0% found this document useful (0 votes)
19 views9 pages

E. coli Resistance Mechanisms Study

Uploaded by

Vishal Pandey
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
19 views9 pages

E. coli Resistance Mechanisms Study

Uploaded by

Vishal Pandey
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

1.

Name of the Institute/University/Organisation submitting the Project Proposal :

2. State:

3. Status of the Institute:

4. Name and designation of the Executive Authority of the Institute/University forwarding the application :

5. Project Title :

Molecular characterization of resistance mechanisms and epidemiological typing of clinical isolates of cephalosprine(3
generation) e coli (CREC) in one health.

Category of the Project :

6. Specific Area :

Is the Proposal Submitted Under Specific Call for Proposal :

7. Project Duration : 3 Years and 0 Months

8. Project Total Cost (Rs.)

9. Is the project Single Institutional or Multiple-Institutional (S/M) : Single-Institute

Affiliation : N/A

Address : N/A

10. Project Summary (Not to exceed one page. Please use separate sheet). If the project is multi-institutional, please
furnish the following : Project Coordinator : N/A

One health is an approach to investigating infectious disease which acknowledges that human, animals , plant and the
environment are closely interlinked. The world health organization (WHO) has declared antimicrobial resistance (AMR)
one of humanity’s top 10 health threats worldwide (AMR). The Amr research, as seen through OH lens, recognizes the
iterdependence and the coproduction of the health of humans, nonhuman animals and the environment. Escherichia
coli (E. coli) is a common commensal of the intestinal microbiota in both animals and humans due to increasing AMR
and death associated with resistance . E. coli infections are caused by extraintestinal and uropathogenic subtypes , with
uropathogenic E. coli responsible for up to 80% of urinary tract infections , the most common infectious disease in the
community . Virulence potential varies according to molecular types of bacterial isolates . AMR of E. coli is due to both
intrinsic (the outer membrane and expression of efflux pumps) and extrinsic mechanisms (the acquisition of mobile
genetic elements or through horizontal gene transfer that assists in capturing, accumulating, and disseminating
resistance genes . Serological classification of [Link] (a) based on somatic (O) antigens: 173 O groups, (b) Based on
Flagellar (H) antigens: 56H groups, (c) Based on capsular(K) antigens: 100 K groups. Pathotype classification of [Link] (a)
Uropathogenic [Link](UPEC), (b) Enteropathogenic [Link](EPEC), (c) Enterohemorrahagic [Link](EHEC), (d) Enteroinvasive
[Link](EIEC), (e) Enterotoxigenic [Link](ETEC), (f) Enteroaggregative [Link](EAEC), (g)Diffusely adherent [Link](DAEC).

Two main features contribute to the success of A. E. coli: (i) They normally exhibit multidrug resistance (MDR), acquired
by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, transposons, or
resistant islands, and (ii) The ability to survive in the environment, in which the biofilm production plays an important
role. The mechanisms involved in resistance to ß-lactams in E. coli typically include: (i) enzymatic mechanisms or
production of ß-lactam hydrolyzing enzymes (ß- lactamases) and (ii) non-enzymatic mechanisms that involve
modification of membrane permeability by either the loss of or decrease in the expression of OMPs or an increased
expression of efflux pumps as well as sequence variation of PBPs. ß-lactamases are encoded either chromosomally or in
plasmids. The common genome of E. coli possesses 4 intrinsic ß-lactam hydrolyzing enzymes; including (a) AmpC ß-
lactamase (Ampc), (b) TEM-1 Beta-lactamase(TEM-1) , (c) OXA-1 Beta-lactamase(OXA-1), (d) SHV-1 Beta-lactamase
(SHV-1). However, the primary intrinsic Beta-lactamase in E. coli including AmpC beta-lactamase penicillins,
cephalosporins, monobactams
TECHNICAL DETAILS OF PROJECT

14 Introduction :

14.1 Origin of the proposal- The Manhattan principle of conservation published in 2004 . called for a more
integrated view of interaction between human and animal the 2002-2004 global out break of sevre acute
respiratory syndrome coronavirus (SARS- Covid) highlighted the risk to human by genosis the term one health
was first coined at time 2003 by William Karesh DVM. Un sustainable development goal are relevant to one
health as they include target of health and well being, clean water and sanitation, climate action as well as
sustainability in marine and territorial ecosystem. [SDG-Eludi] around 6SDG selected to one health which are
3,6,11,13,14,15 and suggest some action that may help to address them using coronavirus disease 2019
(Covid-19) pandemic. E. coli is an emerging bacterial pathogen that causes a broad array of infections,
particularly urinary tract infection(UTI) sepsis and diarrheal disease. WHO reported that patient with 3 rd
generation cechalosporin resistant E. coli infection had a two fold increasing all cause mortality. resistant to the
third generation cephalosporins is mediated by extende-spectrum beta-lactamases (ESBLs) and AmpC beta-
lactamases. (a)In early antibiotic era pencillin discovery in 1928 and introduction of sulfonamides in 1935.
E. coli began to develop resistance to sulfonamides. Broad-spectrum antibiotics - introduction of tetracyclines
in 1950 and E. coli developed resistance to tetracyclines through tet(A) gene. Aminoglvcoside and Quninolone
in era 1970 [Link] develop resistance to aminoglycosides through aac(3)-II gene. Flouroquinolone resistance
through gyrA mutations. Extended-Spectrum Beta-lactamases era 1990s-present- Emergence of ESBL-
producing [Link] (eg., CTX-M-15). Spread of ESBL genes through horizontal gene transfer. Carbapenem-Resistant
E. coli (CRE) Era (2000s-present) – Emergence of carbapenem-resistant E. coli (eg., KPC, NDM). Colistin
Resistance in 2010-present – Emergence of colistin-resistant E. coli(e.g., mcr-1 gene). Spread of colistin
resistance genes through horizontal gene transfer. Continuous surveillance is neded for monitoring and to
control the spread of these worrisome strains equipped with multiple drug resistance mechanisms.

14.2 Rationale of the study supported by cited literature (b) Hypothesis (c) Key questions.

a) Antibiotic resistance in E. coli has been attributed to either intrinsic or acquired mechanisms. The resistance
mechanisms in E. coli are diverse and include enzymatic modification of antibiotics, target gene mutation,
altered outer membrane permeability, and up-regulated multidrug efflux pump activity16. Genome sequence
analyses reveal that, on average, efflux pumps constitute at least 10% of the transporters in bacterial species,
and they usually are capable of extruding a broad range of structurally unrelated compounds. These multidrug
efflux systems are classified into five different families: ATP-binding cassette (ABC), major facilitator super family
(MFS), resistance/nodulation/cell division (RND), multidrug and toxic-compound extrusion (MATE), and the
small multidrug resistance (SMR) family of bacterial integral membrane proteins. The majority of gram-negative
bacterial multidrug efflux pumps are entirely different in their construction in that they traverse both the
cytoplasmic (inner) and outer membranes by utilizing three protein components. These systems include AcrAB-
ToIC(RND family), EmrE(MFS family), MdtABC(MFS family), MdlABC(ABC family), MacAB(ABC family) in E. coli.
Three fruther RND efflux pump system in E. coli AcrAB-ToIC, AcrEF-ToIC, AcrD-ToIC in E. coli. OprN are the only
mutants that appear to pump out efflux of 3rd generation cephalosporins, such as Cefotaxime, Ceftriaxone,
Ceftazidime.

b) Despite everything happening inside and outside the cell walls of E. coli, there are still some drugs that have
some potential activity against the bacteria terrorizing UTI. These include Rifaximin, azithromycin, and
ciprofloxacin are currently recommended by the Infectious Diseases Society of America(IDSA) and the
international Society of Travel Medicine(ISTM) to treat [Link] infection.
c) Porins are specialized OMPs that allow for the passage of small metabolites such as sugar, amino acids, and
ions. The action of efflux pumps in conjunction with porins is believed to be a very powerful resistance
mechanism. Consequently, the exact resistance mechanism and genetic relatedness of the CREC should be
determined (by MLST) for each isolate to ensure proper and effective treatment and to prevent delay and
unnecessary morbidity.

14.3 Current status of research and development in the subject (both international and national status)

E. coli is a ubiquitous microorganism and the most common cause of UTI, a condition affecting young women more than men,
owing to anatomical differences. During infection, the first and most critical step in UPEC virulence is the attachment of the
bacterium to the urinary tract, and its colonization and spread in the ascending or descending direction of the urinary tract.
Various adhesins and colonization mechanisms are used by virulent E. coli strains to accomplish this important virulence
initiation step. In this study, Uropathogenic Escherichia coli isolates from multiple geographical locations in India were evaluated,
to study some common virulence characteristics (cell surface hydrophobicity, siderophore production, biofilm formation, gelatin
hydrolysis, and colicin production) facilitating this first virulence step. Emergence of multidrug-resistant (MDR) E. coli strains has
become a serious clinical problem in many parts of the world. Antimicrobial options for the treatment of MDR E. coli are limited,
including rifaximin and azithromycin.

Cephalosporin(3rd generation) - hydrolyzing beta-lactamases , belonging to molecular class D have emerged globally as the main
mechanism responsible for this resistance. The 3rd generation cephalosporin hydrolyzing beta-lactamase gene of E. coli are (a)
blaCtx-M-14 gene – Hydrolyzes cefotaxime, ceftriaxone, and ceftazidime (b) blaCTX-M-15 genes – Hydrolyzes cefotaxime,
ceftriaxone, and ceftrazidime (c) blaSHV-2 genes- Hydrolyzes cefotaxime and ceftazidime (d) blaTEM-26 genes – Hydrolyzes
cefotaxime and ceftazidime. determinants are consistently associated with resistance or, at least, with reduced susceptibility.
Increased MDR in bacteria is a combination of slower diffusion of drugs from reduced number of porin channels and increased
expulsion through endogenous efflux system. Alterations of outer membrane lipopolysaccharides and fluoroquinolone efflux at
the inner membrane should also be considered as factors determining multi-drug resistance. The Global Antimicrobial Resistance
and Use Surveillance System (GLASS) report highlights alarming resistance rates among prevelant bacterial pathogens, including
E. coli , in Europe. The European Centre for Disease Prevention and Control (ECDC) is conducting studies AMR in E. coli and other
bacteria, focusing on molecular characterization and transmission dynamics. The joint programming initiative on Antimicrobial
Resistance (JPIAMR) is a European consortium funding research projects on AMR, including studies on E. coli. In a study from
Christian Medical college in Vellore India used MLST identified the sequence type of 60 E. coli isolates. The isolates belonged to
14 different sequence type and 6 clonal complexes. Study found that all isolates were resistant to carbapenems, quinolones,
cephalosporins, and beta-lactamase inhibitors. This approach may prove helpful in identifying the genotypes that are most likely
to cause problems in hospitals.
14.4 The relevance of the proposed study

(a) The study of cephalosporin generation 3 resistance E coli is highly relevant in one health context, as it address the
intersection of human, animal , and environment health.
(b) In data integrating data challenges from human health, animal health, and environmental monitoring systems is
complex due to fragmented data collection and analysis practices across sectors.
(c) Insufficient research on E. coli virulence factors and pathogenesis
(d) There is growing recognition of the one health approach, research in India often focuses primarily on human health
aspects of AMR, with less emphasis on animal and environmental health. Therefore PCR based molecular methods
will be standardized for animal and environmental health.

14.5 The Outcome of Proposed Study

The identification of E. coli based on phenotypic analysis will be confirmed using molecular methods in this study. The
microbiological status, epidemiological typing and antimicrobial susceptibility pattern and resistance mechanism in our patients
will be studied. The data about the isolation rate of E. coli will also be generated from this study from India. Genetic relatedness
of our clinical isolates will be studied with those throughout the world. The MLST database does not contain Indian isolates other
than those of single study from (Christian Medical College, Vellore Tamil Nadu). Thus further studies are required to characterize
isolates from different parts of India. Sequence Types encountered in the present study will be compared with antibiotic
resistance patterns of all CREC in human, animal and environment isolates.

14.6 Preliminary work done so far :

a) A total of 100 A. baumannii isolates have been identified using standard bacteriological procedures and
interpretation of susceptibility testing was done according to CLSI guidelines. Escherichia coli ATCC 25922 and
Pseudomonas aeruginosa ATCC 27853 were used as the quality control strains

b) A sum of 100 A. baumannii have been isolated and confirmed with OXA-51 Gene PCR.

c) The newer ß-lactamases, including extended-spectrum ß-lactamases (ESBLs), Amp-C-ß- lactamases, and
metallo-ß- lactamases (MBLs) production have been determined in 53 isolates Acinetobacter calcoaceticus-
baumannii complex.

d) In this field the related experiments (MLST) have been performed in one of our projects entitled, “Molecular
identification and Epidemiological typing of Burkholderia cepacia complex, an emerging pathogen, in
septicaemic and cystic fibrosis patients”. Efflux pump real time gene expression is on standardization in one of
our ongoing project entitled, “Efflux pumps, OprD porin, AmpC ß-lactamases and carbapenemases in clinical
isolates of Burkholderia cepacia complex

Related publications in the related area are:

1) Gautam V, Singhal L, Arora S, Jha C, Ray P. Reliability of Kirby-Bauer disk diffusion method for detecting
carbapenem resistance in Acinetobacter baumannii-calcoaceticus complex isolates. Antimicrob Agents
Chemother. 2013 Apr; 57(4):2003-4.

2) Chatterjee SS, Karmacharya R, Madhup SK, Gautam V, Das A, Ray P. High prevalence of co-expression of newer
beta-lactamases (ESBLs, Amp-C-beta-lactamases, and metallo- beta-lactamases) in gram-negative bacilli. Indian
J Med Microbiol. 2010 Jul-Sep;28(3):267- 8.
14.7 Scope of the Application indicating anticipated product and processes

A. E. coli is a common pathogen and constantaly present both in the digestive tract of animals, humans and also
in the environment. In recent years, due to the widespread use of antimicrobial drugs for the treatment of
E. coli induced disease in farm animals. E. coli has become one of the common bacterial sources to AMR genes,
which has been prevelant and exhibited an increasing trend. Moreover, as a new type of environmental
pollutant, it has been confirmed that the AMR genes could be transmitted vertically between strains and
transmitted horizontally by plasmid, transposon, integron, and other elements. Cephalosporins (3 rd generation)
Resistant E. coli (CREC) generally appears to be multidrug resistant. In this study we will be dealing in India the
effect of bacterial growth phase (cell density) on the expression of RND pumps and outer membrane proteins
that are implicated in the antibiotic resistance of E. coli. In the clinical isolates, this will be first study suggest
the role of some global regulatory and resistance mechanism involved in the expression of these proteins that
could be responding to the changes in cell density. The mechanism for augmented pump activity as well as
interactions between different types of efflux pumps are yet to be investigated for better understanding of
efflux-based resistance mechanisms.

B. The MLST database study in Vellore Tamil Nadu . Therefore, the prevalence of the ST types in India could be
ascertained only if more MLST studies are performed on large scale. Thus this study will serve the purpose to
characterize isolates from different parts of the country. In addition, this study will include resistant isolates
(CREC). Therefore a comparative report will be generated of Sequence types and resistance mechanism.
15. Specific objectives:

Institute Name :Post Graduate Institute of Medical Education and Research

[Link] Objectives
.

1 Identification of the E. coli by gyrB & lacz (beta-galactosidase) like genes using PCR

2 To study the expression of multidrug resistance efflux pumps and outer protiens using RT-PCR

(i)AcrAB-ToIC

(ii)EmrE

(iii)Mdfa

(iv)OmpF

(v)OmpC

(vi)OmpA

3 PCR based detection of cephalosporin generation 3

(a)Cephalosporin-Hydrolyzing beta -Lactamases

blaCTX-M-14

blaCTX-M-15

blaShv-2

blaTEM-26

(b) beta-lactamases

blaCTX-M-15

blaCTX-12

blaTEM-10

4 To determine the genetic variability of the CREC isolates using molecular typing analysis by MLST

18 Work Plan:

Institute Name : Graphic Era Deemed to be University, Dehradun.

Objective 1- Identification of the E. coli by gyrB & lacz(beta galactosidase)like genes using PCR

Work plan: Members of major E. coli sequence groups (SGs) will be confirmed by gyrB & lacz like gene PCR.

a. Gene (gyrB) gyrB (DNA gyrase subunit B) gene For – 5’TGA TCA CGGTGGTGATGG-3’ Rev – 5’ TCAGCATCCGCAGCATTT-3’
b. lacz primers will also be used to confirm E. coli.

Objective 2- To study the expression of multidrug resistance efflux pumps and outer protiens using RT-PCR

(i)AcrAB-ToIC

(ii)EmrE

(iii)Mdfa

(iv)OmpF

(v)OmpC

(vi)OmpA

Work plan: Expression of three different RND pump- encoding genes: AcrAB-ToiC, EmrE, Mdfa, and three outer membrane porin-
encoding genes, OmpF, OmpC, OmpA . The bacterial strains will be grown overnight at 37°C in TSB in the presence and absence
of antibiotics and total RNA of cells grown on two different conditions will be obtained with by High Pure RNA Isolation Kit
(Roche Diagnostics GmbH, Germany), as dictated by the manufacturer. cDNA will be prepared from template RNA using reverse
transcriptase and random primers provided in the kit (Roche Diagnostics GmbH, Germany). The cDNA product will be stored at -
20°C. cDNA will be used to perform the downstream PCR amplification. The expression of RND pump and outer membrane-
encoding genes will be determined by qPCR using Light Cycler 480 SYBR Green I (Roche Diagnostics GmbH, Germany) according
to the manufacturer’s instruction. Primers used for the analysis are listed in . Gene expression will be normalized using
housekeeping gene 16S RNA as an endogenous control. 16rRNA (rrs) gene For AGAGTTTGATCMTGG RevACGGTCGTAGCCCCACGA
AcrAB For – ATGAACGCGCAAGCAGAA Rev-TCAGCATCCGCAGCATTT EmrE FOR – ATGAAGCAGCAGCAAGCA Rev – TCA GCA TCC
GCA GCA TTT.

Objective 3 – PCR based detection of cephalosporin 3rd gen

(i) blaCTX-M

(ii) blaSHV

(iii) blaTEM

(iv) blaAMP

(v) blaOXA

Work Plan :

The genes encoding cephalosporin 3rd gen blaCTX-m, blaCTX-M, blaSHV, blaTEM, blaAMP, blaOXA will be analyzed by multiplex
PCR using primers. Multiplex PCRs will be performed at the same time with five pairs of specific primers, one pair for each of the
five families. A 50µl PCR mixture will contain: 1µl DNA tempelate and rest 49µl mixture will be containing 10mm Tris/HCL
(PH 8.8), 4mm Mgcl2, 50mm KCL, 0.1% Triton X-100, 200µm each dNTP, 30 nM oxacillinase primers, 200 nM IMP primers, 100 nM
VIM primers, 50 nM SIM primers and 1 U Taq DNA polymerase. The PCR conditions will be as follows: initial denaturation at 94 °C
for 5 min, 33 cycles of 94 °C for 25 s, 53 °C for 40 s and 72 °C for 50 s, followed by a single, final, elongation step at 72 °C for 6
min. blaCTX-M For- ATGTGAAACCGTTTTGTT Rev- TGATCGGTGTAGTGCCGGT, blaSHV For-ATGCGTTTATCTGCCGGT Rev-
TCAGCATCCGCAGCATTT, blaTEM For- ATGAGTATTCAACTTTCC Rev- TCAGCATCCGCACATTT, blaAMP For- ATGGCAGCAGAAGCAGAA
Rev- TCAGCATCCGCAGCATTT, blaOXA For- ATGGCAGCAGAAGCAGAA Rev- TCAGCATCCGCAGCATTT.
Objective 4- To determine the genetic variability of the Cephalosporin resistance (3rd gen) isolates using Molecular typing analysis
MLST.

Work Plan: In a total of 40 clinical isolates of [Link], MLST of seven housekeeping genes, i.e. adk, fumC, gyrB, icd, mdh, purA,
recA, will be performed as described by Bartual42 et al. followed by sequencing. The sequences of these 7 housekeeping genes
will be analyzed using the Pubmlst database ([Link] coli/). The sequence type (ST) will be designated according
to the allelic profiles in the database. The eBURST algorithm (version 3; [Link] will be used to assign STs
(Sequence Types) to CCs (Clonal Complexes) and to assess the genetic relationship with definition of the groups sharing
alleles at =6 of 7 loci. The CC founding ST as a common ancestor and several other closely related STs descending from the
predicted founding genotype will be analyzed by BioNumerics software and phylogenetic tree will be generated.

Table-3

adk - For- ATTCTGCTTGGCGCTCCGGG Rev- CCGTCAACTTTCGCGTATT

fumC – For- TCACAGGTCGCCAGCGCTTC Rev- GTACGCAGCGAAAAAG ATTC

gyrb – For- TCGGCGACACGGATGACGGC Rev- GTCCATGTAGGCGTTCAGGG

icd – For- ATGGAAAGTAAAGTAGTTGTTCCGGCACA Rev- GGACGCAGCAGGATCTGTT.

mdh- For- ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG Rev- TTAACGAACTTTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT,

purA- For-CGCGCTGATGAAAGAGATGA Rev-CATACGGTAAGCCACGCAGA,

recA- For- ACCTTTGTAGCTGTACCACG Rev- TCGTCGAAATCTACGGACCGGA

You might also like