Scribd
Upload
7 views2 pages

Types of Genetic Mutations Explained

The document outlines various types of mutations, including deletion, insertion, and substitution, and their classifications such as frameshift, missense, silent, and nonsense mutations. It provides examples of mutated DNA sequences and prompts for analysis of their corresponding mRNA and amino acid sequences, as well as the potential effects of these mutations. Additionally, it discusses sickle cell anemia as a specific mutation affecting hemoglobin, leading to serious health complications.

Uploaded by

harleelcox
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
7 views2 pages

Types of Genetic Mutations Explained

The document outlines various types of mutations, including deletion, insertion, and substitution, and their classifications such as frameshift, missense, silent, and nonsense mutations. It provides examples of mutated DNA sequences and prompts for analysis of their corresponding mRNA and amino acid sequences, as well as the potential effects of these mutations. Additionally, it discusses sickle cell anemia as a specific mutation affecting hemoglobin, leading to serious health complications.

Uploaded by

harleelcox
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Mutations Activity Name

There are several types of mutation:


DELETION (a base is lost)
INSERTION (an extra base is inserted)
Deletion and insertion may cause what’s called a FRAMESHIFT, meaning the reading “frame”
changes, changing the amino acid sequence.
SUBSTITUTION (one base is substituted for another)
If a substitution changes the amino acid, it’s called a MISSENSE mutation.
If a substitution does not change the amino acid, it’s called a SILENT mutation.
If a substitution changes the amino acid to a “stop,” it’s called a NONSENSE mutation.

Complete the boxes below. Classify each as Deletion, Insertion, or Substitution AND as either
frameshift, missense, silent or nonsense (hint: deletion or insertion will always be frameshift).

Original DNA Sequence: T A C A C C T T G G C G A C G A C T


mRNA Sequence:
Amino Acid Sequence:

Mutated DNA Sequence #1: T A C A T C T T G G C G A C G A C T


What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What kind of mutation is this?

Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T


What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What kind of mutation is this?

Mutated DNA Sequence #3: T A C A C C T T A G C G A C G A C T


What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What kind of mutation is this?

Mutated DNA Sequence #4: T A C A C C T T G G C G A C T A C T


What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What kind of mutation is this?
Original DNA Sequence: T A C A C C T T G G C G A C G A C T
mRNA Sequence:
Amino Acid Sequence:

Mutated DNA Sequence #5: T A C A C C T T G G G A C G A C T


What will be the corresponding mRNA sequence?
What will be the amino acid sequence?
Will there likely be effects? What kind of mutation is this?

1. Which type of mutation is responsible for new variations of a trait?


2. Which type of mutation results in abnormal amino acid sequence?
3. Which type of mutation stops the translation of the mRNA? ______________________________________________

Sickle Cell Anemia

Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule. Recall that
hemoglobin carries oxygen in your red bloods cells. The mutation causes the red blood cells to become stiff and sickle-shaped when
they release their oxygen. The sickled cells tend to get stuck in blood vessels, causing pain and increased risk of stroke, blindness,
damage to the heart and lungs, and other conditions.

Analyze the DNA strands below to determine what amino acid is changed and what type of mutation occurred.

Normal hemoglobin DNA CACGTGGACTGAGGACTCCTC

Normal hemoglobin mRNA

Normal hemoglobin AA sequence

--------------------------------------------------------------------------------------------------------------------------------

Sickle cell hemoglobin DNA CACGTGGACTGAGGACACCTC

Sickle cell hemoglobin mRNA

Sickle cell hemoglobin

4. What type of mutation is this? Please explain why.

You might also like