0% found this document useful (0 votes)
9 views12 pages

Cystic Echinococcosis in Egyptian Camels and Cattle

Uploaded by

fatma elgohary
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
9 views12 pages

Cystic Echinococcosis in Egyptian Camels and Cattle

Uploaded by

fatma elgohary
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

ORIGINAL RESEARCH

published: 04 October 2021


doi: 10.3389/fvets.2021.750640

Epidemiological, Morphometric, and


Molecular Investigation of Cystic
Echinococcosis in Camel and Cattle
From Upper Egypt: Current Status
and Zoonotic Implications
Ahmed Gareh 1 , Amira A. Saleh 2 , Samar M. Moustafa 3 , Amin Tahoun 4 , Roua S. Baty 5 ,
Refaat M. A. Khalifa 6 , Ahmed K. Dyab 6 , Doaa A. Yones 6 , Mohsen I. Arafa 7 ,
Amer R. Abdelaziz 8 , Fatma A. El-Gohary 9 and Ehab Kotb Elmahallawy 10*
1
Department of Parasitology, Faculty of Veterinary Medicine, Aswan University, Aswan, Egypt, 2 Department of Medical
Parasitology, Faculty of Medicine, Zagazig University, Zagazig, Egypt, 3 Department of Zoonoses, Faculty of Veterinary
Edited by: Medicine, Benha University, Benha, Egypt, 4 Department of Animal Medicine, Faculty of Veterinary Medicine, Kafrelsheikh
Hui Zhang, University, Kafrelsheikh, Egypt, 5 Department of Biotechnology, College of Science, Taif University, Taif, Saudi Arabia,
6
South China Agricultural Department of Parasitology, Faculty of Medicine, Assiut University, Assiut, Egypt, 7 Animal Health Research Institute, Assiut,
University, China Egypt, 8 Department of Parasitology, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt, 9 Department of
Hygiene and Zoonoses, Faculty of Veterinary Medicine, Mansoura University, Mansoura, Egypt, 10 Department of Zoonoses,
Reviewed by: Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt
Wenchao Li,
Anhui Science and Technology
University, China Cystic echinococcosis has been considered one of the major parasitic zoonoses
Dr. Sumbal Haleem,
Kohat University of Science and
which is associated with severe economic losses. The present study was undertaken
Technology, Pakistan to investigate the occurrence, organ distribution, cyst fertility, and viability of cystic
*Correspondence: echinococcosis in slaughtered camels and cattle from various abattoirs in Assiut
Ehab Kotb Elmahallawy Governorate, Egypt. The work also involved morphological, morphometric, and
eehaa@[Link]
molecular identification of the parasite. The occurrence of hydatid cysts was investigated
Specialty section: in total number of 100 lungs of camels and 574 liver and lungs of cattle admitted to
This article was submitted to three slaughterhouses at Assiut Governorate, Egypt. Moreover, several individual variable
Parasitology,
a section of the journal factors, including organ involvement, age, sex, and hydatid cyst characteristics, were
Frontiers in Veterinary Science studied to identify their possible association with the occurrence of the disease. Genomic
Received: 30 July 2021 DNA was extracted from the hydatid cysts, followed by molecular identification of the
Accepted: 07 September 2021
parasite through amplification of ribosomal DNA internal transcribed spacer (ITS) regions.
Published: 04 October 2021
Hydatid cysts were found in 6 camels (6%) out of 100 inspected camels, while 5 hydatid
Citation:
Gareh A, Saleh AA, Moustafa SM, cysts (0.87%) were detected in a total number of 574 cattle examined. The parasite
Tahoun A, Baty RS, Khalifa RMA, was detected exclusively in lungs of camels, while lungs were the main organ infected
Dyab AK, Yones DA, Arafa MI,
Abdelaziz AR, El-Gohary FA and
by the parasite in cattle and one hydatid cyst was found in the liver (0.17%). In camel,
Elmahallawy EK (2021) 66.7, 16.65, and 16.65%of detected cysts were fertile, sterile, and calcified, respectively,
Epidemiological, Morphometric, and
while in cattle, these percentages were 60, 20, and 20%, respectively. None of the
Molecular Investigation of Cystic
Echinococcosis in Camel and Cattle studied variable factors were significantly associated with the occurrence of the disease
From Upper Egypt: Current Status in camels, with the exception that all cysts were found in the lung. Conversely, we found a
and Zoonotic Implications.
Front. Vet. Sci. 8:750640.
significant association (P < 0.05) between the age and sex of the slaughtered cattle and
doi: 10.3389/fvets.2021.750640 the occurrence of hydatid cysts. In this respect, the rate of infection was higher in female

Frontiers in Veterinary Science | [Link] 1 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

cattle and those cattle more than 5 years (P < 0.05). The morphological, morphometric,
and molecular studies confirmed the presence of the parasite. Taken together, our results
concluded that camels and cattle play a potential role in maintaining the transmission
cycle of this zoonotic parasite.

Keywords: molecular, morphometric, hydatid cyst, camel, cattle, Egypt, epidemiological

INTRODUCTION performed using light microscopy and, more recently, scanning


electron microscopy (SEM) in detection of the parasite (34, 35).
Cystic echinococcosis (CE) is a parasitic zoonotic disease with Light microscopy was reported as a valid method for identifying
a worldwide distribution, particularly in developing countries E. granulosus strains in several previous studies based on its
(1–4). This disease is caused by a tapeworm of the species larval hook morphology (33, 35). However, other studies have
Echinococcus granulosus (EG) complex that has several distinct considered that its morphological identification based solely on
genotypes (5). The adult tapeworm inhabits the intestine of ordinary microscopy is insufficient to differentiate the various
the definitive hosts, i.e., carnivores, who contract the infection strains of E. granulosus (34, 36–38). In this respect, SEM
through the consumption of the viscera of the intermediate hosts provides many advantages over light microscopy and facilitates
(3). The epidemiological profile of the disease includes human the visualization and measurements of the large and small
hosts and a wide range of wild and domestic hosts, including larval rostellar hooks, particularly in some countries where
cattle, sheep, goats, and camels, which serve as intermediate molecular studies cannot be performed (39, 40). Polymerase
hosts (3, 6). Carnivores then contaminate the environment, chain reaction (PCR) is a widely accepted molecular tool for
resulting in the spread of the infection, while human and other epidemiological studies aimed at identifying and quantifying
intermediate hosts contract the infection from fecal matter Echinococcus spp. in various tissues and body fluids, either in
via oral routes and/or indirect contact with canines (3). In reservoirs or hosts (41–44). To our knowledge, E. granulosus
humans and other intermediate hosts, the larval stage of the is an assemblage of cryptic species that differ in morphology,
parasite can reside and grow in the liver and lung, but rarely host specificity, pathogenicity, and mitochondrial and nuclear
in other visceral organs (7). The pathogenesis of the disease genomes, making the taxonomy of this parasites is challenging
and its clinical impact depend on the severity of the infection issue (45). Several molecular approaches that can distinguish
and the organ involved and the occasional rupture of hydatid the genotypes of E. granulosus revealed that they are associated
cysts might lead to sudden death resulting from anaphylaxis, with distinct intermediate hosts, including sheep, goats, pigs,
hemorrhage, and metastasis (8, 9). It is therefore not surprising horses, cattle, camels, and cervids (5, 46, 47). Based on the
to state that CE might represent a life-threatening disease most recent molecular phylogeny of the six nuclear genes and
in humans if left untreated, as it affects around one million mitochondrial genomes, E. granulosus sensu lato comprises 5
people worldwide (10, 11). In addition, CE has been ranked as species and 8 genotypes that represent intraspecific variants (48,
the second most significant helminthic disease associated with 49). According to these analyses, G2 genotype has a variant of G3,
serious global economic losses, besides being a cosmopolitan while G6-G7 and G8-G10 genotypes are considered as distinct
disease (12–15). These huge economic losses result from the species. It seems that this great diversity has led to phylogenetic
waste of animal protein because the edible organs are deemed differences and affinities within the same genus. Therefore, it
unfit for human consumption (16, 17). According to the is not surprising to find that various hypotheses regarding the
World Health Organization (WHO), echinococcosis results in origin and geographic dispersal of the causative agents of CE have
around 19,300 deaths and 871,000 disability-adjusted life-years been reported (45).
(18). Providing periodical updates on the available epidemiological
In accordance with its distribution, several previous studies data of the disease through field surveys performed for
revealed the endemicity of the disease in Egypt and neighboring surveillance purposes, together with the investigation of
countries of the Mediterranean basin and Middle East (19– the genotypes of the E. granulosus strains circulating in a
30). The prevalence rates varied greatly among intermediate given endemic area, may be crucial for the development of
hosts of various species because of the influence of a vaccines, diagnostic tests, and control strategies targeting
variety of environmental factors and hygienic conditions hydatid disease (45, 50). Given the fact that limited
(25), which is potentiated by the presence of infected stray information is available about the real contribution of
dogs that are mostly used for guarding purposes or by camel and cattle in transmission of the disease in Upper
the ease access of these dogs to slaughter houses (25, Egypt, the present study was undertaken to investigate the
29). occurrence, organ distribution, cyst fertility, and viability
One of the most important strategies used for controlling of CE in slaughtered camel and cattle from various
the disease is accurate detection. The role of morphology abattoirs in Assiut Governorate, Egypt, followed by the
criteria in the differentiation of the taxa of E. granulosus has morphological, morphometric, and molecular identification of
been documented repeatedly (31–34). Several trials have been the parasite.

Frontiers in Veterinary Science | [Link] 2 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

MATERIALS AND METHODS SEM according to the protocol described elsewhere (40). Briefly,
the hydatid fluid was aspirated from 3 hydatid cysts in cattle
Ethical Considerations and 4 hydatid cysts in camels, then the parasite materials were
The study protocol was approved by the local guidance of prepared from the fluid by repeated centrifugations. This step was
Research, Publication and Ethics Committee of the Faculty then followed by washing several times in phosphate buffer and
of Veterinary Medicine, Kafrelsheikh University, Egypt, which fixation in mixture of 3% glutaraldehyde with 0.1 M phosphate
complies with all relevant Egyptian legislations in publication and buffer. The re-suspended samples were centrifuged twice at
research. The ethical approval number is KFS-2015/1. 112 g for 5 min and the resulting pellet was then resuspended
in 1% osmium tetroxide prepared at room temperature. The
Study Area and Sample Collection and morphometric analysis of the preparations was then done using
Preparation SEM (Joel, JSM-5400LV Scanning Electron Microscope, Tokyo
The present study was conducted to determine the occurrence of 1993, Japan) (40). The identified structures, including small
CE in camels (N = 100) and cattle (N = 574) slaughtered during and large hooks, were also examined using SEM for a different
the period of October 2015 to December 2017. The animals were characteristics and aspects including length and the width of each
admitted to different abattoirs (N = 3) in Assiut Governorate hook and the guard angle, following to the protocols described
(Assiut, Bani-Adi, and Dairout abattoirs). Assiut Governorate elsewhere (39, 40, 55, 56).
is located in Upper Egypt (latitude, 27◦ 10′ 48.4824′′ N; and
longitude 31◦ 11′ 21.4188 ′′ W). The liver and lungs of camels Preparation of Parasite Material for the
and cattle were examined for the detection of hydatid cysts Extraction of DNA
through visual inspection, palpation, and systematic incision It is important to note that camel and cattle samples were
of each lung (51). Any hydatid cysts obtained from the lungs processed separately using the same protocol. The processing
and liver of each species were collected during the postmortem of the cyst samples was carried out as described elsewhere
examination; then extracted, counted, and carefully removed (52). Briefly, the cyst wall was opened and the hydatid fluids
during evisceration by dissection; and finally placed into sterile were collected into marked test tubes, then centrifuged. The
flasks (thermo flasks) and transported to the laboratory at supernatant was discarded and the sediment (parasite material),
the Department of Medical Parasitology, Faculty of Medicine, which contains free scolices and brood capsules) was collected
Assiut University, for the experimental work. The methodology into clean sterile bottles containing 70% ethanol and stored at
included the morphological and microscopic identification of the −20◦ C until use (52). After washing the samples with nucleic-
hydatid cysts, together with sending samples of parasite material acid-free water, to remove the ethanol, total genomic DNA
to the Molecular Biology Unit, Assiut University, Assiut, Egypt, was extracted from parasite material using the QIAamp DNA
for further examination and molecular analysis. The samples Mini Kit (QIAGEN, Germany), according to the manufacturer’s
used for morphological and microscopic identification were protocol and as described elsewhere (50). The DNA was then
preserved in 10% formalin and stored in closed containers at 4◦ C, stored in sterile DNAse- and RNAse-free microtubes and kept
while those used for molecular identification were kept in clean at −20◦ C.
sterile bottles containing 70% ethanol (52).
Molecular Identification (PCR)
Morphological and Microscopic Table 1 lists the primers used for the amplification of the
Examination of the Hydatid Cysts DNA obtained from protoscoleces of hydatid cysts. The primers
The hydatid cysts were subjected to morphological examination targeted the ribosomal DNA (rDNA) region spanning the
to check their shape, size, viability, and condition according internal transcribed spacers ITS-1 and ITS-2 regions which is
to a protocol described elsewhere (53, 54). The condition of validated for E. granulosus diagnosis (46, 57, 58). The PCR
the cysts was classified into three categories, as follows: fertile was designed for ITS1 and ITS2 regions and the amplification
hydatid cysts, containing protoscoleces and/or daughter cysts; conditions were as per a protocol described elsewhere (5, 61),
sterile hydatid cysts, full of fluid but without protoscoleces; with slight modification. Briefly, the PCR mixture (25 µl)
and calcified hydatid cysts, with a tough thickened wall and contained 12.5 µl of Master mix (Promega), 1 µl of forward
absence of protoscoleces or fluid (53, 54). The hydatid fluid of primer (10 p/mol), 1 µl of reverse primer (10 p/mol), 1 µl of DNA
each cyst was aspirated using 21 gauge needle. The collected (50 ng/µl of DNA template), and 9.5 µl of deionized distilled
fluid was centrifuged at 252 g for 5 min. The last drops of the water. The amplification included an initial denaturation step
sediment were then transferred to a slide, mounted with a glass of 5 min at 95◦ C; followed by 40 cycles of 1 min at 95◦ C, 30 s
cover slip, and observed under a microscope for the presence of at 60◦ C, and 3 min at 72◦ C; and a final extension at 72◦ C for
protoscoleces, brood capsules, and taeniid hooks. When scolices 10 min. Five microliter of the resultant amplified PCR products
could not be detected, the whole cyst was opened in a Petri dish, were analyzed in 1.6% (w/v) agarose gels in Tris-acetate-EDTA
in which the fluid and germinal layer scrapings were examined (TAE) buffer stained with ethidium bromide, transilluminated
for the presence of protoscoleces or brood capsules. Microscopic under ultraviolet light, and photographed. A known positive
examination of the cyst fluid was performed to look for viable control comprising a reference strain was included [kindly
protoscoleces after dropping 0.1% eosin into the fluid. The provided by Professor Refaat Khalifa (Animal Health Research
specimens of hydatid cysts were also processed and prepared for Institute, Assiut, Egypt)], while purified water was used as the

Frontiers in Veterinary Science | [Link] 3 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

TABLE 1 | The PCR primers for rDNA region spanning the ITS region target genes.

Gene Primer type Primer sequence PCR product size (base pair) References

ITS region ITS1-BD1Forward 5′ GTCGTAACAAGGTTTCCGTA-3′ 1,100 bp (46, 57, 58)


4S (reverse) 5′ TCTAGATGCGTTCGAATGTCGATG-3′
ITS2−3S- forward 5′ GGTACCGGTGGATCACTCGGCTCG3′ 750 bp (57, 59, 60)
A28 - reverse 5′ GGGATCCTGGTTAGTTTCTTTTCCTCCGC-3′

negative control. Controls were processed in parallel with the occurrence of hydatid cysts in cattle are illustrated in Table 3. As
experimental samples, to detect possible contamination. shown in the table, the majority of hydatid cysts were detected in
the lungs (0.7%), while one hydatid cyst was found in the liver
Data Analysis (0.17%). The age and sex factors were the variables that were
Data were collected, organized and then analyzed using SPSS, 23. significantly associated with the occurrence of hydatid cysts (P
Fisher’s exact test was used to compare frequencies of presence < 0.05). The occurrence of hydatid cysts in female cattle older
of hydatid cyst in different organs in camels and cattle besides than 5 years of age was 2.6% (5 out of 175 examined cattle), while
studying the potential explanatory individual variable factors no hydatid cysts were detected in younger male cattle (<5 years
associated with the occurrence of the disease. Furthermore, of age). In addition, out of the 5 detected hydatid cysts, 3 (60%)
normality of quantitative parameters (length and width of hooks, were fertile, 1 was sterile (20%), and another was calcified (20%).
handle, and blade of small hook and large hooks) were assessed Regarding the viability of fertile hydatid cysts, only 33.3% (1 out
using normal probability plots and the Kolmogorov-Smirnov test of 3 examined cysts) of the fertile cysts isolated from cattle were
generated with the Proc T-test procedure of Statistical Analysis non-viable, while 66.7% (2 out of 3 examined cysts) were viable.
System (SAS R , version 9.2, SAS Institute, Cary, NC, USA) to In accordance with the number of cysts in cattle, 4 cattle had
study the statistical differences between cattle and camel. For all single cyst and only one animal exhibited multiple hydatid cysts.
analyses, P ≤ 0.05 was defined as significant.
Molecular, Morphological, and
RESULTS Morphometric Identification of Hydatid
Cysts
Occurrence of Hydatid Cysts in Camel and In accordance with the molecular identification of hydatid cysts
Cattle Samples and the Potential (46, 57, 58, 62), the DNA fragments amplified from the rDNA
Explanatory Individual Variable Factors extracted from hydatid cyst protoscoleces of the organs from
In the present study, hydatid cysts were detected in 6% of infected camels and cattle were approximately 1,100 base pairs
the examined lungs of camels. Table 2 summarizes the variable (bp) and 750 bp in length for ITS1 and ITS2, respectively
factors associated with the occurrence of the disease in camels. In (Supplementary Figures 1, 2). Figure 1 illustrates the gross
accordance with organ distribution of hydatid cysts in camels, 6 morphological appearance of examples of the hydatid cysts
hydatid cysts were detected in the lungs, whereas no cysts were detected in camels. Several instances of multiple scolices in viable
found in the liver (P < 0.05). The remaining factors were not and non-viable fertile hydatid cysts, and different-shaped and -
significantly associated with the occurrence of cysts. Regarding sized hooks in fertile viable hydatid cysts in the lungs of camels
the age factor in camels, the rate of cysts was higher in camels were also observed (Figure 1). Similar to that observed in camels,
older than 5 years of age than younger camels (<5 years of age). the morphological and microscopic examinations of the hydatid
In this context, Table 2 shows that the occurrence of hydatid cysts cysts encountered in the lungs of cattle are shown in Figure 2,
in camels older than 5 years of age was 10% (4 out of 40 examined several instances of multiple scolices in viable and non-viable
camels), whereas in younger camels (<5 years of age) this value solitary fertile hydatid cysts, as well as different-shaped and -
was 3.33% (2 out of 60 examined camels). In accordance with sized hooks in fertile viable hydatid cysts, were detected in the
sex, the occurrence of hydatid cysts in male camels was 6.7% (6 lungs of cattle (Figure 2). On the other hand, SEM visualization
out of 90 examined camels) and no hydatid cysts were detected of the morphometric appearance of the small and large hooks of
in females. Out of the 6 detected hydatid cysts, 4 (66.7 %) were hydatid cysts obtained from the infected lung of camel is shown
fertile, 1 was sterile (16.65%), and another was calcified (16.65%). in Figure 3, while that of cattle are depicted in Figures 4, 5. The
Furthermore, in camels, the current investigation showed that morphometric characteristics and measurements of the hooks of
75% (3 out of 4 examined cysts) of the fertile cysts were viable cattle and camel are shown in Table 4. As shown in Figures 3–
and 25% (1 out of 4 examined cysts) were non-viable. In addition, 5, morphologically, the small hooks of cattle lungs had a flatter
3 hydatid cysts were found as single cysts in camels and another concavity of the handle and much thinner blade with a pointed
three animals experienced multiple hydatid cysts. end, while the large hooks of cattle lungs were generally smaller
In accordance with their occurrence in cattle, hydatid than those of the camel lungs. Regarding their morphometry, the
cysts were found in 0.87% of examined cattle. The potential blade of small hooks of cattle lungs was narrow, the concavity
explanatory individual variable factors associated with the between the handle and the guard was shallower, and the handle

Frontiers in Veterinary Science | [Link] 4 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

TABLE 2 | Summarizes the data of the possible associations between the occurrence of hydatid cysts in camels and the potential explanatory individual variable factors
of these detected cysts.

Variable factor Sample size No. of positives Positive rate/% Statistical data (Fisher exact P. value)

Organ Lung 100 6 6 0.029*


Liver 100 0 0
Age > 5 years 60 2 3.3 0.214
< 5 years 40 4 10
Sex Male 90 6 6.7 1
Female 10 0 0

The symbol *means that P < 0.05.

TABLE 3 | Summarizes the data of the possible associations between the occurrence of hydatid cysts in cattle and the potential explanatory individual variable factors of
these detected cysts.

Variable factor Sample size No. of positives Positive rate/% Statistical data (Fisher exact P. value)

Organ Lung 575 4 0.7 0.369


Liver 575 1 0.17
Age > 5 years 400 0 0 0.003**
< 5 years 175 5 2.6
Sex Male 400 0 0 0.003**
Female 175 5 2.6

The symbol **means that P < 0.01.

was longer and narrower than those of camel lungs. Moreover, higher occurrence rates of CE, of 9 and 24.15% were reported
the large hooks of cattle lungs were smaller in total length, width, in camels from the same region of Egypt (66, 67). Moreover,
and handle length, with a similar blade length. Collectively, Barghash et al. (26) reported higher rates of 18.7% in camels from
Figures 3–5 depict the presence of slight but clear differences in Cairo, Dairut, Mallawy, and Kafr-ElShikh, Egypt (26). Another
the morphology and morphometry of the small and large hooks study of CE in various municipals abattoirs in Cairo, Giza,
of cysts obtained from the lungs of camels and cattle. and Beni-Suef governorate, Egypt, reported a higher prevalence
rate of 10.82% (29). Conversely, lower values of 2.35 and 5%
have been reported in camels from Beni Suef and Upper Egypt,
DISCUSSION respectively (25, 68). In the present study, CE was only reported
in 0.87% of examined cattle. The present rates of CE are lower
The present study provides interesting data related to the than those of a previous study performed in cattle from Egypt,
occurrence of CE and to several potential explanatory individual which reported an occurrence rate of 3.3% (69). Another study
variable factors associated with the occurrence of hydatid cysts in performed in Cairo reported that 18.4% of the examined cattle
camels and cattle from slaughterhouses in Assiut Governorate, were infected by CE (70). In contrast, the occurrence rate
Egypt. The confirmation of the results was performed using obtained in the present study was higher than those reported
a set of molecular identification tools and by studying the in cattle slaughtered in abattoirs in Assiut, Mansoura, and other
ultrastructure of the protoscoleces and hooks in the detected provinces of Upper Egypt, where hydatid cysts were noted in
cysts via SEM. Given the fact, limited information are available 0.4, 0.068, and 0.004% of the examined animals, respectively (25,
about CE in upper Egypt, our study provides novel contribution 71, 72). The discrepancy in the occurrence of CE in camels and
about the occurrence of this disease and the real contribution cattle in the present study vs. those reported in several previous
of camels and cattle in maintenance the epidemiological foci of studies may be attributed to several factors, such as hygienic
this disease of zoonotic importance in this area. As shown in practices during slaughter, sex and age of the slaughtered animals,
our work, hydatid cysts were detected in 6% of examined lungs the method of detection, the geographic location, and various
of camels. A previous survey of hydatid disease in camels and climatic conditions (25, 45, 73, 74). The unhygienic disposal of
cattle in the same studied area reported a prevalence rate of condemned carcasses and infected organs, the ease of access stray
7.67% in camels, while no infection was reported in cattle (54). dogs to slaughter houses, and the unauthorized slaughter are also
Another study reported a seroprevalence rate of 6% in camels relevant factors in the transmission of CE (29, 30, 74, 75).
harboring hydatid cysts (63). The frequency of CE observed in In accordance with the studied potential variable factors, the
camels in the present work is similar to that detected previously statistical analysis revealed that the number and type of cysts,
by Dyab et al. (64) in Assiut Governorate (64) and to that organ involved, and fertility and viability of hydatid cysts were
reported by Lahmar et al. (65) in Tunisia (65). In contrast, not significantly associated with the occurrence of the of CE in

Frontiers in Veterinary Science | [Link] 5 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

FIGURE 1 | Morphological appearance of Hydatid cyst in the lung of camels. (A) Solitary sterile hydatid cysts. (B) Multiple hydatid cysts. (C) Multiple scolices in viable
and non-viable fertile hydatid cyst, using 0.1% Eosin stain (X400) and (D) different-shaped and sized hooks in fertile viable-hydatid cysts.

FIGURE 2 | Morphological appearance of hydatid cyst in lung and liver of cattle. (A) Solitary viable fertile hydatid cysts in the lung of cattle. (B) Multiple scolices in
viable fertile hydatid cyst in the lung of cattle using 0.1% eosin stain (X100). (C) Multiple scolices in non-viable fertile hydatid cyst in the lung of cattle using 0.1% eosin
stain (X100) and (D) calcified hydatid cysts in the liver of cattle.

Frontiers in Veterinary Science | [Link] 6 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

FIGURE 3 | Morphometric appearance of small and large hook of hydatid cyst isolated from lung of camel using SEM. (A) The small hook of hydatid cyst. (B) The
large hook of hydatid cyst. (C) Measurement the small hook of hydatid cyst; total hook length = 27 µm (arrow), total hook width = 9 µm (arrow), handle length =
9 µm (arrow) and blade length = 10 µm (arrow) and (D) measurement the large hook of hydatid cyst; Total hook length = 34 µm (arrow), total hook width = 12 µm
(arrow), handle length = 14 µm (arrow) and blade length = 15 µm (arrow).

camels or cattle. The present study also showed that CE were only examined male cattle. This observation may be explained by the
detected in the lungs of camels, while cysts occurred mainly in fact that female animals are not slaughtered at younger ages,
the lungs of cattle and only one cyst was reported in the liver of as the owners mostly keep them for breeding, obtaining calves
cattle, which is consistent with several previous reports, mainly and for milk production; in contrast, male cattle are slaughtered
from Egypt (69, 70, 72). However, some previous reports revealed at younger ages (70, 82, 83). The management practices might
that the parasite exhibited single-organ involvement, although also contribute to this difference since males move far away for
the involvement of two organs has also been recorded, which is grazing; meanwhile females are usually kept homesteads, making
apparently associated with the specific geographic regions and females are more exposed to infection than males (84).
strain of the parasite (25, 76, 77). Regarding the age as variable Considering the sex as potential variable factor, all detected
factor, our study reveals that occurrence of hydatid cysts in aged hydatid cysts in camels were found in males and no cysts were
camels at rate of 10% (4 out of 40 examined camels), whereas detected in females. Meanwhile, all detected hydatid cysts in
in younger male camels, this value was 3.33% (2 out of 60 cattle were found in females. Reviewing the available literature,
examined camels). Furthermore, the present data illustrate the a previous study reported an infection rate of 16.89% in female
occurrence of hydatid cysts in aged cattle at a rate of 2.6% (5 and 13.55% in male cattle in Northwest Iran (85). This difference
infected out of 175 examined animals), while no infection was might be attributed to the low number of females analyzed in
detected among young cattle (<5 years of age) (N = 400). The our study compared with males. In the present study, single
present findings agree with several previous studies performed cysts were detected in 80% of positive samples and multiple cysts
either at the national (Egypt) or international level (70, 78, 79). were present in 20% of infected cattle, while single and multiple
This observation could be attributed to the fact that older animals cysts were reported at an equal percentage of 50% in camels.
are exposed to infection more than young ones and aged animals Our results are consistent with those reported in Southern Italy,
get slaughtered more than young ages, since their production where 78.8% of the cysts were single entities (86). Regarding
(calves/milk) and working capacity decrease (80). Immunity hydatid cyst viability in camels, 75% of the examined cysts were
represent an additional factor might involve this difference since viable while 25% of the cysts were non-viable. Meanwhile, our
older ages have weak immune system to combat the infection data revealed that 66.7% of hydatid cysts detected in cattle were
(81). Furthermore, the present study showed that female cattle viable, while 33.3% of the examined fertile cysts were non-
were infected exclusively, at rate of 2.6% (5 infected out of viable. Similar results were recorded in camels in Addis Ababa,
175 examined animals), while no infection was detected in the where 66.6% of the detected hydatid cysts were viable (87).

Frontiers in Veterinary Science | [Link] 7 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

FIGURE 4 | Morphometric appearance of small and large hook of hydatid cyst isolated from cattle lung using SEM. (A) The small hook of hydatid cyst isolated from
cattle lung. (B) The large hook of hydatid cyst isolated from cattle lung. (C) Measurement the small hook of hydatid cyst isolated from cattle lung; Total hook length =
22 µm (arrow), total hook width = 6 µm (arrow), handle length = 10 µm (arrow) and blade length = 5 µm (arrow) and (D) measurement the large hook of hydatid cyst
isolated from cattle lung; total hook length = 28 µm (arrow), total hook width = 8 µm (arrow), handle length = 8 µm (arrow) and blade length = 16 µm (arrow).

Another previous study performed in Southeastern Iran found


that 57.14% of the hydatid cysts detected in camels were viable
(88). Regarding the type of cyst, the current investigation showed
that 4 of hydatid cysts (66.7 %) were fertile, 1 was sterile (16.65%),
and another was calcified (16.65%). In addition, 75% of the
fertile cysts in camels were viable and 25% were non-viable.
Moreover, 3 hydatid cysts were found as single cysts in camels
and another three animals experienced multiple hydatid cysts.
On the other hand, our study found that 60% of hydatid cysts
in cattle were fertile, 20% were sterile, and 20% were calcified.
In addition, only 33.3% of the examined fertile cysts isolated
from cattle were non-viable, while 66.7% were viable. Moreover,
4 cattle had single cyst and only one animal showed multiple
hydatid cysts. Similar to the present results obtained in cattle,
another study performed in Eastern Ethiopia found that 80%
of the cysts were fertile, 17.3% were sterile, and 2.85% were
calcified (79). Another study from Southern Italy revealed that
42.7% of cysts were sterile and 57.3% were calcified/caseous, FIGURE 5 | Morphometric appearance of hydatid cyst isolated from cattle
lung using SEM. (A) SEM of rostellar hooks from protoscoleces of hydatid
while no fertile cysts were found (86). In this context, camelids
cyst, isolated from cattle showing alternating large and small hooks, and (B)
and porcine are suitable hosts that frequently contain fertile SEM of brood capsules showing exterior outgrowth in hydatid cyst isolated
cysts (45). from a cattle lung (arrow).
In accordance with the morphological and morphometric data
(Table 4, Figures 3–5), the reported data indicated slight but
clear differences in the morphology and statistical significant
differences morphometric measurements of the small and large 40). However, the limitations of the use of SEM, i.e., the need for
hooks obtained from the lungs of camels and cattle, which is infrastructure or financial constraints, favor the performance of
consistent with the results of several previous studies (31–34, 39, molecular techniques vs. purchasing an SEM instrument (89).

Frontiers in Veterinary Science | [Link] 8 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

TABLE 4 | The morphometric measurements (µm) of total length, width, handle, and blade of large and small hooks hydatid cysts retrieved from lungs of cattle and camel
[Values are means ± error of the mean (SEM)].

Cattle (mean± SD) Camel (mean± SD)

Small hook Large hook Small hook Large hook

Length of hooks 22.32 ± 0.615a e 28.03 ± 0.97U 34.05 ± 0.615b e 27.02 ± 0.44U
b U a
Width of hooks 6.04 ± 0.16 e 8.03 ± 0.38 9.01 ± 0.34 e 12.05 ± 0.56U
bU
Handle length 10.07 ± 0.51e 8.04 ± 0.5 9.06 ± 0.41e 14.02 ± 0.38aU
Blade length 5.03 ± 0.34b e 16.02 ± 0.51U 10.02 ± 0.63a e 15.02 ± 0.53U

Means within rows with different superscripts differ at P ≤ 0.05. Different letters, a and b, indicate statistical significance differences between small hook and large hook of cattle and
camel. Different asterisks, U and e, indicate statistical significant differences between values of small hook and large hook within the same species.

Among other molecular targets, PCR was used to amplify the DATA AVAILABILITY STATEMENT
ITS region of ribosomal DNA as a genetic marker, which provides
a simple and powerful tool for the accurate identification The original contributions presented in the study are included
and differentiation of Echinococcus strains (90). In the present in the article/Supplementary Material, further inquiries can be
work, the size of the DNA fragment amplified for rDNA- directed to the corresponding author/s.
ITS1 and rDNA-ITS2 was 1,100 and 750 bp, respectively, in
both camel and cattle samples. Similar results were reported in AUTHOR CONTRIBUTIONS
several previous studies (57, 59, 62). A review of the available
literature showed that CE is widespread in many countries AG, RK, AD, DY, and MA involved in the conception of
where camels are raised, including Egypt (52, 91–94). This the research idea and methodology design, supervision, and
finding implies the widespread presence of CE across the performed data analysis and interpretation. AS, SM, AT, RB,
area of Upper Egypt. Among others, recent molecular data FE-G, and EE participated in methodology, sampling, and data
suggested that the prevalence of infection of E. canadensis analysis. AG and EE drafted and prepared the manuscript for
G6 might be higher than previously described, and that this publication for publication and revision. RK, AD, DY, and MA
genotype exists as a complex of different strains that differ in contributed their scientific advice. All authors read and approved
a wide variety of criteria (92, 94, 95). Clearly, future genotypic the final manuscript.
characterization of the major strains circulating in the country
using phylogenetic studies would provide interesting information FUNDING
about the genetic relatedness of the parasite, both at the regional
and international levels. This work was supported by the Taif University Researchers
Supporting Program (Project number: TURSP-2020/269), Taif
CONCLUSIONS AND University, Saudi Arabia.
RECOMMENDATIONS
ACKNOWLEDGMENTS
In summary, the results of this study demonstrated the
occurrence of CE among camels and cattle in Upper Egypt. The authors also thank the veterinarians and directors of the
Moreover, our findings conclude that camels and cattle play abattoirs for their support and help in providing data and during
a potential role in the maintenance of the zoonotic foci and collection of the samples throughout the study. The authors
the transmission cycle of the parasite in Egypt. Our results also would like to thank Dr. Kirsty Jensen from University of
also suggest the possible spreading of this zoonotic disease to Edinburgh for improving the English style of the paper.
other provinces in Egypt, together with animal movements.
Further research and epidemiological studies are recommended SUPPLEMENTARY MATERIAL
to explore the involvement of other intermediate hosts in
Egypt and identify the species of Echinococcus species that The Supplementary Material for this article can be found
are circulating throughout the country, which is important online at: [Link]
information for combating this zoonotic disease. 2021.750640/full#supplementary-material

REFERENCES 2. Alvarez Rojas CA, Romig T, Lightowlers MW. Echinococcus granulosus sensu
lato genotypes infecting humans–review of current knowledge. Int J Parasitol.
1. Budke CM, Deplazes P, Torgerson PR. Global socioeconomic (2014) 44:9–18. doi: 10.1016/[Link].2013.08.008
impact of cystic echinococcosis. Emerg Infect Dis. (2006) 3. Deplazes P, Rinaldi L, Alvarez Rojas CA, Torgerson PR, Harandi
12:296–303. doi: 10.3201/eid1202.050499 MF, Romig T, et al. Global distribution of alveolar and cystic

Frontiers in Veterinary Science | [Link] 9 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

echinococcosis. Adv Parasitol. (2017) 95:315–493. doi: 10.1016/[Link].2016. 24. Kouidri M, Benchaib-Khoudja F, Boulkaboul A, Selles M. Prevalence, fertility
11.001 and viability of cystic echinococcosis in sheep and cattle of Algeria. Bulgarian
4. Khan SN, Ali R, Khan S, Norin S, Rooman M, Akbar NU, J Vet Med. (2012) 15:191–7.
et al. Cystic echinococcosis: an emerging zoonosis in southern 25. Omar M, Sultan K, Haridy M, Ali A. Prevalence of Cystic Echinococcosis in
regions of Khyber Pakhtunkhwa, Pakistan. BMC Vet Res. (2021) slaughtered ruminants in different abattoirs, upper Egypt. Am J Anim Vet Sci.
17:139. doi: 10.1186/s12917-021-02830-z (2013) 8:117–21. doi: 10.3844/ajavsp.2013.117.121
5. Nakao M, McManus DP, Schantz PM, Craig PS, Ito A. A molecular 26. Barghash S, El-Sayed R, El-Alfy N, Abou-Elnour B, El-Kattan A, Sadek AS.
phylogeny of the genus Echinococcus inferred from complete mitochondrial Prevalence and molecular identification of Echinococcus granulosus in humans
genomes. Parasitology. (2007) 134:713–22. doi: 10.1017/S00311820060 and slaughtered animals in Egypt. Europ J Biomed Pharm Sci. (2017) 4:34–42
01934 27. Manciulli T, Mariconti M, Vola A, Lissandrin R, Brunetti E. Cystic
6. Eckert J, Deplazes P. Biological, epidemiological, and clinical aspects of Echinococcosis in the Mediterranean. Curr Trop Med Rep. (2017) 4:235–
echinococcosis, a zoonosis of increasing concern. Clin Microbiol Rev. (2004) 44. doi: 10.1007/s40475-017-0129-z
17:107–5. doi: 10.1128/CMR.17.1.107-135.2004 28. Scala A, Bosco A, Pipia AP, Tamponi C, Musella V, Costanzo N, et al. Cystic
7. Moro P, Schantz PM. Echinococcosis: a review. Int J Infect Dis. (2009) echinococcosis in cattle dairy farms: spatial distribution and epidemiological
13:125–33. doi: 10.1016/[Link].2008.03.037 dynamics. Geospat Health. (2017) 12:562. doi: 10.4081/gh.2017.562
8. Getaw A, Beyene D, Ayana D, Megersa B, Abunna F. Hydatidosis: 29. El-Dakhly KM, Arafa WM, El-Nahass ESN, Shokier KAM,
prevalence and its economic importance in ruminants slaughtered at Adama Noaman AF. The current prevalence and diversity of cystic
municipal abattoir, Central Oromia, Ethiopia. Acta Trop. (2010) 113:221– echinococcosis in slaughtered animals in Egypt. J Parasitic Dis. (2019)
5. doi: 10.1016/[Link].2009.10.019 43:711–7. doi: 10.1007/s12639-019-01151-1
9. Ahmadi NA, Meshkehkar M. An abattoir-based study on the prevalence 30. Borhani M, Fathi S, Lahmar S, Ahmed H, Abdulhameed MF, Fasihi
and economic losses due to cystic echinococcosis in slaughtered Harandi M. Cystic echinococcosis in the Eastern Mediterranean
herbivores in Ahwaz, south-western Iran. J Helminthol. (2011) region: neglected and prevailing! PLoS Negl Trop Dis. (2020)
85:33–9. doi: 10.1017/S0022149X10000234 14:e0008114. doi: 10.1371/[Link].0008114
10. Craig PS, McManus DP, Lightowlers MW, Chabalgoity JA, Garcia HH, 31. Hobbs R, Lymbery A, Thompson R. Rostellar hook morphology of
Gavidia CM, et al. Prevention and control of cystic echinococcosis. Lancet Echinococcus granulosus (Batsch, 1786) from natural and experimental
Infect Dis. (2007) 7:385–94. doi: 10.1016/S1473-3099(07)70134-2 Australian hosts, and its implications for strain recognition. Parasitology.
11. Casulli A. Recognising the substantial burden of neglected pandemics (1990) 101:273–81. doi: 10.1017/S0031182000063332
cystic and alveolar echinococcosis. Lancet Glob Health. (2020) 8:e470– 32. Pednekar RP, Gatne ML, Thompson RC, Traub RJ. Molecular
e1. doi: 10.1016/S2214-109X(20)30066-8 and morphological characterisation of Echinococcus from food
12. Torgerson PR, Deplazes P. Echinococcosis: diagnosis and diagnostic producing animals in India. Vet Parasitol. (2009) 165:58–
interpretation in population studies. Trends Parasitol. (2009) 25:164– 65. doi: 10.1016/[Link].2009.06.021
70. doi: 10.1016/[Link].2008.12.008 33. Gholami S, Irshadullah M, Mobedi I. Rostellar hook morphology
13. Romig T, Omer RA, Zeyhle E, Huttner M, Dinkel A, Siefert L, et al. of larval Echinococcus granulosus isolates from the Indian buffalo
Echinococcosis in sub-Saharan Africa: emerging complexity. Vet Parasitol. and Iranian sheep, cattle and camel. J Helminthol. (2011)
(2011) 181:43–7. doi: 10.1016/[Link].2011.04.022 85:239–45. doi: 10.1017/S0022149X10000520
14. Youssefi MR, Mirshafiei S, Moshfegh Z, Soleymani N, Rahimi MT. Cystic 34. Singh BB, Sharma JK, Tuli A, Sharma R, Bal MS, Aulakh RS, et al. Prevalence
echinococcosis is an occupational disease? J Parasit Dis. (2016) 40:586– and morphological characterisation of Echinococcus granulosus from north
90. doi: 10.1007/s12639-014-0543-2 India. J Parasit Dis. (2014) 38:36–40. doi: 10.1007/s12639-012-0189-x
15. Essa A. Worms and human disease – second edition. J Clin Pathol. (2004) 35. Ahmadi NA. Using morphometry of the larval rostellar hooks to distinguish
57:110–1. doi: 10.1136/jcp.57.1.110-b Iranian strains of Echinococcus granulosus. Ann Trop Med Parasitol. (2004)
16. Tembo W, Emmanue Nonga, H. A survey of the causes of cattle organs and/or 98:211–20. doi: 10.1179/000349804225003217
carcass condemnation, financial losses and magnitude of foetal wastage at 36. Hussain A, Maqbool A, Tanveer A, Anees A. Studies on morphology of
an abattoir in Dodoma, Tanzania. Onderstepoort J Vet Res. (2015) 82:E1– Echinococcus granulosus from different animal-dog origin. Punjab Univ J
7. doi: 10.4102/ojvr.v82i1.855 Zool. (2005) 20:151–7.
17. Jemal D, Kebede B. The study of major parasitic causes of 37. Yildiz K, Gurcan IS. The detection of Echinococcus granulosus strains
organ condemnation and financial losses in cattle slaughtered at using larval rostellar hook morphometry. Türkiye Parazitoloji Dergisi.
Hawassa Municipal Abattoir, Ethiopia. Cogent Food Agric. (2016) (2009) 33:199–202.
2:1201183. doi: 10.1080/23311932.2016.1201183 38. Mustafa I, Shahbaz M, Asif S, Khan MR, Saeed U, Sadiq F, et al. Availability,
18. World health organization (WHO). Echinococcosis fact sheet. (2020). Available cyst characteristics and hook morphology of Echinococcus granulosus isolates
online at: [Link] from livestock (Cattle, Sheep and Goats) in Central Punjab, Pakistan. Kafkas
(accessed July 11, 2020). Univ Vet Fak Derg. (2015) 21:849–54. doi: 10.9775/kvfd.2015.13755
19. Battelli G, Mantovani A, Seimenis A. Cystic echinococcosis and 39. Antoniou M, Tselentis Y. Studies on Echinococcus granulosus using the
the Mediterranean Region: a long-lasting association. Parassitologia. scanning electron microscope. II. The hooks. Parasitol Res. (1993) 79:543–
(2002) 44:43–57. 6. doi: 10.1007/BF00932237
20. Kandeel A, Ahmed ES, Helmy H, El Setouhy M, Craig PS, Ramzy RM. A 40. Elmajdoub L, Rahman W, Wajidi M, Siti-Azizah M. Studies on the
retrospective hospital study of human cystic echinococcosis in Egypt. East protoscoleces and hooks of Echinococcus granulosus from libya by scanning
Mediterr Health J. (2004) 10:349–57. electron microscope. Acta Med Int. (2014) 1:74–81. doi: 10.5530/ami.2014.2.5
21. Capuano F, Rinaldi L, Maurelli MP, Perugini AG, Veneziano V, Garippa G, 41. Khademvatan S, Yousefi E, Rafiei A, Rahdar M, Saki J.
et al. Cystic echinococcosis in water buffaloes: epidemiological survey and Molecular characterization of livestock and human isolates of
molecular evidence of ovine (G1) and buffalo (G3) strains. Vet Parasitol. Echinococcus granulosus from south-west Iran. J Helminthol. (2012)
(2006) 137:262–8. doi: 10.1016/[Link].2006.01.016 87:1–5. doi: 10.1017/S0022149X12000296
22. Cringoli G, Rinaldi L, Musella V, Veneziano V, Maurelli MP, Di Pietro F, et al. 42. Chaya D, Parija SC. Performance of polymerase chain reaction for
Geo-referencing livestock farms as tool for studying cystic echinococcosis the diagnosis of cystic echinococcosis using serum, urine, and cyst
epidemiology in cattle and water buffaloes from southern Italy. Geospat fluid samples. Trop Parasitol. (2014) 4:43–6. doi: 10.4103/2229-5070.1
Health. (2007) 2:105–11. doi: 10.4081/gh.2007.259 29164
23. Grosso G, Gruttadauria S, Biondi A, Marventano S, Mistretta A. Worldwide 43. Moradi M, Meamar AR, Akhlaghi L, Roozbehani M, Razmjou E.
epidemiology of liver hydatidosis including the Mediterranean area. World J Detection and genetic characterization of Echinococcus granulosus
Gastroenterol. (2012) 18:1425–37. doi: 10.3748/wjg.v18.i13.1425 mitochondrial DNA in serum and formalin-fixed paraffin embedded

Frontiers in Veterinary Science | [Link] 10 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

cyst tissue samples of cystic echinococcosis patients. PLoS ONE. (2019) 64. Dyab A, Mohamed G, Abdella O. Seroprevalence of hydatidosis in
14:e0224501. doi: 10.1371/[Link].0224501 camels of Assuit Province, Egypt. Madridge J Vaccines. (2017) 1:5–8.
44. Yousefi E, Rafiei A, Rashidi I, Khademvatan S, Foroutan M. Molecular doi: 10.18689/mjv-1000102
characterization of Echinococcus granulosus in paraffin-embedded 65. Lahmar S, Trifi M, Naceur S, Bouchhima T, Lahouar N, Lamouchi I, et al.
human tissues from Southwest Iran. Asian Pacific J Trop Med. (2019) Cystic echinococcosis in slaughtered domestic ruminants from Tunisia. J
12:507. doi: 10.4103/1995-7645.271290 Helminthol. (2012) 87:1–8. doi: 10.1017/S0022149X12000430
45. Romig T, Ebi D, Wassermann M. Taxonomy and molecular epidemiology 66. Ali A. Some studies on ecto and endoparasites of camels in Assiut Governorate.
of Echinococcus granulosus sensu lato. Vet Parasitol. (2015) 213:76– Assiut: [Link]. of parasitology in Assiut Universitym (2005).
84. doi: 10.1016/[Link].2015.07.035 67. Khalifa R, Abdel-Rahman S, Monib MS, Yones D, Saleh DAS. Characteristics
46. Bowles J, McManus DP. NADH dehydrogenase 1 gene sequences compared of hydatid cyst of camel strain of Echinococcus granulosus in Assiut. El-Minia
for species and strains of the genus Echinococcus. Int J Parasitol. (1993) Med J. (2005) 16:202–14.
23:969–72. doi: 10.1016/0020-7519(93)90065-7 68. Gab-Allah HM, Saba S. Incidence of hydatid cyst in slaughtered animals and
47. Thompson RC. The taxonomy, phylogeny and transmission of Echinococcus. their relation to public health at Sharkia Province Egypt. J Agric Res. (2010)
Exp Parasitol. (2008) 119:439–46. doi: 10.1016/[Link].2008.04.016 88:285–90. doi: 10.21608/ejar.2010.180436
48. Kinkar L, Laurimae T, Sharbatkhori M, Mirhendi H, Kia EB, Ponce-Gordo F, 69. Mahdy O. Epidemiological and molecular characterization of antigens
et al. New mitogenome and nuclear evidence on the phylogeny and taxonomy extracted from Hydatid cysts of camel, cattle and donkeys in Egypt. Int J Basic
of the highly zoonotic tapeworm Echinococcus granulosus sensu stricto. Infect Appl Sci. (2014) 3:93–8. doi: 10.14419/ijbas.v3i2.2127
Genet Evol. (2017) 52:52–8. doi: 10.1016/[Link].2017.04.023 70. Abo-Aziza FAM, Oda SS, Aboelsoued D, Farag TK, Almuzaini
49. Laurimae T, Kinkar L, Moks E, Romig T, Omer RA, Casulli A, et al. AM. Variabilities of hydatidosis in domestic animals slaughtered
Molecular phylogeny based on six nuclear genes suggests that Echinococcus at Cairo and Giza abattoirs, Egypt. Vet World. (2019) 12:998–
granulosus sensu lato genotypes G6/G7 and G8/G10 can be regarded as two 1007. doi: 10.14202/vetworld.2019.998-1007
distinct species. Parasitology. (2018) 145:1929–37. doi: 10.1017/S0031182018 71. Ahmed S. Seroepidemiological studies on hydatid cyst in animals and man.
000719 Ph.D, Assiut, Egypt (2006).
50. McManus DP, Thompson RC. Molecular epidemiology of 72. Abbas I, Al kappany Y, Al-Araby M. Prevalence and molecular
cystic echinococcosis. Parasitology. (2003) 127(Suppl):S37– characterization of hydatid cyst isolates from cattle in Egypt. Asian J
51. doi: 10.1017/S0031182003003524 Anim Vet Adv. (2016) 11:794–804. doi: 10.3923/ajava.2016.794.804
51. Eckert J, Gemmell MA, Meslin FO.-X, Pawlowski ZS, World Health 73. Sanli A, Onen A, Karapolat S, Atinkaya C, Yuncu G, Eyuboglu GM, et al. Social
Organisation "WHO/OIE Manual on Echinococcosis in Humans and Animals: factors associated with pulmonary hydatid cyst in Aegean, Turkey. Afr Health
A Public Health Problem of Global Concern. Eckert J, Gemmell MA, Sci. (2011) 11(Suppl. 1):S82–5. doi: 10.4314/ahs.v11i3.70075
Meslin F-X, Pawłowski ZS, editors. Paris: World Organisation for Animal 74. Otero-Abad B, Torgerson P. A systematic review of the epidemiology of
Health (2001). echinococcosis in domestic and wild animals. PLoS Neglect Trop Dis. (2013)
52. Osman A, Aradaib I, Ashmaig A-L, Gameel A. Detection and differentiation 7:e2249. doi: 10.1371/[Link].0002249
of Echinococcus granulosus-complex using a simple PCR-based assay. Int J 75. Oudni-M’rad M, M’rad S, Babba H. Molecular and epidemiology data on
Trop Med. (2009) 4:24–6. cystic echinococcosis in Tunisia. In: Current Topics in Echinococcosis. Croatia:
53. Himonas C, Antoniadou-Sotiriadou K, Papadopoulos E. Hydatidosis of food Intech publisher (2015). p. 55–74. doi: 10.5772/60891
animals in Greece: prevalence of cysts containing viable protoscoleces. J 76. Gottstein B. Hydatid disease, major tropical syndromes by body system.
Helminthol. (1994) 68:311–3. doi: 10.1017/S0022149X00001541 Systemic infections. Cambridge: Cambridge University Press (2000) 169 p.
54. Dyab KA, Hassanein R, Hussein AA, Metwally SE, Gaad HM. Hydatidosis 77. El-Majdoub L, Drah M. Light microscopy of the hooklets of protoscolices
among man and animals in Assiut and Aswan Governorates. J Egypt Soc of hydatid cysts infecting sheep and camels from misurata, libya and their
Parasitol. (2005) 35:157–66. possible role in ‘parasite strain’recognition. Int J Infect Dis. (2008) 12:e128–
55. Mahmoud LH, el-Garhy MF. A histochemical study on the hydatid cyst and 9. doi: 10.1016/[Link].2008.05.320
electron microscopy of the hydatid sand of Echinococcus granulosus. J Egypt 78. Zewdu E, Teshome T, Makwoya A. Bovine hydatidosis in ambo municipality
Soc Parasitol. (2002) 32:647–56. abattoir, West Shoa, Ethiopia. Ethiop Vet J. (2010) 14:1–14.
56. Antoniou M, Tselentis Y. Studies on Echinococcus granulosus using the 79. Mulatu M, Mekonnen B, Tassew H, Kumar A. Bovine hydatidosis
scanning electron microscope. I. preparations of the parasite for infection of in eastern part of Ethiopia. Momona Ethiop J Sci. (2013) 5:107–
the final host. Parasitol Res. (1993) 79:537–42. doi: 10.1007/BF00932236 14. doi: 10.4314/mejs.v5i1.85334
57. Bowles J, Blair D, McManus DP. A molecular phylogeny 80. Ibrahim K, Thomas R, Peter K, Omer RA. A molecular survey on cystic
of the genus Echinococcus. Parasitology. (1995) 110:317– echinococcosis in Sinnar area, Blue Nile state (Sudan). Chin Med J.
28. doi: 10.1017/S0031182000080902 (2011) 124:2829–33. doi: 10.3760/[Link].0366-6999.2011.18.006
58. Hansh W, Awad A. Genotyping study of hydatid cyst by sequences of ITS1 81. Himonas C, Frydas S, Antoniadol-Sotiriadou K. The fertility of hydatid cysts
– rDNA in Thi-Qar – Southern of Iraq. Int J Curr Microbiol Appl Sci. (2016) in food animals in Greece. In: Helminth Zoonoses. Dordrecht: Springer (1987).
5:350–61. doi: 10.20546/ijcmas.2016.508.037 p. 12–21. doi: 10.1007/978-94-009-3341-5_2
59. Gasser RB, Chilton NB. Characterisation of taeniid cestode species 82. Haleem S, Niaz S, Qureshi NA, Ullah R, Alsaid MS, Alqahtani AS, et al.
by PCR-RFLP of ITS2 ribosomal DNA. Acta Trop. (1995) 59:31– Incidence, risk factors, and epidemiology of cystic echinococcosis: a complex
40. doi: 10.1016/0001-706X(94)00085-F socioecological emerging infectious disease in Khyber Pakhtunkhwa, Province
60. Bowles J, Blair D, McManus DP. A molecular phylogeny of of Pakistan. Biomed Res Int. (2018) 2018:5042430. doi: 10.1155/2018/5042430
the human schistosomes. Mol Phylogenet Evol. (1995) 4:103– 83. Guduro GG, Desta AH. Cyst, viability, and economic significance
9. doi: 10.1006/mpev.1995.1011 of hydatidosis in Southern, Ethiopia. J Parasitol Res. (2019)
61. White BA. PCR Protocols : Current Methods and Applications. Totowa, NJ: 2019:2038628. doi: 10.1155/2019/2038628
Humana Press (1993). doi: 10.1385/0896032442 84. Parija S. Medical Parasitolgy, Protozology and Helminthology. Text and Atlas
62. Gholami S, Sosari M, Fakhar M, Sharif M, Daryani A, Hashemi M, et al. 2nd Ed. India Ichennia Medical Books Publisher (2004). p. 221–9.
Molecular characterization of Echinococcus granulosus from hydatid cysts 85. Taghavi M, Mirzaei M, Fartashvand M. An abattoir survey of liver and lung
isolated from human and animals in golestan province, North of Iran. Iran hydatidosis in Northwest Iran. J Nov Appl Sci. (2013) 2: 710–2.
J Parasitol. (2012) 7:8–16. 86. Rinaldi L, Maurelli M, Veneziano V, Capuano F, Perugini A, Cringoli
63. Ghada M, Osama H. Seroprevalence of hydatidosis in S. The role of cattle in the epidemiology of Echinococcus granulosus
camels of Assuit Province, Egypt. Madridge J Vaccine. (2017) in an endemic area of southern Italy. Parasitol Res. (2008) 103:175–
1:1–4. 9. doi: 10.1007/s00436-008-0948-x

Frontiers in Veterinary Science | [Link] 11 October 2021 | Volume 8 | Article 750640


Gareh et al. Cystic Echinococcosis in Upper Egypt

87. Saleh MA, Mahran OM, Al-Salahy MB. Circulating oxidative stress status in 94. Khalifa N, Khater H, Fahmy H, Radwan MEI, Jsa A. Genotyping
dromedary camels infested with sarcoptic mange. Vet Res Commun. (2011) and phylogenetic analysis of cystic echinococcosis isolated from
35:35–45. doi: 10.1007/s11259-010-9450-x camels and humans in Egypt. Am J Epidemiol Infect Dis. (2014)
88. Fathi S, Dehaghi MM, Radfar MH. Occurrence of hydatidosis in camels 2:74–82. doi: 10.12691/ajeid-2-3-2
(Camelus dromedarius) and their potential role in the epidemiology of 95. Mandal S, Mandal MD. Human cystic echinococcosis: epidemiologic,
Echinococcus granulosus in Kerman area, southeast of Iran. Compar Clin zoonotic, clinical, diagnostic and therapeutic aspects. Asian Pac J Trop Med.
Pathol. (2012) 21:921–7. doi: 10.1007/s00580-011-1200-0 (2012) 5:253–60. doi: 10.1016/S1995-7645(12)60035-2
89. Owen G. Purchasing an electron microscope?–Considerations and scientific
strategies to help in the decision making process. Microscopy Vancouver, BC Conflict of Interest: The authors declare that the research was conducted in the
(2018). absence of any commercial or financial relationships that could be construed as a
90. Hasan HF, Fadhil MH, Fadhil ZH. Molecular characterization of Echinococcus potential conflict of interest.
granulosus isolated from 703 human and domestic animals in Kirkuk, Iraq.
Anim Res Int. (2016) 13:2544–7. Publisher’s Note: All claims expressed in this article are solely those of the authors
91. Karine B, Piarroux R, Dia M, Schneegans F, Beurdeley A, Godot V, et al. and do not necessarily represent those of their affiliated organizations, or those of
Combined eco-epidemiological and molecular biology approaches to assess
the publisher, the editors and the reviewers. Any product that may be evaluated in
Echinococcus granulosus transmission to humans in Mauritania: Occurence
this article, or claim that may be made by its manufacturer, is not guaranteed or
of the ’camel’ strain and human cystic echinococcosis. Trans R Soc Trop Med
Hygiene. (2002) 96:383–6. doi: 10.1016/S0035-9203(02)90369-X endorsed by the publisher.
92. M’Rad S, Filisetti D, Oudni-M’rad M, Mekki M, Belguith M, Nouri A, et al.
Molecular evidence of ovine (G1) and camel (G6) strains of Echinococcus Copyright © 2021 Gareh, Saleh, Moustafa, Tahoun, Baty, Khalifa, Dyab, Yones,
granulosus in Tunisia and putative role of cattle in human contamination. Vet Arafa, Abdelaziz, El-Gohary and Elmahallawy. This is an open-access article
Parasitol. (2005) 129:267–72. doi: 10.1016/[Link].2005.02.006 distributed under the terms of the Creative Commons Attribution License (CC BY).
93. Maillard S, Benchikh-Elfegoun M, Knapp J, Bart J.-M, Koskei P, et al. The use, distribution or reproduction in other forums is permitted, provided the
Taxonomic position and geographical distribution of the common sheep original author(s) and the copyright owner(s) are credited and that the original
G1 and camel G6 strains of Echinococcus granulosus in three African publication in this journal is cited, in accordance with accepted academic practice.
countries. Parasitol Res. (2007) 100:495–503. doi: 10.1007/s00436-006- No use, distribution or reproduction is permitted which does not comply with these
0286-9 terms.

Frontiers in Veterinary Science | [Link] 12 October 2021 | Volume 8 | Article 750640

Common questions

Powered by AI

The study explains the correlation between cyst fertility and host species by emphasizing the varying prevalence of fertile cysts in camels and cattle. In camels, 66.7% of the hydatid cysts were fertile with a higher viability rate (75% of fertile cysts), indicating camels as suitable hosts for supporting fertile cysts. In cattle, although 60% of cysts were fertile, the viability rate was slightly lower (66.7%). This suggests that differences in host species physiology and immune response may impact the fertility rate of cysts and their viability, influencing the potential for transmission and disease progression .

Several potential factors influencing the transmission dynamics of cystic echinococcosis include hygienic practices, climatic conditions, and geographic location of slaughter operations. Differences in CE rates across regions, such as lower rates in Upper Egypt, highlight how localized factors like environmental management and sanitation can significantly affect transmission . Furthermore, variables like age, sex, and cyst viability in host animals influence disease persistence and spread . By synthesizing data on these influences, it is evident that integrating local environmental management with veterinary and public health practices is crucial for managing CE transmission effectively .

The study noted that the morphological characteristics of hydatid cysts, such as the presence of fertile, sterile, and calcified types, significantly influence diagnosis and treatment options. Fertile cysts are more clinically significant due to their potential to spread protoscoleces, indicating active infections that require careful intervention. The study highlighted considerable fertility in camels (66.7%) and cattle (60%). Understanding these morphological features aids in identifying viable infections needing treatment and assessing the risk of transmission . These attributes emphasize the importance of detailed morphological assessment in effective disease management and control strategies .

In camels, hydatid cysts were detected in 6% of examined lungs, with no cysts in the liver. Cysts were more common in camels older than 5 years, occurring in 10% of older camels versus 3.33% in younger ones. In contrast, hydatid cysts in cattle were found in 0.87% of examined animals, primarily in the lungs (0.7%) and rarely in the liver (0.17%). Female cattle older than 5 years had a 2.6% occurrence rate, while younger males had no detected cysts. In camels, 66.7% of the cysts were fertile, and 75% of fertile cysts were viable. Cattle had 60% fertile cysts with 66.7% viability of fertile cysts .

Differences in hook morphology of hydatid cysts, such as total hook length and widths, contribute to the broader understanding of Echinococcus granulosus taxonomy and epidemiology by enabling precise species and strain identification. The study illustrated distinct morphometric diversity in the hooks from camels and cattle, offering insights into zoonotic compatibility and host-specific adaptations . For example, longer hooks in camels (34 µm) compared to cattle (28 µm) suggest possible evolutionary adaptations to specific hosts . This morphological data supports classification and epidemiological tracking, aiding in effective disease control and prevention strategies .

The age factor significantly influences the occurrence of hydatid cysts in both camels and cattle. In camels, those older than 5 years had a higher rate of cysts (10%) compared to younger ones (3.33%). In cattle, hydatid cysts were more prevalent in females older than 5 years (2.6%), with no cysts found in younger male cattle . Sex also played a role: In camels, only males exhibited cysts (6.7%), while females showed none .

Geographical and environmental factors significantly impact cystic echinococcosis prevalence. Differing rates in various Egyptian regions highlight this impact, with much lower occurrences in Upper Egypt compared to Cairo and other areas. This discrepancy may be due to varying hygienic practices during slaughter, climatic conditions, and local ecological settings . Additionally, the allowance for stray dog access to slaughterhouses and unauthorized slaughters contribute to CE transmission variability . These factors collectively affect the environmental risk and control measures' effectiveness, influencing the disease's prevalence .

The study highlights the significance of the type and number of cysts in informing disease complexity and management by showing that multiple cysts may indicate higher disease burden and potential for transmission. In camels, equal distribution of single and multiple cyst occurrences was noted, while cattle primarily showcased single cysts (80%). This distribution affects management strategies, as multiple cysts could require more comprehensive treatment approaches and stricter monitoring . Understanding cyst type and count helps anticipate disease dynamics and tailor management practices, especially in surveillance and intervention planning .

Hydatid cyst viability data are crucial for understanding regional differences in cystic echinococcosis outcomes as they reflect the potential for disease transmission and persistence. In the study, a higher proportion of viable cysts in camels (75%) compared to cattle (66.7%) indicates that camels might act as more effective reservoirs of infection in certain regions . Regional differences in viable cysts could inform local transmission dynamics, with areas showing higher viability rates possibly facing greater challenges in managing and reducing the spread of echinococcosis. Understanding these differences helps tailor regional public health strategies and focuses on targeted interventions based on local viability data .

The varying detection rates of hydatid cysts across regions can be attributed to differences in slaughter practices, detection methods, and sample sizes, among other factors. For example, more thorough detection methods or varying sample sizes can alter prevalence figures. The rates were higher in Cairo compared to Upper Egypt, likely due to better detection practices or environmental differences. Additionally, factors like the age and sex of animals affect occurrence rates, as seen with higher prevalence in older and female animals . This highlights the significance of consistent detection methods and controlled environments in obtaining accurate data .

You might also like