0% found this document useful (0 votes)
15 views5 pages

DNA Markers Reveal Rice Varietal Differences

The study evaluates ten rice genotypes cultivated under aerobic conditions using RAPD and SSR markers to assess seed quality attributes and genetic differences. BI 43 exhibited the highest germination and seedling vigor, while genotypes IRRI 14, IRRI 23, and IRRI 49 showed significant dormancy and low germination rates. The results indicate that molecular markers are effective for identifying varietal differences in rice, with specific primers revealing polymorphisms related to seed dormancy and germination rates.
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
15 views5 pages

DNA Markers Reveal Rice Varietal Differences

The study evaluates ten rice genotypes cultivated under aerobic conditions using RAPD and SSR markers to assess seed quality attributes and genetic differences. BI 43 exhibited the highest germination and seedling vigor, while genotypes IRRI 14, IRRI 23, and IRRI 49 showed significant dormancy and low germination rates. The results indicate that molecular markers are effective for identifying varietal differences in rice, with specific primers revealing polymorphisms related to seed dormancy and germination rates.
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Research Journal of Agricultural Sciences 2011, 2(3): 450-454

Efficiency of DNA Markers in Revealing Varietal Differences in Rice


(Oryza sativa) Cultivated under Aerobic Conditions
B V Pavithravani, Rame Gowda, C K Pramila, *K Aparna, *Vinodhini and **H E Shashidhar
Department of Seed Science & Technology, *Department of Genetics & Plant Breeding,
**Department of Plant Biotechnology,
University of Agricultural Sciences, Bangalore (GKVK) – 560 065, Karnataka, India
e-mail: pavisst@[Link]

ABSTRACT
Ten genotypes of rice cultivated under aerobic conditions were evaluated for important seed quality
attributes and genotypic differences were estimated using RAPD and SSR primers. Among the genotypes
BI 43 recorded higher germination and seedling vigour index (98.7% and 3183, respectively). Dormancy
was also noticed in IRRI 49, IRRI 14 and IRRI 23. Among 33 distinct bands generated using RAPD primers,
16 (49.82%) were polymorphic and 17 were monomorphic bands. However, highest number of
polymorphic bands and monomorphic bands was amplified by OPA 08 and OPAE 14, respectively. Among
four SSR primers, seed dormancy specific primer RM 7 and RM 254 primer specific for germination rate
showed distinct upper bands in IRRI 14, IRRI 23 and IRRI 49. Similarly, germination differences were also
noticed in the standard germination test conducted among genotypes. While RM 26 and RM 232 showed
monomorphism for shoot-root dry weight and total reducing sugar, respectively that is attributed to seed
quality.

Key words: SSR, RAPD, Seed quality, Seed germination, Aerobic rice

Rice (Oryza sativa L.) plant is a member of the markers. Rice has a large collection of SSR markers
grass family, gramineae, belongs to the genus oryza, extensively produced by SSR libraries that could be
which originated 130 million years ago. Transplanting used for characterization of seed quality and crop
has been a major traditional method of rice improvement (Fakuoka et al. 1992, Mane et al. 2003).
establishment in Asia. Flooded rice fields, with their Therefore, in the present study, molecular markers were
abundant organic matter, warm temperatures and used for fingerprinting of the selected rice genotypes
anaerobic conditions, provide an ideal environment for well suitable for cultivation under aerobic condition for
methanogenic activity and release of methane gas (IPPC identifying the varietal differences with respect to seed
1996) one of the main sources of green house gases. quality parameters.
Hence, aerobic rice has been identified as a potential
new technology, an attractive alternative to traditional MATERIALS AND METHODS
transplanting rice to save precious water and is In the present study, the freshly harvested seeds of
considered to be eco-friendly. A superior quality seed rice genotypes were dried to the safe moisture levels
not only increases productivity per unit area, but it also and physiological seed quality attributes viz 100 seed
helps to produce uniform crops. High-quality produce weight (g), germination (%) using between paper
results in high milling recovery and better quality rice, method as per ISTA (1995), seedling vigour index
which translates into increased profits, besides food based on mean seedling length (Abdul-Baki and
value. As a routine practice, seed quality is usually Anderson 1973) at final count and the biochemical seed
measured in terms of purity and germinability which are quality parameters like electrical conductivity of seed
very important for obtaining high prices in the market. leachate as per ISTA (1995) total soluble sugars were
Thanks to knowledge of molecular markers by which determined as per the standard protocols.
estimates of genetic diversity of seeds stored in gene The healthy seedlings of fifteen days old were used
banks more efficiently than with phenotypical analysis for DNA extraction as per the modified CTAB (Cetyl
alone. The increased availability of highly polymorphic Trimethyl Ammonium Bromide) method (Cao and Oard
genetic markers provide high-power for resolving the 1997). The DNA was treated with 2µl of RNase A
true biological relationship between individuals. Micro (5µg/ml), proteinase K (50µg/ml) and incubated at
satellite markers also known as ‘Simple Sequence 37°C for 20 minutes to remove RNA and proteins,
Repeats’ (SSR) are potentially used to infer the genetic which is essential to obtain stable and reproducible
variability in comparison to other classes of molecular amplification in PCR reactions. Extracted genomic

450 [Link]
Pavithravani et al.

DNA was loaded on a one per cent Agarose gel in 1X concentration of the sample was estimated by visual
TBE buffer containing Ethidium bromide (5µg/ml) comparison of the band with known dilutions of
along with known dilutions of Lambda uncut DNA bacteriophage DNA.
(50ng, 100ng, 200ng, 500ng etc). The DNA
Table 1 Primer sequences used for the study
RAPD Primers Nucleotide sequence (5’ to 3’)
1 OPA 08 GTGACGTAGG
2 OPA 11 CAATCGCCGT
3 OPA 17 GACCGCTTGT
4 OPAE14 GAGAGGCTCC
SSR Primers Forward primer Reverse primer
5 RM7 TTCGCCATGAAGTCTCTCG CCTCCCATCATTTCGTTGTT
6 RM26 GAGTCGACGAGCGGCAGA CTGCGAGCGACGGTAACA
7 RM 232 CCGGTATCCTTCGATATTGC CCGACTTTCCTCCTGACG
8 RM 254 AGCCCCGAATAAATCCACCT CTGGAGGAGCATTTGGTAGC

Four RAPD and trait specific SSR primers (Table respectively. However, BI 43 exhibited highest
1) were used in the present study. The 10 µl of PCR germination (98.7%) and SVI (3183). Freshly harvested
reaction mixture includes, DNA (2.0µl), Assay buffer seeds showed considerably lower germination per cent
(10x) [1.0µl], 2.5 mM dNTP (2 µl), 30pM primer probably due to presence of post harvest dormancy as
(1.0µl), Taq polymerase (0.2µl), water (3.8µl) and a reported by Roberts (1963). Maurya and Vaish (1984),
drop of mineral oil for RAPD analysis and the reaction Swaranna et al. (2001) also reported that rice strains
mixture for SSR is similar to RAPD except 30pM possessed dormancy for considerable time and it ranged
primer (forward primer-1.0µl and reverse primer 1.0µl) from one to four weeks. Similarly, Hartmann et al.
and water 2.8 µl was added. The RAPD PCR program (1997) revealed that cereal grains that have low
consist of an Initial denaturation at 94C for 4 minutes, germination are caused by post harvest dormancy.
followed by 30 cycles of denaturation at 94C for 1min, Genotype IRRI 14 (4.6%) and BI 43 (6.82) produced
primer annealing at 36C for 1 minute, primer extension under aerobic condition recorded significantly lower
at 72C for 1 minute and final extension at 72C for 7 TSS. This may be due to higher conversion of soluble
minutes. The SSR PCR program consist of an Initial sugars to starch, which is translocated along the phloem
denaturation at 94C for 5 minutes, followed by 30 and thus accumulating in the starch form. These results
Tree Diagram for 10 Variables

cycles of denaturation at 94C for 2 minutes, primer are in conformity with the Singlefindings
Linkage of Chaturvedi et al.
(1993). Euclidean distances
annealing at 55C for 2 minutes, primer extension at
72C for 2 minutes and final extension at 72C for 7 BI 27
minutes. The amplified products were separated on BI 33
Agarose gel (1.5% for RAPD and 3% for SSR) stained BI 34-1

with Ethidium bromide and viewed under UV light and BI 43

documented using the gel-documentation system. The IRRI 259

bands generated by random primers (RAPD) were IRRI 49

scored by binary coding ‘0’ and ‘1’ for absence and IRRI14

presence of band, respectively at each level while, the IRRI 292

IRRI 23
bands generated by SSR primers were scored by giving
code ‘1’ and ‘3’ for lower and
Rasi
upper band,
respectively. Analysis of DNA banding pattern was 2 2.2 2.4 2.6 2.8 3 3.2 3.4 3.6 3.8

done using ‘STATISTICA’ software, the dendrogram Fig 1 Dendogram of riceLinkage Distance
genotypes indicating their linkage
was constructed using cluster analysis and the distance distance
was computed using Euclidean distance.
Further, DNA fingerprinting for 10 rice genotypes
RESULTS AND DISCUSSION was done using four RAPDs and four SSR primers.
The seed quality attributes of the rice cultivated RAPD primers generated 33 distinct bands out of which
under aerobic conditions is presented in the table 2. 16 (49.82%) were polymorphic and 17 were
Among the genotypes IRRI 292 has recorded highest monomorphic bands (Plate 1). The primer OPAE14
(2.34g) 100 seed weight while BI 27 contained poorly generated the highest number of bands (10) whereas
filled seeds recording lowest (2.00g). IRRI 49 (4.70% least number of bands (8) was generated by the RAPD
and 252) and IRRI 14 (10% and 195) recorded very low primer OPA08. However, the RAPD primer OPA08
germination per cent and seedling vigour index (SVI), showed highest number of polymorphic bands and
highest monomorphic bands were noticed in OPAE14

451 [Link]
DNA Markers in Revealing Varietal Differences in Rice

Plate 1 RAPD banding profile of ten rice genotypes

Plate 2 SSR banding profile of ten rice genotypes

1. BI 27 2. BI 33 3. BI 34-1 4. BI 43 5. IRRI 14 6. IRRI 23 7. IRRI 49 8. IRRI 259 9. IRRI 292 10. RASI

452 [Link]
Pavithravani et al.

profile. IRRI 23 and Rasi showed single specific bands with other genotypes for some characters like plant
for OPA08, which were absent in rest of the genotypes. height, vigour, specific gravity and electrical
BI 27, BI 33 and IRRI 49 showed specific bands conductivity. Primer OPA17 showed absence of bands
whereas, IRRI 14, IRRI 23, IRRI 49 showed absence of at two regions in IRRI 14 as it differed significantly
bands between 200-500 base pairs for OPA11, which from other genotypes possessing high seed yield, more
was present in rest of the genotypes. Primer OPA17 number of productive tillers (data not shown), high seed
showed absence of bands at two molecular levels for weight, less dormancy, low vigour and low soluble
IRRI14. Bands were absent at one molecular level in BI sugars. Fukuoka et al. (1992) has revealed that RAPDs
27, BI 33, IRRI 14, IRRI 259, IRRI 292 and Rasi. More are useful in determining polymorphism in rice. RAPD
monomorphic bands were observed in OPAE-14 except primers very successfully employed in identifying the
at certain levels in which bands were absent in BI 33, duplicate accessions within the rice germplasm (Virk et
IRRI 259 and IRRI 292. The primer OPA08 can be used al. 1995). Yu and Nguyen (1994), Cho et al. (1995),
for identifying the genotypes based on the presence and Farooq et al. (1995) characterized the rice cultivars
absence of bands at particular level. A significant band using RAPD primers.
shown in IRRI 292 reveals that it differed significantly

Table 2 Seed quality attributes of 10 genotypes of rice cultivated under aerobic condition
100 Seed weight Germination Seedling Vigour EC (dSm-1) Total soluble
Genotypes
(g) (%) Index sugars (%)
BI 27 2.00 86.0 2576 93.03 10.26
BI 33 2.17 88.9 2862 62.13 7.00
BI 34-1 2.04 83.6 2700 83.15 8.74
BI 43 2.23 98.7 3183 88.45 10.06
IRRI 14 2.33 10.0 252 86.60 4.60
IRRI 23 2.21 64.3 1504 80.03 9.97
IRRI 49 2.20 4.70 195 92.34 9.53
IRRI 259 2.07 93.7 2904 108.77 10.91
IRRI 292 2.34 85.7 3015 115.23 11.54
RASI 2.08 81.0 2465 76.27 10.54
Mean 2.17 69.7 2166 88.60 9.32
S. Em ± 0.01 1.83 41.81 0.77 0.32
CD (0.05P) 0.02 5.24 119.50 2.20 0.905
CV (%) 0.99 6.70 3.99 2.27 8.38

Among four trait specific SSR primers used, RM7 The dendrogram was constructed by using marker
and RM254 showed polymorphism for seed dormancy profile obtained from four RAPD and SSR markers (Fig
and germination rate, respectively (Plate 2). The seed 1). Based on the cluster analysis genotypes were
dormancy specific SSR primer RM 7 showed upper grouped into two main clusters at 3.8 per cent
band in IRRI 14, IRRI 23 and IRRI 49. However, lab dissimilarity level. The genotype Rasi was grouped in
results indicated that these genotypes possessed high one cluster and remaining nine genotypes were grouped
dormancy, low germination and vigour. Similarly, RM in another cluster which revealed that the genotype Rasi
254 primer for germination rate also showed upper was distinct and diverse from the rest of the genotypes,
bands in IRRI 14, IRRI 23 and IRRI 49 indicating as it is an indigenous variety. Second cluster is further
variation in the performance of these genotypes for divided into two sub clusters at 3.6 per cent
germination rate. Among the cultivars IRRI 14, IRRI 23 dissimilarity. Sub cluster one is again grouped into two
and IRRI 49 possessed polymorphism at higher clusters at 3.5 per cent dissimilarity, having IRRI 23 in
molecular weight (170-190 bps) compared to other one group and other group containing IRRI 14 and IRRI
genotypes in RM7 and RM254, whereas, RM26 and 292. The two genotypes IRRI 14 and IRRI 292 are
RM232 showed monomorphism for shoot-root dry separated by 3.17 per cent dissimilarity. Sub cluster two
weight and total reducing sugar, respectively. In is further divided into two groups at 3.5 per cent
contrast Xing et al. (2002) have reported that RM212 dissimilarity having BI-27 at one end and IRRI 49 at the
was linked to biomass and root dry weight in other end possessing 96.5 per cent similarity between
Zh97/Ming63 RI lines. Further, Kanagaraj et al. (2010) them. Later, group one is divided into 2 subgroups at
have identified the microsatellites linked to drought 3.75 per cent dissimilarity. In subgroup two, BI 33 and
resistance in rice which may be useful in marker BI 34-1 are closely related, possessing 97.75 per cent
assisted breeding for selection of varieties that can be similarity and that group is similar to BI 43 with 97.37
grown under aerobic condition. per cent. Among IRRI lines, IRRI 14, IRRI 292 and

453 [Link]
DNA Markers in Revealing Varietal Differences in Rice

IRRI 23 were closely related and IRRI 259 was more method of cultivation with protective irrigation like any
associated to BI lines except BI 27. All ‘BI’ lines were other cereal crops. However, some genotypes produced
grouped into single cluster as they are derived from under aerobic and puddle conditions exhibited
cross between Budha and IR 64. dormancy. Further, RAPD primer OPA08 can be used
Based on the experimental findings it may be to reveal the varietal differences while SSR primers,
accomplished that the quality of seeds produced under RM07 and RM254 may be employed as markers to
aerobic condition was also superior, which indicated the discriminate the genotypes based on the dormancy and
possibility of seed production even under aerobic germination rate.

LITERATURE CITED
Abdul-Baki A A and Anderson J D. 1973. Vigour determination in soybean seeds by multiple criteria. Crop Science
13: 630-633.
Cao D and Oard J H. 1997. Pedigree and RAPD based DNA analysis of commercial U.S rice cultivars. Crop Science
37: 1630-1635.
Chaturvedi G S, Misra C H, Singh O N, Pandey C B, Yadav V P, Singh A K, Dwivedi J L, Singh B B and Singh R
K. 1993. Physiological basis and screening for tolerance for flash flooding. pp78-97.
Cho Y C, Chung T Y, Park Y H and Suh H S. 1995. Genetic polymorphism and phylogenetic relationships of
Korean rice (weedy rice in Oryza sativa L.) based on randomly amplified polymorphic DNA (RAPD)
markers. Korean Journal of Breeding 27(1): 86-93.
Fakuoka S, Hosaka K and Kamijima O. 1992. Use of random amplified polymorphic DNAs (RAPDs) for
identification of rice accessions. Japanese Journal of Geneics 67(3): 243-252.
Farooq S, Shah T M, Arif M and Iqbal N. 1995. Utilization of RAPD markers for the identification of cultivated and
wild rice species. Pakistan Journal of Botany 27(1): 127-138.
Hartmann H T, Kester D E, Davies F T and Geneve R L. 1997. Plant propagation: Principles and practices. 6th ed.
Prentice Hall, Englewood Cliffs, [Link]- Intergovernmental Panel on Climate Change, 1996. The science
of climate change. Cambridge (UK), Cambridge University Press, pp572.
IPPC. 1996. Intergovernmental Panel on Climate change, the science of climate change. In: Cambridge. Cambridge
University press, UK, pp572.
ISTA. 1995. Hand book of Vigour Test Methods, Zurich, pp117.
Kanagaraj P, Silvas J K, Annie S J, Biji K R, Sheetal B P, Senthil A and Chandra B R. 2010. Microsatellite markers
linked to drought resistance in rice (Oryza sativa L.). Current Science 98(6): 836-839.
Mane S P, Shashidhar H E, Adnan K and Shailaja H. 2003. Molecular marker analysis for root length in a diverse
germplasm of rice. Indian Journal of Genetics 63(3): 197-201.
Maurya D M and Vaish C P. 1984. Seed dormancy in upland rainfed rice. Seed Research 12(2): 38-43.
Roberts E H. 1963. An investigation of intervarietal dafference in dormancy and viability of rice seed. Annals of
Botany 27: 365-368.
Swaranna. 2001. Studies on seed storability in relation to seed vigour and viability in hybrid rice (KRH-2) and its
parental lines. M. Sc., Thesis, University of Agricultural Sciences, Bangalore.
Virk P S, Newbury H J, Jackson M T and Ford-Lloyd B V. 1995. The identification of duplicate accessions within
rice germplasm collection using RAPD analysis. Theory of Applied Genetics 90: 1049-1055.
Xing Z, Tan F, Hua P, Sun L, Xu G and Zhang Q. 2002. Characterization of the main effects, epistatic effects and
their environ-mental interactions of QTLs on the genetic basis of yield traits in rice. Theory of Applied
Genetics 105: 248-257.
Yu L X and Nguyen H T. 1994. Genetic variation detected with RAPD markers among upland and low land rice
cultivars (Oryza sativa L.). Theory of Applied Genetics 87: 668-672.

454 [Link]

You might also like