76

47 The Theory of Evolution

Key Idea: Scientific theories have been developed to
explain the diversity of life on Earth, both presently, and this observed change. Jean-Baptiste Lamarck was one of
in the past. Fossilized remains of organisms have been the first scientists to propose that advantageous
discovered and puzzled over by humans for thousands of physical features from one generation could pass onto
years. Some remains could be identified as being the another, although he was yet to understand the basic
same as, or very similar to, living organisms. Other principles of inheritance. Over 50 years later, Charles
fossils seemed to be ‘mystery’ organisms that no-one Darwin published his theory of evolution by natural
could identify. Scientists developed hypotheses and selection, causing a paradigm shift in the field of
theories to explain the mechanism behind evolution that provided a viable explanation supported
by evidence.
1. Why did scientists working on the first dinosaur fossils have
difficulty interpreting newly discovered examples to determine
+ what type of organism or species they were from, or how they
were related to modern species?
Early scientists struggled to interpret dinosaur fossils due to a lack of prior knowledge and reference,
incomplete and fragmented specimens, attempts to compare fossils with known living animals, and limited
understanding of extinction and evolution. Misinterpretations were common because paleontology was in its
infancy, methodologies were undeveloped, and preconceived notions influenced their conclusions.

2. Suggest what scientific evidence, not available in the early

1800s, is available to today's scientists to help them
understand how dinosaurs are related to each other, and to
current living species? Recreated iguanodon dinosaur models (1853)
Litle fossil evidence
In the mid 1800s, sculptures that attempted
▶ Around 1800, French scientist Jean-Baptiste Lamarck proposed a solutiontotorecreate
accountrecently
for howdiscovered
differencesdinosaurs
between
were
current species, specifically the giraffe, and those found in ancestral fossils installed inLamarck
developed. Crystal Palace, London,
reasoned that, as food
England. Scientists at the time had little fossil
became more scarce for each generation of giraffe ancestor, the animal had to stretch
evidence higher.
on which Thetheir
to base longer necked
assumptions
giraffe then passed this acquired physical characteristic onto the next generation. This meantandthat, eventually, the short-
+ necked giraffes ancestors were replaced by the long necked giraffes we have
of dinosaur
themtoday.
forms therefore modelled
on species of living reptiles. Future
fossil evidence would lead to completely
+ changing what they knew about dinosaurs.
3. Using your knowledge of modern genetics, what might
you have explained to Lamarck to help him with his
ideas on
giraffe neck length 'growing over time'?

Time
I would explain to Lamarck that traits like giraffe neck length are passed down through genes, and changes occur due to genetic
mutations and natural selection, not by the use or disuse of traits. Giraffes with slightly longer necks were better able to reach food,
giving them a survival advantage. Over time, these giraffes were more likely to reproduce, passing on the genes for longer necks. This
process of natural selection, where favorable genetic variations are inherited by the next generations, explains how neck length gradually
increased in giraffes, rather than traits being directly modified by individual behavior during their lifetime, as Lamarck suggested.

Lamarck observed giraffe ancestors had shorter necks

4. Although Lamarck's ideas about how change occurred over time in organisms were later proven wrong, why
+ were his ideas still considered to have contributed to understand how organisms change, while sharing
common ancestors?
Though his mechanism (inheritance of acquired traits) was incorrect, Lamarck’s recognition that
species evolve and share common ancestry helped shape the foundations of evolutionary thought,
influencing future scientists, including Darwin, to explore and refine ideas about how evolution
works.

A4.1 ©2024 BIOZONE International

ISBN: 978-1-99-10141302--8
NOS 1 Photocopying prohibited
 77

Observations and evidence

▶ In 1831, an aspiring young English naturalist, Charles Darwin, took a job on a British Royal Navy ship, the HMS Beagle. He
was to collect and catalogue samples of living and non-living specimens, including any fossils.
▶ Darwin was able to observe a wide range of life-forms, from many diverse and isolated regions. He found that island
groups, such as the Galápagos Islands, were particularly rich in biodiversity. After his five year journey, he returned
home. He began to hypothesize about how similar, yet different, species could have formed over time, and may have
descended from a common ancestor. Darwin did understand that ‘traits’ were heritable, but the genetic mechanism
was still unknown in his time. Unlike Lamarck, Darwin realized the importance of inherited variation already present in a
population being the key to differentiated reproduction, where those individuals with the best ‘fitness’ were more likely
to survive and pass on their traits.

Map showing Darwin's voyage on the Beagle from 1831-

+ 1836
5. How might the five year voyage around the world on the Beagle have contributed to Darwin's ideas about evolution?
The five-year voyage on the HMS Beagle provided Darwin with firsthand observations of the diversity of life across different environments. He saw distinct yet
similar species on different islands, such as the Galápagos finches, and observed how they were adapted to their specific environments. This led him to consider
how species might change in response to environmental pressures. The variety of geological formations and fossil discoveries showed him evidence of an Earth
much older than previously thought, which provided the time necessary for gradual evolutionary change. These experiences and observations were crucial in
shaping Darwin’s ideas about natural selection and how species adapt and evolve over time.

Developing the theory

▶ In science, a theory is the term used when an explanation of a phenomenon has
been developed and supported by significant evidence and observations. It
must also be scientifically testable.
▶ Theories are accepted as the current ‘truth,’ but the nature of science dictates that
they can be discarded or modified if valid evidence is found to disprove them.

Julia_Margaret_Cameron_2 PD
▶ Charles Darwin formulated his theory of evolution privately between 1837-1839. He
spent many more years gathering evidence before receiving a letter from Alfred
Russel Wallace that covered many of his own ideas. This prompted him to finally
publish his theory of evolution by natural selection in 1859, 20 years after he had
first thought of it.
▶ With increasing understanding of the role genetics plays in evolution, Neo-Darwinism
is a synthesis of both the natural selection theory and Mendelian genetics. Darwin’s Charles Darwin (1809-1882)
theory was not refuted, but instead modified to account for the genetic basis of
phenotype and the mechanism for passing on traits to the next generation.

+ 6. Why does the term ‘theory’ have a different meaning in science in comparison to everyday usage, and
why was Lamarckism discarded, rather than modified like Darwinism, when new evidence was
produced?
A well-supported explanation of natural events that has been validated by numerous tests and a substantial body of evidence is referred to as a "theory" in
science. Experiments, observations, and data support scientific hypotheses like the theory of evolution. There is misunderstanding over the scientific
meaning of the term "theory" because in common usage it frequently refers to a guess or idea that lacks substantial evidence.

Because genetic advancements disproved Lamarckism's basic mechanism—the inheritance of acquired characteristics—it was abandoned rather than
reformed. Contrary to Lamarck's theories, experiments and current genetic knowledge have demonstrated that features gained during an organism's lifetime
are not passed on to descendants. However, later genetic studies, such as Mendel's work, reinforced Darwinism, which postulated natural selection as the
primary driver of evolution. Darwinism may be improved to incorporate new data. Lamarckism had no scientific basis considering genetic mechanisms, but
Darwin's theory was in line with genetic inheritance and contributed to the contemporary synthesis of evolutionary biology.

©2024 BIOZONE
International ISBN: 978-1-99-
10141302--8
Photocopying prohibited
78

48 Molecular Sequencing as Evidence for Evolution

Key Idea: Relationships between species can be Not only can areas of difference be identified, the
assessed by comparing the sequence difference in DNA variation between the nucleotides or amino acids at a
and amino acids. Sequencing provides the precise order certain position can be determined. This information
of nucleotides in a DNA molecule or amino acids in a allows researchers to more accurately determine the
protein. This information, which can now be analysed relatedness between species, even between those with
using sophisticated computing, allows researchers to very minor differences, where less difference indicates
compare sequences between species. closer relatedness in individuals.

DNA sequencing
▶ Improved DNA sequencing techniques and powerful computing software have allowed researchers to accurately and
quickly sequence and compare entire genomes (all an organism’s genetic material) within and between species.
▶ Once DNA sequences have been determined, they are aligned and compared to see where the differences occur
(below). DNA sequencing generates large volumes of data and the improvement in computing power has been central
to modern sequence analyses. Technological advances have been behind the new field of bioinformatics, which uses
computer science, statistics, mathematics, and engineering to analyse and interpret biological data.

DNA: Species 1

DNA: Species 2

Based on DNA evidence, chimpanzees (right)

Species 1 are more closely related to humans than they
are to gorillas (left) and there is no genetic
Species 2 basis for the taxon: great apes.

What type of sequences are compared?

▶ Highly conserved sequences are often used for comparative genomic analysis because they are found in many
organisms. The changes (mutations) of the sequences over time can be used to determine evolutionary relationships.
As with other forms of molecular analysis, species with fewer nucleotide differences are more closely related than
those with many.
▶ Whole genome analysis has been important in classifying the primates. Historical views attributed special status to
humans which often confused primate classification schemes. DNA evidence provides impartial quantitative
evidence and modern classification schemes have been based on this data.

1. Explain why DNA sequence comparisons are useful in determining evolutionary relationships:
+
DNA sequencing comparisons are uselful considering that they account for the ancestry of the evaluated species, giving an
insight on the characteristics that they have inherited as a result from the conditions in which their parents lived. Then, by
comparing these sequences, inferences can be made to determine the evolutionary pathways of two species that share a
common ancestor, based on similar DNA sequences. Also, sequences can be used to estimate the time that these species
separated from their common ancestor, this is called “molecular clock”.

2. Three partial DNA sequences for three different species are presented below.
+
Species ATGGCCCCCAACATTCGAAAATCGCACCCCCTGCTCAAAATTATCA
—
1 AC
Species ATGGCACCTAACATCCCCAACTCCCACCGTGTACTCAAAATCATCA
2 AG
Species ATGGCACCCAATATCCGCAAATCACACCCCCTGTTAAAAACAATCA
3 AC
Based on the number of differences in the DNA sequences:

+ (a) Identify the two species that are most closely related: Species 1 and 3, since they share the highest number of
codons (8)
–
(b)

+ (c) Identify the two species that are least closely related: Species 2 and 3, since they share the least number of
codons (6)
–
(d)

©2024 BIOZONE International

ISBN: 978-1-99-10141302--8

A4.1

2 Photocopying
prohibited
 79
Protein homology
▶ The amino acid sequence of proteins can be used
to establish molecular homologies (similarities)
between organisms. Any change in the amino
acid sequence reflects changes in the DNA
sequence. As genetic relatedness increases, the
number of amino acid differences due to
mutation decreases. The Hox gene provides evidence for evolution
▶ Some proteins are common to many different species.
These proteins are often highly conserved, meaning
they mutate (change) very little over time. This is
because they have critical roles, e.g. in cellular
respiration, and mutations are likely to be detrimental ► Hox genes (short for homeobox) determine the position of
to their function. body ‘parts’, which develop in the early animal embryo; the
▶ Evidence indicates that these highly conserved
proteins are homologous and have been derived
from a common ancestor. Because they are highly
conserved, changes in the amino acid sequence are
likely to represent
major divergences between groups during the
course of evolution.

PhiLiP
order of the genes on the chromosome orders the body plan.
Haemoglobin sequencing
▶ Haemoglobin is the oxygen-transporting blood protein found in most vertebrates. Haemoglobin DNA sequences from
different organisms can be compared to determine evolutionary relationships and common ancestry.
▶ As genetic relatedness decreases, the number of amino acid► The key protein
differences produced
between the from the gene in
haemoglobin the clusters
chains is
of different
vertebrates increases (below). For example, there are no amino acid differences between humans and chimpanzees,
indicating they recently shared a common ancestor. Humans and frogs have 67 amino acid differences, indicating they
had a common ancestor a very long time ago.

Human – Chicken 45
chimpanzee Gibbon 2 Horse 25
0

Rhesus monkey
Gorilla 8
1 Dog Mouse Frog 67
15 27

Kangaroo 38
Increasing difference in amino acid sequence

Primates Placental mammals Marsupial Non-mammalian vertebrates

+ 3. Compare the similarities and differences in the haemoglobin sequence of humans, rhesus monkeys, and horses.
What do these tell you about the relative relatedness of these organisms to each other, and to other animals?

Humans, rhesus monkeys and horses all have the haemoglobin transporting blood protein, which can be used to compare
them based on the difference between chains of this protein. The three species have relatedness between each other,
suggesting that they shared a common ancestor. Humans and rhesus monkeys have similar haemoglobin sequences
compared to horses, since their difference in amino acids sequences is only of 8. However, that of horses and humans is
notably separated, being that the differences between sequences are 25. This suggests that humans are more related to
rhesus monkeys than to horses, probably sharing other physical similarities inherited from a closer common ancestor.

4. The fossil record shows that amphibians diverged from the lineages that evolved into mammals before the
birds did. Why is sequencing data sucha valuable tool for providing evidence for evolution in addition to
traditional taxonomy?
+ and protein sequences directly reflect the genetic blueprint of organisms, offering insights into evolutionary relationships
DNA
that might not be evident through morphological traits alone. can be used to estimate the timing of divergence events through
molecular clocks, which calculate genetic changes over time.

©2024 BIOZONE
International ISBN: 978-1-99-
10141302--8
Photocopying prohibited
 80

49 Evolution and Selective Breeding

The origin of domestic
Key Idea: Selective breeding is the process of breeding
organisms with desirable qualities, e.g. animals
high milk yield, often uses reproductive technologies, such as artificial
so that the trait is reliably passed on to the next insemination, so that the desirable characteristics of
generation. PIG DOMESTIC
one male can FOWLbe passed onto many offspring. This
Wildselection)
Selective breeding (or artificial ancestor: Boar (left)
is the process Wild ancestor:
increases Red at
the rate jungle
which the desirable trait is passed
Origin: Anatolia,
by which humans select organisms 9000 years
with desirable traits tofowl (right) Selective breeding is based around the
progeny.
and breed them so the BP Now:
trait More than
appears in 12
the next Origin:mechanism
same Indus Valley,that
4000 drives
BP natural selection, but
generation. The process distinct modern breeds,
is repeated over many Now: More
occurs than 60 breeds
at a significantly faster pace. Humans determine
generations until the including
characteristic becomes including
which Rhode Island
organisms red
are bred, and therefore which traits
common. Selective breeding the Berkshire (meat) (meat)
are andon.
passed leghorn (egg
and Tamworth production).
(hardiness).

Each domesticated breed has been

bred from the wild ancestor. The date
indicates the earliest record of the
domesticated form (years before
present or BP). Different countries
have different criteria for selection,
based on their local environments and
consumer preferences.

Bezoar ibex goat Mouflon Zebu: derived from Indian

aurochs

GOAT SHEEP CATTLE

Wild ancestor: Bezoar goat Wild ancestor: Asiatic Wild ancestor: Auroch (extinct)
Origin: Iraq, 10,000 years BP mouflon Origin: Iran, Iraq, Origin: SW Asia, 10,000 years
Now: approx. 35 breeds Levant, 10,000 years BP BP Now: 800 modern breeds
including Spanish (meat), Now: More than 200 breeds including the Aberdeen Angus
Angora (fibre) and including Merino (wool), Suffolk (meat), Friesian and Jersey
Nubian (dairy). (meat), Friesian (milk), and (milk), and zebu (draught).
dual purpose (Romney).

Natural selection’s results are found after many generations.

USDA
+— 1. (a) How does selective breeding differ from natural selection?Selective breeding is a human-conceived activity that uses
reproductive technology
+– + (b) What are the advantages of selective breeding?
– Highly specific traits can be achieved in a much faster way than natural selection. It can adapt to the consumer’s taste in each
region. It occurs in a controlled environment, with room to modify and accommodate the outcome to what is expected.

+ 2. How does selective breeding still provide evidence for evolution?

It shows that organisms can change over time through selection pressures. The observable changes in traits, in the
case of artificial selection, quickly show and can be taken as evidence that when environmental pressures favor
certain traits, it leads to gradual changes in a population. It is, essentially, a practical demonstration of evolutionary
changes.

©2024 BIOZONE International

ISBN: 978-1-99-10141302--8

A4.1
352
3 Photocopying
prohibited
 81

Selective breeding in crops

▶ The genetic diversity within crop varieties provides options to develop new crop plants through selective
breeding. For thousands of years, farmers have used the variation in wild and cultivated plants to develop
crops.
▶ Brassica oleracea is a good example of the variety that can be produced by selectively growing plants with desirable
traits. Not only are there six varieties of Brassica oleracea, but each of those has a number of sub-varieties as well.
Although brassicas have been cultivated for several thousand years, cauliflower, broccoli, and Brussels sprouts appeared
only in the last 500 years.

Cauliflower
(flower)

Broccoli
(inflorescence:
cluster of flowers on
a stem)

Cabbage
(terminal
buds) Brussels sprouts
(lateral buds)

kale
(leaf
)

Domestication of Brassica
Around 3750 BC in China, the cabbage was probably
the first domesticated variety of its wild form to be
developed. Selective breeding by humans has
produced six separate vegetables from this single
species, Brassica oleracea. The wild form species
is shown in the centre of this diagram. Different
parts have been developed by human selection. In Kohlrabi
spite of the enormous (stem)
Wild form
visible differences, if allowed to flower, all six can
cross- pollinate. Kale is closer to the wild type than the (Brassica )
other related varieties. oleracea

+ 3. What was an important factor in the populations of wild form Brassica oleracea that allowed selective
breeding to ‘create’ many different types of crop?
Genetic diversity in its wild form allowed selective breeding to emphasize traits like leaves, stems, flowers, and
buds, creating varieties.

+ 4. If Brassica oleracea was planted in a wide range of different environments, would it be likely that the same
types of vegetables evolve through natural selection over a longer time period? Explain your answer:
It would be unlikely, since different environmental conditions would cause selection pressures, leading to different
traits being favored in each space. Distinct varieties of Brassica olearacea could evolve, but in a much slower
process compared to selective breeding.

©2024 BIOZONE
International ISBN: 978-1-99-
10141302--8
Photocopying prohibited
 82

50 Homologous Structures
Key Idea: Homologous structures (homologies) are land vertebrates were amphibians with a pentadactyl
structural similarities present as a result of common limb structure (a limb with five fingers or toes). All
ancestry. The common structural components have vertebrates that descended from these early amphibians
been adapted to different purposes in different taxa. have limbs with this same basic pentadactyl pattern.
The bones of the forelimb of air-breathing vertebrates They also illustrate the phenomenon known as adaptive
are composed of similar bones arranged in a radiation, since the basic limb plan has been adapted to
comparable pattern. This is indicative of common meet the requirements of different niches.
ancestry. The early

Specializations of pentadactyl limbs

Generalized pentadactyl limb
The forelimbs and hind limbs have the same
arrangement of bones but they have different names.
In many cases, the basic limb plan has been adapted
(e.g. by loss or fusion of bones) to meet the Bird wing
requirements Mole
of different niches (e.g. during adaptive radiation of forelimb
the mammals).

Forelimb Hind limb

Dog
front
leg

Upper arm
(humerus) Thigh
(femur)
Bat wing
Fibula
Seal flipper
Tibia
Radius
Ulna
Human arm
Wrist Ankle
(carpals) (tarsals)

Palm Sole
+ 1. Briefly describe the purpose of the major anatomical change that has taken place in each of the limb examples
(metatarsals) (metatarsal
above:
—
b)Highly modified for fine motor skills, grasping, tool use. Flexible joints for tree climbing, and improved dexterity of fingers
Fingers Toes
c)Modified for efficient swimming by increasing surface area for
(phalanges) propulsion. Flattened shape to act as a paddle.
(phalange

d)Modified for walking or swift running, in pursuit of pray. Long limbs for long stride.

e)Modified for digging, short and strong limbs with enlarged claws for propulsion underground

f) Modified for flight. Elongated metacarpals and phalanges that stretch the skin into a wing.

(a) Bird wing: Highly modified for flight. Forelimb is shaped for aerodynamic lift and feather
attachment.
+ (b) Human arm:
–
+ (c) Seal flipper:
–
+ (d) Dog front leg:
–
+ (e) Mole forelimb:
–
+ (f) Bat wing:
–
+
2. Explain how homology in the pentadactyl limb is evidence for evolution:
Despite modifications in different species, the basic bone structure (humerus, radius, ulna, carpals, metatarsals,
and phalanges) remains largely conserved, indicating that these limbs all evolved from a common ancestral
vertebrate.

+ 3. Homology is due to divergent evolution. Define this term and explain how discovery of a new species of whale
fossil, complete with limb bones, could be classified using evidence from anatomical homology: Divergent

A4.1

4 Photocopying
prohibited
 evolution refers to the process by which two or more related species become more dissimilar over time, often as 83
they adapt to different environments or niches. The discovery of a new species of whale fossil with limb bones
would be evidence of divergent evolution because whales are descended from land-dwelling mammals, which
had pentadactyl limbs. Over time, the limbs of early whale ancestors became more specialized for aquatic life,
eventually evolving into the flippers of modern whales. The anatomical structure of the fossil's limb bones
would likely show similarities to the limbs of land mammals, indicating a common evolutionary origin. This
supports the idea that whales diverged from terrestrial ancestors and adapted their limbs for life in water through
modifications of the ancestral pentadactyl limb.
4.

©2024 BIOZONE International

ISBN: 978-1-99-10141302--8

©2024 BIOZONE
International ISBN: 978-1-99-
10141302--8
Photocopying prohibited
 83

51 Convergent from different evolutionary lineages come to resemble

each other or evolve analogous structures that serve
Evolution the same purpose, because they have similar habitats,
ecological roles, or selection pressures.
Key Idea: Some species living in similar environments
have evolved similar structural adaptations, called
analogous structures, even though they are not closely
related.
Convergent evolution describes the process by which
species
Convergence: same look, different origins
▶ We have seen how artificial selection applies selection
pressure to bring about phenotypic change in a
population. In natural environments, selection pressures
to solve similar problems in particular environments can
result in similar phenotypic characteristics in unrelated
(or very distantly related) species.
▶ The evolution of succulence in unrelated plant groups Fish: Shark Reptile: Ichthyosaur (extinct)
(Euphorbia and cacti) is an example of convergence in
plants. In the example (right), the selection pressures of
the aquatic environment have produced a similar
streamlined body shape in unrelated vertebrates.
Ichthyosaurs, penguins, and dolphins each evolved from
terrestrial species that took up an aquatic lifestyle. Their
body form has evolved similarities to that of the shark,
which has always been aquatic. Note that flipper shape Mammal: Bird: Penguin
Analogous
in mammals,structures arise through
birds, and reptiles is a result of
Dolphin
convergence
convergence, but its origin from the pentadactyl limb is
▶an example of common [Link] function and
Analogous structures have the
often the same appearance, but different origins.
▶ The example (right) shows the structure of the
camera eye in two unrelated taxa (mammals and
cephalopod molluscs). The eyes appear similar, but
have different embryonic origins and have evolved
independently. Mammalian eye Octopus eye
The wings of birds and insects are also analogous.
▶ The wings have the same function but the two taxa
do not share a common ancestor. Longisquama, an Iris Iris
Jo Naylor cc2.0
extinct reptile, also had wing-like structures that
probably allowed gliding between trees. These
were highly modified, long scales extending from its Lens Lens
Retina
back and not a modification of the forearm (as in Retina
birds). Cornea Cornea

+ 1. In the example above, illustrating analogous eye structure, describe two ways in which the structure has
evolved in response to the particular selection pressures of its functional requirements.
—
+ (a)  (a) Light focusing: Both eyes evolved lenses capable of focusing light precisely onto the retina to create clear
– images, adapting to their respective environments (e.g., air for mammals, water for cephalopods).
+
 (b) Adaptation for survival: Both structures evolved to detect predators or prey effectively, increasing survival
– in their habitats despite their different evolutionary origins.

+ 2. Describe two of the selection pressures that have influenced the body form of the swimming animals
— above:
+
–  (a) Streamlined shape: Animals such as dolphins, ichthyosaurs, and penguins evolved streamlined bodies to
+ reduce drag in water, enabling faster and more energy-efficient swimming.
+ –  (b) Propulsion efficiency: Selection for effective movement through water led to the development of flippers or
fins, enhancing thrust and maneuverability
3. When early taxonomists encountered new species in the Pacific region and the Americas, they were keen to
assign them to existing taxonomic families based on their apparent similarity to European species. In recent
times, many of these species have been found to be quite unrelated to the European families they were
assigned to. Explain why the traditional approach did not reveal the true evolutionary relationships of the new
species:
Traditional taxonomy relied on physical traits to classify species, often leading to errors because convergent
evolution can result in similar traits in unrelated species. Without genetic data, these classifications could not
account for evolutionary lineage or molecular homologies.

©2024 BIOZONE International A4.1

ISBN: 978-1-99-10141302--8
Photocopying prohibited 5