0% found this document useful (0 votes)
4 views10 pages

Zombie DNA Mutation Analysis

The document discusses the genetic mutations associated with Zombie DNA, Cystic Fibrosis, and Sickle Cell Anemia, detailing the processes of transcription and translation, as well as the symptoms and treatments for these conditions. It highlights that Cystic Fibrosis is linked to the CFTR gene and is most common in white individuals, while Sickle Cell Anemia arises from a mutation in the B-Globin gene and predominantly affects those of African descent. Additionally, it outlines the organizations and resources available for support and research related to these genetic disorders.

Uploaded by

mandevillehv
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
4 views10 pages

Zombie DNA Mutation Analysis

The document discusses the genetic mutations associated with Zombie DNA, Cystic Fibrosis, and Sickle Cell Anemia, detailing the processes of transcription and translation, as well as the symptoms and treatments for these conditions. It highlights that Cystic Fibrosis is linked to the CFTR gene and is most common in white individuals, while Sickle Cell Anemia arises from a mutation in the B-Globin gene and predominantly affects those of African descent. Additionally, it outlines the organizations and resources available for support and research related to these genetic disorders.

Uploaded by

mandevillehv
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Zombie DNA Mutation

Hope Mandeville & Abby Mars


Non infected DNA
Non - infected DNA
5’TACCTCTCTGGATACCGCAAGCGAAACGGCAATGGGGTATTGGCACAGGACAAAGCTTTGTATGGTATT3’

Non infected mRNA


5’AUGGAGAGACCUAUGGCGUUCGCUUUGCCGUUACCCCAUAACCGUGUCUGUUUCGAAACAUACCAUA
A3’

Non infected protein


METGLUARGPROMETALAPHEALALEUPROLEUPROHISASHARGRAILEUPHEARGASNLLEPRO
Zombie DNA
Zombie DNA:
3’TACCTCTCTGGATACCGCAAGCGAAACGGCACTGGGGTATTGGCACAGGA
CAAAGCTTTGTATGGTATT 5’
Zombie RNA:
AUGGAGAGACCUAUGGCGUUCGCUUUGCCGUGACCCCAUAACCGUGUCCU
GUUCGAAACAUACCAUAA
Zombie Protein:
Met, Glu, Arg, Pro, Met, Ala, Phe, Ala, Leu, Pro, STOP, Pro, His, Asn, Arg, Val,
Leu, Phe, Arg, Asn, Ile, Pro, STOP
Process of Transcription
Transcription is when mRNA is created from DNA.

Steps of that process:

1). Helicase breaks open DNA


2). RNA Polymerase builds mRNA from parent DNA strand.

3). mRNA is created with RNA nucleotides opposite from the DNA.
Process of Translation
Translation is the process in which the mRNA is formed into the protein it’s coded
for.

Steps of Transcription:

1). mRNA leaves the nucleus and goes into the cytoplasm.

2). mRNA finds a ribosome and the rRNA signals the tRNA

3). On the tRNA the codons and the anticodon pair up.

4). The amino acids then pair up.


Type of mutation: Point Mutation
This was discovered because the mutation is only three nucleotide and only
occurs at one point in the sequence.

It is also a gene mutation and causes a premature stop in the process,


therefor stopping the process of DNA replication.
Cystic Fibrosis
● The CFTR gene can be affected
● Symptoms
○ Very salty-tasting skin.
○ Persistent coughing, at times with phlegm.
○ Frequent lung infections including pneumonia or bronchitis.
○ Wheezing or shortness of breath.
○ Poor growth or weight gain in spite of a good appetite.
● Most commonly affects white people in the US, with some ethnic people being
diagnosed.
● One treatment is getting a replacement lung for the lung that is affected.
● One place that works to help is the Cystic Fibrosis foundation. They help in the search
for a cure for CF and supports a broad range of research initiatives to tackle the
disease from all angles.
Sickle Cell Anemia
Sickle Cell Disease Association of America Inc. is an organization that supports those with sickle cell
anemia.

Sickle Cell Anemia is a genetic disorder where red blood cells are not properly formed, resulting in a
difficulty to transport oxygen throughout the body. This disorder occurs because of a single-base pair point
mutation in the B- Globin gene. This results in the substitution of the amino acid valine for glutamic acid in
the β-globin chain.

Symptoms: Treatments: Those of African descent are most

- Anemia - Pain medicines likely to have Sickle Cell Anemia.


- Episodes of pain - Plenty of water
- Swelling of hands and feet - Blood transfusions
- Frequent infections - Red blood cell exchange
- Delayed growth or puberty - Vaccines and antibiotics
- Vision problems - Folic acid
Citations

● Inusa, B., Hsu, L., Kohli, N., Patel, A., Ominu-Evbota, K., Anie, K., & Atoyebi, W. (2019). Sickle Cell

Disease—Genetics, Pathophysiology, Clinical Presentation and Treatment. International Journal of Neonatal

Screening, 5(2), 20. [Link]

● About cystic fibrosis. (n.d.). Cystic Fibrosis Foundation. [Link]

● Cystic fibrosis: MedlinePlus Genetics. (n.d.).

[Link]

common,1%20in%2031%2C000%20Asian%20Americans.m

● Home | Cystic Fibrosis Foundation. (n.d.). [Link]


Citations
● Sickle cell anemia - Symptoms & causes - Mayo Clinic. (2022, December 22). Mayo Clinic.

[Link]

● Home - Sickle Cell Disease Association of America Inc. (2017, June 21). Sickle Cell Disease

Association of America Inc. [Link]

● Sickle cell disease. (n.d.). [Link].


[Link]
disease%20is%20more,Asian%2C%20Indian%2C%20and%20Mediterranean%20descent

You might also like