0% found this document useful (0 votes)
15 views8 pages

DNA Profiling with STR Analysis

The document provides an overview of DNA profiling using short tandem repeats (STRs) for identification purposes, including forensic applications and paternity testing. It explains the basics of STRs, their inheritance, and the process of DNA profiling, including extraction, amplification, and analysis through capillary electrophoresis. The document also includes a practical activity for building a DNA profile to solve a crime, emphasizing the uniqueness of individual DNA profiles and the low probability of random matches.

Uploaded by

ohemma asibey
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
15 views8 pages

DNA Profiling with STR Analysis

The document provides an overview of DNA profiling using short tandem repeats (STRs) for identification purposes, including forensic applications and paternity testing. It explains the basics of STRs, their inheritance, and the process of DNA profiling, including extraction, amplification, and analysis through capillary electrophoresis. The document also includes a practical activity for building a DNA profile to solve a crime, emphasizing the uniqueness of individual DNA profiles and the low probability of random matches.

Uploaded by

ohemma asibey
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

LESSON

DNA Profiling Using STRs

DNA PROFILING USING STRs


INTRODUCTION
Most individuals of the same species, whether African elephants, portobello mushrooms, white oak trees, or
humans, have nearly identical DNA. But the DNA sequence at certain locations, or loci, throughout the genome
varies among individuals. These variations can be used to distinguish one individual from another of the same
species. The process of analyzing these DNA variations for the purpose of identification is known as DNA profiling,
or genetic fingerprinting.
DNA profiling techniques have been used for a variety of reasons, including forensic science (matching a suspect’s
or victim’s DNA with samples found at the scene of a crime or catastrophe), paternity testing, historical
investigations, missing-person investigations, identifying victims of accidents and disasters, and cataloging
convicted offenders in a database. In this activity, you will learn about DNA profiling and how to apply it to solve
different cases. Think what you learn in the classroom has no practical use? Think again.
PART 1: DNA PROFILING BASICS
While most of the genome is identical among individuals of the same species, differences do exist. DNA profiling
takes advantage of these differences. Variations occur throughout the genome, and in particular, in regions of
noncoding DNA, which is DNA that is not transcribed and translated into a protein. Variations in noncoding
regions are less likely to affect an individual’s phenotype, and therefore changes in these regions are less likely to
be eliminated by natural selection.
DNA profiling uses a category of DNA variations called short tandem repeats. STRs are comprised of units of
bases, typically two to five bases long, that repeat multiple times. The repeat units are found at different
locations, or loci, throughout the genome.
Every STR has multiple alleles, or variants, each defined by the number of repeat units present or by the length of
the sequence. They are surrounded by nonvariable segments of DNA known as flanking regions.
For example, the STR allele in Figure 1 could be designated as “6” because the repeat unit (GATA) repeats six
times, or as 70 bp (where bp stands for base pairs) because it is 70 bp in length, including the flanking regions. A
different allele of this same STR would have a different number of GATA repeat units but the same flanking
regions.
Flanking regions are important because knowing their sequences enables geneticists to isolate the STR using
polymerase chain reaction, or PCR, amplification.

Figure 1. Each one of the rectangles above represents a repeat unit. In this example, the STR is comprised of six repeats of the
four-base unit GATA. On either side of the STR is a flanking region of DNA. If you were to write out the STR sequence in Figure
1, it would be GATAGATAGATAGATAGATAGATA. For STRs with many repeat units, writing out the sequence can get very
unwieldy, so geneticists use shorthand. The repeat unit is placed in brackets with a subscript indicating the number of times it
repeats. The shorthand for the STR in the example above would be [GATA]6.

Page 1 of 8
LESSON
DNA Profiling Using STRs

1. Identify the flanking sequences and the number of repeat units [GAAT] in the following STR, known as
TPOX, on human chromosome 2:
CCACACAGGTAATGAATGAATGAATGAATGAATGCCTAAGTGCC

a. partial flanking sequences: ____________________ and _____________________


b. number of repeat units: ___________
2. Write out the STR shown above using genetic shorthand. _________________
STRs are inherited just like any gene or segment of DNA. Every individual has two alleles per STR, one inherited
from each parent. However, many different alleles are often present within a population. If the inherited alleles
for a given STR in an individual are identical (i.e., contain the same number of repeat units), the individual is
homozygous for that STR. If the individual has inherited two different alleles for a given STR, then he or she is
heterozygous for that STR. Figure 2 shows a simple model of STR inheritance.

Figure 2. Model of inheritance for a single STR. The numbers refer to the allele
number. Here, the mother is homozygous for an allele with 10 repeat units. The
father is heterozygous at this STR locus, with one allele having 12 repeats and the
other having 14. Their daughter is heterozygous, having inherited allele 10 from her
mother and allele 12 from her father.

3. Is there any way that the daughter in Figure 2 could have been homozygous for the STR shown? Explain
your answer.

4. Using the diagram on the right, identify all of the possible STR allele
combinations that the son could have inherited at this particular locus.
______________________________________

Page 2 of 8
LESSON
DNA Profiling Using STRs

PART 2: HOW DNA PROFILING IS DONE


So how do scientists analyze DNA to determine an individual’s STR alleles?
First, DNA is extracted and isolated from the other materials in an individual’s cells. Once extracted, the target
STRs are amplified by PCR. Different STRs are tagged using a different fluorescent marker so that they can easily
be detected and differentiated. For efficiency, many STRs are analyzed at once during genetic profiling.
You may be familiar with gel electrophoresis as a technique for separating DNA fragments by size. Researchers
analyzing many fragments from many samples use a variation of the technique called capillary electrophoresis,
which is faster and more easily automated.
Figure 3 shows a model of capillary electrophoresis. As DNA samples go through the system, the results appear as
an electropherogram, or a graph showing the quantity of light at specific wavelengths detected over time. DNA
fragments appear as different-colored peaks that can easily be compared across samples and to the DNA ladder.

Figure 3. A simplified schematic of how an electropherogram for a single STR is generated. In this example, the individual has
one allele with five repeats and another with 11 repeats. During PCR, the DNA fragments are amplified and a fluorescent tag
is applied. After PCR, the DNA samples are run through ultrathin capillary tubes filled with a polymer. An electrical field is
then applied, causing the negatively charged DNA fragments to move toward a positively charged electrode, with larger DNA
fragments moving more slowly than smaller fragments. As the sample is drawn through the capillary tube, a laser excites the
tags and the emitted fluorescence is measured by an electronic camera (the “detector”). Fragments of the same length pass
the detector at the same time. Running fragments of known DNA sizes (known as a DNA ladder or DNA standards) through
the system allows scientists to determine the sizes of alleles in the DNA samples. The alleles are shown in the
electropherogram as labeled peaks. This technique also allows scientists to construct a graph that relates fragment sizes
(measured as number of base pairs) versus time. Computer software uses data from the detector to determine the sizes of
alleles in the DNA samples, in this example 55 bp (allele 5) and 79 bp (allele 11).

Page 3 of 8
LESSON
DNA Profiling Using STRs

Figure 4. An electropherogram from an individual, showing the alleles at four STR loci: D8S1179, D21S11, D7S820, and
CSF1PO. Each locus shows the alleles below it as peaks in the electropherogram. The number of repeats for each allele is
indicated.

5. Examine the electropherogram in Figure 4. Describe how you determine whether an individual is
heterozygous or homozygous for a particular STR.

6. List the STR locus or loci at which this individual is homozygous. _______________________
7. Which locus has the longest DNA fragments? _____________________ How do you know?

Different individuals have unique sets, or profiles, of STR alleles. For many forensic analyses, researchers use a
core set of 13 STR loci established in 1996 by the FBI Laboratory. They are CSF1PO, FGA, TH01, TPOX, VWA,
D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, and D21S11. In addition, a gene marker called
AMEL is used to determine an individual’s chromosomal sex and is analyzed along with the 13 STR loci as part of
that individual’s genetic fingerprint.
When all 13 loci are analyzed, the chance of two people (with the exception of identical twins) having the same
exact set of alleles for each of these 13 STRs is extremely low —some put it in the neighborhood of 1 in
10,000,000,000,000. In other words, the chance of a random perfect match at all 13 loci is about one in 10 trillion.

PART 3: BUILD A DNA PROFILE AND SOLVE A CRIME


Today’s technology has made it easier to quickly and accurately generate DNA profiles. In this part of the activity,
you will model the process yourself to solve a crime. Good luck, detective!

Crime Report: A thief has stolen a priceless collection of jewels from the Museum of Precious Jewels. Forensic
technicians obtained skin cells from a forehead print left on the glass enclosure of the jewel exhibit. DNA has been
isolated and PCR amplified for some of the standard STR loci. A partial genetic profile generated from the
collected DNA is shown in Figure 5.

Page 4 of 8
LESSON
DNA Profiling Using STRs

Figure 5. The DNA profile of the forehead print from the scene of the crime. Each colored line shows the alleles for one of
four of the core CODIS STR loci (D5S818, CSF1PO, D7S820, D8S1179).
A suspect was identified in the case. Her DNA was collected, and data for the four STR loci that were included in
the analysis of the forehead print were obtained. The suspect’s profile data is shown on the next page.
Your task: Compare the suspect’s data below to the electropherogram in Figure 5. Analyze each STR locus by
locating the repeats for each locus and counting the number of repeats and indicate whether the suspect is
homozygous or heterozygous at each locus. Record your answers on the next page.
SUSPECT’S DNA PROFILE DATA
D5S818
allele 1: 5'–CAATCATAGCCACAAGATAGATAGATAGATAGATAGATAGATACCAAAGAG–3'
allele 2: 5'–CAATCATAGCCACAAGATAGATAGATAGATAGATAGATAGATAGATACCAAAGAG–3'
CSF1PO
allele 1: 5'–GGCCATCTTCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGCTAGTCC–3'
allele 2: 5'–GGCCATCTTCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGCTAGTCC–3'
D7S820
allele 1: 5'–CCTCATTGACGATAGATAGATAGATAGATAGATACATAGTCAG–3'
allele 2: 5'–CCTCATTGACGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACATAGTCAG–3 '
D8S1179
allele 1: 5'–GTTCATTTTCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTACGAATGTACA–3'
allele 2: 5'–GTTCATTTTCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTACGAATGTACA–3'

Page 5 of 8
LESSON
DNA Profiling Using STRs

Locus Repeat unit # of repeats # of repeats Homozygous or Heterozygous


Allele 1 Allele 2
STR D5S818 on
Chromosome 5 AGAT
STR CSF1PO on
Chromosome 5 TAGA
STR D7S820 on
Chromosome 7 GATA
STR D8S1179 on
Chromosome 8 TCTA
Now, use the data to fill in the suspect’s electropherogram and answer the analysis questions.

Analysis Questions:
1. Compare your DNA profile to the one generated by the suspect’s DNA. Do they match?

2. Make a claim about this suspect’s guilt or innocence based on this evidence. How confident are you that
your claim is correct?

Page 6 of 8
LESSON
DNA Profiling Using STRs

EXTENSION ACTIVITY
Allele frequencies tell you how common a given allele is in a population. An allele frequency of 0.03 means that
3% of the population can be expected to have that particular allele. The frequency in the U.S. population of each
STR allele from the suspect’s profile has been provided in the table below.
STR allele from suspect’s DNA Frequency in the U.S.
profile population
D5S818 allele 1 0.0106
D5S818 allele 2 0.0198
CSF1PO allele 1 0.0656
CSF1PO allele 2 0.0656
D7S820 allele 1 0.0005
D7S820 allele 2 0.1361
D8S1179 allele 1 0.0787
D8S1179 allele 2 0.0787
Table 1: Frequencies for suspect alleles. (Data source: Promega allele frequencies
[Link]
To calculate the probability of a given genotype, we can use the formulas below:
Heterozygous genotype frequency = 2pq, where p is the frequency of the first allele and q is the
frequency of the second allele
Homozygous genotype frequency = p2, where p is the frequency of the allele
3. Using the U.S. frequency data, calculate the probability of having the given genotype at each locus. Show
your work.
a. Probability of genotype for D5S818:

b. Probability of genotype for CSF1PO:

c. Probability of genotype for D7S820:

d. Probability of genotype for D8S1179:

Page 7 of 8
LESSON
DNA Profiling Using STRs

Remember that the alleles above are inherited independently of one another. To determine the probability of a
locus being inherited with another locus, we use the product rule for combining probabilities. To calculate the
probability of having a given genetic fingerprint, the probabilities of having each STR genotype are multiplied by
one another.

4. Calculate the probability of someone else having a DNA profile identical to that of the suspect. Show your
work.

The probability calculated in Question 4 represents the likelihood that someone other than the suspect left the
DNA found at the crime scene.

5. Based on your calculations, explain to the members of the jury why they should feel confident that the
suspect was at the scene of the crime.

Page 8 of 8

You might also like