0% found this document useful (0 votes)
17 views15 pages

Exploring Biological Databases and Tools

The document outlines a lab assessment focused on biological databases and tools, detailing experiments aimed at familiarizing students with accessing and utilizing various biological data sources. It includes definitions of biological data, databases, and examples of specific biological databases like GenBank, PDB, and PubMed. Additionally, it describes features of tools such as BLAST and SwissDock, and provides protocols for converting sequence formats using a file format converter.

Uploaded by

Suryaa
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
17 views15 pages

Exploring Biological Databases and Tools

The document outlines a lab assessment focused on biological databases and tools, detailing experiments aimed at familiarizing students with accessing and utilizing various biological data sources. It includes definitions of biological data, databases, and examples of specific biological databases like GenBank, PDB, and PubMed. Additionally, it describes features of tools such as BLAST and SwissDock, and provides protocols for converting sequence formats using a file format converter.

Uploaded by

Suryaa
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

Biological Databases Lab

BBIT418P

Assessment – 1

By:
Suryaa .A
21BCB0032
Experiment 1
Accessing Biological database/tools

Aim: To get familiarize with the different biological databases and tools.

1. Answer the following questions using search engine?


a.) What is a data related to biology?
Biological data refers to any information related to living organisms. This
includes data on genes, proteins, cellular components, and entire ecosystems. It
can come from experiments (e.g., DNA sequences, protein structures),
observations (e.g., ecological data), or computational predictions (e.g., gene
functions). Biological data is often used to understand the structure, function,
and evolution of organisms.

b.) What are databases?


A database is an organized collection of data that can be easily accessed,
managed, and updated. Databases store large amounts of information in a
structured format, allowing for efficient retrieval and manipulation of data. They
can be used for a variety of purposes, from managing business information to
storing scientific data.

c.) What are biological databases?


Biological databases are specialized databases that store data related to biology.
These databases collect, organize, and make accessible information such as
DNA sequences, protein structures, gene functions, and more. They are essential
tools for researchers in the fields of genomics, proteomics, and other areas of
biology, enabling them to retrieve and analyze biological data efficiently.
d.)Give an examples for sequence database, structure database and
literature database.

 Sequence Database: GenBank is a comprehensive public database of


nucleotide sequences and supporting bibliographic and biological
annotation.
 Structure Database: Protein Data Bank (PDB) is a database of 3D
structural data of large biological molecules, such as proteins and nucleic
acids.
 Literature Database: PubMed is a free search engine accessing
primarily the MEDLINE database of references and abstracts on life
sciences and biomedical topics.

2. Visit the following biological database website URL's and answer the
following questions

[Link]
[Link]
[Link] or [Link]
[Link]
[Link]
a) How the sequence are arranged in NCBI database?
b) Which database is more specific to the literature data among the above
databases?

c) Name the database which is specific to protein 3D structure? Describe


the contents present in it.
d) Write the feature of the following tools

i)BLAST – NCBI
 Sequence Alignment: Compares a query sequence against a database.
 Fast Searches: Optimized for quick alignment of large datasets.
 Customizable: Adjustable parameters and various output formats.

ii)Clustal omega
 Multiple Sequence Alignment: Aligns many sequences simultaneously.
 Scalability: Handles large datasets effectively.
 High Accuracy: Uses advanced algorithms for precise alignments.

iii)Swiss-PdbViewer
 3D Visualization: Displays detailed protein structures.
 Mutagenesis: Models and analyzes protein mutations.
 Energy Minimization: Optimizes protein conformations.

iv)SwissDock
 Molecular Docking: Predicts how small molecules bind to targets.
 Web-Based: Accessible through a web interface for ease of use.

V)STRING-covid
 Protein-Protein Interactions: Maps interactions between proteins related
to COVID-19.
 Data Integration: Combines data from various sources to study viral
mechanisms.

Experiment 2
Conversion of sequence/structure from one database format to another
using file format converter

AIM: To convert sequence from one database format to another using file
format converter

PROTOCOL:
1. Open Browser (Chrome or Firefox) from your system
2. Visit the OPENBABEL Chemical File Format Converter
([Link]
[Link])
Part A
I)Input Query sequence (SMILES format):
1.C1=CN=CC=C1C(=O)NN

2.CC1=CC(=C(C(=N1)SC)NC(=O)CN2CCN(CC2)CCSC3=NC4=CC=CC=C4
N3)SC
Try for the following and save the results
a. Retrieve the PDB format for the input query sequence
i)C1=CN=CC=C1C(=O)NN

ii)CC1=CC(=C(C(=N1)SC)NC(=O)CN2CCN(CC2)CCSC3=NC4=CC=CC=C4
N3)SC
b. Retrieve the SDF format for the input query sequence
i)C1=CN=CC=C1C(=O)NN
ii)CC1=CC(=C(C(=N1)SC)NC(=O)CN2CCN(CC2)CCSC3=NC4=CC=CC=C4
N3)SC
II)Input Query sequence (SDF format):
[Link] the following structure in the structure editing panel
OUTPUT:

Convert the following sequence (text file) into fasta format


GACAGTCTTACGTACTAATGCGTCGTACGTCGTCGTGTCGTAGTA
GTCGTGTCTGCAATCAGTAGTGCTATGCGTCGTCGTAGTAGTCCT
GTCGTGATGCTGACTGTGCTGCTGCGTACTGAGCTGTCGCGCGT
GTCTGCAGTCGTCGTAGTCGTACGTACGTACGCCGTGTACGTACG
TGTACGTACTGCTGCACGTAGCTAGATCGTACTCATGTCATCGAT
C

OUTPUT:

Common questions

Powered by AI

BLAST is crucial for sequence alignment and comparison, allowing researchers to identify evolutionary relationships and functional similarities between sequences quickly . Clustal Omega performs multiple sequence alignment, essential for studying conservation and variability across multiple sequences which is key for understanding functional domains and evolutionary patterns . Swiss-PdbViewer provides a detailed visualization of protein structures, supporting tasks such as mutagenesis and structural analysis, which aids in understanding protein dynamics and designing experiments related to protein function . These tools are indispensable in bioinformatics for enhancing our understanding of biological data through visualization and structural and functional comparisons.

Integrated databases like STRING-covid support research on viral mechanisms by mapping out protein-protein interactions related to COVID-19 . These databases combine data from various sources to provide comprehensive insights into the molecular interactions that underlie the viral life cycle. By understanding these interactions, researchers can identify potential therapeutic targets and develop strategies to disrupt the virus's ability to replicate or evade the immune system . The integration of diverse types of data allows for a multidimensional view of viral biology, which is crucial for developing effective interventions against COVID-19.

The Protein Data Bank (PDB) is essential for researchers because it provides detailed 3D structural data of proteins and nucleic acids . This information is invaluable for studying protein function, designing drugs, and engineering biomolecules. The 3D structures are crucial for understanding the spatial arrangement and interaction sites on proteins, which can lead to insights into how proteins work within the cellular environment and how they can be modulated in therapeutic contexts . PDB's extensive collection makes it a fundamental resource in structural biology and molecular biology research.

Converting biological sequences between different database formats can be challenging due to potential loss of data fidelity and differences in format specifications . However, it is beneficial for integrating data across various platforms and tools in bioinformatics research. Tools like OPENBABEL facilitate this process by providing a versatile chemical file format converter, which allows researchers to convert sequences to formats that are compatible with different analytical tools without manual reformatting . This ensures data interoperability and enhances the capacity to utilize diverse bioinformatics tools effectively, ultimately advancing scientific inquiry.

Web-based molecular docking tools like SwissDock have significantly impacted the study of drug-target interactions by providing a platform for predicting how small molecules interact with biological targets . They facilitate the virtual screening of potential drug candidates, allowing for quick and cost-effective identification of promising compounds. SwissDock's accessibility through a web interface broadens its use among researchers who may not have access to powerful computational resources, thus democratizing drug discovery . The ability to perform molecular docking studies enhances our understanding of the mechanisms of drug action and accelerates the development of new therapeutics.

File format converters like OPENBABEL provide the advantage of handling diverse chemical and biological data by enabling seamless conversion between different formats, such as SMILES to PDB or SDF . This flexibility facilitates data integration from various sources, which is often necessary in multidisciplinary projects involving computational chemistry, molecular biology, and bioinformatics. By supporting a wide range of file formats, OPENBABEL enhances data interoperability and allows researchers to leverage specialized software tools tailored for specific formats, thereby improving the accuracy and efficiency of data analysis and interpretation .

Biological databases store various types of data such as DNA sequences, protein structures, and gene functions, among others. DNA sequences help in understanding genetic information and evolutionary relationships . Protein structures reveal the 3D shape of proteins, which is crucial for understanding protein function and interactions . Gene functions provide insights into the roles that different genes play within an organism, aiding in functional genomics studies . Each data type allows researchers to analyze biological processes at different levels, contributing to advancements in fields such as systems biology, drug development, and personalized medicine.

The National Center for Biotechnology Information (NCBI) plays a pivotal role in biological research by providing access to a wide array of databases and bioinformatics tools. It organizes sequence data into structured formats that allow for efficient retrieval and analysis . For example, the sequences are curated in a way that links them to relevant bibliographic and biological annotations, which aids in comparative genomics and functional genomics studies . NCBI's resources support researchers in understanding molecular biology, genetics, and genomics across diverse biological organisms.

GenBank provides a comprehensive collection of nucleotide sequences, which supports research in genetics and evolutionary biology by allowing extensive genomic comparisons . Protein Data Bank (PDB) offers 3D structural data of biological molecules, facilitating the study of protein interactions and the development of therapeutic agents based on protein structure-function analysis . PubMed, as a literature database, provides access to life sciences and biomedical literature, enabling researchers to stay informed about the latest scientific discoveries and methodologies . Together, these databases support a wide range of bioinformatics applications, from data analysis to knowledge dissemination.

Biological databases enhance ecosystem studies by organizing and making accessible large volumes of ecological data, such as species distributions, genetic variations across populations, and interactions within ecosystems . This information allows scientists to model ecological networks and understand biodiversity and conservation efforts. By examining data on how organisms interact with each other and their environments, researchers can predict ecosystem changes in response to various factors, such as climate change or human interventions, and implement conservation strategies more effectively . Such databases are thus critical for sustaining biodiversity and ecological health.

You might also like