High Ranker’s Biology:- 6265237391,

9891766736

NEET,ICAR
IISER

‘YOU
R GOAL IS UNDER YOUR RANGE KNOW’

Biology- XII
Study
MaterialforBRD,NEET,ICAR,IAT(IISER)

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 1
 High Ranker’s Biology:- 6265237391,
9891766736

*CONTENT AND MARKING SCHEME OF CBSE:-

s Unit – I 14/16
 Reproduction
1. Reproduction in Organisms
2. Sexual Ressproduction in Flowering Plants
3. Human Reproduction
4. Reproductive Health

 Unit – II 18/20
 Genetics and Evolution
5. Principles of Inheritance and Variation
6. Molecular Basis of Inheritance
7. Evolution

 Unit – III 14/12

 Biology in Human Welfare
8. Human Health and Disease
9. Strategies of Enhancement in Food Production
[Link] in Human Welfare

 Unit – IV 10/12
 Biotechnology
11. Biotechnology : Principles and Processes
12. Biotechnology and Its Applications

 Unit – V 14/10
 Ecology
13. Organisms and Populations
14. Ecosystem
15. Environmental Issues
16. Biodiversity and Conversation

(Mat Pita charankamlebhyoh: nmh:)

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 2
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER :2:- SEXUAL REORODUCTION IN FLOWERING PLANTS

# Introduction:-
*A flower is a sex organ of an
angiospermic plants.
*A flower is a modified shoot having
bright colour and nector to attract the
insects for pollination.
*It may be unisexual or dioecious and
bisexual or monoecious.
*They are sites of sexual reproduction
in flowering plants.
.
# Sexual reproduction in flowering plants:-
*During sexual reproduction pre-
fertilization structures Fig- An Angiospermic Flower (Bisexual flower)
and events shows stamen, microsporangium and pollen grains.
*Stamen is made up of long and slender stalk called the filament and the terminal bilobed
structure called anther. The number and length of stamens are variable in species to species.
*An anther is bilobed having two theca so are dithecous.
*There are four microsporangiums in two lobes known as pollen sacs.
*A microsporangium is generally surrounded by four wall layers i.e epidermis, endothecium, middle
layers and its innermost part tapetum, from outer to inner-side respectively.
*The outer three wall layers
protect and help to release the
pollen grains.
*The innermost layer is the
Tapetum. On its degeneration it
will nourishes the developing
pollen grains.

Fig- a.) Complete stamen b.) anther

Fig- a.) T.S of anther,
c.) A dehisced anther. b.) details of Microsporangium with
wall layers .

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 3
 High Ranker’s Biology:- 6265237391,
9891766736
*During degeneration of the tapetal layer it seems like multicellular but this is due to
degenerating wall of adjacent cells.
*At young the centre of microsporangium having sporogenous tissues (PMC) which undergo
meiotic divisions to form microspore tetrads, and the process is called microsporogenesis.
*Microspore tetrad disociate from each other and develop into pollen [Link] anther burst
pollens released out as powder. The pollen grains represent the male
gametophyte.

Fig- Formation and development of pollen grains and Germination of Pollen Grains (male
gametophyte).

# Male Gametophyte ---‘ A Pollen Grain ‘ :---

*A pollen is spherical 25-50 micrometer in diameter and double layered the hard outer layer is
called ‘exine’ made up of sporopollenin, most resistant organic material, no enzyme degrades
sporopollenin and inner ‘intine’ that is made up of cellulose and pectin and continuous in nature.
*The exine having germ pores, where sporopollenin is absent. The inner wall is intine.
*A mature pollen grain contains two cells larger vegetative cell and smaller generative cell which
floats in the cytoplasm of the vegetative cells.
*When pollen germinate, a pollen tube arises from germ pore having two male gametes on
division of generative cell. So a pollen or male gametophyte is three celled stage.
# Pollens and its products :-
*Pollen grains of many species e.g Parthenium or carrot grass, cause severe allergies and bronchial
disorders like
- asthma, bronchitis etc.
*This came into India as a contaminant with imported wheat, that was a quarantine failure..

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 4
 High Ranker’s Biology:- 6265237391,
9891766736
*Pollen grains are rich in nutrients and products are available in the form of tablets and syrup in
markets. Its consumption increases the performances of athletes and race horses.
*In cereals e.g Rice and Wheat pollens loose viability in 30 minutes while in leguminoceae,
solanaceae they persists for months.
* Cryopreservation:- Chefly Pollens stored with viability for years in liquid nitrogen -196o C,
even whole plant or any part of a plant called Explant can preserved at this temperature for
further use. This is known as cryopreservation.
*Tissue culture is a modern technique that helps in micro-propagation at large scale.

# The Pistil , Megasporangium OR Ovule and Embryo Sac :-

*The gynoecium represents the female reproductive part of the flower.
*If one pistil present called monocarpellary,more than one pistil called multicarpellary.
*When fused then syncarpous and if remain free is apocarpous.
*Each pistil has three parts the stigma, style and ovary.
*The stigma is bilobed received pollen grains, and ovary is basal bulged part, having placenta through
which megasporangia or ovule attached.
*No. of ovules in an ovary varies from species to species.

Fig- a.) A pistil of Hibiscus plant (Floral parts are removed) b.) Multicarpellary , syncarpous pistil of
Papaver
c.) Multicarpellary , apocarpous gynoecium of Michelia d.) A Typical anatropous ovule.
*One ovary containing plants- Wheat, Paddy, Mango etc.
*Many ovaries present in - Papaya, Orchids etc.

# Ovule OR Megasporangium :-
*The ovule is a small structure attached to the
placenta by stalk called funicle.
*The funicle fuses with ovule body is called hilum.
*Each ovule has one or two protective
envelops called integuments outer and inner.
*Integuments encircle the ovule except at
the tip, forming a small opening called the
micropyle. This side is known as
micropylar end from where pollen tube
will enter. Opposite the micropylar end is
the chalaza.
*Integuments enclosed mass of cells
called the nucellus always (2n), in which
embryo sac or female gametophyte is
present.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 5
 High Ranker’s Biology:- 6265237391,
9891766736
# Megasporogenesis and female gametophyte development :-
*The process of formation of megaspores from the megaspore mother cell inside gynoecium is called
megasporogenesis.
*A single megaspore mother cell (MMC- Diploid (2n)) of the nucellus towards micropylar end contains
dense cytoplasm undergo meiosis.
*Meiosis results in the production of four megaspores (n) as a linear tetrad.
*Mostly three degenerates from micropylar end and one is remain functional towards chalazal end.
*The functional one developed into the female gametophyte. Here only one out of four megaspore
take part in development of embryo sac, so is called monosporic development.
*The nucleus of the functional megaspore divide mitotically 3 times by free nuclear division and
form all together 8 nucleate embryo sac. In which three at micropylar end and consists the egg
apparatus i.e ‘one egg’ and ‘two synergids’ , two cells in the middle of the embryo sac that is
‘polar nuclei’ and three cells towards chalazal end called ‘antipodals’.

*The polar nuclei fuse together in the central cell, so embryo sac forms a 7 celled 8
nucleate structure. Figures- a.) A large megaspore mother cell; a dyad and a tetrad;
a.)2;4;8-nucleated stages of embryo sac and a mature embryo sac;
b.)A mature embryo sac, diagrammatical.

# Pollination :-
*Transfer of pollen grains on to the body
of stigma of a pistil is called pollination.
*Depending on the sources of
pollen, pollination can be divided
into three types :-
*(Autogamy & Geitenogamy-
under self pollination,) while
*( Xenogamy = Cross pollination)

Fig: Pollination and their types

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 6
 High Ranker’s Biology:- 6265237391,
9891766736
*Autogamy:-
*Transfer of pollen grains from the anther to the stigma of the same flower, e.g Viola (common
pansy), Oxalis and commelina. They produce chasmogamous flower i.e exposed anther and
stigma, and cleistogamous flower where they do not open e.g Pea.
*Geitenogamy :-
*Transfer of pollen grains from the anther to the stigma of another flower of the same plant. It usually
occurs in plants bear unisexual flowers. Ex – papaya and cucurbites.
*Xenogamy :-
*Transfer of pollen grains from anther to stigma of a different plant. It brings some genetic variations
that helps in gaining new improved characters for the plants.
# Pollinating Agents :-
*Those things which helps to bring pollens on to the body of stigma are known as pollinating agents.
Plants uses abiotic and biotic agents to achieve pollination.
*Abiotic agents- (Environmental physical factors)- Wind, Water.
*Animophily- wind pollinated e.g Maize, Grasses, Palm.
*Hydrophily- water pollinated plants e.g Hydrila, Zostera, Vallisnaria and Ceratophyllum etc.

*Biotic agents- They are living members. They are - Insects, Birds,
Bats, Snails, Ants etc.
*Entemophily- Insect pollinated plants. Bees and butterflies pollinate
maximum no. of flowering plants, e.g Yucca,
*Amorphophallus ( tallest flower 6 feet in height ), Magnolia etc.
*Ornithophily:- Birds pollinated plants e.g Bombax, Agave,
Bignonia, Butea etc.
*Chiropterophily:- Bat pollinated e.g Kizelia, Anthocephalus
(Kadam tree) and Adensonia.
*Malacophily or Conchophily:- pollination by snails e.g Arisaema
and some Arum lilies.
*Mirmicophily:- ants pollinated plants. Fig:- Hairy stigma n pendulous anther

*Cross-pollination is also performed by human beings during different breeding programmes

between selected varieties. It is known as controlled pollination. This is done to bring some desirable
change into a desired plant for humans advantage.
# Outbreeding Divices (plants own methods to avoid self-pollination):-
*Continued self-pollination results in inbreeding depression that results in poor yield and poor
quality of seeds. So flowers developed many devices to discourage self-pollination and to
encourage cross-pollination e.g
1.) Pollen and pistil not mature together, they shows -
Protoandry- Pollens mature first before stigma maturity e.g
Salvia, Sunflower.
Protogyny - Stigma mature first before release of pollens e.g
Mirabilis, Gloriosa etc.
2.) Anther and stigma placed on different positions.
3.) Self-incompatibility i.e genetic mechanism prevents self pollination.
4.) Produces unisexual flowers to prevent
autogamy n geitonogamy in caster, maize, papaya.
5.) Developing monoeciuos/dioecious plant body.
..

Fig:- Allowing right types pollen to germinate over stigma

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 7
 High Ranker’s Biology:- 6265237391,
9891766736
# Pollen –Pistil Interaction :-
*When a pollen come on to the stigma it germinates. On
germination a pollen tube arise from germ pore having
two male nuclei.
*The pistil has the ability to recognise the pollen, whether it is
of the right type (compatible) or of the wrong type
(incompatible).
*Compatibility and incompatibility during pollen-pistil
interaction are determined by special protein mainly
enzymes, present in the exine layers of pollen as well as
certain proteins and lipids on stigma surface.
# Artificial Hybridisation :-
*Crossing between two different plants having c
omplementary good traits in order to obtain overall
superior plants or hybrids which have good desired traits of
both the parent plants.
*Plants breeders use this technique for the improvement of crops.
*This is done by two methods:- emasculation, followed by bagging and tagging is also done.

*Emasculation is the process of removal of male parts (anthers ) from a bisexual flowers before its
dehiscence, without harming the female(pistil).
*Bagging – The emasculated flower is immediately cover by a poly bag or paper bag to avoid
unwanted pollens contamination.
*Tagging- is written information regarding the operated
flower on a paper sheet.
# Fertilisation :-
*The pollen tube enter through stigma and style towards
micropyle and filiform apparatus helps the male gametes
inside the embryo sac.
*The polar nuclei fuses with 1 of the male nuclei and forms
3n endosperm initial (PEN-primary endosperm nucleus),
later serve as nutritive substances for developing embryo.
*The egg fuses with remaining one male gamete that forms
zygote and it developed into embryo ( n+n=2n ) and by
division and development forms seed (2n).
*Here three haploid nuclei cells fuses for endosperm (PEN –primary endosperm nucleus -3n) is so
called ‘triple fusion’ and male gametes fuses with female gametes cell two time is called ‘double
fertilisation’.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 8
 High Ranker’s Biology:- 6265237391,
9891766736
# Endosperms (a nutritive arrangement for the embryo) :-
*Endosperm and Zygote formation is post fertilisation events :-
*Endosperms tissues are filled with food material and provide nutrition for the developing embryo.
(PEN develops later into PEC- primary endosperms cells).
*Genetically Endosperm is 3n (triploid) in nature.
*The development of endosperms is three types:- on the basis of development :---
*Free-nuclear- PEN divide without wall formation called free nuclear in maize, rice etc.
*Cellular- When endosperm initial divide by cell wall formation in each and every division is called
cellular endosperms e.g Datura, Balsum, Petunia etc.
*Hellobial – When endosperm initial cells first
divide by wall formation and then they divide
by free nuclear division forms hellobial
endosperms., e.g coconut and castor etc.
*Endosperms may either be completely
consumed called non-endospermic or non-
albuminous or dry seeds, e.g, Pea, Grams,
Beans, Groundnuts etc.
OR
*Sometime in certain seeds endosperms may
persists in the mature seeds and use by embryo
during germination called endospermic or
albuminous seeds e.g,Caster and coconuts .

Fig:- Development of various types of

endosperms
# Embrogeny- The Art Of Embryo
Development :-
*Development of embryo is called embryogeny are similar in both
monocots and dicots.
*A typical dicot embryo consists of an embryonal axis and two cotyledons.
*Axis above the level of cotyledons is the epicotyls which ended in plumule.
*The cylindrical portion below the level of cotyledons is hypocotyls that
ended in the redical.
*The tip covered with a root cap e.g Gram, Pea, Fruits and vegetables.
#Development of Dicot embryo :-
*When the zygote divides transversely, a two-celled proembryo is generated.
*The basal cell undergoes many transverse divisions.
*By dividing longitudinally twice, the terminal cell divides into four-celled stage is
referred to as the quadrant stage,now divide transversely to form an octant stage with eight cells
divided into two layers of four cells.
*The stem tip and cotyledons are formed in the lower, while the hypocotyl is formed in the higher .
*Periclinal division resulting in the formation of eight outer and eight inner cells.
*The dermatogen is made up of the eight outer cells, which divide the anticlinal and grow into the
epidermis.
*The periblem and plerome are formed by the inner cells. The periblem gives way to the
cortex, while the plerome gives way to the stele(xylem and phloem.)
*The basal cell divides multiple times to generate a six- to ten-cell long suspensor.
*The hypophysis is the suspensor cell nearest to the developing embryo.
*The root cap, epidermis, and cortex of the root are formed by repetitive divisions of the hypophysis.
*The curvature of the cotyledons is caused by further hypocotyl and cotyledon expansion and are
positioned laterally.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 9
 High Ranker’s Biology:- 6265237391,
9891766736

*Embryo of monocots possess only one cotyledon and is called scutellum e.g grass and cereals.
*At lower end the embryonal axis has the radical and root cap enclosed in an undifferentiated sheath
called coleorrhiza.
*Epicotyls is above portion of axis has a shoot apex and enclosed a hollow foliar structure the
coleoptiles e.g rice, wheat, maize etc.

Fig :- A to G are the steps of monocots embryonic development and H is the embryo of GRASS

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 10
 High Ranker’s Biology:- 6265237391,
9891766736
# SEED (enclosed within ovary)(2n) :-
* Seeds are formed inside fruits. Seed typically
consists of seed coat, cotyledon and embryo.
*When seeds having remanant of nucellus this
residual persistant nucellus is called
‘perisperms’, e.g black pepper and beet.
*Sometimes embryo enter into a state of
inactivity is called dormancy, in which seeds
generally mature self chemically and get an
ability to germinate.
*As ovules mature into seeds, the ovary develops
into a fruit. Wall of fruit called pericarp.
*Fruit may be fleshy e.g Guava, Orange, Mango etc, or may be dry e.g Groundnut, Mustard.
*In apple, strawberry and cashew, the thalamus also contributes to fruit formation such fruits are
called false fruits. If fruits develop from ovary is called a true fruit, e.g mango.
*In most of the species fruits develops without fertilisation such fruits are called a
parthenocarpic fruit, e.g Banana, grapes etc.

*Parthenocarpy can be induced through growth hormones that forms the seedless fruits.
*King Herod’s palace near The Dead sea-
*A 2000 years old viable seed of the date palm ‘Phoenix ductylifera’ was found.
*10,000 years old viable seeds of Lupinous arcticus is also recorded.
* *This represent that seeds are the plant products that over come adverse conditions and
when favourable conditions come they again develop as new plant body.
*Asteraceae and grasses have a special mechanism to produce seeds without fertilization called
apomixis.
8 nuclei female gametophyte.
* Apomixis is a form of asexual ANS_6. Draw the embryo sac i.e 7 celled 8 nucleated
reproduction that mimics sexual structure Fig 2.8 (c).
reproduction. ANS_7.In such flowers, the anthers and stigma lie
*A diploid egg cell is formed without reduction close to each other. Cleistogamous flowers never
division and develops into the embryo without open to
fertilisation.
*This brings no any change in their genetic set
up, so the qualities maintained for next too.

*NCERT Exercise Questions

Solutions:- ANS_1.Male gametophyte
develops in microspore inside the pollen grains
that are released from anther. Female
gametophyte develops from the megaspore
inside the ovule.
ANS_2.Microsporogenesis occurs inside the
pollen sacs of anthers. During this process
meiosis occurs in ANS_3.Sporogenous tissue –
pollen mother cell – microspore tetrad – Pollen
grain – male gamete.
ANS_4.Refer Fig. 2.5
ANS_5.When the female gametophyte (or
embryo sac) develops from a single
megaspore, it is called monosporic. Usually, in
most of the angiosperms the megaspore
mother cell divides by meiosis to from 4
haploid megaspores arranged in a linear
fashion.
Only the chalazal megaspore remains
functional while the other three degenerate.
The functional megaspore enlarges and its
nucleus undergoes three divisions to produce
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 11
 High Ranker’s Biology:- 6265237391,
9891766736
*Importance :-
* If hybrids made into apomicts, there is no
segregation of characters in the progeny . So
farmers can keep on using the hybrid seeds
year after year.
*Production of hybrid seeds is costly so expensive
for farmers.
*More than one embryo in a seed is referred as
‘polyembryony’, e.g. , mango and citrus.

microspore mother cells resulting in the formation

of microspores.
*Megasporogenesis occurs inside the ovule,
where one of the sporogenous cells of
nucellus acts as a megaspore mother cell.
During this process, meiosis occurs
resulting in the formation of megaspores.
ensure self-pollination. They remain closed
so that cross pollination does not occur.
ANS_8. Cross-pollinating flowers develops
the following strategies to prevent self-
pollination:
1. Protogyny (when gynoecium
matures earlier than androecium) or
protandry (when androecium matures and
shed pollen before maturation of
gynoecium).
2. Incompatibility between its
anthers and stigma.
ANS_9. Self-incompatibility is to prevent
inbreeding. This is a genetic mechanism and
prevents self-pollen from the same flower or
other flowers of the same plant, from
fertilising the ovules by inhibiting pollen
germination or pollen tube growth in the
pistil.
ANS_10. Bagging is the covering of flowers
by butter paper or polythene. The
emasculated floral buds of

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 12
 High Ranker’s Biology:- 6265237391,
9891766736
the female parents and the floral buds of the nucellus some times remains persistent as
male parents are bagged in order to protect perisperm. Thus, the perisperm lies below the
them from contamination. When the stigma of testa and tegmen. ANS_14.The fruit derived
the bagged flower attains receptivity, mature from the ovary along with other accessory floral
pollen grains collected from anthers of the parts is called a flase fruit. The apple is called
male parents are dusted on the stigma, and false fruit because the main edible parts is the
the flowers are rebagged and the fruits are fleshy swollen thalamus.
allowed to develop. ANS_15. Emasculation is removal of stamens
ANS_11. Fusion of male gamete with secondary from the floral buds of the female parent so
nucleus inside the embryosac (female
that chances of self-pollination are eliminated.
gametophyte) of angiosperms is called triple
Emasculation is not required if the flowers are
fusion. It involves fusion of one male gamete
unisexual.
nucleus and two polar nuclei. It result in the
ANS_16. Orange, Lemon, Water melon, Guava,
formation of the triploid primary endosperm
etc. These fruits are economically importance
nucleus (PEN).
and if seeds are removed they become more
ANS_12. Inside the fertilized ovule, the zygote
valuable.
remains dormant for sometime because the
ANS_17. During microsporogenesis, the cells of
embryo develops only after the formation of the
tapetum provide various enzymes, hormones,
endosperm. So the zygote waits for endosperm
amino acids and other nutritive materials to the
formation, which supplies food material for its
dividing microsporocytes. The main functions
development.
of tapteum are
ANS_13.(a) The part of embryonic axis (a) Transportation of nutrients into anther locule
between the radicle and the point of at the time of meiosis in spore mother cells.
attachment of cotyledons is called hypocotyls. (b) Secretion of enzymes and hormones.
The part of embryonic axis between the (c) Production of Ubisch bodies, which are
plumule and the point of the attachment of coated with sporopollenin to cause
cotyledons is called epicotyl. thickening of exine.
(b) In monocot seeds, the radicle is (d) Secretion of an oily material (pollenkitt)
covered by a protective sheath called over outside of mature pollen.
coleorhizae, whereas plumule is surrounded by (e) Secretion of special proteins for
a conical protective sheath called coleoptile. pollen to recognize compatibility.
(c) Integument is the covering of ovule ANS_18. Some species of Asteraceae and
whereas, testa is the covering of seed. However, grasses ( Poaceae ) having special
the outer integument of ovule is converted into mechanism, to produce seeds without
testa of seed. fertilisation called apomixes.
(d) After fertilization, the wall of ovary is * Apomixis is a form of asexual reproduction that
transformed into wall of fruit, which is called mimics sexual reproduction.
pericarp. The ovule is transformed into seed, in *A diploid egg cell is formed without reduction
which the division and develops into the embryo without
fertilisation.
*Importance :- *Production of hybrid seeds is
costly so, expensive for farmers.
*If hybrids made into apomicts, there is no segregation of characters in the progeny . So
farmers can keep on using the hybrid seeds year after year.
self- pollination not lead to seed formation
 --#A S S I G N M E N T S. in self- incompatible species.
Chapter-2nd for revision 7. What is meant by monosporic development
1. What is apomixis and what is its importance? of female gametophyte?
2. What is emasculation? When and why does a 8. Explain suitably—a.) Cleistogamous nd
plant breeder employ this technique?
3. What is triple fusion? Where and how it takes
place? Name nuclei involved in triple fusion.
4. Mention three strategies evolved to prevent
self- pollination in flowers.
5. Differentiate between:
a.) coleoptiles and coleorhizae
b.) integuments and testa c.) perisperm
and pericarp d.) hypocotyls
and epicotyls.
6. What is self-incompatibility? Why does
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 13
 High Ranker’s Biology:- 6265237391,
9891766736
chasmogamous flowers b.) double fertilisation.
c.) filiform apparatus
d.) cryopreservation
e.) true and false fruit f.) dormancy .
*Post fertilization changes and formations
after the events :-

Ovary Fruit (Ripen ovary)

Ovule Seed
Ovary wall Pericarp/fruit wall
Integument Seed coat (protective)
Outer integument Testa
Inner integument Tegmen
Nucellus Remain as perisperm
Synergis n antipodals Degenerates
Hilum Scar on seed
Funicle Stalk of seed

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 14
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER – 3. HUMAN REPRODUCTION .

*Introduction:- *Sexual reproduction dependent on fusion of haploid gametes produced by meiotic
division.
*Humans are sexually reproducing and viviparous ( child producers ).
*The reproductive events in human includes –
*Gametogenesis – ( formation of gametes ). *Insemination – ( transfer of sperms ).
*Fertilisation - ( fusion of male and female gametes ). *Embryogenesis - ( blastocyst ).
* Implantation – ( attachment of blastocyst to the uterine wall ).
*Gestation – ( embryonic development ). *Parturition – ( child birth ).

# Male Reproductive Organ :-

* The male reproductive organs system is located in the pelvis region. It includes a pair of
testis, glands, accessory ducts and external genitalia or penis.
* The testis are situated outside the abdominal cavity within a pouch called ‘scrotum’, having
20 – 2.50c less temp. than body. This helps in formation of sperms.
* Each testis has about 250 campartments called testicular lobules.
* Each lobule contains 1—3 highly coiled seminiferous tubules in which sperms are produced.
*Each seminiferous tubule is lined by two types of cells called male germ cells called
spermatogonia and sertoli cells.
*The male germ cells undergo meiotic divisions and forms sperms while sertoli cells provide
nutrition to the germ cells.

Fig- Human reproductive system, details and TS

*The region outside the seminiferous tubules called interstitial spaces contain small blood vessels
and Leydig cells. It synthesize and secretes testicular
hormones called androgens.
* The epididymis leads to vas
deferens that ascends and receive a
duct from seminal vesicle and opens
into urethra as the ejaculatory duct
for sperms ejaculation.
*The seminal vesicle glands produce
viscous seminal plasma rich in
fructose, calcium and certain enzyme.
(coagulating enzyme, ascorbic acid
and prostaglandins- this helps in
female vaginal tract contraction).
*The bulbourethral glands (Cowper’s
gland) secrete alkaline mucus that
neutralise urethra and helps in the
lubrication of the penis in coitus.
Fig:- T S through seminiferous tubules
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 15
 High Ranker’s Biology:- 6265237391,
9891766736
# Gametogenesis :-
*Formation of gametes is called
gametogenesis. It fallows meiosis division
and forms haploid cells called gametes..
*In male this is Spermatogenesis (sperm - n) and
*In female known as Oogenesis (Ovum - n).

# Spermatogenesis in human male :-

* The process starts in male testis. The
immature male germ cells called
spermatogonia that will produce sperms
later.
*The spermatogonia present on the inside wall
of seminiferous tubules multiply by mitotic
division and increases in numbers.
* Some of the spermatogonia called Fig- Section through seminiferous tubules
.
primary spermatocytes which undergo meiosis.
* A primary spermatocytes complete
the first meiotic division and forms
haploid(n).
*Secondary spermatocytes which
undergo the second meiotic division to
produce four equal haploid (n)
spermatids.

*The spermatids are metamorph into

sperms called spermiogenesis.
*The sperms released from seminiferous
tubules by the process called
‘spermiation’.
*The seminal plasma along with the sperms
constitue the semen.

#Harmonal control of spermatogenesis:-

*Spermatogenesis starts by increase
in the secretion of gonadotropin
releasing hormone (GnRH) from
hypothalamus.
*The GnRH acts at the anterior
pituitary glands and secretes two
gonadotropins – LH- Lutenising
Hormone ,and FSH- Follicle
Stimulating Hormone.
*LH acts at the leydig cells and stimulates
synthesis and secretion of androgens.
Androgens stimulate the spermatogenesis.
*FSH acts on the sertoli cells which help in
spermatogenesis.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 16
 High Ranker’s Biology:- 6265237391,
9891766736

Fig- Hormonal Control of Spermatogenesis

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 17
 High Ranker’s Biology:- 6265237391,
9891766736
# Detail structure of a Human Sperm :-
*Microscopic structure of a sperm show a head,
neck a middle piece and a tail.
*The head contain an elongated haploid nucleus,
anteriarly an acrosome filled with enzyme that
helps in fertilisation. The entire sperm is enclosed
by a plasma membrane.
*Proximal and distal centriole also present in neck
region.
*Mitochondria produce energy for movement.
* Tail is several time longer than the head and its
helps in sperm movement inside female vagina.
*Man ejaculates 200-300 millions sperms in a coitus.
*At least 60% sperms must have normal shape and
size and approx 40% of them must show vigorous
motility.

Fig- Structure of Human Sperm in Detail.

*Male reproductive system structure comprises following structure in sequence :-

Testiculur Lobules (250) Seminiferous tubules (1-3)  Rete TestisVasa efferentiaEpididymusVas
DeferenceUrethraPenile uretraUrethal orifice/Urethral Meatus (Urine and Sperms both comes out)

Suppose,
Total ejaculated sperms = 1000
Normal shape n size = 60% i.e 1000 x 60/100 = 600
Vigrous motility for fertilization = 40% of normal i.e 600 x 40/100 = 240 sperms

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 18
 High Ranker’s Biology:- 6265237391,
9891766736

Fig- Sectional view through female reproductive system

# Female Reproductive Organs :-

* The female reproductive system consists of a pair of ovaries along with a pair of oviducts, uterus,
cervix, vagina and the mammary glands are integrated structurally and functionally to support the
process of ovulation, fertilization, pregnancy, birth and child care.

* Ovaries are the primary

female sex organ that
produces the female gamete
‘ovum’.
* The ovaries are located one on
each side of the lower abdomen
connected to the pelvic wall and
about 2-4 cm in length. Ovary
made up of a peripheral cortex
and an inner medulla.
* The fallopian tubes is about 10 -
12 cm long and extends from the
periphery of each ovary to the
uterus, the part closer to the ovary
is the funnel-shaped infundibulum.
*The infundibulum posseses
finger-like projections called
fimbriae, which collect the ovum
after ovulation.
. Fig- Female Reproductive system in detail
* The infundibulum leads to a wider part of the oviduct called ‘ampulla’.
*The last part of the oviduct isthmus has a narrow lumen and it joins the uterus. The uterus is
inverted pear shaped. The uterus opens into vagina through a narrow cervix.
* The wall of the uterus has 3 layers.
*The external thin membranous perimetrium, middle thick layer of smooth muscle
myometrium and inner glandular layer called endometrium that lines the uterine cavity.
*The endometrium undergoes cyclical changes during menstrual cycle while the myometrium exhibits
strong contraction during baby born.
* The female external genitalia includes mons pubis, labia majora, labia minora, hymen and clitoris.
*Mons pubis is a cushion of fatty tissue covered by skin and pubic hair. The labia majora are fleshy
folds of tissue covered vaginal opening .

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 19
 High Ranker’s Biology:- 6265237391,
9891766736
* The opening of the vagina is often covered partially by a membrane called hymen which often
torn during first intercourse, of jerk, cycling or sporting.
* The mammary glands are
paired structures that contain
glandular tissues and variable
amount of fat cells that will
determined the size of the
mammary glands that varies
person to person.
*Each breast is divided into 15 – 20
mammary lobes containing cluster of
cells called alveoli.
*The cells of alveoli secrete milk which
stored in the cavities of alveoli. The
alveoli open into mammary tubules.
*The tubules of each lobe join to form
a mammary duct, which join
together forms mammary ampulla.
The ampulla connected to
lacticeferous duct
projected out as a projection called nipple from where milk is sucked out by baby.

# Oogenesis (formation of ovum in human females) :-

* The process of formation of a mature
female gamete is called oogenesis.

*Oogenesis is initiated during the

embryonic development. Approx 60,000-
80,000 oogonial cells present in a ovary. No
more new/extra oogonia are formed or
added after birth.
* The oocyte cells starts division and
enter into prophase of the meiotic
division and get temporarly arrested at
that stage called primary oocytes.
* Each primary oocyte surrounded by a
layer of granulosa cells and then
called the primary follicle.
*Other structure is surrounded by more
layers of granulosa cells and a new
theca called secondary follicles.
*Secondary follicles transforms into a
tertiary follicle which is fluid filled cavity
called ‘antrum’.
* Primary oocyte within the tertiary
follicle grows in size and completed
its first meiotic division.
*It is an unequal division resulting in the
formation of a large haploid (n)
secondary oocyte and polar body. .

*The tertiary follicle further changes into

the mature follicle or ‘Graafian follicle’.
It now ruptures to release the secondary
oocyte covered with zona pellucida the
‘ovum’
*The ovarian and uterine cycles are
controlled by chemical messengers or
hormones.
*Gonadotropin releasing hormone

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 20
 High Ranker’s Biology:- 6265237391,
9891766736
(GnRH) is secreted by the hypothalamus
and stimulates the release of follicle-
stimulating hormone (FSH) and
luteinizing hormone (LH) from the

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 21
 High Ranker’s Biology:- 6265237391,
9891766736
anterior pituitary gland.
*FSH, in turn, initiates follicular growth and
the secretion of estrogens by the growth
follicles.
*LH stimulates the further development of ovarian
follicles and their full secretion of estrogens, brings
about ovulation, promotes formation of the corpus
luteum and stimulates the production of estrogens,
progesterone, relaxin and inhibin by the corpus
luteum.
# Menstrual Cycle and various events :-
*Menstruation begins at puberty and it called “menarche”.
*It repeated at an average interval of about 28/29
days and the cycle of events from one menstruation
till the next one is called the menstrual cycle.
*One ovum is released during the middle of
each menstrual cycle.
*Menstrual flow occurs and it lasts for 3-5 days, due to breakdown of endometrial lining of the uterus.
Next the primary follicles in ovary grow to become a full mature Graafian follicle.
*Gonadotropins LH and FSH increases gradually during the follicular phase.

Fig- Menstrual cycle and related events in females during Oogenesis.

*Both LH and FSH attain a peak level in the middle of cycle caliled ‘LH surge’ induces rupture of
Graafian follicle and ovum out called ovulation. The developmental phase of follicles is known as
follicular phase or proliferating phase.
*The remaining part of Graafian follicle forms ‘corpus luteum’ that secretes large amount of
progesterone.
*(it also regulate only one ovum in each menstrual cycle , by alternate ovaries.)
*It helps in maintaining vaginal gland that produces watery mucus and also endometrium wall.
Such an endothelium wall necessary for implantation of fertilized ovum, which helps in

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 22
 High Ranker’s Biology:- 6265237391,
9891766736
pregnancy.
*Menstrual Cycle ceases around 50yrs of age called ‘menopause’.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 23
 High Ranker’s Biology:- 6265237391,
9891766736
# Fertilisation And Implantation :-
* Fusion of male and female gametes to form
zygote is called fertilisation.
*During copulation semen is released by the
penis into the vagina.
*The sperms pass in female tract is able to
fertilise the egg by secretion of vagina. These
secretions alter deposits on the surface of the
spermatozoa from the semen this is known as
capacitation.
*Now the sperm through the cervix enter into
the uterus and finally reach the junction of the
isthmus and ampulla of the fallopian tube.
*The ovum released by the ovary also
transported to the ampullary isthmic junction,
where fertilisation takes place. The process of
fusion of a sperm with an ovum is called
fertilisation.
* The secondary oocyte is
surrounded by zona pellucid and
corona radiate.
*Extra:- * A capacitated sperm
passes through the corona radiata to
reach the zona pellucida. The
glycoproteins of zona pellucid ZP3
function as a sperm receptor binds
to sperm head.
* The acrosome release sperm lysins.
* The sperm lysins having *Haluronidase –
hydrolyses hyaluronic acid of follicle,
*Corona penetrating enzyme –
dissolve corona radiate,
*Zona lysine or acrosin – helps to
digest zona pellucida. Ca++ and Mg++
and temperature play a significant
role in it. Binding of the sperm to the
egg induces

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 24
 High Ranker’s Biology:- 6265237391,
9891766736
FIG:- FROM OVULATION TO IMPLANTATION

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 25
 High Ranker’s Biology:- 6265237391,
9891766736
depolarisation of the egg plasma membrane that inhibits polyspermy.
*The acrosomal enzyme helps sperms to dissolve the zona pellucida of ovum that avoid other sperms
from entry.
*Meiotic division of secondary oocyte form haploid (n) ovum (ootid) and both the haploid nucleus
of the sperm and ovum (n 🞡 n =2n)fuse together to form a diploid (2n) ‘zygote’.
* The meiotic cleavage (no. of division starts as the zygote moves through the isthmus of the oviduct
called
cleavage, towards the uterus and forms 2, 4, 8, 16 daughter cells called blastomere.
* The embryo with 8 to 16 cell is called a morula. The morula continues to divide and transforms
into blastocyst, which consists outer trophoblast and inner cell mass.
*The trophoblast attached to the endometrium and inner cell differentiated as the embryo.
*The blastocyst embedded in the endometrium is called implantation ( at 7th day) and it leads to
pregnancy.

# Pregnancy And Embryonic Development :-

*The cells of inner cell mass differentiated into two layers- a layer of hypoblast and epiblast.

*After implantation finger like projection appear on the trophoblast called chronic villi, which are
surrounded by the uterine tissue and maternal blood.
*The chorionic villi and uterine tissue become integrated with each other and jointly form a
structural and functional unit between developing embryo and
maternal body called placenta. (Chorion and
Alentois)
*The placenta supply oxygen and nutrients to
the embryo and also helps in waste removal.
*Placenta also act as an endocrine tissue and
produces several harmones like-
*hcG – Human Chronic Gonadotropin-
that maintain corpus luteum and
stimulates progesterone secretion, and
also helps in endometrium wall
proliferation throughout pregnancy.
Progesterone also causes excess
secretion of mucus that forms protective
mucus plug in cervix.
*hpL – Human Placentation Lactogen,
estrogen, progestogens etc. later it also
secrets relaxin that helps in child birth.
*Formation of Embronic disc:- The layer of epiblast and hypoblast together forms a two layered
embryonic disc. The space between these two layers is called amniotic cavity filled with amniotic
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 26
 High Ranker’s Biology:- 6265237391,
9891766736
fluid.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 27
 High Ranker’s Biology:- 6265237391,
9891766736
*Formation of primitive Streak:- (Extra)

*Gastrulation involves rearrangement of cells from epiblast. A primitive streak which is a faint
groove on the dorsal surface of the epiblast is formed. It forms the head and tail ends of the
embryo and the left and right ends too.
*During pregnancy estrogens, progestogens, cortisol. Prolactin, thyroxin, oxytocin etc. are
increased several fold in the maternal blood.
*On implantation embryo divided into three layers, outer ectoderms, middle- mesoderm and inner –
endoderms.
*All these three layers give rise
to cells, tissues and organs in
adults. So human beings are
triploblastic.

*Development:-
*In humans, after one months of
pregnancy, the embryo’s heart is
formed.
*By the end of the second
month, the foetus develops
limbs and digits.
*By the end of first trimester (12
weeks), most of the major organ-
system like the limbs and external
genitalia are formed.
*The first movement of the foetus is generally observed in 5th months.
*By the end of the 2nd trimester, the body of the foetus is covered with hairs and eye lashes.
*By the end of the 9 months ± 7 days of pregnancy, the foetus is fully formed and is ready for delivery.

# Parturiation And Lactation :-

*The average duration of human pregnancy is about 9 months called gestation period.
*Vigorous contraction of the uterus at the end of pregnancy causes delivery of the foetus. This is called
parturition.
*The fully developed foetus and the placenta which induce mild uterine contractions called “foetal
ejection reflex”. This triggers release of oxytocin.
*Oxytocin helps in uterine contraction for baby birth.
*The mammary glands of the female undergo differentiation during pregnancy and starts producing
milk called lactation.
*First milk called “colostrum” is highly proteinaceous yellowish and contains several antibodies
important for child health and development.

# NCERT Exercise Questions solutions (HUMAN REPRODUCTION):-

ANS_1. (a) Sexually (b) Viviparous (c) Internal (d) haploid (e) diploid (f) Corpus luteum,
(g) Luteinizing hormone (LH), (h)fertilization, (i)ampullary-isthmic junction of fallopian tube,
(j) blastocyast, (k) placenta.
ANS_2. Draw male reproductive system.
ANS_3. Draw female reproductive system.
ANS_4. Functions of Testis: (i) Production of sperms and (ii) Secretion of male sex hormones and
androgens (e.g. testosterone)
Functions of Ovary: (i) Production of ova and (ii) Secretion of female sex hormones, e.g.,
oestrogens progesterone. Draw the fig- 3.2.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 28
 High Ranker’s Biology:- 6265237391,
9891766736
ANS_6. At puberty spermatogonium or germ cells define. The spermatogonium (2n) differentiated
mitotically into primary spermatocytes in seminiferous tubules. 1st meiotic division forms secondary
spermatocytes (n). The 2nd meiotic division forms in spermatid formation. The spermatid later
differentiated into spermatozoa (n). Draw fig- 3.8a
ANS_7. Follicle stimulating hormone (FSH) and Interstitial cells stimulating hormone (ICSH).
ANS_8. Spermiogenesis It is a process in which spermatids are transformed into spermatozoa
(sperms). Spermiation. After spermiogenesis, sperm heads become embedded in the Sertoli cells
and are finally released from the seminiferous tubules by the process called spermiation
ANS_9. Draw fig-3.6
ANS_10. Major components of seminal plasma are: (i) Secretions of accessory sex glands,
(ii) Mucus, and (iii) Spermatozoa. The seminal plasma is rich in fructose, ascorbic acid, citrate,
prostaglandins calcium and certain enzymes.
ANS_11.(i) Aid in sperm transport, (ii) temporary storage of spermatozoa;
Major functions of male accessory glands. The male accessory ducts include rete-testis, vasa
efferentia, epididymis and vas deferens. These ducts store and transport the sperms from the
testis to outside through urethra. The male accessory glands include paired seminal vesicles, a
prostate and paired bulbo-urethral glands. Secretion of these glands constitute the seminal
plasma, which is rich in fructose, calcium and certain enzymes. The secretion of bulbo-urethral
glands helps also in the lubrication of the penis.
ANS_12. The process of formation of a mature female gamete is called oogenesis.
Oogenesis is initiated during the embryonic development. No more oogonia (60,000-80,000)
are formed or added after birth.
The oocyte cells starts division and enter into prophase of the meiotic division and get temporarly
arrested at that stage called primary oocytes.
Each primary oocyte surrounded by a layer of granulosa cells and then called the primary follicle.
Other structure is surrounded by more layers of granulosa cells and a new theca called secondary
follicles.
*Secondary follicles transforms into a tertiary follicle which is fluid filled cavity called ‘antrum’.
*Primary oocyte within the tertiary follicle grows in size and completed its first meiotic division. It is
an unequal division resulting in the formation of a large secondary oocyte (n) and polar body.
The tertiary follicle further changes into the mature follicle or ‘Graafian follicle’. It now ruptures to
release the secondary oocyte covered with zona pellucida the ‘ovum’.
ANS_13. Draw ovary section fig-.
ANS_14. Draw Graafian follicle fig-.
ANS_15. (a) Corpus luteum. Its major function is the secretion of progesterone hormone. If
fertilization occurs, the progesterone secretion, through feed back control, inhibits the
secretion of FSH-RH from hypothalamus. This prevents the onset of next menstrual cycle.
(b) Endomentrium. It is the inner layer of uterus which undergoes cyclic changes during
different phases of menstrual cycle in anticipation for the implantation of blastocyst.
(c) Acrosome. It is the anterior part of head of sperm. It contains hydrolytic enzymes and is used to
contact and penetrate the egg in fertilization.
(d) Sperm tail. It helps in the movement of spermatozoan in a fluid medium.
(e) Fimbriae. The motile, finger-like processes present on the margins of infundibulum (broad,
funnel shape proximal part of fallopian tubes) are termed fimbriae. These bear cilia which
directs the egg into the infundibulum.
ANS_16. a.) F b.) T c.) F d.) T e.) F f.) T g.) T.
ANS_17. Menstruation occurs in humans, apes and old world monkeys. Menstruation is
bleeding from the uterus of adult females at intervals of one lunar month in female humans. In
human females, the menstruation is repeated at an average interval of about 28/29 days and the
cycle of events starting from one menstruation till the next one is called the menstrual cycle. One
ovum is released (ovulation) during the middle of each menstrual cycle.
The hormones that regulate menstrual cycle are (i) Follicle stimulating hormone (FSH) (ii) Luteinizing
hormone
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 29
 High Ranker’s Biology:- 6265237391,
9891766736
(LH) (iii) Estradiol (iv) Prolactin (v) Progesterone
ANS_18. The signals for child birth (parturition) originate from the fully matured foetus and
placenta which induce mild uterine contractions. This causes release of oxytocin from the material
pituitary which promotes contraction of the uterine muscles. Relaxin helps dilate the uterine cervix
during labour pains.
ANS_19. Female produces only one type of gametes, each carrying X chromosome. However,
male produces two types of gametes, 50% carrying X chromosome and 50% carrying Y
chromosome. Sex of the child, in human beings, is determined by the kind of male gametes that
fertilizes the female gamete. If male gamete carrying X chromosome fertilize the female gamete,
the child will be female. However, if male gamete carrying Y chromosome fertilizes the female
gamete, the child will be male. Therefore, women should not be balmed for giving birth to
daughters.
ANS_20. Every month only one egg is released by the ovaries. However, both the ovaries
release an egg alternately every month, i.e. if the right ovary release an egg in the 1st month,
then the left ovary will release it the next month and so on.
If a months has given birth to identical twins, then the number of egg released is one because
identical twins occur when the same fertilized egg splits into 2. However, if the mother has given
birth to fraternal twins, then the ovaries released two eggs that were fertilized by 2 sperms.
ANS_21. The female dog would have released 6 eggs to give birth to 6 puppies.

*-----------NEET pattern MCQ for medical entrance exams :-

1. Sertoli cells are regulated by the pituitary a.) FSH b.) GH c.) Prolactin d.) LH
2. Testes desent into scrotum in mammals for
a.) spermatogenesis b.) Fertilization c.) Development of sex d.) Viceral development
3. CL secretes a.) LH b.) Estrogen c.) Progesteron d.) FSH
4. Villi of placenta develop from a.) Chorion b.) Allontois c.) Yolk sac d.) Both a&b.
5. Fertilised ovum is transplanted in uterus after a.) 1day b.) 7days c.) 8days d.) 10days
6. Spermatozoa are nourished during their development by
a.) Sertoli cell b.) Leydig cell c.) Germ cells d.) No one
7. Glands secreting male sex hormone are a.) Leydig cells b.) Seminiferous tubules c.) Vasa deferentia
d.) testes.
8. The head of mammalian sperms made of a.) an acrosome b.) nucleus covered by acrosome
c.) 2 centriole and an axial filament d.) nucleus, acrosome, cytoplasm and mt sheath.
9. Part of sperm involved in penetrating egg membrane is a.) Tail b.) Acrosome c.) Allosome d.)
Autosome.
[Link] occurs under the influence of a.) LH b.) FSH c.) Estrogen d.) Progesterone.
*------------------ASSIGNMENT chapter--3 rd ** Q.1.
Draw a Labelled diagram of male and female reproductive organs.
Q.2. What is spermatogenesis? Describe the process of spermatogenesis.
Q.3. Define spermiogenesis and spermiation and draw a detail structure of sperm.
Q.4. What is oogenesis? Give a brief account of oogenesis.
Q.5. Draw a labelled diagram of a section through ovary, and a grafian follicle.
Q.6. What is menstrual cycle? Which hormones regulate menstrual cycle?
Q.7. What is parturition? Which hormones involved in induction of parturition?
Q.8 Define the terms suitably :--- a.) seminal plasma b.) corpus luteum
c.) acrosome d.) fimbrie e.) colostrumf.) stem cell g.) menopause h.) antrum i.) foetal ejection reflex

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 30
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER-4. Reproductive Health

# Introduction –
*According to WHO – World Health Organisation reproductive health means a total
reproductively healthy person at physical, emotional, social and behavioural levels.
*Those who have physically are functionally normal reproductive organs and normal behavioural and
emotional interactions among them in all sex-related aspects.
*Why it is so significant to maintain reproductive health and their methods are as follows :-
*Reproductive health is a problem we should make strategies to remove it.
*One of them is -
1. RCH- Reproductive and child health care’ programme currently in operation- widely.
2. Over Population – main problem of India is its excess population which is directly connected
with reproductive health. “Family Planning” programme was initiated in 1951 to support the
reproductive healthy society and also control the population.
3. Awareness- about reproduction and related aspects and providing facilities and support for
building up a healthy society.
4. Sex education should also be introduced at required time among people.
5. Knowledge of growth of reproductive organs and STD’s, information about adolescence,
reproductive organs, safe and hygienic sexual practices information given them.
6. Birth control device and care of mother and child. Marriageable age group should know
about available birth control devices. Care of mother and child also bring a healthy
environment.
7. Prevention of sex abuse and sex related crime. Awareness of problems due to social evils like
sex abuse and sex-related crime etc need to be created
so that people should think and take
up necessary step to prevent them
and take up a reproductively healthy
society.
8. For successful action plans to
attain reproductive health
requires good infra structure
facilities, professional expert,
Knowledge and material support.
9. Amniocentesis –
*It is a foetal sex determination and
disorder test based on the
chromosomal pattern in the
amniotic fluid surrounding the
developing embryo.
*Amniotic fluid contains cells that
can be used to determine the sex of
the developing foetus or to identify
some
abnormalities in the number of Fig:- Amniocentasis
chromosomes and if the child is likely to suffer from a serious incurable congenital defect the
mother should get the foetus aborted.

*Misuse – Being used to kill the female foetus i.e ‘female foeticide’, causes a imbalance in sex ratio.
10. Research in reproductive health area. CDRI – Central Drug Research Institute, Lucknow, developed
a new
‘oral contraceptive’ named ‘Saheli’ to avoid unwanted pregnancy that related to safety of women.
11. Medical facilities to suffered and sex-related problem having people and their rehabilitation
is also very important to check the spreading of STDs.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 31
 High Ranker’s Biology:- 6265237391,
9891766736
# Population Explosion And Birth Control :-
*The total number of individuals of a species present in a particular area at a given time is called
population. The scientific study of population is called “demography” that includes—
a.) change in population size b.) composition c.) distribution.
*‘Census’ is an official counting of population and preparing data about age groups, births, deaths,
sex ratio, education etc.

*In 2001 we are 1027 million, ‘the rapid increase in population over a relatively short period is called
‘population explosion’.
*A rapid decline in death rate, MMR — maternal mortality rate and IMR—infant mortality rate as
well as increase in reproducible age are responsible for this.
*According 2001 CENSUS — Growth rate is still around 1.7% i.e 17/1000/year.
*Better health care facilities and greater medical attention.
*Development in agriculture, storage of food, better transport and governmental schemes and
protection from natural calamities certain religions are against the family planning.
# Measures To Check Over Population:-
1. Educate to all rural and urban families and people.
2. Marriageable age male-21yrs and female-18yrs.
3. Couples with small family should be given incentives.
4. Motivate smaller families by using various contraceptive methods.
5. Family planning should be implemented more seriously—“Hum Do Hamare Do”.
# Birth Control By Various Methods -- Some of the commonly used contraceptive methods
which help in preventing unwanted pregnancy categorised in two groups—
*1. NATURAL METHODS:—
*The methods avoid meeting sperm and ovum---
a.) Periodic Abstinence—in this method the couples avoid from coitus from day 10 to 17 of the
menstrual cycle because ovulation occur during this period may causes fertilisation.
b.) Withdrawal or coitus interruptus -- male withdraw his penis from the vagina just before ejaculation.
c.) Lactational amenorrhea – Absence of periods. There is no menstrual cycle so no ovulation
during intense lactation following parturition, only up to 6 months of baby birth.

*2. BARRIER METHODS ( Artificial methods);–

*Barrier methods are based on avoiding the meeting of gametes from each other (sperm from ova).
*Various devices are prepared by humans to avoid the fertilisation after copulation.
*Artificial barriers are also used to avoid the meeting of sperms and ova to avoid fertilisation.
1. Condom—
*A thin rubber latex sheath used to cover the penis of male or vagina and cervix in the female
just before coitus so that the ejaculated semen is not released in the female reproductive tract.
This prevent fertilisation and so the pregnancy.
2. Diaphragm—
*Cervical caps and vaults. Made of rubber, injected into the female reproductive tract to cover
the cervix during coitus. It prevent fertilisation by blocking the entry of sperms through the
cervix.
3. IUD’S—
*Intra Uterine Devices- These devices are inserted by doctors in the uterus through vagina. These
are available as the--
*Non-medicated IUDs e.g., Lippes loop.
*Copper releasing IUDs – e.g-Cu T, Cu 7, Multiload 375.
*Hormone releasing IUDs –e.g- Progestasert, LNG-20.
*IUDs increases phagocytosis of sperms within the uterus and Cu suppress sperm motility is
widely accepted method in India.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 32
 High Ranker’s Biology:- 6265237391,
9891766736
4. Oral Contraceptive Pills—
*Small dose of either progestogens or progestogen-estrogen combinations are used by the females.
*They are used as tablets so called pills.
*Pills have to be taken daily through mouth for 21 days starting within the 1st 5 days of menstrual cycle.
*After a gap of 7 days it has to be repeted e.g., “Saheli” an oral contraceptive for females.

Fig;- various types of contraceptives for human

5. Injection and Implants—

*Progestogens alone or in combination with estrogen can also be
used by females as injections or implants under the skin (Subdermal
in osistion).
*The combinations or IUDs within 72 hours of coitus have been found
to be very effective as emergency contraceptives to avoid fertilization
due to rape or casual unprotected intercourse.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 33
 High Ranker’s Biology:- 6265237391,
9891766736
6. Surgical Methods — This is Also called sterilization.
*Surgical methods block gamete transport and hence prevent fertilization. In male this is
“vasectomy” and in female is “tubectomy”.
*In vasectomy a small part of the vas deferens is removed or tied up through a small cut on the
scrotum, while in tubectomy a small part of the fallopian tube is removed or tied up through a
small cut in the abdomen or vagina.
* A suitable contraceptive method should be practised in under supervision of qualified doctors.

Fig:- Vasectomy and tubectomy in both male n female repectively

# MTP :-- Medical Termination of Pregnancy—

*Voluntary or intentional termination of pregnancy before full term is known as medical
termination of pregnancy or induced abortion.
*About 40-50 million MTP are done in a year in the world which is 1/5th of the total number of
pregnancies in a year. This is done for—
a.) get rid of unwanted pregnancies and
b.) helps mother if it is fatal for her.
c.) safe up to 12 weeks of pregnancy, done by qualified doctors.

# STDs—Sexually Transmitted Diseases—

*Diseases or infections which are transmitted through sexual intercourse are collectively called STDs
or Venereal diseases or “VD” or ‘RTI’- Reproductive tract infections or PIDs- Pelvic Inflametry Disease.
*The common STDs are:- Gonorrhoea, Syphilis, Genital Herpes, Chlamydiasis, Genital warts,
Trichomaniasis, Hepatitis-B and AIDS. They are caused by viruses, Bacteria, Chlamydia and
Protozoa.
*Early symptoms of most of them are itching, fluid discharge, swelling, slight pain etc. later causes, PIDs
—Pelvic Inflammatory Disease that includes - Still birth, abortion, infertility and cancer of the
reproductive tract.
*STDs can be prevent by following methods--
*Avoid sex with unprotected/ unknown /multiple sexual partners, use condom during sex, avoid
infected blood transfusion and infected syringes, in doubt he/she must consult a qualified doctor,
complete treatment if disease diagnosed.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 34
 High Ranker’s Biology:- 6265237391,
9891766736
# What is an ART ? How
various technique use in it
to cope the infertility?
*A large no. of couples
unable to produce children
called infertility.
*It may be due to physical,
immunological etc reasons.
*These couple scan be
assisted to have children
through certain special
techniques called the
assisted reproductive
technologies- ‘ART’. They are
—
*TEST TUBE BABY- (Test tube baby):-
*The fusion of ovum and sperm is done outside the body of women to form embryo. This
embryo is then implanted in uterus where it develops into a foetus. This is called “Test Tube
Baby”. Methods is
(wife)-ova × sperm-(Husband) = Zygote (Test Tube)→ Embryo ( 8 cell Blastomere) transfer in fallopian
tube.
*ZIFT —Zygote intra-fallopian transfer . If transferred into the uterus- (‘IUT’- Intra Uterine Transfer).
This is in vitro fertilisation, for those females who cannot conceive.
*GIFT —Transfer of an ovum from a donor into the fallopian tube of another female who cannot
produce one, but can provide suitable environment for fertilisation and further development.
*ICSI —Intra Cytoplasmic Sperm Injection- in lab, a sperm is directly injected into the ovum.
*AI —Artificial Insemination :—
*In case of infertility, due to very low sperm counts and male is not able to inseminate the
female, could be corrected by artificial insemination.
*In this technique the semen collected either from husband or a healthy donor is artificially
introduced either into the vagina or into the uterus (IUI—Intra-uterine insemination)
*These methods require extremely high specialised persons and expensive instruments.

---------------* NCERT Text Book Exercise Questions solutions:-

ANS_1. Rapidly expanding human population, pollution and substandard living condition, etc.
particularly in the developing countries like Thus reproductive health of a society reflects the
India has a greater population of young
individuals who determine the size, health and
prosperity of the future population.
*A reproductively healthy society can solve all
the problems of a nation such as population
explosion, sex abuse, sex-related crimes,
unhygienic conditions, unemployment,
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 35
 High Ranker’s Biology:- 6265237391,
9891766736
nations development.
ANS_2 (a) Creating awareness among the
people about various reproductive – related
aspects such as STDs, available birth control
methods, care of pregnant mothers, post-
natal care of mother and child, importance
of breast feeding, adolescence and related
changes, safe and hygienic sexual practices,
etc.
(b) Providing facilities and support for
building up a reproductively healthy
society. These include medical assistance
and care to people especially

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 36
 High Ranker’s Biology:- 6265237391,
9891766736
during pregnancy, delivery, STDs, abortions, reproductive system is not possible. A gonad
contraception, menstrual problems, infertility performs two functions: (i) Production of
etc. ANS_3. Yes, so that right information about gametes and (ii) Secretion of hormones.
sex can be provided to the children. They are ANS_8. Yes, ban on amniocentesis is necessary
also discouraged from believing in a myth and to present female foeticides.
having misconceptions about sex related ANS_9. Following are special techniques used to
aspects. assist infertile couples to have children.
ANS_4. Yes. The programme of family planning (i) Test tube babies.
has been successfully launched. Now people (ii) Gamete intra fallopian transfer (GIFT)
are aware about the methods of birth control. (iii)Intra cytoplasmic sperm injection (ICSI)
People are being educated about the (iv) Artificial insemination technique (AIT)
importance of small family. They understand
ANS_10. (i) Avoid sex with an unknown
the importance of care of pregnant mother, partner/ multiple partners
post-natal care of mother and child, breast
(ii) Always use condom during intercourse.
feeding etc.
(iii)If a person is in doubt, he or she
*Some such areas of improvement are: must consult a qualified doctor. If STD is
(i) Child immunization at very large scale. detected get complete treatment.
(ii) Maternity and child health ANS_11. (i) True. Abortion could
(iii)Increasing use of contraceptives happen spontaneously too.
(iv) Family planning (ii) False. Infertility is defined as the
ANS_5. (i) Decline in death rate, maternal inability of the couple to produce viable
mortality rate and infant mortality rate. offspring. It is due to abnormalities / defects in
(ii) An increase in number of either male or female or both.
people in reproductive age. (iii)False. Complete lactation is a natural
(iii)Control of diseases. method of contraception but is limited to period
(iv) Better public health care and up six months after parturition.
greater medical attention. s (iv) True.
ANS_6. Yes. The use of contraceptives is justified.
ANS_12. (a) Surgical method of
Population in India is increasing at a very fast rate contraception prevent fusion of male and
and has crossed a billion mark in 2000. Such a female gametes during intercourse.
growth necessitated intense propagation and
(b) Few STDs are completely
use of contraceptive methods of bring all the curable if detected early and treated
fertile couples under its cover. It will help in bring properly.
birth rate down and consequently check (c) Oral pills are very popular
population growth. contraceptives among the educated urban
ANS_7. An ideal contraceptive should be women.
effective, user friendly, easily available, (d) In ET- embryo transfer Techniques, 8
reversible and with no or least side-effects. It called embryos are transferred into fallopian
should not interfere with the sexual desire, drive tubes and more than 8 celled embryos are
and / or the sexual act of the user. transferred into the uterus.
When gonads (testes and
ovaries) are removed, basic function of male
and female
*----------------------------- Assignments CHAPTERS--4th
Q.1. What is an ART ? Give any four techniques related to it.
Q.2. How unwanted pregnancies can be checked ? Give any 2 natural and 2 barrier methods for it.
Q.3. Short notes, answer as it required--
a.) amniocentesis, b.) STDs c.) MTP d.) Sterlization e.) name four STDs. f.) implants
Q.4. Suggest some methods to assist infertile couples to have children.
Q.5. Is the use of contraceptive justified? Give reasons.

* The first test tube baby Louise Joy Brown was born to Lesley and Gilbert Brown on July 25, 1978, in Oldham, Lancashire,
England with the help of Dr Patric Steptoe and Dr. Robert Edward. (2010 Nobel Prize).

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 37
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER-5- PRINCIPLES OF INHERITANCE AND VARIATION

*Heredity- transmission of characters from parents to offspring.
*Inheritance- process by which characters or traits pass from one generation to the next generation.
*Variation- degree of differences in the progeny and between the progeny and the parents.
*Genetics- the branch of biology that deals with the study of heredity and variations.
*Allele- alternative forms of a gene which is located on same position (loci) on the homologous
chromosome is called allele coined by Bateson.
*Multiple alleles- It is the presence of more
than two alleles of a gene. These are produced
due to repeated mutation of the same gene
but in different direction. Ex- ABO blood group,
Skin colours in human.
*Homozygous – A zygote is formed by fusion of
two identical gametes is called homozygous,
or an individual possessing two identical alleles
(XX) at one particular locus on homologous
chromosome.
*Heterozygous- An individual possessing two
different alleles {44A + XY} at one particular
locus on homologous chromosome.

*Locus or Loci- the position or site of a gene on chromosome.

*Back cross- a cross between F2 hybrid and either the parents.
*Test cross- a cross between F2 generation and recessive parent.
*Punnett Square- a checker board used to show result.
*Dominant factor or Allele- the factor of an allelic or allelomorphic pair, which is unable to express
its effect in the presence of its contrasting factor in a heterozygote is called recessive factor or
allele e.g., Tt, tt.
*F1 Generation- F1 or first filial ( filus-son, fila- daughter, Bateson, 1905)
*F2 Generation- F2 or second filial generation is the generation is the generation of individuals, which
arises as a result of inbreeding or interbreeding of F1 generation.
*Phenotype- characteristics that recognise from outside e.g., flower colours, plant height.
*Genotype- internal constituent of genes present in an individual that after sexual reproduction.

*Genome- it is the complete set of chromosomes where every gene and chromosome is
represented singly as in a gamete.
*Gene pool- the aggregate of all the genes and their alleles present in an interbreeding populations is
known as gene pool.
*Pure line- A strain of genetically pure true breeding individuals which have been derived
from a single self fertilise homozygous ancestor or identical homozygous ancestors.
*Pleotropic Gene- The ability of of a gene to have multiple phenotypic effect because it influence a
number of characters simultaneously is known as pleotropy.
*Daltonism- Alternate name of red-green colour blindness after the famous who also affected with it.
*Deviations from Mendel’s Classical ratios- 3:1 and 9:3:3:1.
*Lethality- 2:1,
* Epistasis- 12:3:1,
*Recessive Epistasis (Supplementary gene)- 9:3:4,
*Complementary Gene- 9:7,
*Duplicate Gene- 15:1,
*Inhibitory Gene- 13:3,
*Incomplete Dominance- 1:2:1.
*Transposons:- A group of mobile genetic elements/DNA sequence that can jump into different places
of the genome; so called jumping genes.
However, some transposons are always kept at the insertion site in the genome.
Sometimes creating or reversing mutations and altering the cell's genetic identity and genome size.
Transposition often results in duplication of the same genetic material.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 38
 High Ranker’s Biology:- 6265237391,
9891766736
#Mendel’s law Of Inheritance :-
*[Link] (1822-1884) is known as ‘Father of Genetics’ because he was the first to demonstrate
the mechanism of transmission of character from one generation to the other. He worked with 7
pairs of contrasting characters of garden pea plants—Pisum sativum.
*Mendel performed various types of cross breeding and then allowed the offspring to self breed.
*Mendel employed the law of probability and statistical methods for analysis of his results.
*His paper was published in 1866 but recognized in 1900.

# Mendel chosen pea plants for his experiment because :-

a.) Pure varieties of pea were available.
b.) Easily detectible characters.
c.) Flower structure allow controlled breeding.
d.) Short life span and are grown easily.
e.) Number of seeds produced at a time.

# He studied seven pairs of contrasting characters:-

Characters Dominant Recessive
1. plant height Tall (T) dwarf (t)
[Link] position Axial (A) Terminal (a)
3. Pod colour Green (G) Yellow (g)
4. Pod shape Full (F) Constricted (f)
5. Flower colour Voilet (V,R) White (v,r)
[Link] shape Round (R) Wrinkled (r)
[Link] colour Yellow (Y) Green (y)

Fig:- Diagramatic Representation of seven contrasting characters with their recessive one.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 39
 High Ranker’s Biology:- 6265237391,
9891766736
# Inheritance of one gene/ Monohybrid Cross/ Explain 3:1/ Explain The Law of Dominance
using Monohybrid cross/ Ex- Q-4.
*To study of inheritance of a single pair of alleles or factor of a character in an indivisual organism
is called one gene inheritance. In his experiment :-
*He crossed a tall (TT) plant and a dwarf(tt) plant, and get new hybrid called them filial progeny or the
F1 .
*In F1 all were tall even having Tt gene. He then selfed the tall F1 and get F2.
*In this generation he get 3/4th plants were tall, and 1/4th were dwarf as 3:1.
*He said—something was passed down, unchanged from the parent to offspring i.e ‘factor’ later
known as
‘gene’.
*The character which express itself is called dominant and which do not express is called recessive.

# On the basis of his monohybrid cross Mendel postulated—

1. Law Of Factor- A character is represented in an organism by at least two factors (pair). Alternate
or same form (TT,Tt) are called allele. These Factors are later known as genes.
2. Law Of Dominance- Out of the two alleles only one is able to express its effect in the individual or
dominant will express in F1 generation.
Mendel’s Monohybrid Cross:-

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 40
 High Ranker’s Biology:- 6265237391,
9891766736
# Inheritance of two gene/ /Dihybrid cross/ Explain 9:3:3:1 ratio/ Ex-Q.2/ Law of Segregation?
Law of purity of Gametes and Law of Independent assortment;-
*In dihybrid cross Mendel taken two characters and crossed them.
*He taken Round yellow and Wrinkled green characters from the two,
*one is related with seeds shape and another is related with seeds colour.
* The method of crossing was as same in monohybrid cross to get F1 and F2 progenies.
*On the basis and his experiment’s results he proposed—

Fig:- Dihybrid Cross.

3. Law Of Segregation/Universal law :- 4. Law Of Independent Assortment :-

*In the two factors of the character which *According to the low- the two factors of each
remain together in an individual, - character assort or separate independent of the
*Do not get mixed up. factors of other characters at the time of gamete
*Keep their identity distinct, formation randomly distributed to different
*Separate at the time of gamete gametes and get paired again in different offspring
formation, as per the probability by randomly re-arranged in the
offspring .

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 41
 High Ranker’s Biology:- 6265237391,
9891766736
# Exception of Mendelian Ratio/Ex-Q-13 (b)/ Corren’s law/ Incomplete
dominance/ Explanation of Ratio 1:2:1:-
*This low is a exception of low of dominance.
*According to this low- ‘None of the two contrasting alleles or factors is dominant, or going to express
in F1 generation’.
*F1 had a phenotype that did not resemble either of the two parents and was in between the two.
Example- in Dog flower (snapdragon or Antirrhinum sp.).
*Red is dominant over white, so ratio should come as 3:1 but the result comes as 1:2:1 that
representing incomplete dominance.
*In F1 pink colour obtained it may be due to-
a.) the normal/less efficient enzyme, or
b.) a non-functional enzyme, or
c.) no enzyme at all .
So, we can say that:-
Incomplete dominance is a form of
intermediate inheritance in which one allele
for a specific trait is not completely
expressed over its paired allele.
*This results in a third phenotype in which the
expressed physical trait is a combination of the
phenotypes of both alleles.

Fig- Corren’s low of Incomplete Dominance.

# Co-dominance/Ex.Q.13(a).
*In the case of co-dominance the F1 generation resembles both parents or we can say that ‘when
dominant genes come together express together’ e.g ABO blood grouping in human is good
example of co-dominance.
*The plasma membrane of the red blood cells has sugar polymers that sugar is controlled by the gene
(I).
*The gene I has three alleles- IA, IB and
i. So the possibilities are –

Genotypic combinations Blood groups possibilities

IAIA, IAI A
IBIB, IBI B
IAIB AB codominance
II O

*This also represent multiple alleles i.e more than two alternate forms of a gene present on the same
locus.
*Occasionally a single gene product may produce more than one
effect. Example- Starch synthesis in pea seed controlled by gene ‘B’
(ONE GENE) having two alleles B and b.
*BB- Large starch grain, Bb- intermediate size, bb- small starch grain.
*In 1900, three scientists ( de vries, Correns and von Tschermak) independently rediscovered Mendel’s

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 42
 High Ranker’s Biology:- 6265237391,
9891766736
work on inheritance of characters- then given ‘Father of Genetics’.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 43
 High Ranker’s Biology:- 6265237391,
9891766736
# Chromosomal Theory Of Inheritance/ Ex.Q.15(b).
*Chromosomal theory of inheritance was proposed by Sutton and Boveri independently in 1902.
The theory means:-
*Gametes serve as a bridge between two successive generations.
*Male and Female contributing hereditary components.
*Nucleus contains chromosomes. Number of chromosomes are variable in species to species but
fix within a members of same species,
e.g. Human (2n= 46).
*Chromatin in the
nucleus is associated
with the cell division in
the form of
chromosomes.
*Both chromosomes as
well as genes occur in
the pairs in the diploid
cell.
*A gamete contains only
one chromosome of a
type and only one of the
two alleles of a trait.
*The pairing of
chromosomes and
Mendelian factors is
restored during
fertilisation.
So there is a parallelism
between gene and chromosomes.
Fig:- Transfer of chromosomes from germ cells to
gametes.

# Parallelism between Mendelian Factor And Chromosome-

1.) Both transmitted from generation to generation.
2.) During gamete formation a gamete contains only
one factor and only one chromosome of
a pair of homologous chromosomes.
3.) During S-phase chromosomes duplicate or doubled
that also helps in equal distribution of alleles into newly
from daughter cells.
4.) At fertilisation they again restored their diploid form.

# Drosophila as Material for Experimental Genetics/EX.Q.9. Fig- Drosophila chromosomes.

*Morgan selected fruit fly Drosophila melanogaster (2n=8)as experimental material due to : -
*Small size, easily available, reared inside bottle, new young once reised in 2 weeks, female easily
distinguished from male, male- XY and female-XX.
*Number of progenies produced in a single birth. .
*Linkage maps/ Chromosome maps / Cross-over maps:-
*Is a linear graphic representation of the sequence and relative distances of the various genes present
on a chromosome.
*Basis of chromosome mapping:-
a.) Genes present in a chromosome are arranged in a linear sequence.
b.) The frequency of Crossing Over is directly proportional to the physical distance between two genes.
*Map Units:- 1% crossing over between two linked

Recombination frequency (RF)= Numbers of Recombinants x 100%

Total numbers of progeny
*When genes are found on same chromosome and nearly placed, goes together is linkage or linked
gene.
*When genes are found on different chromosomes or far apart on the same chromosome, they
assort independently and are said to be unlinked.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 44
 High Ranker’s Biology:- 6265237391,
9891766736
# Q. Linkage and Recombination/ EX. Q.9.
*Morgan (1910) carried out several crosses in Drosophila. During his study he described linkage.
*’Linkage is the phenomenon of certain gene staying together during inheritance without any
change or separation due to being present on the same chromosome’.
* They present in same chromosome in linear sequence.
* Janssens (1909) discovered chiasma formation and related process of crossing over.
*The recombination of genes is possible only due to exchange of genetic material between
homologous chromosomes.
* Mutual exchange of segments of genetic material between nonsister chromatids of two
homologous chromosomes, produce recombinants or new combination of genes.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 45
 High Ranker’s Biology:- 6265237391,
9891766736
# Test Cross/ EX. Q. 5.
*When F1 progeny crossed by recessive parent is called test cross.
*The progeny obtained is hybrid and in equal in proportion, 50% dominant and 50% recessive for
heterozygous dominant.(1:1). In case of dihybrid ratio (1:1:1:1).

w w ←(ww) Recessive parent (ww)→ w w

Ww W Ww Dominant phenotype W Ww Ww W
W Genotype unknown w ww ww w
Ww Ww
so

(Purple flower may be (WW or Ww)i,e Homozygous purple or heterozygous purple)

*Homozygous produces all PURPLE. * Heterozygous produces 50% PURPLE 50% WHITE.

# Sex Determination/ EX. Q. 11.

*The diploid organisms bear two types of chromosomes.
*Sex chromosome and autosomes.
*The sex chromosomes are generally a pair of
chromosomes that are responsible for sex
determination. The remaining pairs of
chromosomes that are not involved are
autosomes.
*If an organism produces only single type of
gametes XX is homogametic and if produces two
types of gametes XY is called heterogametic e.g
human and Drosophila.
*XX-XY TYPE-
*In human and drosophila males are
heterogametic due to XY sex chromosomes and
females are homogametic due to XX.

*ZW—ZZ TYPE-
*In fowls male is ZZ homogametic and female is ZW heterogametic.
*ZZ 🞡 76 form cock while ZW 🞡 76 form hen.
*Hen is ZW that is heterogametic and responsible for determining the sex.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 46
 High Ranker’s Biology:- 6265237391,
9891766736
*XX-XO TYPE-
*Reported in case of grasshoppers, round-
worms and cockroaches.
*Male posses only one sex chromosome. It is
similar to those of females.
*XO forms male while XX forms female.

# Mutation : Point And Frame - Shift/ Q.14.:-

*Mutations are sudden inheritable
discontinuous variations which appear in
the organisms due to permanent change
in their genotypes.
*The term was given by ‘Hugo-de-vries’ (1901) during his
work on a plant also known as an evening primrose
‘Oenothera lamarkiana’.
*Mutation bring sudden and discrete change in the genetic
material due to alteration in chromosomes as well as genes
due to loss (deletion) and gain (insertion)on a segment of
DNA. This is also called chromosomal aberrations.
*Commonly observed in cancer cells.
A.)Deletion- a segment of a chromosome breaks.
B.) Inversion- it is a change in chromosome in which part of
chromosome get rotated in its position so the sequence of
genes is reversed.
C.) Duplication- a segment of chromosome breaks and
gets attached to another chromosome, homologous or non-
homologous.
D.) Translocation- a segment separates from one chromosome and gets attached to a
non-homologous chromosome.
*Mutation also arise due to change in a single base pair of DNA called ‘point mutation’ e.g Sickel cell
anemia.
*If deletion and insertion of base pair of DNA takes place causes ‘frame-shift mutation’.
*There are many chemical and physical factors which causes mutation called ‘mutagens’.
*Mutagens oriented mutation is called induced mutation.
*Chemical mutagens:—EMS, 5BU. Netal ions.
*Physical mutagens:—UV, X-rays, Radioactivity and ϒ-rays.
*Biological mutagens :- Viruse, bacteria and transposons.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 47
 High Ranker’s Biology:- 6265237391,
9891766736
# Pedigree Analysis/Ex.Q.10.
*The study of the family
history about inheritance of a
particular trait, such as
analysis of traits in several of
generations of a family is
called pedigree analysis.
*In the pedigree analysis the
inheritance of a particular trait is
represented in the family tree
over generation.
*This provide a strong tool to
trace the inheritance of a
specific trait or disease like-
Haemophilia , Sickle cell
Anemia, Thalesemia ,colour
blindness etc. to advice
intending couples about the
possibilities of having children
with genetic defects.
*Some important symbols used
in this analysis are—

*PEDIGREE ANALYSIS:-
1.) HOMOZYGOUS AUTOSOMAL RECESSIVE

3.) X-linked Recessive

A/a
– Generally A/a
children – Only shows in males for the
of unaffected parents most part.
show the disease XX
A A X a
Y – Sons of affected fathers not
–The trait will often affected but the daughters are
1
A/A A/a a/a A/a skip generations carriers.
A a A
– A
4
Seen in ~ of progeny XY XX XY
– Seen in both genders

XAY XaY XA Xa XAXA

. -1/2 of sons of female carriers are affected. .
. -1/2 daughters are carrier.

2.) HOMOZYGOUS AUTOSOMAL DOMINANT

-Seen in every
A/a A/a generation
- Rare/ so outsiders
Don’t generally have
1
a/a a/a A/a a/a it
2
- About of progeny are affected
- Both genders are affected

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 48
 High Ranker’s Biology:- 6265237391,
9891766736
*Pedigree Analysis-
*A record of inheritance of certain genetic traits for two or more generations presented in the form
of a diagram or family tree is called pedigree.
*Pedigree employs :-
1. Principle of probability and chances of difference in realised ratio due to smallness of the progeny
2. Elimination of alternatives
* Autosomal Dominant trait- seldom skip a generation.
* An Autosomal recessive trait may skip a generation.
* Sex Linked Dominant trait is more common in females.
* Sex-linked recessive trait is more common in males.
* Y-linked trait directly passes from father to the Son.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 49
 High Ranker’s Biology:- 6265237391,
9891766736

# Mendelian Disorder/Ex.Q.16.
*These disorders are determined by mutation in single gene.
*These are transmitted to the offspring as per Mendelian Principles.
*Mendelian disorders are mainly determined by alteration or mutation in the
single gene. Examples are- Haemophilia, cystic fibrosis, SCA, Colour blindness,
PKU, Thalesemia etc.

1. Haemophilia:-
*Also known as bleeder’s disease
*Sex linked recessive disease. Follows criss-
cross pattern of inheritance.
*Occurs in change in sex chromosomes.
*Transmission from unaffected carrier female.
*Blood clotting affected ,so
*non-stop bleeding on even a minor cut.
*XhXh female generally dies so no female
infected seen.
*Queen Victoria (1819-1901) family children get
this disease by them.
*The disease appearance is approx (1/7000 birth).

2. Colour Blindness:-
*Disease recessive allele is carried by X-
*Red Green colour blindness chromosome.
*Recessive sex-linked trait * In males approx 8% and in female is about 0.4%.
*Eye fails to distinguish red and green * XcXc – Colour blind; XcY – Colourblind male; XcX –
colour
female will be carrier.
*Possibilities of variations in colourblind cases
are:-

Case-I- Colourblind female XCXC & Normal

male XY Case-II Carrier female XCXC &
Colourblind male XCY
*All female and all male progeny become diseased.
Gametes XC Y
X C X X
C C XCY
XC XCXC XCY
Case-III Carrier female XCX & Colourblind male [Link] FemaleXX & Colourblind male
XCY XCY*
*1 female Colourblind, 1 female Carrier and 1 *All female carrier and all male becomes
male is Colourblind and 1 male is normal. desease free (normal).

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 50
 High Ranker’s Biology:- 6265237391,
9891766736
Gametes XC Y Gametes XC Y
XC Y X XCX XY
XC XCXC
X XCX XY
X XCX XY

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 51
 High Ranker’s Biology:- 6265237391,
9891766736
1. Sickle-Cell Anaemia :-
*Autosomal disorder.
*Autosomal linked recessive trait.
*Transmitted from parents to offspring
when both the parents are carrier for the
gene (Heterozygous).
*Disease controlled by a single
pair of allele, HbA and HbS.
**6th position amino acid of β-
chain of haemoglobin, Glutamic
acid (Glu) is changed by Valine
(Val).
*This causes low oxygen tension and
change in the shape of red blood
cells from biconcave disc to
elongated sickle cell. Blood circulation
and supply disturbed.
* SCA is a qualitative disorder.
*Sickle Cell Anemia is
another example of Co-dominance
HbA = Normal Haemoglobine
HbS = Sicle cell anemic.

Case:- 1. ♀ Carrier Female HbA HbS X HbA HbA Normal Male ♂

Female gamets ↓ HbA male gametes HbA male gametes
(Carrier)
HbA HbA HbA HbA HbA
HbS HbA HbS HbA HbS

Case:- 2. Carrier female HbA HbS X Carrier Male ♂ HbA HbS

Female gametes HbA male gamete HbS male gametes
↓ (Carrier)
HbA HbA HbA HbA HbS
Hb S Hb Hb
A S HbS HbS

[Link] : ( Example of Pleotropy ).

*‘PKU’ is an autosomal recessive disease.
*Inborn error of metabolism.
**(Normal metabolism- Phenylalanine converts into tyrosine.)
*Affected lack an enzyme that convert amino acid-phenylalanine into phenyl pyruvic acid.
*So, accumulation in brain causes mental retardation.
*poorly absorbed by kidney so excreated through urine.
*The disease appearance may be 1/18000 birth.
# CHROMOSOMAL DISORDERS :-
*Changes in chromosomes numbers- These genetic disorder are caused due to absence or excess or
abnormal arrangement of one or more chromosomes.
*These are non heritable, pedigree don’t trace these abnormilities.
*These are two types:- autosomal (22 pairs) and sex chromosomal (xx
or xy ). #Aneuploidy :-
*It is a condition of having fewer or extra chromosomes than the normal genome number of a
species. Failure of segregation of chromatids during cell division cycle results in the gain or loss of a
chromose(s). This is known as aneuploidy. Aneuploidy is two types—
#Hypoploidy:- #Hyperploidy:-
*Loss of chromosomes e.g 2N – 1 *Gain of chromosomes.
(Monosomy). Ex– ( 2n + 1 – Trisomy) and (2n + 2 - Tetrasomy).
*2n-2 – (Nullisomy).
*2n-1-1 (Double monosomy).
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 52
 High Ranker’s Biology:- 6265237391,
9891766736

#Polyploidy:-
*Failure of cytokinesis after telophase stage of cell division results in an increase in a whole set of
chromosome in an organism and this is known as polyploidy.
*Autopolyploids:-
*It is the phenomenon of having more than two sets of chromosomes or genomes of self
chromosomes. This is also known as autopolyploidy. Examples – 2n- diploid, 3n- triploid, 4n-
tetraploid and so on.
*Allopolyploids:-
*When two different species are crossed together and having two types of chromosomes together
is allopolyploids; e.g, Raphnobrassica, First Man Made Cereal- Triticale (Hexaploid 6n wheat 42
chromosomes.)

Fig- Raphnobrassica and Modern wheat both are examples of

allopolyploids. Fig: Raphnobrassica (Rdish n Brassica crossed)

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 53
 High Ranker’s Biology:- 6265237391,
9891766736

Fig:- First Man made

cereals (Modern Wheat
or (hexaploid wheat
(6n)).

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 54
 High Ranker’s Biology:- 6265237391,
9891766736
# Dawn’s syndrome/ Mongolism/ 21- Trisomy :-
*Autosomal abnormalities.
*An extra chromosome on 21st chromosome i.e trisomy of 21.
*First described by Langdon Down-1866.
*Short stature, small round face and head.
*Furrowed tongue.
*Partially opened mouth.
*Palm creased.
*Mental retarded.
*Undeveloped gonads and genitalia, so sterile.

# Klinefelter’s Syndrome :-
*Sex chromosome abnormality.
*An extra X chromosome, so 47 (XXY). Male with ( 44 + XXY).
*Feminised male or sterile male (not able to produce/ sterile).
*Development of breast in male, this is Gynecomastia.
*Long body stature with feminised character.
*Reported in case of male is nearly 1/500.
# Turner’s Syndrome :-
*Sex chromosome abnormality.
*Due to monosomy (2n—1), so, that particular female having 45 chromosomes.
*Absence of one of the X chromosome in female. (44 + ...X)
*So female get short stature. Ovary and mammary glands are less developed.
*She will be sterile.
*Reported in case of female birth nearly 1/3000.
# Super Female – 44 + XXX, 44 + XXXX.
# Super Male – 44 + XYY.

# Supplementary Materials :-Topics:-

# Polygenic inheritance:-
*If a trait is controlled by three of more genes are called polygenic traits. Examples- Kernel colour in
wheat, skin colour in human beings, height of human, cob length of maize etc.
*Polygenic inheritance also influence by environment.
* Human skin colour is controlled by three genes- A,B,and C.
*Dark Skin – AABBCC, Dominant alleles.
*Light Skin – aabbcc, Recessive alleles; and
*Mulato – (AaBbCc), is the intermediate hybrid alleles.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 55
 High Ranker’s Biology:- 6265237391,
9891766736
# Pleiotropy:-
*Pleiotropy is defined as the expression of multiple traits by a single gene.
* A single gene can exhibit multiple phenotypic expression. Such a gene is called a pleiotropic gene.
* Mechanism of pleiotropy- gene affect on metabolic pathway of phenotype.
* In case of phenylketonuria (a disease caused by single gene mutation) the disease causes mental
retardation and also reduces hair and skin pigmentation.

# Sex Determination In Honey Bee:- * The sex determination in honey bee is based
* Parents - on the number of sets of chromosomes an
Female (Queen) Male individual receives.
32 16 * Sperm + Egg develop as a female (queen or
↓ worker) and an unfertilised egg develop as a
Gametes 16 16 16 male (drone) i.e parthenogenetically.
F1 ↓ ↓ * So, female is 2n=32 chromosomes and male
Male 16 32 female. is haploid n=16. This is also known as
haplodiploid sex determination system. There
is no father no son but grandfather and
grandson reported.
# Thalassemia:-
*An autosome – linked recessive blood disease transmitted from parents to the offspring when
both the parents are unaffected carrier for the gene (heterozygous).
*Due to reduce rate of synthesis of one of the globin chain either α or β, so abnormal haemoglobin is
formed
and thus causes anaemia.
* In α – Thalassemia production of alpha globin chain is afected.
*This Thalassemia is controlled by genes HBA1 and HBA2 located on chromosome 16th of each parent.
*Thalassemia occurs due to mutation or deletion of one or more of the four genes.
* In β – Thalassemia production of β-globin chain is affected,
*This Thalassemia is controlled by gene HBB located on 11th chromosome of each parent. It occurs
due to one or both HBB genes.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 56
 High Ranker’s Biology:- 6265237391,
9891766736
*--------------------- NCERT Exercise Questions Answers :-
ANS_1.Mendel selected Garden pea ( Pisum sativum) for his experiments because of -
(a) Pure varieties of Pea were available.
(b) Pea plants showed a number of easily detectable contrasting characters.
(c) The plant produces number of seeds for analysis at a time.
(d) Pea flower normally remains closed and undergoes self-pollination

ANS_2.(a)
Dominance Recessive
1 The condition in which the dominant allele 1 The condition in which recessive allele or
is able to factor is unable to express its effect in the
express itself even in the presence of its presence of the dominant allele is known as
recessive allele is recessive.
known as dominance.
2 In dominance, the dominant allele 2 In recessive, the recessive allele forms an
. or factor can form complete incomplete defective polypeptide or enzyme
polypeptide so
or enzyme for expressing its that the expression consists of absence of the
effects, e.g., red colour of flower in effect of dominant allele, e.g., white flower
Pea. colour in Pea.

(b)
Homozygous Heterozygous
1 Homozygous individual is pure for a 1 Heterozygous individual is not pure and produces
. trait/true breeds or give rise to offspring with
homozygous individual. different genotypes e.g. TT, Tt and tt on selfing of Tt
individuals.
2 The alleles are similar 2 The alleles are dissimilar
3 Homozygous carry either 3 Heterozygous individual has both
. dominant/recessive alleles. dominant/recessive alleles.
4 It produces one type of gametes 4 It produces two types of gametes
.

(c) A homozygous or heterozygous individual in which, the paired genes control one
character’s known as monohybrid. The breeding experiment dealing with a single characters
controlled by two pairs of alleles are considered at a time, the breeding experiment is called a
dihybrid cross.
ANS_3. It can be calculated by 2n. Here n = number of loci.
Organism is heterozygous at 4 loci, So possibilities is 24 = 2x2x2x2 = 16 types of gametes.

ANS_4. Principle or Law of Dominance. In heterozygous individuals or hybrids, only one allele is
able to express its effect in the individual. It is called dominant factor or dominant factor or
dominant allele. The other allele which does not show its effect in the heterozygous individuals is
called recessive factor or recessive allele.
*Mendel found that the trait of tallness is dominant over the other trait of dwarfness when a cross
was made between a homozygous tall (TT) pea plant and a homozygous dwarf (tt)pea plant. All the
plant in F1 generation were tall even they have also received a factor for dwarfness.
*The factor for dwarfness is present in F1 plants can be tested by selfing them when individuals of F2
generation will be both tall and dwarf in the ratio of 3:1.
*Therefore, in F1 plants both the factors for tallness and dwarfness are present. However, the factor
for dwarfness is unable to express itself in the presence of factor for tallness.
Hence, tallness is dominant over the dwarfness. The latter factor is called recessive.
ANS_5. Test cross. It is a cross to know whether an individual is homozygous or heterozygous for
dominant character, where the individual is crossed with recessive parent.
Dominant phenotype (Violet) Genotype is unknown, May be WW or Ww ?
*Case-1. If we take unknown flower genotype as WW and crossed it with Homozygous recessive ww
then---
. w w
Ww Ww
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 57
 High Ranker’s Biology:- 6265237391,
9891766736
Ww Ww
Result-All flower produced is violet then the unknown flower is homozygous dominant (WW).

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 58
 High Ranker’s Biology:- 6265237391,
9891766736
*Case-2. If cross is made as purple as Ww and homozygous recessive ww then---
w w
Ww Ww
Ww Ww
Result-Half of the flowers 50% are violet and half of the flowers 50% are white, then the unknown
flower is heterozygous dominant (Ww).

ANS_6. When a cross is made between homozygous female (rr) and a heterozygous male (Rr)for
single locus The F1 progeny will be— 50% homozygous and 50% heterozygous individuals.
R r
.. R Rr Rr .
. R Rr Rr

Ans_7. When a cross is made between tall plant with yellow seeds (TtYy) and tall plant with green
seed (Ttyy), the phenotype in the offspring expected to be----
TY Ty tY ty
TTYy Ttyy TtYy Ttyy
ttYy Ttyy ttYy Ttyy
TTYy Ttyy TtYy Ttyy
TtYy Ttyy ttYy Ttyy
Tall and green – 6/16; dwarf and green – 2/16.

ANS_8 . There will not be any segregation of characters due to linkage so phenotypic features will be
same as parents.

ANS_9. Thomas Hunt Morgan (the father of experimental genetics) formulated the
chromosome theory of linkage in 1910 from his work on fruitfly Drosophila melanogaster.
*Mention four reasons why Drosophila was chosen by Morgan for his experiments in Genetics.
Drosophilla melanogater were found suitable for studies on genetics by Morgan due to the following
reasons:
(i) They could be grown on simple synthetic medium in the laboratory.
(ii) They complete their life cycle in about two weeks and produce a large number of progeny files.
(iii)The male and female files are easily distinguishable.
(iv) It has many types of hereditary variations that can be seen with low power microscope.
# He discovered two types of linkages – complete linkage (1919) and incomplete linkage. He
discovered sex-linkage or sex-linked inheritance (1910) and showed that the sex-linked characters
showed criss-cross inheritance, while studying the inheritance of red-white eye colour trait in
Drosophila. He found the phenomenon of recombination and laid the basis for the technique of
chromosome mapping. He was awarded Noble Prize for physiology / medicine in 1933.

ANS_10. Pedigree Analysis:-

A record of inheritance of certain genetic traits for two or more generations presented in the form
of a diagram or family tree is called pedigree. Analysis of traits in a several generation of a family
is called as pedigree analysis.
(i) In human genetic, pedigree study provides a strong tool, which is utilized to trace the
inheritance of a specific trait, abnormality or disease.
(ii) It is useful for the genetic counsellors to advice intending couples about the possibility of
having children with genetic defects like haemophilia, colour blindness, alkaptonuria,
phyenylketonuria, thalassemia, and sikle cell anaemia (recessive traits).
(iii)Pedigree analysis employs two tools:
(a) Principle of probability.
(b) Elimination of alternatives.

ANS_11. In Humans female is homogametic with two similar sex chromosomes, XX. The male is
heterogametic with one X-chromosome and one Y-chromosome. Sex of the baby is determined by
the type of sperm which

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 59
 High Ranker’s Biology:- 6265237391,
9891766736
fuses with the egg. The XY-pattern of sex determination is like this:-
. Parents→ 44+XX (Female) 44+XY(Male)
. ↓ ↓
. gametes→ 22+X 22+X 22+X 22+Y

22+X↓ 22+Y↓
22+X→
44 + XX 44 + XY
. 22+X→
44 + XX 44 + XY

ANS_12. Given that child blood group is O, that means the child having (iOiO) genotype this can be
possible only when both father and mother should be heterogenic.
So father should be iAiO and mother should be iBiO. Other possibilities are:- iA iO

. iB  i Ai B iBiO .
. iO →
iAiO iOiO

ANS_13. (a) What is codominance? In codominance offsprings produced in F1 generation

resembles both of the parents and both alleles express themselves:--- Example:- In humans ABO
blood group- three alleles iAiBiO are present. iA and iB are codominant thus give a blood group
AB which resemble to both the parents
(b) Incomplete Dominance (Intermediate Inheritance): Sometimes F1 phenotype does not
resemble either of the two parents and is inbetween or intermediate to two parents such a
phenomenon is called incomplete dominance. Example- Snapdragon ( Red,Pink,White-1:2:1).
ANS_14. Point Mutation:- mutation that arise due to change in a single base pair of DNA are
called point mutation. e.g, Sickle cell Anaemia.
ANS_15.‘Chromosomal theory of inheritance’ was proposed by Walter Sutton and Theodore
Boveri in 1902. According to this theory :-
*Gametes serve as a bridge between two successive generations.
*Male and Female contributing hereditary components.
*Nucleus contains chromosomes. Chromatin in the nucleus is associated with the cell division in the
form of chromosomes.
*Both chromosomes as well as genes occur in the pairs in the diploid cell.
*A gamete contains only one chromosome of a type and only one of the two alleles of a trait.
*The pairing of chromosomes and Mendelian factors is restored during fertilisation. So there is
a parallelism between gene and chromosomes.

ANS_16. Autosomal genetic disorders :- (i) Down’s syndrome/ Mangolism. The main symptoms
are rounded face, broad fore-head, permanently open mouth, protruding tongue, projecting
lower lip, short neck, broad palm with characteristic palm crease and Mongolian type eye-lid
fold.
(ii) Phenylketonuria affected babies are normal at birth but within a few weeks there is a
rise (30-50 times) in plasma phenylalanine level, which impairs brain development. Usually by six
months of life severe mental retardation becomes evident. If these children are not treated about
one third of these children are unable to walk and two-thirds cannot talk. Other symptoms are
mental retardation, decreased pigmentation of hair and skin.
*------------------------A S S I G N M E N T S -5th ** blood group A and mother blood group B, work
Q.1Explain Low of Dominance using a out the
monohybrid cross.
Q.2. Define and design a Test-cross.
Q.3. When a cross is
made between tall plant with yellow seeds (TtYy)
and tall plant with green seed (Ttyy), what
proportions of phenotype in the offspring could
be expected a.) tall and green b.) dwarf and
green.
Q.4. How is sex determined in human beings?
Q.5. A child has blood group O. If the father has

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 60
 High Ranker’s Biology:- 6265237391,
9891766736
genotypes of the parents and the possible
genotypes of the other offspring.
Q.6. What is pedigree analysis? Suggest
how such an analysis, can be useful.
Q.7. Explain the following terms with example-
a.) Inc dominance b.) Co-dominance c.) 9:3:3:1
Q.8. What is point-mutation? Give an example.
Q.9. Chromosomal theory of inheritance.
Q.10. Mention two autosomal and two
sex chromosomal diseases, with their
characteristics.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 61
 High Ranker’s Biology:- 6265237391,
9891766736
--------Important genetical diseases and related chromosomes:-
# Autosomal :-
1. Sickle-cell anemia – C – 11. RBC disturbed. 2.
Cystic fibrosis – C – 7. Mucus in lungs, liver.
3. PKU – C – 12. Phenylalanine causes mental retardation. 4. Dawn’s syndrome – trisomy 21.
5. Patau’s syndrome – trisomy 13 ( cleft palate and lip). 6. Cri du chat – C – 5 deletion. (Cat’s cry).
7. Huntington’s disease – C – 4. Gradual degeneration of brain tissue in middle ages.
8. Edward’s syndrome – trisomy 18. (webbed neck, mental, narrow skull, small face etc.)
9. Wolf Hirschhorn syndrome – C – 4 (deletion). Cleft palate, cryptorchidism.

# Sex chromosomal disorders: -

1. Klinefelter’s syndrome – 44 + XXY. 2. Turner’s Syndrome – 44 + XO.
3. Super males – 44 + XYY. ( Tall, subnormal IQ, testosterone high, criminal tendencies).
4. Super female – 44 + XXX ( mental dev less than normal, sex characters normal).
5. Haemophilia and Colour blindness both are X-chromosome related diseases.
6. Thalassemia – α thalassemia – defective alpha globin genes.
β thalassemia – decreased synthesis of β- globin of haemoglobin on chromosome.

*Heredity of Sex Chromosomes:-

*Barr Bodies are condensed, inactivated X chromosomes that are typically found exclusively in female mammals.
*Barr Bodies can be found in various biological samples such as hair, buccal cells, and blood.
* In humans, both males and females have 22 pairs of autosomal chromosomes that are the same
regardless of the sex of the individual. In addition, people have two sex chromosomes called X
and Y.
*A female has two X chromosomes in her genetic makeup, while a male has one X and one Y
chromosome.
*A female always passes on an X chromosome to her offspring.
*The male partner may pass on an X or Y chromosome.
*If he passes on an X chromosome the offspring will
be female, and passing on the Y chromosome will
result in male offspring.
*Barr Body
*Chromosomes are composed of the genes that
are expressed in the body. Females with their
extra X chromosome -- put it aside so the gene
isn't expressed.
*Females shut off one of their X chromosomes
during embryonic development.
*The inactivated X chromosome is called a Barr body and is
sometimes referred to as sex chromatin. If females
genetically expressed both of their X chromosomes at once, then
double the necessary genetic product would be produced. When
the body inactivates extra X chromosomes to keep the dosage
of genetic products equal it is called dosage compensation.
*Each cell only expresses the genetic information from one X
chromosome. The only exception is one small arm of the extra X
chromosome which remains genetically active. During fetal
development, somatic cells (cells that are not involved in sexual
reproduction) shut off one X chromosome.
*Different cells shut off the X chromosome at random, so some cells might
express the genetic code contributed from the mother and some from the father. However,
once the X chromosome is shut off, all of the offspring from those original cells share the same
inactive copy.
*The Barr body remains within cells even though it is not genetically active.
*The Barr body, or sex chromatin, displays itself as a richly stained circular disk. It is particularly
visible when the cell is in interphase, meaning it is not currently undergoing cell division. Arrow
showing Barr Body.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 62
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER – 6. Molecular basis of inheritance

# Discovery :-
*Nucleic acids were first isolated by Fredric Miescher (1869) from pus cells, and named it ‘nuclein’.
* Deoxyribonucleic acid is a polymer composed of two polynucleotide chains that coil around
each other to form a double helix.
*Each strand has a backbone made of alternating sugar (deoxyribose) and phosphate groups.
*The polymer carries genetic instructions for the development, functioning, growth and
reproduction of all known organisms and many viruses.
*DNA duplex model proposed by Watson AND Crick is right handed and spiral and having 10
base pairs in a helical turn and are known as B - DNA.

Others are A – DNA - 11 bps in a helix and right handed.

. B – DNA – 10 bps in a helix and right handed.
. C – DNA – 9 bps in a helix and right handed.
. D – DNA – 8 bps in a helix and right handed.
. Z – DNA – 12 bps in a helix and left handed with zigzag back bone.

#Salient Features of The Double-helix Structure of DNA are as follows :- Bases and
components of DNA * DNA also called a polynucleiotide. so,
*A nucleotide = a nitrogenous base + pentose sugar + phosphate.
*Nucleosides = Nitrogenous base + sugar molecule.
*There are two types of nitrogenous bases.
*Purines – Adenine (A), Guanine (G).
*Pyrimidines – Cytosine (C ), Uracil ( U ), Thymine (T )
*Thymine is present in DNA while Uracil in RNA.
*Nitrogenous base is linked to the pentose sugar through N- glycosidic linkage to form a nucleoside.
*A phosphate group is linked to 5’- OH of a nucleoside through phosphoester linkage nucleotide is
formed. Two nucleotides are linked through 3’-5’
phosphodiester linkage to form a
dinucleotide.
*Nucleotides joined together to form a
polypeptide. Free phosphate end is
called 5’ end and other end of the
polymer the ribose has a free 3’ –OH
called 3’ end.
*Polynucleotide chains said to be
complementary to each other so if the
sequence of bases in one strand is
known then the sequence in other
stand can be predicted.
*Each strand of a DNA double helix acts as
a template for synthesis of a new strand.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 63
 High Ranker’s Biology:- 6265237391,
9891766736
# Primaary structure of DNA double helix and arrangement of BACKBONE (Sugar n
Phosphate).

*DNA strand s is made up of two

polynucleotide chains.
*Chains having anti-parallel
polarity i.e 5’→ 3’ and 3’→ 5’.
*The bases joined together buy A
= T ; G ≡ C and vice versa.
*The two chains are coiled in
a right handed fashion.
*The distance helical turnor
one helical turn having 10 bp
(base pairs) and also called a
‘pitch’.
*Between two consecutive
base pairs is 0.34nm (0.34 X
10-9m).
*A helix having 10 bp so is 3.4 nm.

*Chargaff’s Rule-
[ A + G ] = [ T + C ], i.e., [A+G] = 1
. [T+C]

* Molar concentration of A
is always equal T.
Similarly, molar concentration of G is equal to C.
[A] = [T], i.e., [A] = 1 ; [G] = [C ], i.e., [G] = 1 .
. [T] [C]

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 64
 High Ranker’s Biology:- 6265237391,
9891766736

# Central Dogma of Life (Blue print of life) :-

* Central dogma. The central dogma of molecular biology is a theory stating that genetic
information flows only in one direction, from DNA, to RNA, to protein, or RNA directly to protein.

Reverse Transcription (Reverse transcriptase In RNA

Viruses) Fig- Central Dogma Reverse

* Arragement of DNA at various Level:-

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 65
 High Ranker’s Biology:- 6265237391,
9891766736

Fig- Structural arrangement of DNA to Chromosome

# Packaging of DNA helix or nucleosome model :-

* In prokaryotes the DNA is not scattered throughout the cell.
Negatively charged DNA held with some proteins having
positive chrge in a dense region termed as ‘nucleoid’.
*Two consecutive base pairs having 0.34nm distance, so the length
of human DNA in a diploid cell is 6.6 x 10-9 x 0.34 x 10-9 m/bp = 2.2m.
*This long sized DNA is accommodated in small areas only
through packing. It is done with the help of Lysine and
Arginine rich basic proteins called histones.
*There are five types of histones proteins- H1, H2A, H2B, H3 and H4.
*Four of them H2A, H2B, H3 and H4 occurs in pairs and forms
histone octamer called the nu body or core of nucleosome.
The positively charged ends are towards the outside.
*They attract negatively charged strands of DNA.
*About 200 bp of DNA is wrapped over H1 linker to core particle
or nu body for 1 3/4th or 1.67 turns to again till H1 linker form
nucleosome.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 66
 High Ranker’s Biology:- 6265237391,
9891766736
*The DNA turn over core having approx 146 base pairs on it.
*The two adjacent nucleosomes is connected by DNA
called linker DNA i.e H1 histone protein.
*The nucleosome in chromatin are seen as ‘beads-on-string’.
*The packaging of chromatin at higher level requires
additional set of proteins that are referred to as Non-
histone Chromosomal (NHC) proteins.
*Some region of chromatin are loosely packed and stain
light called euchromatin and are transcriptionally
active chromatin.
*More densely packed region stain darkly called
heterochromatin and are transcriptionally inactive.

# Transforming Principle/ Transformation / Griffith’s Experiments:-

*Fredrick Griffith 1928,
*In a series of experiments with Streptococcus pneumonia,
the bacterium responsible for pneumonia in mice, shows transformation in the bacteria.
*He took two strains of this bacteria.
R-type – non-pathogenic and non virulent (no disease causing), rough walled.
S-type – virulent, pathogenic (disease causing), smooth walled. In his experiments -

Fig:- Different stages of Griffith’s Experiment.

*In his experiment he explained as:-

Step 1. R – strain→ injected into mice→ mice lived.

Step 2. S -- strain→ injected into mice→ mice died.
Step 3. S – strain heat killed) → injected into mice→ mice lived.
Step 4. R-- strain and S- strain (heat killed)→ mixed and injected→ mice died.
*He found that the R-type bacteria did not produce any disease so mice lived while S-type bacteria
caused pneumonia and mice died. However, heat killed S-type bacteria did not produce any
disease in the mice.
*Finally they injected a combination of heat killed S-type + R-type into mice then, mice died.
Autopsy of the dead mice body showed living S-type bacteria in the body.
*The presence of living S-type virulent bacteria is possible only by their formation from R-type
non virulent bacteria is possible only by the trait of virulence from dead bacteria.
The phenomenon is called Griffith effect of transformation.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 67
 High Ranker’s Biology:- 6265237391,
9891766736
# Biochemical characterisation of Transforming Principle:-
*Oswald Avery, C. Macleod and McCarty (1940’s) worked to determined the biochemical nature of
‘transforming principle'.
*Before their work, the genetic material was thought to be a protein.
*They purified biochemicals (proteins, RNA, DNA etc.) from the heat-killed S cells to see which
one could transform live R cells into S cells.
*They found DNA from S bacteria caused R bacteria to ‘transformed’.
*Protein-digesting enzymes (proteases) and RNA-digesting enzymes (RNases) did not affect
transformation, so protein and RNA was not a transforming substance.
*Digestion with DNase did inshibit transformation, confirms DNA as genetic material.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 68
 High Ranker’s Biology:- 6265237391, 9891766736

# The Hershey and Chase Experiment for

the genetic material is DNA:-

*DNA is the genetic material, proof came from

the Experiment of Harshey and Chase-1952.
*The bacteriophage attaches to the
bacteria and its genetic material forms more
virus particles. They worked to discover
whether it was protein or DNA from the
viruses that entered the bacteria.
*They grew viruses on a medium that
contained radioactive P (phosphorus) and S
(Sulfur).
*Viruses grown in 32P contained radioactive
DNA and viruses grown in 35S contained
radioactive protein.
*Radioactive phage was allowed to attach
to E. coli bacteria and Infection proceeded.
* The virus particles were separated from
the bacteria by spinning them in a
centrifuge.
*Bacteria which were infected with viruses
that had radioactive DNA were radioactive
indicating that DNA passed from virus to the
bacteria.
*Bacteria that were infected with viruses that
had radioactive protein were not radioactive.
*This indicates that proteins did not enter
the bacteria from the viruses. So DNA is the
genetic material.

# Properties of genetic material (to be a genetic material) :-

*A molecule that act as a genetic material must RNA provides stability to DNA.
fulfil the following criteria:- vi.)RNA is more reactive both DNA and RNA
i.) It should be replicate themselves. retained in genetic expression.
ii.)Chemically and structurally should be stable. vii.)DNA is stable and not changes with different
iii.) It should be provide the scope for slow stages of life cycle and age, it is better for the
change (mutation) that are required for storage of genetic information.
evolution. viii.) For transmission of genetic information
iv.)Should be able to express itself. RNA is better.
v.) DNA contain thymine (T) instead of Uracil (U)
in
*All metabolism, splicing and translation evolved
#RNA world:- around RNA. It act as a genetic material as
*Ribonucleic acid (RNA) is a polymeric well as a catalyst.
molecule essential in various biological roles in *RNA being a catalyst was reactive and
coding, decoding, regulation and expression of hence unstable.
genes. RNA and DNA are nucleic acids, and, *Therefore, DNA has evolved from RNA with
along with lipids, proteins and carbohydrates, chemical modifications that make it more stable.
constitute the four major macromolecules *They also maintain themselves by repair.
essential for all known forms of life.
*Perhaps RNA was the first genetic material.

Types of RNAs Their Functions

mRNA- messenger Translation (protein synthesis), regulatory
r-RNA- Ribosomal Translation (protein synthesis) Catalytic
t- RNA- transfer Translation (protein synthesis)
hnRNA- heterogenous nuclear Precursors and intermediates of mature mRNAs & other
RNAs
scRNA-small cytoplasmic Signal recognition particles.(SRP), tRNA processing,
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 69
 Catalytic
snRNA- small nuclear mRNA processing, polyA addition,
snoRNA-small
nucleolar Catalytic
rRNA processing/maturation/Methylation
Regulatory RNAs (siRNA, miRNA, Regulation of transcription and translation
etc.)

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 70
 High Ranker’s Biology:- 6265237391,
9891766736
# Replication:- ( Doubling of DNA material before cell divisions.)
*The replication of DNA takes place at S-phase. Replication of DNA requires a set of enzymes,
main DNA dependent DNA polymerase.
*Replication site from where it
starts called ‘Ori’ or ‘origin’
or ‘replication eye’ or
‘origin of replication’.

*DNA topoisomerases
are enzymes that
catalyze changes in the
topological state of DNA,
interconverting relaxed
and supercoiled forms.
*All cells have two major
forms of topoisomerases:
*type I, which makes single-
stranded cuts in DNA, and
*type II enzymes, which
cut and pass double-
stranded DNA.
*Gyrase belongs to a class
of enzymes known as
topoisomerases that are
involved in the control of
topologicsal transitions of
DNA.
*Enzyme helicase act over
the ‘Ori’ site and unzips the
two strands of DNA.
*The separated strands are
stabilised by single strand binding protein called ‘SSB protein’.
*RNA primer is a 10 bps long sequence formed by RNA primase.
*RNA primer initiates the DNA synthesis because, without the presence of RNA primer DNA
polymerase cannot add.
*DNA polymerase added nucleotides in 5’→ 3’ direction on 3’→ 5’ strand. They do a lot of works like
synthesise complementary bases and excise wrong bases i.e. proof reading.
*DNA polymerase synthesise the complementary bases in discontinuous manner by leaving gaps.
*This was discovered by Okazaki (1968) so called Okazaki Fragments and the strand is called lagging
strand.
*Another strand of the fork form bases in continuous manner called leading strand (5’→3’).
*Okazaki fragments are joined together by the enzyme DNA ligase,(but without new complementary
base synthesis) which helps in formation of two identical strands of DNA.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 71
 High Ranker’s Biology:- 6265237391,
9891766736
# Fig:- Messelson and Stahl experiment representing Semi- Conservative Mode of DNA Replication:-

*The experimental proof of DNA replication, or Messelson and Stahl’s experiment/ Semi-
conservative mode of DNA replication:-
*Semi-conservative replication of DNA was proved by the work of Messelson and Stahl (1958).
*They grew E. coli in a medium having isotopes of nitrogen 15NH4Cl the bacterial DNA become
completely labelled, another bacterial DNA was labelled with 14NH4Cl isotope.
*15N15N (heavy isotope) labelled shows its band at the bottom of test tube while,
14N14N (light isotope) shows its band at the top of test tube because 14N is lighter than 15N.

*Labelled DNA shows their bands in test tubes at bottom and upper position respectively.
*Now 15N15N labelled bacterium now allow to grow in 14N14N containing medium.
*The first generation shows a hybrid 15N 14N in 20 minutes.
*A hybrid shows their band between 15N15N and 14N14N that is in the middle.
*Second generation just after 40 minutes shows more 14N strands because they are allow to grow in
medium containing 14N. So the newly formed DNA with more 14N strands show band shifting towards
14N band.

*During the second generation 15N14N strands of DNA duplex separates to functions as a
template and the newly formed DNA will synthesized from surrounding that is new DNA of 14N
containing.
*In this way at each replication one strand of parent DNA is conserved in the daughter and second
strand is newly synthesisedfrom the surrounding medium i.e semi conservative mode of DNA
replication.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 72
 High Ranker’s Biology:- 6265237391,
9891766736
# Transcription:- (Script of stored genetic information in the form of RNA from DNA):-

*The process of copying genetic information from strand of the DNA into RNA is called transcription
or taking the coded information from DNA to the site where it is required for protein synthesis. In
transcription only a segment of DNA and only one of the strands is copied into RNA.
* If both strands act as a template. They would code for RNA molecules with different sequences
and if they code for proteins the sequence of amino acids in the proteins would be different
that complicate whole genetic machinery.
* The two RNA produced would form a doble stranded RNA. This prevent RNA from being translated
into protein.

# A transcriptional unit in DNA -having:- (i) a promoter (ii) the structural gene (iii) a terminator.
*The DNA dependent RNA polymerase work 5’→3’ and strand 3’→5’ work as a template.
*The strand 5’→3’ polarity has sequences same as RNA (except T at U) is displaced during
transcription this strand is called coding strand.
*Template strand- 3’ATGCATGCATGC ATGCATGC5’.
*Coding strand- 5’ TACGTACGTACGTACGTACG3’.
*Promoter provide site for RNA polymerase.
*In many cases the promoter has an AT rich sequences called TATA box which also called Prinbow box
after its discoverer.

# Mechanism of Transcription:-
*In eukaryotes transcription occurs
at G1 and G2 phase of the cell cycle,
inside the nucleus and the products
move out into cytoplasm for
transcription.
*Transcription requires a DNA dependent
enzyme RNA polymerase.
*In bacteria there are three major RNA
which all needed to synthesise protein
e.g m RNA – messenger RNA –
provides the template,
t RNA – transfer RNA – bring anticodon
and forms amino acids,
r RNA – ribosomal RNA – catalytic role during
translation.
*RNA polymerase binds to promoter
and initiate transcription called
initiation.
*Bacterial RNA polymerase having β, β′, α, α
, omega and a sigma (σ) factor.
*All β, β′, α, α and omega forms
core enzyme which with sigma (σ)
forms Holoenzyme.
*Sigma recognises the start signal
or promoter.
Splicing (Capping & Tailing)
*The released RNA is primary transcript and
processed to form functional RNA i.e

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 73
 High Ranker’s Biology:- 6265237391,
9891766736
‘splicing’.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 74
 High Ranker’s Biology:- 6265237391,
9891766736
*In prokaryotes a transcription
unit is polycistronic mRNA.
*In eukaryotes it is monocistronic mRNA.
*Eukaryotes genes have coding
sequences or expressed sequences
called exons and non coding
sequences or intervening sequences
called introns.
* In Eukaryotes, the structural genes
are monocistronic and ‘split’.
* In eukaryotes, there are three RNA
polymerases in the nucleus, apart from
the RNA polymerase in the organelles.
A.) RNA pol-I transcribes
rRNAs ( 28S, 18S, and 5.8S )
B.) RNA polymerase II- transcribe
the precursor of mRNA (called
hnRNA- heterogenous nuclear
RNA)
C.) RNA polymerase III- catalyses
transcription of tRNA, 5 srRNA and
snRNA.
*Splicing is removal of introns and
fusion of exons to form functional RNAs.
*Introns recognised by ‘snurps’-
small nuclear RNA proteins.
.
. (Fig:- Splicing with capping and Talling)
*Capping and tailing → cap at 5’ by guanosine and tail at 3’ end of poly-A done for specific work.
*Now full processed mRNA is transported out of the nucleus for translation.
*In prokaryotes transcription and translation occurs in the same region.

# Genetic Code :- ( Chemical Coded form of you and your characteristics) :-

*Genes are made-up of nucleotides arranged in a specific manner.

*Now-a- days a gene refers to a cistron of DNA.
*The relationship between the sequence of amino acid in a polypeptide and nucleotide sequence
of DNA or mRNA is called genetic code.

*Why code is triplet?

*A singlet code (41 = 4) i.e one amino acid specified by one base can specify only 4 acids.
*A doublet code only 16 (42 = 4x4 = 16 ).
*Our body needs twenty different forms of amino acids, so singlet and doublet codon are not able to
fulfill the adequate amount of codon. So these two combinations are not possible.
*While a triplet code can specify up to 64 amino acids (43 = 4x4x4 = 64 ). As there are 20 amino
acids, a triplet i.e 3 nitrogen bases for one amino acid can be operative.

*Characteristics of gentic codes:-

a.) The codon is triplet. (43 = 4x4x4 = 64 is sufficient for 20 amino acids.)
b.) AUG is a dual codon because it is start codon and also synthesizes metheionine amino acid.
c.) UAA- ochre, UAG- amber, UGA- opal, are
(‘stop codon’ or ‘non-sense codon’ or ‘termination codon’, they never code any amino acids.)
d.) Ther are Universal and specific in nature (one codon specify same amino acid in Viruses-Bacteria-
Human)
e.) They are Unambiguous ( show “unambiguity” – one codon specifies only one
amino acid. f.) Some amino acids are coded by more than one codon hence the
codon is “degenerate”. g.)Non-overlapping – a nitrogen base is only for a codon.
h.) Comma less (no punctuation) – codon are continuous, not stop after the triplet.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 75
 High Ranker’s Biology:- 6265237391,
9891766736
# Mutation and genetic code:-
*Insertion (adition) or deletion of one or two bases changes the reading frame from the point of
insertion or deletion.
*Insertion or deletion of three or its multiple bases insert or delete one or multiple codon hence one
or multiple amino acids and reading frame remains unaltered. Such mutation is called frame
insertion or deletion mutation. A proof that codons is triplet-
RAM HAS RED CAP - normal.
RAM HAS CAP - deletion of a
frame. RAM HAS BIG RED CAP -
insertion.

# Translation :Protein Synthesis (RNA → Protein) :-

*The way in which bacteria determine the Start codon differs from the method used in eukaryotes.
Bacterial mRNAs do not have 5′ caps, so ribosomal assembly in prokaryotes must be different
from that in eukaryotes.

*The Shine–Dalgarno sequence is a ribosomal binding site in bacterial and archaeal messenger RNA,
generally located around 8 bases upstream of the start codon AUG.
*The RNA sequence helps recruit the ribosome to the messenger RNA to initiate protein synthesis
by aligning the ribosome with the start codon.
*The Shine-Dalgarno sequence is typically found around position -7 to -4 of the translational Start
codon and has the sequence AGGAGG. This sequence is complementary to part of the 3′ end of
16S rRNA: GAUCACCUCCUUA-3′ (the portion that is complementary to Shine-Dalgarno is
underlined).

*Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a
polypeptide, or chain of amino acids.
*The process of polymerisation of amino acids to form a polypeptide is called translation.
*Firstly formation of peptide bond requires energy.
*In the presence of ATP an amino acid combines with its specific aminoacyl- t RNA synthetase called
activation.

*Ribosomes are actual site of protein-

synthesis. The mRNA attaches itself to
smaller subunit of ribosome in such a
manner that initiation codon of m RNA
(AUG) comes at P- site called initition.
*Numbers of initiation factors required for this.
*Prokaryotes ribosome (70s – 30s and 50s)
*Eukaryotes ribosome (80s – 40s and 60s).

*An aminoacyl t RNA complex reaches the

A- site and attaches to mRNA codon next
to initiation codon with the help of its
anticodon. It required GTP and an
elongation factor the process is known as
elongation.
*A peptide bond ( -CO-NH- ) from between
the –COOH to RNA at P-site and – NH2 to tRNA at A-site. The reaction catalysed by the enzyme
‘peptidyl transferase’.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 76
 High Ranker’s Biology:- 6265237391,
9891766736
S*Termination –
*Synthesis of polypeptide terminates when a nonsense codon of m RNA reaches the A-site.
*There are three non-sense codon or termination codon (stop codon), UAA, UAG, and UGA.
*No more synthesis takes place, no amino acids are found for these termination codon. The t RNA
hydrolysed and polypeptide is released in the presence of GTP dependent ‘release factor’.
*A chain of amino acids obtain that forms protein.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 77
 High Ranker’s Biology:- 6265237391,
9891766736
# Structure of tRNA ( Clover leaf model or an adopter molecule):-
*Also called transfer RNA.
*About 100 types.
*Smallest RNA also called SRNA
(soluble RNA).
*A tRNA have following parts-
*Anticodon- it is made up
of three nitrogenous
bases
for recognising and attaching
to the codon of m RNA.
*AA binding site is the
amino acid binding site.
Both are recognition site of
t RNA.
*4th loop is ribosome binding
site called TѱC loop.
*Variable arm function is
not known.
*There are no tRNA for
stop codon.

Fig:- t-RNA, An adopter molecule (clover leaf model).

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 78
 High Ranker’s Biology:- 6265237391,
9891766736
# Regulation of gene expression or Operon Concept :-
*Gene regulation refers to the mechanisms that act to induce or repress the expression of a gene.
*These include structural and chemical changes to the genetic material, binding of proteins to
specific DNA elements to regulate transcription, or mechanisms that modulate translation of
mRNA.
*Operon: A set of genes transcribed under the control of an operator gene.
*More specifically, :- an operon is a segment of DNA containing adjacent genes including
structural genes, an operator gene, and a regulatory gene.
*An operon is thus a functional unit of transcription and genetic regulation.
*The control over the functioning of gene is called regulation of gene expression.

*According to Jacob and Monad ‘the genetic material having regulated gene units called operon’.
*In lac operon a poly-cistronic structural gene is regulated by a promoter, an operator and
three structural genes z, y and a coding for enzymes, β-glactosidase, permease and
transacetylase respectively.
*Permease pumps lactose into the cell
where β- glactosidase converts it into
glucose and glactose. Those genes are
not expressed in the absence of lactose.
*RNA polymerase bind at promoter and
forms repressor which bind to the operator
and cause structural change in operator
which do not allow RNA polymerase for
further transcription.
*When lactose given from outside it induce
the active repressor into inactive repressor
which do not bind to operator and
transcription proceeds.

*trp Operon :-

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 79
 High Ranker’s Biology:- 6265237391,
9891766736
FIG:- OPERON MODEL OF TRYPTOPHAN

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 80
 High Ranker’s Biology:- 6265237391,
9891766736
# Human Genome Project :-
Genetic make-up of an organism or an individual lies in the DNA sequences. If two individuals differ
then their DNA sequences also be different. These assumptions led to find out the complete DNA
sequence of human genome. Human Genome Project (HGP) was called a mega project involving
a lot of money, most advanced techniques numerous computers and scientists at work.
# Goals :-
i.) Identify all the 20,000 – 25,000 genes in human DNA.
ii.)Determine the 3 billion sequences
iii.)Store information in database
iv.) Improve tools for data analysis
v.) Transfer technologies for other industries
vi.) Projects may arise the ethical legal and social issues (ELSI).

#Methodologies :-
1. Identifying all the genes that expressed as RNA i.e Expressed sequence tags (ESTs)
2. Simply sequencing the whole set of genome that contained all the coding and non-coding
sequence and later assigning different regions in the sequence with functions i.e , ‘sequence
annotation’. For sequencing, DNA from a cell isolated and fragmented randomly in small sizes.
There are technical limitations in sequencing very long pieces of DNA so it sometimes cloned by
the help of yeasts and bacteria.
*BAC – bacterial artificial chromosomes. YAC – yeast artificial chromosomes.
*The fragments were sequenced using automated DNA sequences worked on ‘Sanger’s Method.
Specialised computer programs were developed. Maps developed by the help of repetitive DNA
sequence and restriction enzyme.

# Salient feature of Human genome:-

[Link] 3164.7 million nucleotide bases.
2.3000 bases per gene, largest known gene is distrophin having 2.4 million bases.
[Link] no. of gene estimated – 30,000.
4.99.9% bases are exactly
the same in all people.
[Link] than 25 of genome
codes for proteins.
[Link] sequences
make up very large portion.
[Link] 1 having
2968 genes (largest in
numbers) Y chromosome
has fewest – 231 genes.
[Link] – Single nucleotide
polymorphism, about, 1.4
million location in human.

# DNA Finger printing:-

*DNA fingerprinting or ‘DNA
typing’ is a technique to
identify a person on the basis
of his/her DNA specificity.
Each person has a unique
DNA fingerprint.
*A conventional fingerprint
that occurs only on the
fingerprints can be altered by
surgery.
*A DNA fingerprint of same
person cannot be altered by
any known treatment. So
recently it becomes a suitable
method to distinguish an
individual from other people
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 81
 High Ranker’s Biology:- 6265237391,
9891766736
unmistakably.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 82
 High Ranker’s Biology:- 6265237391,
9891766736
# Principle –
*DNA very specific in each individual and short nucleotide repeats are very specific in each
individual and vary in no. from person to person but are inherited. These are the Variable Number
Tandem Repeats – ‘VNTRs’.
*Each person inherits these repeats from his/her parents which are used as genetic markers.
# Techniques :-
1. The DNA is extracted from the nuclei of white blood cells or of sperm of the hair follicles like
evidences at the crime sites – Robbery, Rape, Murder or Paternity claim.
2. Cut into fragments by restriction endonuclease, and the fragments contain ‘VNTRs’.
3. The fragments are separated according to size by Gel electrophoresis.
4. The separated fragments of DNA in the gel are copied on to a nylon paper by Southern
Blotting Technique. [Link] DNA probe having complementary on VNTRs binds to repeated
sequences. X-ray film marks the places where the radioactive DNA probe bound to the DNA
fragments.
6. The dark bands on X-rays film represent the ‘DNA fingerprints’.

# Applications-
a.) identify victims and killers.
b.) paternity disputes can be solved
c.) robbers murders and rapists are identified
d.) helps in evolutionary studies.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 83
 High Ranker’s Biology:- 6265237391,
9891766736
*DNA Fingerprinting stepwise method (technique):-
*Comprision between Southern, Northern and Western blotting:-

*HERE IT IS GIVEN THAT,

*THE LENGTH OF THE [Link] DNA IS 1.36 MM.
*WE KNOW THE LENGTH OF THE DNA CAN BE CALCULATED BY MULTIPLYING THE NUMBER OF BASE PAIRS
INTO THE DISTANCE BETWEEN THE BASEPAIRS.

*NUMBER OF BASE PAIRS = LENGTH OF DNA/ DISTANCE BETWEEN THE BASE PAIRS
=1.36 / 0.34 X 10−9
= 4 X 106 BASE PAIRS.
*HENCE, THE CORRECT ANSWER IS 4X106 .

# Distance between two consecutive base pair = 0.34 x 10-9 m

*The length of bacteriophage lambda DNA = 0.34 x 10-9 m x 48502 = 16.49 x 10-6 m
----------------------------# NCERT Questions Solutions:-
Q.1. Group the following as nitrogenous Q.3. If the sequence of one strand of DNA is
bases and nucleosides: written as follows:
Adenine, Cytidine, Thymine, Guanosine, 5’ – ATGCATGCATGCATGCATGCATGCATGC
Uracil and Cytosine. –
Ans. Nitrogenous bases: Adenine, Thymine, 3’
Uracil, Cytosine. Nucleosides: Cytidine, Write down the sequence of
Guanosine. complementary strand in 5’ → 3’ direction.
Q.2. If a double stranded DNA has 20% of Ans. 5’ – GCATGCATGCATGCATGCATGCATGCAT
cytosines, calculate the percent of adenine –
in the DNA. 3’
Ans. In a DNA molecule, the number of Q.4. If the sequence of coding
cytosine molecules is equal to guanine strand in a transcription unit is written
molecules and the number of adenine as follows:
molecules are equal to Thymine molecules. 5’ – ATGCATGCATGCATGCATGCATGCATGC
Thus, –
* If a double stranded DNA has 20% of cytosine, it 3’
has 20% of guanine. Thus, cytosine plus guanine Write down the sequence of mRNA.
make 40% of the total bases. The remaining 60% Ans. If the coding strand in a transcription unit
includes both adenine and thymine which are in is – 5’ – ATGCATGCATGCATGCATGCATGCATGC-
equal amounts. 3’
*Therefore, the percent of adenine is 30%. Then the template strand will be 3’ –
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 84
 High Ranker’s Biology:- 6265237391,
9891766736
TACGTACGTACGTACGTACGTACGTACG – 5’
and the
sequence of bases in mRNA will be – 5’ –
AUGC AUGC AUGC AUGC AUGC AUGC
AUGC – 3’

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 85
 High Ranker’s Biology:- 6265237391,
9891766736
Q.5. Which property of DNA double helix Q.6. Depending upon the chemical nature of
led Watson and Crick to hypothesize template (DNA or RNA) and the nature of
semiconservative mode of DNA replication, nucleic acids synthesized from it (DNA or RNA),
explain.
list the types of nucleic acid polymerases.
Ans. Watson and Crick suggested that the two
Ans. 1. DNA – dependent DNA
strands of double helix DNA molecule uncoil polymerase uses a DNA template for
and separate and each of the two strands synthesis of DNA
serves as a template for the synthesis of a new 2. DNA – dependent RNA
(complementary) strand alongside it. The polymerase uses a DNA template for
template (i.e., parental strand) and its synthesis of RNA
complement (i.e., the daughter strand) then 3. RNA – dependent DNA
form a new DNA double strand, identical to the polymerase uses RNA template for synthesis
original DNA molecule. The sequence of bases of DNA (reverse transcription)
which should be present in the new strands can be
easily predicted because these would be Q.7. How did Hershey and Chase
complementary to the bases present in the old differentiate between DNA and protein in
strands. A will pair with T, T with A, C with G and their experiment while proving that DNA is
G with C. Thus two daughter DNA molecules are the genetic material?
formed from the parent DNA molecule and Ans. Hershey and Chase used different
these are identical to the parent molecule. radioactive isotopes to label DNA and protein.
Since each daughter DNA molecule consists of They used radioactive sulphur (35S) to identify
one old (parental) strand and one new strand, protein and radioactive phosphorus (32P) to
this mode of replication is said to be identify nucleic acids.
semiconservative (i.e., the new DNA molecule has
conserved half of the parent molecule).
Q.8. Differentiate between the
following:
a) Reptitive DNA and Setellite DNA
b) mRNA and tRNA
c) Template strand and Coding strand.
Ans. a) Differences between repetitive DNA and Satellite DNA
Repetitive DNA Satellite DNA
There are some specific regions in DNA The repetitive DNA, when separated from bulk
molecules where a small stretch of non- genomic DNA by the technique of density
conding DNA sequence is repeated gradient centrifugation, from minor peaks
several hundred or thousand times. whereas the bulk DNA forms the major peak.
The stretch of DNA which is repeated The minor peaks are referred to as satellite
several times is called repetitive DNA. DNA. Thus, satellite DNA represents highly
These repetitive DNA stretches are found repetitive nature of small stretches of DNA
at many places throughout the length of having distinctive base composition (A:T or
DNA and are specific in each individual. G:C). The so called satellite bands, quite
separate from the major band of bulk DNA.
A useful genetic marker in DNA finger printing.
b) Differences between mRNA and tRNA
mRNA tRNA
1. mRNA is longest and linear in shape. 1. tRNA is shortest and clover leaf-like, folded
into L- shape.
2. mRNA carry information from DNA for 2. They carry amino acids to mRNA
protein synthesis. codons for protein synthesis.

3. They are numerous in number 3. They are about 60 in number.

c) Differences between template strand and coding strand
There are two strands in a DNA double helix. One strand, which functions as template for RNA
synthesis is known as template strand or sense strand. The complementary strand of template
strand is called coding strand or antisense strand.
Q.9. List two essential roles for ribosome during translation.
Ans. 1. Ribosome provides the site for protein synthesis. The mRNA comes in contract with
small subunit of ribosome and then protein synthesizing complex is formed. The large subunit
provides sites for amino acid binding.
2. Ribosome also acts as a catalyst for the formation of peptide bond.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 86
 High Ranker’s Biology:- 6265237391,
9891766736
Q.10. In the medium where E. coli was dollars. Further, if the data is to be stored in
growing, lactose was added, which induced books, with each book having 1000 pages and
the lac-operon. But why does lac-operon shut each page having 1000 letters, some 3300
down after some time after addition of books will be required. Thus, high speed
lactose in the medium? computational devices were used for storing
Ans. Lactose acts as an ‘inducer’ by switching and analyzing the data.
on and off the operon. If lactose is present in Q.13. What is DNA fingerprinting?
the bacterial culture, it inactivates the repressor Mention it application.
and induces transcription for the synthesis of Ans. DNA fingerprinting is a technique
enzyme beta- galactosidase. This enzyme acts on employed to assist in the identification of
lactose so that the lactose is utilized. Absence individuals on the basis of their respective DNA
of lactose (or inducer) causes synthesis of profiles. DNA fingerprinting is also known as
repressor mRNA that binds to the operator region DNA profiling or DNA typing.
and stops transcription. In this way the lac-operon Q.14. Briefly describe the following:
is shut down. a) Transcription b) Polymorphism c)
Q.11. Explain (in one or two lines) the Translation
function of following: (a) Promoter (b) tRNA d) Bioinformatics.
(c) Exons. Ans. a) Transcription is a process of making a
Ans. a) Promoter. Promoter gene lies copy of genetic information stored in a DNA
adjacent to the operator gene and marks the strand into a complementary strand of RNA
site where the RNA polymerase enzyme binds. (mRNA) with the aid of RNA polymerase.
b) tRNA. tRNA molecules read the code (b)If a inheritable mutation is observed in
and link it to the amino acids during protein a population at high frequency, it is
synthesis. called DNA polymorphism.
c) Exons. In split – arrangement of (c) Translation is the mechanism by which the
eukaryotic mRNA, the sequence of bases that triplet base sequence of an mRNA guides the
appear in processed RNA are called exons. They linking of a specific sequence of amino acids
are interrupted by introns in unprocessed RNA. to form a polypeptide (protein) on ribosomes.
Q.12. Why is the Human Genome Project (d)Bioinformatics is the branch of science
called a mega project? concerned with the management and analysis
Ans. Human Genome Project (HGP) was called
of biological information stored in databases.
a mega project because it had involved a lot This branch is a recently developed science
of money, most advanced technologies, using information to understand biological
numerous computers, many scientists and a phenomenon.
long span of time. The magnitude of the project *It has developed after establishment of
can be imagined by visualizing that it was genetic engineering techniques, introductive
aimed to find out the complete DNA sequence of automated protein and DNA sequencing
of human genome which is said to have technologies and use of computers to store
approximately 3 × 109 bp. The cost of the enormous data which could be easily accessed
project can be imagined that if the cost of remotely.
sequencing a bp is 3 dollars, sequencing of 3 ×
109 bp would be a billion
---------------------------Assignments- chapter- 6. What is genetic code ? Write its various features.
6:- 7. What is operon concept ? Describe it by the help
1. Salient features of DNA genetic material. of lac operon.
2. Explain Griffith’s experiment of transforming 8. DNA finger printing. Method and its applications.
principle. 9. What are different stages of replication?
3. How Harshey and chase experiment support the Describe the capping and tailing regarding this.
DNA is the genetic material and not the protein. [Link] of tRNA molecules.
4. How DNA replication is semi-conservative type?
Explain it by the help of Masselson and Stahl
experiment.
5. How DNA replication performed inside eukaryotes..

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 87
 High Ranker’s Biology:- 6265237391,
9891766736
Organism Connecting link Neopilina (Mollusca) Annelida and Mollusca
between Balanoglossus Nonchordata
Viruses Living and nonliving (Chordata)
Euglena (Protozoa) Plants and animals and Chordata
Proterospongia Protozoa and Porifera Dipnoi (Lungfish) Pisces and Amphibia
(Protozoa) Archaeopteryx Reptiles and Birds
Peripatus Annelida and (Aves)
(Arthropoda) Arthropoda Prototheria Reptiles and Mammals
(Mammalia)

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 88
 High Ranker’s Biology:- 6265237391,
9891766736

*CHAPTER – 7. EVOLUTION
# Introduction :-
*Study of history of life forms on earth is evolutionary biology. To understand the evolution change
in flora and fauna that have occurred over millions of years an earth, we must understand
evolution of earth, stars and the story of origin of life and evolution of life and biodiversity on the
planet earth.
# Origin Of Earth :--
*Most accepted theory to explain the origin of universe is the Big Bang theory given by Abbey Lemaitre
in 1931. According to this theory universe had an explosive beginning.
*It originated about 15 billion years ago by a big bang i.e., thermonuclear explosion.
*The universe expanded and hence the temperature came down. H and He formed later.
*The gases condensed under gravitation and formed the galaxies of the present day universe.
*Earth formed about 4.5 billion years back. There was no atmosphere on early earth.
*Water vapour, methane, CO2 and NH3 released from molten mass covered the surface.
*The UV rays from the sun broke up water into H and O and the lighter H2 escaped.
*Oxygen combined with NH3 and CH4 to form water (H2O), CO2 and others.
*The ozone layer is formed later.
*As vapour cooled the water droplets fell and fill the ditches and depressions on the surface and form
oceans.
*Life appeared 500 million years ago (mya).
#Theories Of Origin Of Life :-
[Link] theory :-
*According to this theory “protoplasm” reached the earth in the form of ‘spores’ or ‘germs’ from
some unknown part of the universe with the dust and evolved into various forms of life, but life
can’t survive in extreme cold.
[Link] Generation :-
*This theory states that life originated from nonliving thing in a spontaneous manner. For a long time it
was also believed that life come out of the decaying and rotting matter like straw and mud etc.
But Louis Postuer’s experiment demonstrated that “life comes only from pre-existing life”.
3. Modern Theory:-
*Operin and Halden Theory/Chemical theory/Abiogenic Theory;-
*Oparin and Halden proposed that the first form of life could have come from pre-existing non-
living organic molecules e.g., RNA, Protein etc. and preceded by chemical evolution i.e formation
of diverse organic molecules from inorganic constituents. The condition on earth was - high
temp. volcanic storms, reducing atmosphere containing CH4, NH3 etc.

# Experimental Proof Of Modern Theory By

Miller’s Experiment :-
*In 1953 Miller created similar conditions in a
laboratory and advocate this theory.
*He created electric discharge in a closed
flask containing CH4, H2, NH3 and super
heated water vapour at 8000c
*He observed formation of amino acids.
*In similar experiment others observed, sugars,
nitrogen bases, pigment and fats.
*Analysis of meteorite contents also support by
possessing similar compounds.
*Chemical evolution is a widely
accepted theory regarding origin of
life.

Fig:- Miller’s Experiment

Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 89
 High Ranker’s Biology:- 6265237391,
9891766736
# Evolution of life forms :-
*According to the theory of ‘special creation’ life was created by super natural power.
*This theory includes two ideas.
1. All living organisms that we see today were created as such.
2. The diversity was always the same since creation and will remain same in future also.
# Darwinism :--
*In 1881 Darwin travel on H.M.S Beagle a ship, for a voyage of the world exploration.
*Darwin observed and studied a wide variety of plants and animals.
*When he reached ‘Galapagos Island’ he noticed that the Galapagos Islands have many
endemic species of plants and animals.
*He was recorded that in the island, insect eating Warblers and woodpeckers were absent.
*Instead, various types of finches, a group of small black birds, which were originally seed-eating
but have assumed insect eating pattern were present in the Island. These finches were referred
as ‘Darwin Finches’. On the basis of his exploration he proposed- ‘theory of natural selection’.
*Features of this theory are :-
a.) Rapid multiplication-‘organisms produces
no. of individuals’.
b.) Limited food resources and space .
c.) Struggle for existence.
d.) Survival of the fittest.
e.) Natural selection.
f.) variation and inheritance of useful variations.
g.) Formation of new species.
# The Evidences For Evolution :-
*Evidence from fossils record of plants and
animals are good source of evidences in
support of evolution e.g ,
*Archeopterix a link of reptile and birds. FIG- HOMOLOGOUS ORGANS
*Evidences from comparative – Anatomy and
Morphology :-

1. Homologous Organs :-
*The organs which have the same
fundamental structure but are different in
functions are called homologous organs.
*These organs follow the same basic plan of
organisation during the development, on maturity
modified to perform different functions, due to
divergent evolution,
*e.g., Fore limb of frog- jumping,
*Lizards- for climbing,
*Bat-for flight,
*Whale- for diving and swimming,
*Cheetah- for running and
*Human – for grasping and holding.
*In plants the homologous organs may be a thorne of Bougainvillea or a tendril of Cucurbita both
arising in the axillary position.
*Functionally they are different in Bouganvillea it is related to defense while in cucurbita it is related with
support.
2. Analogous Organs :-
*The organs which have different
anatomy but perform similar
functions are called as analogous
organs.
*They have different origin.
*For example, wings of insects and birds.
*Sweet potatoes and potatoes both
have the same function of food storage

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 90
 High Ranker’s Biology:- 6265237391,
9891766736
but have

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 91
 High Ranker’s Biology:- 6265237391,
9891766736
different origin.
*The organs which have similar functions but having different origin are called analogous organs.

*The analogous structures are the result of convergent

evolution, e.g., forewings of moths, birds and bats.

Fig:- Pattern of
convergent and
Divergent evolution.

3. Vestigeal Organs :-
*The organisms which are present in
reduced form and do not perform any
function in the body but correspond to the
full development functional organs.
*They are believed to be remnants of
organs which were complete and
functional in their ancestors,
*For example:- In humans- nictitating
membrane, hairs on body, presence of
mammy, abdominal muscles, external
pinna , vermiform appendix, canine etc.

4. Natural Selection :-

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 92
 High Ranker’s Biology:- 6265237391,
9891766736
*Industrial melanism. In Britain a moth Biston betularia show more white winged moths than dark
winged before industrialisation.
*But after industrialisation there were more dark- winged moths in the same area. Before
industrialisation almost white coloured lichen covered the tree trunks.
*In that background the white winged moths survived but the dark-coloured moths were eaten by
predators.
*During post industrialisation period the tree trunks become dark due to industrial smokes. Under
such condition the white winged moths did not survive due to predators and dark winged moths
survived.
*Here lichens can be used as pollination indicators, because they did not grow in polluted
areas. Therefore, moths that were hidden in the background survived.
Thus industrial melanism supports evolution by natural selection.

5. Adaptive Radiations :-
*A form of divergent evolution. Development of different functional structures from a common
ancestral form called adaptive radiation.
# Darwin’s Finches –
*They had common ancestors but
now have different types of modified
beaks according to their food habits.
This was a result of changing of their
habit and adaptation to avoid
conflicts between
them. Examples- Darwins’s finches
*Sources were limited. So, for the continuity of their life they changed their food habits.

# Australian Marsupials :-

*The adaptive radiation gave rise to a variety of marsupial a ‘pouched mammals’ in Australia.
*A no. of marsupials evolved from an ancestral stock.
*They all developed due to isolated geographical area, food habit etc. as found in the finches in the
‘Galapagos Islands’.
*Australian marsupials and
placental mammals show
convergent evolution, e.g.,
placental wolf Tasmanian wolf -
marsupial. When convergent
evolution is found in closely
related species. It is called
‘parallel evolution’ e.g, Running
habit in deer and horse.

Fig:- Australian Marsupials.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 93
 High Ranker’s Biology:- 6265237391,
9891766736
# Recapitulation Theory:- (Biogenetic Law):-
*Baer’s law or embryological parallelelism which stated that during embryonic development, the
generalised features appeared earlier than the
special features.
*Earnst Haeckel (1866)-
modified this law as
biogenetic law that states:-
“Ontogeny repeats phylogeny”.
*Ontogeny – life history of an
organism.
*Phylogeny - evolutionary
history of an organism.
*In other words – an organism
repeats its ancestral history
during its development. At
their embryological level
various multicellular animals
look alike.
# Genetic Drift: –
*It is an important example of variation and evolution.
*The random changes in gene frequencies in a population occurring by chance alone rather than by
natural selection are called ‘genetic drift’.
*Founders effect:-
*When a small group of persons called
founders leaves their homes to find a new
settlement, the population in a new
settlement may have different genotype
frequencies from that of the parent
population.
*Formation of a different genotype in new
settlement is called the ‘founders effect’.
Sometimes they form a new species.

# Mechanism Of Evolution :-
*According to Hugo de Vries – new species are not formed by continuous variations but by ‘sudden
inheritable change’ called mutation. Hugo de Vries belived that mutation causes evolution and
not the minor variations which was mentioned by Darwins.
*Mutations are random and directionless while Darwin’s variations are small and directional.
*According to Darwin, evolution is gradual while Hugo de Vries belived that mutation caused
species formation and hence known as “saltation”—a single step large mutation.
# An Account Of Evolution :-
*About 2000 million years ago the first cellular forms of life appeared on earth.
*500 mya – invertebrates were formed.
*Jawless fish probably 350 mya. Sea weeds and few plants around 320 mya.
**In 1938, a fish caught in South Africa ‘Coelacanth’ which was thought to be extinct.
**Ichthyosaurs 200 mya.
**The dinosaurs disappeared 65 mya.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 94
 High Ranker’s Biology:- 6265237391,
9891766736
# Hardy- Winberg Principle :-
*Hardy and Winberg describe a
theoretical situation in which a population
is undergoing no evolutionary change. In
fact – it defines the genetic structure of a
non-evolving population.
*According to the principle :-
‘Gene frequencies will remain constant if all
conditions are not change’.
*If there is no :-
Mutation, Gene migration, Genetic drift,
Random mating (recombination) and
Natural selection.
*The distribution of genotype describe by the relationship—
. (A+a)2 = A2 + 2Aa + a2 = 1.
Where,
A2 represents the freq. of the homozygous dominant
genotype. 2Aa represents the freq. of the
heterozygous genotype, and a2 represents the freq. of
the homozygous recessive genotype.
*Sum total of the all allelic frequency is “1”.

*Constant gene frequencies over several generations indicate that evolution is not taking place.
So, ‘evolution occurs when the genetic equilibrium is upset’.
# Natural Selection Categorised In :-
*Natural selection is the process through which populations of living organisms adapt and change.
*Individuals in a population are naturally variable, meaning that they are all different in some ways.
*This variation means that some individuals have traits better suited to the environment than others.
*Individuals with adaptive traits— are more likely to survive and reproduce.

*These individuals then pass the adaptive traits on to their offspring Over time.
A.)Normalising Selection B.) Directional Selaction. C.) Disruptive Selection.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 95
 High Ranker’s Biology:- 6265237391,
9891766736
A.) The stabilizing (Normal):- *Dinasourous and mammals - in Triassic.
*Influence of natural selection in an *Toothed birds or first birds ‘Archeopterix’ - in
environment changes little space and time. ‘jurassic’.
*It occurs in population which have a normal
distribution in variations of a particular # Concept Of Human Evolution :-
phenotype ‘stabilizing selection reduces *The fossils evidence clearly indicates that
variation yet it does not change the mean value. origin of man occurred in central Asia, china,
Java and India (Shivalik Hill). Oldest fossils
B.) Directional ;-
‘Dryopithecus’ evolved in ‘apes’ and ‘men’.
*Selection produces a regular change within a
*Dryopithecus lived about 20-25 million years
population in one direction. Associated with
ago. Ape like arboreal (tree dweller).
environmental changes and occurs when the
Various fossils related to human development are
environment is changing progressively in a -
particular direction e.g., industrial melanism. ‘Ramapithecus’
C.) Disruptive ;- 14-15 mya. Man like, erect walked on ground,
*Selection is opposite of stabilizing selection. It is teeth and jaws human like.
a selection that changes the frequency of alleles ‘Australopithecus’
in a divergent manner. Disruptive selection from Africa, was about 1.5m high and human
increases the variation of a trait. It is a rare type of as well as apes characters , bipedal
selection e.g , ‘selecting seeds from the longest locomotion, erect posture, omnivorous diet,
and shortest plants’. 500cc brain, 1.5 – 5 mya.
Homo habilis –
# Evolution Of Plants :-
tool maker, 2mya , 700 cc brain, 1.2 – 1.5 m
*The pattern of evolution of major groups of plants
tall , bipedal locomotion, moved erect,
are different from those of vertebrates.
omnivorous, teeth were modern man used,
*Different kinds of algae were present in
sharpened stones tools making tools.
‘Cambrian’.
Homo erectus –
*Marine algae – ‘in Ordovician’.
1.7 mya, omnivorous, 1.5 – 1.8m tall, erect
*Bryophytes appeared before vascular plants
posture, flatter skull protruding jaw, projecting
like pteridophytes, gymnosperms,
eyebrow, brain 800 – 1300 cc, perhaps fire user,
angiosperms in ‘Silurian’.
game, tools of stone and bones .
*First Gymnosperms – in Devonian period.
Homo sapience –
*First seed plants – Carboniferous. Angiosperms –
*modern man, appeared 25,000 years ago,
in Cretaceous.
spreading in world 10,000 years ago, thin skull
*Evoluton of vertebrates:- Origin of vertibrates in
bones, 1300 – 1600 cc brain, arose in Africa then
‘Ordivisian’ period in the form of Osteracoderms
migrated across continents and developed into
.‘jawless vertebrates related to cyclostomes.’
distinct races.
*Vertebrates with lower jaws – in Silurian.
*Ice age 75,000 – 10,000 years ago modern
*Amphibian - in Devonian. Reptiles - in
carboniferous. Homo sapiens arose.
*Agriculture came around 10,000 years back.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 96
 High Ranker’s Biology:- 6265237391,
9891766736

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 97
 High Ranker’s Biology:- 6265237391,
9891766736
*----------------------Assignments. C-7th . Homo erectus evolved from Homo habilis about 1.7
1. What is evolution? Describe it by mya. He was about 1.5-1.8 metres tall with an erect
posture. His skull was flatter than that of modern
the help of analogous and homologous
man.
organs.
2. What is adaptive radiation? How
Australian marsupials and Darwin finches
are related from it?
3. What is Hardy Winberg law? How the
genetic equilibrium changes?
4. Give the various fossil records of human
evolution.
5. Short notes:- a.) industrial melanism
b.) Natural selection.

#-----NCERT Questions and Solution:-

1. Earlier the mosquito-population had
more DDT-sensitive one than the DDT-
resistant ones. When DDT was not being used,
the DDT-resistant remained dominant by DDT-
sensitive mosquitoes. But when the use of DDT
as an insecticide started, DDT-resistant
mosquitoes had a competitive edge over their
counterparts. The DDT-resistant mosquitoes
could better-adapt, survive and increase in
population size.
2. Activity related question.
3. Species can be defined as assemblage
of individuals with morphological features in
common and separable from such other
assemblages by correlated morphological
discontinuities in a number of features.
4. Dryopithecus africanus is regarded as
the common ancestor of man and apes, which
lived about 20-25 mya. It had a large canines. It
was more ape-like but had arms and legs of
the same length with a semi-erect posture. It
was arboreal, knuckle- walker and ate soft fruits
and leaves.
*Dryopithecus gave rise to a Ramapithecus about
14- 15 mya. Perhaps, it walked erect on its on
kind feet. It was more man-like and lived on tree
tops but also walked on the ground. Its small
canines and large molars suggested that they
are at hard nuts and seeds like modern man.
The early human stock gave rise to
Australopithecus. Australopithecus africans
appeared about 5 mya, had a height of about
1-5 metres and were ape men. It was with
bipedal locomotion, ominivorous diet and had
erect posture. The brain capacity was about
500 c.c.
Australopithecus africanus gave rise to Homo
habilis about 3 mya. He was about 1.2-1.5 metres
tall, had bipedal locomotion, moved erect and
was omnivorous. Homo habilis was the first tool
marker had used tools of chipped stones
extensively. He also led a community life in
caves and gently cared for the young ones.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page 98
 High Ranker’s Biology:- 6265237391,
9891766736
The cranial capacity was 8000 to 1300 cc. genetic variations took place over a number of
He was omnivorous. He made more generations and thus, cannot be referred to as
elaborate tools of stones and bone and adaptive radiation.
perhaps knew use of fire. Homo erectus 10. Activity based.
includes three fossils: Java Ape-man, Peking
man and Heidelberg man. The Neanderthal
man existed about 100,000 years ago and
became extinct 30,000 years ago. He had
slightly proganthous face, walked upright,
had receding jaws and high domed heads.
Their cranial capacity was 1300 and 1600
c.c. They were legendary cave dwellers and
adapted to cold environment. They were
not only skilled hunters but true predators.
They used hides to protect their body and
buried their dead.

*Cro-Magnon man emerged about 34000

years ago. They had about 1.8 metres tall,
well built body. Its face was perfectly
orthognathus with an arrow, elevated nose,
strong jaws with man-like dentition and a well
developed chin. Its cranial capacity was
about 1650
c.c. It could walk and run faster and lived in
families in caves. It made excellent tools and
even ornaments of stones and bones. It
became extinct about 10000 – 11 years ago.
Cro-Magnon man was the direct ancestor of
the living modern man, Homo sapiens
which appeared about 25000 years ago.
Morphologically, the transition is marked
merely by a slight raising of skull cap,
thinking of skull bones, a slight reduction in
cranial capacity (1300-1600 c.c.) and
formation of four curves in the vertebral
coloumn.
5. Yes
6. Internate based activity.
7. Drawing based question.
8. Development of different functional
structures from a common ancestral form is
called adaptive radiation. The concept of
adaptive radiation in evolution was
developed by H.F. Osborn in 1898.
Examples:
(i) Darwin’s Finches of the Galapagos
Islands had common ancestors but now
have different types of modified beaks
according to their food habits as shown.
(ii) Australian Marsupials. Darwin explained
that adaptive radiation gave rise to a variety
of marsupials (pouched mammals) in
Australia in the same process of adaptive
radiation as found in the finches in the
Galapagos Islands.
9. No. Human evolution is not an
adaptive radiation.
Human evolution has occurred due to
genetic variations such as mutation, genetic
drift, migration, nonrandom mating, genetic
recombination, hybridization etc. The
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page 99
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER-8. Biology in Human Welfare / Human Health And

Disease
# What is health :
*Health does not mean ‘absence of disease or physical fitness’.
*Health may be defined as – “state of complete physical mental and social well being and not only
absence of disease”.
*Importance of health is that – healthy persons are more efficient at work, increases life and reduce
mortality. Balanced diet, regular exercise and personal hygiene are very important for keeping good
health.
# What is a disease ? *Affected should wash after using toilet.
*Any functional or physical change from the *Mary Mallon nicknamed Typhoid mary was a
normal state that causes discomfort in our body cook by profession to spread typhoid carrier
is called a disease., or who continued to spread typhoid for several
‘When the functioning of one or more organs or years through the food she prepared.
systems of the body is adversely affected,
characterised by various signs and symptoms is 2. Pneumonia :-
called disease’. or *Caused by bacteria- ‘Streptococcus pneumonia’
‘Malfunctioning of the body or part of the body and ‘Haemophilus influenzae’.
with specific symptoms is known as disease’. *The bacterium infects the alveoli of the lungs.
*It is grouped into two types :- So it filled with fluid leading to serve problems in
( I ) Infectious disease ( II ) Non-infectious respiration.
disease. *Symptoms are – fever, chills, cough and
*Disease which are easily transmitted by one headache.
person to another are called infectious diseases, *In severe cases, the lips and finger nails may
e.g AIDS, TB, Viral diseases. turn gray to bluish. Persons get infection by
*Common Diseases in Humans:- Disease inhaling the droplets by an infected person,
causing organisms are called ‘pathogens’. even by sharing glasses and utensils.
*A wide range of organism belonging to *Dysentery, Plague, Diphtheria etc are other
bacteria, viruses, fungi, protozoan, helminthes bacterial diseases in human.
etc could cause diseases in human and all
comes under ‘pathogens’. 3. Common cold :-
*Most infectious human ailments.
1. Typhoid:- *Caused by – ‘Rhino viruses’. Infect the nose and
* Caused by Salmonella typhi. (Bacterium). respiratory passage.
*Pathogens generally enter the small intestine *Cold is characterised by nasal discharge, sore
through food and water contamination. throat, hoarseness, cough, headache,
*Insect other organs through blood. Sustained tiredness etc. which usually last for 3-7 days.
high fever (390-400). *Droplets of cough or sneezes of an infected
*Weakness, stomach pain, constipation, person transmitted through pens, books, cups,
headache and loss of appetite are common doorknobs, keyboard etc.
symptoms.
Diagnosed by ‘Widal Test’. Intestinal
perforation and death may occur.
[Link] :-
*Malaria is an infectious disease caused by a parasite: it is spread by the bite of an infected mosquito.
*People catch malaria when the parasite enters the blood. The parasite causes a deadly infection
which kills many people each year.
*The parasite that causes malaria is a protozoan called 'Plasmodium'
*The four most important species are –
* P. vivex ;/ *P. malaria ; /*P. falciparum ; /*P. ovale. /*P . falciparum is the deadliest.
*Plasmodium enters the human body as sporozoites the infectious form. When infected female
Anopheles mosquito bite non-infected person.
*The parasites initially multiply within the liver cells and then attack the red blood cells (RBCs). The
rupture of RBCs is associated with release of a toxic substance ‘haemozoin’ which is responsible for
the chill and high fever recurring every three to four days.
*When a female Anopheles mosquito bites an infected person, these parasites enter the mosquito’s
body and undergo further development.
*The parasites multiply within them to form sporozoites that are stored in their salivary glands.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
100
 High Ranker’s Biology:- 6265237391,
9891766736
When these mosquitoes bite a human, the sporozoites (infectious form) are introduced into
body.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
101
 High Ranker’s Biology:- 6265237391,
9891766736

*The malaria parasite requires two hosts- human and mosquitoes.

Fig- Life-Cycle of malaria parasite in different host.

5. Amoebiosis OR ‘ Amoebic dysentery’ :-

7. Filariasis or Elephantiasis :-
*caused by ‘Entamoeba histolytica’ (protozoa). *Worms ‘Wuchchereria boncrofti’ and ‘Wuchreria
*Infect large intestine of human and causes malayi’ are the filarial worms cause a slowly
‘constipation, abdominal pain and cramps, developing chronic inflammation of the
stools with excess mucous and blood clots. organs in which they live for many years.
*Houseflies act as carrier and transmit the *Infection is transmitted by Culex mosquitoes.
parasite from faeces of infected person to *The genital organs are also often affected.
food, and water contaminations are the
*Aedes mosquito is responsible for dengue and
main source of infection.
chikungunia in many part of India.
6. Ascariasis ;-
*The disease is caused by a helminnths ‘Ascaris
8. Ringworms :-
lumbricoides’.
*Many fungi belonging to the genera
*An endoparasite infect small intestine of
Microsporum. Tricophyton and Epidermophyton
human.
are responsible for ringworms. Dry and scaly
*Symptoms are – internal bleeding, muscular lesions on various parts of the body such as
pain, fever, anemia and blockage of the skin, nails and scalp, intence itiching.
intestinal passage.
*Heat and moisture help these fungi to grow.
*The eggs of the parasite are excreted along *Spread by sharing towel, clothes or even by
with the faeces of infected persons with the comb of infected individuals. Personal and
contaminated water, vegetables, fruits etc. public hygiene is very important or prevention
and control.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
102
 High Ranker’s Biology:- 6265237391,
9891766736
# Immunity :-
*The body is able to defend itself from most of these foreign agents. This ability of the host to fight
the disease- causing organisms is called immunity. This is also known as dedease resistant
capacity.
*The system of animal body, which protects it from various infectious agents and cancer is known
as immune system and its study is called immunology.
*Immunity is of two types :- a.) Innate Immunity and b.) Acquired immunity.

Non-specific Specific
The original immune system Evolved later
1st line of defense Pathogen specific
Responds to a wide variety of pathogens Reacts to inducer organisms
Quick in response Require time to mount response

# Innate immunity :-
*Non-specific immunity.
*A type of defence that is present at the time of birth.
It has different types of barriers to the entry of the foreign agents into
our body. These are-
a.) Physical barriers-
*Skin prevents the entry of bacteria and viruses. Mucus coating
of the epithelium lining the respiratory, gastrointestinal and
urogenital tracts also help in trapping microbes entering the
body.
b.) Physiological barriers-
*Acid in the stomach, saliva in the mouth , tears from eye all
prevent microbial growth.
c.) Cellular barriers-
*WBC of our body, polymorpho-nuclear leukocytes (PMNL-
neutrophils) and monocytes and natural killer lymphocytes in the
blood as well as macrophages in tissues can phagocytose and
destroy microbes.
d.) Cytokine barriers-
*Virus-infected cells secrets proteins called ‘interferons’ which protect non-infected cells from
further viral infection.
# Acquired immunity :-
*Adaptive or specific immunity, pathogen
specific and characterised by memory.
*When our body encounters a
pathogen for the first time
produces a response called
‘primary response’ which is of low
intensity. Subsequent encounter
with the same pathogen shows
highly intensified response i.e
secondary response or
anamnestic response.
*This was due to memory of the
first encounter or primary
response.
*The primary and secondary immune
responses are carried out with the
help of special types of lymphocytes-
B- lymphocytes and T-lymphocytes.
*The B-lymphocytes produce an army of
proteins in response to pathogens into our blood to fight with them. These proteins are called
antibodies.
*The T-cells themselves do not secrets antibodies but help B-cell produce them.
*Each antibody molecule has four peptide chains, two small called light chains and two longer

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
103
 High Ranker’s Biology:- 6265237391,
9891766736
called heavy chains i.e H2L2. Both the strand are linked together by sulphide bridge.
*Our body having other antibodies too. IgA, IgM, IgE, IgG and IgD.
*All finds in blood so called ‘humoral immune response’ mediated by B-lymphocytes.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
104
 High Ranker’s Biology:- 6265237391,
9891766736
*Antibody formation by B cells is stimulated by helper T-cells. All B-lymphocytes are not
converted into plasma cells few of them develops into ‘memory cells’. This is called antibody
mediated immunity.

Fig: Immunoglobulin structure (H2L2):-

*CMI- Cell Mediated Immunity:-

*The cell mediated immunity is the responsibility of cytotoxic T-cells.
*An activated cytotoxic T-cell is specific to a target cell, infect and kill the target cell.
*The body is able to differentiate ‘self’ and ‘non-self’ and the cell-mediated immune response is
responsible for the graft rejection, like- heart, eye, liver, kidney transplantation.
*Cell-mediated immunity (CMI) is an immune response that does not involve antibodies but
rather involves the activation of macrophages and NK-cells, the production of antigen-specific
cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen.
*Chances of kidney transplant is like:-
. Mono zygotic twins > siblings > parents > others.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
105
 High Ranker’s Biology:- 6265237391,
9891766736
# Active Immunity:-
*When a host is exposed to antigens, which may be in the form of living or dead microbes or
other proteins, antibodies are produces in the host body. This type of immunity is called ‘active
immunity’. It is show and takes time to give effective response. Immunisation induces active
immunity.
*Passive immunity- *When ready-made antibodies
are directly given to protect the body against foreign agents is called passive immunity. First milk
colostrums and other antibodies show passive immunity. Provide immediate relief and are long
lasting.
# Vaccination And Immunisation:-
*Based on ‘memory’ of the immune system. In vaccination, inactivated or weakened pathogens
are introduced into the body. The antibodies produced in the body against these antigens would
neutralise the pathogenic agents during actual infection.
*Vaccines also generate memory. The B and T cells recognise the pathogen quickly.
*In snake biting the injection which is given to the patients contains preformed antibodies against
the snake venom. This is passive immunisation.
# Allergies:-
*Allergy is the hypersensitiveness of a person to some foreign substance coming in constant with or
entering the body. The substances that cause allergic reaction are called allergens.
*The common allergens are dust, pollen, mould, spores, fibres, lipsticks, nail paints, feathers, fur,
plants, bacteria, foods, heat, cold, sunlight and animal danders.
*Mostly affects the skin and mucous membrane.
*Allergy involves mainly IgE antibodies and
histamines and serotonin from the mast cells.
*Symptoms of allergic reactions include
sneezing, watery eyes, running nose and
difficulty in breathing. The use of drugs like anti-
histamines, adrenalin and steroids quickly
reduce the symptoms of allergy.
*Auto immunity:-
*In higher vertebrates memory based
acquired immunity have an ability to
differentiate pathogens from self-cells.
*Due to genetic and other unknown reasons the
body attacks self-cells. This result in damage to
the body is called auto-immune disease, e.g
Rheumatoid- arthritis
*Symptoms of allergic reactions include
sneezing, watery eyes, running nose and
difficulty in breathing. The use of drugs like anti-
histamines, adrenalin and steroids quickly
reduce the symptoms of allergy.
*Auto immunity:-
*In higher vertebrates memory based
acquired immunity have an ability to
differentiate pathogens from self-cells.
*Due to genetic and other unknown reasons the
body attacks self-cells. This result in damage to
the body is called auto-immune disease, e.g
Rheumatoid- arthritis.
. Fig:- Lymphoid Orans and their location in human
body
# Lymphoid organs- immune system in the body :-
*The human immune system comprises lymphoid organs, tissue cells and soluble molecules such
as antibodies. This plays an important role in allergic reactions, auto-immune response diseases
and organ transplantation.
*Primary Lymphoid Organs-
*Those organs where T-lymphocytes and B-lymphocytes mature and get specificity. Bone marrow is the
site of all lymphocytes formed. They are also responsible for cellular and humoral immune response
respectively.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page
106
 High Ranker’s Biology:- 6265237391,
9891766736
*Secondary Lymphoid organs-
*After maturation B and T lymphocytes migrate via blood vascular and lymphatic sysstem to
the secondary lymphoid organs where they undergo proliferation and differentiation.
*The secondary lymphoid organs are lymph nodes, spleen, tonsils, Peyer’s patches of small intestine
appendix

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
107
 High Ranker’s Biology:- 6265237391,
9891766736
and mucosal associated lymphoid tissues (MALT) located within the lining of the major tracts-
respiratory, digestive and urogenital.

# AIDS :- Acquired Immune Deficiency Syndrome.

‘*A disorder of cell mediated immune system of the body. There is a reduction in the number of
helper T-cells which stimulate antibody production by B-cells. This result in loss of natural defence
of body’’.
*First noticed in USA amongst homosexuals in 1981.
*In India in prostitutes of Chennai in 1986.
*The virus of AIDS was officially named by ICVN.
*Human immunodeficiency virus- HIV, a retrovirus that attacks helper T cells.
*RNA- is the genome of HIV.

*Transmission:-
* Through Sexual contacts/unprotected/multi partner sexual relationships.
*Contaminated blood transfusion and sharing infected syringes.
*The disease may spread from infected mother to her developing baby.
*AIDS is not spread by mere touch or physical contact. It spread only through body fluids. So,
infected persons are not isolated from family and society.
*AIDS symptom occurs (a few months to 5-10 years).
*Mode of action- (Replication of retrovirus) :-
*The virus enters into macrophages where RNA genome of virus replicates to form viral DNA with
the help of enzyme Reverse transcriptase.
*The viral DNA gets incorporated into host cell DNA and directs the infected cell to produce virus
particles.
*This causes a progressive
decrease in helper T-lymphocytes.
The patient becomes so immune-
deficient that he/she is unable to
protect himself against infections.
*AIDS diagnosed by ELISA-
Enzyme Linked Immuno Sorbent
Assay.

*Prevention :-
*Blood test and transfusion
should be done very strictly.
*Disposable needle and syringes
should be use. He/She should be
monogamous. Avoid common
blades in barber’s shop.
* National AIDS Control
Organisation (NACO) and non-
governmental organisation
(NGOs) should work as challenge
to doing well.
*No vaccine has been prepared so
far. Thus People should be
educated about AIDS.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
108
 High Ranker’s Biology:- 6265237391,
9891766736
# CANCER:--
*Abnormal and uncontrolled proliferation of cells without any differentiation, or
*Abnormal and uncontrolled division of cells is called cancer.
*Cancer cells are different from normal cells in some aspect.
*Normal cell show a property called ‘contact inhibition’ which make them able to contact with other
cells and inhibits their uncontrolled growth.
*Cancer cells losses this property, result cancerous cells continue to divide and forms masses of cells
called
‘tumor’.
*Tumours are two types-
a.) Benign tumors (confined)’ b.) Malignant tumors ( invading) .
*The malignant tumor proliferating , grow rapidly and invade and damage the surrounding tissues.
This property of cancerous cells is called ‘metastasis’.
Benign Tumor Malignant Tumor
Slow Growing Fast Growing
Capsulated Non Capsulated
Non-invasive Invasive and Infiltarate
Do Not Metastatise Metastasis
Well Differentiated Poorly Differenciated
Suffix “Oma” e.g; Fibroma. Suffix “Carcinomas” or “Sarcoma”.

*Causes of Cancer- cancer causing

substances are called carcinogens. These
are physical, chemical and biological
agents.
*Ionising radiation like X-rays, Y-rays and non-
ionising radiation like UV-rays cause DNA
damage. Chemical carcinogens in
tobacco smoke cause lung cancer.
*Viruses, excess hormones are biological
carcinogen.
*Several genes called cellular Oncogenes
(c-onc) or proto-oncogenes are present in
normal cells.
When occur suppress tumor formation.
* Any change in proto oncogenes forms
oncogene and a tumor suppressor becomes tumor activator and forms cancer.

# Detection And Diagnosis:-

If early detected treated successfully in many cases.
* Biopsy and histopathological studies of the tissue, blood
and bone marrow in Leukemias. *In
biopsy a suspected tissue cut into thin sections is stained
and examined under microscope- histopathological
studies.
* Radiography X-rays , CT and MRI are very useful to detect
cancers of the internal organs. X-rays three-dimentional
images are formed.
*In MRI – magnetic field are uses. Specific antibodies are
also used. Inherited cancer patient may be advised to avoid
exposure to particular carcinogens to which they are
susceptible e.g tobacco smoke in lung cancer.
#Treatments:-
a.) Surgery – removal of entire cancerous tissue.
b.) Immunotherapy- natual anti-cancer immunological defence mechanisms.
c) Radiation therapy- X-rays are used to infected cell without harming surrounding cells.
d.) Chemotherapy- majority of drugs have side effects. Treated by combination of surgery,
radiotherapy or chemotherapy.
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page
109
 High Ranker’s Biology:- 6265237391,
9891766736
#DRUG AND ALCOHOL ABUSE :-
*Drug is a single active chemical entity present in a medicine that is used for diagnosis,
prevention, treatment and cure of a disease. Or ,
*‘Drug is any substance or product that is used or is intended to be used to modify or explore
physiological system or pathological states for the benefit of the recipient’.
*The drugs which are commonly abused are opioids, cannabinoids and coca alkaloids.
*Majority of these are obtained from flowering plants and even from fungi. Drugs are normally
used as medicines to help patients cope with mental illness like depression, insomnia and so
on.
*But when drugs are taken for a purpose other than their normal clinical use in an amount or
concentration of frequency the impares one’s physical, physiological and psychological function is
called drug abuse- the drug commonly abused are-
a.) Opioids-
*Obtained from poppy plant- ‘Papaver somniferum’ affect central nervous system and gastrointestinal
tract. It is generally taken by snorting
and injection.
*Heroin commonly called
sssmak is chemically
diacetylmorphine, a
white, odourless bitter
crystalline compound.
This is obtained
acetylation of morphine.

Fig:- Morphine (chemical structure) and Opium plant (Papaver somniferum)

b.) Cannbinoids--
*Produced from plants
‘Cannabis sativa’.
*Cannabinoids receptors
present in the brain so mainly
affect brain.
*The inflorescence of plant
produced cannabinoids. Even
the flower tops, leaves and
resin of cannabis plant are
used in to produce- marijuana,
hashish, charas and ganja.
Generally taken
by inhalation and oral ingestion. Fig- Cannabis sativa leaf.
c.) Cocaine-
*Obtained from ‘Erythroxylon coca’ a native plant of South America.
*Cocaine commonly called coke or crack usually snorted.
It interferes with the transport of the neuro-transpmitter dopamine.
*Stimulates central nervous system,
producing a sense of euphoria and increased energy.
*Excessive dosage of cocaine causes hallucinations.
*Atropa belladonna and Datura are also abused.
*Smoking nicotine stimulates adrenal gland to release adrenaline and
nor-adrenaline into blood circulation, both of which raise blood pressure Fig- Coca plants leaf.
and increase heart rate also prone to cancer of lung.
*Urinary bladder and throat, bronchitis, emphysema, coronary heart disease, gastric ulcer etc.
*Smoking increases CO content in blood and reduces the concentration of haemoglobin bound
oxygen cause oxygen deficiency in the body.
*Drugs like Barbiturates, Benzodiazepines and LSD (lysergic acid diethyleamide- obtained from ergot
(a fungus)-
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page
110
 High Ranker’s Biology:- 6265237391,
9891766736
‘Claviceps purpurea’ ) given to the patient cope with mental illness.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
111
 High Ranker’s Biology:- 6265237391,
9891766736
# Adolescence And Drug Abuse:- intake of drugs. That becomes necessary to
*Adolescence is the period of rapid growth, maintain physiological equilibrium for that person
physical and mental development between i.e ‘physical dependence’.
childhood and adulthood i.e 12-18 years. This
period is from puberty to complete sexual *Withdrawal symptoms are physical and
maturity. psychological disturbances which appear in
*Adolescence is marked by physical growth an addict when they do not take the needed
development of reproductive organs and dosage of drug, alcohol or tobacco. They vary
changes in functioning of the neuro endocrine with the type and degree of addiction.
system. *The most common warning signs of drug and
*Curiosity, adventure, excitement and alcohol abuse among youth include drop in
experimentation constitute common causes academic performance, unexplained absence
which motivate youngsters towards drug and from school/collage, lack of interest in personal
alcohol use. hygiene, withdrawal, isolation, depression,
*A child’s natural curiosity motivates him/her to fatigue, aggressive and rebellious behaviour,
experiment. deteriorating relationships with family and
*The first use of drugs or alcohol may be out of friends, loss of interest in hobbies, change in
curiosity or experimentation, but later the child sleeping and eating habits fluctuation in
starts using these to escape facing problems. weight, appetite etc.
*Other factors that have been seen to be *The use of alcohol during adolescence may
associated with drug and alcohol abuse among also have long-term effects. It could lead to
adolescents are unstable or unsupportive heavy drinking in adulthood. The chronic use
family structures and peer pressure. of drugs and alcohol damages nervous system
*The prolonged use of drugs may lead to the and liver called ‘cirrosis’.
dependence of body upon them.
*Prevention and control:-
*The state of psychological and physiological
1. Avoid undue peer pressure
dependence of an individual to the intake of
2. Education and counselling .
certain drug due to its repeated consumption
3. Seeking help from parents and peers.
on a periodic or continuous basis is called
4. Looking danger signs.
drug addiction.
5. Seeking professional and medical help.
*When an individual believe that normal
condition of well being achieved only through
drug, then a changed physiological state
produced by repeated

*------------------ASSIGNMENTS- Chapter-8th . infected

Q.1. How does the transmission of each persons.
of the following diseases take place?
2. Study of biology has helped us to know about
a.) amoebiasis b.) malaria c.) ascariasis d.)
causes of diseases, carriers of diseases (vectors),
pneumonia.
effects of
Q.2. Name the primary and secondary
lymphoid organs.
Q.3. Expand each one to its full formand
explain-

# NCERT Exercise QUESTIONS solutions:-

1. (i) Maintenance of personal hygiene i.e.,

keeping the body clean, consumption of clean
drinking water and food.
(ii) Maintenance of public hygiene, i.e.,
proper disposal of excreta/ wastes, periodic
cleaning and disinfection of water reservoirs,
hygiene in public catering.
(iii) Eradication of vectors and their
breeding places. For e.g., avoiding stagnation in
and around the house regularly cleaning water
coolers etc.
(iv) Vaccination and immunization for
diseases like polio, diphtheria, tetanus, pneumonia
etc.
(v) Use of antibiotics and drugs to treat the
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page
112
 High Ranker’s Biology:- 6265237391,
9891766736
a.) MALT b.) CMI c.) AIDS d.)
NACO e.)AIDS
Q.4. Differentiate a.) Innate and acquired
immunity
b.) Active and Passive immunity.
Q.5. Draw a well-labelled diagram of an
antibody molecule.
Q.6. explain the metastasis nature of cancer
cells.
Q.7. Mechanism of AIDS spreading

diseases on different body functions and above

all means to control diseases.
3. (a) Infection occurs by ingesting cysts
with food and water. These cysts are carried by
flies from faeces to food and drinks.
(b) Malaria. Malaria Parasites are carried
from the infected to the healthy persons by the
female Anopheles mosquito. The mosquito picks
up the parasites along with the blood, when it
bites an infected person. When this mosquito
bites healthy person, parasites migrate into his
blood with the saliva, which the mosquito injects
before sucking up blood to prevent its clotting.
(c) Ascariasis. Man gets infection by taking
Ascaris eggs with contaminated food and water.
Children become infected by ingesting soil.
(d) Pneumonia. It spreads by sputum of
the patient. Pneumococci are inhaled and get
lodged in the bronchioles.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
113
 High Ranker’s Biology:- 6265237391,
9891766736
4. Fresh and clean water should be taken. If
acquire their antigen-specific receptors. Thymus
water is contaminated it should be filtered before
and bone marrow are primary lymphoid organs.
drinking. Water resources should be disinfected.
The secondary lymphoid organs are lymph
One should not drink pond water.
nodes, spleen, tonsils, Peyer’s patches of the small
5. The term ‘suitable gene’ refers to that gene
intestine, appendix and mucosal associated
(specific segment of DNA) that will be modified in
lymphoid tissues (MALT).
the host to produce specific protein, to kill specific
7. (a) MALT: Mucosal Associated Lymphoid Tissues
disease causing organism.
(b) CMI: Cell Mediated Immunity
6. The primary lymphoid organs are those
(c) AIDS: Acquired Immunodeficiency Syndrome
organs where T lymphocytes and B lymphocytes
(d) NACO: National AIDS Control Organisation
mature and
(e) HIV: Human Immunodeficiency Virus

8. (a)
Innate Immunity Cell Mediated Immunity
1. Innate immunity includes all the defence 1. The immunity, which is acquired after the birth is
elements with which an individual is born. called acquired immunity.
2. It consists of various types of barriers that 2. It consists of specialized cells (T-cells and B-cells) and
prevent the entry of foreign agents. antibodies that circulate in the body fluid.
3. This is the first line of defence in most animals 3. This provides the third life of defence.
and plants.
(b)
Active Immunity Passive Immunity
1. It is developed when a person’s own cells produce 1. It is developed when antibodies produced in
antibodies in response to infection or vaccine other organisms are injected into a person to
counteract antigens such as snake venom.
2. It provides relief only after long period. 2. It provides immediate relief.
3. It has no side effects. 3. It may cause side effects
4. It is long lasting. 4. It is not long lasting.
e.g., Immunity developed after an attack of small e.g., immunity given to the infant by antibodies in
pox / measles and immunity developed by colostrum.
vaccinations

9. Immune Response The specific lymphocytes, after their origin in the bone
reactivity induced in a host by an antigenic marrow, first migrate to the thymus gland.
stimulus is known as the immune response. It is Hence, they divide rapidly and develop extreme
of two types: diversity for reacting against
(i) Humoral immunity or Antibody –
mediated immunity (AMI). In human beings, B
lymphocytes are known to be preprocessed in
the liver during midfoetal life and in the bone
marrow during late foetal life and after birth.
After preprocessing, the B lymphocytes migrate
to the lymbphoid tissue throughout the body.
*B-lymphocytes produce antibodies that
regulate humoral immunity or antibody-
mediated immunity. Antibody formation by B
cells is stimulated by helper T cells and inhibited
by immunity. Antibody formation by B cells is
stimulated by helper T cells and inhibited by
suppressor T cells. Certain B – lymphocytes are
transformed into plasma cells, which produce
antibodies at a rapid rate. All B-lymphocytes
are not converted into plasma cells. A small
portion of them developed into “memory
cells”, which have a long life span and serve
to recognize the same antigen when introduced
subsequently.
*The antigen-binding sites of the antibody
bind to the specific antigens in a lock and key
pattern, an antigen-antibody complex is
formed.
(ii) Cell-mediated immunity (CMI). T
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page
114
 High Ranker’s Biology:- 6265237391,
9891766736
different specific antigens. These different
types of processed T lymphocytes now
leave the thymus and like B lymphocytes
migrate to the lymphoid tissue throughout
the body.
*The cell mediated immunity is the
responsibility of cytotoxic T cells (a sub group
of T cells). An activated cytotoxic T cells is
specific to a target cell that has been
infected, and kill the target cell by
preventing the completion of life cycle of
the pathogen.
Cytotoxic T cells also kill the cancer cells.
*CMI protects against fungi, most of the
viruses and intracellular bacterial pathogens
like M. leprae, M. tuberculosis and Salmonella
and parasites like Leishmania and
Trypanosomas. It also particulars in allograft
rejection, graft versus host reaction, delayed
hypersensitivity and certain autoimmune
disease.
10. Virus of AIDS is transmitted via
blood and semen in the following way:
(i) Transfusion of infected blood or blood
products.
(ii) Use of contaminated needles and syringes
to inject drugs or vaccines.
(iii)Sexual intercourse with the infected partner
(iv) From infected mother to child through
placenta.
11. AIDS (Acquired Immuno Deficiency
Syndrome) It is a disorder of cell mediated
immune system of the body. There is a
reduction in the number of helper T cells, which
stimulate antibody production by B - cells that
results in the loss of natural defence against
viral infection.

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
115
 High Ranker’s Biology:- 6265237391,
9891766736
It is caused by the Human Immunodeficiency *Incubation period. The incubation period of
Virus (HIV), which is a retrovirus. HIV ranges between 6 months to 10 years.
First reported in 1981, it has killed more than 25 *Symptoms. The symptoms of HIV infection
million people in 25 years. include fever, lethargy, pharyngitis, nausea,
Mode of Action of AIDS Virus. headache, rashes etc.
*After the entrance of the virus into the body of *Diagnosis AIDS can be diagnosed by ELISA
the person, the virus enters into macrophages (Enzyme linked Immunosorbent Assay) test and
where RNA genome of the virus replicates to Western Blot test.
form viral DNA with the help of reverse *Treatment. Although there is no cure for HIV,
transcriptase enzyme. This viral DNA gets use of certain drugs can prolong the life of an
incorporated into the host cell’s DNA and HIV positive patient. Drugs such as Zidovudine
directs the infected cells to produce viruses. or AZT (3’ – azidoz’, 3’ – dideoxythymidine),
Simultaneously, HIV virus enters into helper T Didanosine (didexoyionosine, DDI) are
lymphocytes, where it replicates and produces employed to treat HIV positive patients.
other viruses. *----------------------------Prevention of AIDS.
This is repeated so that the number of T No vaccine has been prepared so far
lymphocytes, decreases in the body of the against HIV. The following steps may help in
infected person. preventing HIV infection.
Due to the decrease in the number of helper T National AIDS Control Organization (NACO) and
lymphocytes, the person starts suffering from non- governmental organizations are trying
infections of bacteria especially Mycobacterium, their best to educate people about HIV
viruses, fungi and even parasites like infection.
Toxoplasma. World Health Organization (WHO) has started
The patient’s immune system becomes a number of programmes to prevent
deficient and he / she is unable to protect spreading of HIV infection. The steps include:
himself/ herself against these infections. (i) Ensuring use of disposable needles and syringes
HIV is transmitted via blood and semen in the (ii) Checking blood of HIV
following way: (iii)Free distribution of condoms and
(i) Transfusion of infected blood or blood advocating safe sex
products (iv) Regular check-ups for HIV in
(ii) Use of contaminated needles and syringes to susceptible population, etc.
inject drugs or vaccines. 12.
(iii)Sexual intercourse with an infected partner.
(iv) From infected mother to child through
placenta.
Cancer Cells Normal Cells
1. These cells divide in an unregulated / 1. These cells divide in a regulated manner.
uncontrolled manner.
2. Their life span is not definite. 2. They have a definite life span.

13. A phenomenon in which cancer cells enlargement of the prostate gland.

spread to distant sites through body fluids to 15. Yes, friends can influence for taking
develops secondary tumor is called alcohol / drugs. Following measures can be taken
metastasis. (i) Avoiding
14. Alcohol abuse causing- damages CNS
and liver (cirrhosis). In pregnancy affects
foetus.
* Various drug likenarcotic analgesic, anabolic
steroids, diuretics and hormones. The side-
effect of anabolic steroids in females nclude
masculinisation, increased aggressiveness,
mood swings, depression, abnormal menstrual
cycles, excessive hair growth on the face and
body, enlargement of clitoris, deepening of
voice.
**In males it includes – acne, increased
aggressiveness, mood swings, depression,
reduction in size of testicles, decreased sperm
production, kidney and liver dysfunction, breast
enlargement, premature baldness,
Academics, NEET, PAT and career counciling 6265237391; 9891766736
Page
116
 High Ranker’s Biology:- 6265237391,
9891766736
undue peer pressure. (ii) Not taking undue (i) Curiosity, pleasure, desire to do more work.
pressure of failure beyond its threshold. (iii) (ii) superiority/inferiority complex to elders,
Getting counseling from some counseller (iv) partners and friends.
seeking help from parents and relatives (v) (iii)Social pressure, desire to escape from such
Seeking medical help. realities of life as disappointments and failures.
16. Drug Abuse:- Why do **Following measures can be taken (i)
(iv) Desire to offset hardships and monotony Avoiding undue peer pressure. (ii) Getting
of daily life. counseling from some counseller (iii) seeking
17. People start taking alcohol and drugs help from parents and relatives (iv) Seeking
due to- medical help

Academics, NEET, PAT and career counciling 6265237391; 9891766736

Page
117
 High Ranker’s Biology:- 6265237391,
9891766736

Chapter-10. MICROBES IN HUMAN WELFARE

# Introduction :-
*Microbes and microorganisms are those organisms which are not visible to naked eye because of
size > 0.1mm. so they are microscopic.
*Microbes are present everywhere in soil, water, air, inside our body and that of other animals and
plants.
*They are present even at sites where no other life-form could possibly exist. They can be exits in
deep inside the geysers, where temp. can be as high as 1000C, deep into the soil, layers of snow
and highly acidic environments.
*Microbes are- protozoa, bacteria, fungi and microscopic plants, viruses, viroids and prions
that are proteinacious infectious agents.
*While microbes are causal agents of most of the infectious disease, they also use by humans
and nature in many important processes in homes, industries, agriculture and sewage
treatment.
# Household products :-
[Link] Products- LAB-lactic acid bacteria, like lactobacillus are added to milk. It converts lactose
sugar milk into lactic acid. Lactic acid causes coagulation of milk protein Casein. Milk is changed
into curd, yoghurt and cheese.
[Link] are prepared by Baker’s Yeast- ‘Saccharomyces cerevisiae’.
[Link] and Idli are also prepared by these microbes. The dough is fermented by bacteria,
puffed-up due to production of CO2 gas.
4.‘TODDY’, a traditional drink of some parts of southern India is made by fermenting sap from
palms. Fish, soya bean and bamboo-shoots also fermented to make food.
[Link] is one of the oldest food items in which microbes were used. Different varities of cheese
are known by their characteristic texture, flavour and taste. Ex- The large holes in ‘Swiss cheese’
due to CO2 by ‘Propionibacterium sharmani’.
6.‘Roquefort cheese’ ripened by a
fungus provide a particular flavour.
#Microbes in industrial
products :- Microbes are used
even in industries to synthesise a
number of products e.g., beverage
and antibiotics.
[Link]-
*Production on an industrial scale,
requires growing microbes in very
large vessels called fermentors,
and the process is called
fermentation.
*Yeasts have been used from long
time for the production of
beverages like wine, bear, whiskey,
brandy and rum; yeasts (brewer’s
yeast) ‘Saccharomyces cerevisiae
were used.
*It is used for fermenting malted
cereals and fruit juices to produce
ethanol.
. Juice + Yeast → Alcohol + CO2.
*Depending on the type of the raw
material used for fermentation and
the type of processing different
types of alcoholic drinks are
obtained, wine and beer- without
distillation.
*Whiskey, brandy and rum – by
distillation.
[Link]- (Anti-against, bio- life.)
*Antibiotics are chemical substances which are produced by some microbes and can kill or retard
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
118
 High Ranker’s Biology:- 6265237391,
9891766736
the growth of other microbes. Ex- penicillin - first antibiotic discovered by Fleming while working
on ‘Staphylococci’ and named it Penicillium notatum. It later worked by Chain and Florey.
*This antibiotic was extensively used to treat American soldiers wounded in World War II. Fleming,
Chain and Florey awarded by Novel prize in 1945.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

119
 High Ranker’s Biology:- 6265237391,
9891766736
[Link] ;-
*organic acids, alcohol and enzymes are being manufactured with the help of microbes.
Acetic acid is prepared from fermented alcohol with the help of acetic acid bacteria
‘Acetobacter aceti’
C6H12O6 zymase 2C2H5OH + 2CO2. .
C2H5OH + O2 --- CH3COOH + H2O.
*Aspergillus niger (a fungus) – citric acid.
*Clostridium botylicum (a bacterium) – butric acid.
*Lactobacillus – lactic acid. Lipases- used in laundry to remove oily stains.
*Pectinases and Proteaes used in bottled juice clarification.
*Streptococcus a bacterium produces ‘streptokinase’ a ‘clot buster’ for removing clots from the
blood vessels of patients who have undergone myocardial infraction leading to heart attack.
*Cyclosporine A – used as an immunosuppressive agent in organ-transplant patient, and is
produced by the fungus ‘Trichoderma polysporum.’.
*Yeast ‘Monascus purpureus’ produces ‘Statins’ as blood-cholesterol lowering agents that inhibit the
enzyme responsible for synthesis of cholesterol.

[Link] in Sewage Treatment :-

*Sewage or municipal waste should not be passed into rivers, streams and water bodies
because it not only contains human excreta and other organic wastes but a no. of
pathogenic microbes too.
*It can be made less polluting by passing it through sewage treatment
plants (STPs). The treatment steps are :-

*Primary treatment :-
*Physical removal of particles- large and small- from the sewage through filtration and
sedimentation. Floating debris and grit are removed by sedimentation.
*All solids that settle down forms primary sludge, and the supernatant forms the effluents. The effluent
from the primary settling tank is taken for secondary treatment.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

120
 High Ranker’s Biology:- 6265237391,
9891766736
*Secondary treatment or Biological treatment :-
*The primary effluent is passed into large aeration tanks where it is constantly mixed with air.
*This allow growth of aerobic microbes into ‘flocs’- ‘masses of bacteria associated with fungal
filament’.
*These microbes consume the organic matters from the effluent and reduces the BOD-
biological oxygen demands of the effluent.
*BOD means “the amount of the oxygen
that consumed by bacteria to oxidised
the organic matter in one liter of water. The
sewage water treated till the BOD is
reduced. Greater BOD indicates more is its
polluting potential.
*Once the BOD of sewage is reduced the
effluent is then passed into a settling tank
where bacterial ‘flocs’ sediment. This
sediment is called ‘activated sludge’.
*A small part of the activated sludge is
pumped back into the aeration tank to
serve as the inoculums.
*The remaining major part of the sludge is
pumped into large tanks called anaerobic
sludge digesters. Here another anaerobic
bacteria grow and digest the bacteria and
the fungus in the sludge.
*Bacteria produces a mixture of gases called
‘biogas’ a mixture of (CH4+H2S+CO2) can be used as source of energy. The secondary
treatment effluent is released into natural water bodies like river and streams.
*Prior to 1985 very few cities and towns had sewage treatment plants.
*The municipal waste was discharged directly into rivers resulting in their pollution and high
incidence of water borne diseases.
*In order to protect the major rivers of India from sewage pollution,- The ministry of Environment
and Forests has initiated development of sewage treatment plants under the National River
Conservation Authority e.g., Ganga Action Plan and Yamuna Action Plan etc.

# Production of Biogas :-
*Biogas is a methane rich fuel gas
produced by anaerobic break
down or digestion of biomass with
the help of methanogenic
bacteria.
*Biogas is made up of methane 50-
70%; carbon dioxide 30-40% with
traces of nitrogen; hydrogen
sulphide and hydrogen. Biogas
generation is a three stage
anaerobic digestion of animal and
other organic wastes.
*In India it was developed by IARI
and KVIC (khadi and village
industries commission).
Fig- Biogas plant

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

121
 High Ranker’s Biology:- 6265237391,
9891766736
# Microbes as biocontrol agents / IPM- integrated pest management :-
*As the chemical pesticides are
toxic and biocidal they kill even
useful organisms, harm human
beings and animals, pollutes
soil and water, fruits,
vegetables and crop plants.
Therefore, instead of trying to
eradicate pests and pathogens
through chemicals it is better
to use biological agents for
controlling them. Examples-
* Lady bird Beetle with red and
black markings feeds on
aphids, while Dragon flies
prey upon mosquitoes.
*Baculoviruses controls many
insects and arthropods without
affecting others e.g.,
Nucleopolyhedrovirus a species
specific agent.
*Bacillus thuringiensis – spores of
these bacterium produce the
insecticidal ‘Cry-protein’.
Therefore, spores of this
bacterium kill larvae of certain
insects and caterpillars.

# Microbes as biofertilisers :-
*Due to harmful effect of
chemical pesticides and
fertilizers there is a need to
stop their use. So we should
switch to organic farming to
use of biofertilisers.
*Biofertilizers are organisms
that enrich the nutrient
quality of the soil. These are
bacteria, fungi and
cyanobacteria.
*Rhizobium fix nitrogen into
organic forms from atmosphere,
by the
help of root nodules, used by the plant as nutrient in all the pulses or legume plants.
*Azospirillum and Azotobacter enrich the soil as they are free living bacteria in soil.
*Symbiotic association with plants of fungi known as ‘mycorhiza’, *It absorb phosphorous
from soil and tolerate plants from salinity and drought.
*Cyanobacteria e.g., Anabaena, Nostoc, Oscillatoria etc can fix atmospheric
nitrogen. In paddy (rice) fields cyanobacteria serve as an important
biofertilisers and replenish soil.

*----------------Assignment. Chapter- 10th .

1. Give the detail notes on the following with converted to curd by lactic acid bacteria (LAB).
suitable examples:-
a.) Microbes as biofertilizer (3)
b.) Household products(3)
# ------------NCERT Exercise Questions
Solutions:-
1. The common household product that
shows the presence of bacteria is curd. Milk is
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
122
 High Ranker’s Biology:- 6265237391,
9891766736
c.) Fermentation (3)
d.) Sewage treatment (5)
e.) IPM- integrated pest management (5).
f.) bioactive molecules and their uses

2. The best examples that microbes

release gases during metabolism are the
puffed appearance of dough used for
making ‘dosa’, idli and bread.
3. Mention the functions of LAB useful to
man.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

123
 High Ranker’s Biology:- 6265237391,
9891766736
4. Dosa and Idli. The common SCTP are Spirulina, Yeast and Fusarium
5. Microbes are the major source of graminerum. Processing is
antibiotic production. The antibiotics are
used in controlling diseases caused by
harmful bacteria.
6. 1. Penicillium notatum
2. Penicillium griseofuluvm.
7. Define Sewage.
Municipal waste water with large amount
of human excreta and other organic wastes is
called sewage.
Harmful effects of sewage:
(i) It results in dissemination of water-
borne diseases caused by microorganisms.
(ii) It may cause depletion of dissolved
oxygen in the water body. Reduction in oxygen
availability may kill aerobic aquatic organisms.
(iii)Untreated sewage produces
offensive odour making it unfit for
consumption.
8. State one difference between
primary and secondary treatment.
Primary treatment involves the removal
of large sized floating and suspended solids by
physical methods, while secondary treatment
involves decomposition of organic wastes by
microbial actions.
9. Yes, the microbes present in activated
sludge are digested anaerobically to generate
an inflammable biogas which is used as source
of energy.
10. The fertility of the soil depends not only
on its chemical composition but also on the
presence of useful microbes in it. Most of the
plant nutrients are obtained from the soil. If
the soil composition is not upto the mark and
poor in fertility, chemical fertilizers are added
to improve and maintain its fertility. Constant
leaching (dissolution in water) and harvesting
of crops also deprive the soil of mineral
contents. Thus, use of chemical fertilizers,
along with pesticides, is an essential
component shortfall in the supply.
Biofertilizers and biopesticides are presently
being used, which can reduce the burden of
use of chemicals and pesticides. Above all,
these microbes has no harmful effect.
11. Sample A, having BOD 20 mg/, secondary
effluent discharged from a sewage treatment
plant.
Sample B, having BOD 8 mg/1, river
water Sample C, having BOD 400 mg/1,
untreated
sewage water.
12. Source of bioactive molecules
cyclosporine A- Trichoderma polysporum
(fungus) and Statin- Monascus purpureus (yeast).
13. SCP (Single cell protein). It is the
production of microbal biomass for consumption
as human food or animal feed by growing the
same on agricultural and other organic wastes.
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
124
 High Ranker’s Biology:- 6265237391,
9891766736 (d) Plants having other benefit also, such as
required to remove contaminants and
excess nucleic acids. SCP is rich in high resistance to root-borne pathogens, tolerance to
quality protein but poor in fat. Besides salinity and drought, and on overall increase in
proving much needed proteins, SCP is useful plant growth and development.
in reducing environmental pollution by
managing industrial and agricultural wastes.
Soil. The most favorable habitat of
microorganism is soil where they occur in
abundance. The microorganisms present in soil
increase the fertility of soil by decomposing
organic matter. They also fix atmosphere N2
into usable forms.
14. (i) Penicillin – It is used to obtain
antibiotic which is used to cure many
bacterial diseases.
(ii) Biogas – It is an ecofriendly
source of energy particularly in rural
areas.
(iii)Citric acid – It is used mainly as
preservative of many food items.
(iv) Curd – It is an easily digestible food.
15. - Microbes as Biofertilizers –
*Biofertilizers are micro-organisms,
which bring about nutrient enrichment of soil
by enhancing the availability of nutrient s like
nitrogen (N) and phosphorus (P) to crops.
The micro-organisms, which act as
biofertilizers are bacteria, cyanobacteria
(blue green algae) and mycorrhizal fungi.
(i) Free Living Nitrogen Fixing Bacteria
(a) They live freely in the soil and perform
nitrogen fixation.
(b) Some of them are saprotrophic, living on
organic remains, e.g., Azotobacter, Bacillus
Polymyxa, Azospirillum,, Beijerinckia.
(ii) Free Living Nitrogen Fixing
Cyanobacteria. A number of free living
cyanobacteria have the property of nitrogen
fixation, e.g., Anabaena, Nostoc.
(iii)Symbiotic Nitrogen fixing bacteria. They
form a mutually beneficial association with
the plants. The bacteria obtain food and
shelter from plants and in return, they give
a part of their fixed nitrogen to the plants.
The most important of the symbiotic
nitrogen fixing bacteria is Rhizobium,
which form nodules on the roots of
leguminous plants.
(iv) Symbiotic Nitrogen Fixing Cyanobacteria.
Nitrogen fixing cyanobacteria (blue – green algae)
form symbiotic association with several plants,
e.g., cycad roots, lichens, Azolla (fern). Out of
these, Azolla-Anabaena association is of great
importance to agriculture.
(v) Mycorrhiza
(a) It is a mutually symbiotic association of a
fungus with the root of a higher plant.
(b) The most common fungal partners of mycorrhiza
are
Glomus species.
(c) The fungi symbiont in these associations
absorbs phosphorus from soil and passes it
to the plant.
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
125
 High Ranker’s Biology:- 6265237391,
9891766736

Chapter-11. PRINCIPLE OF BIOTECHNOLOGY .

*Introduction:--
*Gene manipulation is a fast emerging science which started with the development of
recombinant DNA molecules. It is named recombinant DNA technology / genetic
engineering/ r-DNA technology.
*Biotechnology deals with techniques of using live organisms or their cellular component or
enzymes from organisms to produce products and processes useful to mankinds.

*Principle:- it includes two main techniques:-

1. Genetic engineering – The technique which change the chemistry of genetic material to
introduce these into host organisms and thus alter the phenotype of the host organism are called
‘genetic engineering’ i.e “Recombinant DNA technology”.
2. Maintain sterile surrounding during production of chemicals like- antibiotics, vaccines enzymes etc.
*“The techniques of genetic engineering includes formation of r-DNA , by cutting it at desired
site by ‘R.E- restriction enzymes’ and a ‘plasmid’. (an autonomously replicating circular extra-
chromosomal DNA.).

# Steps used in this technique are-

1.) Identification of desired gene from a source.
2.) Cutting by R.E and introduced it into a
suitable host.
3.) Transfer of the DNA to its progeny.

Fig:- Recombinant DNA Technology (Steps)

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

126
 High Ranker’s Biology:- 6265237391,
9891766736
# Tools of r-DNA technology :-
1. Restriction enzyme :- Also called
‘molecular scissor’or R.E (restriction enzyme)
belongs to a larger class of enzymes called
‘nucleases’,these are ‘exonucleases’ and
‘endonucleases’.
*Exonucleases remove nucleotides from the
end of the DNA.
*Endonucleases make cuts at specific position
within the DNA.
*First endonuclease is ‘Hind II’.
*About 900 restriction enzymes are isolated from
230 strains of bacteria.
. Fig- Exonuclease and Endonuclease
cutting.
*Restriction enzymes are specific in cutting at recognition sequences e.g.,
*‘Hind II’ cut 6bp specific sequences.
*Eco RI cuts 4bp long sequences that is –

*Vector DNA:G AATT

. C C TTAA

*Foreign DNA:G AATT C

. C TTAA G

*Restriction enzyme
always recognises a
specific palindromic
nucleotide sequences
in the DNA.
Restriction enzyme creates on DNA
‘sticky end’ cleavage- “when few bases are remain as open and
‘blunt end’ cleavage- “when no one base remain free. .

2. Electrophoresis : -
*The fragments of DNA separated by gel-electrophoresis.
*The fragments can be seen only after staining with
‘ethidium bromide’ in exposure to UV-radiation as
bright orange coloured bands.
*The separated bands of DNA are cut out from the
gel and extracted from the gel piece called
‘elution’.
*The purified DNA fragments are used in the formation
of recombinant DNA.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

127
 High Ranker’s Biology:- 6265237391,
9891766736
# Cloning Vectors (Gene Taxy) :-
*The vectors are DNA molecule that can carry a foreign DNA segment and replicate inside the host.
*The sequence is also responsible for controlling the copy numbers of linked DNA.

*Having an ‘Ori’- origin of replication.

*A vector requires a selectable markers which
helps in identifying and eliminating non-
transformants and selectively permitting the
growth of transformants.
*To link the alien DNA the vector needs to have few or single recognition site.
*More cutting sites creates several fragments.
* A recognition site for external DNA results into inactivation of the particular gene this called
‘insertional inactivation’.
*Plasmid, Bacteriophage, BAC, YAC, Shuttle vectors, λ-10, M-13, cosmid, pBR 322, 325 etc use as
vectors.

# Agrobacterium tumifasciens – as natural genetic engineer :-

*Agrobacterium tumefaciens is the causal agent of crown gall disease (the formation of tumours) in
over 140 species of dicots. It is a rod-shaped, Gram-negative soil bacterium.
*Symptoms are caused by the insertion of a small segment of DNA (known as the T-DNA, for
'transfer DNA') from a plasmid into the plant cell, which is incorporated at a semi-random
location into the plant genome.
*A bacterium a pathogen of several dicot plants is able to deliver a piece of DNA known as ‘T-DNA’ to
transform normal plant cells into a tumor.
*Agrobacterium tumifasciens can infect more than 200 sp. and causes ‘crown gall’ and ‘hairy root’
disease. So it is a natural genetic engineer that can transfer genes of interest in wide varieties.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

128
 High Ranker’s Biology:- 6265237391,
9891766736
# Uptaking recombinant DNA- making a competent host :-
*It is done by a divalent cation e.g., Ca++.
*That increases the efficiency with which DNA enters the bacterium through pores in its cell wall.

*The r-DNA and cell cooled along with ice and given a heat shock at 420C.
*Now again it put back into ice. On repeating this method several times the bacterium takes up the r-
DNA.

Fig- Making Competent

Host Divalent cations
1.
Cacl2 / current OR
2.
Cold (ice) and then Heat-sock (420C)
repeatedly.

Bacterial chromosome

# Physical methods of gene-transfer :-

a.) Microinjection- r-DNA is directly injected into the nucleus of an animal or plant cells.
b.) Gene gun- Cells are bombarded with high velocity micro-projectiles of gold or tungsten
coated with DNA method known as ‘gene gun’ or ‘biolistics’.

Fig- Microinjection

# Process of recombinant DNA technology :- F IG :- GENE GUN

1.) Isolation of the genetic material:-
*DNA obtained from plant tissues, bacterial cells or animal tissue with enzymes such as
lysozyme. Cellulose, chitinase, ribonuclease (RNA) and proteases removes proteins.
*When chilled alcohol is added fine threads of DNA obtained.

Fig:- Isolation DNA from Source

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

129
 High Ranker’s Biology:- 6265237391,
9891766736
2.) Cutting of DNA at specific locations :-
*A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into
fragments at or near specific recognition sites within molecules known as restriction sites.
*Restriction enzymes are one class of the broader endonuclease group of enzymes.
*Restriction enzymes are commonly classified into five types.
*DNA is cut by known restriction enzyme.
*Both foreign DNA and vector DNA cut by a specific restriction enzymes.
*Both mixed together and treated with ligase enzyme and forms r-DNA (recombinant DNA).

3.) Amplification of gene by ‘PCR’- polymerase chain reactions.

*The technique of PCR given by Karry Mullis.
*In this technique – a double stranded DNA molecule is heated to a high temp.
*So the DNA strand separate, giving rise to single stranded DNA molecules, which later forms DNA.
PCR involves-
a.)Denaturation- The DNA is heated to a high temp. at 940C resulting in the separation of the two
strand. Each strand work as templet.
b.)Annealing- DNA template, primers and enzyme help both strand make their complementary at a
low temp.
c.) Extension- In last, Taq polymerase synthesize the DNA at 720C , with in 24 hrs billions of copies
produced.
This enzyme Taq polymerase obtained from Thermus aquaticus find near thermal vent (1000C) in
deep sea and hot springs.

Denaturation at 1 minute/940-950

Anneling at 45 seconds/500

Extension at 2 minutes/720

Fig:- PCR and its various Stages

4.) Insertion of r-DNA into the host-

*If a recombinant DNA bearing gene for resistant to an antibiotic is transferred into E. coli cells.
The host cell become transferred into ampicillin resistant cells.
*If we spread the transformed cells on agar plates containing ampicillin only transformants will
grow, untransformed cell will die.
*The ampicillin resistance gene in this case is called a selectable marker.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

130
 High Ranker’s Biology:- 6265237391,
9891766736
5.) Obtaining the foreign gene product-
*When r-DNA is transferred into a bacterial, plant or animal cell the foreign DNA is multiplied.
*Most of the recombinant technologies are aimed to produce a desirable protein.
*If any protein encoding gene is expressed in a heterologous host it is known as a ‘recombinant
protein’.
*Small volume cultures cannot give large quantities of the products. To produce large amount we
require
‘bioreactors’.

*Bioreactors are like vessels in which row materials are biologically converted into specific products.
OR
*A bioreactor is a vessel in which raw materials are converted into products, using
microbial plant, animal or human cells.
*It provides the optimal conditions by providing optimum temperature, pH, substrate,
vitamins, oxygen, etc.
*A stirred tank reactor is generally cylindrical. The stirrer provides movement even mixing.
*Air can be alternately bubbled through the reactor.
*The bioreactor has an O2 delivering system, a temperature control system, pH control,
agitator system and sampling ports for regular withdraw.
# Dawn stream processing:-
*After the formation of the product, it undergoes through some processes before a finished product
to be ready for marketing. It includes separation and purification of the product.
*Then it goes for clinical trials and after evaluation released for commercial purpose. The whole
process is called downstream processing.

*----------------------Assignments-11th **. *------- Exercise Questions Solution:-

1. What is r-DNA technology ? Give its various Q.1. Answer –
stages during formation of r-DNA.
2. What are cloning vectors ?
3. Various processes are used in
recombinant DNA technology.
4. What is PCR ? Describe it with
denaturation, anneling and extention.
5. Short notes:-
a,) Insertional inactivation b.)
downstream processing c.)
Endonuclease.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

131
 High Ranker’s Biology:- 6265237391,
9891766736
a.) OKT-3 – A therapeutic antibody – reversal
of kidney Transplant rejection,
b.) Reopro – prevent blood clots,
c.) t-PA – tissue plasmogen activator- for
myocardial infraction,
d.) Asparaginase – for cancer treatments
e.) DNase – cystic fibrosis
f.) Insulins – diabetes mellitus
g.) Hepatitis B vaccine for Hepatitis
h.) Flvr – Savr – fragrance, taste and delayed
ripening of tomato,
i.) α – lacta albumine gene – human milk
protein
j.) ADA from viruses

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

132
 High Ranker’s Biology:- 6265237391,
9891766736
2. Name of the Restriction enzyme:
ECORI The substrate DNA on which it
acts: G↓AATT C
. C TTAA↑G

And the product is formed will beG AATTC

. CTTAA G
3. DNA molecules are bigger in molecular size as compared to molecular size of enzymes. The
enzymes are proteins. Protein synthesis is regulated by small portions of DNA, called genes.

4. DNA content in a 1C human cell is 3.2

picograms. DNA size in a haploid human cell
is 3.2 × 109 bp.

5. No, the eukaryotic cells do not have restriction endonucleases. The DNA molecules of
eukaryotes are heavily methylated.

6. Shake flasks are used for growing and mixing the desired materials on a small scale in the
laboratory. A large scale production of desired biotechnological product is done by using
‘bioreactors’. Besides better aeration and mixing properties, the bioreactors have following
advantages:

1. Small volumes of cultures are periodically withdrawn from the reactor for sampling.
2. It has a foam control system
3. It has temperature and, pH control systems besides agitator system and oxygen delivery
system

7. Palindromic nucleotide sequences in the DNA molecule are groups of bases that form the
same sequence when read both forward and backward. Five examples of palindromic DNA
sequences are as follows:

1.
5’ AAGCTT 3’
3’ TTCGAA 5’ 3. 5’ GGATCC 3’
2. 5’ ACTAGT 5’ 3’ CCTAGG 5’
3’ TGATCA 5’ 4. 5’ ACGCGT 3’
3’ TGCGCA 5’
5. 5’ AGGCCT 3’
3’ TCCGGA 5’

8. A recombinant DNA is made in first meiotic prophase by the process of crossing – over.
9. A selectable marker helps to identity transformed host cells as non-transformed cell will be
eliminated and only transformed cells will grow. Whereas reporter gene is the one whose
phenotypic expression can be monitored and thus it reports about activity or change in advance
of the effect of modification, in addition to eliminating non-transformed cells by selectable
markers.

10. (a) Chitinase is a digestive (or lysing) enzyme that breaks down glycosidic bonds in
chitin. Chitin composes the cell walls of fungi and exoskeleton of some animals (e.g. worms).
Chitinase is usually found in organisms that either need to reshape own chitin or to dissolve
and digest the chitin of fungi or animals. Chitinase is also used in genetic engineering
(recombinant DNA technology).

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

133
 High Ranker’s Biology:- 6265237391,
9891766736

Chapter- 12. BIOTECHNOLOGY AND ITS APPLICATION .

*Introduction :-
*Biotechnology mainly deals with industrial scale production of biopharmaceuticals and
biological using genetically modified microbes, fungi, plants and animals.
*The application of biotechnology includes therapeutics, diagnostics, genetically modified crops
for agriculture, processed food bioremediation waste treatment and energy production.
Biotechnological applications in agriculture:-
a.) Agrochemical based agriculture,
b.) Organic agriculture,
c.) Genetically engineered crop
based agriculture.
*The green revolution succeeded in
increasing the food production but it was
not sufficient to feed the growing human
population.
*Increased yields due to the use of
improved crop varieties, fertilizers and
pesticides.
*It was too expensive and further increase
in yield with existing varieties or not
possible using conventional breeding. So
use of genetically modified crops is a
possible solution.
*Our modern genetic knowledge make
us able to manipulate, plants, bacteria,
fungi and animals and make them
genetically modified as a good quality
organisms.

#‘Genetically Modified Organisms’ (GMO):-

1. Make plants more tolerable to cold, drought, salt and heat to check loss.
2. Reduction in post-harvest losses.
3. Increasing nutritional value of food.
4. Disease Resistance and resources to industries.

# Bt cotton:-
*Some strains of Bacillus thuringiensis (Bt)
produces proteins that kill certain insects like
lepidopterans (tobacco budworm, armyworm),
coleopterans (beetles) and dipterans (flies,
mosquitoes).
*Bt toxin genes were isolated from Bacillus
thuringiensis and incorporated into the several
crop plants e.g., Bt cotton, Bt brinjal etc.
*The toxin coded by gene- “cry”. There are no. of
them, the proteins encoded by the genes cry IAc
and cryIIAb control the cotton bollworms, and
cryIAb controls corn borer.
*The Bt toxin protein exist as inactive protoxins but
once an insect ingests the inactive toxin it is
converted into an
active form of toxin due to the alkaline pH of the gut which solubilise the crystals.
*The activated toxin binds to the surface of mid gut epithelial cells and creates pores which causes
cell swelling and lysis and death of the insect.

# Pest Resistant Plants:-

*Many nematodes live in plants and animals including human beings.
*A nematode Meloidegyne incognitia infects the roots of tobacco plants and causes a great loss in

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

134
 High Ranker’s Biology:- 6265237391,
9891766736
yield, for this RNA inference (RNAi) is used. This is a cellular defence in all eukaryotic organisms.
*This method involves silencing of a specific mRNA due to a complementary dsRNA , which
binds to and prevents translation of the m RNA (silencing).

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

135
 High Ranker’s Biology:- 6265237391,
9891766736
*The source of this dsRNA could be from an infection by viruses having RNA or transposons
(mobile genetic elements) or jumping gene.
*Agrobacterium is a natural genetic engineer, using it as vectors, nematode specific genes
(NSG) are introduced into the host plant. It produce both sense and antisense RNA in the host
cells.
*These two RNAs being complementary to each other, so they together form a dsRNA. This will initiate
RNAi and

silenced m RNA of the nematode and plant protected from the parasite.

# Medicinal Application:- The

biotechnological tools helps in therapeutic
drugs.
1.) Genetically engineered Insulin:-
*Human insulin is made up of 51 amino acids.
*A-chain is – 21 amino acids and B-chain is
30 amino acids.
*Insulin control sugar level in blood and its
deficiency causes- ‘diabetes’.
*In mammals including human insulin is
synthesised as a pro-hormone which contain
an-extra ‘C-peptide’.
*This C-peptide is not present in the mature
insulin and is removed during maturation.
*Previously a diabetic person given animal insulin
extracted from slaughtered pigs and cattle causes
allergy.

*In 1983 Eli Lily an American company first prepared two DNA sequence corresponding to A and B
peptides of human insulin and introduced them in plasmid of E coli to produce insulin chains.
*Chain A and B were produced separately, extracted and combined by creating disulphide
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
136
 High Ranker’s Biology:- 6265237391,
9891766736
bonds to form human insulin (Humulin).

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

137
 High Ranker’s Biology:- 6265237391,
9891766736
2. Gene therapy:-
*ADA – adenosine deaminase
enzyme is crucial for the immune
system to function.
*The disorder is caused due to
the deletion of the gene for
adenosine deaminase.
*The first clinical gene therapy was
given in 1990 to a 4yr old girl with
ADA deficiency.
*In some children ADA deficiency
can be cured by bone marrow
transplantation or enzyme
replacement therapy in which
functional ADA is given to the
patient by injection.
*Lymphocytes from the blood to
the patient are grown in a culture
outside the body.
*A functional ADA c DNA prepared
by a retroviral vector is then
patient. The cells are not immortal,
so the patient requires periodic
infusion of such lymphocytes.
*Early embryonic stages treatments
cure it permanently.

Fig:- Proceure of Gene Therapy:

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

138
 High Ranker’s Biology:- 6265237391,
9891766736
# Molecular Diagnosis:-
*Conventional methods of diagnosis
i.e serum and urine analysis, early
detection is not possible.
*R-DNA, PCR and ELISA helps in early
detection.
*PCR amplify the contents of DNA
helps in cancer and AIDS detection.
*A single stranded DNA or RNA with
a radioactive molecule is allowed to
hybridise to its complementary DNA
in a clone of cells using
autoradiography.
*The clone will not have
complementary with the natural
gene. ELISA is based on antigen-

#Transgenic Animals:-
*Animals that have had their DNA manipulated to possess and express an extra gene are known as
transgenic animals e.g., Transgenic pigs, sheeps, cows, fish, rabbits etc.
*95% are mice in all existing transgenic animals.
# Transgenic are formed because of-
a.)Normal physiology and development- they are specifically designed to study of how genes
are regulated. Study of complex factors involved in growth such as insulin like growth factor.
b.)Study of disease:-
Transgenics are for disease study e.g., cancer, cystic fibrosis, rheumatoid arthritis and Alzheimer’s.
c.) Biological Products:-
*Transgenic animals produce useful biological products by gene manipulation. Example – α-1-
antitrypsin used to treat emphysema.
*In 1997 the first transgenic cow- “Rosie” produced human protein-enriched milk 2.4 gm/lt.
*The milk contained the human α-lacta albumin and was more nutritionally balanced product for
human babies than natural cow-milk.
d.)Vaccine safety – ice use in testing the safety of vaccines before they are used on humans.
e.)Chemical safety testing- used for testing toxicity of drugs.

# Ethical Issues:-
*GEAC- Genetic Engineering Approval Committee:-
*The organisation make decisions regarding the validity of GM research and the safety of
introducing GM- organisms for public services.
*Approx 200,000 varieties of Rice in India alone and about 27 varieties of Basmati rice are grown in
India.
*In 1997 an American company got patent rights on Basmati Rice through the US
patent and Trademark office. This new variety was crossed with semi-dwarf varieties.
*Turmeric and Neem were also taken as patent, but now they are our legacy.
# Biopiracy:-
*The use of bio-resources by multi-national companies or country and other organisations without
proper authorisation from the countries and people concerned without compensating payment.
3. What is gene-therapy ?
----------------------Assignments-12th * insulin) were
1. What are GMO’s ?
2. Give the use of r-DNA technology in the
area of agriculture and medicine in details.
(5).

*-----------------NCERT Exercise Question

Solution:-
1. When a foreign gene or series of genes
are introduced into the genome of a bacterium,
the later becomes transgenic. For example,
two DNA sequences (A and B chains of human
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
139
 High Ranker’s Biology:- 6265237391,
4. Short notes:- 9891766736
a.) Biopiracy b.) Basmati rice c.)
GEAC d.) Rosie cow

introduced into the plasmid of bacteria E.

Coli. The transgenic bacteria start
producing insulin chains.
The production of hirudin from
transgenic bacteria Brassiea napus seed is
another example.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

140
 High Ranker’s Biology:- 6265237391,
9891766736
2. Advantage. Transgenic plants have *A nematode Meloidegyne incognitia infects
definitely several advantages such as: the roots of tobacco plants and causes a
(a) They increase productivity of crops drastic reduction in yield.
generally by showing resistance against *A novel strategy that was based on the
plant pathogens and to some herbicides. process of RNA interference (RNAi) was
(b) They develop crop varieties with added adopted to prevent this infection.
vitamins and mineral. Thus, the GM crops *This method involved silencing of a specific
have enhanced nutritional quality and yield. mRNA due to a complementary dsRNA
(c) Transgenic crops grow well in saline soil and molecule that binds to and prevents
show salt tolerance. translation of the mRNA (silencing).
*Disadvantages. Transgenic in commercial
*RNAi takes place in all eukaryotic organisms
crops can endanger native species. For as a method of cellular defense.
example, the gene for Bt toxin expressed in *The source of this dsRNA could be from an
pollen might endanger pollinators like infection by viruses having RNA genomes, or
honeybees. These crops cause problems in mobile genetic elements (transposons), which
human health by supplying altered genes and replicate through an RNA intermediate.
transfer of antibiotics resistance markers. They *Using Agrobacterium vectors, nematode
cause damage to the natural environment. specific genes are introduced into the host
3. Cry proteins are encoded by the genes plant which produce both sense and anti-sense
named cry. They are produced in Bacillus RNA in the host cells.
thuringiensis. Cry proteins are toxic to insects *These two RNAs being complementary to
and act as insecticides. Man has developed each other, form a dsRNA that initiates RNAi
several transgenic crops by introducing these and, therefore, silences the specific mRNA of
genes from bacteria to crop plants such as Bt the nematode. The result is that the parasite
cotton, Bt corn, tomato, etc. cannot survive in a transgenic host expressing
4. Pest Resistance Plans – specific interfering RNA.
*Many nematodes live in plants and animals *The Transgenic plant thus, gets itself protected
including human beings. from the parasitic.
*Examples of Transgenic Plants. Transgenic
plants and their potential applications are
given below.
Transgenic Plants Useful applications
1 Bt Cotton Pest resistance, herbicide tolerance and high yield. It is resistant to
boll worm infestation.
2 Golden Rice Vitamin A-rich
3 Flavr Savr Tomato Increased shelf-life (delayed ripening) and better nutrient
quality
4 Potato Higher protein content
5 Corn, Brinjal Insect resistance
6 Soyabean, Maize Herbicide resistance

*Disadvantage of GM Crops. antibiotic resistance gene can cause allergies,

(i) Environmental hazards. These are as follows: because it is a foreign protein.
*Unintended harm to other organisms. If pollen
from Bt corn is blown by the wind onto
milkweed plants in neighbouring fields, the
caterpillars could eat the pollen and die.
*Reduced effectiveness of pesticides:-
*Just as some populations of mosquitoes
developed resistance to the now-banned
pesticide DDT, many people are concerned
that insects will become resistant to Bt or
other crops that have been genetically
modified to produce their own pesticides.
(ii) Human health risk. GM food can lead to
following health problems:
1. *Allergies.
*The transgenic food may cause toxicity and
produce allergies. The enzyme produced by the

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

141
 High Ranker’s Biology:- 6265237391,
9891766736
2.*Effect on Bacteria of Alimentary canal. The
bacteria present in the human alimentary
canal can take up the antibiotic resistance
gene that is present in the GM food. These
bacteria can become resistant to the
concerned antibiotic and will be difficult to
manage.

5. Vitamin A deficiency often causes

blindness among children and may even
lead to their death.
*This deficiency often occurs where rice is
the staple food since rice grain does not
contain provitamin A, i.e., β-carotene.
*Three transgenes providing phytoene
synthase, phytoene desaturase, zeta –
carotene desaturase and lycopene cyclase
activities were transferred into rice by
Agrobacterium – mediated transformation.
*All the transgenes were introduced
together in a single co-transformation
experiment.
*The resulting transgenic rice, popularly
called “golden rice” contains good
quantities of β-carotene, which gives the
grains a golden colour.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

142
 High Ranker’s Biology:- 6265237391,
9891766736

Chapter- 13. Organisms and Population.

*Ecology ( Gk - oikos – home or dwelling, logos – to study ).
*The term given by Ernst Hackel-1869. Firstly used by Reiter in 1885.
*Ecology is the scientific study of the relationship with their environmental of all living organisms.
*Ecology is basically concerned with four levels of biological organisation- organisms, population
communities and biomes.
*Rotation of our planet around the sun, duration of temperature, seasons, rain precipitation all helps
for the formation of major biomes e.g., desert forest and tundra.
*Regional and local variations within biome lead to the formation of a wide variety of habits.
*Abiotic components alone do not characterise the habitat of an organism completely.
*The habitat includes biotic components also like pathogens, parasites, predators and competitors
with which

they interact constantly. Important abiotic factors are-

1. Temparature;-
*The average temperature on land varies seasonally decreases progressively from the equator
towards the poles and from plains to the mountain.
*It ranges from sub zero levels in polar areas and high attitude to >500C in tropical desert in summer.
*Thermal vents having 1000C temperature, even there some organisms live.
*For the kinetics of enzymes and basal metabolism and physiological functions of the organisms
temperature is essential.
*If an organism tolerate wide range of temparature called ’eurythermal’ and if tolerate narrow
range of temparature called ‘stenothermal’.
2. Water-
*Water is the most important factor influencing the life of organisms. The productivity and distribution
of plants depends on water.
*Many fresh water animals cannot live for long inside sea water and vice-versa because of the
osmotic problems.
*Organisms can tolerate high range of salt called ‘euryhaline’ and narrow range of salt tolerating is
‘stenohaline’.
3. Light-
*Light is essential for photosynthesis, growth, stomatal closing and closing, germination, movements in
plants.
*Many plants having some specific period of their life-span for flowering.
*Even birds migration also dependent on light period. Light also affects greatly the aquatic habitat.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

143
 High Ranker’s Biology:- 6265237391,
9891766736
(i) Heliophytes are popularly called sun plants because they grow in open in full sunlight. They
possess a number of characteristics like.
(ii) Sciophytes are shade plants which
grow in areas having moderate to low
intensity light, as below the shade of other
plants. Optimum growth occurs with light
of 10-30% of full sunlight.
*The plants grow in total darkness
are called etiolated (Long, thin, weak and
yellow in colours).

4. Soil-
*Soil is a dynamic natural body, on the surface
of the earth in which plants grow. *Soil composition, grain
size and aggregation determine the percolation and water holding capacity of the soils. Even
inorganic elements and compounds of soil, organic matter
affect soil nature. Generally soils
determine the type of
vegetation.
*Weathering of solid rocks into soil is
maintained by physical and
chemical factors, destructive
process of transformation. The
abiotic condition of many habitats
may be different.
*Number of organisms live in such
habitat and manage to overcome
stressful conditions. Many species
have evolved a relatively constant
internal environment. This internal
environment permits all biochemical
reactions and physiological
functions and overall fitness of the species. Fig:- Soil Particles sizes
*A process by which the organism keeps the internal environment const is called homeostasis.

# Other organisms shows adaptations like:-

[Link]- some organisms are capable to
maintain homeostasis by physiological means and
sometime behavioural also, that maintains
constant body temperature, constant osmotic
concentration etc. e.g., all birds and mammals,
some biologist believe that the ‘success of
mammalians is mainly due to their ability to
maintain a constant body temperature.
[Link]- About 99% of animals and mostly all
plants are not able to maintain a constant internal
body environment. Their body temperature
changes with the surrounding temp.
In aquatic animals the body fluid osmotic
concentration changes with that of the surrounding
water osmotic concentration in unfavourable
external conditions- organisms also exhibits other
alternatives.
[Link]- The organism can migrate temporarily from the unfavourable habitat to more
favourable area and return when unfavourable period is over e.g., every winter the Bharatpur
National park in Rajasthan receive thousands of migratory birds which come from Siberia.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

144
 High Ranker’s Biology:- 6265237391,
9891766736
4. Suspend- Thick walled structure in spores, bacteria and lower plants helps them survive under
unfavourable conditions.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

145
 High Ranker’s Biology:- 6265237391,
9891766736
In animals hibernation (winter sleep) and aestivation (summer sleep) is find to avoid related
problems. So these all called suspend- ‘stop for a time’.
*Diapause – Zooplanktons suspend their developmental process under unfavourable conditions in
many lakes and ponds.

#Adaptations-
*Organisms have alternatives to cope with extreme in their environment through certain
physiological adjustment or behaviourally change. So, any attribute of the organism-
morphological, physiological behavioural that enables the organism to survive and
reproduce in its habitats called adaptation.
*Many adaptations have evolved over a long evolutionary time and are genetically fixed, e.g.
*The kangaroo rat in North American deserts is capable of meeting all its water requirements
through its internal fat oxidation and by concentrating urine.
*Many desert plants have a thick cuticle, stomata sunken in deep pits to minimise water loss. They
also have a special photosynthetic pathway CAM. Leaves reduce to spines to check water loss.
Photosynthesis done by flattened stems.
*Allen’s Rule- *Mammals from colder climates generally have shorter ears and limbs to minimise heat
loss. This is called Allen’s rule.
* In polar areas and sea aquatic mammals like seals have a thick layer of fat “blubber” below their
skin that acts as an insulator and reduces loss of body heat.
* Altitude Sickness-
*At lower atmospheric pressure of high altitudes, the body does not get enough
oxygen. So body shows nausea, fatigue and heart palpitations.
*The body compensates low oxygen availability by increasing red blood cell production
decreasing the binding capacity of haemoglobin and by increasing breathing rate.
*Many tribes live in the higher Himalayas normally have a higher red blood cell than people living in
the plain.
*Archaebacteria can live in hot springs and deep sea hydrothermal vents at 1000C temp.
*Desert lizards lock the physiological ability to deal with high temperature but manage to keep their
body temperature constant by behavioural means.
*They bask in the sun and absorb heat when their body temperature drops below, and burrowing
into the soil to hide and escape from extreme heat.
# Populations Attributes :-
*Species lives in groups in a well defined geographical area, share or compete for similar
resources and potentially interbreed called population.
*Natural selection operates to evolve the desired traits that are important for evolution.

*A population has attributes that an individual organism does not have they are-
1. Birth rate 2. Death rate
3. Sex ratio 4. Population density.
*A population at any time is composed of individual of different ages. If the age distribution of
humans is plotted for the population the structure is called an age pyramid.
*Human population distribution of the age pyramids generally show age distribution of males and
female in a diagram.
*The shape of the pyramids reflects the growth status of the population whether it is –

a.) Growing- pyramidal shape (developing countries), low education, low life standard, combined
family.
b.) Stable- bell shaped (developed countries)or
c.) Declining- urn shaped. (extreme environmental codition)
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
146
 High Ranker’s Biology:- 6265237391,
9891766736
# Population Growth-
*The size of the population keeps
changing with time, depending on
various factors including food
availability, predation pressure and
reduce weather.
*The density of a population in a given
area fluctuates due to changes in four
basic processes. example-
[Link]- Natality is the number of
births during a given period in the
population that are added to the initial
density represented by (B).
[Link]- Number of death in a
given period in the population
represented by (D) that decline
population.
[Link]- Number of individuals of the
same species that have come into the habitat from other place (I) increases the population.
[Link]- Number of individuals who left the habitat represented by (E) that decreases the
population. So, if N is the population density at time t then its density at time t+1 is –
Nt+1 = Nt + [ (B+I) – (D+E)] ,
where Nt = population density at time t.
B = birth rate. D = death rate.I = immigration. E = emigration.
*If B+I>D+E , then population density increases.
*B+I<D+E – then, population density decreases.
*There are two models of population growth-
1. Exponential growth model.
2. Logistic growth model.
* 1. Exponential growth model-
*When the area and resources availability is unlimited in the habitat, the population grows in an
exponential fashion (unlimited) due to no any
barrier or control by
other factors.
dN/dt = (b – d) x N.
Let (b – d) = r,
then dN/dt = rN,
r is called the intrinsic rate
of natural increase and is
an important factor.
*Norway rat the r is 0.015,
and for the flour beetle it is
0.12. in 1981 the r value for
human population in India
was 0.0205.
*When a population shows
exponential growth the
curve plotted with N in
relation to time show ‘J’
shape curve, represented
by,, Nt = N0 ert.
Nt = population density at time t.
N0 = population at
beginning. r = intrinsic rate
of natural increase,
e = natural log (2.71828).

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

147
 High Ranker’s Biology:- 6265237391,
9891766736
* 2. Logistic growth-
*No population can continue to grow exponentially because resources are limited.
*Every habitat has resources to support a particular maximum number of individuals called its carrying
capacity.
*A population showing logistic growth shows ‘sigmoid curve (S).’ also
called--- Verhulst- Pearl Logistic growth.
The equation is-
dN/dt = rN (k – N)/ K,
N = population density at time t,
k = carrying capacity ,
r = natural increase rate,
more realistic model because no population can sustain exponential growth.

# Life History Variations / Population Interaction:-

*Evolution of populations aims at improving the reproductive fitness. They evolve towards the most
efficient reproductive strategy.
*Organisms like Pacific Salmon fish and bamboo breed only once in their life time.
*Oysters and pelagic fishes produce a large number of offspring small sized. Birds and mammals
produce a small number of large-sized offspring.
*According to ecologists life history traits of an organism have evolved in relation to the biotic
and abiotic factors in their habitats.
## Population Interaction-
*Living organism cannot live in isolation and interact in various ways to form communities.
*The interaction of populations of two different species is called species interaction.
*Interspecific interactions arise from the interaction of populations of two different species.
*They could be beneficial, detrimental or neutral ( neither harm nor benefit).
‘+’ sign for beneficial interaction, ‘-‘ sign for detrimental (having harm) and ‘0’ for
neutral interaction. Such interactions are following types:-

1. Mutualism :- ( + + )
*This interspecific interaction show both the interacting species are benefitted (+ ; +). Examples are-
a.) Lichens shows a mutualistic relationship between fungus and an alga cyanobacterium.
Here the fungus helps in absorption of moisture and provide protection while the alga prepare
the food.
b.) Mycorrhizae are mutualistic association between fungus and roots of higher plants. In this the
fungushelps the plant in absoption of essential nutrients while the plant provide food for
the fungus.
c.) plants depends on insects for pollination the pollinators
are rewarded in the form of nector and site for oviposition
(egg laying) e.g., Fig and Wasp.
d.) The Mediterranean Orchid ‘OPHRYS’ get its flowers
pollinated by bee, through “sexual deceit”. In this Orchid,
one petal of the flower resembles the female of a bee
species in size and colour.
*The male bee attracted and “pseudocopulates” with it.
So pollen dusted on its body.
*When the bee is attracted by another flower of this species the

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

148
 High Ranker’s Biology:- 6265237391,
9891766736
pollens grain fall on to
the stigma and
pollination achieved.
plant-animal interactions
often involve co-
evolution of the
mutualists.
*Animals that try to steal
nectar without aiding in
pollination called
“cheaters”.

2. Predation:- (+; - )
*One animal that called
predator kills and
consumes the other
weaker animals called
‘prey’.
*Predation is a nature’s way of transferring the energy fixed by plants, to higher trophic levels e.g.,
Lion – Deer, Seeds – Sparrow.
*Predators act as ‘conduits’ for energy transfer to higher trophic levels. They keep the prey
population under control which otherwise reach very high population and cause imbalance in
the ecosystem.
*Prickly pear cactus introduced into Australia in the early 1920’s, spread rapidly into millions of
hectares, which later brought under control only after a cactus-feeding predator, a moth is
introduced. Biological control method adopted in agricultural pest control.
*Predators also help in maintaining species diversity in a community by reducing competition among prey.
Some species of insects and frogs are camouflaged to avoid being detected easily by the
predators.
*Monarch butterfly are highly distasteful to their predator because of a special chemical by
feeding on a poisonous weed during its caterpillar stage.
*Clotropis produces highly poisonous cardiac glycoside, so no animal can eat it.
*Nicotine, caffeine, quinine, opium etc. are defence against grazers and browsers which develops by
plants.

3. Compitition:- ( -; - )
*Struggle for existence and survival of fittest in nature given by Darwin show interspecific and
intraspecific competition and that is helpful in organic evolution.
*Competition occurs when closely related species compete for the same resources that are limiting.
*But it is not always true, because completely unrelated species can also compete for the same
sources e.g in South America the visiting flamingos and the native fishees compete for the same
zooplanktons as their food.
*Resource need not be limiting for competition to occur, therefore ‘competition’ is a process in
which the fitness of one species is significantly lower in the presence of another species.
*When resources are limited the competitively superior species will eventually eliminate the other
species.
*Abingdon tortoise in Galapagos Island became extinct within a decade after goats are
introduced into the Island.
*‘Competitive release’- A phenomenon in which a species whose distribution is restricted to a
small geographical area, due to the presence of a competitively superior species, is found to
expands its distributional range, when the competing species is experimentally removed.
*Gause’s competitive exclusion principle states that –
“two closely related species competing for the same resources cannot co-exist together as the
competitively inferior one will be eliminated”.
But this is true only when the resources are limiting.
*According to him- species facing competition might
evolve mechanisms that promote co-existence than
exclusion by a mechanism that is “resource
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
149
 High Ranker’s Biology:- 6265237391,
9891766736
partitioning”.

4. Parasitism:- (+; - )
* Many parasites have evolved to be host-specific in
such a way that both host ans the parasite tend to
co-evolve.
*Host evolves special rejecting or resisting the parasite, the

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

150
 High Ranker’s Biology:- 6265237391,
9891766736
parasite has to evolve counteract and neutralise them.
* Parasites evolved special adaptations such as the loss of unnecessary sense organs,
adhesive organs or suckers to cling on to the host loss of digestive system and high
reproductive capacity.
* Parasite develops intermediate hosts e.g., the human liver fluke (a trematode parasite)
depends on two intermediate hosts ( a snail and a fish) to compete its life cycle.
*The parasites harm the hosts, they may reduce the survival, growth and reproduction of the host and
reduce its population.
*Parasites that feed on the external surface of the host organism are called ectoparasites, e.g.,
Lice on humans, ticks on dogs, Loranthus and cuscuta on the hedge plants.
*Marine fishes are infested with endoparasitic copepods.
*Endoparasites are those that live inside the host body at different sites e.g,liver, kidney, lungs,
red blood cells etc.
*‘Brood parasitism’ in birds- in which the parasitic birds lays its eggs in the nest of its host and the
host encubate them, e.g., Cuckoo and crow.

5. Commensalism:- ( +, 0 )
*One is benefited while the other related one is
neither harm nor benefitted.
* The clown fish living among sea anemone and
get protection from its predators, which stay away
from the stinging tentacles of the sea anemone.
*An orchid growing as an ‘epiphyte’ ( plant above
on the plant body, without nutritionally
attachment) on a mango tree branch, the orchid
get a place to survive but mango having no effect
by this orchid.
*Barnacles growing on the back of a Whale.
*Egret and grazing cattle.
*Sucker fish attaches itself to the under surface of
Shark’s body.
*Sea Anemone and Hermit crab.
*The crab derive some benefit through sea
anemone stinging tentacles protection from
predators.

6. Amensalism:- ( - , 0 )
*Here the related species are having harm and another F IG :- ORCHID EPIPHYTE
related species having neither harm nor benefits e.g.,
*A fungus ‘Penicillium notatum did not allow growth of Staphylococci ( a bacterium).
*Grazing cow is neutral (0) while insects expose eaten (-) by birds,
*-----------------------------Assignments C-13th
1. Short notes. water because of osmotic problems, that
a.) Diapouse b.) mirate c.) suspend would result in its death.
d.) Allen’s rule e.) altitude sickness f.) bask.
2. What are various population growth
curves (exponential and logistics)
explain with graph.
3. What are the various components of population

*-----------------NCERT EXERCISE QUESTIONS

SOLUTION:-
1. Diapause is a stage in the development
of certain animals during which development
growth is suspended during winter when days
are short, e.g., (i) in winter the larvae of cotton
ballworm enter into diapause, (ii) under
unfavorable conditions many Zooplankton in
lakes and ponds enter diapause.
2. The marine fish cannot survive in fresh
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
151
 High Ranker’s Biology:- 6265237391,
9891766736
growth?
5. Describe population interactions by
suitable examples (3 of each).
a.) mutualism b.) commensalism c.)
Parasitism.
d.) predation e.) ammensalism

*Hibernation. Animal like frog is cold blooded

animal, whose body temperature changes
according to surroundings. During too much cold,
it cannot move and buries itself deep in the mud.
Respiration during this period is carried out
through skin. This wintersleep is known as
hibernation.
3. Some oraganisms possess adaptations
that are phenotypic, which allow them to respond
quickly to a stressful situation. For example, if a
person has

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

152
 High Ranker’s Biology:- 6265237391,
9891766736
ever been to any high altitude, on visiting such *Reduced leaves (to thorns) to present loss of
as place her or she must have altitude sickness water.
because body does not get enough oxygen. *Waxy coating on leaves to prevent loss of water.
But gradually he or she gets acclimatized and *Closure of stomata during the day to prevent
stop experiencing altitude sickness. loss of water. This is known as CAM pathway.
4. Such microorganisms have minimum *They have scyren stomata.
amount of free water in their bodies. Removal
of water provides resistance to high
temperature.
5. List of attributes that population but not
the individuals possess.
6. The intrinsic rate of increase of this
population will be towards maximum.
7. (i) Modification of leaves into thorns (e.g.,
Bougainvillea) and spines (e.g. Acacia, Caetus
etc.)
(ii) Many plants produce and store
chemicals that make the herbivore sick when
eaten, inhibit feeding or digestion or even kill
it.
8. The interaction between orchid and the
mango tree is termed commensalism, wherein
orchid derives benefit of interaction while
mango tree is not affected.
9. Predation is the means of biological
control to manage pest insects, where
predators prey upon pests and regulate their
numbers in the habitat. Thus, biological control
methods adopted in agricultural pest control
are based on this prey-regulating ability of the
predator.
10. (a) Some animals escape cold by
hiding themselves in frost-free shelters such as
caves, burrows, etc. This habit is called
hibernation or winter sleep. Example: Polar
bears.
Several insects, certain spiders, reptiles
and mammals living in hot, dry regions undergo
aestivation or summer sleep in burrows on
under rocks. Example: some snails and fish.
(b) Ectotherms are cold-blood animals
whose body temperature changes with
changes in the environmental temperature.
They are affected by temperature variations.
Examples: reptiles.
Endotherms are warm blooded
animals who regulate their body temperature
by physiological means. They maintain more
or les a constant internal temperature.
Example: Human beings.
11. (a) Adaptations of desert plants and
animals:
(i) Desert plants like opuntia have
certain adaptations that help them survive
in the harsh conditions of the desert.
These are:
*Short shoot system to reduce loss of water
*Long root system and at times extended to
the surface of the soil for more absorption of
water
*Succulent stems and leaves to store water.
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
153
 High Ranker’s Biology:- 6265237391,
9891766736
(ii) Desert animals like kangaroo rat photoblastic) e.g., onion.
have various adaptations to conserve *(v) Movements. Plant shoots bend towards
water. the source of light.
These are:
- They seldom drink water
- They have a thick coat to
minimize evaporative
dessication
- 90% of their water requirement is met
from metabolic water (Water
produced by respiratory
breakdown)
- They produce nearly solid
urine and faeces.
(b) Adaptations of plants to water scarcity.

(i) Ephemerals live for a brief during the rains

and the rest of the year is passed in the form
of seeds, e.g., Euphorbia prostrata.
(ii) Succulents or drought resistants have
modifications to reduce transpiration. The
plants have fleshy organs, where water and
mucilage are stored. Stems and leaves
possess very thick cuticle and stomata are
sunken.
(c) Behavioural adaptations in animals:
Animals show various behavioural adaptations
to survive during unfavourable conditions.
These are:
(i) Migration – It is a two – way movement of
an animal group to other places for food,
favourable weather and other reasons. It is of
three types – daily, seasonal and periodic.
e.g., locusts migrate periodically to various
regions.
(ii) Hbernation and aestivation – They are
winter sleep and summer sleep respectively.
During these adaptations the metabolic rate
of the animals reduces drastically and help
in conservation of energy during
unfavourable conditions e.g., polar bear
undergo hibernation.
(iii)Behavoural adaptations in desert lizards.
They bask in the sun and absorb heat when
their body temperature is below the comfort
level and move into shade when it is higher.
(d) Importance of light to plants:
*Sunlight is an essential source of energy to
carry out photosynthesis. It influences plants
in many respects:
*(i) Photosynthesis. The rate and amount
of photosynthesis depends upon the
quality, intensity and duration of light.
*(ii) Growth. High light intensity reduces
growth but increases development of
mechanical tissues. It increases flowering
and makes leaves smaller and thicker.
*(iii) Transpiration. It promotes transpiration.
*(iv) Germination. Some seeds germinate in
the presence of light (positively
photoblastic) e.g., viscus and some
germinate in absence of light (negatively
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
154
 High Ranker’s Biology:- 6265237391,
9891766736
*(e) Effect of temperature or water scarcity and (e) Competition between individuals of
the adaptation of animals: different species is known as interspecific. In
*(i) Few animals can tolerate and thrive in a interspecific competition two or more
wide range of temperature and are called populationsusually belonging to the same trophic level
eurythermals. Some animals are not capable of or feeding habit compete with one another for the
doing this and are called Stenothermals. natural resources. For example, in a forested area
*(ii) Pigmentation in animals is dependent on the trees, shrubs, herbs and vines compete with one
temperature of the surrounding (Glogers rule). It another for sunlight, nutrients, water, pollinators and
dispersal agaents. Carnivorous animals like tigers and
is little in colder areas, yellow brown to red in
leopards may compete for the same prey.
arid climates and black in humid hot areas. (f) Symbiosis. It means ‘living together’.
*(iii) Kangaroo / Desert rat seldom drink water Presently, this term is used for all intersections in
and have thick coat to minimize water which two species actually live together without
dessication. 90% of water requirement is met regard to benefit or harm to the participants. If, thus,
from metabolic water while 10% is gotfrom includes commensalism, protocooperation,
food. They produce nearly solid urine and stool. mutualism, amensalism, parasitism. Example.
12. Temperature, light, water, soil, wind, humidity, Rhizobium bacteria and roots of leguminous plants.
gases pH and mineral elements. (g)Mimicry. It is a defensive mechanism
13. (a) Maize (b) Ferns (c) Garlic (d) Human adopted by palatable organisms to protect
beings (e) frog (f) bacteria (decomposers). themselves from predators. It may be defined as
14. A population is a unit of biotic community the superficial but close resemblance of one
made up of, near permanent group of organism to another or to the natural objects
interbreeding individuals of a species found in a among which it lives, that secures its concealment,
geographical area of space at a particular time. protection or some other advantage.
Community is a grouping of different but Example. Viceroy butterfly mimics unpalatable
independent and interacting populations of toxic monarch butterfly.
different species which live in green locality, e.g., 16. (d)
pond community. 17. The size of the population tells us about its
15. (a) Commensalism. It is the relationship status in the habitat. The size of the population may
between two living individuals of different species in be the outcome of competition with another species,
which one is benefitted while the other is neither the impact of the predator, or the effect of use of
harmed nor benefitted except to a negligible pesticide.
extent. Example. An orchid growing on a mango The various characteristics of population are:
tree. (i) Birth rate – It is the number of births per thousand of
(b)Parasitism. It is relationship between two the population.
living organisms of different species in which one (ii) Death rate – It is the number of deaths per
organism called the parasite obtains its food directly thousands of the population.
from another living organism called me host. The (iii) Sex ratio – It is the comparison of distribution
parasite spends a part or whole of its life on or in of males and females in a population.
the body of the host. Example. Lice on humans. (iv) Population size – it is also known as population
(c) Camouflage (Cryptic Appearance). It is density. It tells us about the status of the population
the ability of an organism to blend with the in the habitat.
surroundings or background. It is the most common (v) Population growth – the growth of a population
type of adaptation by animals to remain unnoticed depends on many factors such as food availability,
for protection or aggression. Examples. Some predator pressure and weather. It changes due to
insects are cryptically coloured. four basic processes- natality, mortality, immigration
(d)Mutualism (Symbiosis). It is an interaction and emigration.
between two organisms of different species, where (vi) Population interactions – These include interactions
both the partners are benefitted with none of the such as predation, parasitism, commensalism,a nd
two capable of living separately. Examples liches, mutualism.
symbiotic nitrogen fixation, mycorrhizae and cellulose (vii) Competition – It is the struggle for various
digestion in animals. resources such as food and water. It can be
18. interspecific (between different species) or
intraspecific (between same species).
Ectoparasites Endoparasites
1 They live on the surface of the host. 1 They live in the body of the host.
2 They can be temporary, intermittent or 2 They are generally permanent parasites.
permanent.
3 They can be hemiparasites or holoparasites 3 They are usually holoparasites
4 Respiration is aerobic 4 Respiration is often anaerobic
5 Specialisation has lead to loss of fewer 5 Specialization has lded the loss of several
structures, e.g., wings in fleas, bedbugs and structures, e.g., digestive organs in Taenia.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

155
 High Ranker’s Biology:- 6265237391,
9891766736

Chapter-14. Ecosystem :-
*Introduction:- The term ecosystem given by Tansley- 1935.
*‘Ecosystem is a self regulatory and self sustaining structural and functional unit of landscape,
consisting of community of living beings and the physical environment, both interacting and
exchanging material between them.’ Or
*“The relationships of all the livings with their environment is called ecosystem”.
*Vertical distribution of different species occupying different level is called ‘stratification’.
*The components of the ecosystem are seen to function as a unit are:-
a.) Productivity,
b.) Decomposition,
c.) Energy flow and
d.) Nutrient cycling.
# Productivity:-
*The rate of synthesis of energy containing organic matter or biomass by any trophic level per unit
area in unit time is called its productivity. The amount of energy accumulation in green plants as
biomass or organic matter per unit area over a time period through the process of photosynthesis
is known as primary productivity.
*GPP- Gross primary productivity;-
*The total organic matter synthesised by the producer in the process of photosynthesis per unit
time and area. The rate of biomass production is called productivity. It is expressed in the terms of
g-2 yr-1 or (k cal m-2) yr-1.
*NPP- Net primary productivity-
*A considerable amount of GPP is utilised by plants in respiration. Gross primary productivity minus
respiration losses is the net primary productivity. (NPP = GPP – R). NPP = 170 billion tons (dry weight)
annually.
# Decomposers and Decomposition: -
*Decomposition is a process break dawn complex organic matter into inorganic substances like CO2
,water and nutrients and the process is done by decomposers.
*They are bacteria and fungus. Dead remains of animals, faecal materials, plant remains are called
‘detritus’
serve as row material for decomposition.
*Steps are,Fragmentation→ Leaching→ Catabolism→ Humification→ Mineralisation.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

156
 High Ranker’s Biology:- 6265237391,
9891766736
Fig:- Decomposition and its various stages

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

157
 High Ranker’s Biology:- 6265237391,
9891766736
*Detritivores like earthworms breakdown detritus into smaller particles called ‘fragmentation’.
*Leaching allow water soluble inorganic nutrients go down into the soil by percolating water.
*Bacterial and fungal enzymes degrade detritus into simpler inorganic substances. This process
is called as catabolism.
*Humification is the process of formation of humus, colloidal in nature and it serve as a reservoir of
nutrients.
*The humus is further degraded by some microbes and release inorganic nutrients occur by the
process known as mineralisation into the soil.
. Environmental conditions
*Detritus Humification and Mineralisation.
.. Fragmentation, Leaching, Catabolism

# Energy Flow:-
*Sun is the ultimate source of energy for all ecosystem on earth.
*Only green plants can fix sun’s radiation energy to make food from simple inorganic materials. They
are called producers and always present at the base of a food chain or ecological pyramids.
*All animals depends on plants for their food needs. They are called consumers or
heterotrophs. Primary consumers are herbivores.
*The consumers that feed on these herbivores are called carnivores. Those depends on the
primary carnivores for food are secondary carnivores or top carnivores. Example-
*Grass (producer)→ Deer (primary consumer/herbivore)→ Lion (sec/top consumer/carnivore) in a
grazing food chain.
*The Detritus food chain (DFC) begins with dead organic matter. Fungus and bacteria take their
nutrition from detritus i.e a detritus food chain energy flow.

Fig- Energy flow in a food chain.

*In an aquatic ecosystem energy flow shows grazing food chain type flow. Against this, in a
terrestrial ecosystem, a much larger fraction of energy flow through the DFC than through the
GFC. DFC and GFC may be connected at some levels. Thiese natural interconnection of food
chains make it has a food web.
*So we say two lows of thermodynamics govern this flow of energy:-
a.) According to First low- Energy can be transformed but is neither created nor destroyed.
b.) Second low- Every activity involving energy transformation is accompanied by dissipation of energy.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

158
 High Ranker’s Biology:- 6265237391,
9891766736
# Unidirectional flow of energy:-
*Photosynthetically Active Radiation (PAR) plants capture only 2-10 % of the PAR that sustain the
entire living world.
*All organisms are dependent for their food on plants directly or indirectly. So the energy flow is
unidirectional by each successive trophic levels, as it transfer from sun to producers and then to
consumers.
*Based on the source of organisms nutrition they occupy a specific place in a food chain that is
known as trophic level.
*Maximum trophic levels in a food chain is ‘six’.
*Producers→ Herbivores→Prim carnivores→ Sec carnivores→ Top carnivores →
. T1 ↓ T2 ↓ T3 ↓ T4 ↓ T5 ↓
(when all dies, ‘organic bodies’ decomposed by 6th trophic level ‘T6’ Decomposers).

*The amount of energy decreases at successive trophic levels.

*The transfer of energy follow Lindeman’s (1942) 10% low.
*According to this low ‘only 10% of the energy retain in each successive trophic level from previous
trophic level.
. Example-
. 1J Top consumers
. 10J Secondary consumers (energy transfer in an
ecosystem)
. 100J Primary consumers
. 1000J Producers
*Each trophic level has a certain mass of living material at a particular time called as the “standing
crop”.
*It is measured as the mass of living organisms (biomass) or the number in a unit area.
*It is expressed in terms of
fresh or dry weight (is more
accurate).

# Ecological Pyramids:-
*‘When we try to represent a
relationships among
producers and consumers of
a particular
ecosystem or food chain e.g
deserts, forests, trees, oceans,
ponds etc. we get a geometrical
shape having broader base and
narrow apex is called a
‘pyramids’.
*An ecological pyramid is a
graphic representation of a
ecological parameter like
number of individuals present in
various trophic level of a food
chain with producers forming
the base and top carnivores at
the tip.
Pyramids are usually
prepared for three aspects of
a food chain or ecosystem-

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

159
 High Ranker’s Biology:- 6265237391,
9891766736
a.) pyramids of numbers
b.) pyramids of biomass
c.) pyramids of energy.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

160
 High Ranker’s Biology:- 6265237391,
9891766736
*Pyramid of numbers-
*It is a graphic representation of the number of individuals, stepwise with producers being kept at
the base and top carnivores kept at the tip.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

161
 High Ranker’s Biology:- 6265237391,
9891766736
*Pyramid of Biomass:-
*It represents the biomass present sequence wise per unit area of different trophic levels.
*In pyramid of biomass of ocean (Sea ecosystem), it is inverted, where a small ‘standing crop’ of
phytoplankton supports large number of zooplanktons.
*Pyramid of energy:-
*Without any exception pyramid of energy is always “upright”, never inverted, energy lost as heat as
each step.
*It work on Lindeman’s 10% low of energy transfer. According to this only ten percent of the total
energy present in a trophic level goes into the next trophic level.

# Ecological Succession :-
*Ecological succession is
the natural development
of series of biotic
communities at the same
site, one after the other
till a climax community
develops which does not
change further because
it is perfect with the
environment of the area.
*The gradual and fairly
predictable change in
the species
composition of a given
area is called
ecological succession.
*Succession leads,
some species to
colonise and increase
in numbers in an area
and other species
decline and disappear. The entire sequence of communities that successively change in a
given area are called ‘sere’.
*The first biotic community which develops first is called ‘pioneer community’.
*When succession end climax community established, which is a stable self perpetuating and
final biotic community that develops at the end of biotic succession.
# Biotic succession on bare rock is called ‘lithosphere’ or ‘xerosere’ or ‘xerarch succession’.
*Lichen and mosses bring organic matters to the bare rock which helps in maintaing moisture and
other material for next stage succession.
*These changes lead finally to a community that is fully developed and is near equilibrium with the
environment and is called ‘climax community’.
*In desert various communities comes during succession are-

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

162
 High Ranker’s Biology:- 6265237391,
9891766736
Lichen stage→ Moss stage→ Annual grasses→ Shrubs stage →Forest.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

163
 High Ranker’s Biology:- 6265237391,
9891766736

# Biotic succession in ‘pond or ‘hydrarch succession’ stages are

–
*Plankton stage (pioneer stage)→ Rooted submerged
stage→ submerged free floating plant stage →Reed-swamp
stage→ Marsh- meadow stage→ Scrub stage →Forest
(climax stage).
*Phytoplanktons and zooplanktons are pionner members in
a pond area.
*Their death provides organic matter at the bottom of water
bodies which provides support for other submerged and
free floating plant stage.
*Now water becomes shallow so amphibians plants grow called
Reed- swamp stage.
*Much amount of organic matter and suitable amount of
moisture sustain scrub and trees which later converted into
full fledge forest.
*Primary succession is very slow process may takes
thousands of years.

Fig:- Steps during hydrarc succession

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

164
 High Ranker’s Biology:- 6265237391,
9891766736
# Nutrient cycling:-
*The amount of nutrients such
as C, N, P, Ca, etc. present in the
soil at any given time is referred
to as the ‘standing state’.
*It varies in different kinds of
ecosystems and also on a
seasonal basis.
*Nutrients are on the basis of
nature they present, categorised
in two forms :-
a.)Gaseous ( N, C etc.) and
b.)Sedimentary ( P, S etc.)
1. Carbon cycle-
*About 4x1013 Kg of carbon is
fixed by the process of
photosynthesis annually.
*A considerable amount of
carbon returns to the
atmosphere as CO2 through
respiration of producers and
consumers.
*Decomposers also contribute
to CO2 pool. Burning of wood
forest fire and combustion of
organic matter, fossil fuels,
volcanic activity are Fig- Carbon cycle representation
additional sources for releasing CO2 in the
atmosphere.

2. Phosphorus cycle:-
*The natural reservoir of
phosphorous is rock which
contains P in the form of
phosphates.
*When rocks are weathered
minute amounts of these
phosphate dissolve in soil
solution and are absorbed by the
roots of the plants.
*The waste products and the
dead organisms are
decomposed by phosphate-
solubilising bacteria releasing
phosphorus.

# Ecosystem Services:-
*The products of ecosystem
processes which have
environmental and indirect
economic value are namedas
‘ecosystem services.
*Robert Constanza and his collegues
have put the value of ecosystem services is 33trillion dollars. Nearly twice the Global GNP of 18 trillion
dollars.
*Soil, timbers, air, temparature maintainance, forest products, Oxygen are valuable products
of ecosystem services, which are indispensible things for human life.

*----------------------------Assignments. C-14th 1.) What are the various stages takes place
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
165
 High Ranker’s Biology:- 6265237391,
9891766736
during decomposition?
basis ? explain with examples.
2.) How energy flow is uni-directional?
4.) What is succession? How its takes place in
3.) What is a pyramid? How they prepared on
desert (bare rocks ) and aquatic
various
environment?
5.) Explain sedimentary and gaseous nutrient
cycling by suitable examples.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

166
 High Ranker’s Biology:- 6265237391,
9891766736
*------------------NCERT Exercise Questions Solutions.

1. (a) Autotrophs, (b) Upright, (c) Light, (d) Bacteria, fungi and earthworms, (e) hydrosphere.
2. (d)
3. (b)
4. (d)
5. (b)
6. (a)

Grazing Food Chain Detritus Food Chain

1 The chain begins with producers at the 1 The chain begins with detritivores
first trophic level. and decomposers at the first trophic
level.
2 Energy for the food chain comes from 2 Energy for the food chain comes from
sun organic remains or detritus
3 Food chains adds energy into 3 It retrieves food energy from detritus
the ecosystem and prevents its wastage.
4 The food chain binds up inorganic 4 The food chain helps in releasing
nutrients inorganic nutrients to the cycling pool.
(b)
Production Decomposition
1 It refers to the process of synthesis of 1 It is the process of breaking down a
organic compounds from inorganic complex substance into its
substances such as carbon dioxide, water constituent parts.
and minerals utilizing generally the sunlight
2 It is mainly done by plants. 2 It is brought about by reducer
organisms (bacteria, fungi).
(c)
Upright Inverted Pyramid
Pyramid
1 When the number of producer or their 1 When the number of individuals or
biomass is maximum in an ecosystem and their biomass at producer level is
these decrease progressively at each minimum and it increases
trophic level in a food chain, we get upright progressively at each trophic level
pyramids in a food chain, we get
inverted pyramid.
(d)

Food Chain Food

Web
1 It is a straight pathway through foo 1 It consists of number of
which, energy travels in the ecosystem d interconnected food chains through
which, food energy passes in the
ecosystem.
2 Members of higher trophic level feed 2 Member of higher trophic level can
upon a single type of organism of lower feed upon a number of alternative
trophic level organisms
of the lower trophic level.
3 Presence of separate or isolated food 3 Presence of food increas the
chains adds to the instability of the webs stability of the e
ecosystem. ecosystem
4 If does not add to and 4 Food webs increase adaptability
adaptability competitiveness of and competitiveness of the
the organisms. organisms.

(e)
Detritus Litte
r
1 Dead remains of plants and animals 1 It is the above ground detritus.
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
167
 High Ranker’s Biology:- 6265237391,
9891766736
constitute the detritus. It is differentiated The dead remains of plants (leaves,
into litter fall (above ground detritus) and bark, flowers etc.) and dead remains
below ground detritus. of animals, their faecal matter that
fall on the surface of earth in
terrestrial
ecosystem is litter.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

168
 High Ranker’s Biology:- 6265237391,
9891766736
(f) *Pyramid of biomass is upright for terrestrial
7. Organization (Components) of the habitats. Inverted or spindle – shaped pyramids
Ecosystem An ecosystem is made up of two for aquatic
types of components, biotic and abiotic.
I. Biotic Components
*They constitute all the living members of an
ecosystem.
*The different biotic components are connected
through food chains and a number of other
relations. Both matter and energy are
transferred in the living world through food.
II. Abiotic Components. Abiotic
components of an ecosystem consists of non-
living substances and factors. The important
one are as follows:

(i) Temperature (ii) Light

(iii) Wind (iv) Humidity
(v) Precipitation (vi) Water
(vii) Topography (viii) Gases
(ix) Soil
(x) pH (Hydorgen ion Concentration)

*Interaction of biotic and abiotic components

result in a physical structure that is
characteristic for each of ecosystem.
8. Ecological Pyriamids (Eltonian Pyramids)
*The food or energy relationships between
organisms at different trophic levels can be
expressed in terms of number, mass or energy
in the shape of a pyramid.
*An ecological pyramid can be upright,
inverted or spindle shaped.
*There are three types of ecological pyramids.
(i) Pyramid of Numbers. It is a graphic
representation of the number of
individuals per unit area at various
trophic levels stepwise, with producers
being kept at the base and top
carnivores kept at the tip. In most cases,
the pyramid of number is upright with
members of successive higher trophic
level being fewer than the previous.

*A single large sized producer like a tree can,

however, provide food to several herbivores
(e.g., birds). The birds may support a still larger
population of ectoparasties. Such a pyramid
shall be inverted.
*Small sized herbivorous birds are usually
eaten by a falcon or eagle. The number of
eagles is, however, very small. This type of
pyramid of numbers shall be spindle-like.
(ii) Pyramid of Biomass. The amount of living or
organic matter present in an organism is called
biomass. It is measured both as fresh and dry-
weight.
*Pyramid of biomass is more real than the
pyramid of numbers because the latter does not
take into consideration the size of the individual.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

169
 High Ranker’s Biology:- 6265237391,
9891766736
Decomposition helps in recycling of biochemical
habitats, where the biomass of a trophic substances and creates space for newer
level depends upon reproductive potential generations of organisms.
and longevity of its members. Decomposition occurs in three steps, all of
(iii)Pyramid of Energy. It is a graphic which operate simultaneously.
representation of amount of energy trapped
per unit time and area at different trohpic
levels of a food chain, with producers forming
the base and top carnivores the tip.
The energy content is expressed as Kcal / m2 / yr
or kJ
/ m2 / yr
 Maximum energy content is
present in producers.
 As the energy passes to higher
trophic levels along with food, its
amount decreases because of its
dissipation as heat and use in
overcoming entropy as well as for
performing various body activities.
 The pyramid of energy is always
upright. It is more accuate than the
pyramid of biomass or the pyramid of
numbers.
 Limitations of Ecological Pyramids
(a) They does not take into account the
same species belonging to two or more
trophic levels.
(b) Thus assume a simple food chain,
whereas in nature it does not exist.
(c) They have no place for detrivores
and decomposers, though they play
a vital role in ecosystem.
9. (i) Pyramid Productivity. The amount of
energy accumulation in green plants as
biomass or organic matter per unit area
over a time period through the process of
photosynthesis is known as primary
productivity.
Productivity is expressed as weight – g /
m2 / yr, or energy – Kcal / m2 / yr.
(ii) Gross primary productivity is
equal to rate of increase in body weight of
producers plus loss suffered through
respiration and damages. Net primary
productivity is equal to organic matter
synthesis by photosynthesis minus the rate
of respiration and other loss of NPP = GPP – R.
(iii) Various factors which affect
primary productivity include light,
temperature, water, nutrients, etc. For
example, in deserts, sunlight is abundant but
water is scarce or nutrients are lacking.
Therefore, in such areas, water and nutrient
supply become the limiting factor. Productivity
increase from polar regions towards the
tropics because the increasing sunlight and
temperature.
10. Decomposition is the physical and
chemical breakdown of complex organic
remains with the help of decomposers.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

170
 High Ranker’s Biology:- 6265237391,
9891766736
(i) Fragmentation of detritus. It is the break biomass;’ this is in accordance with the second
down of dead plants and animals into smaller law of thermodynamics.
particles due to which left-over detritus comes 12. In the sedimentary cycle, the reservoir
to have large surface area. for the nutrient elements is located in the
(ii) Catabolism. The decomposers (e.g., earth’s crust. Elements such as phosphours,
bacteria, fungi) excrete digestive enzymes over sulphur, potassium and calcium have
the detritus. It changes insoluble complex sedimentary cycles. These cycles are slow and
organic substances into simple and soluble less perfect systems as the elementary may got
organic compounds and inorganic substances. locked in the reservoir pool and go out of
A part of the broken down food is taken up by circulation for long period.
decomposers and immobilized. 13. The cycling pool of carbon cycle consists
(iii) Leaching. Soluble substances formed
of 29% of free CO2 in the atmosphere and about
during decomposition are subjected to
71% of dissolved CO in the hydrosphere.
leaching or passage to deeper layer of soil /
(i) Reservoir pool – the lithosphere
ground water by percolating water.
contains 2.8 x 1021 kg of carbon, which does
*Decomposition process gives rise to two
not become available to the organism till it is
products, humus and inorganic nutrients ( =
burnt or changed chemically.
minerals) by the process of humification and
(ii) About 4 x 1013 kg of carbon is fixed in
mineralization respectively.
the biosphere through photosynthesis annually.
*Humus is a dark coloured amorphous organic
(iii) Carbon fixed by producers enters the
matter, rich is lignin and cellulose and acts as
food chain and is hence, passed to herbivores,
reservoir of nutrients, maintenance of soil
carnivores, decomposers, etc. During
moisture and aeration.
photosynthesis, the carbon component of the
*Mineralization is the release of inorganic
atmosphere and hydrosphere decreases. It is
substances, both non-minerals (E.g., CO2 , H2O )
replenished by five methods:
and minerals (e.g., Ca2+ , Mg2+ , K+ , NH4 + ) from
(a) Respiration of organisms
organic matter.
(b) Decomposition of organic wastes and
11. Except for the deep hydrothermal dead bodies by decomposers.
ecosystems, the source of energy in all (c) Burning of wood and fossile fuels.
ecosystems is solar energy. (d) Weathering of carbonate containing
rocks or treatment of carbonate minerals.
*Only about 50% of the incident solar energy is
(e) Volcanic eruptions and not springs.
present in photosynthetically active radiation
(iv) Some carbon is taken out of
(PAR).
circulation and added to lithosphere by hard
*About 1-5% of incident solar energy or 2-10% of
carbonaceous shells, skeletons of animals,
PAR is captured by the photosynthetic
fossilization, seepage of carbon rich water into
organisms in synthesis of organic matter on
interior earth and caving in of forests during
which all other organisms are dependent for
earthquakes.
their food on producers either directly or
(v) Major exchange in carbon cycle is
indirectly.
between organisms (absorption by producers,
*The flow of energy from the sun to the
released by all in respiration) and the
producers and then to consumers is
atmosphere or hydrosphere.
unidirectional and is in accordance with the first
law of thermodynamics.
*In an ecosystem, energy is transferred in the
form of food and it leads to degradation and loss
of a major part of food energy as heat during
metabolic activities and a very small fraction
becomes stored as

Primary productivity Secondary productivity

1 It is rate of synthesis of organic matter 1 It is rate of synthesis of organic matter
by producers by consumers.
2 It is comparatively quite high 2 It is small and decreases with rise
of trophic level
3 It is due to synthesis of fresh organic matter 3 It is due to synthesis or organic matter
from inorganic raw material

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

171
 High Ranker’s Biology:- 6265237391,
9891766736

CHAPTER – 15. BIODIVERSITY AND CONSERVATION:-

# Introduction -- ( Bio – life , diverse – different ).
*The word given by Wilson 1992. This means different forms of life exists not only at the species
level but at all level of biological organisation ranging from macromolecules within cells to
biomes.
# What Are Various Level Of Biodiversity –
Most important level of biodiversity are –
A.) Genetic Diversity –
*A single species may show high variation at the genetic level due to its distribution range. They
may show various quality difference level at the plant occurs in nature, e.g. , 50,000 genetically
different strain of rice and 1000 varieties of mango.
*Rouwolfia vomitaria , growing in different Himalayan ranges, shows differences in the
potency and concentration of active chemical reserpine due to genetic diversity.
B.) Species Diversity –
*Geographical distribution also influences species. Western Ghats amphibian varieties are
different from Eastern Ghat species.
C.) Ecological Diversity –
*In India various type of habitats are present e.g. , Desert, Rain forests, Mangroves, Wetlands,
Estuaries and Alpine. These different habitats influence organisms to changes, that causes
biodiversity.
* Ecological diversity is three main types- 1.) Alpha-α-diversity- within community,
2.) Beta- β-diversity- diversity between community, 3.) Gama-ϒ- diversity- range of communities.

# Pattern Of Biodiversity –
1. Latitudinal gradients-
*The diversity of plants and animals is not uniform throughout the world but shows a rather uneven
distribution.
*Species diversity decreases as we move away from the equator towards the pole.
*At equator temperature and rain fall is maximum that sustain the dense vegetation in this region.
*Towards pole the vegetation and animal distribution gradually degreases. This is due to
unevenness of rainfall and temperature distribution.
Example- Colombia- near equator – 1400 species of birds.
*New York -- 41o N – 105 species.
*Greenland -- 710 N – 56 species.
*In Amazon region – 40,000 species of plants, 3000 fishes,
*1300 birds, 427 mammals, 427 amphibians, 378 reptiles.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

172
 High Ranker’s Biology:- 6265237391,
9891766736
2. Species area relationship: –
Alexander Van Hamboldt observed that
- “within a region species richness
increased with increasing area, but only
up to a limit”. So , it shows rectangular
hyperbola.
On a logarithmic scale,
the relationship is a straight line
describe by the equation –
log S = log C + Z log A.
.
.
.
Fig- Species area Relationship. On log
scale it is linear.

S = species richness A = aria,

Z = slope of the line ( regression coefficient) C = Y-
intercept. (Z = 0.1 – 0.2) small area, less steeper
( Z = 0.6 – 1.2 ) entire continent much steeper.

# The Importance of Species Diversity to the Ecosystem :-

According to “ Rivet popper hypothesis” --

*In an aeroplane ( ecosystem) all rivets ( species ) live together.
*If every passenger travelling in it starts a rivet extinct, it may not affect flight safety ( i.e,
functioning of an ecosystem ) initially, but as more and more rivets are removed it may be
dangerous to plane safety.
*Even a certain rivet may also be critical. Loss of this critical species is more dangerous than other
species.
# Loss Of Biodiversity –
* Since the origin and diversification of life on earth there were five episodes of mass extinction of
species during the long period of more than 3 billion years.
*The current rate of extinction is 100-1000 times faster than pre-human times. It seems that the
earth is heading for the ‘sixth extinction’. If the present trends continue, nearly half of all the
species on the earth might be vanish within the next 100 years.
*Humans and human’s activities are more responsible region for biodiversity loss.
*It leads to - a.) decline in plants production
b.) lower environmental resistance c.) variation in ecosystem functions.
*Causes --- The accelerated rates of species extinctions that the world is facing now are largely
due to human activities. There are four major causes for i.e., “The Evil Quartet”.
1. Habitat loss and fragmentation :--
Loss of tropical rain forests causes great loss to habitat. The Amazon Rain Forest called “lungs of
the planet”. Due to forest cutting habitats are going to be loss and in fragments. It causes loss of
species and even pollution and improper functioning of an ecosystem. Species interaction also
causes great loss.
2. Over-exploitation :--
For their food and shelter human always depends on nature. Increasing in demand in food and shelter
causes biodiversity loss due to over- exploitation of nature and natural products. example -
( Steller’s sea cow, passenger pigeon ).
3. Alien Species Invasions :--
*When alien species are introduced causes decline or extinction of indigenous species.
*The Nile Perch introduced into Lake Victoria in East Africa causes loss of 200 species of Cichlid fish in
the lake.
*Parthenium , lantana and water hyacinth are also invasive species.
*Illegal introduction of the African catfish Clarias gariepinus for aquaculture purposes is posing a threat to
the indigenous catfishes in our rivers.
4. Co-extinction :--
When both host and parasite become dead called co-extinction. When a plant died the parasite
Cascuta also die due to lack of food i.e. , co-extinction. Means when two species are nutritionally
Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
173
 High Ranker’s Biology:- 6265237391,
9891766736
related to each other, one extinction causes the death of another one.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

174
 High Ranker’s Biology:- 6265237391,
9891766736
# Biodiversity Conservation :--
*If we consider narrowly utilisation of biodiversity it
related to only human welfare than conservation is
important.
*Even we consider broadly utilisation like whole
ecosystems function then also biodiversity
conservation is must. some approach are --
# In- Situ Conservation:--
* In these methods, natural plants and animals,
remain in their natural habitats and protected
from outside by human efforts by restricting safari,
tourism and illegal hunting in these particular area.
Examples- Hot spots, Protected areas, National
reserves. Fig- Zonation in Terrestrial biosphere.
*Endemism species are necessary to [Link] are found not anywhere in the world than that area.
*When the conservation done on the organisms original place is called in situ conservation.
*Here species rich area are considered as hot spot , .
initially 25 now 34 hot spots in the world and provide all facilities for them to grow in their numbers.
*In India now has 14 biosphere reserves, 90 national parks and 448 wildlife sanctuaries.
*Khasi and Jaintia Hills in Meghalaya, Aravalli Hills of Rajasthan, Western Ghat regions of
Karnataka and Maharashtra and Surguja, Chanda and Baster areas of Madhya Pardesh forms
“sacred groves” where each plants are given total protection. They having cultural and
mythological importance so protected well.
# Ex-Situ Conservation :--
*Conservation and protection of selected rare plants or animals in places outside their natural habitat.
*Offsite collections:-In this method, threatened animals and plants are taken out from their natural
habitat and placed in special area where they are given special care, e.g. , “zoological parks” ,
“botanical garden” and safari parks serve this purpose.
*Gene Banks:- Institutes which maintain stock of viable seeds, live growing plants, tissue culture
and frozen germplasm with the whole range of genetic variability.
*Cryopreservation;- Now gametes of threatened species can be preserved in viable and fertile
condition for long periods using “cryopreservation” technology.
*Egg can be fertilized in vitro and plants can be propagated using tissue culture technique to
overcome these problems. Somaclones , tissue culture also comes under it.
*Red Data Book- Record of thretened species of plants and animals maintained by IUCN. It has 8
categories --- Extinct; Extinct in Wild; Critically Endangered, Vulnerable, Lowest risk; Data deficient and
Not Evaluated.
#The Earth Summit: -
*The historic convention on Biological Diversity held in Rio de Janeiro in 1992, ‘The Earth Summit”
where called upon all nations to take appropriate measures for conservation of biodiversity and
sustainable utilisation of its benefits.
*The World Summit on Sustainable Development held in 2002 in Johannesburg, South Africa, 190
countries pledged their commitment to achieve by 2010, that they will reduce in the current rate of
biodiversity loss at global, regional and local levels.
# Kyoto Protocol:-
*Held in Kyoto, Japan, during December1997.
*Kyoto protocol obtained commitments of different countries to cut down the green house
gases and ‘other ozone depleters’. All the countries to reduce it by 5% below 1990 level by
2008-2012.
# Ramsar Sites:-
* Named after city Ramsar in Iran. Here the Ramsar convention was signed in 1971 to
develope awareness about the importance of wetlands.
*Wetlands are the area where water is the primary factor, controlling the environment and
the plants and animals life found there. Here land is covered by water because water table is
near the surface.
* These sites are for the conservation and sustainable utilisation of wetland and recognising
their ecological function, economic, cultural, scientific and recreational values.
*Ramsar Sites In India:- Chandra Taal (H.P), Chilka lake (Odissa), Deepor Beel (Assan), Loktak Lake
(Manipur), Sambhar Lake in Rajasthan and Wular lake in J&K, etc.
*Threats of wetland:- loss of vegetation, saliniation, excessive inundation, water pollution, invasive

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

175
 High Ranker’s Biology:- 6265237391,
9891766736
species, urbanisation and transportation

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

176
 High Ranker’s Biology:- 6265237391,
9891766736
*----------------------------- ASSIGNMENTS INDIA:-
chapter-15th .
Q .[Link] the three important components of
biodiversity.
Q.2. How do ecologists estimate the total
number of species present in the world?
Q.3. What is the significance of the slope of
regression in a species-area relationship?
Q.4. What are the major causes (the evil
quartets) of species losses in a geographical
region?
Q.5. What are sacred groves? What is their
role in conservation?
Q.6. Define the terms:-
a.) in situ conservation b.) Ex situ conservation
*---------NCERT Exercises Questions
Solutions:-
1. Ecologists make a statistical comparison of
the species richness of exhaustively studied
groups of insects the temperate – tropical
regions and extrapolate this ratio to other groups
of animals and plants to calculate gross estimate
of the total number of species on the earth.

2. There are various hypothesis for higher

diversity in tropical areas:
(i) Temperate areas have undergone
frequent glaciation in the past. It killed most of
the species. No such disturbance occurred in
tropics where species continued to flourish and
evolve undisturbed for millions of years.

(ii) There are no unfavourable seasons in

tropics. Continued favourable environmental
has helped tropical organisms to gain more
niche specialization and increased diversity.

(iii) More solar energy is available in

tropics. This promotes higher productivity and
increased biodiversity.

3. When analysis of species – area

relationships is done among small areas, the
values of slopes of regression are remarkably
similar regardless of the taxonomic group or the
region. However, when such analysis is done for
very large areas like a whole then the slope or
regression would be much steeper.

4. Major causes of species losses in a

geographical region are habitat loss and
fragmentation, introduction of exotic species,
over exploitation, disturbance and degradation
both natural and man made, pollution, etc.

5. (i) Stability. Biodiversity is essential for

stability of an ecosystem. Communities with
more species tend

#Some National Parks or Sanctuary of

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736
177
 High Ranker’s Biology:- 6265237391,
9891766736
to be more stable than those with less
species. It is able to resist occasional
disturbance. Alien species are unable to find a
foot-hold.

(ii) Productivity. Ecosystems with

higher biodiversity (e.g., tropical forests) are
more productive than ecosystems with lower
biodiversity (e.g., temperate forests)

(iii) Ecosystem Health. Biodiversity is

essential for maintenance and health of
ecosystems through the occurrence of
various checks, controls, negative and positive
feed backs, critical link and keystone species.
6. Sacred forest (= sacred groves) are
forest patches around places of worships
which are held in high esteem by tribal
communities. They are found in several parts
of India, e.g., Karnataka, Maharashtra,
Rajasthan (Aravalli), Madhya Pradesh
(Sarguja, Chanda and Bastar), Kerala,
Meghalaya. Not a single branch is allowed to
be cut from these forests. As a result many
endemic species which are rare or have
become extinct elsewhere can be seen to
flourish here.

7. Plant play a vital role in the control of

floods and soil erosion. Their roots bind the
soil particles firmly and in this way they do
not allow the top soil to be drifted away by
winds or moving water Run off of rain water is
reduced to that flood water is rarely formed.

8. Variations in the genes of a species

increase with increase in size and
environmental parameters of the habitat.
Genetic diversity is useful in adaptation to
changes in environmental conditions.
Compared to plants, animals have increased
size and genetic variation. Also the animals
posses elaborate nervous system to control
and coordinative various activities. They
possess receptor organs for receiving
environmental stimuli and responding
against them. All these contribute to the
higher species diversity in animals than
plants in which nervous system are absent.

9. We are trying to eradicate disease

causing organisms (e.g., polio virus) from this
world to make this world disease free. Since,
such microorganisms are harmful to the
human society, such attempt is justified.
Further, such microorganisms are not essential
components (producers or decomposers) of
any ecosystem and losing one or few such
organisms would not affected the functioning
of ecosystem.

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

178
 High Ranker’s Biology:- 6265237391,
9891766736

Name of Parks Situated year area Animals commonly found Concerned river

Bandhavgarh Madhya 1982 446 1336 species of endemic plants

National Park Pradesh

Bandipur National Karnataka 1974 874.20 Chital, Bengal tiger, Kabini

Park gray langurs, Indian River, Moyar
giant River
squirrel, gaur, leopard,
sambar deer, Indian
elephants, honey buzzard,
red-headed vulture

Tiger, sloth
Bannerghatta Karnataka 1986 104.3
bear, peacock, elephant, sambar
National Park deer, mouse deer

Betla National Jharkhand 1986 1135 Tiger, Indian bison, elephant, hyenas, North Koyal
Park monkey,Leopard River

Bhitarkanika Odisha 1988 145 Mangroves, saltwater crocodile, Brahmani

National Park white crocodile, Indian python, River,
black ibis, wild pigs, rhesus Baitarani
monkeys, olive ridley sea turtle, River,
chital Dhamra
River,
Pathsala
Chandoli National Maharashtra 2004 317.67
Park

Dachigam Jammu and 1981 141 Only area where Kashmir stag is
National Park Kashmir found[2]

Desert National Rajasthan 1980 3162 Great Indian bustard

Park
Dudhwa Uttar 1977 490.29 Tiger, Sambar deer, hog deer
National Park Pradesh

Eravikulam N. Park Kerala 1978 97 Nilgiri tahr, Strobilanthes kunthiana Pambar River
(Kerala)

Gangotri N. Park Uttarakhand 1989 2390 Gaumukh Glacier Ganga

Gir Forest National Gujarat 1975 1412 Asiatic lion Hiran ,

Park Godavari and
Raval

Great Himalayan Himachal 1984 754.40 UNESCO World Heritage Site

National Park Pradesh

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

179
 High Ranker’s Biology:- 6265237391,
9891766736
Guru Ghasidas Chhattisgarh 1981 1440.71
(Sanjay)
National Park

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

180
 High Ranker’s Biology:- 6265237391,
9891766736
Hemis National Ja and 198 4400 Largest National park in India
Park Kashmir 1

Indravati N. Park Chhattisgarh 198 1258.37 Wild Asian buffalo, tiger reserve,
1 hill mynas

Jaldapara National West Bengal 201 216 Indian rhinoceros

Park 2

Jim Corbett Uttarakhand 193 1318.5 First national park in India Ramganga
National Park 6 (established in 1936 as Hailey
National Park)
Kalesar National Haryana 200 100.88 On the bank of Yamuna river
Park 3

Kanha National Madhya 195 940

Park Pradesh 5

Kanger Ghati Chhattisgarh 198 200

National Park 2

Kaziranga Assam 197 858.98 Highest known tiger density in the

National Park 4 world, Indian
rhinoceros, UNESCO World
Heritage Site

Keibul Lamjao Manipur 197 40 Only floating park in the world Loktak Lake
National Park 7

Keoladeo National Rajasthan 198 28.73 UNESCO World Heritage Site

Park 1

Khangchendzong Sikkim 197 1784 UNESCO World Heritage Site

a National Park 7

Khirganga Himachal 201 710

National Park Pradesh 0

Kishtwar Jammu and 198 400

National Park Kashmir 1

Kudremukh Karnataka 198 600.32

National Park 7

Kuno National Madhya 201 748.76 Asiatic Lion Reintroduction Project

Park Pradesh 8
Introuction of Cheetah from Namibia

Manas National Assam 199 950 UNESCO World Heritage Site

Park 0

Marine National Gujarat 198 162.89

0

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

181
 High Ranker’s Biology:- 6265237391,
9891766736
Park, Gulf of Kutch

Mount Harriet Andaman 198 46.62 Important bird area as

National Park and 7 attributed by BirdLife
Nicobar International
Islands
Mudumalai Tamil Nadu 194 321.55
National Park 0

Namdapha Arunachal 197 1985.24

National Park Pradesh 4

Nanda Devi Uttarakhand 198 630.33 UNESCO World Heritage Site,

National Park 2 UNESCO World Biosphere Reserve

Nokrek National Meghalaya 198 47.48 UNESCO World Biosphere Reserve

Park 6

Panna National Madhya 198 542.67

Park Pradesh 1

Pench National Madhya 197 758

Park[3] Pradesh 7

Periyar National Kerala 198 305 Malabar parakeet, Malabar grey

Park 2 hornbill, Nilgiri laughing thrush,
Nilgiri blue robin, great hornbill,
lion-tailed macaque, hairy-winged
bat
Rajaji National Uttarakhand 198 820 Mainly known for elephants, tigers,
Park 3 leopards and several species of
birds, reptiles and mammals.

Rajiv Gandhi Andhra 200 2.4

(Rameswaram) Pradesh 5
National Park

Rani Jhansi Marine Andaman 199 256.14

National Park and 6
Nicobar
Islands
Ranthambore Rajasthan 198 392
National Park 1

Salim Ali Jammu and 199 9.07

National Park Kashmir 2

Sanjay Gandhi Maharashtra 196 104 Asiatic Lion, Indian Leopard,

National Park 9 Rhesus Macaque, Bonnet
Macaque, Spotted Deer,
Hanuman Langur, Indian Flying
Fox, Indian Hare, Barking
Deer, Porcupine, Palm Civet, Mouse

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

182
 High Ranker’s Biology:- 6265237391,
9891766736
Deer

Sariska Tiger Rajasthan 195 866

Reserve 5

Satpura Madhya 198 524

National Park Pradesh 1

Silent Valley Kerala 198 237 Indian bison, Travancore flying Kunthipuzha
National Park 0 squirrel, Salim Ali's fruit bat, River
Stripe- necked mongoose, Blue-
winged parakeet.

Simlipal National Odisha 198 2750 Tiger, leopard, Asian elephant,

Park 0 sambar, barking deer, gaur, jungle
cat, wild boar

Sultanpur Haryana 198 1.43

Nation. Park 9

Sundarbans West Bengal 198 1330.12 UNESCO World Heritage Site

NatPark 4

Tadoba Maharashtra 195 625 Tiger

National Park 5

Valley of Flowers Uttarakhand 198 87.50 UNESCO World Heritage Site

National Park 2

*Wish U Luck FOLKS.

``````````````````````````````````````````````````````````````````````````````````

Academics, NEET, PAT and career counciling Page 6265237391; 9891766736

183