0% found this document useful (0 votes)
6 views8 pages

Metitepine: A 5-HT2A Antagonist for Appetite Control

Uploaded by

sshrndbt
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
6 views8 pages

Metitepine: A 5-HT2A Antagonist for Appetite Control

Uploaded by

sshrndbt
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

OPEN Small molecule drug screening in

SUBJECT AREAS:
Drosophila identifies the 5HT2A receptor
FEEDING BEHAVIOUR
PHENOTYPIC SCREENING
as a feeding modulation target
BEHAVIOURAL GENETICS
Gabriel Gasque1, Stephen Conway1, Juan Huang2, Yi Rao3 & Leslie B. Vosshall1,4
RNAI

1
The Rockefeller University, 1230 York Avenue, Box 63, New York, NY 10065, U.S.A, 2School of Basic Medical Sciences, Nanjing
Received Medical University, Nanjing 210029, People’s Republic of China, 3Peking-Tsinghua Center for Life Sciences at Peking University
3 June 2013 School of Life Sciences, Yiheyuan Road, Beijing 100871, People’s Republic of China, 4Howard Hughes Medical Institute.

Accepted
14 June 2013
Dysregulation of eating behavior can lead to obesity, which affects 10% of the adult population worldwide
Published and accounts for nearly 3 million deaths every year. Despite this burden on society, we currently lack
2 July 2013 effective pharmacological treatment options to regulate appetite. We used Drosophila melanogaster larvae
to develop a high-throughput whole organism screen for drugs that modulate food intake. In a screen of
3630 small molecules, we identified the serotonin (5-hydroxytryptamine or 5-HT) receptor antagonist
metitepine as a potent anorectic drug. Using cell-based assays we show that metitepine is an antagonist of all
Correspondence and five Drosophila 5-HT receptors. We screened fly mutants for each of these receptors and found that
requests for materials serotonin receptor 5-HT2A is the sole molecular target for feeding inhibition by metitepine. These results
should be addressed to highlight the conservation of molecular mechanisms controlling appetite and provide a method for
L.B.V. (Leslie. unbiased whole-organism drug screens to identify novel drugs and molecular pathways modulating food
Vosshall@rockefeller. intake.
edu)

A
bout 1 in every 10 adults worldwide is overweight or obese1 and obesity is a risk factor for morbidity and
mortality from cardiovascular diseases, diabetes, certain cancers, and musculoskeletal disorders. Despite
strong interest in research addressing obesity, safe and effective pharmacological options for the preven-
tion and treatment of this condition remain elusive2,3. Currently, most drug-discovery efforts are based on in vitro
assays with candidate targets, but in vitro assays do not reconstitute the complexity of whole organisms. This is
particularly relevant for drugs modulating feeding behavior and metabolic homeostasis, since both arise from
complex interactions within and between the central nervous system, the digestive tract, and fat-storage organs4–6,
which cannot be modeled in vitro.
An alternative to in vitro-based screens is phenotype-based whole organism screens7–10. Whole organism drug
screens provide several advantages over in vitro assays. Active drugs are by definition bio-available and potential
toxicity can be evaluated at early project stages. Further, an effective drug need not act through a well-validated
target, but can have novel or complex mechanisms of action. However, whole organism drugs screens can be
costly and time-consuming. These disadvantages can be partially overcome by using model organisms that can be
raised cost-effectively in large quantities, like the vinegar fly Drosophila melanogaster. Flies and vertebrates share
many metabolic functions, molecular machinery, and analogous organ systems that control nutrient uptake,
storage, and metabolism11–15. Like humans, flies regulate circulating sugar levels according to food availability,
and store excess energy in the form of glycogen and lipids. These reserves are mobilized during periods of energy
consumption12,16,17. As seen in many animals, fasted flies increase food foraging and intake18. Two master
metabolic regulators in vertebrates, insulin and leptin, have functional homologues in the fly13,14. In addition,
an unbalanced diet can trigger a type-2 diabetes-like insulin resistance and obesity phenotypes in the fly19.
Here we report the development of a high-throughput drug-screen for Drosophila larval feeding. We identify
the serotonin (5-hydroxytryptamine or 5-HT) receptor antagonist metitepine as a potent anorectic drug and
show that all five fly 5-HT receptors are inhibited by this drug. Despite its broad spectrum antagonism of
Drosophila 5-HT receptors, metitepine requires only receptor 5-HT2A for its in vivo anti-feeding activity. Our
results highlight the potential of Drosophila as a tool for pharmacological study of feeding behavior and provide a
powerful method for drug discovery and target identification.

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 1


[Link]/scientificreports

We next tested a known feeding mutant in our assay by com-


a 0 2 Time (hrs) 19 21 22 paring the fluorescent signal accumulated in three different wild-
Liquid Fluorescence
Liquid food + reading
type strains (w1118, Canton-S, and Oregon-R) and a klumpfuss09036
Load food fluorescein Wash mutant (klu, ref. 20). klu encodes a transcription factor necessary
for proper expression of the neuropeptide hugin, whose activity is
required for normal feeding behavior in Drosophila20. All three
wild-type strains ingested significantly more than the feeding
mutant (Fig. 1e). In addition, we confirmed previous reports21
b that high concentrations of dietary amino acids suppressed food
intake (Fig. 1f).

Drug screen for modulators of food intake. After validating our


c d e f feeding assay, we screened for small molecules that modulated food
40 *** a a a b a a b intake. In a pilot screen of 415 compounds tested individually at
% Relative F (well)

20 mg/ml, we identified one compound, cycloheximide, which


0 *** inhibited feeding (data not shown). This established a hit rate of
0.24%. To improve the throughput of the subsequent primary
-40
screen, we used pools of 3 to 4 compounds per well (see Methods
for details).
3630 small molecules were tested in the primary screen (Fig. 2a).
-80
The compounds were obtained primarily from annotated chemical
25oC 4oC -yeast w1118 CS OR klu +Ala +Lys
libraries, such that each compound had at least one known cellular
Liquid food Liquid food target (see Methods for details). The average signal of all the drug-
treated wells was less than 3% different from the average of solvent-
Figure 1 | A high-throughput assay to monitor Drosophila larval feeding. treated wells, indicating that the drugs did not cause generalized
(a) Assay schematic. (b) Representative picture of the bottom of a single toxicity (Fig. 2b). 279 and 114 compounds were identified as can-
well of a 96-well plate with larvae treated as in (a). Scale bars: 250 mm. didate anorectic (feeding suppressant) and orexigenic (feeding
(c) Relative fluorescence of larvae incubated at either 25uC or 4uC during stimulant) drugs, respectively, by the criterion that they differed from
the fluorescein feeding stage (n 5 32). Fluorescence normalized to 25uC. solvent controls by more than one standard deviation (Fig. 2a). The
Data were compared using Mann Whitney test. (d) Relative fluorescence of anorectic compounds caused an average decrease in fluorescent sig-
larvae that were pre-fed either complete liquid food or liquid food lacking nal of 27%, while the orexigenic compounds caused an average
yeast extract overnight (n 5 16). Fluorescence plotted relative to animals increase of 18% (Fig. 2b).
fed liquid food. Data were compared using t test. (e) Relative fluorescence The 393 candidate small molecules were re-tested individually in
of larvae of different genotypes: w1118, Canton-S (CS), Oregon-R (OR), the secondary screen (Fig. 2a). Of the anorectic and orexigenic can-
klumpfuss09036 (klu) (n 5 22–24). Fluorescence plotted relative to w1118. didates, 32 and 10 compounds, respectively, were reconfirmed as
(f) Relative fluorescence of larvae that were fed liquid food or liquid food hits, defined as differing from solvent controls by more than one
supplemented with 400 mM alanine or lysine. Fluorescence plotted standard deviation (Fig. 2a, c, d, Supplementary Table 1). We
relative to liquid food (n 5 12). In (e–f), data was compared with Kruskal- searched for reported molecular targets for each of the 42 hits of
Wallis test, followed by Dunn’s test. In (c–f), error bars indicate s.e.m. In the secondary screen using a drug-discovery database (https://
(c–d) *** p , 0.001. Significant differences are labeled with different [Link]/). Two known insect anti-feedants,
letters in (e–f). gedunin and plumbagin22,23, were among these compounds
(Fig. 2d), confirming the efficacy of our screen. We chose 14 com-
pounds for verification of a dose-response curve (Supplementary
Results Table 1), based on their annotation as drugs that target neuromodu-
lators, cell signaling, and/or neuronal activity. From these, only meti-
High-throughput feeding assay for Drosophila larvae. To screen
tepine, a non-selective antagonist of 5-HT receptors, and reserpine,
for drugs that modify food intake in whole animals, we developed a
an inhibitor of the vesicular mono-amine transporter (VMAT),
high-throughput assay that allowed us to monitor ingestion of
showed reliable dose-dependent responses and were selected for
fluorescent liquid food by Drosophila first instar larvae in 96-well
further characterization. Reserpine was subsequently discarded
plates read by a plate reader (Fig. 1a). Larvae were dispensed into
because it dramatically reduced larval locomotion at concentrations
plates and fed liquid food consisting of sugar and yeast extract and as low as 10 mM (data not shown). In light of these results, we con-
supplemented with fluorescein for visualization. After washing cluded that the effects of reserpine on feeding were secondary to a
uningested fluorescent food from the wells, we quantified the general effect on locomotion and muscular tone, as confirmed by the
fluorescein ingested by the larvae that was visible in the digestive sluggish phenotype of the dVMAT mutant larvae24.
tract (Fig. 1b). Metitepine decreased food accumulation by more than one stand-
To evaluate the dynamic range of our assay, we carried out control ard deviation when tested in combination with other drugs, during
experiments to either decrease or increase food intake in the larvae. the primary screen (Fig. 2e, f), or alone, in the secondary screen
When the animals were cold-paralyzed while feeding on fluorescent (Fig. 2g). Dose-response experiments indicated that the threshold
food, ingestion was reduced (Fig. 1c). When larvae were selectively concentration for metitepine efficacy was 10 mM, with increasing
fasted for protein by removing yeast extract from the liquid food effects at 50 and 100 mM (Fig. 2h).
before being exposed to fluorescent food, they showed a post-fasting
rebound in which they ingested more standard liquid food than Metitepine decreases feeding persistently, reversibly, and speci-
control animals continuously fed standard liquid food (Fig. 1d). fically. To ask if metitepine decreases larval feeding on conven-
The dynamic range of feeding suppression was more than two times tional fly food, we tested the effect of the drug on larvae fed a
greater than feeding enhancement in these experiments, perhaps standard laboratory cornmeal-agar-molasses diet supplemented
because larvae are continual feeders and may be ingesting at a near with the dye bromophenol blue. We quantified the amount of food
maximal rate during basal conditions20. ingested by measuring the optical density (O.D.) of the gut in

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 2


[Link]/scientificreports

a 3630 b primary screen


30 individual larvae. Larvae treated with the drug accumulated less solid

% Relative F
Solvent food in their digestive tract as reflected by a lower O.D. (Fig. 3a). The

(well)
primary All compounds effect of metitepine on solid food accumulation was dose-dependent
0
screen Anorectic (Fig. 3b) with a threshold efficacy dose of 50 mM.
Orexigenic To rule out the possibility that metitepine was causing a general
-30
279 114 locomotor defect in larvae, we measured their crawling speed when
secondary c secondary screen fed solvent or metitepine. Metitepine-treated animals crawled at the
screen 40 Orexigenic same speed as solvent treated controls (Fig. 3c).

% Relative F
0 Food accumulation in the digestive tract is a function of both

(well)
32 10 ingestion and excretion. To establish a direct link between metitepine
-40
Anorectic Orexigenic treatment and food intake, we measured mouth-hook contraction
-80 rates of larvae that were treated with either solvent or 100 mM meti-
tepine. Mouth-hook contraction is the motor behavior associated
% Relative F (well)

d secondary screen
40 with food intake in larvae. Animals treated with the drug displayed
0 decreased mouth-hook contraction rates, confirming that metitepine
had a direct effect on food intake (Fig. 3d). Notably, since mouth-
-40 Plumbagin
Metitepine Anorectic hook contractions were measured after drug treatment (see
-80 Gedunin Methods), this result also suggests that metitepine is not required
to be present in food to induce a decrease in ingestion.
50 50 To further explore the time course of metitepine action on feeding
e f behavior, we measured food intake at various time points after meti-
% Relative F (well)

% Relative F (well)

tepine treatment. When tested immediately after exposure, drug-


treated larvae showed reduced food accumulation (Fig. 3e, 0-h
0
* 0
* recovery). The anorectic effect of metitepine lasted for 2 hours but
was not evident 4 hours after treatment (Fig. 3e). At 24 hours after
treatment, metitepine-treated larvae ate significantly more, suggest-
ing that larvae were rebounding from drug-induced fasting (Fig. 3e).

-50 -50
Solvent Tapride Solvent Solvent Metitepine is a non-selective antagonist of Drosophila 5-HT
Brefeldin A Spectinomycin receptors. Metitepine is a broad spectrum antagonist of vertebrate
S-(-)-Eticlopride Prazosin 5-HT receptors. To investigate the pharmacology of this drug on
Metitepine Metitepine Drosophila 5-HT receptors, we expressed each in mammalian
50 10 tissue culture cells and carried out calcium imaging experiments.
g h Four 5-HT receptors have been previously identified and cloned:
% Relative F (well)
% Relative F (well)

5-HT1A and 5-HT1B (ref. 25), 5-HT2 (ref. 26), and 5-HT7 (ref.
0
* 27). Of these, 5-HT1A, 5-HT1B, and 5-HT7 were previously
0
* -10
*** expressed in heterologous systems, shown to respond to 5-HT, and
to activate different intracellular effector systems25,27,28. In binding-
*** competition assays 5-HT2 was shown to bind to both 5-HT and
-20 metitepine26. A fifth putative receptor (CG42796) was annotated as
a 5-HT receptor based on homology29. We cloned CG42796 and
-50 -30 0 1 10 50 100
propose that it be named 5-HT2B, since its closest homologue is 5-
Solvent Metitepine [Metitepine] (µM) HT2 (ref. 29). We suggest that the gene formerly known as 5-HT2 be
Figure 2 | A small molecule screen identifies metitepine as a feeding denoted as 5-HT2A. This revised nomenclature for 5-HT2A and 5-
suppressant. (a) Diagram of the drug screen. (b) Fluorescence, plotted HT2B is used throughout the manuscript.
relative to solvent-treated wells, of all compounds tested in the primary We expressed all five 5-HT receptors in HEK-293T cells and
screen (black), anorectic compounds (cyan), and orexigenic compounds monitored their activity by measuring intracellular calcium concen-
(green). The gray shaded area indicates the standard deviation of all wells trations. All of the receptors induced a dose-dependent response to
treated only with solvent. (c, d) Average fluorescence of primary screen 5-HT (Fig. 4a). From the dose-responses curves of each receptor we
orexigenic (c) or anorectic (d) compounds tested in the secondary screen calculated a half effective concentration (EC50, Fig. 4b). The most
plotted relative to the solvent-treated wells. Individual compounds are sensitive receptor was 5-HT7 (EC50 5 12 nM) and the least sensitive
indicated as green (c) or cyan (d) dots and the gray shaded area indicates receptor was 5-HT1A (EC50 5 1 mM). We next established stimulus
the standard deviation of all wells treated only with solvent. In (d) three conditions in which we applied two pulses of 5-HT without desens-
anorectic compounds are highlighted by circles. (e, f) Relative fluorescence itizing any of the receptors (Fig. 4c). Under these conditions, 100 mM
accumulation in wells treated with the mixtures of four (e) or three metitepine dramatically suppressed or completely abolished res-
(f) compounds including metitepine during the primary screen, plotted ponses to 5-HT in all 5-HT receptors (Fig. 4d). Control experiments
relative to their solvent control wells. Each dot is the signal from a single confirmed that metitepine did not kill the cells because ATP, a ligand
well, horizontal lines are mean 6 s.e.m. (e–g). (g) Fluorescence for endogenous purinergic receptors, activated all cells after metite-
accumulation in solvent or metitepine treated wells during the secondary pine treatment (Fig. 4d). Metitepine had an effective inhibitory con-
screening. (h) Dose-response effects of metitepine. Y-axis shows relative centration (IC50) in the mM range, ranging from 2 mM for 5-HT2B to
accumulated fluorescence (n 5 31 for solvent; n 5 15–16 for all 58 mM for 5-HT1B (Fig. 4e). These pharmacological experiments
concentrations of metitepine); mean 6 s.e.m. is plotted. In (e–g) data were confirmed that all five candidate 5-HT receptors in the Drosophila
compared with Mann Whitney test. In (h) ANOVA followed by Dunnett’s genome respond to serotonin. However, since they all showed sens-
test was used. * p , 0.5, *** p , 0.001 compared to solvent-treated itivity to metitepine, further genetic experiments were required to
controls. identify the molecular target of the anorectic drug in vivo.

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 3


[Link]/scientificreports

a b render larvae resistant to the drug. We generated or obtained null


10 mutants for each one of the five Drosophila 5-HT receptors and asked

% Relative O.D. (gut)


1.4 if they were sensitive to the anorectic effects of 100 mM metitepine.
0 All mutants except 5-HT2AGal4 were sensitive to metitepine and
showed a decrease in feeding similar to that seen in wild-type

O.D.
-10 strains (Fig. 5a). In contrast, 5-HT2A receptor mutants were
*** resistant to the effects of this drug.
-20 *** To confirm this observation, we tested additional 5-HT2A mutant
0.0 alleles. 5-HT2Ae01363 and 5-HT2APL00052 are different pBac transposon
0 100 -30 0 1 10 50 100 insertions in the 5-HT2A locus. We tested each as homozygous
[Metitepine] (µM) [Metitepine] (µM) insertions and in heteroallelic combinations with the original 5-
c d HT2AGal4 mutant.
***
Mouth-hook contractions/min
0.15 140 5-HT2Ae01363 (5-HT2Ae in Fig. 5b) interferes with proper splicing
Crawling speed (mm/s)

of the transcript, but is not a null30. Consistent with this, 5-HT2Ae was
sensitive to the effects of metitepine when tested as a homozygote
0.10 120 (Fig. 5b). However, when 5-HT2Ae was tested in combination with
the original 5-HT2AGal4, the heteroallelic mutant combination 5-
HT2AGal4/e was insensitive to metitepine (Fig. 5b).
0.05 100 5-HT2APL00052 (5-HT2APL in Fig. 5b) has dramatically reduced
levels of 5-HT2A mRNA31. Both 5-HT2APL homozygous mutants
and the heteroallelic mutant combination 5-HT2AGal4/PL were insens-
0.00 80 itive to metitepine (Fig. 5b). Heterozygous 5-HT2AGal4 larvae showed
0 100 0 100
[Metitepine] (µM) [Metitepine] (µM) normal sensitivity to the drug (Fig. 5b).
e If metitepine suppresses feeding by blocking the activation of 5-
Recovery (0-24 hr)
HT2A, mutating the gene should result in larvae that eat less. Indeed,
5-HT2AGal4/e mutants ate less than wild-type larvae (Fig. 6a).
To further confirm the role of 5-HT2A in larval feeding behavior,
we knocked down 5-HT2A by conditional expression of a 5-HT2A
0 2 Time (hrs) 19
RNAi with a pan-neuronal GeneSwitch system32. Larvae in which
Load Liquid Liquid Wash Image
food + food + neuronal expression of 5-HT2A-RNAi was induced ate less than
metitepine fluorescein larvae in which the RNAi was not induced or in control larvae in
which GFP was induced (Fig. 6b). Thus, genetic knock-down of 5-
Recovery (h): 0 2 4 24 HT2A in a time frame similar to the action of metitepine was suf-
ficient to phenocopy the drug-induced feeding phenotype.
40
*
% Relative F (gut)

0 *** *** Discussion


Serotonin is involved in regulating appetite, food intake, and meta-
bolic homeostasis in organisms ranging from C. elegans to humans.
-40 In C. elegans, serotonin activates overall feeding by activating two
separate neural pathways that respectively control pharyngeal
pumping and isthmus peristalsis33. In Drosophila, serotonin has been
-80 shown to play a trophic role during embryonic development in the
0 100 0 100 0 100 0 100
establishment of neuronal innervation to the gut34. In adult female
[Metitepine] (µM) flies, serotonin controls the postmating dietary switch to protein-rich
food35. We show here that the 5-HT receptor antagonist metitepine
Figure 3 | Metitepine decreases food ingestion persistently but reversibly. reduces food intake in Drosophila larvae and that the drug acts selec-
(a) Representative pseudo-color pictures of larvae fed either solvent or tively through the 5-HT2A receptor.
100 mM metitepine in solid food with bromophenol blue. In each pair of
Interestingly, metitepine was previously identified in a different
images, the left is a whole larva and the right is the gut region quantified in
small molecule screen as a compound that extends lifespan in C.
MetaMorph. Scale bar: 250 mm. (b) Dose-response effects of metitepine in
elegans8. There is a known connection between dietary restriction
solid food with bromophenol blue. Y-axis shows relative optical density of
and lifespan across several organism including primates36. We have
gut-region (n 5 60 for solvent; n 5 28–38 for metitepine). Data were
not tested the effect of metitepine on Drosophila lifespan, but this
compared using ANOVA followed by Dunnett’s test. (c) Crawling speed
would be of interest in future studies on this drug.
on an agar surface of larvae treated with either solvent or 100 mM
In mammals, the role of serotonin in controlling appetite and
metitepine (n 5 18–20). (d) Mouth-hook contraction rate in yeast-
body-weight is complex37. It appears that the level of brain serotonin
suspension of larvae treated with either solvent or 100 mM metitepine (n 5
signaling has an inverse relationship with food intake: when brain
58 and 38, respectively). t test was used for comparison. (e) Time course of
serotonin signaling is increased, food intake is reduced, and vice
recovery after metitepine treatment. The upper diagram shows a schematic
versa. For example, serotonin re-uptake inhibitors reduce food
of the experiment. Y-axis shows relative fluorescence (0 h: n 5 42 and n 5
intake2,37. Part of the complexity of the serotonin system that controls
30; 2 h: n 5 47 and n 5 42; 4 h: n 5 43 and n 5 45; 24 h: n 5 49 and n 5 56;
metabolic homeostasis in mammals might arise from the fact mam-
for solvent and metitepine, respectively). Mann-Whitney test was used for
mals have 14 5-HT receptor subtypes. This raises the possibility of
comparisons. * p , 0.5, *** p , 0.001 compared to solvent-treated
serotonin having divergent effects on food intake and body weight
controls. In all graphs, error bars are s.e.m.
depending on the receptor subtype activated. Drosophila, with only
5-HT2A is required for the anorectic actions of metitepine and for five receptor subtypes, offers a simplified model in which to study the
normal feeding behavior. We reasoned that if metitepine were core mechanisms by which serotonin regulates food intake and coor-
acting through a specific 5-HT receptor, mutating that gene would dinates metabolic homeostasis.

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 4


[Link]/scientificreports

a 5-HT1A 5-HT1B 5-HT2A 5-HT2B 5-HT7 b EC50


5-HT 0.75 1.0 2.5 0.25 0.5 5.0 62.5125250 0.1 0.25 2.5 20 50100 5-HT1A 1 µM
nM µM 1.5
5-HT1B 625 nM
5-HT2A 99 nM
5-HT2B 293 nM
0.5 ΔF/ΔF0

1.0 5-HT7 12 nM

ΔF/ΔFmax
200ms 0.5

5-HT 1 650 100 300 20 0.0


c -9 -8 -7 -6 -5 -4
nM µM
-0.5 log [5-HT] (M)

e 1.5 IC50
Solvent 5-HT1A 27 µM
5-HT1B 58 µM
1.0
5-HT2A 44 µM
5-HT2B 2 µM

ΔF/ΔF0
d 5-HT 1 650 100 300 20
0.5 5-HT7 9 µM
nM µM
ATP
50µM 0.0
-8 -7 -6 -5 -4 -3
-0.5 log [Metitepine] (M)
Metitepine
100µM

Figure 4 | Metitepine is an antagonist of all known Drosophila 5-HT receptors. (a) Traces show calcium responses for each receptor to increasing
concentration of 5-HT (red arrow: mM; orange arrow: nM). All traces are average responses in black (6 s.e.m. in gray) of 10–12 simultaneously recorded
cells. (b) Dose-response curves were obtained normalizing the peak response at each concentration of 5-HT to the maximal response in that cell (DF/
DFMAX). n 5 3–6 plates, 10–12 cells each. (c) Traces of cells after treatment with serotonin and then solvent. (d) Traces of cells after treatment with
serotonin and then 100 mM metitepine. (e) Inhibitory dose-response curves of metitepine. In b and e, error bars are s.e.m.

Here we established that Drosophila larvae can be used to screen Liquid food feeding assay. Seventy-five larvae were dispensed into each well a filter-
bottom 96-well plate (Millipore, Part. No. MSRLN04) using a COPAS Select worm
for drugs that modulate food intake. Few model organisms allow the sorter (Union Biometrica). Once loading was completed, the liquid content of the
combination of large-scale drug screens with genetic screens to plates was filtered away and replaced with 100 ml of liquid food. The plates were
identify bioactive small molecules and their in vivo targets2. incubated for 16–18 hours at 25uC and 70% humidity. Thereafter, the food was
Drosophila is an appealing model to study appetite control because replaced with food that contained 0.3% fluorescein (sodium salt, Sigma Cat. No.
60% of functional human genes have orthologues in the fly38 and 6377). Before the fluorescent signal was quantified the plates were washed 43 with
300 ml double-distilled water, 103 with 0.05% PBT, 63 with 400 mM lysine and 23
Drosophila has a specialized tissue for fat storage that controls meta- with 100 mM Na-citrate, 100 mM NaCl, pH2 (citrate buffer). The larvae were kept in
bolic homeostasis using a leptin-like signaling mechanism13. Future 50 ml of citrate buffer for quantification or imaging capture. The fluorescent signal
work can apply these methods to larger scale screens of novel com- from the plate was acquired in a 5 3 5 circular grid using an EnVision Plate Reader
pounds to identify new pathways regulating feeding behavior. (Perkin Elmer). The total fluorescent value of each well was calculated by adding the
data points.

Methods Small-molecule screen. Primary screen. The small molecules were obtained from the
Fly stocks. Flies were maintained on conventional cornmeal-agar-molasses medium LOPAC1280, Prestwick, GreenPharma, and MicroSource Spectrum libraries, and
and, unless otherwise stated, under a natural light-dark cycle, at room temperature. were provided by the High-Throughput Screening Resource Center (HTSRC) of The
klumpfuss09036 (stock #11733), 5-HT1AD5Kb (stock #27640), 5-HT1BMB08181 (stock Rockefeller University. A total of 3688 compounds, representing 3630 unique
#24240), 5-HT2APL00052 (stock #19367), 5-HT2ARNAi (stock #31882) and Df(3R)tll-e structures, were screened. Small molecules were pooled at 10 mg/ml each such that
(stock #5415) were obtained from the Bloomington Stock Center. 5-HT2Ae01363 was each compound was represented twice in two independent mixtures. Only those
obtained from the Harvard Exelixis Collection. 5-HT1AGal4, 5-HT2AGal4, 5-HT2BGal4, compounds that showed the required effect two times were chosen for confirmation
and 5-HT7Gal4 were generated by J.H and Y.R. by replacing the first coding exon of in the secondary screen. For the primary screen, sixteen 384-well plates with a
each gene by Gal4, and will be reported elsewhere (Huang and Rao, in preparation). different small-molecule in each well were mixed using a 4 3 4 grid into eight 384-
well destination plates. Since we screened 3688 small molecules, and the 384-well
Embryo collection. For embryo collection, grape-juice 2%-agar plates were used. plates contain 352 usable wells each (32 wells in each plate are reserved for solvent
Flies were allowed to lay eggs for 24 hours at 25uC. Eggs were further incubated at controls), a total of 1944 wells in the source plates were empty (16 3 352 2 3688 5
18uC for another 24 hours. Egg laying and embryo development were both performed 1944). While the majority of mixtures contained 4 compounds, about a third
at 70% humidity and in a 12 hour light: 12 hour dark cycle. contained only 3. To apply the drugs to the larvae loaded into the 96-well plates, each
384-well plate quadrant was treated as an independent 96-well plate.
First instar larva collection. Previously hatched larvae were removed from the The cut-off for hit-identification was arbitrarily set to one standard deviation above
embryo-collection plates under a stream of water. Plates were further incubated for 2 or below the solvent-treated wells for anorectic and orexigenic compounds,
hours at 25uC to allow new larvae to hatch. respectively. The compounds were applied to the larvae in 96-well plates in the liquid
food together with fluorescein for 16–18 hours. In each 96-well plate, 80 compound-
For primary and secondary screens. Newly hatched larvae were collected in a cell mixtures were tested and 16 wells were treated only with solvent as control (1.6%
strainer with a gentle stream of distilled water, rinsed and re-suspended in liquid DMSO). Each plate was tested in duplicate.
food (100 g/l yeast extract, 100 g/l glucose, 7.5% sucrose, 0.15% nipagin, 6.25 mg/ml
cholesterol). Secondary screen. Compounds were screened individually at 40 mg/ml. Each hit was
tested in two rounds, in duplicate. Each screening plate contained 8 solvent-treated
For individual larval assays. Newly hatched larvae were collected with a brush, and control wells.
transferred to a vial with conventional medium or to a 96-well plate with liquid food.
To facilitate penetration of the larvae into the solid food, incisions were made on the Solid food feeding assay. Zero-to-two hour old larvae were transferred to
surface of the medium. Larvae were incubated at 25uC and 70% humidity. conventional solid food containing either solvent or 100 mM metitepine and 0.05%

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 5


[Link]/scientificreports

a
Metitepine (µM)
0 100 0 100 0 100 0 100 0 100 0 100 0 100
high

low
50
*** *** *** *** NS *** ***
% Relative F (gut)

-50
w1118 CS 5-HT1AGal4/Δ5kb 5-HT1BΔIII-V 5-HT2AGal4 5-HT2BGal4 5-HT7Gal4/Df

b Metitepine (µM)
0 100 0 100 0 100 0 100 0 100
high

low
50
* NS NS NS ***
% Relative F (gut)

-50
5-HT2Ae 5-HT2AGal4/e 5-HT2APL 5-HT2AGal4/PL 5-HT2AGal4/+

Figure 5 | 5-HT2A is the in vivo target of metitepine. (a, b) Top pictures are representative pseudo-color images of larval digestive tracts of the indicated
genotypes that were fed the specified concentration of metitepine or solvent in liquid food with fluorescein. The Y-axis in the graphs is relative
fluorescence of metitepine-fed larvae to solvent-fed larvae. n 5 88–99 for all genotypes, except 5-HT1BDIII-V (76), 5-HT2AGal4 (124), and 5-HT7Gal4/Df (65).
Scale bar (white): 100 mm applies to all panels. Data were compared using Kruskal-Wallis test followed by Dunn’s test. * p , 0.05, *** p , 0.001.

bromophenol blue, and allowed to feed for 17 hours at 25uC and 70% humidity. MetaMorph (Molecular Devices) to calculate the optical density of the digestive tract.
Larvae were recovered from the food with a brush, rinsed in PBS, and photograph Optical density values of drug-treated larvae were analyzed always in parallel with
under a SMZ1500 dissecting scope (Nikon). Images were captured with a DS-2Mv same day solvent-treated larvae.
digital camera (Nikon) and a NIS-Elements F acquisition program. Larvae were
immobilized in a cold plate set to 4uC. Reflective light was adjusted to make the Mouth-hook contractions. Zero-to-two hour old larvae were transferred to
background of each picture 12% gray. Images of individual larvae were analyzed in conventional solid food containing either solvent or 100 mM metitepine, and allowed

a b
high high

40 low 40 low
a a b a a b
% Relative F (gut)
% Relative F (gut)

0 0

-40 -40

5-HT2A +/+
5-HT2A Gal4/+
5-HT2A Gal4/e UAS-5-HT2A RNAi + +
UAS-GFP +
RU-486 + +

Figure 6 | 5-HT2A is necessary for normal larval feeding. (a,b) Top pictures are representative pseudo-color images of digestive tracts of larvae of
the indicated genotypes that fed in liquid food with fluorescein. Scale bar (white): 100 mm applies to all panels. The graphs show relative fluorescence to
wild-type larvae (c) or to Elav-GeneSwtich . 5-HT2ARNAi larvae that were not fed RU-486 (d). n 5 98–126 in (c); n 5 90–104 in (d). Data were compared
using Kruskal-Wallis test followed by Dunn’s test. In all graphs, error bars are s.e.m. Significant differences are labeled with different letters.

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 6


[Link]/scientificreports

to feed for 17 hours at 25uC and 70% humidity. Larvae were recovered from the food Dose-response curves, in vitro pharmacology, and behavioral experiments. Stock solu-
with a brush, rinsed in PBS and transfer to a 2% yeast suspension at room tions of metitepine (Sigma) were prepared in DMSO (100 mM or 500 mM). Stock
temperature. After a one-minute acclimation, a one-minute movie was recorded at solutions of 5-HT and ATP (both from Sigma) were prepared in water (50 mM), kept
6.25 frames per second (fps) using a Nikon SMZ1500 dissecting scope, a Rolera-RX frozen at 220uC, and aliquots thawed only once.
camera (Q Imaging), and Q Capture 6.0 Software (Q Imaging). Movies were manually
scored to quantify mouth-hook contraction rate. 5-HT1B mutant generation. Homozygous males carrying the Minos MB05181
transposable insertion inserted in the sixth intron of 5-HT1B were crossed to virgin
Larval locomotion. Zero-to-two hour old larvae were transferred to conventional females of this genotype:
solid food containing either solvent or 100 mM metitepine and 0.05% bromophenol SnaSco/SM6a, p(w[1mC] 5 hslLMiT) (Bloomington stock #24613).
blue, and allowed to feed for 17 hours at 25uC and 70% humidity. Bromophenol blue The heat-shock scheme to induce expression of the Minos transposase, marker
facilitated tracking of the animals since it enhanced contrast. Larvae were recovered selection, and the establishment of excision lines were carried out as originally
from the food with a brush, rinsed in PBS, and transferred to a 3% agar plate at room described41. Ninety-four independent excision events were analyzed by PCR with the
temperature. After a one-minute acclimation, a one-minute movie was recorded at following primers:
6.25 fps using a Nikon SMZ1500 dissecting scope, a Rolera-RX camera (Q Imaging), Forward primer: 59-CTGCGCTCCTTCTTCAGC-39
and Q Capture 6.0 Software (Q Imaging). Movies were analyzed in EthoVision XT 8.0 Reverse primer: 59-CGTAATTGCCGCCATTATACTC-39
(Noldus) to calculate linear velocity. One imprecise excision that removed a 1344 bp fragment from genomic DNA, thus
producing a 1002 bp PCR product instead of the wild-type 2346 bp product, was
Cloning Drosophila 5-HT receptors. 5-HT1A, 5-HT1B and 5-HT2A receptors were selected for further characterization. The resulting allele was named 5-HT1BDIII-V,
PCR-cloned from genomic DNA extracted from transgenic flies expressing full- since the deleted exons encode transmembrane segments III-V. The breakpoints of
length cDNAs under regulation of UAS promoter (5-HT1A: Bloomington stock the sequence are:
#27630; 5-HT1B: Bloomington stock # 27632; 5-HT2A (formerly 5-HT2): AAAAAGGATGTAGAGGAATAGAATA //deletion//
Bloomington stock #24504). The 5-HT2B receptor cDNA (GenBank accession CTCCAAAAATAATATTTATACAATA
#KC852205) was PCR-cloned from whole adult fly cDNA prepared using poly-A A precise excision was also identified in this screen by virtue of producing a 2346 bp
primers and SuperScript III Reverse Transcriptase (Invitrogen) according to the PCR fragment, diagnostic of a clean deletion of the Minos element.
manufacturer’s instructions. 5-HT7 receptor was PCR-cloned from w1118 genomic
DNA. High-fidelity KOD polymerase (Novagen) was used for all cloning Expression of 5-HT2A-RNAi. Zero-to-two hour old transgenic larvae carrying Elav-
amplifications and the full sequences of the amplicons were verified. The following GeneSwitch and either UAS-5-HT2A-RNAi (Bloomington stock #31882) or UAS-
primers were used in the cloning reactions: mCD8-GFP were transferred to fluorescent liquid food containing 160 mg/ml of RU-
5-HT1A: 486 (induced) (Sigma Cat. No. M8046) or 1% ethanol (uninduced) for 17 hours.
Forward: 59-ATGGCGCACGAGACCAGC-39
Reverse: 59-CTAGAGCTTCCCGCTGCGG-39 Data presentation. Fluorescence and optical density data were always normalized to
5-HT1B: controls ran in parallel, according to the equation:
Forward: 59-ATGCTGAAAACTGTGACAACAGC-39 % Relative F~1001ðF{Fcontrol Þ=Fcontrol
Reverse: 59-TCAAATTTTCGCACTGCG-39
5-HT2A: Unless otherwise noted, data are presented as mean 6 s.e.m.
Forward: 59-ATGGAGATGCAAAGCTACTCTG-39
Reverse: 59-TCACCGTTTGCAGTTGCACTTG-39 Statistical analysis. Statistical analysis was conducted as indicated in the figure
5-HT2B: legends using Prism (GraphPad). Every single set of data was tested for normality
Forward: 59-ATGGAAGAGGATGTGTATGCCT-39 (Shapiro-Wilk test) and equal variance (F test or Bartlett’s test). If those criteria were
Reverse: 59-TTATCTGCTCGGTCGCCA-39 met, parametric comparisons were performed (t test or ANOVA). Otherwise, Mann
5-HT7: Whitney test or Kruskal-Wallis test were used. Post hoc test (Dunnett’s or Dunn’s) are
Forward: 59-ATGGCTTTATCTGGACAGGACT-39 listed for each condition examined. Significance is as described in the figure legends
with *p , 0.05; **p , 0.01; ***p , 0.001.
Reverse: 59-CTAGAGAAAGCTCTCCCTCGC-39
A 59-GCCACC-39 vertebrate Kozak sequence was added upstream of every forward
primer. The amplicons were cloned into the XhoI-NotI sites in the pME18ST ver- 1. Finucane, M. M. et al. National, regional, and global trends in body-mass index
tebrate expression vector39. since 1980: systematic analysis of health examination surveys and epidemiological
studies with 960 country-years and 9.1 million participants. Lancet 377, 557–567
Expression of Drosophila 5-HT receptors in HEK-293T cells. HEK-293T cells were (2011).
seeded on glass-bottom 35-mm Petri dishes (MatTek Corporation, Part No. P35GC- 2. Dietrich, M. O. & Horvath, T. L. Limitations in anti-obesity drug development: the
1.5-10-C) and allowed to reach ,70% confluence. Cells were transiently transfected critical role of hunger-promoting neurons. Nat. Rev. Drug. Discov. 11, 675–691
with 2 mg of each receptor-expressing plasmid and Ga15-expressing plasmid using (2012).
Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Ga15 3. Huntington, M. K. & Shewmake, R. A. Anti-obesity drugs: are they worth it?
is a promiscuous G protein that couples activation of a wide variety of G-protein Future. Med. Chem. 3, 267–269 (2011).
coupled receptor to release of calcium from intracellular stores40. Cells were kept for 4. Oury, F. & Karsenty, G. Towards a serotonin-dependent leptin roadmap in the
24–32 hours at 37uC and 5% CO2 before imaging. To monitor intracellular Ca21 brain. Trends Endocrinol. Metab. 22, 382–387 (2011).
concentrations, transfected cells were loaded for 20 minutes with 2 mM Fura2-AM. 5. Broberger, C. Brain regulation of food intake and appetite: molecules and
Imaging was carried out in a saline solution containing 140 mM NaCl, 5.6 mM KCl, networks. J. Intern. Med. 258, 301–327 (2005).
2 mM CaCl2, 2 mM MgCl2, 1.25 mM KH2PO4, 2 mM Na-pyruvate, 0.17% Glucose, 6. Yeo, G. S. & Heisler, L. K. Unraveling the brain regulation of appetite: lessons from
5 mM HEPES (pH 7.4 with NaOH). The Petri dish was placed on an Eclipse TE 2000- genetics. Nat. Neurosc. i 15, 1343–1349 (2012).
U inverted microscope (Nikon) equipped with a Retiga Exi Fast Camera (Q Imaging) 7. Rihel, J. et al. Zebrafish behavioral profiling links drugs to biological targets and
and excited with a Lambda DG-4 xenon lamp illumination system (Sutter rest/wake regulation. Science 327, 348–351 (2010).
Instruments). Images were acquired at 1.43 fps. Ligands and drugs were dissolved 8. Petrascheck, M., Ye, X. & Buck, L. B. An antidepressant that extends lifespan in
freshly every day at the indicated concentrations in saline solution and superfused adult Caenorhabditis elegans. Nature 450, 553–556 (2007).
directly into the Petri dish with a peristaltic pump (Miniplus 3, Gilson). Ca21 9. Dar, A. C., Das, T. K., Shokat, K. M. & Cagan, R. L. Chemical genetic discovery of
fluctuations were recorded with MetaFluor software (version [Link]; Molecular targets and anti-targets for cancer polypharmacology. Nature 486, 80–84 (2012).
Devices). To determine 5-HT sensitivity for each receptor, several pulses of increasing 10. Chang, S. et al. Identification of small molecules rescuing fragile X syndrome
concentration of 5-HT were applied to the same cells. Pulses were delivered 2 minutes phenotypes in Drosophila. Nat. Chem. Biol. 4, 256–263 (2008).
after full recovery of the previous pulse to Ca21 resting levels. 5-HT dose-response 11. Bland, M. L., Lee, R. J., Magallanes, J. M., Foskett, J. K. & Birnbaum, M. J. AMPK
curves were calculated normalizing the responses elicited by each concentration supports growth in Drosophila by regulating muscle activity and nutrient uptake
tested, by the maximal response elicited by 5-HT in those cells: DF/DFMAX. For in the gut. Dev. Biol. 344, 293–303 (2010).
metitepine inhibition, a pair pulse protocol was used. Each set of cells was stimulated 12. Gutierrez, E., Wiggins, D., Fielding, B. & Gould, A. P. Specialized hepatocyte-like
twice; first they were exposed to 5-HT alone (DF0), then they were exposed to 5-HT cells regulate Drosophila lipid metabolism. Nature 445, 275–280 (2007).
and a given concentration of metitepine (DFMet). The concentration of 5-HT used in 13. Rajan, A. & Perrimon, N. Drosophila cytokine unpaired 2 regulates physiological
these experiments was closed to the calculated EC50 for each receptor and within 95% homeostasis by remotely controlling insulin secretion. Cell 151, 123–137 (2012).
confidence intervals. The degree of metitepine inhibition was calculated by the 14. Rulifson, E. J., Kim, S. K. & Nusse, R. Ablation of insulin-producing neurons in
following equation: DFMet/DF0. Data analysis and curve-fitting was done in Prism 5 flies: growth and diabetic phenotypes. Science 296, 1118–1120 (2002).
(GraphPad). 15. Kim, S. K. & Rulifson, E. J. Conserved mechanisms of glucose sensing and
regulation by Drosophila corpora cardiaca cells. Nature 431, 316–320 (2004).
Drug preparation. Primary and secondary screens. Drugs were obtained from the 16. Rusten, T. E. et al. Programmed autophagy in the Drosophila fat body is induced
HTSRC of The Rockefeller University pre-dissolved in DMSO at 2.5 mg/ml. by ecdysone through regulation of the PI3K pathway. Dev. Cell. 7, 179–192 (2004).

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 7


[Link]/scientificreports

17. Scott, R. C., Schuldiner, O. & Neufeld, T. P. Role and regulation of starvation- 36. Mair, W. & Dillin, A. Aging and survival: the genetics of life span extension by
induced autophagy in the Drosophila fat body. Dev. Cell. 7, 167–178 (2004). dietary restriction. Annu. Rev. Biochem. 77, 727–754 (2008).
18. Carvalho, G. B., Kapahi, P. & Benzer, S. Compensatory ingestion upon dietary 37. Lam, D. D., Garfield, A. S., Marston, O. J., Shaw, J. & Heisler, L. K. Brain serotonin
restriction in Drosophila melanogaster. Nat. Methods 2, 813–815 (2005). system in the coordination of food intake and body weight. Pharmacol. Biochem.
19. Musselman, L. P. et al. A high-sugar diet produces obesity and insulin resistance in Behav. 97, 84–91 (2010).
wild-type Drosophila. Dis. Model. Mech. 4, 842–849 (2011). 38. Bier, E. Drosophila, the golden bug, emerges as a tool for human genetics. Nat. Rev.
20. Melcher, C. & Pankratz, M. J. Candidate gustatory interneurons modulating Genet. 6, 9–23 (2005).
feeding behavior in the Drosophila brain. PLoS Biol. 3, e305 (2005). 39. Chalasani, S. H. et al. Neuropeptide feedback modifies odor-evoked dynamics in
21. Zinke, I., Kirchner, C., Chao, L. C., Tetzlaff, M. T. & Pankratz, M. J. Suppression of Caenorhabditis elegans olfactory neurons. Nat. Neurosci. 13, 615–621 (2010).
food intake and growth by amino acids in Drosophila: the role of pumpless, a fat 40. Offermanns, S. & Simon, M. I. G alpha 15 and G alpha 16 couple a wide variety of
body expressed gene with homology to vertebrate glycine cleavage system. receptors to phospholipase C. J. Biol. Chem. 270, 15175–15180 (1995).
Development 126, 5275–5284 (1999). 41. Metaxakis, A., Oehler, S., Klinakis, A. & Savakis, C. Minos as a genetic and
22. Tokunaga, T., Noburu, T. & Ueda, M. Mechanism of antifeedant activity of genomic tool in Drosophila melanogaster. Genetics 171, 571–581 (2005).
plumbagin, a compound concerning the chemical defense in carnivorous plant.
Tetrahedron Lett. 45, 7115–7119 (2004).
23. Kubo, I. & Klocke, J. A. Some terpenoid insect antifeedants from tropical sources.
Adv. Pestic. Sci. 2, 284–291 (1986).
24. Simon, A. F. et al. Drosophila vesicular monoamine transporter mutants can adapt Acknowledgements
to reduced or eliminated vesicular stores of dopamine and serotonin. Genetics 181, Dragana Rogulja, Vanessa Ruta, and members of the Vosshall Laboratory provided helpful
525–541 (2009). comments on the manuscript. We thank Yi-Chen Hsieh for technical help in setting up the
25. Saudou, F., Boschert, U., Amlaiky, N., Plassat, J. L. & Hen, R. A family of feeding assay and Fraser Glickman and members of The Rockefeller University HTSRC for
Drosophila serotonin receptors with distinct intracellular signalling properties advice in implementing the drug screen. G.G. was a Pew Latin American Fellow in the
and expression patterns. EMBO J. 11, 7–17 (1992). Biomedical Sciences. This work was funded by National Natural Science Foundation of
26. Colas, J. F., Launay, J. M., Kellermann, O., Rosay, P. & Maroteaux, L. Drosophila 5- China (Young Scientists Fund 31000547 to J.H.), Chinese Ministry of Science and
HT2 serotonin receptor: coexpression with fushi-tarazu during segmentation. Technology (973 Program 2010CB833900 to Y.R.), and The Klarman Family Foundation
Proc. Natl. Acad. Sci. U. S. A. 92, 5441–5445 (1995). Grants Program in Eating Disorders Research to L.B.V. L.B.V. is an investigator of the
27. Witz, P. et al. Cloning and characterization of a Drosophila serotonin receptor that Howard Hughes Medical Institute.
activates adenylate cyclase. Proc. Natl. Acad. Sci. U. S. A. 87, 8940–8944 (1990).
28. Obosi, L. A. et al. Functional characterisation of the Drosophila 5-HTdro1 and 5-
HTdro2B serotonin receptors in insect cells: activation of a G(alpha) s-like protein Author contributions
by 5-HTdro1 but lack of coupling to inhibitory G-proteins by 5-HTdro2B. FEBS G.G. and L.B.V. conceived the project. G.G. carried out all experiments and analyzed the
Lett. 381, 233–236 (1996). data. S.C. provided technical help for the drug screen and the mouth-hook contraction
29. Hauser, F., Cazzamali, G., Williamson, M., Blenau, W. & Grimmelikhuijzen, C. J. experiments. J.H. and Y.R. made the Gal4 knock-in Drosophila mutant lines. G.G. and
A review of neurohormone GPCRs present in the fruitfly Drosophila melanogaster L.B.V. wrote the manuscript and prepared the figures.
and the honey bee Apis mellifera. Prog. Neurobiol. 80, 1–19 (2006).
30. Yuan, Q., Joiner, W. J. & Sehgal, A. A sleep-promoting role for the Drosophila
serotonin receptor 1A. Curr. Biol. 16, 1051–1062 (2006).
Additional information
Supplementary information accompanies this paper at [Link]
31. Nichols, C. D. 5-HT2 receptors in Drosophila are expressed in the brain and
scientificreports
modulate aspects of circadian behaviors. Dev. Neurobiol. 67, 752–763 (2007).
32. Osterwalder, T., Yoon, K. S., White, B. H. & Keshishian, H. A conditional tissue- Competing financial interests: The authors declare no competing financial interests.
specific transgene expression system using inducible GAL4. Proc. Natl. Acad. Sci. How to cite this article: Gasque, G., Conway, S., Huang, J., Rao, Y. & Vosshall, L.B. Small
U. S. A. 98, 12596–12601 (2001). molecule drug screening in Drosophila identifies the 5HT2A receptor as a feeding
33. Song, B. M. & Avery, L. Serotonin activates overall feeding by activating two modulation target. Sci. Rep. 3, 2120; DOI:10.1038/srep02120 (2013).
separate neural pathways in Caenorhabditis elegans. J. Neurosci. 32, 1920–1931
(2012).
This work is licensed under a Creative Commons Attribution-
34. Neckameyer, W. S. A trophic role for serotonin in the development of a simple
feeding circuit. Dev. Neurosci. 32, 217–237 (2010). NonCommercial-ShareAlike 3.0 Unported license. To view a copy of this license,
35. Vargas, M. A., Luo, N., Yamaguchi, A. & Kapahi, P. A role for S6 kinase and visit [Link]
serotonin in postmating dietary switch and balance of nutrients in D.
melanogaster. Curr. Biol. 20, 1006–1011 (2010).

SCIENTIFIC REPORTS | 3 : 2120 | DOI: 10.1038/srep02120 8

You might also like