Isolation
Isolation
A R T I C L E I N F O A B S T R A C T
Edited by: Bing Yan The massive accumulation of polyethylene (PE) in the natural environment has caused persecution to the
ecological environment. At present, the mechanism of microbial degradation of PE remains unclear, and the
Keywords: related enzymes for degrading PE need to be further explored. In this study, a strain of Klebsiella pneumoniae Mk-1
Polyethylene which can effectively degrade PE was obtained from the soil. The degradation performance of the strains was
Klebsiella pneumoniae Mk-1
evaluated by weight loss rate, SEM, ATR/FTIR, WCA, and GPC. The key gene of PE degradation in the strain was
Laccase-like multi-copper oxidase
further searched, which may be the laccase-like multi-copper oxidase gene. Then, the laccase-like multi-copper
Enzymatic properties
Polyethylene degradation characterization oxidase gene (KpMco) was successfully expressed in [Link] and its laccase activity was verified, which reached
85.19 U/L. The optimum temperature and pH of the enzyme are 45 ◦ C and 4.0, respectively; it shows good
stability at 30–40 ◦ C and pH 4.5–5.5; Mn2+ and Cu2+ can activate the enzyme effect. After the enzyme was
applied to the degradation of PE film, it was found that the laccase-like multi-copper oxidase did have a certain
degradation effect on PE film. This study provides new strain and enzyme gene resources for the biodegradation
of PE, thereby promoting the process of PE biodegradation.
* Corresponding author at: College of Bioengineering, Sichuan University of Science & Engineering, Yinbin 644000, China.
E-mail addresses: zx15708286249@[Link] (X. Zhang), sunmay5520@[Link] (X. Feng), 19334018962@[Link] (Y. Lin), ghmei446@[Link] (H. Gou),
yaozhang0409@[Link] (Y. Zhang), yanglijuan@[Link] (L. Yang).
[Link]
Received 7 February 2023; Received in revised form 16 April 2023; Accepted 26 April 2023
Available online 2 May 2023
0147-6513/© 2023 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license ([Link]
nc-nd/4.0/).
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
microorganisms, and pointed out that laccase could act on PE molecules several times to remove the microorganisms attached to the surface of
to produce carbonyl groups, thus reducing the molecular weight of PE the film. After drying the surface moisture in an oven at 40 ◦ C, take it out
molecules (Santo et al., 2013). In the study of Trichoderma harzianum on and weigh it in time. According to the weighing results, the weight loss
PE degradation, [Link] et al. found that laccase and manganese rate of the PE film was calculated, and the weight loss rate = (m1-m2)/
peroxidase were associated with PE degradation (Sowmya et al., 2014). m1, where m1 was the initial weight of the PE film, and m2 was the
Martini M C used in silico profile hidden Markov models to identify weight of the PE film after 30 days. The strain with the highest weight
novel laccase-like genes in Ochrobactrum sp. BF15 (Carla et al., 2021). loss rate was selected for subsequent determination.
Laccases (EC [Link]), a member of the multicopper oxidase (MCO)
family, catalyze the oxidation of a wide range of inorganic and aromatic 2.3. Identification, sequencing, and phylogenetic analysis of PE-degrading
compounds, which is accompanied by the transfer of four electrons to strains
reduce oxygen molecules to water molecules (Solomon et al., 1996).
This broad catalytic capacity of laccases makes it suitable for a variety of The selected PE-degrading strains were seeded in LB medium at
biotechnological applications, such as decolorization of different types 37 ◦ C and 180 R /min for 12 h, and the colony morphology and Gram
of recalcitrant dyes, bioremediation of soil and water bodies, bleaching staining were observed, And collect the bacteria using the bacterial DNA
of pulp, and synthesis of natural products (Kai et al., 2021). However, genome extraction kit to extract the genome of the strain, then carry out
there are few reports on the degradation of PE by laccase-like multi- PCR amplification of 16 S rRNA, the universal primers were 27-F (5′ -
copper oxidase. CAGAGTTTGATCCTGGCT-3′ ) and 1492-R (5′ -AGGAGGTGATC
In this study, functional strains that could degrade PE films were CAGCCGCA − 3′ ). The PCR products were detected by 1% agarose gel
screened from forest soil with deeply buried PE films, and the degra electrophoresis and sent to Chengdu Qingke Company for sequencing.
dation performance of PE plastic was evaluated by weight loss rate, Sequencing results were compared with microorganisms in the GenBank
SEM, ATR/FTIR, WCA, and GPC, which provided strain resources for database using the Basic Local Alignment Search Tool (BLAST) created
reducing "white pollution". According to the comparative analysis of the by the National Center for Biotechnology Information (NCBI). The
reported multi-copper oxidase gene and laccase gene, the laccase-like reliable strain sequences with high similarity were selected, and the
multi-copper oxidase gene in the selected strain was explored and phylogenetic tree was constructed by the neighbor-joining method of
verified, in order to find the key gene of PE degradation in this strain. MEGA 7 software.
2.1. PE material and culture medium Take out the PE film with the highest weight loss rate measured in
2.2. The surface morphology was observed by SEM, and the change of
The PE film is a conventional food fresh-keeping bag film, with a chemical functional groups on the surface of the PE film was determined
weight-average molecular weight (Mw) greater than 130,000, belonging by ATR/FTIR. In addition, a change in the polarity of the PE film was
to low-density polyethylene (LDPE), and the weight-average molecular found in the WCA experiment. The changes in molecular weight before
weight (Mw) of PE powder is greater than 80,000. Cut the PE film into and after the degradation of the PE powder were determined using GPC.
4.0 cm * 4.0 cm and 1.0 cm * 1.0 cm pieces, soak them in 0.5% potas The PE films or PE powders that were not inoculated with the degrading
sium chloride for 1 h, rinse off the remaining potassium chloride with strains and cultured in LCFBM for 30 days were used as controls.
alcohol, and then use sterile rinse with water, dry at below 50 ◦ C, and
finally UV sterilize for 4 h. Liquid carbon-free basal medium (LCFBM) 2.5. Construction and induced expression of recombinant multi-copper
and Luria-Bertani (LB) medium was prepared with deionized water. oxidase plasmid
Each 1 000 mL of LCFBM contains K2HPO4 0.7 g, KH2PO4 0.7 g, MgSO4
7 H2O 0.7 g, NH4NO3 1.0 g, FeSO4 7 H2O 0.002 g, ZnSO4 7 H2O 0.002 g, The KpMco gene was amplified by PCR using Klebsiella pneumoniae
MnSO4 H2O 0.001 g, NaCl 0.005 g. Carbon-free basal agar medium Mk-1 genomic DNA as a template, and the upstream and downstream
(CFBAM) was prepared by adding 20 g of agar to 1 000 mL of LCFBM. primers were KpMco-F/ KpMco-R (KpMco-F: 5′ -CCGGAATTCCAACG
Prepared cultures were autoclaved at 121 ◦ C for 20 min TAGAGACTTCCTCAAACTG-3′ ;KpMco-R:5′ -CCGCTCGA
GAACCGTGAACCCCAACATCAT − 3′ ). The PCR product was purified
2.2. Preliminary screening of PE-degrading strains and digested with Xho I and EcoR I, and then connected to the expres
sion plasmid pET-28a to construct a recombinant expression plasmid
After mixing 2 g of soil with physiological saline, 5 mL of the upper pET-28a-KpMco, which was transformed into [Link] DH5α, and the re
liquid was taken into LB medium (50 mL/250 mL conical flask), and combinant was identified by double digestion, the positive recombinant
incubated at 30 ◦ C, 180 r/min in a constant temperature shaker for 1 d to plasmids were sent to Qingke Biological Company for sequencing. The
complete the enrichment of microorganisms. CFBAM (containing 10 g/L recombinant expression plasmid pET-28a-KpMco was transformed into
PE powder) was prepared, and the enriched bacterial solution was [Link] BL21 (DE3), and the recombinant [Link] BL21/pET-28a-KpMco
diluted and spread on CFBAM plates containing PE powder and incu was cultured overnight and activated. The seed liquid of the cultured
bated at 30 ◦ C for 3 d. After the strains grow, pick a single strain and recombinants was inoculated into a fresh LB medium (containing 50 μg/
streak it on a CFBAM plate containing PE powder, repeat the above plate mL kanamycin). The cells were incubated at 37 ◦ C with shaking at 180
streaking operation 3 times, purify, screen, and pick a single strain with rpm for 2–3 h, added with 1 mM isopropyl-β-D-thiogalactoside (IPTG),
better growth, and compare the colony morphology under a microscope and incubated for 8 h at 25 ◦ C and 180 rpm. The recombinant E.
size and color, etc., strains with different shapes were stored and coliBL21/pET-28a-KpMco was collected at 4 ◦ C and 7000 rpm. The cells
numbered at 4 ◦ C. were washed twice with 20 mM PBS (pH 7.4), resuspended, and soni
Accurately weigh the initial weight of the prepared PE film and cated. The disrupted bacterial solution was centrifuged at 4 ◦ C and 7000
number it, add it to LCFBM (50 mL/250 mL conical flask) after sterili rpm for 30 min, and the crude enzyme solution of KpMCO was collected.
zation, activate the screened strain, and inoculate it into the PE film at
an inoculum of 5%. In the LCFBM of 30 ◦ C, 160 r/min constant tem 2.6. Multi-copper oxidase laccase activity assay
perature shaking culture for 30 d, each strain was made three parallels.
The PE film was taken out from the 30 day co-culture solution, soaked in The enzyme activity of KpMCO was determined by the visible light
2% SDS solution for 4 h, and repeatedly washed with sterile water for absorption method: 2,2 ’-azo-bis-3-ethyl benzothiazoline 6-sulfonic acid
2
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
(ABTS) was used as the substrate to measure the change of OD value Table 1
within 3 min at 420 nm. The reaction system consisted of 0.2 mL enzyme The Weight Loss Rate of PE film.
solution, 3.8 mL buffer containing 0.5 mmol/L ABTS, and 1 mmol/L Serial number Weight loss rate/%
HAK-NAAC. The amount of enzyme required to oxidize 1 μmol of ABTS
Mk-1 2.21 ± 0.025a
per minute was defined as one unit of enzyme activity (U) (Bourbonnais Mk-2 1.63 ± 0.062b
and Paice, 1990). The calculation formula of enzyme activity is as Mk-3 0.76 ± 0.020d
follows: Mk-4 1.55 ± 0.019c
/ Mk-5 1.51 ± 0.029c
V0 × ΔOD × n Mk-6 1.49 ± 0.028c
Enzyme activity(U L) = 106 × Mk-7 0.78 ± 0.012d
Δt × V1 × ε
Mk-8 0.77 ± 0.012d
In the formula: ΔOD is the change value of OD420; Δt is the reaction Mk-9 1.49 ± 0.033c
time (min); V1 is the amount of enzyme (0.2 mL); V0 is the total volume Mk-10 1.49 ± 0.029c
of the reaction system (4 mL); n is the dilution ratio of the enzyme so Note: The data are presented as the means ± standard de
lution; ε is the Molar extinction coefficient (ε = 3.6 ×104 L⋅mol-1⋅cm- viations of three independent experiments;Different
1). lowercase indicate significant differences between treat
ments (P<0.05).
3
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
Fig. 1. The Neighbor-Joining method was used to infer the evolutionary history of strains Mk-1.
that during the 30 d degradation process, hydrophilic groups were EcoR I, two bands of about 5200 bps and 1600 bps appeared in the
formed on the surface of the PE film. This result is favorable for the product. The experimental value was in line with the theoretical value,
attachment and colonization of strain microorganisms on PE, which indicating that the vector pET28a-KpMco was successfully constructed
further accelerates the degradation rate of PE. (Fig. 3B). The target gene was induced with 1 mM IPTG to achieve its
ATR/FTIR imaging was used to analyze the changes of functional expression in E. coli. The size of 60 kDa detected by SDS-PAGE was
groups on the surface of PE films. The PE films incubated with strain Mk- consistent with the theoretical value (Fig. 3 C). It was partially soluble
1 had different film surfaces compared to the control (Fig. 2E). Due to and expressed in a small amount in the supernatant. Under the condition
the C-H bending vibration in the PE long-chain backbone, both the of 37 ℃, the multi-copper oxidase activity of the supernatant was
experimental group and the control group have a common peak at determined to be 85.19 U/L.
1450 cm-1. However, the experimental group showed an exponential
decrease in the carbonyl band range (1600 cm-1–1850 cm-1), that is, a 3.4. Effects of temperature and pH on the enzymatic activity and stability
new functional group carbonyl was formed on the membrane surface. of multicopper oxidase
Studies have shown that the appearance of carbonyl groups is an
important marker of PE biodegradation. Yang Jun and Wasserbauer The enzyme activity of KpMCO was measured at a temperature of
et al. found that PE films exposed to PE-degrading strains showed 30–60 ◦ C (Fig. 4A), and it was found that the optimal temperature of the
oxidation structures and carbonyl groups in the FTIR spectrum (Jun enzyme was 45 ◦ C, and when the temperature was greater than 55 ◦ C,
Yang et al., 2014; Wasserbauer et al., 1990). the enzyme activity dropped sharply. Its optimum temperature for
Shabbir used GPC to verify the degradation effect of microorganisms enzymatic activity is lower than the optimum temperature (80 ◦ C) of the
on PE, and its weight-average molar mass (Mw) and number-average laccase derived from Bacillus amyloliquefaciens (Hongbin Wang et al.,
molar mass (Mn) both decreased (Sadaf Shabbir et al., 2020). In GPC 2020) and higher than the optimum temperature of the laccase derived
results of this study, the Mn of PE powder decreased from 19979 to from Psychrobacter sp. NJ228 (30 ◦ C) (AilinZhang et al., 2022). The
17258, the Mw decreased from 81315 to 77890, the relative molecular optimum temperature (40 ℃) of laccase of Bacillus sp. ADR is similar
mass decreased by 4.21%, and the relative molecular mass of PE powder (Telke and Dayanand, 2011). The stability at 30–60 ◦ C is shown in
decreased, This result indicated that strain Mk-1 did degrade PE. Fig. 4B. After the enzyme was incubated at 30–40 ◦ C for 0.5 h, the re
sidual enzyme activity was greater than 95%; when the temperature was
3.3. Cloning and expression of KpMco gene higher than 40 ◦ C, the stability of the enzyme began to decline. The
enzyme showed higher enzymatic activity at lower pH (Fig. 4C). Within
The exploration of PE biodegradation mechanisms and the isolation the pH range used in this study, the enzyme exhibited the highest
of a large number of PE-degrading species motivated researchers to dig enzymatic activity at pH 4. The pH values of the highest laccase activity
into PE degradation-related enzymes (Zhang et al., 2022). Numerous of Sphingobacterium ksn-11 and Psychrobacter sp. NJ228 were 4.5 and
studies have shown that laccase is a copper-containing polyphenol oxi 3.0, respectively (AilinZhang et al., 2022; Neelkant et al., 2020). The pH
dase and the most important member of the multicopper oxidase family. stability of the enzyme is an important indicator for the practical
In addition, many multicopper oxidases have been found to have laccase application of the enzyme. After the enzyme was stored at 4 ◦ C for 4 h
activity and play an important role in the biodegradation of PE (Santo under different pH conditions, the residual enzyme activity of the
et al., 2013; Boonen et al., 2014; Fujisawa et al., 2001; Luka et al., 2015). enzyme was determined at pH 4 (Fig. 4D). The enzyme showed good
In this study, through the annotation and comparative analysis of the stability at pH 4.5–5.5, and the residual enzyme activity was greater
multi-copper oxidase gene in the NCBI database, it was speculated that than 85%; when the pH was greater than 5.5, the stability of the enzyme
the multi-copper oxidase gene of the MK-1 strain could degrade PE. The decreased rapidly, and the residual enzyme activity at pH 6 only
genomic DNA of MK-1 was obtained, the KpMco gene was amplified by accounted for 19.23% of the initial enzyme.
specific primers, and the size of the target gene was detected by 1%
agarose electrophoresis to be 1.6 kbps (Fig. 3 A). The PCR product was 3.5. The effect of metal ions on the activity of multicopper oxidase
cloned into the expression plasmid pET-28a and transferred into [Link]
DH5α competent cells, positive transformants were selected, and the In this study, the effect of metal cations on the enzyme activity of
recombinant expression plasmid pET-28a-KpMco was extracted for KpMCO was investigated. It can be seen from Table 2 that Mn2+ and
verification by enzyme digestion. After double digestion with Xho I and Cu2+ can activate KpMCO. Among them, Cu2+ has the greatest
4
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
Fig. 2. Characterization of PE film degradation by strain MK-1. (A and B) SEM observations of the physical surface topography of the sterile control (A) versus the PE
sheets incubated with strains Mk-1 (B) after 30 days. (C and D) WCA observation of physical surface hydrophilicity of the sterile control (C) versus the PE sheets
incubated with strains Mk-1 (D) after 30 days. (E) ATR-FTIR spectra analysis of the sterile control and PE samples after the 30-day incubation with strains Mk-1.
activation effect on KpMCO, and the enzyme activity is increased by 4 from Bacillus sp. CF96 in the presence of Mn2+ and Cu2+. Laccase activity
times. The remaining K+, Mg2+, and Fe2+ inhibited the activity of (Chong Zhang et al., 2013; Javadzadeh and Asoodeh, 2020). Contrary to
KpMCO. Similar to the previous results, Zhang et al. found that laccase the results, the presence of Mg2+ was reported to increase the laccase
from Bacillus vallismortis FMB-103 and Javadzadeh et al. studied laccase activity, while the presence of Mg2+ did the opposite.
5
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
Fig. 3. Cloning and expression of multicopper oxidase (KpMco) from Klebsiella pneumoniae. (A) PCR amplification results of KpMco. Lane 1: DNA marker
(100–2000 bps); Lane 2: KpMco amplification results (1599 bps). (B) The recombinant plasmid pET-28a-KpMco was digested with XhoI and EcoRI restriction en
zymes. Lane 1: DNA marker (500–15000 bps); Lane 2: Double digestion of the pET-28a-KpMco sequence with an insertion size of 1599 bps. (C) Analysis of multiple
copper oxidase (KpMCO) by SDS-PAGE. Lane 1: Standard protein marker; Lane 2: IPTG induced crude protein expressed by E. colicarrying plasmid pET-28a-KpMco;
Lane 3: IPTG-induced ultrasound-treated supernatant of E. coli carrying plasmid pET-28a-KpMco; Lane 4: IPTG-induced ultrasound-treated precipitation of E. col
icarrying plasmid pET-28a-KpMco.
Fig. 4. Determination of enzymatic properties of multicopper oxidase (KpMco). (A) Effect of different temperature on enzymatic activity of KpMco. (B) The tem
perature stability of KpMco. (C) Effect of different pH on enzymatic activity of KpMco. (D) The pH stability of KpMco.
3.6. Degradation performance of multi-copper oxidase on PE film empty plasmid was used as the control group. After KpMCO crude
enzyme solution (Fig. 5A-B), obvious cracks and holes appeared on the
The PE film treated with the expression supernatant of the pET-28a surface of the PE film in the experimental group, but not in the control
6
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
Table 2 4. Conclusion
Effect of metal ions on KpMCO enzyme activity.
Metal ions Relative activity / (%) In this study, a strain of Klebsiella pneumoniae Mk-1, which can
degrade PE plastics, was obtained, and the degraded LDPE films were
Control 100.00 ± 1.95c
K+ 90.97 ± 1.60c characterized by different analytical techniques (weight loss, surface
Mg2+ 57.33 ± 1.11d morphology, functional group analysis, contact angle, relative molecu
Fe2+ 94.90 ± 1.78c lar weight, etc.) degradability. The weight loss rate of Mk1 within 30
Mn2+ 115.18 ± 1.99b days was 2.21%. SEM found that there were obvious pores on the surface
Cu2+ 400.92 ± 5.58a
of the PE film after the strain was degraded; ATR/FTIR found that new
Note: The data are presented as the means ± standard de functional groups (carbonyl groups) were generated on the surface of
viations of three independent experiments;Different the PE film, and the appearance of carbonyl groups indicated that the PE
lowercase indicate significant differences between treat film was oxidized; The change of WCA characterizes the generation of
ments (P<0.05).
hydrophilic groups; in the GPC determination, the relative molecular
mass of the PE film decreased by 4.21%.
group. SEM results show that KpMCO can cause some damage to the In addition, the laccase-like multi-copper oxidase gene derived from
surface morphology of PE films. In the contact angle test of the PE film Mk-1 was explored, and its heterologous expression in E. coli was real
mixed with the enzyme solution after treatment (Fig. 5C-D), the contact ized. The enzymatic properties related to the laccase activity of the gene
angle θ of the control group was 78.22◦ and the contact angle θ of the were studied, and it was found that the optimum temperature and op
experimental group was 45.23◦ . The degraded contact angle value timum pH for the enzymatic reaction of the enzyme were 45 ◦ C and 4.0,
became smaller, indicating that the polarity of the PE film changed, and respectively. The thermal stability was better at 30–40 ℃, and showed
hydrophilic groups were formed on the surface of the film. In addition, better stability at pH 4.5–5.5. Mn2 + and Cu2 + could activate the
in the gel permeation chromatography (GPC) results, the Mn (25819) laccase activity of KpMco. In this study, the protein was applied to the
and Mw (100428) of the PE film of the experimental group were degradation of PE film, and the characterization results showed that the
significantly higher than those of the control group PE film (34197) and enzyme did have a certain degradation effect on PE film. The research
Mw (135592). The Mw decreased by 25.93%, and the Mn decreased by results provide an experimental basis for exploring the mechanism of
24.5%, indicating that the average molecular weight of the PE film microbial degradation of polyethylene.
decreased. Compared with the GPC results of the strain degrading PE
film (Fig. 2), Mn and Mw changed more, which proved that the strain CRediT authorship contribution statement
Mk- 1’s multi-copper oxidase has a good degradation effect on PE film.
Lijuan Yang conceived and designed the experiment. Xian Zhang Xu
Fig. 5. Characterization of PE degradation by multiple copper oxidase (KpMco). (A and B) SEM results; (A) PE film without KpMco treatment; (B) PE film treated
with KpMco. (C and D) WCA results; (C) PE film without KpMco treatment, with a contact Angle of 78.22◦ ; (D) The contact Angle of PE film treated with KpMco
is 45.23◦ .
7
X. Zhang et al. Ecotoxicology and Environmental Safety 258 (2023) 114965
Feng, and Yuan Lin completed most of the experimental work. Xian Geyer, R., Jambeck, J.R., Law, K.L., 2017. Production, use, and fate of all plastics ever
made. Sci. Adv. 3 (7), e170078.
Zhang and Yao Zhang analyzed the experimental results and wrote and
Hongbin Wang, L.H., Yanzhen, Li, Jieying, Ma, Shuang, Wang, Yuanfu, Zhang, Xiuqi, Ge,
received the manuscript. Houmei Gou assisted in data analysis. Lijuan Nan, Wang, Fuping, Lu, Yihan, Liu, 2020. Characterization and application of a
Yang supervised the overall work, revised the manuscript, and all au novel laccase derived from Bacillus amyloliquefaciens. Int. J. Biol. Macromol. 150,
thors read and approved the final manuscript. 982–990.
Javadzadeh, S.-G., Asoodeh, A., 2020. A novel textile dye degrading extracellular laccase
from symbiotic bacterium of Bacillus sp. CF96 isolated from gut termite
Declaration of Competing Interest (Anacanthotermes). Int. J. Biol. Macromol. 145, 355–363.
Jun Yang, Y.Y., Wei-Min, Wu, Jiao, Zhao, Lei, Jiang, 2014. Evidence of polyethylene
biodegradation by bacterial strains from the guts of plastic-eating waxworms.
No conflict of interest exits in the submission of this manuscript, and Environ. Sci. Technol. 48 (23), 13776–13784.
this manuscript is approved by all authors for publication. I would like to Kai, S., Shunyao, L., Youbin, S., Qingguo, H., 2021. Advances in laccase-triggered
declare on behalf of my co-authors that the work described was original anabolism for biotechnology applications. Crit. Rev. Biotechnol. 41 (7).
Khandare, Shrikant D., Niharika Mehru, D.A., Chaudhary, Doongar R., 2022. , Marine
research that has not been published previously, and not under bacterial based enzymatic degradation of low-density polyethylene (LDPE) plastic.
consideration for publication elsewhere, in whole or in part. All the J. Environ. Chem. Eng. 10 (3), 107437.
authors listed have approved the manuscript that is enclosed. Lee, B., Pometto, A.L., Fratzke, A., Bailey, T.B., 1991. Biodegradation of degradable
plastic polyethylene by phanerochaete and streptomyces species. Appl. Environ.
Microbiol. 57 (3), 678–685.
Data Availability Luka, A., Miha, Č., Marko, Š., Poklar, U.N., Ines, M.-M., 2015. Characterization of a novel
high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in
Thioalkalivibrio sp. Appl. Microbiol. Biotechnol. 99 (23).
The authors are unable or have chosen not to specify which data has
M, R. S.-J. F. S. W. S. T. K. D, 2018. Production of methane and ethylene from plastic in
been used. the environment. PloS One 13 (8).
Neelkant, K.S., Shankar, K., Jayalakshmi, S.K., Sreeramulu, K., 2020. Purification,
Acknowledgements biochemical characterization, and facile immobilization of laccase from
Sphingobacterium ksn-11 and its application in transformation of diclofenac. Appl.
Biochem. Biotech. 192 (3), 845.
This work was supported by Key science and technology plan pro Sadaf Shabbir, M.F., Naeem, Ali, Philip, [Link], Long-Fei Wang, S.K., Yi, Li, 2020.
jects of Zigong Science and Technology Bureau (2020YGJC14). Periphytic biofilm: an innovative approach for biodegradation of microplastics. Sci.
Total Environ. 717, 137064.
Santo, M., Weitsman, R., Sivan, A., 2013. The role of the copper-binding enzyme –
Appendix A. Supporting information laccase – in the biodegradation of polyethylene by the actinomycete Rhodococcus
ruber. Int. Biodeterior. Biodegrad. 84, 204–210.
Solomon, E.I., Sundaram, U.M., Machonkin, T.E., 1996. Multicopper oxidases and
Supplementary data associated with this article can be found in the oxygenases. Chem. Rev. 96 (7), 2563–2606.
online version at doi:10.1016/[Link].2023.114965. Sowmya, H.V., Ramalingappa, Krishnappa, M., Thippeswamy, B., 2014. Degradation of
polyethylene by Trichoderma harzianum—SEM, FTIR, and NMR analyses. Environ.
Monit. Assess. 186 (10), 6577–6586.
References Sridharan, R., Krishnaswamy Veena, G., Senthil, K.P., 2021. Analysis and microbial
degradation of Low-Density Polyethylene (LDPE) in Winogradsky column. Environ.
AilinZhang, Y., Quanfu, Wang, Yatong, Wang, 2022. Characteristics and polyethylene Res. 201, 111646.
biodegradation function of a novel cold-adapted bacterial laccase from Antarctic sea Telke, Amar A., Dayanand, G.S.G., Kalyani, C., Dhanve, Rhishikesh S.,
ice psychrophile Psychrobacter sp. NJ228. J. Hazard. Mater. 439 (129656). Govindwar, Sanjay P., 2011. Biochemical characteristics of a textile dye degrading
Alshehrei, F., 2017. Biodegradation of synthetic and natural plastic by microorganisms. extracellular laccase from a Bacillus sp. ADR. Bioresour. Technol. 1020 (2),
J. Appl. Environ. Microbiol. 5 (1), 8-1. 1752–1756.
Boonen, F., Vandamme, A.-M., Etoundi, E., Pigneur, L.-M., Housen, I., 2014. Tribedi, P., Sil, A.K., 2013. Low-density polyethylene degradation by Pseudomonas sp.
Identification and characterization of a novel multicopper oxidase from Acidomyces AKS2 biofilm. Environ. Sci. Pollut. Res. 20 (6), 4146–4153.
acidophilus with ferroxidase activity. %J. Biochimie 102. Vollmer, I., Jenks, M.J.F., Roelands, M.C.P., White, R.J., van Harmelen, T., de Wild, P.,
Bourbonnais, R., Paice, M.G., 1990. Oxidation of non-phenolic substrates. an expanded van der Laan, G.P., Meirer, F., Keurentjes, J.T.F., Weckhuysen, B.M., 2020. Beyond
role for laccase in lignin biodegradation. FEBS Lett. 267 (1), 99–102. mechanical recycling: giving new life to plastic waste. Angew. Chem. Int. Ed. 59
Carla, M.M., Francesca, B., Luka, A., Carmine, C., Carolina, V., Mariano, P., Antonio, L., (36), 15402–15423.
Ines, M., Flavia, M., Florencia, D.P.M., 2021. Identification and characterization of a Wasserbauer, R., Beranová, M., Vancurová, D., Doležel, B., 1990. Biodegradation of
novel plasmid-encoded laccase-like multicopper oxidase from ochrobactrum sp. polyethylene foils by bacterial and liver homogenates. Biomaterials 11 (1), 36–40.
BF15 isolated from an on-farm bio-purification system. Food Technol. Biotechnol. 59 Yang, J., Yang, Y., Wu, W.-M., Zhao, J., Jiang, L., 2014. Evidence of polyethylene
(4). biodegradation by bacterial strains from the guts of plastic-eating waxworms.
Chamas, A., Moon, H., Zheng, J., Qiu, Y., Tabassum, T., Jang, J.H., Abu-Omar, M., Environ. Sci. Technol. 48 (23), 13776–13784.
Scott, S.L., Suh, S., 2020. Degradation rates of plastics in the environment. ACS Zhang, Y., Pedersen, J.N., Eser, B.E., Guo, Z., 2022. Biodegradation of polyethylene and
Sustain. Chem. Eng. 8 (9), 3494–3511. polystyrene: From microbial deterioration to enzyme discovery. Biotechnol. Adv. 60,
Chong Zhang, S.Z., Hanwen, Diao, Haizhen, Zhao, Xiaoyu, Zhu, Fengxia, Lu, Zhaoxin, Lu, 107991.
2013. Purification and characterization of a temperature- and pH-stable laccase from Webb, H.K., Arnott, J., Crawford, R.J., Ivanova, E.P., 2013. Plastic Degradation and Its
the spores of Bacillus vallismortis fmb-103 and its application in the degradation of Environmental Implications with Special Reference to Poly(ethylene terephthalate).
malachite green. J. Agric. Food Chem. 61 (23), 5468–5473. Polymers 5 (1), 1–18.
Fujisawa, M., Hirai, H., Nishida, T., 2001. Degradation of polyethylene and nylon-66 by
the laccase-mediator system. J. Polym. Environ. 9 (3), 103–108.