: 2,4-D.
3. Coconut milk.

2.2.6 Germination 1. Semisolid culture medium based on [16] medium free of

growth regulators (named GSE); see medium formulations in
Table 1.
2. Coconut milk.

3 Methods

3.1 Organ Culture 1. Sterilize all instruments and the laminar flow cabinet before
use.
3.1.1 Surface
Sterilization of Shoots 2. Cut from the field plants the last region of the stem comprising
and Culture Conditions the apical meristem and the leaves that surround it (about
20 cm long) (Fig. 1a).
3. Remove external leaves of the explants giving a spindle form.
4. Reduce the size of the spindle from 20 to 5 cm conserving the
apical meristem region (see Note 4).
5. In the laminar flow cabinet, place the reduced spindle in
350 mL flask with an aqueous solution of sodium hypochlorite
(NaOCl) with 3 % of active Cl and shake during 15 min.
6. Rinse spindle three times with sterile distilled or deionized
water.
7. Under aseptic conditions and with the help of a stereomicro-
scope, excise apical shoot of about 5 mm size.
8. Inoculate one apical shoot (Fig. 1b) per culture tube contain-
ing 10 mL liquid medium MS-I (Table 1). MS-I comprises
basal MS medium [14] supplement with 30 g/L sucrose and
1.0 mg/L thiamine and 0.89 μM BA (see Note 5), pH of the
medium adjusted to 5.6 by addition of 0.1 N NaOH or 0.1 N
HCl, before autoclaving at 121 °C and 105 kPa for 15 min
(see Note 6).
 Automation in Cymbopogon 451

9. Incubate the explants at 28 ± 2 °C under natural light conditions,

photoperiod 13/11 h and 20–45 μmol/m2/s (see Note 7).
10. After 3 weeks (see Note 8), singulate and cut shoots approxi-
mately in 2.5–3.0 cm length (Fig. 1c) for TIS inoculation.
Discard any contaminated shoots.

3.1.2 Shoot 1. Prepare RITA units (see Note 9).

Multiplication in RITA 2. Add to each RITA 230 mL liquid medium MS-I, supple-
and 1 L TIS mented as described (Table 1) (see Note 10).
3. After sterilization connect the RITA to the shelf for the tempo-
rary immersion. Program the timer for some parameters like
time and immersion frequency (1 min every 4 h).
4. Check functioning of RITA for 3 days before inoculation.
Discard any contamination.
5. Inoculate five individual shoots (2.5–3.0 cm long) per RITA in
a laminar flow cabinet.
6. Reconnect RITA to the shelf for the temporary immersion,
and incubate the culture for 3 weeks at 28 ± 2 °C under natural
light conditions, photoperiod 13/11 h and 20–45 μmol/m2/s
(see Note 7).
7. After 3 weeks of culture (Fig. 1d, e), harvest the biomass in a
laminar flow cabinet. Produced shoots can be sub-cultivated
again into RITA or into 1 and 10 L TIS.
8. Separate the individual shoots from the explants. Cut the
shoots transversally eliminating apical dominance and reducing
shoot size to 2.5–3.0 cm length, and transfer again into TIS.
9. For shoot multiplication in 1 L TIS, prepare TIS units
(see Note 9) and connect all components.
10. Add to each 1 L TIS unit 500 mL MS-I liquid medium, sup-
plemented as described in Table 1 (see Note 11).
11. Connect the TIS to the shelf for the temporary immersion.
Program the timer for some parameters like time and immer-
sion frequency (2 min every 4 h).
12. Same as step 4.
13. Inoculate 20 individual shoots (2.5–3.0 cm long) (Fig. 1c) per
1 L TIS (Fig. 1f) in a laminar flow cabinet.
14. Same as step 6.
15. The shoots grow quickly filling the flask in 3 weeks of culture
(Fig. 1g). Averages of 12.3 shoots per explants with 5.25 cm
of length are achieved. Shoots can be individualized and trans-
ferred to rooting phase or used for scale-up in 10 L TIS.
16. Individualize and cut shoots approximately in 2.5–3.0 cm
length (Fig. 1c) for 10 L TIS inoculation. Discard any con-
taminated shoots.
452 Elisa Quiala et al.

3.1.3 Scale-Up of Shoot 1. Prepare TIS units (see Note 9) and connect all components.
Multiplication in 10 L TIS
2. Add to each 10 L TIS unit a volume of 3000 mL liquid
culture medium MS-I, supplemented as described in Table 1
(see Note 12).
3. Connect the TIS to the shelf for the temporary immersion.
Program the timer for some parameters like time and immer-
sion frequency (3 min every 4 h for 10 L TIS).
4. Same as step 4 under Subheading 3.1.2.
5. Inoculate 20 individual shoots (2.5–3.0 cm long) (Fig. 1c) per
10 L TIS.
6. Same as step 6 under Subheading 3.1.2.
7. After 4 weeks (Fig. 1h), collect the biomass and separate the
individual shoots (more than 3 cm) from the clumps (Fig. 1i).
Averages of 17.3 shoots/explants are achieved.

3.1.4 Rooting 1. Reduce shoot size to 5 cm in length and leaf area to 50 %.

and Acclimatization Transfer six shoots into 250 mL culture flask, each containing
of Plantlets 30 mL rooting liquid culture medium (named MS-II), and see
medium formulation in Table 1. MS-II is similar to MS-I
medium formulation, but without growth regulator. After 21
days of culture, the shoots grow fast and develop 3–4 adventi-
tious roots (Fig. 1j).
2. Remove plantlets from the culture flask and wash them with
water to remove rest of liquid culture medium. Now the plant-
lets are ready for the transfer to acclimatization.
3. After washing, plant in vitro plantlets individually and accord-
ing to their length in the substrate mix of organic matter and
zeolite (4:1, v/v) contained in perforated plastic multipot tray
(50 cm × 70 cm, with 70 holes). Transfer the multipots in the
greenhouse. During the first 2 weeks of acclimatization, reduce
light intensity (50 %) by covering the plantlets with a plastic
black mesh (Zaran). Keep the multipots under high humidity
by watering during 30 s every 1 h.
4. In the third week, remove the Zaran and space watering fre-
quency every 6 h. Keep this condition for 1 week more. Reduce
watering frequency every 12 h the next 2 weeks. Well-developed
and acclimated plants were achieved 45 days after ex vitro
transfer (Fig. 1k).

3.2 Somatic 1. Cut from the field-grown plants the last region of the stem
Embryogenesis comprising the apical meristem and the leaves that surround it
(about 20 cm long) (Fig. 2a, b).
3.2.1 Callus Initiation
2–6. Same as steps 2–6 under Subheading 3.1.1 for plant
material and disinfection procedure (see Note 13).
 Automation in Cymbopogon 453

Fig. 2 Plant regeneration via somatic embryogenesis of Cymbopogon citratus in liquid culture, (a) apical
branch from field of plants, (b) the apical region of the stem (about 20 cm long) from field plants (named
spindle), (c) leaf segment (0.5 cm long) of the most internal leaves classified as A and B [16], (d) yellowish
callus corresponding to embryogenic tissue from CM culture medium (MS + 13.57 μM 2,4-D + 4.1 μM kine-
tin + 7.3 μM IAA), (e) cell suspension obtained by transferring 2.0 g of yellowish callus into 50 mL of IEC culture
medium (MS + 22.52 μM 2,4-D), (f) stable embryogenic cell suspension obtained 2 months after initiation in
the presence of coconut milk, (g) roots growth in the cellular aggregates cultivated in liquid culture medium
without cocconut milk, (h) 1.8 L bioreactor unit with embryogenic cultures on IEC culture medium, (i) germi-
nated somatic embryos 1 week after culture in GSE medium (MS + 180 mL/L coconut milk and without regula-
tor of growth), (j) plantlets from somatic embryos 4 weeks after culture on GSE medium
454 Elisa Quiala et al.

2. After the disinfection eliminate the external leaves in the

laminar flow cabinet by keeping only the most internal leaves
classified as A and B according to [16] for Saccharum sp. spe-
cies. Discard apical meristem.
3. Excise leaf segments of 0.5 cm length from the A and B leaves
(Fig. 2c). Inoculate vertically around five segments per 250 mL
culture flask containing 25 mL CI medium (Table 1). Adjust
pH of the medium to 5.6 by addition of 0.1 N NaOH or 0.1 N
HCl, before autoclaving at 121 °C and 105 kPa for 20 min.
4. Incubate the cultures at 28 ± 2 °C for 4 weeks in the darkness.
Within 4 weeks, callus develops from the leaf segments.

3.2.2 Callus 1. Cut the callus into small fragments (around 5 mm size), dis-
Multiplication card watery and mucilaginous callus, and transfer the compact
and Induction callus to the multiplication medium (CM) (Table 1). Adjust
of Embryogenic Culture the pH of the medium to 5.6 by addition of 0.1 N NaOH or
0.1 N HCl, before autoclaving at 121 °C and 105 kPa for
20 min.
2. Distribute around 15–20 small callus fragments per 250 mL
flask culture, each containing 25 mL of the culture medium.
Incubate the cultures in dark conditions.
3. After 3 weeks, subculture the callus to fresh medium CM fol-
lowing the same procedure and culture conditions described in
step 1. At this stage, select only the yellowish and friable callus
(Fig. 2d).

3.2.3 Maintenance 1. Maintenance of embryogenic culture is more efficient by estab-

of Embryogenic Culture lishing cell suspension cultures. A cell suspension is obtained
by transferring 2.0 g yellowish callus into 50 mL liquid culture
medium for the induction of cell suspension culture (IEC)
(Table 1). The resulting cell suspension cultures are cultured in
250 mL Erlenmeyer flasks at 26 °C ± 2 °C on a rotary shaker at
110 rpm.
2. After 2 weeks, add weekly 25 mL IEC medium during 4 weeks.
Renew the 50 % of the culture medium every week for two
more weeks. Stable embryogenic cell suspension cultures are
obtained 2 months after initiation in the liquid medium
(Fig. 2e). For subculturing in a 250 mL Erlenmeyer contain-
ing 50 mL liquid medium, aggregates are collected by physical
separation using metallic sieve (375 μM pore size).
3. Maintenance cell suspension cultures by subculture at 8-week
interval following the same procedure as described in step 2.
Keep cell suspensions in the darkness. Coconut milk is indis-
pensable during the entire process to the maintenance embryo-
genic cultures (Fig. 2f). In the absence of coconut milk, cells
lose embryogenic competence and develop into root (Fig. 2g).
 Automation in Cymbopogon 455

3.2.4 Proliferation 1. For proliferation of embryogenic cultures, inoculate 60 g

of Embryogenic Culture embryogenic masses from cell suspension into 1.8 L bioreactor
in Bioreactors (Fig. 2h) containing 1.8 L induction of embryogenic culture
medium (IEC) (Table 1). For the control of the dissolved
oxygen bioreactors are equipped with a unit to gas mixture
(air, O2, N2, CO2). Keep cultures at 26.0 ± 0.1 °C, and speed of
agitation at 110 rpm, and for gassy mix fix the sparger flow at
1.43 L/h. Do not control pH. Keep the culture in the dark-
ness for 9 days.
2. After 9 days the fresh and dry weight increases five and six
times, respectively. Dry weight is recorded after the biomass is
dried to constant weight at 60 °C.

3.2.5 Development 1. Collect embryogenic cultures from the proliferation medium

of Somatic Embryos on 250 μm metallic sieve.
2. Rinse embryogenic cultures on metallic sieve with 50–100 mL
liquid medium for embryo development (DSE) (Table 1).
3. Transfer 200 mg FW embryogenic culture from metallic sieve
to 250 mL flask containing 30 mL DSE medium gelled with
7.0 g/L agar for development of somatic embryos. Keep cul-
ture under the darkness for 3 weeks.

3.2.6 Germination 1. Transfer group of 2–3 green somatic embryos into semisolid
of Somatic Embryos germination medium (GSE). Distribute 15 groups into
250 mL flask containing 30 mL GSE medium (Table 1). Adjust
the pH of the medium to 5.6 by adding 0.1 N NaOH or 0.1 N
HCl, before autoclaving at 121 °C and 105 kPa for 20 min.
2. The somatic embryos turn green and hypocotyls emerge about
1 week after transfer to the germination medium (Fig. 2i),
while root emergence occurs 1 week later. Because most of the
somatic embryos remain together it is common to observe two
or more hypocotyls emerging for somatic embryos germinated
(Fig. 2j). More than 95 % germination is recorded at 4 weeks
of culture.
3. After six weeks, an average of 80 plants are regenerated from
initial 200 mg FW embryogenic cultures, placed development
of somatic embryos (DSE) medium and subsequent germi-
nated in GSE medium.

4 Notes

1. Filter paper as support avoids the complete immersion of

shoots in the liquid medium.
2. Individual shoots could come from RITA or 1 L TIS.
456 Elisa Quiala et al.

3. Compost consisted of bovine manure with 8 months of

decomposition.
4. Because of the hardness of the spindle, use a knife to reduce
their size.
5. 6-BAP 1 mM stock solution: Dissolve 22.52 mg 6-BAP in a
few drops of 1 M sodium hydroxide, dilute to 100 mL with
distilled or deionized water, and store at 4 °C.
6. IAA 1 mM stock solution: Dissolve 8.76 mg IAA in a few
drops of 1 M sodium hydroxide, dilute to 50 mL with distilled
or deionized water, and store at 4 °C.
7. Before the liquid medium distribution in the culture tube, add
filter paper bent in the form of M at the bottom of the culture
tube. To discard contamination, conserve the medium in a
clean and dark area at 4 °C at least for 3 days, but use within
2 weeks.
8. It is possible to cultivate in vitro at 16-h photoperiod and 125–
150 μmol/m2/s photosynthetic photon flux supplied by cool
white fluorescent lamps.
9. During shoot culture establishment, the percent of shoot tips
is more than 82 %, after 7 days. The apical shoots grow fast and
develop several buds in the establishment. After 3 weeks the
buds can be inoculated in TIS.
10. Prior RITA and TIS assembling, wash all pieces with deionized
water. Connect all components according to the maker’s
instructions.
11. For preventing wetting of filters, protect them during sterili-
zation by covering with aluminum foil on the filter inlet.
To avoid the internal pressure in the containers, loosen the top
of RITA and after sterilization seal it before removing from the
autoclave.
12. Prior to the sterilization, distribute the half of medium
(1500 mL) for each vessels. To discard contamination, store
medium in darkness at 4 °C at least for 3 days.
13. For somatic embryogenesis induction, reduce the spindle size
from 20 to 15 cm.

Acknowledgments

The authors wish to thank the support of the EU through the ALFA
Network CARIBIOTEC (project AML/B7-311/97/0666/
II-0201), the German Ministry for Education and Research (BMBF),
and the Cuban Ministry of Science, Technology and Environment
(CITMA). We also thank Manuel de Feria, Maité Chávez, and
Anabel López for collaboration and technical assistance.
 Automation in Cymbopogon 457

References
1. Preil W (2005) General introduction: a per- in vitro multiplication of Cymbopogon citratus
sonal reflection on use of liquid media for (D.C.) Stapf. Biotecnol Vegetal 1:77–81
in vitro culture. In: Preil W (ed) Liquid culture 11. Quiala E, Barbón R, Jiménez E, de Feria M,
system for in vitro plant propagation. Springer, Chávez M, Capote A, Pérez-Alonso N (2006)
Dordrecht, pp 1–18 Biomass production of Cymbopogon citratus
2. Paek KY, Chakrabarty D, Hahn EJ (2005) (DC) Stapf., a medicinal plant, in temporary
Application of bioreactor systems for large scale immersion systems. In Vitro Cell Dev Biol-
production of horticultural and medicinal Plant 42:298–300
plants. Plant Cell Tiss Org Cult 81:287–300 12. Quiala E, Barbón R, Capote A, Pérez-Alonso
3. Pérez-Alonso N, Capote A, Gerth A, Jiménez N, Chávez M, de Feria M (2014) Scaling-up
E (2012) Increased cardenolides production the biomass production of Cymbopogon citra-
by elicitation of Digitalis lanata shoots cul- tus L. in temporary immersion system. Bio-
tured in temporary immersion systems. Plant tecnol Vegetal 14:67–71
Cell Tiss Org Cult 110:153–162 13. Jiménez E, Tapia A, Cheel J, Theoduloz C,
4. Steingroewer J, Bley T, Georgiev V, Ivanov I, Rodríguez J, Schmeda-Hirschmann G, Gerth
Lenk F, Marchev A, Pavlov A (2013) Biopro- A, Wilken D, Jordan M, Jiménez E, Kosky R,
cessing of differentiated plant in vitro systems. Quiala E (2007) Free radical scavengers from
Eng Life Sci 13(1):26–38 Cymbopogon citratus (DC.) Stapf plants culti-
5. Georgiev V, Schumann A, Pavlov A, Bley T vated in bioreactors by the temporary immer-
(2014) Temporary immersion systems in plant sion (tis) principle. Z Naturforsch C 62:
biotechnology. Eng Life Sci 14:607–621 447–457
6. Paranagama P, Abeysekera T, Nugaliyadde L, 14. Wilken D, Jiménez E, Hohe A, Jordan M,
Abeywickrama K (2003) Effect of the essential Gómez R, Schmeda G, Gerth A (2005)
oils of Cymbopogon citratus, C. nardus and Comparison of secondary metabolite produc-
Cinnamomum zeylanicum on pest incidence tion in cell suspension, callus culture and
and grain quality of rough rice (paddy) stored temporary immersion system. In: Hvos-Elf T,
in an enclosed seed box. Food Agric Environ Preil W (eds) Liquid culture systems for in
2:134–136 vitro plants propagation. Kluwer Academic,
7. Syed M, Khalid MR, Chaudhang FM (1990) Dordrecht, The Netherlands, pp 525–538
Essential oil of Gramineae family having 15. Murashige T, Skoog F (1962) A revised
antibacterial activity. Part I (Cymbopogon medium for rapid growth and bioassays with
citratus),(C. martinii) and (C. jawarancuso) tobacco tissue cultures. Physiol Plant 15:
oils. Pakistan J Sci Ind Res 33(12):529–531 473–497
8. Pattnaik S, Subramayam VR, Kole CR, Sahoo S 16. Guiderdoni E, Demarly Y (1988) Histology of
(1995) Antibacterial activity of oils from somatic embryogenesis in cultured leaf seg-
Cymbopogon inter and intraspecific differ- ments of sugarcane plantles. Plant Cell Tiss
ences. Microbios 84(241):239–245 Org Cult 14:71–88
9. Suaeyun R, Kinouchi T, Arimochi H, 17. Payán A, Carmen H, Tascón G (1977) Técnicas
Vinitketkumnuen U, Ohnishi Y (1997) Inhi- para la micropropagación de la caña de azúcar
bitory effects of lemon grass (Cymbopogon (Saccharum officinarum L) mediante el cultivo
citratus Stapf) on formation of azoxymethane- de tejidos y yemas. Acta Agronómica (Columbia)
induced DNA adducts and aberrant crypt foci in 37:43–79
the rat colon. Carcinogenesis 18(5):949–955 18. Heinz DJ, Mee GWP (1969) Plant differentia-
10. Licea RJ, Fernández M, Alvarado K, Gómez K tion from callus tissue of Saccharum species.
(1999) Influence of agar concentration on Crop Sci 9:346–348
 INDEX

A B
Abscisic acid ............................................................... 33, 358 Bacoside............................................................................154
Acclimatization ................................4, 6, 160, 168, 187–189, 6-benzylaminopurine (BAP) ......................49, 56, 83, 89, 91,
195–197, 206, 216–217, 222–225, 265, 281, 282, 97, 106–111, 114, 116–118, 122, 157, 159, 161, 169,
306, 308, 340, 348, 358, 360, 364, 446–447, 449, 452 202, 203, 205–207, 212, 338–343, 348, 350–353,
Adaptogen ........................................................................125 382, 383, 394, 395, 409, 411, 412, 424, 428, 431, 441,
Adventitious roots ....................................... 6, 126–134, 136, 446, 448, 456
138, 184, 452 β-glucuronidase .............................................. 86, 93, 94, 422
Agar .................................4–6, 34, 49, 91, 106, 118, 127, 143, Bioactive compounds ................................................ 134, 234
145, 146, 155, 158, 160, 169, 174, 175, 178, 184, 189, Biological activities .............................................................66
191, 195, 196, 205, 206, 217, 222, 226, 230, 232, 246, Biomass .................................... 17–19, 28, 44, 69, 70, 72, 81,
264, 265, 279, 282, 306–308, 318, 320, 321, 329, 333, 82, 89, 98, 113–122, 126, 129, 131, 133, 134, 138,
339, 353, 359, 360, 362, 364, 365, 370, 371, 389, 395, 142, 143, 147, 150, 185, 230, 234, 253, 285, 361,
401, 405, 408, 409, 425, 431, 432, 455 440, 441, 446, 451, 452, 455
Agave sisalana ...................................................................144 Bioreactors ..........................................82, 114, 126, 130, 131,
Agrobacterium......................................82, 85–86, 90–94, 99, 133, 137, 174, 242, 445, 446, 450, 455
100, 175, 177–179, 184, 242, 243, 380, 381, 383, 429, Black pepper .............................................368, 369, 371, 372,
434, 439 381–384
rhizogenes....................................177–179, 242, 243, 429 Blumea balsamifera ....................................................215–226
Air lift bioreactor ...................................................... 245, 251 Brahmi..............................................................................153
Alginate beads .................................................. 340, 342, 344 Brugmansia candida ...........................................................174
Alizarin............................................................. 143, 149, 151
Allicin ...............................................................................335 C
Allogamous, Cannabaceae ................................................276 Caffeic acid ................................................................... 4, 8, 9
α-naphthalene acetic acid (NAA)....................... 49, 389, 405 Callus............................................16–19, 22–29, 52–53, 129,
Aluminum chloride ........................................67, 71, 78, 128, 145, 146, 150, 206, 230, 233, 348, 350–351,
134, 138, 235 360–362, 380, 393–394, 409–411, 431, 432, 437,
Anthocyanins ...............................................................65–79 449, 452–454
Antibiotic ...........................................99, 100, 175, 178, 179, culture ..................................................................... 16, 18
244, 247, 255, 335, 380, 382, 383, 439 Cannabis sativa L. Cannabinoids profile ..................285–286
Anti-diabetic .................................................... 125, 229, 230 Carbon source..................................16–19, 54, 127, 232, 359
Antimicrobial ...........................................3, 32, 97, 303, 335, Cardenolides.................................................................81, 82
357, 388 cDNA Library ..........................................................317–333
Antioxidant .........................3, 14, 24–27, 29, 68, 73, 78, 125, cDNA Synthesis ................................292, 319, 324–325, 332
138, 235, 303, 335, 357, 360, 388, 431 Cell and suspension cultures .............................................318
Apical shoot...................... 104, 106, 110, 162, 395, 446–447, Cell culture ..........................................82, 141, 150, 154, 235
449, 450, 456 Cell suspension culture .............................141, 150, 230, 238,
Apocynaceae ............................................................. 241, 347 358, 361, 362, 428, 454
Artificial/synthetic seeds ....................................................53 Ceropegia noorjahaniae ..............................................348–352
Aseptic seedlings ..............................................................308 Chilling .................................................................... 197, 336
Asymbiotic seed germination ...............................................3 Chromosome counts...........................................................37
AuxI.......................................................................... 180, 184 Clonal fidelity ....................262–263, 267–269, 304, 308–311

S. Mohan Jain (ed.), Protocols for In Vitro Cultures and Secondary Metabolite Analysis of Aromatic and Medicinal Plants, Second Edition,
Methods in Molecular Biology, vol. 1391, DOI 10.1007/978-1-4939-3332-7, © Springer Science+Business Media New York 2016

459
 PROTOCOLS FOR IN VITRO CULTURES AND SECONDARY METABOLITE...
460 Index

Clonal lines............................................................... 187, 197 E

Clonal propagation ...........................................................154
Clonal repository ..............................................................276 Ebb-and-flood irrigation ..................................................195
Clones ........................................................48, 197, 255, 330, EdU assay ...........................................................................66
333, 434, 435 Elitegermplasm ................................................................275
Cold acclimation ..........................................................32, 42 Embryo culture .................................................................367
Conservation .................................. 3, 14, 48, 50, 54–56, 103, Embryo rescue ............................................................ 62, 411
104, 154, 155, 160–163, 168, 169, 242, 276, 336, 358, Emodin........................................................32, 34, 39, 40, 44
368, 381–382, 384, 389, 390, 395–397, 412–414 Encapsulation ............................. 50, 340–343, 374, 381, 394,
Controlled environment room ..........................................192 397, 411–412, 414
Cotyledonary leaves ..........................................................209 Endangered ................................................13, 103, 111, 242,
Critically endangered........................................................348 259, 336, 428
Cryopreservation ..................................32, 33, 35–36, 40–42, plants .................................................................. 104, 242
44, 48, 50, 55–57, 168, 178, 336, 338–339, 344, 345, Ex situ conservation ......................................... 104, 111, 261
358, 382–384, 390, 395–397, 412–414 Explant ................................14, 16–20, 24, 28, 29, 49, 53, 89,
Culture medium ......................... 6, 16–19, 51, 53, 62, 73–75, 104, 106, 108–109, 117, 158, 160, 162, 189, 195, 196,
79, 88, 89, 97, 99, 133, 137, 141, 150, 155, 179, 180, 202, 206–209, 218, 264–266, 271, 279, 338–340,
184, 188, 191, 193, 195, 234, 244–247, 255, 279, 280, 342–344, 350, 358–361, 382, 389, 392, 394, 400,
307, 308, 343, 354, 358, 362, 373, 374, 377, 382, 383, 405, 407, 410, 425, 430–431, 441, 446
392–394, 408, 411, 418, 431, 439, 449, 450, 453–455 type ............................................................. 14, 16–19, 29
Culture vessel ....................................... 33, 42, 54, 62, 88, 97, Ex-situ ...................................................... 104, 111, 261, 336
98, 114, 117, 118, 144, 196, 226, 246, 251, 264, 265,
F
277, 279, 280, 307, 339, 381, 384, 389, 405, 431
Curcuma longa L. ..............................................................388 Fiber .................................................................................347
Cyclopamine.....................................................................187 Flavonoids ..........................................67, 128, 130, 232, 234,
260, 289, 335
D Flow cytometry................................................. 126, 130, 132
Dark gland(s)............................................................ 318, 321 Fold change ......................................................................296
Dark gland development ..................................................318 Foxglove..............................................................................81
Date palm .................................................................357–364 Functional food ................................................................125
Dehydration .........................................36, 55, 209, 210, 336,
G
340–344, 364, 381, 397, 414
Desert plants ....................................................................104 Gallic acid....................................... 4, 8, 9, 14, 18, 19, 26, 27,
6-diamidino-2-phenylindole (DAPI) .................... 69, 76, 77, 67, 70, 71, 128, 134, 137, 235, 238
127, 138 Gas chromatograph .................................................. 279, 285
2,4-dichlorophenoxy acetic acid (2,4-D) ............... 14, 16–19, Gas Chromatography-Flame Ionization Detection
22–24, 26, 28, 29, 59, 126, 128, 129, 144–146, 202, (GC-FID) ....................................................285–286
209, 230, 231, 233, 234, 348, 350, 351, 353, 360–362, Gel electrophoresis .................................... 95, 116, 120–122,
374, 376, 381, 391, 393, 394, 407, 417, 428, 431, 432, 165, 166, 170, 180, 255, 263, 267, 269, 295, 310–311,
440, 448–450, 453 327, 328, 380, 435
Dietary supplement ......................................................2, 125 Gelrite .......................................................83, 88, 91, 97, 126
2,2-diphenyl-1-picrylhydrazyl (DPPH) ...................... 15, 18, Gene sequencing ..............................................................317
19, 24–27, 29, 68, 73, 78, 79, 128, 135, 137, 138, 232, Genetic diversity..................................48, 104, 187, 304, 368
235–236, 239 Genetic stability .......................................114, 126, 154, 155,
Direct organogenesis ........................................................279 168–170, 428, 439
Direct regeneration ...........................................................207 Genetic transformation ...................................... 93, 368, 383
DNA electrophoresis ........................................................157 Germination ..................................... 3, 14, 20, 23–24, 28, 35,
DNA extraction ........................................119–120, 122, 282, 51, 53, 55–57, 62, 88, 97, 98, 113, 177, 204, 233, 304,
293–295, 377–379 318, 321, 348–350, 372, 428, 448, 450, 455
DNA fingerprinting .........................................................303 Germplasm conservation ............................................ 53, 384
DNA isolation ..................................86–87, 94–95, 115, 157, Gibberelic acid (GA3).................................14, 17, 20, 21, 28,
163–164, 179–180, 262–263, 267, 306, 369 289, 338–341, 343
DNeasy plant mini kit ......................................................277 Ginseng .................................................... 125–127, 129–133
Dormancy .........................................................................187 Ginsenosides ............................................ 125–130, 135–138
 PROTOCOLS FOR IN VITRO CULTURES AND SECONDARY METABOLITE...
Index
461
Growth ..................................3, 14, 17, 19, 20, 22, 24, 28, 29, Indole-3-butyric acid (IBA) ...............................4, 6, 7, 9, 14,
33, 41, 50, 54–56, 62, 82, 83, 88, 94, 98, 106, 117, 17, 19–22, 25, 28, 29, 49, 51, 53, 54, 56, 62, 106, 107,
130, 137, 157, 160–162, 167, 168, 177, 179, 181, 184, 109, 110, 114, 116, 117, 119, 122, 126, 128–130, 137,
187, 189, 191, 195–197, 216, 221, 225, 230, 234, 238, 144–146, 202, 203, 206, 207, 264, 272, 277, 279, 281,
243, 247, 251–254, 264–266, 277, 281, 282, 306, 348, 350–354, 389, 405, 428, 431, 440, 442
308, 338, 340, 344, 351, 353, 358, 362–365, 371, 2-isopentenyladenine (2iP) ....................................... 360, 362
373–375, 381–384, 395, 397, 401, 409, 411, 412, Inter Simple Sequence Repeats, Marijuana
428, 431, 433–435, 439–441, 446–447, 450, 452, 453 (ISSR)...................................157, 166, 167, 170, 278,
Gur-mar ...........................................................................229 284, 306, 309, 311, 313, 398–400, 420–422
Gymnemagenin ........................................229, 233, 237, 238,
430, 435–438 J
Gymnemic acid ........................................229, 230, 234, 237, Jute ................................................................... 143, 144, 146
427, 428, 435–437 Juvenile explants ...............................................................307
H K
Hairy root cultures....................................174, 180, 182, 242,
Kinetin...................................... 4, 49, 51, 106, 114, 116, 117,
245, 250, 251, 428, 430, 439
122, 126, 128, 129, 144–146, 230, 231, 342, 343, 383,
Hairy roots ...............................................174, 176, 179–181,
389–391, 395, 405, 407, 412, 425, 428, 431, 441, 448,
184, 247, 252, 253, 428, 434–436, 439
449, 453
Hardening .......................................... 7, 53, 54, 56, 117, 155,
160, 202, 206, 212, 265, 291, 308, 351–353, 360, 364, L
369, 371, 394, 395, 411, 412, 433
Herbal medicine ......................................... 31, 103, 201, 215 Light emitting diode (LED) .................................... 191, 195
High pressure liquid chromatography Lignocellulosic materials .......................................... 143, 148
(HPLC) ................................ 3, 4, 6–9, 15, 34, 39–40, Liquid culture .......................................51, 62, 114, 144, 184,
44, 85, 90, 127, 128, 135–137, 146, 149, 151, 176, 205, 247, 445, 446, 449, 450, 452–454
182–183, 231, 233, 237–239, 246, 252–254, 263, Loofa ................................................................ 143, 144, 146
269–271, 273, 430, 435, 437–439 Low-temperature propagation..........................................187
Histology ..........................................................................212 Luffa cylindrica ..................................................................144
Hordeum vulgare........................................................ 131, 132
Hyperhydricity ........................................... 98, 160, 169, 212 M
Hypericin biosynthesis .....................................................318 Medicinal ............................................. 1, 14, 65, 81, 98, 103,
Hypericins ...................................................31, 32, 39, 40, 44 125, 154, 201, 215, 216, 229, 241, 242, 259, 261, 275,
Hypericum...............................................31–42, 44, 317, 318 276, 289, 293, 303, 335, 388, 404, 427, 445
Hypericum perforatum ............................................ 32, 33, 317 herb ........................................................ 1, 154, 347–354
plant........................................................81, 98, 103, 104,
I 125, 201, 215, 216, 259, 261, 275, 276, 293, 303,
Immobilization ......................................... 141–144, 146–150 317, 427, 445
In vitro ............................................ 3, 6, 8, 14, 17–20, 22–24, Medium ......................................................3, 5, 9, 14–26, 28,
26, 28, 29, 32, 35, 40, 43, 48–50, 52–54, 57, 62, 82, 29, 33–36, 41, 42, 49–59, 62, 68, 73, 82–84, 86, 88,
86, 89, 104, 108–109, 111, 114, 126, 154, 168, 169, 89, 91, 92, 94, 97–100, 106, 108, 110, 111, 114,
174, 184, 202, 203, 205–208, 216, 222, 225, 226, 230, 117–119, 126–130, 137, 138, 144–147, 149, 150,
231, 246, 248, 254, 266, 276, 281, 282, 304, 309, 314, 154, 155, 157–162, 166–169, 174–180, 183, 191,
318, 321, 336, 338, 340, 343, 348, 350, 352, 358, 368, 195, 196, 202–207, 209, 212, 216, 218–221,
369, 371, 374, 376, 377, 384, 389, 393–395, 400, 401, 224–226, 230–234, 238, 242, 243, 246–248, 251,
405, 408, 411–414, 416, 425, 439, 445, 446, 448, 449, 252, 254, 255, 261, 262, 264–266, 271, 272, 277,
452, 456 279, 281, 282, 286, 306–309, 312, 318, 320, 321,
In vitro conservation ............................................ 48, 62, 154, 329, 333, 337–344, 348–351, 353, 354, 358–365,
169, 384 369–377, 380–384, 389–395, 397, 401, 405–409,
In Vitro Genebank .................................................... 161, 169 411, 412, 414, 416–418, 422, 424, 425, 428, 429,
In vivo ..............................................................3, 6, 8, 66, 82, 431–435, 445–456
226, 409 Melt curve ........................................................ 295, 296, 299
Indirect organogenesis ......................................................347 2-C-methyl-D-erythrose-4-phosphate
Indirect regeneration ................................................ 208, 352 (MEP) pathway ....................................................290
 PROTOCOLS FOR IN VITRO CULTURES AND SECONDARY METABOLITE...
462 Index

Methyl jasmonate ............................................. 126, 130, 137 Plant growth regulators ....................................16, 35, 49, 52,
Microflora.........................................................................343 54, 104, 106, 108–109, 168, 203, 237, 306, 343, 351,
Micropropagation ...................................3, 33, 35, 41, 48, 49, 353, 370, 389, 405, 422, 428, 431
51–52, 97, 105, 113–122, 144–146, 187–191, Plant regeneration ..................................48, 53, 62, 104, 109,
193–196, 202, 204–206, 261, 264–265, 276, 279, 111, 348, 350, 358, 374, 383, 393, 394, 409, 410, 424
281, 339, 369–371, 392, 406–408 Plant secondary metabolites ...............................................82
Micro-rhizome production .......................................387–401 Plating efficiency .............................................. 358, 363–365
Mitra’s medium ....................................................................5 Plinia cauliflora .............................................................65–79
Molecular profiling ...................................... 59–61, 368, 369, Ploidy level ....................................................... 32, 39, 43, 44
397–400, 418–422 Polymerase chain reaction (PCR) .......................... 60–62, 87,
MTT assay ............................................................. 74, 75, 79 95–96, 100, 120–122, 157, 170, 176, 180, 184, 242,
Murashige and Skoog (MS) Basal Salts .................... 91, 114, 244–245, 249–251, 255, 256, 263, 267, 268, 272,
117, 277, 306 278, 284, 287, 290, 292–293, 295–300, 306–307,
Murashige and Skoog (MS) medium .................. 49, 50, 104, 309–313, 320, 321, 324–326, 369, 379–380, 399,
114, 115, 117–119, 144, 230, 305, 428 405, 420, 429–430, 433–435
amplifications ............................................................. 309
N Positive pressure culture room .................................. 193, 196
Naphthalene acetic acid (NAA) ...................... 14, 16–18, 22, Potassium permanganate (KMnO4) ......................... 338, 340
23, 28, 49, 52, 59, 62, 106–110, 157, 188, 191, 202, Primary leaves........................................................... 321, 322
203, 206, 216, 218, 221, 225, 226, 264, 306, 308, 309, Propagation ........................................ 3, 14, 48, 89, 104, 111,
338–341, 348, 350–353, 360–362, 365, 376, 381, 113, 114, 154, 159, 168, 169, 187, 202, 203, 216, 276,
389, 391–395, 397, 405, 407–409, 412, 414, 417, 280, 304, 336, 358, 368, 405, 428, 445–447
424, 428, 431, 432, 440, 442 Protocorm like bodies (PLBs) ..........................................2, 6
Naphtodianthrones ......................................31, 32, 40, 43, 44 Protoplast isolation ............................................ 59, 376, 383,
NCBI Genbank ........................................................ 291, 293 414, 417
Nodal segments ....................................49, 51, 108, 117, 204, Purpurin ........................................................... 143, 149, 151
205, 265, 271, 279, 281, 308, 368, 382–383
Q
Non-endospermous seeds .....................................................1
Quality assurance......................................................285–286
O
R
Orchid ........................................................................ 1, 3, 47
Organogenesis ..........................................339, 348, 374, 394, Randomly amplified polymorphic
409, 410, 445, 446 DNA (RAPD) ..................................59, 61, 114, 120,
157, 164–166, 170, 262–263, 267–269, 306, 309,
P 310, 312, 368, 369, 373, 380, 389
Packed cell volume ...........................................................362 Rauwolfia serpentine ................................................241–256
Panax ginseng ................................................... 125, 126, 132 Real Time PCR ............................................... 290, 292, 295,
Passiflora setacea...........................................................13–29 299, 300
Passiflora tenuifila ........................................................13–29 Regeneration ........................................ 36, 41, 42, 53, 58, 86,
Peptone...........................................................................5, 91 91, 94, 99, 110, 111, 154, 202, 203, 218, 226, 276,
Pharmaceutical industry ........................................... 216, 318 304, 351, 352, 358, 374, 377, 418, 427, 428, 431, 453
Phenolic compounds ........................................ 13, 29, 70, 71 Relative gene expression ........................... 291, 292, 299, 300
Phenolics .......................................... 3, 4, 6–9, 14–15, 18, 19, Relative quantification (RQ) plot .....................................300
24–27, 29, 234, 335, 357, 358, 372 Reserpine ...................................241, 242, 245–246, 253, 254
Phenols ............................................................ 128, 130, 134, RNA isolation ...................................293, 319, 322, 429, 435
231, 289 Rol gene .................................................... 184, 245, 251, 255
Pheonixdactylifera ....................................................357–365 Rooting............................................... 4, 6, 17, 19, 28, 29, 35,
p-hydroxybenzoic acid ......................................................4, 8 52, 106, 107, 109, 119, 160, 189, 195, 206, 207, 221,
Phytochemical profile .........................................................32 225, 265, 266, 272, 281, 306, 308, 309, 340, 348, 350,
Phytohormones ........................................................ 277, 304 351, 361, 364, 371, 381, 393, 408, 428, 431, 433, 439,
Plant cell culture ......................................................... 14, 143 442, 446–449, 451, 452
 PROTOCOLS FOR IN VITRO CULTURES AND SECONDARY METABOLITE...
Index
463

S 115, 118, 127–130, 145, 146, 155, 156, 158, 161, 168,
174, 191, 196, 202, 204, 206, 209, 231–234, 246, 251,
Salep .....................................................................................1 261, 264, 279, 304–308, 337, 339, 342, 344, 353, 359,
Saponin .................................................................... 435, 436 361, 364, 370, 371, 373, 376, 377, 381, 382, 384, 389,
Satyrium nepalense.........................................................1–10 390, 393–395, 397, 405, 409, 412, 414, 417, 425, 431,
Scopolamine ..................................................... 173, 176, 183 448, 450
Scratch assay .......................................................................76 Suppression Subtractive Hybridization ....................317–334
Secondary metabolites ..................................3, 31, 44, 65, 98, Suspension culture ..............................82, 126, 129, 143, 147,
138, 142, 143, 174, 201–202, 242, 289, 290, 335, 428 148, 150, 230, 234, 247, 358, 361, 363, 364, 374, 383,
production ............................................98, 141, 143, 154, 414, 416, 454
168, 174, 202, 428 SYBR Green chemistry ....................................................292
Shoot culture ........................................14, 16–18, 21, 22, 24, Synthetic seeds ..................................50, 53, 55, 62, 375, 412
28, 52, 54, 62, 82, 99, 161, 162, 221, 226, 244, 246, Syringic acid ................................................................. 4, 8, 9
254, 271, 308, 340, 395, 412, 456
Shoot development .......................................................6, 106 T
Shoot multiplication .................................21, 52, 89, 97, 106,
Temporary immersion system..................82, 84, 89, 446–447
109, 111, 118, 159, 160, 162, 221, 279, 339–341, 343,
Terpene indole alkaloids ......................................................241
381, 448, 449, 451
Thidiazuron (TDZ) .................................202, 203, 205, 277,
Shoot tip ...............................................17, 19–25, 28, 29, 32,
279, 281, 358, 373, 374
35–37, 40–42, 45, 49–51, 144, 147, 161, 162, 168,
Thin layer chromatography (TLC) ..................................263
218, 219, 265, 266, 271, 340, 358, 360, 361, 371, 381,
Threatened ................................................... 1, 104, 154, 336
382, 390, 395, 401, 456
Total flavonoids .......................................................... 72, 134
Soil-moisture sensor .........................................................198
Totipotent.........................................................................343
Soilrite ...................................................................... 306, 308
Transplantation.................................................................226
Solanaceae ........................................................ 174, 201, 303
Tri-scale initiation ............................................................189
Somaclones .......................................................................389
Tris–saturated phenol .......................................................418
Somatic embryo........................................154, 202, 209, 210,
Tropane alkaloids......................................173, 174, 181, 182,
358, 361–364, 368, 372–374, 383, 394, 409, 412,
185, 202
445, 446, 448, 453, 455, 456
True-to-type ..................................................... 113–122, 358
Somatic embryogenesis ................................... 154, 202, 210,
Turmeric ...................................................388, 389, 392, 393,
358, 361–364, 368, 372–374, 445, 446, 453, 456
395–397, 399–401, 408, 414
Southern ........................................................... 66, 87, 95–97
Sponge ...................................................................... 143, 146 U
Steroidal lactones..............................................................260
Stevia ......................................... 113, 114, 289, 291, 293, 298 Ultra high performance liquid chromatography (U-HPLC)
Stevia rebaudian ................................................................289 Up-scaling ................................................................ 242, 255
Steviol glycosides ...................................................... 289, 296
Stevioside ................................................. 113, 289, 290, 298
V
Stirred tank bioreactor .............................. 174, 176, 182, 185 virD .................................................................. 176, 180, 184
Stolon ....................................................................... 215, 216 Vitrification ................................................36, 212, 381, 382,
Stratification .....................................................................304 397, 414, 415
Subculture..................................... 28, 37, 53, 54, 86, 94, 106,
107, 111, 147, 150, 160, 162, 168, 169, 195, 212, 220, W
372, 395, 412, 424, 454
Withaferin A ............................................................ 202, 271
Sucrose ................................... 4, 5, 14, 16–26, 28, 29, 33–36,
Withania coagulans ....................................................259–273
42, 49, 51, 54–56, 59, 62, 83, 88, 91, 104, 106, 113,
Withanolides .............................202, 260, 263, 269–271, 304