0% found this document useful (0 votes)
14 views53 pages

Mock Exam: Basic & Medical Genetics

This document is a mock examination paper for first-year students at Kwame Nkrumah University of Science and Technology, focusing on Basic & Medical Genetics. It includes instructions for completing the exam, a series of questions related to genetics, and guidelines for answering and submitting the exam. The questions cover various topics in genetics, including meiosis, DNA structure, and genetic mutations.

Uploaded by

eugenelamptey17
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
14 views53 pages

Mock Exam: Basic & Medical Genetics

This document is a mock examination paper for first-year students at Kwame Nkrumah University of Science and Technology, focusing on Basic & Medical Genetics. It includes instructions for completing the exam, a series of questions related to genetics, and guidelines for answering and submitting the exam. The questions cover various topics in genetics, including meiosis, DNA structure, and genetic mutations.

Uploaded by

eugenelamptey17
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

ALTERNATIVE C

KWAME NKRUMAH UNIVERSITY OF SCIENCE & TECHNOLOGY


COLLEGE OF SCIENCE –DEPT OF THEORETICAL & APPLIED BIOLOGY
MOCK Examination 1, 2022/2023
1st Year Human Biology, Dentistry, Veterinary Medicine, Optometry & Physician
Assistant
Biol. 153 Basic & Medical Genetics 1

MARCH 2022 TWO HOURS

DO THE FOLLOWING FIRST BEFORE ATTEMPTING ANY


QUESTION !!!!!

1. CAREFULLY WRITE AND SHADE IN YOUR INDEX NUMBER AND


COURSE CODE
2. Write down the alternative and section of your question paper at the centre
bottom of the 2 scannables as appropriate A1-A2…..D1-D2
3. Attempt As many Questions as your planned time will allow you, in BOTH SECTIONS
1&2.
MOVE BETWEEN SECTIONS BY YOUR OWN TIMING; You will NOT be
prompted to do so. Sections 1 & 2 must be answered using the YOUR
APPROPRIATELY LABELLED scannables.

P.S. Please if you perceive a mistake in a question or you think a particular


question is not understood, QUICKLY MOVE ON TO THE NEXT. Do not disrupt
the rhythm of the class by asking the invigilator for corrections. Adequate
provisions are made for such anomalies in the final evaluation. DO NOT
BOTHER THE INVIGILATOR WITH ANY QUESTIONS.

ALL QUESTIONS CARRY EQUAL MARKS so work speedily through the


questions.

NOTE: YOU ARE FREE TO TAKE THE QUESTION PAPER AWAY FROM THE
EXAMINATION HALL ONCE YOU ARE DONE
SECTION C1
You are again reminded to use pencil to write “SECTION C1”
at the bottom of the scannable.
All the section C1 scripts across programmes will be pulled
together and graded. Yours must be identified with your index
number, therefore in addition write and shade in your index
number on the scannable
SECTION C1
For the following questions, match the key event of meiosis with the stages listed below.
I. Prophase I VI. Prophase II
II. Metaphase I VII. Metaphase II
III. Anaphase I VIII. Anaphase II
IV. Telophase I IX. Telophase II
V. Interkinesis

I. Tetrads of chromosomes are aligned at the center of the cell; independent assortment soon follows.
a) I
b) III
c) VI
d) VIII
e) II

1. Synapsis of homologous pairs occurs; crossing over may occur.


A) II
B) IV
C) VI
D) I
E) VII

2. Nuclear envelopes may-form; no replication of chromosomes takes place.


A) III
B) VI
C) VII
D) V
E) VIII

3. Centromeres of sister chromatids uncouple and chromatids separate.


A) II
B) VIII
C) III
D) VI
E) VII

4. All of the following are functions of meiosis in plants EXCEPT


A) production of spores.
B) production of identical daughter cells.
C) reduction of chromosome number by half.
D) independent assortment of chromosomes.
E) crossing over and recombination of homologous chromosomes.

5. The questions below refer to the following terms. Each term may be used once, more than once, or not at all.
A. incomplete dominance
B. multiple alleles
C. pleiotropy
D. epistasis
E. penetrance

6. The ability of a single gene to have multiple phenotype effects


Answer: C

7. One example is the ABO blood group system.


Answer: B

8. The phenotype of the heterozygote differs from the phenotypes of both homozygotes.
Answer: A

9. Barring in chickens is due to a sex-linked dominant gene (B). The sex of chicks at hatching is difficult
determine, but barred chicks can be distinguished from non-barred at that time. To use this trait so that at
hatching all chicks of one sex are differently coloured from those of the opposite sex, what cross would you
make?
A) barred males x barred females
B) barred males x non-barred females
C) non-barred males x non-barred females
D) None of the above crosses will produce differently barred chicks.
E) non-barred males X barred females

10. Which of these syndromes afflicts males only?


A) Down syndrome
B) Duchenne's muscular dystrophy
C) Patau syndrome
D) Edwards syndrome
E) Turner syndrome

11. From the following list, which is the first event in translation in eukaryotes?
A) elongation of the polypeptide
B) binding of the larger ribosomal subunit to smaller ribosome subunits
C) covalent bonding between the first two amino acids
D) base pairing of activated methionine-tRNA to AUG of the messenger
E) Both B and D occur simultaneously.

12. Muscle cells and nerve cells in one kind of animal owe their differences in structure to
A) having different genes.
B) using different genetic codes.
C) expressing different genes.
D) having unique ribosomes.
E) having different chromosomes.

13. A DNA fingerprint is produced by


A) treating selected segments of DNA with restriction enzymes.
B) electrophoresis of restriction fragments.
C) oligonucleotides from PCRs.
D) Both A and B are correct.
E) electroporation of cDNAs

14. If one were to observe the activity of methylated DNA, it would be expected that it would
A) be replicating.
B) be very active in translation.
C) be unwinding in preparation for protein synthesis.
D) have turned off or slowed down the process of transcription.
E) induce protein synthesis by not allowing repressors to bind with it.

15. What is a cloning vector?


A) the enzyme that cuts DNA into restriction fragments
B) the sticky end of a DNA fragment
C) a DNA probe used to locate a particular gene in the genome
D) an agent, such as a plasmid, used to transfer DNA from an in vitro solution into a living cell
E) the laboratory apparatus used to clone genes

16. If cells in the process of dividing are subjected to colchicine, a drug that interferes with the functioning of the
spindle apparatus, at which stage will mitosis be arrested?
A) Anaphase
B) metaphase
C) prophase
D) telophase
E) interphase

17. A cell containing 92 chromatids at the start of mitosis would, at its completion, produce cells containing how
many chromosomes?
A) 12
B) 46
C) 16
D) 23
E) 92

18. A 1:2:1 phenotypic ratio in the F2 generation of a monohybrid cross is a sign of


A) complete dominance.
B) multiple alleles.
C) polygenic inheritance.
D) pleiotropy.
E) incomplete dominance.

19. If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the
chromosome number (n) of the four resulting gametes?
A) n+l; n-1; n; n
B) n+l; n-l; n-l; n-l
C) n+1; n+l; n; n
D) n+l; n+l; n-l; n-l
E) n-l; n-1; n; n

20. Genes A and B are linked with 12 map units between them. A heterozygous individual Ab/aB would be
expected to produce gametes in which of the following frequencies?
A) 44% AB 6% Ab 6% aB 44% ab
B) 6% AB 6% Ab 44% aB 44% ab
C) 12% AB 12% Ab 38% aB 38% ab
D) 6% AB 44%Ab 44%aB 6% a
E) 6% Ab 12% aB 50% AB 32% ab

21. If radioactive sulphur (35S) is used in the culture medium of bacteria that harbour phage viruses, it will later
appear in the
A) viral DNA.
B) bacterial RNA.
C) viral RNA.
D) bacterial cell wall.
E) viral coats.

22. In analysis of the nucleotide composition of DNA to see which bases are equivalent in concentration, which
of the following would be TRUE?
A) A=C
B) A+C = G+T
C) A = G and C = T
D) A+T = G+C
E) Both B and C are true.

23. Which of these statements represents a common misconception regarding point mutations?
A) They involve changes in one base pair.
B) They can cause drastic changes in polypeptide structure.
C) They could result in a frameshift mutation.
D) They always produce a change in the amino acid sequence of a protein.
E) They can lead to the shortening of the mutated polypeptide.

24. Which of the following represents a difference between viruses and viroids?
A) Viruses infect many types of cells, while viroids infect only prokaryotic cells.
B) Viruses contain introns; viroids have only exons.
C) Viruses have genomes composed of DNA; while viroids have genomes composed of RNA.
D) Viruses have capsids composed of protein, while viroids have no capsids.
E) Viruses cannot pass through plasmodesmata; viroids can.

25. Which of the following statements is TRUE about control mechanisms in eukaryotic cells?
A) Cytoplasmic inductive influences act by altering what a particular gene makes.
B) Eukaryotic genes are organized in large operon systems.
C) Methylation of DNA may cause inactivity in part or all of a chromosome.
D) Active gene transcription occurs in the heterochromatic regions of the nucleus.
E) Lampbrush chromosomes are areas of active tRNA synthesis.

26. What is the genetic function of restriction endonuclease?


A) adds new nucleotides to the growing strand of DNA
B) repairs breaks in sugar-phosphate backbones
C) joins nucleotides during replication
D) joins nucleotides during transcription
E) cleaves nucleic acids at specific sites

Figure 1
27. If the cell whose nuclear material is shown in Figure 1continues toward completion of mitosis. Which of the
following events would occur next?
A) cell membrane synthesis
B) centromere uncoupling
C) spindle fiber formation
D) nuclear envelope breakdown
E) chromatid synthesis

28. All of the following occur during the latter stages of mitotic prophase EXCEPT:
A) The centrioles move apart.
B) Chromosomes are duplicated.
C) The nucleolus disintegrates.
D) The nuclear envelope disappears.
E) The spindle is organized.

29. If the haploid number for a species is 3, each dividing diploid cell will have how many chromatids at
metaphase?
A) 3
B) 12
C) 6
D) 9
E) 18

30. Eukaryotic sexual life cycles show tremendous variation. Of the following elements, which do all sexual life
cycles have in common?
I. copulation
II. meiosis
III. fertilization
IV. gametes
V. spores
A) I, IV and V
B) All of the above
C) I, II and IV
D) II, III and IV
E) II, IV, and V
31. A cell has a diploid chromosome number of 2n = 4. We will designate these four as chromosomes A, B, C,
and D. If meiosis occurred WITHOUT the formation of homologous pairs, and the chromosomes were
distributed randomly among the resulting cells, how many gametes could be formed?
A) 2 (AB and CD)
B) 6 (AB,AC, AD, BC, BD, and CD)
C) 3 (AB, BC, and CD)
D) 4 (AB, AB, BC, and CD)
E) 5 (AB, AC, AD, BC, and CD)

32. A 9 purple to 7 white phenotype in sweet peas in the F2 generation most likely is due to
A) linkage.
B) epistasis.
C) trisomy 2l.
D) crossing over.
E) pleiotropy.

33. In cattle, roan coat colour (mixed red and white hairs) occurs in the heterozygous (Rr) offspring of red (RR)
and white (rr) homozygotes. When two roan cattle are crossed, the phenotypes of the progeny are found to be
in the ratio of 1 red:2 roan:1 white. Which of the following crosses could produce the highest percentage of
roan cattle?
A) roan x roan
B) white X roan
C) red x roan
D) red x white
E) All of the above crosses would give the same percentage of roan.

34. A DNA molecule consists of two strands of nucleotides. One strand is the information used by the cell, and
the other strand is a complementary series of bases. This is analogous to
A) two sides of a divided highway.
B) a baseball and a bat.
C) an up escalator and a down escalator.
D) a photograph and a photographic negative.
E) Both B and D are correct.

35. For a couple of decades, we knew the nucleus contained DNA and proteins. The prevailing opinion was that
the proteins were the genes and the DNA was a "string" that held them together. The reason for this belief
was that
A) proteins take a greater variety of three-dimensional forms.
B) proteins have four different levels of structure; DNA has only two.
C) All of the below are correct.
D) proteins are made of 20 amino acids and DNA is made of four nucleotides.
E) proteins can vary in their polarity and charge; DNA cannot.

The following DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA,
VAG, and DGA.
promoter
5'(ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3'
3'(TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTCS 5'
36. How many animo acids long will the small protein encoded by this" gene" be?
A) 3
B) 5
C) 6
D) 4
E) 7

The following questions refer to Figure 17.1,


37. A possible sequence of nucleotides in DNA that would code for the polypeptide sequence Phe-Leu-Ile-Val
would be
A) 5' TTG-CTA-CAG- TAG 3',
B) 3' AAA-GAA-TAA-CAA 5',
C) 3' AAC-GAC-GUC-AUA 5',
D) 5' AUG-CTG-CAG-TAT3',
E) 3' AAA-AAT-ATA-ACA 5',

38. What amino acid sequence will be generated based on the following mRNA codon sequence? 5'AUG-UCU-
UCG-UUA-UCC-UUG
A) met-arg-glu-arg-glu-agr
B) met-ser-ser-leu-ser-leu
C) met-glu-arg-arg-gln-leu
D) met-ser-leu-ser-leu-ser
E) met-leu-phe-arg-glu-glu

39. A peptide has the sequence NH2-phe-pro-lys-gly-phe-pro-COOH. What is the sequence in DNA that codes for
this peptide?
A) 3' UUU-CCC-AAA-GGG-UUU-CCC
B) 3' AAA-GGG- TTT -CCC-AAA-GGG
C) 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG
D) 5'GGG-AAA-TTT-AAA-CCC-ACf-GGG
E) 5' ACT-TAC-CAT-AAA-CAT-TAC-UGA

40. What is the sequence of a peptide based on the mRNA sequence 5'UUUUCUUAUUGUCUU?
A) leu-cys-tyr-ser-phe
B) phe-ser-tyr-cys-leu
C) cyc-phe-tyr-cys-leu
D) phe-leu-ile-met-val
E) leu-pro-asp-lys-gly
The questions below refer to the following terms. Each term may be used once, more than once, or not at
all.
A. enhancer sequence
B. promoter region
C. RNA polymerase III
D. pseudogene
E. intron

41. transcribes the genes for small RNA molecules, including tRNA
Answer: C

42. recognition sites for proteins that make the DNA more accessible to RNA polymerase, thereby boosting the
activity of nearby genes several hundredfold
Answer: A

43. site important for controlling the initiation of transcription in eukaryotic DNA
Answer: B

44. has sequences very similar to functional genes, but lacks the signals for gene expression
Answer: D

45. Eco RI and Hin dIII are two different restriction endonucleases. If the DNA of different animals were cut with
either Eco RI or Hin dIII, which of the cut DNAs would not join together easily so that they could be sealed
with ligase?
A) human DNA cut with Eco RI and chimp DNA cut with Eco RI
B) E. coli DNA cut with Eco RI and mouse DNA cut with Hin dIII
C) prokaryotic DNA cut with Hin dIII and eukaryotic DNA cut with Hin dIII
D) mouse liver DNA cut with Eco RI and mouse kidney DNA cut with Eco RI
E) mouse DNA cut with Hin dIII and chimp DNA cut with Hin dIII

46. Movement of the chromosomes during anaphase would be most affected by a drug that
A) reduced cyclin concentrations.
B) prevented shortening of microtubules.
C) increased cyclin concentrations.
D) prevented elongation of microtubules.
E) prevented attachment of the microtubules to the kinetochore.

47. Which of the following terms belongs with the words synapsis, tetrads and chiasmata?
A) haploid
B) autosomes
C) prophase II
D) crossing over
E) fertilization

48. The X and the Y chromosomes are called sex chromosomes because
A) the chromosomes determine whether the individual will be male or female.
B) they are formed only as a result of fertilization.
C) females have X chromosomes and males have Y chromosomes.
D) they are present only when cells undergo meiosis.
E) genes located on the chromosomes playa role in determining the sex of the individual.
49. Tallness (T) is dominant to dwarfness (t), while red (R) flower colour is dominant to white (r). The
heterozygous condition results in pink (Rr) flower colour. A dwarf red snapdragon is crossed with a plant
homozygous for tallness and white flowers. What are the genotype and phenotype of the Fl individuals?
A) ttRr - dwarf and pink
B) TtRr - tall and pink
C) ttrr - dwarf and white
D) TtRr - tall and red
E) TTRR - tall and red

50. Tobacco mosaic virus has RNA rather than DNA as its genetic material. IfRNA from a tobacco mosaic virus
is mixed with proteins from a DNA virus, the result is a mixed virus. If that virus infects a cell reproduces,
what would you expect the resulting viruses to be like?
A) a DNA virus
B) a hybrid: tobacco mosaic virus RNA and protein from the DNA virus
C) a hybrid: tobacco mosaic virus protein and nucleic acid from the DNA virus
D) tobacco mosaic virus
E) I would not expect any viruses to result.

51. Which of the following is LEAST related to the others in the list?
A) transformation
B) DNA
C) Griffith
D) Avery
E) phage

52. Which of the following is LEAST related to the others in the list?
A) ligase
B) primase
C) helicase
D) nuclease
E) DNA polymerase

53. What are polysomes?


A) ribosomes containing more than two subunits
B) multiple copies of ribosomes found associated with giant chromosomes
C) groups of ribosomes reading the same mRNA simultaneously
D) aggregations of vesicles containing ribosomal RNA
E) ribosomes associated with more than one tRNA

54. A virus injects its DNA into a cell. Some genes are transcribed quite rapidly. Those genes are probably
involved in
A) producing DNA polymerase.
B) producing repressor proteins to control the bacterial cell.
C) producing viral capsule proteins.
D) producing proteins that lyse the bacterial cell.
E) producing various enzymes to alter cellular metabolism.

The questions below refer to the following terms. Each term may be used once, more than once, or not at
all.
A. highly repetitive DNA
B. moderately repetitive DNA
C. unique sequence DNA
D. methylated DNA
E. pseudogenes

55. When DNA is heated, the two strands separate. As the DNA cools, the strands come back together
("reanneal") as a function of the complementation of the sequences of bases. Which type of DNA would
reanneal first?
Answer: A

56. When DNA is heated, the two strands separate. As the DNA cools, the strands come back together (reanneal)
as a function of the complementation of the sequences of bases. Which type of DNA would reanneal last?
Answer: C

57. Many transposons fall into this class of DNA.


Answer: A

58. Control regions such as promoters would fall into which class of DNA?
Answer: B

59. Most genes coding for proteins would fall into which class of DNA?
Answer: C

60. This is most commonly found in inactivated chromosomal regions.


Answer: D

61. portions of the genome having sequences similar to functional genes, but that lack control regions
Answer: E

62. DNA fragments from a gel are transferred to a membrane via a procedure called Southern blotting. The
purpose of Southern blotting is to
A) permanently attach the DNA fragments to a substrate.
B) separate the two complementary DNA strands.
C) transfer only the DNA that is of interest.
D) analyze the RFLPs in the DNA.
E) separate out the PCRs.

63. The MPF protein complex turns itself off by


A) activating an enzyme that stimulates cyclin.
B) binding to chromatin.
C) exiting the cell.
D) activating an enzyme that destroys cyclin.
E) None of these is true; MPF is always active.

64. Colchicine is a drug that binds to the protein that forms microtubules, thereby preventing microtubules from
forming. Colchicine has been used to study mitosis because it stops the process. Most likely this is due to
A) prevention of sister chromatid formation.
B) inhibition of DNA synthesis.
C) alteration of centriole structure.
D) prevention of kinetochore formation.
E) prevention of cell-plate formation.
65. In animals, somatic cells result from mitosis and ___ result from meiosis.
A) clones
B) zygotes
C) gametes
D) spores
E) diploid cells

66. In the following list, which term is LEAST related to the others?
A) trisomic
B) monosomic
C) triploid
D) aneuploidy
E) nondisjunction

67. In the following list, which term is LEAST related to the others?
A) hemizygous
B) sex-linked genes
C) homogametic
D) wild type
E) hemophilia

68. Which of the following help to hold the DNA strands apart while they are being replicated?
A) helicase
B) DNA polymerase
C) single-stranded binding proteins
D) ligase
E) exonuclease

69. In making a movie, sometimes an editor will cut out one piece of film and insert another. This is analogous to
which of the following?
A) mismatch repair
B) transformation repair
C) recombinational repair
D) excision repair
E) telomerase repair

70. What are ribosomes composed of?


A) two subunits, each consisting of rRNA only
B) two subunits, each consisting of several proteins only
C) mRNA, rRNA, and protein
D) mRNA, tRNA, rRNA, and protein
E) both rRNA and protein
Use the information given here to answer the following questions. Feather colour in budgies is determined
by two different genes that affect the pigmentation of the outer feather and its core. Y_B _ is green; yy B_
is blue; Y _bb is yellow; and yybb is white.
71. A green budgie is crossed with a blue budgie. Which of the following results is NOT possible?
A) all white offspring
B) all green offspring
C) all blue offspring
D) all yellow offspring
E) All of the above are possible, but with different probabilities.

72. Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
A) fusion into circular forms known as plasmids.
B) excision of introns
C) linkage to histone molecules.
D) union with ribosomes.
E) fusion with other newly transcribed mRNA.

73. The tryptophan synthetase operon uses glucose to synthesize tryptophan. Repressible operons such as this
one are
A) turned off whenever tryptophan is added to the growth medium
B) turned off only when glucose is present in the growth medium.
C) turned on only when tryptophan is present in the growth medium.
D) turned on only when glucose is present in the growth medium.
E) permanently turned on.

74. A DNA molecule consists of two strands of nucleotides. One strand is the information used by the cell,
and the other strand is a complementary series of bases. This is analogous to
A) two sides of a divided highway.
B) a baseball and a bat.
C) an up escalator and a down escalator.
D) a photograph and a photographic negative.
E) Both B and D are correct.
75. In a given organism, how do cells at the completion of meiosis compare with cells that are just a begin
meiosis?
A) They have twice the amount of cytoplasm and half the amount of DNA.
B) They have half the number of chromosomes and one-fourth the amount of DNA.
C) They have half the number of chromosomes and half the amount of DNA.
D) They have the same number of chromosomes and half the amount of DNA.
E) They have half the amount of cytoplasm and twice the amount of DNA.

76. Which of the following is LEAST related to the other items?


A) transcription
B) translation
C) template strand
D) TATA box
E) RNA polymerase
77. Which of the following is the term for a human cell that contains 22 pairs of autosomes and two X
chromosomes?
A) an unfertilized egg cell
B) a sperm cell
C) a female somatic cell
D) a male somatic cell
E) Both A and D are correct

78. All of the following were determined directly from X-ray diffraction photographs of crystallized DNA
EXCEPT
A) the diameter of the double helix.
B) the helical shape of DNA.
C) the linear distance required for one full turn of the double helix.
D) the width of the helix.
E) the specificity of base pairing.

79. Which enzyme catalyses the elongation of a DNA strand in the 5' → 3' direction?
A) primase
B) DNA ligase
C) DNA polymerase
D) topoisomerase
E) helicase

Use the following information to answer the questions below.


A eukaryotic gene has sticky ends produced by the restriction endonuclease Eco RI. It is added to a mixture
containing Eco RI and a bacterial plasmid that carries two genes which make it resistant to ampicillin and
tetracycline. The plasmid has one recognition site for Eco RI located in the tetracycline-resistance gene.
This mixture is incubated for several hours and then added to bacteria growing in nutrient broth. The
bacteria are allowed to grow overnight and are streaked on a plate using a technique that produces isolated
colonies that are clones of the original. Samples of these colonies are then grown in four different media:
nutrient broth plus ampicillin, nutrient broth plus tetracycline, nutrient broth plus ampicillin and
tetracycline, and nutrient broth containing no antibiotics.
80. The bacteria containing the engineered plasmid would grow in
A) the nutrient broth only.
B) the nutrient broth and the tetracycline broth only.
C) the ampicillin and the nutrient broth.
D) the nutrient broth, the ampicillin broth, and the tetracycline broth.
E) the ampicillin and tetracycline broth only.

81. The bacteria that contained the plasmid, but not the eukaryotic gene, would grow
A) in all four types of broth.
B) in the nutrient broth plus ampicillin, but not in the broth containing tetracycline.
C) only in the broth containing both antibiotics.
D) in the broth containing tetracycline, but not in the broth containing ampicillin.
E) only in the broth that contained no antibiotics.
The questions below consist of five phrases or sentences concerned with the cell cycle. For each phrase or sentence,
select answer letter from below that is most closely related to it. Each answer may be used once, more than once, or
not at all.
A. G0
B. G1
C. S
D. G2
E. M

82. The "restriction point" occurs here.


Answer: B

83. Nerve and muscle cells are in this phase.


Answer: A

84. the shortest part of the cycle


Answer: E

85. Chromosomes are duplicated during this phase.


Answer: C

86. Cyclin is destroyed toward the end of this phase.


Answer: E

Refer to the following information to answer the questions below. An achondroplastic dwarf man with
normal vision marries a colour-blind woman of normal height. The man's father was six feet tall, and both
the woman's parents were of average height. Achondroplastic dwarfism is autosomal dominant, and red-
green colour blindness is X -linked recessive.
87. How many of their female children might be expected to be colour-blind dwarfs?
A) all
B) half
C) none
D) one out of four
E) three out of four

88. How many of their male children would be colour-blind and normal height?
A) all
B) none
C) one out of four
D) three out of four
E) half

89. They have a daughter who is a dwarf with normal colour vision. What is the probability that she is
heterozygous for both genes?
A) 0
B) 0.25
C) 0.5
D) 1.00
E) 0.75

Refer to the following information to answer the following questions. For each of the important discoveries
that led to our present knowledge of the nature of genes described below, select the investigator(s)
associated with each.
A. Hershey and Chase
B. Griffith
C. Meselson and Stahl
D. Avery, MacLeod, and McCarty
E. Chargaff

90. Which of the following phenomena are exceptions to Mendel's principles?


a) linkage
b) sex linkage
c) polygenic inheritance
d) all of the above
e) none of the above

91. Which of the following is/are required to study inheritance?


a) spring pollinating plants
b) genetic variation
c) true breeding lines
d) both band c are true
e) both a and b are true

92. Chemicals from heat-killed S cells were purified. The chemicals were tested for the ability to transform
live R cells. The transforming agent was found to be DNA.
Answer: D

93. The DNA of a phage was injected into the bacterial host, but the protein coat stayed outside. The viral
DNA directed the host to replicate new phage viruses.
Answer: A

94. In any DNA sample, the amount of adenine equals the amount of thymine and the amount of guanine
equals the amount of cytosine.
Answer: C

95. Steroid hormones produce their effects in cells by


A) activating key enzymes in metabolic pathways.
B) activating translation of certain mRNAs.
C) promoting transcription of certain regions of DNA.
D) promoting the degradation of specific mRNAs.
E) promoting the formation of looped domains in certain regions of DNA.

96. Which of the following events is necessary for the production of a truly malignant tumor?
A) activation of an oncogene in the cell
B) the inactivation of tumor suppressor genes within the cell
C) the presence of mutagenic substances within the cell's environment
D) the presence of a retrovirus within the cell
E) Both A and B are necessary

97. A DNA fingerprint is produced by


A) treating selected segments of DNA with restriction enzymes.
B) electrophoresis of restriction fragments.
C) oligonucleotides from PCRs.
D) Both A and B are correct.
E) electroporation of cDNAs.

98. Barring in chickens is due to a sex-linked dominant gene (B). The sex of chicks at hatching is difficult
determine, but barred chicks can be distinguished from non-barred at that time. To use this trait so that at
hatching all chicks of one sex are differently coloured from those of the opposite sex, what cross would
you make?
A) non-barred males X barred females
B) barred males x barred females
C) barred males x non-barred females
D) non-barred males x non-barred females
E) None of the above crosses will produce differently barred chicks.

99. From the following list, which is the first event in translation in eukaryotes?
A) base pairing of activated methionine-tRNA to AUG of the messenger
B) elongation of the polypeptide
C) binding of the larger ribosomal subunit to smaller ribosome subunits
D) covalent bonding between the first two amino acids
E) Both B and D occur simultaneously.

[Link] a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?
A) The tRNA that was in the A site moves into the P site.
B) The tRNA that was in the P site moves into the A site.
C) The tRNA that was in the P site departs from the ribosome.
D) The tRNA that was in the A site departs from the ribosome.
E) Both A and C are correct.

[Link] A and B are linked with 12 map units between them. A heterozygous individual Ab/aB would be
expected to produce gametes in which of the following frequencies?
A) 44% AB 6% Ab 6% aB 44% ab
B) 6% AB 44%Ab 44%aB 6% a
C) 6% AB 6% Ab 44% aB 44% ab
D) 12% AB 12% Ab 38% aB 38% ab
E) 6% Ab 12% aB 50% AB 32% ab
[Link] radioactive sulphur (35S) is used in the culture medium of bacteria that harbour phage viruses, it will
later appear in the
A) viral coats.
B) viral DNA.
C) bacterial RNA.
D) viral RNA.
E) bacterial cell wall.

[Link] of the following represents a difference between viruses and viroids?


A) Viruses infect many types of cells, while viroids infect only prokaryotic cells.
B) Viruses contain introns; viroids have only exons.
C) Viruses have genomes composed of DNA; while viroids have genomes composed of RNA.
D) Viruses have capsids composed of protein, while viroids have no capsids.
E) Viruses cannot pass through plasmodesmata; viroids can.

F)

[Link] of the following occur during the latter stages of mitotic prophase EXCEPT:
A) The centrioles move apart.
B) Chromosomes are duplicated.
C) The nucleolus disintegrates.
D) The nuclear envelope disappears.
E) The spindle is organized.

[Link] the haploid number for a species is 3, each dividing diploid cell will have how many chromatids at
metaphase?
A) 3
B) 12
C) 6
D) 9
E) 18The following questions refer to Figure 17.1,
106.A possible sequence of nucleotides in DNA that would code for the polypeptide sequence Phe-Leu-Ile-Val
would be
A) 5' TTG-CTA-CAG- TAG 3',
B) 3' AAA-GAA-TAA-CAA 5',
C) 3' AAC-GAC-GUC-AUA 5',
D) 5' AUG-CTG-CAG-TAT3',
E) 3' AAA-AAT-ATA-ACA 5',

[Link] amino acid sequence will be generated based on the following mRNA codon sequence? 5'AUG-
UCU-UCG-UUA-UCC-UUG
A) met-arg-glu-arg-glu-agr
B) met-ser-ser-leu-ser-leu
C) met-glu-arg-arg-gln-leu
D) met-ser-leu-ser-leu-ser
E) met-leu-phe-arg-glu-glu
[Link] numerous copies of rRNA genes in a salamander are an example of
A) prokaryotic multigene families.
B) eukaryotic multigene families.
C) a highly repetitive sequence.
D) enhanced promoter regions.
E) satellite DNA.
F) with endonuclease X and then insert the gene into the plasmid.

I. DNA polymerase transform E. coli cells


II. cleave by endonuclease
III. extract plasmid DNA from bacterial cells
IV. join plasmid DNA with foreign DNA by hydrogen bonds
V. seal with DNA ligase

[Link] the list above, which of the following is the most logical sequence of steps for splicing foreign DNA
into a plasmid and inserting the plasmid into a bacterium?
A) III, II, IV, V, I
B) I, II, IV, III, V
C) II, III, V, IV, I
D) III, IV, V, I, II
E) IV, V, I, II, III

[Link] RI and Hin dIII are two different restriction endonucleases. If the DNA of different animals were cut
with either Eco RI or Hin dIII, which of the cut DNAs would not join together easily so that they could be
sealed with ligase?
A) human DNA cut with Eco RI and chimp DNA cut with Eco RI
B) prokaryotic DNA cut with Hin dIII and eukaryotic DNA cut with Hin dIII
C) mouse liver DNA cut with Eco RI and mouse kidney DNA cut with Eco RI
D) E. coli DNA cut with Eco RI and mouse DNA cut with Hin dIII
E) mouse DNA cut with Hin dIII and chimp DNA cut with Hin dIII

[Link] first event in translation of eukaryotes (starting with methionine) is the


A) joining of the ribosomal subunits.
B) forming of polysomes.
C) base pairing of met-tRNA to AUG of the messenger RNA.
D) binding of the large ribosomal subunit to AUG of mRNA.
E) covalent bonding between the first two amino acids.

[Link] finding that defective genes behave differently in offspring depending on whether they belong to the
maternal or paternal chromosome is implicated in which of the following?
A) Prader- Willi syndrome
B) fragile X syndrome
C) Angelman syndrome
D) A, B, and D are correct
E) Only A and D are correct.

[Link] happens when T2 phages are grown with radioactive phosphorus?


A) Their proteins become radioactive.
B) Their DNA is found to be of medium density in a centrifuge tube.
C) They are no longer able to transform bacterial cells.
D) They transfer their radioactivity to E. coli chromosomes during infection.
E) Their DNA becomes radioactive

[Link] function as the heritable genetic code, DNA molecules must have all of the following structural
features EXCEPT
A) the ability to form complementary base pairs with other DNA nucleotides.
B) the ability to form complementary base pairs with RNA nucleotides.
C) a sequence of nucleotides that can be decoded into a sequence of amino acids in a protein.
D) histone proteins associated with the double

[Link] is one function of a signal peptide?


A) to attach ribosomes synthesizing secretory proteins to the ER
B) to direct an mRNA molecule into the cisternal space of ER
C) to bind RNA polymerase to DNA and initiate transcription
D) to terminate translation of the messenger RNA
E) to signal the initiation of transcription

[Link] is the attachment site for RNA polymerase?


A) initiation region
B) structural gene region
C) operator region
D) promoter region
E) regulator region

F) During the S phase of the cell cycle there will be 32 separate chromosomes.
[Link] are short, single-stranded DNA segments that are used to identify DNA fragments with a particular
sequence. Before the probe can identify a specific restriction fragment, what must be done?
A) The fragments must be separated by electrophoresis.
B) A, B, and C
C) The double-stranded DNA must be heated to make it single stranded.
D) The DNA must be permanently attached to a suitable substrate so it doesn't migrate.
E) Both A and B

[Link] fragments from a gel are transferred to a membrane via a procedure called Southern blotting. The
purpose of Southern blotting is to
A) permanently attach the DNA fragments to a substrate.
B) separate the two complementary DNA strands.
C) transfer only the DNA that is of interest.
D) analyze the RFLPs in the DNA.
E) separate out the PCRs.

[Link] MPF protein complex turns itself off by


A) activating an enzyme that stimulates cyclin.
B) binding to chromatin.
C) exiting the cell.
D) activating an enzyme that destroys cyclin.
E) None of these is true; MPF is always active.

[Link] of the following help to hold the DNA strands apart while they are being replicated?
A) helicase
B) DNA polymerase
C) single-stranded binding proteins
D) ligase
E) exonuclease

121.A ce1l that passes the restriction point will most likely
A) move into prophase of mitosis
B) have just completed cytokinesis to separate into two new cells.
C) stop dividing.
D) undergo chromosome duplication
E) show a drop in MPF concentration.

[Link] usually, but not always, follows mitosis. If cells undergo mitosis and not cytokinesis, this
would result in
A) a cell with a single large nucleus.
B) a cell with two or more nuclei.
C) cells with abnormally small nuclei.
D) feedback responses that prevent mitosis.
E) death of the cell line.

[Link] does a synaptonemal complex form?


A) during fertilization or fusion of gametes
B) during prophase I of meiosis
C) during prophase of mitosis
D) during metaphase of mitosis
E) during metaphase II of meiosis

[Link] evolutionary advantage is provided by meiosis?


a) Sexual dimorphism.
b) Diploidy.
c) Genetic diversity.
d) Polyploidy.
e) None of the above.

[Link] DNA strand that is replicated smoothly and continuously is called the:
a) primary strand.
b) leading strand.
c) first strand.
d) alpha strand.
e) None of the above.

[Link] are ribosomes composed of?


A) two subunits, each consisting of rRNA only
B) two subunits, each consisting of several proteins only
C) mRNA, rRNA, and protein
D) mRNA, tRNA, rRNA, and protein
E) both rRNA and protein

[Link] which of the following can the laws of probability be applied?


a) To predict the chances of winning the lottery.
b) To predict the chances of producing a female child.
c) To predict the chances of producing a male child.
d) All of the above.
e) None of the above.

128._____ refers to a situation in which several pairs of alleles interact to affect a single trait.
a) Variegation
b) Epistasis
c) Codominance
d) Incomplete dominance
e) None of the above

[Link] Okazaki strand is initiated by:


a) the same RNA primer that began synthesizing on the leading strand.
b) a separate RNA primer.
c) RNA polymerase.
d) DNA polymerase
e) None of the above.

[Link] pink-flowered plants were crossed they produced red-flowered, pink-flowered, and white-flowered
plants in a ratio of 1:2:1. This is an example of:
a) variegation.
b) hybrid vigor.
c) epistasis.
d) a polygenic trait.
e) incomplete dominance.

[Link] inherited feature of an organism is controlled by:


a) two chromosomes.
b) polygenic inheritance
c) two genes.
d) hybrid vigor
e) none of the above

[Link] location of a particular gene on a chromosome is called a(n):


a) allele.
b) trait.
c) locus.
d) map point.
e) none of the above

133._____ are genes that govern the same feature, such as eye color, and occupy corresponding positions on
homologous chromosomes.
a) Loci
b) Homozygotes
c) Coupled traits
d) Alleles
e) None of the above

134."Sticky ends" are:


a) the single-stranded end of a DNA segment that can pair with the complementary single-stranded ends of
other DNA molecules that were cut with the same restriction enzyme.
b) a problem in recombinant DNA technology because they can lead to the formation of loops of single
stranded DNA.
c) used to insert eukaryotic DNA into a prokaryotic chromosome.
d) Both a and b are true.
e) Both a and c are true.

[Link] probes are:


a) Fluorescently labeled segments of mRNA that code for the protein product of interest.
b) radioactively labeled segments of RNA or single-stranded DNA used to identify the DNA of interest.
fluorescently labeled segments of single-stranded DNA used to pair with the DNA of interest.
c) Both a and c are true.
d) None of the above are true
.
[Link] might a scientist choose a bacteriophage rather than a plasmid to use as a DNA vector?
a) Bacteriophages can carry larger DNA molecules than can plasmids.
b) Bacteriophages are easy to cultivate.
c) Bacteriophages are more stable as DNA vectors than are plasmids.
d) Bacteriophages transmit additional characteristics to E. coli that help it adapt to the newly introduced DNA.
e) None of the above are true.

137.A genomic library consists of fragments of


a) all the DNA that occurs in one species.
b) all the DNA contained in one chromosome.
c) all the DNA that would be found in a typical cells of a particular organism.
d) all the DNA in a recombinant gene.
e) Both a and c are true.

[Link] aberrations can be produced by exposure to


a) a, b, and c
b) viruses.
c) radiation.
d) various chemicals.
e) a and b only
[Link] is reverse transcriptase used to clone genes?
a) Reverse transcriptase is used to make a cDNA copy of an mRNA strand, thereby eliminating introns.
b) Reverse transcriptase is used to make a cloned DNA copy of a plasmid DNA molecule.
c) Reverse transcriptase is necessary to read the information contained on the cDNA molecule.
d) Both a and b are true.
e) Both b and c are true.

[Link] is insulin produced by genetically engineered E. coli cells superior to insulin obtained from animal
sources?
a) Animal insulin has a shorter life span than insulin produced using recombinant DNA techniques.
b) Recombinantly produced insulin contains human rather than animal sequences, thus reducing the chances
of an allergic response in the recipient.
c) Animal insulin is more difficult to purify than is recombinantly produced insulin.
d) All of the above are true.
e) None of the above are true.
[Link] entire process of producing two cells from one cell
a) starts with prophase.
b) ends with cytokinesis.
c) results in the equal distribution of organelles between cells.
d) occurs only in multicellular organisms.
e) both a and b, but not c or d

[Link] bodies
a) are dumping places for excess genetic material.
b) have no known biological function.
c) are produced by meiosis.
d) will serve as the gametes if something happens to the egg.
e) all but d are correct

[Link] organism did Mendel utilize to work out the laws of segregation and independent assortmen
a) the fruit fly
b) Neurospora
c) the garden pea
d) the chicken
e) E. coli

[Link] chromosomes are moving to opposite poles during


a) interphase.
b) prophase.
c) metaphase.
d) anaphase.
e) telophase.

[Link] many genetic disorders, galactosemia is a disruption of a metabolic pathway due to a malfunctioning
a) reactant.
b) cofactor.
c) energy source.
d) product.
e) enzyme.

146._____ refers to multiple independent pairs of genes having similar and additive effects on the same
characteristic.
a) Polygenic inheritance
b) Complete dominance
c) Additive dominance
d) Codominance
e) Epistasis

[Link] on nutrient requirements in bread mold led to the idea that one gene specifies the makeup of one
a) amino acid.
b) enzyme.
c) polypeptide.
d) both b and c are correct
e) a, b, and c are correct

148. From X-ray diffraction data, which of the following was determined about DNA?
a) The molecule had uniform diameter.
b) The molecule was long and narrow.
c) Part of the molecule repeated itself often.
d) The shape of the molecule could be spiral.
e) all of the above

149. In the bonding of nitrogenous bases,


a) adenine is paired with cytosine.
b) adenine is paired with guanine.
c) guanine is paired with cytosine.
d) cytosine is paired with thymine.
SECTION C2
You are again reminded to use pencil to write “SECTION C2”
at the bottom of the scannable.
All the section C2 scripts across programmes will be pulled
together and graded. Yours must be identified with your index
number, therefore in addition write and shade in your index
number on the scannable
SECTION C2
1. The DNA molecule could be compared to a
a) hairpin.
b) key.
c) globular mass.
d) ladder.
e) flat plate.

2. Adenine and guanine are


a) single-ringed purines.
b) double-ringed pyrimidines.
c) single-ringed pyrimidines.
d) amino acids.
e) double-ringed purines.

3. Simultaneous transcription and translation occurs in ___ organisms.


a) prokaryotic
b) eukaryotic
c) both a and b
d) none of the above

4. Which of the following is not a stop codon in most species?


a) UAA
b) UGA
c) UAG
d) AUG

5. Four of the five answers listed below are related by a common number. Select the exception.
a) number of nucleotides in a codon
b) number of building blocks (parts) in a nucleotide
c) number of stop codons
d) number of types of RNA
e) number of types of DNA

6.
Four of the five answers listed below are therapeutic measures applied to affected individuals. Select
the exception.
a) prenatal diagnosis
b) chemotherapy
c) surgical correction
d) diet modification
e) environmental adjustment

7. Four of the five answers listed below are caused by recessive genes. Select the exception.
a) phenylketonuria
b) Huntington's disorder color blindness
c) hemophilia
d) albinism

8. The pea plant, Pisum sativum, was used by Mendel as a model organism for which of the following
reason(s):
a) there were easily visible traits such as flower color and seed shape.
b) self-fertilization was possible.
c) it was relatively easy to grow.
d) all of the above are correct.

9. If an organism contains two identical alleles for the same trait, it is said to be which of the following?
a) cross-fertilized
b) heterozygous
c) homozygous
d) a hybrid
e) none of the above

10. A testcross is always conducted between an individual whose genotype is unknown, and which of the
following?
a) a homozygous recessive individual
b) a homozygous dominant individual
c) a heterozygous individual
d) any of the above will work

11. Thomas Hunt Morgan's experiment with white-eyed Drosophila provided proof of which of the
following?
a) law of independent assortment
b) chromosomal theory of inheritance
c) theory of natural selection
d) law of segregation
e) none of the above

12. During which of the following stages of the cell cycle is the DNA of the organism replicated?
a) prophase
b) anaphase
c) S phase
d) G2 phase

13. ___ discovered the process of transformation in bacteria.


a) Griffith
b) Avery and colleagues
c) Chargaff
d) Pauling
e) Franklin

14. __ demonstrated that the genetic material in bacteriophage T2 was DNA.


a) Watson and Crick
b) Hershey and Chase
c) Avery and colleagues
d) Franklin
e) Pauling

15. These were the first individuals to demonstrate that DNA is a double-helix.
a) Watson and Crick
b) Pauling
c) Franklin
d) Chargaff
16. The decoding function of translation occurs during ___
a) initiation
b) translocation
c) cotranslational sorting
d) elongation

17. When does a synaptonemal complex form?


a) during fertilization or fusion of gametes
b) during metaphase II of meiosis
c) during prophase of mitosis
d) during prophase I of meiosis
e) during metaphase of mitosis

18. What is one function of a signal peptide?


a) to direct an mRNA molecule into the cisternal space of ER
b) to attach ribosomes synthesizing secretory proteins to the ER
c) to bind RNA polymerase to DNA and initiate transcription
d) to terminate translation of the messenger RNA
e) to signal the initiation of transcription

19. Where is the attachment site for RNA polymerase?


a) structural gene region
b) initiation region
c) operator region
d) regulator region
e) promoter region

20. The function of reverse transcriptase in retroviruses is to


a) hydrolyze the host cell's DNA.
b) convert host cell RNA into viral DNA.
c) translate viral RNA into proteins.
d) use viral RNA as a template for DNA synthesis.
e) use viral RNA as a template for making complementary RNA strands.

21. Viruses have some of the properties of living organisms. Which of the following is a characteristic of
all organisms, but NOT of viruses?
a) genetic information stored as nucleic acid
b) plasma membrane
c) ability to control metabolism
d) ability to reproduce
e) structure includes proteins

22. A mammalian zygote with which of the following chromosomal abnormalities will NEVER develop
into a viable embryo?
a) YO
b) XO
c) XXX
d) XXY
e) XXXY

23. Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
a) fusion into circular forms known as plasmids.
b) linkage to histone molecules.
c) union with ribosomes.
d) excision of introns.
e) fusion with other newly transcribed mRNA.

24. A mutation that inactivates the regulator gene of a repressible operon in an E. coli cell would result in
a) complete inhibition of transcription of the structural gene controlled by that regulator.
b) irreversible binding of the repressor to the operator.
c) inactivation of RNA polymerase.
d) Both B and C are correct.
e) continuous transcription of the structural gene controlled by that regulator.

25. The tryptophan synthetase operon uses glucose to synthesize tryptophan. Repressible operons such as
this one are
a) turned on only when tryptophan is present in the growth medium.
b) turned off only when glucose is present in the growth medium.
c) turned on only when glucose is present in the growth medium.
d) turned off whenever tryptophan is added to the growth medium.
e) permanently turned on.

26. In a given organism, how do cells at the completion of meiosis compare with cells that are just a begin
meiosis?
a) They have twice the amount of cytoplasm and half the amount of DNA.
b) They have half the number of chromosomes and one-fourth the amount of DNA.
c) They have half the number of chromosomes and half the amount of DNA.
d) They have the same number of chromosomes and half the amount of DNA.
e) They have half the amount of cytoplasm and twice the amount of DNA.

27. All of the following were determined directly from X-ray diffraction photographs of crystallized DNA
EXCEPT
a) the diameter of the double helix.
b) the helical shape of DNA.
c) the linear distance required for one full turn of the double helix.
d) the width of the helix.
e) the specificity of base pairing.
28. Which enzyme catalyses the elongation of a DNA strand in the 5' → 3' direction?
a) primase
b) DNA ligase
c) topoisomerase
d) helicase
e) DNA polymerase

29. A particular triplet of bases in the coding sequence of DNA is AGT. What is the corresponding triplet
in the complementary strand of DNA?
a) AGT
b) TCA
c) UCA
d) GAC
e) TCA in eukaryotes, but UCA in prokaryotes

30. A particular triplet of bases in the coding sequence of DNA is AGT. The anticodon on the tRNA that
binds the mRNA codon is
a) AGT.
b) AGU.
c) UCA.
d) TCA.
e) Either UCA or TCA, depending on wobble in the first base.

31. Bacteriophage DNAs that have become integrated into the host cell chromosome are called
a) intemperate bacteriophages.
b) transposons.
c) T -even bacteriophages.
d) plasmids.
e) prophages.

32. The fact that all seven of the garden pea traits studied by Mendel obeyed the principle of independent
assortment means that the
a) haploid number of garden peas is 7.
b) seven pairs of alleles determining these traits are on the same pair of homologous
chromosomes.
c) seven pairs of alleles determining these traits behave as if they are on different chromosomes.
d) formation of gametes in plants is by mitosis only.
e) diploid number of garden peas is 7.

33. Which of the following is a sex-influenced trait?


a) white eyes in fruit flies
b) hemophilia
c) colour blindness
d) male-pattern baldness
e) Turner syndrome

34. What percentage of the DNA in a typical eukaryotic cell is expressed at any given time?
a) 5-20%
b) 20-40%
c) 40-60%
d) 3-5%
e) 60-90%

35. From the following list, which is the first event in translation in eukaryotes?
a) elongation of the polypeptide
b) binding of the larger ribosomal subunit to smaller ribosome subunits
c) covalent bonding between the first two amino acids
d) base pairing of activated methionine-tRNA to AUG of the messenger
e) Both B and D occur simultaneously.

36. If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the
chromosome number (n) of the four resulting gametes?
a) n+l; n-1; n; n
b) n+l; n-l; n-l; n-l
c) n+1; n+l; n; n
d) n+l; n+l; n-l; n-l
e) n-l; n-1; n; n

37. Genes A and B are linked with 12 map units between them. A heterozygous individual Ab/aB would
be expected to produce gametes in which of the following frequencies?
a) 44% AB 6% Ab 6% aB 44% ab
b) 6% AB 6% Ab 44% aB 44% ab
c) 12% AB 12% Ab 38% aB 38% ab
d) 6% AB 44%Ab 44%aB 6% a
e) 6% Ab 12% aB 50% AB 32% ab

38. If radioactive sulphur (35S) is used in the culture medium of bacteria that harbour phage viruses, it will
later appear in the
a) viral DNA.
b) bacterial RNA.
c) viral RNA.
d) bacterial cell wall.
e) viral coats.

39. A chromosome's gene sequence that was ABCDEFG before damage and ABFEDCG after is an
example of
a) deletion.
b) duplication.
c) inversion.
d) translocation.
e) aneuploidy.
40. Which of the following is a transfer of genes between non-homologous chromosomes?
a) crossing over
b) aneuploidy
c) trisomy
d) translocation
e) duplication

41. During prophase I of meiosis, homologous chromosomes lie side by side. This phenomenon is known
as:
a) homologue pairing
b) synapsis
c) paternal pairing
d) tetrad formation
e) None of the above.

42. Which of the following is/are required to study inheritance?


f) spring pollinating plants
g) genetic variation
h) true breeding lines
i) both a and b are true
j) both band c are true

43. Which of the following represent the possible genotypes resulting from a cross between an individual
homozygous for black hair (BB) and an individual heterozygous for black hair (Bb)?
a) BB and Bb
b) BB, Bb and bb
c) BB only
d) Bb only
e) bb only

44. Symptoms of phenylketonuria (PKU) may be minimized or suppressed by a diet low in


a) serine.
b) glycine.
c) phenylalanine.
d) proline.
e) glutamic acid.

45. Which point mutation would be most likely to have a catastrophic effect on the functioning of a
protein?
a) a base substitution
b) a base deletion near the end of the coding sequence, but not in the terminator codon
c) deletion of three bases near the start of the coding sequence, but not in the initiator codon
d) a base deletion near the start of the coding sequence
e) a base insertion near the end of the coding sequence, but not in the terminator codon
46. .Which of the following represent the possible genotypes resulting from a cross between two
individuals that are heterozygous for black hair (Bb)?
a) BB and Bb
b) BB, Bb and bb
c) BB only
d) Bb only
e) bb only

47. Which of the following represent the possible genotypes resulting from a cross between an individual
homozygous for black hair (BB) and an individual homozygous for blonde hair (bb)?
a) BB and Bb
b) BB, Bb and bb
c) BB only
d) Bb only
e) bb only

48. Heterozygosity can be determined by:


a) the appearance of the individual.
b) the appearance of the parents.
c) a test cross of the unknown individual with a homozygous individual.
d) both a and b
e) both band c

49. During mitosis nucleoli disappear during ___ and again become apparent during.
a) metaphase, anaphase
b) prophase, anaphase
c) prophase, telophase
d) interphase, telophase
e) anaphase, telophase

50. How does the replication of cellular organelles relate to the cell cycle?
a) Organelles replicate at roughly the same time as do the chromosomes.
b) Organelles replicate during interphase and are apportioned more or less between the daughter cells.
c) Organelles contain their own chromosomes that undergo a mitosis of their own while the cell is dividing.
d) None of the above are true.
e) Both a and c are true.

51. An organism with a diploid number of 36 chromosomes will have ____ chromosome in their gametes
and _____ chromosomes in their somatic cells.
a) 18, 18
b) 18, 36
c) 36, 18
d) 36, 36
e) 36, 72
52. During prophase I, each chiasmata represents:
a) the site at which homologous chromosomes are united
b) the site at which maternal and paternal homologues are united
c) a site of crossing over
d) a newly formed haploid gamete
e) None of the above

53. During which of the following stages of meiosis do the chromatids separate?
a) metaphase I
b) anaphase I
c) metaphase II
d) anaphase II
e) telophase II

54. _____ egg(s) are formed by oogenesis and ____ sperm (s) are formed by spermatogenesis.
a) 4, 4
b) 1, 1
c) 4, 1
d) 1, 4
e) 2, 2

55. In prenatal diagnosis, the newest procedure that can be performed early in pregnancy involves
sampling the
a) chorion.
b) amnion.
c) allantois.
d) yolk sac.
e) umbilical cord.

56. The most recent technique for analyzing the genetics of the unborn child involves the sampling of
a) the fetus directly.
b) cells in the amniotic fluid.
c) material from the allantois.
d) the chorionic villi.
e) yolk sac material.

57. The maximum number of tRNAs that can be on one ribosome at one time is
a) unlimited.
b) unknown.
c) 2.
d) 3.
e) 43

58. A gene mutation


a) is a change in the nucleotide sequence of DNA.
b) may be caused by environmental agents.
c) may arise spontaneously.
d) can occur in any organism.
e) all of the above

59. Which of the following does NOT belong with the other four?
a) polyploidy
b) inversion
c) deletion
d) duplication
e) translocation

60. Syndrome means


a) a chromosome disorder.
b) a simple genetic disease.
c) a set of symptoms that occur together.
d) an incurable disease.
e) a rare inborn defect.

61. Which of the following conditions is characterized by a karyotype with forty-five chromosomes?
a) Down syndrome
b) testicular feminization syndrome
c) Klinefelter syndrome
d) Turner syndrome
e) cri-du-chat

62. The sex chromosome composition of a person with Turner syndrome is


a) XXX.
b) XXY.
c) XO.
d) XYY.
e) none of the above
63. A DNA fingerprint is produced by
a) Both A and B are correct.
b) treating selected segments of DNA with restriction enzymes.
c) electrophoresis of restriction fragments.
d) oligonucleotides from PCRs.
e) electroporation of cDNAs.

For the following questions, match the key event of meiosis with the stages listed below.
I. Prophase I VI. Prophase II
II. Metaphase I VII. Metaphase II
III. Anaphase I VIII. Anaphase II
IV. Telophase I IX. Telophase II
V. Interkinesis
64. Tetrads of chromosomes are aligned at the center of the cell; independent assortment soon follows.
a) I
b) II
c) III
d) VI
e) VIII

65. Synapsis of homologous pairs occurs; crossing over may occur.


a) II
b) IV
c) VI
d) I
e) VII

66. Nuclear envelopes may-form; no replication of chromosomes takes place.


a) III
b) VI
c) VII
d) V
e) VIII

67. Centromeres of sister chromatids uncouple and chromatids separate.


a) II
b) VIII
c) III
d) VI
e) VII

68. Genes that tend to be inherited together are said to be:


a) linked.
b) associated.
c) related.
d) similar.
e) alleles.

69. Human females have two X chromosomes, a condition which is referred to as:
a) a sex-linked trait.
b) dominant chromosome sex determination.
c) homogametic.
d) heterogametic.
e) none of the above.

70. Why are slightly more male children born than are females?
a) X-bearing sperm are less likely to survive spermatogenesis.
b) Y-bearing sperm must have some competitive advantage over X-bearing sperm.
c) More Y-bearing sperm are produced.
d) All of the above are true.
e) None of the above are true.

71. When pink-flowered plants were crossed they produced red-flowered, pink-flowered, and white-
flowered plants in a ratio of 1:2:1. This is an example of:
f) variegation.
g) hybrid vigor.
h) incomplete dominance.
i) epistasis.
j) a polygenic trait.

72. Breeding a yellow dog to a brown dog produced mixed color puppies (with both yellow and brown
hairs). This is an example of :
a) variegation.
b) codominance
c) incomplete dominance.
d) epistasis.
e) a polygenic trait.

73. _____ refers to a situation in which several pairs of alleles interact to affect a single trait.
f) Variegation
g) Codominance
h) Incomplete dominance
i) Epistasis
j) None of the above

74. Usually, an individual has the same blood group for life. However, it may rarely change through
addition or suppression of an antigen during:
(a) Malignancy
(b) Autoimmune disease
(c) Infection
(d) All
75. The A and B alleles of blood group differ from each other by nucleotide substitutions:
(a) 3
(b) 5
(c) 7
(d) 9
76. The first successful experiment on blood transfusion was conducted on a dog by:
(a) Richard Lowenin (1666)
(b) Charles Bonnet (1745)
(c) Young (1802)
(d) Franeeseo Redi (1988)
Consider the following statements:
(A) Environment plays a significant role in the determination of blood groups
(B) In ABO blood group, both blood group A and blood group B are dominant over blood group 0
(C) A man with blood group B and his wife with blood group AB, can produce a child of 0 blood group
(D) If the father is of A blood group the mother is of B group their child may be of A, B, AB or 0 blood
group
77. The correct statements are:
(a) All
(b) A, Band D
(c) A and D
(d) Band D

78. If mother is A- and father is O+, the blood group of their child may be:
(a) Nor 0+
(b) A- or 0-
(c) N, A- or 0+,0-
(d) A+ or 0+

79. Mother-foetus ABO incompatibility most commonly occurs when the mother is of _
type and foetus is of A, B or AB type:
(a) A
(b) B
(c) AB
(d) 0

80. If the mother is of blood group 0 and father is of AB, the possible blood group of their child is:
(a) AorAB
(b) B,ABorO
(c) AorB
(d) AB or O

81. Parents having blood group AB cannot produce a child of the blood group:
(a) A
(b) B
(c) AB
(d) 0

Consider the following points with reference to Rh factor:


(A) Discovered by Landstainer and Wiener
(B) A dominant trait
(C) Present in all vertebrates
(D) Responsible for erythroblastosis foetalis

82. The correct statements are:


(a) A, Band D
(b) A, Band D
(c) B, C and D
(d) A, C and D

83. A couple has three sons belonging to blood groups A, AB and 0, the possible genotypes of the couple:
(a)IA IA and 1°1°
(b) IA IO and IBlo
(c) IAIA and IBlo
(d) IAIB and 1010
84. If the blood group of the father is O and that of the mother is AB, what are the chances of blood group
O in their children?
(a) 75 per cent
(b) 50 per cent
(c) 25 per cent
(d) 0 per cent

85. Blood group of the mother is AB and that of the father is also AB, the chances of AB blood group in
their children is:
(a) 25 per cent
(b) 50 per cent
(c) 75 per cent
(d) 0 per cent

86. Which one of the following is a case of genetic imprinting?


(a) Beckwith-Wiedemann syndrome
(b) Wolf-Hirschhorn syndrome
(c) Rett syndrome
(d) Apert syndrome

87. Single gene mutations may be:


(a) Autosomal
(b) Sex linked
(c) Largely recessive
(d) All

88. The most frequent type of translocation in humans is the centric fusion of chromosomes:
(a) 8 and 12
(b) 10 and 12
(c) 13 and 14
(d) 16 and 17
Match column I with column II and select the correct answer using answer codes:
Column I Column 11
(A) Garrod 1. First human gene assignment
(B) Wilson 2. Chromosome analysis on blood
(C) Roberts 3. Biochemical variation
(D) Moorhead 4. United Kingdom's first genetic clinic
89. Answer codes:
A B C D
(a) 3 4 I 2
(b) 3 1 4 2
(c) 4 2 1 4
(d) 2 1 3 4
90. Which one of the following is responsible for 47 + XXX abnormality?
(a) Nondisjunction in female meiotic division.
(b) Nondisjunction in female meiotic division or at the male second meiotic division.
(c) Nondisjunction at the male first or second meiotic division.
(d) Nondisjunction at the second meitotic division either in male or female.
91. Which one of the following is uncommon in eskimos?
(a) Cystic fibrosis
(b) Diabetes inspidus
(c) Diabetes mellitus
(d) Twins

92. Which one of the following is applicable to Klinefelter syndrome?


(a) Hypogonadism
(b) Gynecomastia
(c) Barr body
(d) All

93. A karyotype is a picture of all the chromosomes during _________state:


(a) Prophase
(b) Metaphase
(c) Anaphase
(d) Telophase

94. Hitchhiker's thumb is:


(a) Autosomal dominant
(b) Autosomal recessive
(c) X-linked dominant
(d) X-linked recessive

95. In translocation Down syndrome, the number of chromosomes is:


(a) 45
(b) 46
(c) 47
(d) More than 47

96. Which one of the following is incorrect?


(a) Down syndrome - Trisomy of chromosome 21
(b) Edward syndrome - Trisomy of chromosome J 8
(c) Wolf-Hirschhorn syndrome - Delection of long arm of 4
(d) Chronic myelogenods leukaemia - Reciprocal translocation between chromosome 9 and 22

Match column I with column IT and select the correct answer using answer codes:
Column I Column 11
(A) Cystic fibrosis 1. Dominant gene on chromosome 17
(B) Tay-Sachs disease 2. Recessive gene on chromosome 7
(C) Huntington disease 3. Dominant gene on chromosome 15
(D) Neurofibro matosis 4. Dominant gene on chromosome 4

97. Answer codes:


A B C D
(a) 3 4 2 I
(b) 2 3 4 I
(c) 4 2 1 3
(d) 4 3 1 2
98. Sex-linked characters are generally:
(a) Dominant
(b) Recessive
(c) Lethal
(d) Atavistic

Match column I with column 11 and select the correct answer using answer codes:
Column I Column 11
(A) Sex limited I. AB blood group
(B) Sex influenced 2. Baldness
(C) Sex linked 3. Milk production
(D) Co-dominance 4. Duchenne muscular dystrophy
99. Answer codes:
A B C D
(a) 4 2 1 3
(b) 2 4 2 3
(c) 3 4 4 2
(d) 3 2 4 1

[Link] compensation is not applicable to:


(a) Xg red cell antigen gene
(b) Immunoglobulin heavy chain gene
(c) Fragile X syndrome gene and Xg red gene
(d) Steroid sulfatase gene and Xg red cell antigen cell antigen gene

[Link] compensation applicable to all X-linked genes except:


(a) Those on the long arm
(b) Those near the pairing segment at the end of the short arm
(c) Those near the pairing segment at the end of the long arm
(d) Those near the base of the long arm

[Link] syndrome is applicable to:


(a) Beckwith-Wiedemann syndrome
(b) Male Turner syndrome
(c) Klinefelter syndrome
(d) Apert syndrome

[Link] is the incurved fingers:


(a) Fifth
(b) Third
(c) Second
(d) First

[Link] pigmentosa is:


(a) Autosomal dominant
(b) Autosomal recessive
(c) X-linked recessive
(d) All
[Link] one of the following is a polymorphic trait in humans?
(a) ABO blood groups
(b) MN blood groups
(c) Rh factor
(d) All

[Link] respect to the given symbols used for karyotype description, which one of the following is an
incorrect match?
(a) p - Short arm
(b) qter - Tip of long arm
(c) i-Inversion
(d) 1- Mosaicism

[Link] humans, Philadelphia chromosome is formed by reciprocal translocation between chromosomes:


(a) 2 and 12
(b) 3 and 12
(c) 9 and 21
(d) 9 and 22

Match column I with column II and select the correct answer using answers code:
Column I Column II
(A) Wilson disease 1. Inactivation of one of the two X chromosomes
(B) Lesch-Nyhan disease 2. Defective copper metabolism
(C) Ehlers-Danlos syndrome 3. Found only in males
(D) Lyons hypothesis 4. Autosomal dominant but X-linked and
autosomal recessive forms are known
[Link] codes:
A B C D
(a) 2 4 3 1
(b)2 3 4 1
(c)4 3 1 2

(d)3 1 2 4

[Link] one of the following is an inherited disorder?


(a) Parkinon's disease
(b) Leprosy
(c) AIDS
(d) None

[Link] one of the following is a genetically transmitted trait?


(a) Albinism
(b) Colour-blindness
(c) Muscular systrophy
(d) All

[Link] one of the following is not shown by Down syndrome individuals?


(a) Brushfield spots
(b) Saddle nose
(c) Webbed neck
(d) Epicanthal skin folds

[Link]-Najjar syndrome is characterised by:


(a) Increased uric acid production
(b) Presence of bile in various tissue
(c) Progressive mental deterioration
(d) Increased production of oxidized haemoglobin

[Link] chromosome belongs to group:


(a) G
(b) F
(c)D
(d)A

[Link] one causes erythroblastosis foetalis?


(a) Rh+ male Rh+ female
(b) Rh- male and Rh- female
(c) Rh+ male and Rh- female
(d) Rh- male and Rh+ female

[Link] most commonly associated chromosomal abnormalities with Down syndrome is:
(a) Deletion
(b) Translocation
(c) Mosaicsm
(d) Trisomy

[Link] one of the follwoing is an incorrect match?


(a) ABO blood groups - Multiple allelism
(b) Nondisjunction - Change in chromosome number
(c) Euthansia - Selective inbreeding in human beings
(d) AB blood group - Co-dorninance

[Link] chronological age of a boy is 5 years and his mental age is 15, his I.Q is:
(a) 3
(b) 45
(c) 150
(d) 100

[Link] enzyme deficiencies are autosomal recessive except:


(a) Tryosinase
(b) Acute intermittent porphyria
(c) Galactone phosphate uridyl transferase
(d) Transacetylase

[Link] is due to loss of heterozygosity, which may be due to:


(a) Mitotic recombination
(b) Somatic mutation
(c) Loss of a chromosome
(d) All

[Link] is incorrect about Huntington disease?


(a) Triplet CAG repeated over and over again
(b) Gene located on chromosome 4
(c) Individuals with fewer than 30 repeats of CAG develop this disease
(d) Degenerative brain disorder

Match column I with column II and select the correct answer using codes:
Column I ColumnII
(A) Enzyme defect 1. G-6-PD deficiency
(B) Alteration of protein 2. Albinism
(C) Defect in receptor and transport system 3. Hypercholesteremia
(D) Genetically determined and 4. Sickle cell anaemia
adverse reaction to drugs

[Link] codes:
A B C D
(a) 2 3, 1 4
(b) 3 4 2 1
(c) 4 3 1 2
(d) 2 4 3 1

[Link] to a recent finding, Down syndrome individuals by the age 35 years develop:
(a) Parkinson disease
(b) Alzheimer syndrome
(c) Retinoblastoma
(d) Fragile X syndrome

Match column I with column II and select the correct match using answer codes:
Column I Column 11
(A) Eugenics 1. Sum total of genes in a population
(B) Euphenics 2. Improvement of human race
(C) Gene pool 3. Increase in homozygosity
(D) Consanguinity 4. Phenotypic improvement of humans after birth
[Link] codes:
A B C D
(a) 2 4 1 3
(b) 2 3 4 I
(c) 3 2 4 1
(d) 4 2 1 3

[Link] humans, the possible of number of phenotypes for ABO blood group is:
(a) 2
(b)4
( c) 6
(d)8
[Link] one of the following is an incorrect statement?
(a) Campomelic dysplasia is a genetic disorder.
(b) It is due to a mutation in the gene SOX9, located on the chromosomes 17.
(c) SOX9 is related with sex reversal.
(d) Gene SOX9 is responsible for Waardenburg syndrome.

[Link] male human beings, which one of the following is essential for gonadal development?
(a) Testis-determining gene SRY
(b) X-linked genes
(c) Both (a) and (b)
(d) None

[Link] one of the following regions of X and Y chromosomes are paired during synapses?
(a) Differential region
(b) Pairing region
(c) Both (a) and (b)
(d) None

[Link] expression of testis-determining genes can be detected by:


(a) Feulgen test
(b) Immunochemistry
(c) Immunochemistry and in situ hybridisation
(d) All

[Link] one of the following statements is incorrect?


(a) A deletion in Y chromosome may lead to infertility.
(b) According to data, it has been suggested that X and Y chromosomes evolved from ancestral autosomes
nearly 300 million years ago.
(c) The Y chromosome is one third the size of X chromosome.
(d) The X and Y chromosomes do not share common genes.

[Link] sexuality of an individual is determined at _________ ______level:


(a) Chromosomal sex
(b) Gonadal sex
(c) Somatic sex and sexual orientation
(d) All

[Link] one of the following is not applicable to XY gondal dysgenesis?


(a) Swyer syndrome
(b) Hypogonadism
(c) Defect in specific gene on a chromosome
(d) Cockayne syndrome

[Link] syndrome can be diagnosed by:


(a) Karyotyping
(b) Pedigree analysis
(c) On the basis of behaviour
(d) Somatic cell hybridisation
[Link] one of the following is a key gene in human sex determination?
(a) DAX,
(b) SRY
(c) SOX9
(d) All

Consider the following statements:


(A) 47 XYY syndrome was first reported by Sandberg (1961)
(B) 47 XYY is an aneuploidy
(C) 47 XYY is inherited
(D) The incidence of 47 XYY is not affected by advanced paternal or maternal age
[Link] incorrect statements are:
(a) A, Band C
(b) Band C
(c) B, C and D
(d) C

[Link] one of the following is not used in the analysis of human genetics?
(a) Test cross
(b) Karyotyping
(c) Pedigree analysis
(d) RFLP analysis

[Link] one of the following is an X-linked dominant trait within uterolethality for a hemizygous male?
(a) Marfan syndrome
(b) Mucopolysaccharidosis
(c) Incontinentia pigmenti
(d) Intestinal polyposis

[Link] one of the following is an X-linked recessive trait?


(a) Hurler syndrome
(b) Hunter syndrome
(c) Sanfilippo syndrome
(d) Morquio disease

[Link] diagnosis is not possible for:


(a) Gardner syndrome
(b) Multiple endocrine neoplasia
(c) Hunter syndrome
(d) All

[Link] one of the following is not applicable to neurofibromatosis?


(a) Autosomal dominant
(b) Full penetrance but variable expression
(c) Prenatal diagnosis possible
(d) von Recklinghausen disease
[Link] the given pedigree, the pattern of inheritance is:
(a) Sex-linked dominant
(b) Sex-linked recessive
(c) Autosomal dominant
(d) Autosomal recessive

[Link] one of the following is an autosomal dominant trait with complete but age-dependent
penetrance having locus on 4 pter?
(a) Huntington disease
(b) Wilson disease
(c) Morquio disease
(d) von Recklinghausen disease

[Link] frequency of nondisjunction increases:


(a) With increasing maternal age
(b) With maternal hypothyroidism
(c) After irradiation or viral infection
(d) All

143.A consanguineous couple is at increased risk for:


(a) Congenital malformations
(b) Autosomal recessive traits
(c) Multifactorial traits
(d) All
Consider the following statements:
(A) Pericentric inversions do not produce clinical abnormality in the carrier
(B) In pericentric inversion, there is a risk of producing chromosomally unbalanced offsprings
(C) Diego positive blood group is found only in East Asians and North Americans
(D) The frequency of blood groups is known to be affected by genetic drift, geographical isolation,
temporal variation and natural selection

[Link] incorrect statements are:


(a) C and D
(b) A and D
(c) Band D
(d) None

[Link] the affected males of an autosomal dominant trait with sex limitation are infertile, then the pedigree
pattern is identical to where males do not reproduce:
(a) An X-linked dominant
(b) An X-linked recessive
(c) XY-linked
(d) Autosomal recessive

[Link] Fragment Length Polymorphisms (RFLPs) are important tools for:


(a) Gene mapping
(b) Prenatal diagnosis
(c) Carrier detection
(d) All

[Link] one of the following statements is incorrect?


(a) In human beings, independent assortment of X chromosomes only occurs in females.
(b) Gene dosage cannot be assessed by the intensity of bands on autoradiographs.
(c) Tetraploidisation may well have been an early step in the origin of human karyotype.
(d) A chimaera is an individual with two cell lines, which were derived from two separate zygotes.

[Link]-Marie tooth disease is:


(a) Generally autosomal dominant
(b) Rarely autosomal recessive
(c) X-linked dominant
(d) All

[Link] is rare in:


(a) Indians
(b) Negroes
(c) Ashkenazi Jews
(d) All

[Link] which one of the following is prenatal diagnosis possible?


(a) Zellweger syndrome
(b) Waardenburg syndrome
(c) Gardner syndrome
(d) Peutz-Jeghers syndrome

You might also like