Rowan University
Rowan Digital Works
Open Educational Resources University Libraries
9-15-2020
Computer Science Principles with Java
Seth D. Bergmann
Rowan University
Follow this and additional works at: [Link]
Part of the Computer Sciences Commons
DOI: 10.31986/issn.2689-0690_rdw.oer.1018
Let us know how access to this document benefits you - share your thoughts on our feedback
form.
Recommended Citation
Bergmann, Seth D., "Computer Science Principles with Java" (2020). Open Educational Resources. 19.
[Link]
This Book is brought to you for free and open access by the University Libraries at Rowan Digital Works. It has been
accepted for inclusion in Open Educational Resources by an authorized administrator of Rowan Digital Works.
Computer Science Principles
Java edition
Seth D. Bergmann
September 15, 2021
2
Preface
This book is intended to be used for a first course in computer science. It in-
cludes some programming, but the emphasis is on the principles which form the
foundation for hardware and software. No prior experience with programming
should be necessary in order to use this book.
This book is intended to be used for the College Board’s Advanced Placement
course known as AP Computer Science Principles (CSP). This course is not to
be confused with a more traditional course known as AP Computer Science A,
which places a strong emphasis on programming, currently using Java. The
author(s) of this book have included all the topics that are in CSP.1 We feel
that there are some related topics which may be of interest to those who are
new to computer science; in many cases we have included these extra topics,
but they are denoted by a ⊗ symbol to indicate they are not part of the official
CSP course, and students taking the AP CSP exam will not be responsible for
these topics. Since the AP exams are given in early May, and most school years
end in mid-June, many may wish to visit these extra topics after taking the AP
exam.
The author(s) believe that a breadth-first approach is the best way to intro-
duce the concepts of Computer Science to students. Rather than isolate topics
in courses (bits and bytes in a computer organization course; formal grammars
and languages in a theory course; lists, sets, and maps in a data structurs course;
etc) we believe that topics should be introduced in a brief and simple manner
at the starting level. Elaboration on these topics should occur in subsequent
courses. This breadth-first approach allows the student to build on existing
knowledge and retain a greater proportion of the material.
Our colleagues in the physical sciences have done this for over a century:
Physics I, Physics II, Physics III; Chemistry I, Chemistry II, Chemistry III.
Some examples of this breadth-first approach to Computer Science:
• We teach the rudiments of binary numbers. Is this necessary to learn
to program the solution to a simple problem? Probably not, but it will
become necessary at some later time, when studying hardware, or the
limitations of software.
1 We are using the Computer Science Principles Framework dated 2020, by the The College
Board.
i
ii PREFACE
• Every introductory programming book teaches the concept of an arith-
metic expression. We give a formal definition, and show the structure
of an expression by placing boxes around sub-expressions. The student
thinks we are teaching how to write a correct expression; we are actually
teaching recursion, formal grammars, and derivation trees.
The student thinks we are teaching programming, but we are actually teach-
ing Computer Science. Knowledge is not separated into compartments, and our
curriculum should not attempt to do so.
Though the Computer Science Principles course is not intended to be a
computer programming course, it does have a brief introductory programming
component. For that purpose there are editions of this book which use either
Java or Python (an edition using C++ is planned). Check the title page or
table of contents to determine which edition you are viewing.
This book is an open source book. That means that not only is the pdf
version available (to potential students and teachers) for free download, but
that the original (LaTeX) source files are also available (to potential authors
and contributors). Based on the model of open source software, open source for
textbooks is a relatively new paradigm in which many authors and contributors
can cooperate to produce a high quality product, for no compensation. For
details on the rationale of this new paradigm, and citations for other open
source textbooks, see the journal Publishing Research Quarterly, Vol. 30, No.
1, March 2014. The source materials and pdf files of this book are licensed with
the Creative Commons NonCommercial and Attributioon licenses (NC+BY),
which means that they may be freely used, copied, or modified, but not for
financial gain, and that the author(s) must be cited.
This book is available in pdf at [Link] /oer.
The source files are available at [Link]/∼bergmann/books.
The primary author may be reached at bergmann@[Link]
Secondary Authors
Contributors
Kim Poolos, Rowan University
Minor Contributors
Poonam Gupta, Brunswick Academy
Technical Consultant
Joshua Grochowski, Rowan University
Contents
Preface i
1 Creativity 1
1.1 Computational Artifacts . . . . . . . . . . . . . . . . . . . . . . . 1
1.1.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.2 Creative Expression and Problem Solutions . . . . . . . . . . . . 3
1.2.1 Tool: Computer with Office Package . . . . . . . . . . . . 3
1.2.2 Tool: Computer with Programming Environment . . . . . 3
1.2.3 Other Tools . . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.2.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
1.3 Extending the Human Experience . . . . . . . . . . . . . . . . . . 9
1.3.1 Creativity . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
1.3.2 Problem solution . . . . . . . . . . . . . . . . . . . . . . . 10
1.3.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2 Abstraction 15
2.1 Binary sequences and digital devices . . . . . . . . . . . . . . . . 15
2.1.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.2 Representing integers . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.2.1 Number systems . . . . . . . . . . . . . . . . . . . . . . . 17
2.2.2 Representing positive integers . . . . . . . . . . . . . . . . 20
2.2.3 Representing negative integers . . . . . . . . . . . . . . . 22
2.2.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
2.3 Representing non-integer numbers . . . . . . . . . . . . . . . . . 26
2.3.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
2.4 Representing integers with unlimited precision⊗ . . . . . . . . . . 28
2.4.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
2.5 Representing plain text . . . . . . . . . . . . . . . . . . . . . . . 29
2.5.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.6 Representing graphic images . . . . . . . . . . . . . . . . . . . . . 30
2.6.1 Black and white images . . . . . . . . . . . . . . . . . . . 30
2.6.2 Color images . . . . . . . . . . . . . . . . . . . . . . . . . 32
2.6.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
2.7 Representing sound and video . . . . . . . . . . . . . . . . . . . . 33
iii
iv CONTENTS
2.7.1 Representing sound . . . . . . . . . . . . . . . . . . . . . 33
2.7.2 Representing video . . . . . . . . . . . . . . . . . . . . . . 34
2.7.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
2.8 Looking into memory . . . . . . . . . . . . . . . . . . . . . . . . . 36
2.8.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
2.9 Abstractions in programs . . . . . . . . . . . . . . . . . . . . . . 38
2.9.1 Program abstractions . . . . . . . . . . . . . . . . . . . . 38
2.9.2 Levels of abstraction in software . . . . . . . . . . . . . . 41
2.9.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
2.10 Levels of abstraction in hardware⊗ . . . . . . . . . . . . . . . . . 46
2.10.1 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
2.11 Levels of Abstraction in Models and Simulations . . . . . . . . . 57
2.11.1 Weather . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
2.11.2 Evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
2.11.3 Warfare . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
2.11.4 Biological Populations and Environments . . . . . . . . . 62
2.11.5 Climate . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64
2.11.6 Training . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
2.11.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
3 Data and Information 69
3.1 Information Processing . . . . . . . . . . . . . . . . . . . . . . . . 69
3.1.1 Processinig Information to Gain Insight or Knowledge . . 69
3.1.2 Collaboration . . . . . . . . . . . . . . . . . . . . . . . . . 70
3.1.3 Explanation with Visualization or Notation . . . . . . . . 71
3.1.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
3.2 Information: Exploration and Discovery . . . . . . . . . . . . . . 73
3.2.1 Extracting Information from Large Datasets . . . . . . . . 73
3.2.2 Data analytics⊗ . . . . . . . . . . . . . . . . . . . . . . . 76
3.2.3 Machine learning⊗ . . . . . . . . . . . . . . . . . . . . . . 76
3.2.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
3.3 Digital Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
3.3.1 Time and Space Efficiency . . . . . . . . . . . . . . . . . . 77
3.3.2 Security and Privacy . . . . . . . . . . . . . . . . . . . . . 77
3.3.3 Access to Data . . . . . . . . . . . . . . . . . . . . . . . . 78
3.3.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
4 Algorithms 80
4.1 Algorithm design and implementation . . . . . . . . . . . . . . . 80
4.1.1 Variables, assignments, and the sequence control structure 81
4.1.2 Boolean expressions and selections . . . . . . . . . . . . . 82
4.1.3 Iteration . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
4.1.4 Lists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
4.1.5 Nested control structures . . . . . . . . . . . . . . . . . . 93
4.1.6 Abstraction of Algorithms: Procedures . . . . . . . . . . . 94
4.1.7 Languages for Algorithms . . . . . . . . . . . . . . . . . . 106
CONTENTS v
4.1.8 Robot algorithmic language . . . . . . . . . . . . . . . . . 108
4.1.9 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
4.2 Limitations of algorithms . . . . . . . . . . . . . . . . . . . . . . 112
4.2.1 Algorithm performance . . . . . . . . . . . . . . . . . . . 112
4.2.2 Solvable problems . . . . . . . . . . . . . . . . . . . . . . 118
4.2.3 Undecidable problems . . . . . . . . . . . . . . . . . . . . 119
4.2.4 Evaluation of algorithms . . . . . . . . . . . . . . . . . . . 119
4.2.5 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 121
5 Programming (with Java) 123
5.1 Program development . . . . . . . . . . . . . . . . . . . . . . . . 123
5.1.1 Why program? . . . . . . . . . . . . . . . . . . . . . . . . 123
5.1.2 Problem solution . . . . . . . . . . . . . . . . . . . . . . . 124
5.1.3 Collaboration . . . . . . . . . . . . . . . . . . . . . . . . . 126
5.1.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
5.2 Algorithm implementation . . . . . . . . . . . . . . . . . . . . . . 127
5.2.1 Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . 127
5.2.2 Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . 128
5.2.3 Iteration . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130
5.2.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
5.3 Program abstractions . . . . . . . . . . . . . . . . . . . . . . . . 132
5.3.1 Reducing complexity with abstractions . . . . . . . . . . . 133
5.3.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 138
5.4 Program Development and Maintenance . . . . . . . . . . . . . . 139
5.4.1 Program correctness . . . . . . . . . . . . . . . . . . . . . 140
5.4.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 145
5.5 Programming with Mathematics and Logic . . . . . . . . . . . . 147
5.5.1 Using mathematics and logic . . . . . . . . . . . . . . . . 147
5.5.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
5.6 Hands-on programming: BlueJ IDE⊗ . . . . . . . . . . . . . . . . 149
5.6.1 Java classes . . . . . . . . . . . . . . . . . . . . . . . . . . 150
5.6.2 Java collections: Lists and Sets⊗ . . . . . . . . . . . . . . 150
5.6.3 Starting up: A main method . . . . . . . . . . . . . . . . 152
5.6.4 A complete Java program . . . . . . . . . . . . . . . . . . 153
5.6.5 Using an IDE . . . . . . . . . . . . . . . . . . . . . . . . . 154
5.6.6 The BlueJ IDE . . . . . . . . . . . . . . . . . . . . . . . . 154
5.6.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 159
6 The Internet 160
6.1 Brief history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160
6.2 A Network of Autonomous Systems . . . . . . . . . . . . . . . . . 160
6.2.1 How the internet functions . . . . . . . . . . . . . . . . . 161
6.2.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
6.3 Some Characteristics of the Internet . . . . . . . . . . . . . . . . 164
6.3.1 Hierarchical design and redundancy . . . . . . . . . . . . 164
6.3.2 Standards, growth, and scalability . . . . . . . . . . . . . 167
vi CONTENTS
6.3.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
6.4 Cybersecurity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
6.4.1 Addressing cybersecurity concerns . . . . . . . . . . . . . 168
6.4.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 177
7 Fault Tolerance 178
7.1 Fault tolerance in a single device . . . . . . . . . . . . . . . . . . 178
7.2 Fault tolerance in a network . . . . . . . . . . . . . . . . . . . . . 179
7.3 Redundancy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
7.4 Fault tolerance in software . . . . . . . . . . . . . . . . . . . . . . 180
7.5 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180
8 Parallel and Distributed Computing 181
8.1 Parallel computing . . . . . . . . . . . . . . . . . . . . . . . . . . 181
8.1.1 Run-time savings with parallelism . . . . . . . . . . . . . 182
8.1.2 Parallelism in personal computers . . . . . . . . . . . . . 184
8.1.3 Instruction stream and data stream parallelism . . . . . . 185
8.1.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 188
8.2 Distributed Computing . . . . . . . . . . . . . . . . . . . . . . . 189
8.2.1 Client-server terminology . . . . . . . . . . . . . . . . . . 189
8.2.2 Distributed computing and parallel computing . . . . . . 189
8.2.3 Types of distributed systems and examples . . . . . . . . 190
8.2.4 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
9 Global Impact 199
9.1 Communication, Interaction, and Cognition . . . . . . . . . . . . 199
9.1.1 Computing innovations . . . . . . . . . . . . . . . . . . . 199
9.1.2 Scaling of the problem-solving process . . . . . . . . . . . 207
9.1.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 209
9.2 Impact on Innovation . . . . . . . . . . . . . . . . . . . . . . . . 211
9.2.1 Impact on other fields . . . . . . . . . . . . . . . . . . . . 211
9.2.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 216
9.3 Global Impact on Society . . . . . . . . . . . . . . . . . . . . . . 217
9.3.1 Beneficial and harmful effects of computing . . . . . . . . 217
9.3.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
9.4 Social contexts for innovations in computing . . . . . . . . . . . . 228
9.4.1 Contexts . . . . . . . . . . . . . . . . . . . . . . . . . . . 228
9.4.2 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
9.5 Research . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
9.5.1 Information management . . . . . . . . . . . . . . . . . . 230
9.5.2 Credible and appropriate sources . . . . . . . . . . . . . . 232
9.5.3 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . 233
Glossary 234
Chapter 1
Creativity
Over the course of many centuries, civilization has evolved as a result of the
creative efforts of humans. Whether it be in the arts, sciences, mathematics,
psychology, medicine, or philosophy each generation has passed its accomplish-
ments to succeeding generations.
In this chapter we examine creativity from a computational perspective. We
attempt to answer the question: What are the computational creative processes
currently in use, and what have they created?
1.1 Computational Artifacts
An artifact is something that does not occur naturally but which has been cre-
ated by humans. Examples of artifacts are screwdrivers, automobiles, rocket
ships, skyscrapers, oil refineries, books, and computers. A computational ar-
tifact is an artificat which results from a computational process, usually by
a computer or other digital device. Examples of computational artifacts are
computers, tablets, telephones, information systems, the internet, and search
engines.
When creating a new artifact, humans often use existing methods or pro-
cesses. However, sometimes they must modify existing methods, or construct
totally new methods, to arrive at a new process in the construction of artifacts.
For example, when the internet1 was created in the 1980’s, computers, large
and small, were commonplace in universities, business, industry, and govern-
ment. These computers were able to communicate with each other in pairs,
but there was no way for large groups of computers to communicate efficiently
with each other. Then a process known as TCP/IP2 was created to facilitate
communication among lots of computers, and the internet was born.
A more recent example of a creative process took place in 2006. At that
time people had the capability of sharing text, photographs, sound clips, etc.
1 Here we are really talking about a predecssor of the internet, known as the ARPAnet
2 Transmission Control Protocol/Internet Protocol
1
2 CHAPTER 1. CREATIVITY
Figure 1.1: Developed in 2006 by Mark Zuckerberg, Facebook became a creative
success, connecting people all over the world.
through email. Then Mark Zuckerberg went public with FacebookT M , and
suddenly there was a huge surge of interest in sharing data. Everyone wanted
to make their own experiences, in the form of text, pictures, videos, etc, available
to everyone else in the world. Why? Mainly because it was so easy to do. Few
gave any thought to the advisability of making this personal information public,
or to the huge financial impact that this data would have for Facebook: If a
company such as Facebook knows everything about you - your preferences in
clothing, food, travel, that company has valuable marketing information for
sale.
Facebook, as a computational artifact, was a creative success (see Fig-
ure 1.1).
1.1.1 Exercises
1. Give examples of computational artifacts other than those listed in this
section.
2. Give examples of computational processes, such as Facebook, which suc-
ceeded in changing the way people use computing devices.
3. Create your own computational artifact. Use a computer, phone, tablet,
or similar digital device.
4. (a) In a few sentences describe the ‘Internet of Things’ (IOT). Use Wikipedia
(itself a computational artifact) or other resources to research this
collection of artifacts.
(b) Give some examples of devices which are included in the IOT.
1.2. CREATIVE EXPRESSION AND PROBLEM SOLUTIONS 3
(c) Describe some potential dangers or calamities that could occur in-
volving the IOT if it were to fail or if criminals gained improper
access to it.
1.2 Creative Expression and Problem Solutions
In this section we provide some answers to the question: How can we create a
computational artifact? The hardware tools to be used here include computers,
tablets, and phones. Each of these tools is packaged with software tools for
various purposes.
1.2.1 Tool: Computer with Office Package
A computer equipped with a package of tools - word processor, spreadsheet,
presentation, email, web browser - can be used to create computational artifacts.
This package of tools could be Microsoft Office, Open Office, or other similar
package. Web browsers include (Apple) Safari, (Google) Chrome, (MicroSoft)
Internet Explorer, and (Mozilla) Firefox. Some examples of artifacts that could
be created with these tools are shown below:
Tool Artifact
Word processor Term paper
Spreadsheet Record of expenses
Presentation Slide show for a research report
Web Browser Map of Moscow, labeled with Wikipedia
descriptions of historic sites
1.2.2 Tool: Computer with Programming Environment
[Link] Compilers, Interpreters, and IDEs
A computer is capable of executing a sequence of instructions, coded as binary
numbers, to perform a task. We have developed software, such as compilers and
interpreters, to facilitate the production of these binary programs.
A high level programming language is designed for ease of use by people.
Some common programming languages are Java, C++, Python, and Visual
Basic. A compiler is a translator. It translates a program written in a high
level language to an equivalent program3 written in the computer’s machine
language. An interpreter never produces a machine language program. Instead
it scans the program and carries out the instructions. Python and Java are
examples of two high level languages which are normally interpreted, rather
than compiled.
An Integrated Development Environment (IDE) is a tool which facilitates
software development and includes capabilities such as:
3 Two programs are said to be equivalent if they have the same input-output relation, i.e.
they have the same purpose.
4 CHAPTER 1. CREATIVITY
• Enter and edit program text
• Compile and execute a program
• Locate and fix errors in a program (debugger)
• Manage large collections of software modules
Some examples of common IDEs are
• Eclipse - for use with a variety of languages
• For java programs - BlueJ, IntelliJ, and NetBeans.
• For C or C++ programs - Visual Studio
[Link] Programming the Computer
Here we provide a general description of programming, and the features of a
high-level programming language. A program consists of key words, such as
for, if , else, and while; also special characters such as parentheses, brackets,
semicolons, and arithmetic operators. These keywords and special characters
must be used in a way which conforms to the syntax specification of the language
being used; this is like forming an English sentence according to the rules of
English grammar.
A program will consist of:
• Variables - each variable can store a value. In most programming lan-
guages the type of value that can be stored is determined and specified,
by a declaration in the program. Some common types are
– integer (positive and negative whole numbers),
– floating point (positive and negative numbers with decimal places,
and/or exponents of 10 for scientific notation)
– boolean - true/false value.
– string - Any literal string of characters from the keyboard, usually
enclosed in quotation marks, such as "#3cx?$$bz"
– Most languages also provide the capability of programmer-defined
types which are constructed using the types provided by the language
as building blocks for more complex data types.
Variable names typically are made up of letters (and digits) and give the
programmer the capability of creating meaningful names for variables,
such as salary and year2000.
• Specification of calculations, and the assignment of values to variables.
These are normally algebraic expressions, of various types. The value of
an expression can be assigned to a variable. For example:
1.2. CREATIVE EXPRESSION AND PROBLEM SOLUTIONS 5
sum = a + b + c * 3
The intent is to to add the current values of a, b, and c multiplied4 by
3, and store the result into the variable sum. Another example, using an
expression which has a true/false value:
valid = salary > 0 and hoursWorked > 20
In each of these examples the equal sign (=) does not mean ‘equals’ in the
usual sense; it means: find the value of the expression on the right, and
assign that value to the variable on the left.
• Data structures - Aggregates of related variables grouped together. For
example, a Date data structure could consist of day, month, and year.
• Control structures - Normally the statements in a program are executed
sequentially, in the order in which they are coded in the program. Control
structures provide the capability of altering this sequential flow of control.
Examples of control structures are:
– One-way Selection - A decision is made to execute (or not execute) a
path, or sequence of statements, in a program. The decision may be
based on the current values of variables, i.e. the state of the program.
This control structure typically uses the key word if:
if (true/false expression) statement(s) to be executed only if
the expression is true.
– Two-way Selection - A decision is made to execute one of two paths
through the program, using the key words if and else:
if (true/false expression)
statements executed if expression is true
else
statements executed if expression is false
– Repetition - A sequence of statements is executed repeatedly, a spec-
ified number of times, or until a condition is met. This control struc-
ture is often called a loop,5 or an iteration. Some examples:
while (x > 0) x = x - 3
The value of the variable x is decreased by 3, as long as its value is
positive.
for (i=0; i<10; i=i+1) print i
The variable i is given the initial value 0. The print statement is
executed repeatedly, as long as the value of i is less than 10, and
each time the print statement is executed the value of i is increased
by 1. The loop is repeated exactly 10 times.
4 Multiplication is expressed by an asterisk in most languages, to differentiate with the
variable x
5 The word loop is derived from diagrams of control structures, in which a repetition appears
as a circular loop.
6 CHAPTER 1. CREATIVITY
• SubPrograms - Program modules which are self-contained, with a spe-
cific purpose, and which can be invoked from a main program, or from
other subprograms. Subprograms are often called procedures, functions,
methods, or simply subs, depending on the programming language. A sub-
program may have an explicit result and 0 or more parameters, in which
case it is similar to a mathematical function. Example:
x = -b + sqrt(b*b - 4*a*c)
The sqrt subprogram (i.e. function) has one parameter, the value of
the expression b*b - 4*a*c. It returns the square root of its parameter,
which is then added to -b, and the result is stored in the variable x.
• Input/output - A program may need to obtain input from a peripheral
device such as the keyboard, mouse, scanner, or disk storage. This is
called input. A program may need to send information to a peripheral
device such as a display, printer, or disk storage. This is called output.
In many programming languages input and output are implemented with
subprograms.
1.2.3 Other Tools
Here we summarize some other tools used to create computational artifacts.
[Link] Image processing
Tools such as Adobe Photoshop can be used to modify and/or enhance digital
images. Some features of Photoshop include drawing, cropping, moving, erasing,
and color replacement. Photoshop has become so widely used, as compared with
other image processing software, that the word ‘photoshop’ is often used as a
verb.
Other, more scientific, examples of image processing include:
• Enhancement of photographs with poor resolution (blurred images) using
edge-finding methods to improve the resolution. This is done in astronom-
ical images, producing details in images of remote planets, stars, galaxies.
• Robotic vision systems provide raw data from a camera, and are designed
to interpret that raw data as meaningful objects (chair, desk, pen, ...)
• X-ray and MRI machines used in health care can be improved to help the
radiologist identify malformations (tumors, hairline bone fractures, small
blocked arteries, etc.) which are difficult to spot.
• X-ray machines used for security at airports, concert venues, and sport
venues are enhanced with image processing software to find restricted
objects such as weapons and explosives.
1.2. CREATIVE EXPRESSION AND PROBLEM SOLUTIONS 7
[Link] Web page development
World Wide Web pages originally contained text and graphics content for dis-
play coded in HTML6 . In recent years this language has been improved to
provide sound, video, interaction with the user, and database capabilities. A
web page designer can use tools such as Adobe Flash, Google Web Designer,
EZGenerator, and Microsoft Expression Web.
[Link] Video production
Most digital cameras have the capability of recording moving images, with
sound; these recordings are known as video clips. Software enables the edit-
ing of one or more clips to remove sections or splice sections of video content.
Examples of software tools include: Blender VSE, Ldenlive, Shotcut, and Na-
tron. Video production has experienced a huge surge in popularity in recent
years, largely as a result of the popularity of free hosting sites on the Internet,
such as YouTube.
[Link] Database management
Large collections of data often need to be organized in such a way that needed
information can be extracted easily and quickly. A Database Management Sys-
tem (DBMS) serves this purpose. Major developers of DBMS software include
SAP, Oracle, and MicroSoft (Access).
[Link] Game development
Digital games have had a big impact on society. Platforms for games include
special purpose devices (Xbox, Playstation), general purpose computers, and
web-based games. Most games are designed for stand-alone single players, but
some allow for multiple players, co-located, or remotely connected on the Inter-
net.
[Link] Artificial Intelligence
Artificial Intelligence (AI) has been defined as the instilling in machines of ca-
pabilities normally associated only with human intelligence. Over the years the
nature of AI has changed. For example, many years ago the development of
chess-playing software was included as AI research. However, with advances
in the speed of computer hardware, and the programming of winning strate-
gies, champion-level chess playing machines are more common, and no longer
considered part of AI.
With the advent of lower storage costs and the Internet, huge amounts of
data have accumulated on public computers (known as ‘the cloud’). Searching
this enormous repository of information, and drawing meaningful conclusions
6 HyperText Markup Language
8 CHAPTER 1. CREATIVITY
from it, is now the domain of AI. There are many examples of this in business,
military, and healthcare domains.
[Link] Robotics
One important part of AI is robotics. 7
Once the realm of science fiction, robotic devices have become pervasivie in
modern society. Self-driving vehicles are a reality and are likely to reduce trans-
portation costs of people and goods in the near future (as well as eliminating
jobs for human drivers).
Manufacturing assembly lines (particularly for automobiles) have made ex-
tensive use of robotic arms (with vision capability)
Military applications of robotics include devices used for reconnaisance and/or
battle, such as flying drones, missiles with vision and course-correction, and
land-based mobile units.
Household robots are becoming increasingly popular for cleaning, security,
controlling of appliances, and even baby-sitting.
1.2.4 Exercises
1. Given a spreadsheet containing a column of numbers, show formulas to
calculate the average, maximum, and minimum value at the bottom of the
column.
2. Given a word processing document, show how spelling and grammar can
be checked for accuracy. Find examples of English sentences which contain
spelling and grammatical errors, that your word processor does not detect.
3. Use a slide presentation applicaton to draw a rough diagram, or map, of
your school’s main classroom building.8
4. If you are familiar with a programming language, such as Java, C++, or
Python, write a program to find the smallest value in a list of numbers.
5. The section on Other Tools mentions Image Processing. A self-driving
car manages to move through a city, obeying traffic laws, and avoiding
collisions. Describe some of the problems the self-driving car will need
to solve. What constitute the inputs to the car. How would it process
that input? What knowledge would have to be pre-programmed into the
self-driving car?
7 Isaac Asimov’s three laws of robotics (circa 1950):
I. A robot may not injure a human being or, through inaction, allow a human being to come
to harm.
II. A robot must obey the orders given it by human beings except where such orders would
conflict with Law I.
III. A robot must protect its own existence as long as such protection does not conflict with
Laws I or II.
8 Microsoft Powerpoint and LibreOffice Presentation are examples of a slide presentation
application.
1.3. EXTENDING THE HUMAN EXPERIENCE 9
6. Build your own web page using one of the following tools:
• Code your web page in HTML (HyperText Markup Language) using
a plain text editor such as TextEdit (Mac) or NotePad (Windows).
HTML commands are begun with a tag in angle brackets, and ter-
minated by the same command, preceded by a slash. For example,
This concept is <bold> important </bold> to remember.
• Use a packaged web developer tool which displays the web page as you
are developing it. Some popular tools are: Sublime Text, Chrome
Developer Tools, jQuery, GitHub, Twitter Bootstrap, [Link],
and Sass9
• Use a developer site, such as [Link], which has pre-fabricated
components for your web page.
7. Create a video clip of yourself making a video clip. Use an application
such as QuickTime on a Mac, or MultiMedia Player on a Windows PC.
8. Use Microsoft Access, or similar application to create a database of your
favorite professional sport league. Include games played, scores, rosters,
etc.
9. Give some examples of applications of robotics not mentioned in this sec-
tion.
1.3 Extending the Human Experience
What is it that sets humans apart from less intelligent forms of life? We know
that whales and apes can communicate with each other in fairly sophisticated
ways and many life forms can solve problems which have been posed for them
in a lab setting, especially when rewarded with food. However, most other life
forms do not possess the gift of creativity which humans have. This creativity
could involve the development of tools and technology, or it could involve more
aesthetic artifacts such as music, art, language, poetry, etc.
1.3.1 Creativity
Many forms of creative expression use a computer simply for convenience. A
simple drawing, sketch, or even a painting can be done manually, or with a
computer. However, more ambitious creations would never have been possible
without computers. One good example is the generation of special effects for
movies, and entire movies, which involve so-called animation. In movies such as
Cars, Toy Story, The Lion King, the Star Wars series, etc. Life-like animated
characters and scenes are so realistic that it is often difficult to distinguish
9 Wikipedia
10 CHAPTER 1. CREATIVITY
between what is animated and what is real. 10 Large companies, such as Pixar,
DreamWorks, and Industrial Light & Magic have been formed to produce movies
with animation technology.
With music similar tools have been developed to aid composers with the
creation, orchestration, and play-back of musical compositions. The composer
can now get immediate feed-back on a composition without involving performing
artists, speeding up the composition process immensely.
Modern art has seen an influx of creations by humans, using the computer
to draw still or animated images. Many of these are so complex that they would
not have been possible without the computer.
However, in both art and music, the actual creation has largely been done by
humans, using the computer as a tool. While it is true that this has resulted in
artifacts that the human might not have been able to create without using the
computer, attempts at computer-composed music and art have not yet evolved
in the main stream of publicly appreciated arts. If and when this happens, it
would mark a quantum step forward for AI.
1.3.2 Problem solution
Here we attempt to answer the question: How have computers aided in the
solution of problems?
In today’s world it is rare that any complex problem is solved without aid
from a computer, particularly those problems which involve the analysis of much
data. Some of the more important and common examples are:
• Weather forecasting is extremely important to commerce, transportation,
military, and agriculture. It is not done simply so that you know whether
to bring an umbrella. You may have noticed that in the last decade
weather forecasts have become increasingly more accurate, long-range,
and specific to a time and place (see Figure 1.2). Weather forecasting is
done by simulating atmospheric conditions on a fast computer with lots of
memory, or on a cluster of fast computers. This simulation software stores
large arrays of atmospheric conditions such as air temperature, pressure,
humidity, and wind velocity over a large geographic area. Each such ar-
ray represents conditions at a specific instant of time. The computer is
programmed to deduce the values of these arrays at the next incremental
instant of time. Without computers this kind of simulation would not be
at all feasible (which is why mid-twentieth century weather forecasting
was so poor, as compared with today).
• Any large complex system of tasks can now be organized using a computer.
These had been done in the past, without computers, but not on a large
scale. Examples are:
10 The problem of producing output which is indistinguishable from human expression is
usually referred to as the Turing Test of Intelligence. This measure of intelligence was first
defined in 1950 by the British Mathematician Alan M. Turing, the father of computing.
1.3. EXTENDING THE HUMAN EXPERIENCE 11
Figure 1.2: A web site for weather forecasting provided by the U.S. National
Weather Service: [Link]
12 CHAPTER 1. CREATIVITY
– Transportation systems, such as airline flight scheduling. Hundreds,
if not thousands, of flights are scheduled daily, requiring coordination
of crews, airport runways, flight paths, etc. All this was done before
the advent of computers, but not on a large scale.
– Construction of large buildings, such as skyscrapers involves a de-
tailed process of sequential steps: ironwork, concrete/synthetic walls
and floors, wiring for electric power and communications, HVAC.
This is now coordinated with computers, facilitating the construc-
tion of increasingly complex structures.
– Communication systems, such as telephone, television, and the inter-
net itself, now rely entirely on digital computer technology.
– Supply chain and inventory applications are now much larger and
more complex than ever. Without computers, a large retail outlet
such as Wal-Mart would not have been possible.
• Data analytics11 is the science of extracting useful information from large
quantities of data. This process allows us to discover valuable marketing
information when applied to the behavior of people on the internet. In
health care, data analytics can be used to draw conclusions about disease
using information such as geography, nutrition, air quality, etc.
• Techniques in artificial intelligence and robotics are enabling us to diag-
nose disease, perform surgery, and build self-driving vehicles.
• Ancient Greek, Arabic, and Asian civilizations were known to have made
independent discoveries in mathematics. Some, particularly the Greeks,
were able to prove important theorems and describe natural phenomena
mathematically. However there are several theorems which remained un-
proven - until the computer age arrived. Using the computer as a tool,
or assistant, mathematicians have been able to solve the following mathe-
matical problems. Some examples of important theorems which were too
difficult for humans to prove, but were proved with the aid of computers
are:
– The four-color-map theorem: Given a plane with regions (e.g. a
map) the regions may be assigned colors such that no two neighbor-
ing regions have the same color. This can be done using only four
different colors (see Figure 1.3).
In the nineteenth century it was proved that this could be done with
five colors, and it was conjectured that four colors are sufficient, but
no one was able to prove this until 1976 when mathematicians at
the University of Illinois used a computer to search through a large
space of maps to complete the proof. This was the first time that a
computer had been used for a difficlut proof, and it was initially met
with skepticism and controversy. Today it is widely accepted.
11 Many now define Data Analytics as Applied Data Science.
1.3. EXTENDING THE HUMAN EXPERIENCE 13
Figure 1.3: After trying for centuries, mathematicians were finally able to prove,
with help from a computer, that any map can be colored with only four colors
– Many are familiar with the popular game called Rubik’s Cube, consit-
ing of 27 adjoining multi-colored ccubes in 3 planes of 9 cubes each.
Each plane can be rotated to form a new configuration. The object
is to rotate planes until each face consists of cubes of the same color.
In 2010 a group of researchers used a supercomputer to prove that
any initial configuration or a Rubik’s Cube can be solved in at most
20 face turns.
– The Boolean Pythagorean Triples Problem. A Pythagorean Triple
consists of three positive integers, (a,b,c) such that a2 + b2 = c2 . One
well-known Pythagorean Triple is (3,4,5), which are the lengths of the
sides of a right triangle. Other examples are (5,12,13) and (28,45,53).
The Boolean Pythagorean Triples Problem asks whether it is possible
to assign one of two colors to every positive integer, such that the
three integers in no Pythagorean Triple are all the same color.
In 2016 researchers at the University of Texas showed that such a col-
oring is possible only up to 7824. Using a computer system consisting
of thousands of CPUs, the proof took two full days.
Software has also been developed to create proofs from scratch. Given
a logical proposition, the computer outlines a proof of the proposition.
Some examples of such systems are shown below:
12
– E is a theorem-proving software system for first-order logic which
was developed at the Technical University of Munich.
– Otter was developed at Argonne National Lab. It has been replaced
by Prover9.
– SETHEO (Set Theory) is based on model elimination calculus from
the Technical University of Munich. E and SETHEO have been com-
bined to form a more powerful theorem prover known as E-SETHEO.
12 A logic system which has not only true-false statements (propositions) but also quantifiers
such as for-all and for-each, forming what is known as a predicate calculus.
14 CHAPTER 1. CREATIVITY
1.3.3 Exercises
1. Name a few movies in which it is difficult to determine the difference
between live recorded images and computer-generated images. Are there
any scenes where live recorded images are enhanced by a computer?
2. What are the most accurate weather forecasting sites?
• Web sites: [Link]? [Link]?
• TV stations: CBS local news, ABC local news, NBC local news?
• Accuweather reported on the radio?
Maintain a database of predictions by these various forecasters, and recored
the actual conditions (precipitation, temperature, humidity, wind, etc.) on
each date, to determine which is the most accurate.
3. Which professional sports use data analytics to adjust their play or strate-
gies? How is the data used?
Chapter 2
Abstraction
Today’s world is filled with a huge morass of details, most of which we may find
unintelligible, useless, and/or uninteresting. The process of abstraction is what
we use to ignore the details which we don’t need, and extract useful information
from the details which are needed. This process of abstraction is something we
do all the time, without giving it much thought. For example, think of all the
light rays entering your eye’s pupil and triggering impulses to the visual cortex
in your brain, right now. Your brain has learned to ignore much of what is
coming in, to focus on what it needs (the letters making up this text), and to
extract (hopefully) useful meaning from those letters.
This chapter will investigate some of the ways that abstraction is used in
computer science. It is used to simplify the design of complex software or
hardware components, to process large quantities of data, to facilitate artificial
intelligence or robotics.
2.1 Binary sequences and digital devices
Computers are binary machines. That means they are constructed from bi-
stable devices - devices which can be in one of two states at any one time.1
Any machine composed of bi-stable devices is said to be digital. Any machine
which is not digital is said to be an analog machine. For example, a wall clock
showing hour, minute, and second hands is analog (though its inner workings
may use digital electronics). A clock which shows the hour, minute, and seconds
numerically is digital.
Years ago small metal doughnut-shaped cores were used as bi-stable devices.
The two states were determined by the direction of magnetization in the core
(clock-wise or counter-clockwise). 2
1 The advent of quantum computing will change this. A qubit can be in two different states
at the same time, but that is beyond the scope of this text.
2 Since these metal cores were used to build memory, the word ’core’ was used interchange-
ably with ’memory’, hence the phrase ’core dump’ is still used today.
15
16 CHAPTER 2. ABSTRACTION
In more recent years semiconductor materials3 have a huge matrix of densely
populated ’holes’ in which the presence, or absence, of an electron determines
the state.
Whatever physical device is used, we refer to the two states of the device as
0 and 1. Each device (i.e. each core, or each semiconducto hole) is referred to as
a binary digit, or bit. An example of a sequence of bits is 01101110. Computers
can use bit sequences to represent various kinds of information, such as integers,
numbers which are not integers, plain text, graphic images, sound, and video
clips. When we represent information as a binary sequence (a sequence of 0’s
and 1’s) we refer to the information as digital information; or we may say the
information has been digitzed.
2.1.1 Exercises
1. A binary sequence has a length. For example the length of the binary
sequence 10011 is 5 bits. Fill in the empty cells in the table shown below:
Binary sequence example Length Number of different
sequences of the same length
10011 5 bits 32
3 bits
111111
1024
2. In how many ways can checkers be placed on an 8x8 checker board, with
no more than 1 checker on each square? You may give your answer as a
power of 2.
3. Construct a digital device using small squares of paper. One side of each
paper square should have an X.
(a) Arrange some of the paper squares in a row on a table top to represent
the bit sequence 11001110, where the X side represents a 1, and the
other side represents a 0.
(b) The length of your bit sequence is 8 bits. How many different bit
sequences of length 8 could you form?
4. During the American revolution, Paul Rever was told to look at the lights
in the steeple of Christ Church in Boston, to determine how the British
were attacking: one if by land, two if by sea.
Apparently there were two lights in the steeple. How many different mes-
sages could have been formed with the two lights?
3 Silicon, Germanium, and other elements have semiconductor properties.
2.2. REPRESENTING INTEGERS 17
1 0 3 7
100 = 1
101 = 10
102 = 100
103 = 1000
Figure 2.1: The decimal representation of 1037 (1037 = 1000 + 0 + 30 + 7)
2.2 Representing integers
Here we introduce one way of representing whole numbers using a sequence of
bits, i.e. we introduce a digital representation for whole number.
2.2.1 Number systems
[Link] Decimal numbers: base 10
In the ninth century AD Arab and Hindu mathematicians independently devised
a representation for whole numbers using ten symbols.4 Today we call this the
decimal or base 10 system. The low order digit in a base 10 number represents
a multiplier of 1 (100 ).5 The next digit represents a multiplier of 10 (101 ). The
next digit represents a multiplier of 100 (102 ). The digit at position i represents
a multiplier of 2i , as shown in Figure 2.1. For example, the number 1024 can
be thought of as: 1 × 103 + 0 × 102 + 2 × 101 + 4 × 100
[Link] Binary numbers: base 2
In computer science we are interested in binary numbers, i.e. base 2, because
computers work exclusively with bistable devices as explained in the previous
section. Therefore, a whole number will be represented by a sequence of binary
digits (a sequence of bits). The low order digit in a base 2 number represents
a multiplier of 1 (20 ). The next digit represents a multiplier of 2 (21 ). The
next digit represents a multiplier of 4 (22 ). The digit at position i represents
a multiplier of 2i , as shown in Figure 2.2. For example, the number 19 can be
thought of as: 1 × 24 + 0 × 23 + 0 × 22 + 1 × 21 + 1 × 20 , or 1001126 xxx
The
[Link] Octal numbers: base 8⊗
In computer science we will frequently need to display memory contents as a
sequence of bits. For convenience, a sequence of bits can be expressed in base 8,
4 It is generally believed that they used 10 symbols because humans have 10 fingers.
5 x0 is 1 for any value of x.
6 The subscript on a number represents the base; here we will assume that the base is a
decimal number. For base 16 we will occasionally use the letter x.
18 CHAPTER 2. ABSTRACTION
1 0 0 1 1
20 = 1
21 = 2
22 = 4
23 = 8
24 = 16
Figure 2.2: The binary representation of 19 (19 = 16 + 2 + 1)
1 0 3 7
80 = 1
81 = 8
82 = 64
83 = 512
Figure 2.3: The octal representation of 543 (543 = 512 + 0 + 24 + 7)
or octal (the symbols are 0,1,2,3,4,5,6,7). Each octal symbol represents 3 bits,
as shown in the table below.
octal binary
0 000
1 001
2 010
3 011
4 100
5 101
6 110
7 111
The low order digit in a base 8 number represents a multiplier of 1 (80 ).
The next digit represents a multiplier of 8 (81 ). The next digit represents
a multiplier of 64 (82 ). The digit at position i represents a multiplier of 8i ,
as shown in Figure 2.3. For example, the number 135 can be thought of as:
2 × 82 + 0 × 81 + 7 × 80 or 2078 .
By interpreting each octal digit as 3 binary digits, we can easily see the
sequence of bits that is represented by 2078 :
2 0 7
010 000 111 = 010000111
In recent years most computer scientists have come to favor base 16 (hexadec-
imal) to base 8 (octal) for a short-hand representation of a sequence of binary
2.2. REPRESENTING INTEGERS 19
digits.
[Link] Hexadecimal numbers: base 16
In computer science we will frequently need to display memory as a sequence
of bits. For convenience, a sequence of bits can be expressed in base 16, or
hexadecimal, sometimes abbreviated simply as hex. In base 16 we will need 16
symbols. Using the existing symbols from base 10 (0..9) we still need six more
symbols; we will use the symbols a,b,c,d,e,f.7 Thus the hexadecimal symbols
are 0,1,2,3,4,5,6,7,8,9,a,b,c,d,e,f. Each hexadecimal digit represents 4 bits, as
shown in the table below.
hexadecimal binary decimal
0 0000 0
1 0001 1
2 0010 2
3 0011 3
4 0100 4
5 0101 5
6 0110 6
7 0111 7
8 1000 8
9 1001 9
a 1010 10
b 1011 11
c 1100 12
d 1101 13
e 1110 14
f 1111 15
The low order digit in a base 16 number represents a multiplier of 1 (160 ).
The next digit represents a multiplier of 16 (161 ). The next digit represents a
multiplier of 256 (162 ). The digit at position i represents a multiplier of 16i ,
as shown in Figure 2.4. For example, the number 135 can be thought of as:
2 × 162 + 0 × 161 + 7 × 160 or 20716 .
By interpreting each hexadecimal digit as 4 binary digits, we can easily see
the sequence of bits that is represented by 1a516 :
1 a 5
0001 1010 0101 = 000110100101
When we wish to display a long sequence of bits, it is clearly more efficient
to display hexadecimal digits, rather than binary digits.
7 We use the lower case letters but many sources use the upper case letters A,B,C,D,E,F
to mean the same thing
20 CHAPTER 2. ABSTRACTION
2 1 3
160 = 1
161 = 16
162 = 256
Figure 2.4: The hexadecimal (base 16) representation of 541 (541 = 512 + 16
+ 3)
2.2.2 Representing positive integers
To store a positive whole number in the computer’s memory, we notice that a
sequence of bits can represent a whole number. We choose to use the sequence
which is equal to the base 2 representation of the whole number, as shown below.
In doing so, we will speak of the word size as the length of the sequence of bits
with which we are dealing. In the table shown below, the word size is 5 bits 8 .
8 Since the word size, 5, is not a multiple of 4, the high order hex digit represents 1 bit,
and may only be 0 or 1
2.2. REPRESENTING INTEGERS 21
Integer bit sequence hexadecimal
0 00000 00x
1 00001 01x
2 00010 02x
3 00011 03x
4 00100 04x
5 00101 05x
6 00110 06x
7 00111 07x
8 01000 08x
9 01001 09x
10 01010 0ax
11 01011 0bx
12 01100 0cx
13 01101 0dx
14 01110 0ex
15 01111 0fx
16 10000 10x
17 10001 11x
18 10010 12x
19 10011 13x
20 10100 14x
21 10101 15x
22 10110 16x
23 10111 17x
24 11000 18x
25 11001 19x
26 11010 1ax
27 11011 1bx
28 11100 1cx
29 11101 1dx
30 11110 1ex
31 11111 1fx
Note that with a 5-bit word, there are 32 different bit sequences; these range
from the binary values 0 through 31. If we had a 6-bit word, we would have
twice as many sequences, 64, ranging from 0 through 63. In general, for an n-bit
word there are 2n bit sequences; hence we can represent any positive integer in
the range [0..2n − 1].
If an arithmetic operation produces a result which is beyond the range de-
scribed above, this is known as an overflow condition. Computers can be pro-
grammed to halt execution when an overflow condition occurs. Alternatively,
they can continue to execute, with possibly meaningless results. For example
with a 5-bit word, the integers in the range [0..31] can be represented. If an
attempt is made to add 17+20, for example, overflow occurs because the true
22 CHAPTER 2. ABSTRACTION
result will not fit in a 5-bit word. If execution continues, the result will be 5:
10001 = 17
+ 10100 = 20
----------------
00101 = 5
The carry out of the high order digit is discarded. Most modern computers
have a word size of 64 bits, and can easily work with positive integers through
264 − 1. Most modern programming languages have data types which enable
the programmer to use 8, 16, 32, or 64-bit words.
2.2.3 Representing negative integers
We also wish to represent negative integers. Note that there are no ’-’ signs
in the computer’s memory; there are only 0’s and 1’2. Our strategy is to use
roughly half of the bit sequences to represent negative numbers, half to represent
positive numbers, and one of the bit sequences to represent 09 . We make the
following choices:
• The bit sequence consisting of all 0’s represents the integer 0, regardless
of the word size.
• The bit sequence consisting of all 1’s represents the integer -1, regardless
of the word size.10
• Any other bit sequence beginning with a 0 represents a positive integer.
• Any bit sequence beginning with a 1 represents a negative integer.
This convention is known as the two’s complement representation of integers.
Other schemes could have been used (and have been used in older computers),
but most modern computers use two’s complement representation for integers.11
For a 5-bit word the bit sequences 00000 through 01111 will represent positive
integers, and the bit sequences 1 Our table representing integers using two’s
complement representation is shown below:
9 Zero
is neither positive nor negative
10 To understand this choice, imagine a new car with odometer reading 00000. If the odome-
ter subtracts miles when the car backs up, and the new car backs up for one mile, the odometer
will read 99999, representing -1.
11 The reason for this choice is a result of the ease of designing hardware to add and subtract
(see the open source book on Computer Organization).
2.2. REPRESENTING INTEGERS 23
Integer bit sequence hexadecimal
-16 10000 10x
-15 10001 11x
-14 10010 12x
-13 10011 13x
-12 10100 14x
-11 10101 15x
-10 10110 16x
-8 10111 17x
-8 11000 18x
-7 11001 19x
-6 11010 1ax
-5 11011 1bx
-4 11100 1cx
-3 11101 1dx
-2 11110 1ex
-1 11111 1fx
0 00000 00x
1 00001 01x
2 00010 02x
3 00011 03x
4 00100 04x
5 00101 05x
6 00110 06x
7 00111 07x
8 01000 08x
9 01001 09x
10 01010 0ax
11 01011 0bx
12 01100 0cx
13 01101 0dx
14 01110 0ex
15 01111 0fx
Note that there are 16 negative numbers (-1 through -16), but only 15 pos-
itive numbers (1-15). For any word size there will always be one more negative
number than there are positive numbers.
What happens when we attempt to add a positive number to a negative
number? As an example, we attempt to add 7 and -2:
00111 = 7
+ 11110 = -2
---------------
00101 = 5
24 CHAPTER 2. ABSTRACTION
We get the correct result!12 This is the beauty of two’s complement repre-
sentation.
The largest integer that can be represented with a 5-bit word is 24 − 1 = 15,
and the smallest integer is −24 = −16. For an n-bit word the largest (positive)
number that can be represented is 2n−1 − 1 and the smallest (negative) number
is −2n−1 .
2.2.4 Exercises
1. Convert each of the following hex numbers to a 12-bit binary number.
Hint: Do not convert to decimal.
(a) 022x
(b) 1a3x
(c) f f fx
2. Convert each of the following 12-bit binary numbers to hexadecimal.
Hint: Do not convert to decimal.
(a) 1011101000012
(b) 1111111111112
(c) 0000111001012
3. Memorize the following bit string:
1111111010111010110111102
Hint: Convert the bit string to hexadecimal, and memorize the hex digits.
4. Assume we are representing positive integers only (ignore two’s comple-
ment). What is the largest integer that can be represented with a word
size of:
(a) 3
(b) 7
(c) 10
(d) 11
5. Show a friend that you can count from 0 to 31 using only the fingers on
one hand. (Tell your friend not to be offended when you get to the number
4)
⊗
6. Convert each of the following octal numbers to a 12-bit binary number.
Hint: Do not convert to decimal.
(a) 10378
(b) 24658
12 There is a carry out of the high order bit, which is discarded.
2.2. REPRESENTING INTEGERS 25
(c) 77778
⊗
7. Convert each of the following 12-bit binary numbers to octal.
Hint: Do not convert to decimal.
(a) 1011101000012
(b) 1111111111112
(c) 0000111001012
⊗
8. Perform each of the following conversions.
Hint: Convert to binary first.
(a) Convert 7f 3x to octal.
(b) Convert 23078 to hexadecimal.
⊗
9. Show the 6-bit two’s complement representation of each of the following
decimal integers:
(a) +7
(b) +25
(c) -12
(d) -17
⊗
10. Assuming we are working with two’s complement representation of in-
tegers, what are the largest and smallest integers that can be represented
with a word size of:
(a) 3
(b) 6
(c) 10
(d) 11
⊗
11. Working with two’s complement representation, for any word size, find
the following sums:
Hint: Solve the problem for small word sizes.
(a) The largest number plus the smallest number.
(b) The largest number plus the largest number.
(c) The smallest number plus the smallest number.
26 CHAPTER 2. ABSTRACTION
2.3 Representing non-integer numbers
We have seen how to represent integers; we now investigate a way of representing
non-integers, using only bit sequences. In our math courses, we often use non-
integers (and very large integers) such as 3.14 72/3 and 6.02 × 1023 . But in the
computer’s memory we have only bit sequences, i.e. 0’s and 1’s. There are no
decimal points, fractions, nor superscripts (for exponents).
We will represent a non-integer using two integers, called the mantissa and
exponent. The exponent is assumed to be an exponent of 10.13 The represented
number is the exponent multiplied by a power of 10, determined by the exponent:
number = mantissa × 10exponent
Both mantissa and exponenet may be negative. The exponent directs that
the decimal point be shifted to the left or right, depending on the sign of the
exponent. An exponent of +5 shifts the mantissa’s decimal point 5 places to the
right. An exponent of -3 shifts the mantissa’s decimal point 3 places to the left.
In this scheme, known as floating point, we can represent integers, non-integers,
numbers very close to 0, and very large numbers. Some examples of floating
point numbers represented by two integers are shown below:
mantissa exponent number represented
3 1 3 × 101 = 30.0
17 -3 17 × 10− 3 = 0.017
-33 5 −33 × 105 = -3300000.0
602214 18 602214 × 1018 = 6.02214 × 1023
= Avogadro’s number
Floating point representation has some interesting properties. Some fairly
common numbers have no exact representation, such as:
• The result of 1.0/3.0 is approximately 0.3333333333 but no matter how
many 3’s we write, it will never be exact. The precision is limited by the
word size of the mantissa.
√
• Irrational numbers such as π and 2 have no exact representation.
• On a binary computer the exponent would be an exponent of two, and
thus there is no exact representation for one tenth!14
Because of the inaccuracies inherent in floating point numbers, great care
must be used when working with this type of number. We work with integers
whenever possible, and resort to floating point numbers only if necessary.
13 Inreal floating point hardware, the exponent is an exponent of 2.
14 For an explanation see the open source textbook on Computer Organization at
[Link]
2.3. REPRESENTING NON-INTEGER NUMBERS 27
2.3.1 Exercises
1. Show the mantissa and exponent (of 10) as integers for each of the follow-
ing floating point values.
(a) 113.0
(b) -1024.0
(c) 1024.032
(d) 0.000128
(e) 1 × 10100
(f) −123.45 × 10−12
2. ⊗ Assume we use a 4-bit word for the mantissa, and a 4-bit word for
the exponent (both using two’s complement representation) to represent
a floating point number.
(a) What is the largest possible floating point number that can be rep-
resented?
(b) What is the smallest possible floating point number that can be rep-
resented?
(c) What is the smallest possible positive floating point number that can
be represented?
(d) What is the largest possible negative floating point number that can
be represented?
3. ⊗ Assume we use a 3-bit word for the mantissa, and a 3-bit word for
the exponent (both using two’s complement representation) to represent
a floating point number.
(a) What is the range of values for the mantissa?
(b) What is the range of values for the exponent?
(c) Show a table of all possible floating point values having a 4-bit man-
tissa and a 3-bit exponent.
(d) Are there any whole numbers which have no floating point represen-
tation? If so, show a few of them.
(e) Subtract 2000.0 from the next largest floating point number. What
is the difference?
(f) Subtract 0.0002 from the next largest floating point number. What
is the difference?
28 CHAPTER 2. ABSTRACTION
2.4 Representing integers with unlimited precision⊗
We have seen that there are limitations on the size of the integer that can be
represented with a fixed number of bits. For any n-bit sequence, there are 2n
different values.
Most modern computers use a fixed size for integers, 64 bits. However,
there are applications, particularly in the areas of cryptography and computer
security, where we need greater precision; i.e. we may wish to do arithmetic
with numbers that are hundreds of bits in length. This is generally done with
software:15 We use a sequence of integers, possibly decimal digits, to repre-
sent a single number. The list representing this number can have a variable
length, so we can add more digits when needed (for example, to avoid overflow).
Think of the number 9,453,930,402 represented as the list of decimal digits
[9,4,5,3,9,3,0,4,0,2]. One possible operation would be to multiply this number
by 10, giving a result of [9,4,5,3,9,3,0,4,0,2,0].
The phrase unlimited precision is really a misnomer. All computers have
limited storage, so that is one limitation on the size of a number. As a practical
matter, that is not the limiting factor when working with these huge numbers;
some fairly simple operations, such as multiplication of two numbers will take
so much time that this turns out to be a limitation on the size of numbers that
can be used.
2.4.1 Exercises
1. Each of the following lists of decimal digits represents a single integer:
[2,3,0,4,9,0,9]
[3,0,5,7,0,9]
Show the list which would be produced when adding the two integers.
2. If we have a subtract operation on integers with unlimited precision, the
result could be negative. We will need to find a representation for negative
numbers. One possible solution is to use tens complement when represent-
ing an integer as a list of decimal digits. Tens complement is analagous to
twos complement. A number is negative if and only if its high order digit
is greater than 4. For example:
[9,9,9,9] = -1
[9,9,9,8] = -2
[9,9,9,7] = -3
[9,9,9,9,9] = -1
(a) Show a list of 3 decimal digits representing +23.
(b) Show a list of 3 decimal digits representing +723.
(c) Show a list of 3 decimal digits representing -25.
15 As these applications are becoming increasingly important, special purpose hardware now
exists for the same purpose: unlimited precision arithmetic.
2.5. REPRESENTING PLAIN TEXT 29
Character Code Character Code Character Code Character Code
A 65 a 97 0 48 Space 32
B 66 b 98 1 49 ! 33
C 67 c 99 2 50 ” 34
D 68 d 100 3 51 $ 35
% 36
Z 90 z 122 9 57 & 37
Figure 2.5: Some codes from the ASCII coding system
(d) Show how to add the two numbers 23 + -25 given above, producing
the correct result.
2.5 Representing plain text
To represent plain text, we simply use integer numbers to represent the symbols
in our character set. This representation is called a coding scheme or simply a
code. An early code to represent the symbols found on standard keyboards is
known as ASCII16 and was standardized in 1963 for early teletype machines.
Some examples of these code values are shown in Figure 2.5.
Students often ask “If the character ‘$’ is stored as the number 35, why do
we see it as a ‘$’ ? The ‘$’ exists as the number 35 (actually 01001012) in the
computer’s memory, but when that code is sent to a peripheral device, such as
a display or a printer, that device’s hardware uses the value 35 to construct an
array of pixels that resemble a ‘$’. Note that there are also codes for the 10
decimal numerals: 0..9. The space (and tab, and newline) also have their own
codes.
ASCII is a 7-bit code, which means there are 27 = 128 possible symbols
which can be encoded. It was subsequently agreed that 7 bits is not enough.
We need to be able to store more than 100 special characters.17
Moreover, as computers are used in non-English speaking countries, we need
to represent the characters in foreign alphabets as well. For example, most
modern chinese dialects have over 6,000 characters. A modern code known as
Unicode was developed in 1987 at the Xerox corporation and at Apple Com-
puter. Unicode is so named because it is a “unique, unified, universal encoding”
as described by its developers. It is a 16-bit code which means that it may have
up to 216 = 65, 536 different symbols. This is thought to be big enough to
accommodate the alphabets of today’s world. ASCII is a sub-code of Unicode,
which means that the ASCII codes are replicated in Unicode.
16 American Standard Code for Information Interchange
17 Non alphanumeric characters such as !, ?, &, * are often referred to as ’special’ characters.
30 CHAPTER 2. ABSTRACTION
2.5.1 Exercises
1. Use a search engine, such as Google, to look up the plain text characters
having ASCII codes of 68, 72, 109, 45, 55, and 63.
2. (a) Subtract the ASCII code for B from the ASCII code for b, and show
the result.
(b) Subtract the ASCII code for Q from the ASCII code for q, and show
the result.
(c) What is the result of subtracting the ASCII code for any upper case
letter from the ASCII code of the corresponding lower case letter.
3. (a) Show the ASCII code for B and the ASCII code for b in binary.
(b) Show the ASCII code for Q and the ASCII code for q in binary.
(c) Describe how the ASCCII code for any upper case letter differs from
the ASCII code of the corresponding lower case letter.
(d) If you are given the ASCII code for any lower case letter in binary,
show an easy way to find the ASCII code for the corresponding upper
case letter, in binary,
(e) If you are given the ASCII code for any upper case letter in binary,
show an easy way to find the ASCII code for the corresponding lower
case letter, in binary,
4. (a) Show the ASCII codes of all 10 numeric characters: 0..10.
(b) Given the ASCII code of any numeric character, show how to obtain
the corresponding integer, using a 7-bit two’s complement represen-
tation.
5. The ASCII code 10 represents a non-printable character, usually referred
to as LF (LineFeed). The ASCII code 13 represents a non-printable char-
acter, usually referred to as CR (Carriage Return). These terms are de-
rived from old teletype machines (similar to typewriters) which could send
and receive text. To advance to a new line the machine needed to do both
a CR and a LF, in either order. How have these codes complicated the
usage of a newline character in modern operating systems (try a Google
search)?
2.6 Representing graphic images
2.6.1 Black and white images
We also need to represent graphic images, photographs, works of visual art, etc.
in the computer’s memory. When we speak of a digital image, we are talking
about an image that is represented by a sequence of 0’s and 1’s. To understand
how this is done, take a close look at a newspaper photograph. You’ll see that
2.6. REPRESENTING GRAPHIC IMAGES 31
00000000000000000000
00000000010000000000
00000000111000000000
00000001111100000000
00000011111110000000
00000111111111000000
00001111111111100000
00011111111111110000
00111111111111111000
00000000000000000000
Figure 2.6: An array of bits representing the pixels making up an image of a
triangle, and the image with each pixel shown as a black dot
it consist of many small black dots for a black and white photograph, or small
colored dots for a color photograph. These dots are called pixels (or picture
elements). A black and white photograph can be represented by a large array
of pixels, where each pixel is represented by one bit: 0 means there is no dot,
and 1 means there is a dot.
Figure 2.6 depicts an array of 0’s and 1’s which make up an image of a
triangle. This is the simplest way to represent the pixels in an image, and it is
often called a bitmap image; there are other ways of representing the pixels in
an image.
When viewing a bitmap image which has curved boundaries, such as a circle
or ellipse, it may appear to have rough edges. A device such as a printer or
display can vary the physical distance between pixels, to make a rough edge
appear smooth. Using more densely packed pixels on the page, or on the screen,
will make the image appear to be more smooth. This property is known as
resolution, and it is often measured in dots-per-inch (dpi).
Before 1975 all photography equipment used analog technology, typically a
film which required chemical processing to produce photographic prints. The
leader in this field was the Kodak corporation. When digital cameras were first
introduced, they were either expensive, or had poor resolution when compared
with Kodak’s film cameras. Soon, however, Kodak’s digital competitors in-
creased the resolution of their products. Because Kodak did not anticipate the
rapid advances in digital technology, it failed to move its photograph business
from analog to digital technology quickly enough. Kodak filed for bankruptcy
in 2012.
32 CHAPTER 2. ABSTRACTION
Red Green Blue Alpha
24 16 8 0
Figure 2.7: Packing Red, Green, and Blue components (and alpha value) of a
color into a single 32-bit integer
Color Red Green Blue
RED 255 0 0
YELLOW 255 255 0
ORANGE 255 200 0
CYAN 0 255 255
GRAY 128 128 128
Figure 2.8: Some examples of color values, showing the relative Red, Green,
and Blue components
2.6.2 Color images
To represent color images, we would use an array of integers, rather than an
array of bits.18 Each integer would represent a particular color. Colors are
generally represented by red, green, and blue components (RGB). Any color
can be represented by some combination of these three primary colors.
To represent a single color, relative red, green, and blue components are
packed into a single 32-bit word, as shown in Figure 2.7.19 There is a fourth
component, known as an alpha value, which is a measure of the pixel’s trans-
parency level; it does not affect the actual color of the pixel. The diagram
shows that each component is an 8-bit quantity, so the possible values for each
component are 0..255 (28 = 256).
Figure 2.8 shows a few examples of colors with their red, green, and blue
components.
2.6.3 Exercises
1. Show the bitmap image of a smiling face. Show both the array of binary
digits, and the array of dots, as shown in Figure 2.6.
2. Describe how you would scan the 0’s and 1’s in a bitmap image to find
the boundary of a solid object, such as the triangle shown in Figure 2.6.20
3. A word processing application, such as Microsoft Word, permits text in
various colors. Open a Word document and click the text color button.
This should open a small window with several color choices, and an option
for more colors. Choose more colors. This will open a Colors window, with
18 Each integer, though, is made up of a sequence of bits, as discussed in the previous section.
19 The RGB system described here is the one in the [Link] package.
20 This is an important aspect of image processing, known as edge detection.
2.7. REPRESENTING SOUND AND VIDEO 33
a slider that can be used to choose an arbitrary color. Move the slider all
the way to the left to view the available colors.
(a) What color appears to be a blend of red and green?
(b) What color appears to be a blend of red and blue?
(c) What color appears to be a blend of blue and green?
4. Show the numeric values, in decimal, of the red, green, and blue compo-
nents of a color pixel that has the value 0a1bf f 0316
2.7 Representing sound and video
We may also wish to store (and process) other kinds of information, such as
sound and video. These can also be thought of as information, and can therefore
be digitized, for storage in a digital device such as a computer. In doing so, each
sound clip or video clip may be thought of as a sequence of bits.
2.7.1 Representing sound
What is a sound? A sound consists of:
• A source which creates a disturbance in the air pressure
• The propagation of this disturbance through the air, in the form of sound
waves 21
• A receiver which senses the disturbance in the air pressure, and stores or
processes the disturbance in some way.22
How can we represent these disturbances in air pressure as digital informa-
tion? When the air pressure waves enter our ears, our brain receives a signal
from the auditory nerves. To represent sound, all we need do is store a digital
version of the pressure waves. This is diagrammed in Figure 2.9, in which the
horizontal axis is time, and the vertical axis is the amplitude of the pressure
waves. The wave at top left of Figure 2.9 represents just one cycle of a sound
wave. The wave at top right represents a louder sound at the same pitch because
the amplitude is greater, but the frequency of the cycles is the same. The wave
at bottom left represents a higher pitch, because there are twice as many cycles
in the same time period; the loudness is the same as the sound at top left.23 The
quality of the sound is determined by the number of values sampled per unit
time. To represent sound with very high quality (high fidelity) requires many
21 Sound waves are longitudinal waves, as opposed to light which is propagated through
transverse waves.
22 There must be a receiver. If a tree falls in the forest and no “receiver” hears it, there is
no sound.
23 The higher pitch would be one octave higher, as the musical scale is a logarithmic function
of the frequency of the air waves.
34 CHAPTER 2. ABSTRACTION
Figure 2.9: Representing sound (i.e. air pressure waves) as discrete numbers.
Top right: a louder sound. Bottom left: a higher pitch.
numbers. Consequently a sound clip is merely a sequence of whole numbers
representing varying air pressure. Most sound clips are actually a compressed
format of these numbers. Some examples of compression formats are .wav and
.mp3.
2.7.2 Representing video
A video clip consists of images and, possibly, sound. A silent video clip has
no sound. To represent moving images we use a sequence of bitmap images.
If these images are presented to the human eye in rapid succession, they are
perceived as a moving image. In the past, a movie film was stored as a sequence
of still images on a long film, and stored on a reel. An animated movie consist
of a sequence of images, each of which is called a cel. The cels can be drawn by
hand, or generated by a computer.
Video clips can require much memory, depending on the length of the clip,
and the desired quality (many images, with very small changes from one image
2.7. REPRESENTING SOUND AND VIDEO 35
Figure 2.10: A waveform with a high amplitude (loud) and a low frequency
(pitch)
to the next, result in a high quality (smooth) video clip). Because of the large
size of video clip files, various compression schemes are used to store the video
clip. When a video clip is played, it is decompressed to obtain the air pressure
values. When a video clip is edited, it is recompressed for efficient storage.
Some common compression schemes, indicated by the file extension, are .mov,
.gif, .mpeg, .qt, and .amv.
In the 1980’s video formats included VHS and Betamax, two competing video
formats using analog film technology. Companies such as Blockbuster Video in-
vested heavily in this analog technology. Digital video formats became common
in the 1990’s, and by 2000 streaming technology24 overtook distribution via op-
tical disk. Because Blockbuster did not adapt to these new digital technologies
quickly enough, it filed for bankruptcy in 2010. Nicholas Negroponte, founder
of the MIT Media Lab, predicted in 1995 that shipping bits would be more cost
effective than shipping atoms.25
2.7.3 Exercises
1. Two waves are superimposed by adding their numeric amplitudes, at each
point on the time axis.
(a) Draw a diagram of the superposition of the waves shown in Fig-
ure 2.10 and Figure 2.11.
(b) Describe the sound (pitch, amplitude, and quality) of the superposi-
tion of those two waveforms.
2. Sound files consist of many large numbers, representing a sequence of air
pressure values over time. Much space can be saved by compressing sound
files. One such compression algorithm works by storing the initial value,
followed by the change from one value to the next. Since these changes
are usually small, they require less space (fewer bits) than the original
numbers.
(a) Show how the list of numbers shown below can be compressed:
[109284892, 109284894, 109284895, 109284890, 109284802,
109284907, 109284892, 109284891]
24 Distribution of information, such as movies, over the internet, as opposed to using optical
disk (DVD) technology
25 Being Digital published by Knopf Publishers
36 CHAPTER 2. ABSTRACTION
.
Figure 2.11: A waveform with a low amplitude (soft) and a high frequency
(pitch)
(b) Show how the list of numbers shown below, representing a compressed
file, can be decompressed:
[109284892,7,12,-3,4,0,-10,7]
3. In some movies depicting moving carts, wagons, chariots, etc. where the
wheels have spokes, it may appear that the spokes are not moving, or are
moving in the reverse direction. Explain this phenomenon.
2.8 Looking into memory
We have seen how to represent numbers, plain text, graphic images, sound, and
video as bit sequences. When information can be represented as a sequence of
bits, we say that it is digital.
[Link] Stored programs
In addition to data stored in memory we also have programs. A program consists
of a sequence of binary instructions stored in the computer’s memory. Each
instruction has:
• A binary code for the operation (add, subtract, move data, shift bits within
a word, jump out of sequence, etc.).
• Binary specifications of the operands, i.e. the values to be added, sub-
tracted, moved, etc.
2.8. LOOKING INTO MEMORY 37
• Other information, such as the number of bits to be shifted in a shift
instruction.
• Where the result of the operation is to be placed.
Program execution takes place by executing the instructions, in the sequence
in which they are stored in memory. Jump instructions are capable of altering
this sequence. A jump to a prior instruction will implement a repetition of a
group of instructions. A jump may be conditional ; a conditional jump is taken
only if some prior condition is satisfied. A conditional jump can be used to
execute one of two possible groups of instructions, depending on the result of a
prior operation.
[Link] Stored data
If we were to examine a bit sequence in the computer’s memory it would be
impossible to interpret that sequence as meaningful information. For exam-
ple, the 16-bit sequence represented by 214216 = 00100001010000102 could be
representing either of the following:
• The integer value 8,514 (2 × 4096 + 1 × 256 + 4 × 16 + 2 × 1)
• The two characters !B (! = 2116 and B = 4216 )
Other examples could show that a 32-bit sequence could represent an integer
or a floating point value. How is one to know which interpretation is valid?
It depends on the instruction which is using that portion of memory. Some
computer instructions assume that the memory operands are integers, some
instructions assume the memory operands are floating-point numbers, and some
instructions assume the memory operands are text.
[Link] Stored programs and data
We have seen that bit sequences in memory are used to represent both instruc-
tions and data. The design of most modern computers is based on this principle,
known as the Von Neumann architecture. Conceivably, such an architecture per-
mits a program to modify itself, with instructions that treat other instructions
as data.26
2.8.1 Exercises
1. Given the bit sequence represented by f f f 216 :
(a) Interpret this bit sequence as an integer, with two’s complement rep-
resentation.
26 While some consider this a powerful feature, others discourage its use, particularly when
building parallel processes.
38 CHAPTER 2. ABSTRACTION
(b) Interpret this bit sequence as a floating point number, with an 8-bit
mantissa, followed by an 8-bit exponent of 10, both of which use two’s
complement representation.
2. Given the bit sequence represented by 326216:
(a) Interpret this bit sequence as an an integer, with two’s complement
representation.
(b) Interpret this bit sequence as two ASCII characters.
3. The following 16-bit sequences are different representations of the same
number:
• 323516
• 001916
• 190016
(a) Which is a two’s complement integer?
(b) Which is a floating point number, consisting of an 8-bit mantissa and
an 8-bit exponent of 10?
(c) Which is a string of two characters?
(d) What is the number?
2.9 Abstractions in programs
We have seen that the notion of abstraction may involve the hiding of details,
to bring out the essential aspects of an artifact. When we think of an integer,
we normally don’t think of it in its form as a binary bit sequence. Similarly,
when we think of a graphic image, we don’t see the digital bit sequence which
is representing that image.
2.9.1 Program abstractions
Abstractions also apply to computer programs. To explain this we use an ex-
ample of a fairly common problem: searching a list of names for a particular
target. An example of a list of names is shown in Figure 2.12.27 If we wish
to determine whether a particular name (the target) is in that list, we need to
understand a few processes:
• To compare the target name with a name in the given list, we must be able
to compare two names to see if they are equal. A more general term for a
name would be a string of characters, which would include any character,
not just alphabetic characters.
27 The first name in the list is at position 0. Normally, in computer science, we begin
counting at 0.
2.9. ABSTRACTIONS IN PROGRAMS 39
0 alice
1 joseph
2 mary
3 jimmy
4 joseph
Figure 2.12: A list of 5 names
• To compare two strings for equality, we must be able to compare individual
characters within those strings, as shown in Figure 2.13.
• To compare two characters for equality, we must be able to compare their
ASCII codes. Two characters with the same ASCII code are equal char-
acters.
The computer hardware will be able to compare two integers for equality, so
that is how two characters are compared. The next step would be to build
software that compares arbitrary strings of characters. Here is how that process
could work, to compare an arbitrary string, str1 with another arbitrary string,
str2.
1. Let the variable i represent the position of the first character.
2. Compare the character at postion i of str1 with the character at position
i of str2.
3. If they are not equal, terminate with a result indicating the two strings
are not equal.
4. Increment i, i.e. add one to the value of i.
5. Repeat from step 2 as long as i does not extend beyond the end of either
list.
6. If there are more characters in one of the lists, terminate with a result
indicating the two strings are not equal.
7. Terminate with a result indicating the two strings are equal.
This sequence of steps, describes how two strings of characters can be com-
pared for equality. Such a sequence of steps is called an algorithm. An algorithm
is supposed to solve a particular problem, in this case the comparison of strings
of characters. An algorithm must eventually halt with a correct solution. The
algorithm which compares strings is diagrammed in Figure 2.13, in which we
40 CHAPTER 2. ABSTRACTION
j o e
(0) Equal
(1) Equal
(2) Not Equal
j o s e p h
Figure 2.13: Comparing two names for equality. Comparing one character at a
time, three character comparisons are needed.
show the three steps that are needed to compare the name joe with the name
joseph.
Once we have developed an algorithm (or program) to solve a problem, we
can use that algorithm in the solution of other problems. When doing so we
often hide the details of the algorithm being used; as long as we know its purpose
and how to use it properly, we can ignore its inner workings. This is program
abstracion!
In our example, we can use the string comparision algorithm (let’s call it
strcmp). In order to make general use of it to compare any two strings we
need to be able to tell it which strings are being compared. This is done with
parameters.28 Parameters are generally shown in parentheses, and separated by
commas after the name of the program, as in:
strcmp(joe,joseph)
which would be a comparison of the two strings joe and joseph, and which
would result in an indication that the strings are not equal.
We now have the tools needed to solve the original problem: search a list
of names for a given target name. Let’s call it search(list,target). This
algorithm should not only determine whether the given target is in the given
list, but it should also tell us the position of the first occurrence of the target in
the list (there could be duplicate values in the list). If the target is not in the
list, the result should be -1. Here is the algorithm:
1. Given a list of names, and a target name
2. Let i be the position of the first name in the list.
3. Compare the target name with the name at postion i, using the strcmp
program that we have described above:
strcmp( target, name at position i of the list) .
28 This notation is derived from the notation for functions in mathematics: For example,
cos(x) is a trigonometric function with one parameter, or argument.
2.9. ABSTRACTIONS IN PROGRAMS 41
4. If the result produced by strcmp is equality, terminate this algorithm,
indicating that the target was found in the list of names. The result is the
value if i which is the position of the first occurrence of the target.
5. Increment i, i.e. add one to the value of i.
6. Repeat from step 3, if i has not gone beyond the end of the list.
7. Terminate, indicating that the target was not found in the list. The result
is -1.
This completes our example of an algorithm which searches a list of names
for a particular target name. It makes use of another algorithm which compares
arbitrary strings of characters. The two algorithms are similar, in that both:
• repeat a group of steps (this repetition is called a loop)
• make use of a loop counter. The loop counter (the variable i) is used to:
– select an item from a list of items
– determine whether to continue repeating the loop
The important point is that when designing the search algorithm we made
use of the strcmp algorithm without exposing its details. That is program
abstraction!
2.9.2 Levels of abstraction in software
[Link] An example: arithmetic expressions
In computer programs we often need to specify a sequence of arithmetic oper-
ations, or calculations, which need to be performed. To do this we normally
borrow notation from mathematics, and specify the calculations using algebraic
expressions, or arithmetic expressions. 29 . An example of an arithmetic expres-
sion would be:
(a+b) * (c-d).30
Here we give a somewhat precise defintion of an arithmetic expression. An
arithmeitic expression (or simply an expr) may be any of the following:
1. A constant, such as 45, -12.5, or 0
2. A variable, such as x, y, z, or salary
3. The sum of two expressions:
expr + expr
4. The difference of two expressions:
expr - expr
29 Pronounced with the stress on the third syllable: a-rith-me’-tic
30 The asterisk represents multiplication.
42 CHAPTER 2. ABSTRACTION
5
7
3
2 1 1
( x + 4 ) * 7
Figure 2.14: Boxes show the structure of the expression (x + 4) ∗ 7 . The rule
number is shown in the upper right corner of each box.
5. The product of two expressions:
expr * expr
6. The quotient of two expressions:
expr / expr
7. An expr inside parentheses:
( expr )
Each part of the above definition is called a rule; the definition of expr has
7 rules. Note that this definition of expr uses the word expr in rules 3-7. This
is known as a recursive definition. Using the word being defined as part of the
definition is not a problem, as long as there is a part (rules 1 and 2) which does
not use the word being defined.31
This definition not only tells us exactly what constitutes an expression, but it
also imposes a structure on expressions. This structure can be seen by drawing a
box around each expression within a given expression. As an example, consider
the arithmetic expression (x+4)*7. The structure of this expression is shown
in Figure 2.14, in which we also show which definition rule is used, by including
the rule number from the definition in the upper right corner of the box.
[Link] Programming languages
We have seen that a program consists of a sequence of binary coded instruc-
tions in the computer’s memory. These instructions are typically very simple,
fundamental operations such as:
• Add two numbers
• Subtract a number from another number
• Move a word (i.e. a binary number) from one location in memory to
another location
• Decide whether to alter the sequence of instructions, by jumping to an-
other instruction
31 A definition of expr must be recursive because an arithmetic expression is a recursive
structure.
2.9. ABSTRACTIONS IN PROGRAMS 43
This language of primitive binary instructions is often referred to as machine
language.
To evaluate the expression shown in Figure 2.14, (x+4)*7, the following
machine language instructions could be used:
• Obtain the value of the variable x from memory
• Add the constant 4 plus the value of x, saving this temporary result.
• Multiply the tempororay result by 7, saving this temporary result.
We emphasize that these instructions are coded in binary, forming a machine
language program. There was a time, in the early days of computing, when
all programming was done in this binary machine language. This was a very
tedious, time-consuming, and error-prone process. Thus software (i.e. other
programs) were developed to ease the burden on the programmer.
The first such improvement was the development of assembly language in
which the binary codes were replaced by mnemonics and the binary operand
addresses were replaced by symbols. Assembly language also allowed for com-
ments, descriptions of the computations, ignored by the computer, but for the
benefit of human readers. The machine language program described above,
could be written as shown below, where comments begin with a # symbol:
LOAD x # Obtain the value of x from memory
ADD 4 # x+4
MULT 7 # (x+4)*7
STORE result # Store (x+4)*7 in memory
A program known as an assembler was written32 to translate an assembly lan-
guage program into machine language.
Though assembly language was a huge improvement over machine language
for ease of use, software soon became complex and cumbersome to deal with.
At that time high level programming languages were developed. These typi-
cally replaced the primitive instructions with algebraic expressions. In a high
level programming language the calculation shown above can be specified as
we normally think of it: (x+4)*7. A few of the early programming languages
were Fortran (Formula translator), BASIC, and COBOL (Common Business
Oriented Language). A program called a compiler was developed to translate
a program written in a particular high-level language to the machine language
for a particular computer. For example, a Fortran compiler for the IBM 360
computer would translate any program written in the Fortran language into an
equivalent33 program in IBM 360 machine language.
We can describe an even higher level of abstraction: Database languages.
A database is a collection of structured data, typically stored on a peripheral
32 The first assemblers were written in machine langauge. After that new, improved assem-
blers were written using existing assemblers.
33 Two programs are equivalent if they have the same input/output relation. I.e. If two
programs always produce the same output for any input, the programs are equivalent.
44 CHAPTER 2. ABSTRACTION
device such as a disk or USB drive34 . For example, a university has a database
of students, storing information for each student:
• Student’s name
• ID number
• Home address
• GPA
• Registration information
A database language would allow the user to specify operations on the
database without specifying the details necessary for the operation. For ex-
ample, the user could extract certain students from the database, those with a
high GPA thus:
show students for GPA > 3.0
A statement such as this in a database language, can be implemented by a
program consisting of several statements written in a high-level language.
What we are describing here is really a sequence of abstractions, in which
we build primitive tools, then use them to build more sophisticated tools, which
in turn are used to build even more sophisticated tools. Each higher level of
abstraction is less detailed and easier to use but makes use of lower level tools
that have previously been developed. Multiple levels of abstraction can be
shown as an abstraction hierarchy. The abstraction hierarchy of programming
languages that we have described is shown with a diagram in Figure 2.15. In
this figure an arrow is used to indicate that a tool is used to create a more
sophisticated tool. This is abstraction!
2.9.3 Exercises
1. Devise an algorithm to compare strings of characters for alphabetic order.
Your algorithm should be similar to the one presented in this section that
compares strings of characters for equality. Your algorithm should return
an integer:
• A negative number if the first string comes before the second string
alphabetically
• A positive number if the first string comes after the second string
alphabetically
• Zero if the strings are equal.
Hint: Subtract the ASCII codes of corresponding chracters.
34 Also known as a flash drive or thumb drive.
2.9. ABSTRACTIONS IN PROGRAMS 45
Database Language
High Level
Programming Language
Assembly Language
Machine Language
Figure 2.15: An abstraction hierarchy of programming languages
2. If we have a list named students
[jim,mary,joe,jack,joe,sue]
What will be the result of each of the following?
Hint: The first name is at position 0.
(a) search(students,mary)
(b) search(students,joe)
(c) search(students,sue)
(d) search(students,bob)
3. Show a diagram, similar to Fig 2.14 for each of the following arithmetic
expressions:
(a) b / 3)
(b) a + b * 3
Hint: Multiplication and division take precedence over addition and
subtraction,
(c) (a + b) * 3
(d) a - b + 4
Hint: When two operations have the same precedence, choose the
left-most operation first.
(e) a - (b + 4)
46 CHAPTER 2. ABSTRACTION
x y x AND y x OR y NOT x
False False False False True
False True False True True
True False False True False
True True True True False
Figure 2.16: Definitions of AND, OR, and NOT in formal logic
2.10 Levels of abstraction in hardware⊗
Many of the principles used in developing software apply to hardware as well.
Hardware includes physical devices, such as computers, keyboards, monitors,
phones, etc., as well as the components included in those devices such as memory
chips, processor chips, conntecting wires, etc. Software is distinguished from
hardware by noting that software consists of information, or bit sequences.35
When developing hardware, we can use abstraction to hide details, and use
primitive tools to build increasingly complex tools, just as we did with software.
[Link] Formal logic and digital logic
In formal (mathematical) logic we have three operations: AND, OR, and NOT.
These operations are shown in Figure 2.16, and they can be exposed in everyday
English:
• Elephants are pink AND 2+3 = 5. is a false statement.
• Elephants are pink OR 2+3 = 5. is a true statement.
• Elephants are pink OR 2+3 = 6. is a false statement.
• NOT Elephants are pink. is a true statement.
Note that the AND and OR operations have two operands, whereas the NOT
operation has only one operand. In order for the result of AND to be true, both
operands must be true. In order for the result of OR to be false, both operands
must be false. Note that the result of OR is True when both operands are
True. In computer science we call this an inclusive OR, as distinguished from
an exclusive OR (not shown in Figure 2.16) which is False when both operands
are True.
These concepts form the basis for digital logic gates, which are the funda-
mental building blocks of hardware devices. In digital logic, since we are dealing
exclusively with 0’s and 1’s, 0 represents False, and 1 represents True. Also,
for convenience in writing logical expressions, we use a raised dot for AND, a
35 The distinction between hardware and software is becoming less clear, as functions tra-
ditionally implemented with hardware are now implemented in Read-Only Memory (ROM),
leading to the term firmware, which is somewhere between hardware and software.
2.10. LEVELS OF ABSTRACTION IN HARDWARE⊗ 47
x AND y x OR y NOT x x XOR y
x y x·y x+y x’ x⊕y
0 0 0 0 1 0
0 1 0 1 1 1
1 0 0 1 0 1
1 1 1 1 0 0
Figure 2.17: Definitions of AND, OR,NOT, and Exclusive OR (XOR) in digital
logic
plus for OR, and a postfix apostrophe for NOT.36 In computer science we define
another kind of OR operation known as exclusive OR (XOR), designated with
a ⊕ symbol. The exclusive OR operation is false when both operands are true,
thus it excludes the case where both operands are true from the cases yielding
a true result. These digital logic operations are shown in Figure 2.17.
To demonstrate the difference between (inclusive) OR and XOR, consider
the following statements, both of which are true:
• There are 26 letters in the English alphabet OR 2+3 = 5 [Inclusive OR]
• For recess, students are permitted to play outside or students are permit-
ted to play inside (implying that no student may play both inside and
outside). [Exclusive OR]
We can now write logic expressions, where the notation is exactly the same
as algebraic expressions, but the operands are either 0 (i.e. False) or 1 (i.e.
True). Some examples:
1·0 =0
0′ = 1
(1 + 0) · 1 = 1
1+1=1
((1 + 0) · (0 + 0))′ = 1
((1 + 0) · (0 + 0)′ )′ = 0
1⊕0⊕1=0
We will also use logic variables in logic expressions. For example, the variable
x represents a 0 or 1 (i.e. False or True) value. The table in Figure 2.17 is a
truth table (actually four truth tables). Each column shows all possible results
for every possible value of the variables x and y. The precedence of operations
in a logical expression is the same as for an arithmetic expression:
• NOT takes precedence over AND: x · y ′ = x · (y ′ )
• AND takes precedence over OR: x · y + z = (x · y) + z
36 Some authors use an overbar for the NOT operation, rather than a postfix apostrophe.
x′ = x
48 CHAPTER 2. ABSTRACTION
x y x+y x · (x + y) (x · (x + y))′
0 0 0 0 1
0 1 1 0 1
1 0 1 1 0
1 1 1 1 0
Figure 2.18: Truth table for the logical expression (x · (x + y))′ , showing inter-
mediate results
x y z x+y x + z′ (x + y) · (x + z ′ )
0 0 0 0 1 0
0 0 1 0 0 0
0 1 0 1 1 1
0 1 1 1 0 0
1 0 0 1 1 1
1 0 1 1 1 1
1 1 0 1 1 1
1 1 1 1 1 1
Figure 2.19: Truth table for the logical expression (x + y) · (x + z ′ ) showing
intermediate results
• XOR has the same precedence as OR37
Figure 2.18 shows a truth table for the logical expression (x · (x + y))′ . Since
the expression has two variables, x and y, there are four rows in the truth table,
corresponding to the four possible values of the two variables. Note that this
table shows intermediate results, x + y and x · (x + y), which are used to reach
the final result in the last column:
(x · (x + y))′ ,
A truth table for an expression with three variables would have eight rows,
because there are 23 = 8 possible logical values for three logical variables. A
truth table for the expression (x + y) · (x + z ′ ) is shown in Figure 2.19
From the definitions of the logical operations in Figure 2.17 it should be clear
that certain logic expressions involving variables have a known result, regardless
of the variables’ values. For example, we can see from Figure 2.17 that x · 0 will
always be 0 regardless of the value of x, because 0 · 0 = 0 and 1 · 0 = 0. This is
called a logical property;38 it is true for every value of the variable x. A table
of common properties is shown in Figure 2.20.39
37 Since x + (y ⊕ z) 6= (x + y) ⊕ z, it is a good idea to include parentheses when mixing OR
and XOR in an expression.
38 These are often called identities, but since one of the properties is named identitiy we use
the term properties.
39 See the open source textbook Computer Cryptography for important applications of the
XOR properties in private key cryptography.
2.10. LEVELS OF ABSTRACTION IN HARDWARE⊗ 49
Property Property Name
x+0=x x·1=x Identity
x+x=x x·x=x Idempotent
x+1=1 x·0 = 0 Null
x + x′ = 1 x · x′ = 0 Complements
(x′ )′ = x Involution
x · (y + z) = x · y + x · z x + (y · z) = (x + y) · (x + z) Distributive
x+x·y = x x · (x + y) = x Absorption
x · y + x′ · z + y · z = x · y + x′ · z Consensus
(x + y)′ = x′ · y ′ (x · y)′ = x′ + y ′ DeMorgan’s Laws
x⊕0=x x ⊕ 1 = x′
x⊕x=0 x ⊕ x′ = 1
(x ⊕ y) ⊕ z = x ⊕ (y ⊕ z) Associativity
Figure 2.20: Some properties of digital logic
[Link] Digital logic gates⊗
Now that we have introduced digital logic we can expose the realization of these
operations in hardware. The fundamental building block of hardware is called a
logic gate, or simply a gate. There is a logic gate for each of our logic operations,
and they are shown in Figure 2.21
The arrows going into a gate represent the operands of the operation. Note
that the AND, OR, and XOR gates each have two input arrows because these
operations each have two operands.40 The NOT gate, also known as an inverter
has only one arrow input, because the NOT operation has only one operand.
Each of the logic gates has one arrow coming out, representing the result of the
operation.
[Link] Digital logic circuits⊗
We can now connect logic gates with wires, forming a digital logic circuit. The
ouput of a logic gate may be used as an input to another logic gate. The logic
circuits that we construct are realizations of logical expressions. As an example,
Figure 2.22 is a logic circuit which implements the logical expression x · y + y · z.
[Link] Half adders
Out objective here is to explore the notion of abstraction in hardware. We plan
to do that by designing a series of hardware components which, ultimately, will
be capable of adding binary numbers.
Our first step is to build a device known as a half adder. A half adder has
two inputs (x and y) and two outputs (Sum and Carry). The truth table for a
half adder is shown in Figure 2.23. We have actually combined two truth tables,
40 We will generalize this later to allow more than two inputs to an AND, OR, or XOR gate.
This can be done because these operations are associative.
50 CHAPTER 2. ABSTRACTION
x x·y
y
x x+y
y
x x⊕y
y
x′
x
Figure 2.21: Four basic logic gates: AND, OR, XOR, and NOT
xy + yz
y
Figure 2.22: An implemenation of the logical expression xy + yz using logic
gates
2.10. LEVELS OF ABSTRACTION IN HARDWARE⊗ 51
x y Sum Carry
0 0 0 0
0 1 1 0
1 0 1 0
1 1 0 1
Figure 2.23: A truth table for a half adder
S =x⊕y
x
y
C = x·y
Figure 2.24: A logic diagram implementing a half adder. S is the sum, and C is
the carry, .
one for the Sum and one for the Carry, into a single table. To realize the half
adder, note that:
• The column for the Carry in Figure 2.23 is the same as the AND column
in Figure 2.17; thus Carry = x · y
• The column for the Sum in Figure 2.23 is the same as the XOR column in
Figure 2.17; thus Sum = x ⊕ y
The logic circuit for a halfAdder can now be built, to agree with Figure 2.23.
It will have two inputs, and two outputs, and is shown in Figure 2.24.
Now that we have designed a half adder, we can introduce a block diagram
which represents a half adder. A block diagram is a higher level diagram for
a logic circuit in which all the internal gates and components are not shown.
Instead it shows the inputs, with labels, and the outputs with labels. It also
contains the name of the diagram inside the box, and often it will show the
number of inputs and outputs (2x2 in this case). Together with the truth
table for half adders (see Figure 2.23), the half adder block diagram provides
everything which is needed when using half adders to build more complex logic
circuits. That is abstraction!
A block diagram for the half adder is shown in Figure 2.25
[Link] Full adders
We next turn our attention to the design of a component known as a full adder.
A full adder has three inputs and two output. The truth table for the full
adder is shown in Figure 2.26. When implementing the addition of two binary
numbers, a full adder will be used to implement the addition in one ‘column’ of
52 CHAPTER 2. ABSTRACTION
x S
Half Adder
2x2
y C
Figure 2.25: Block diagram for a Half Adder. S is the one-bit sum, x + y, and
C is the one-bit carry x ⊕ y.
Carry Carry
x y In Sum Out
0 0 0 0 0
0 0 1 1 0
0 1 0 1 0
0 1 1 0 1
1 0 0 1 0
1 0 1 0 1
1 1 0 0 1
1 1 1 1 1
Figure 2.26: A truth table for a full adder: three inputs and two outputs
the numbers. Thus, in each column we have the two bits being added, plus the
carry bit from the previous column. We also need to produce a carry into the
next column; thus, a full adder will need three inputs and two outputs. Note
that the carry into the low order column will always be 0, and the carry out of
the high order column will be discarded.
For example, with a 4-bit word, when adding +7 and -2 we have:
0 1 1 1 = +7
1 1 1 0 = -2
---------------------
0 1 0 1 = +5
Below we show the same operation, with the carry bits shown at the top:
1 1 1 0 0 (Carry bits)
0 1 1 1 = +7
1 1 1 0 = -2
---------------------
0 1 0 1 = +5
2.10. LEVELS OF ABSTRACTION IN HARDWARE⊗ 53
S
x x S x S
Half Adder Half Adder
2x2 2x2
y y C y C
cin cout
Figure 2.27: Logic diagram for a full adder, using two half adders
To build the full adder, we could derive logical expressions from the truth
table, as we did for the half adder.41 However, it may be easier to use two half
adders to build a full adder. The design is shown in Figure 2.27
To understand the two outputs of the full adder in Figure 2.27 consider the
outputs separately:
• The Sum output (S) will be the sum of x + y + cin where cin represents the
CarryIn input. To find the sum, the first half adder finds the sum x + y,
and the second half adder adds that sum to cin to produce x + y + cin .
• The CarryOut output (cout ) of the full adder will be a 1 if there was a
CarryOut from either half adder; thus an OR gate is used to produce the
cout output.
Having designed our full adder, we can present a block diagram for a full
adder, in which we do not show the inner details; we simply show the three inputs
and two outputs, along with the name of the component: Full Adder. This block
diagram, together with the truth table for the full adder (Figure 2.26) is all that
is needed to use a full adder. The details are not visible; that is abstraction!
The block diagram of the full adder is shown in Figure 2.28. Note that we have
placed the inputs on the right and the outputs on the left; this is to facilitate
our next level of abstraction: a binary adder.
[Link] Binary adder
A binary adder is a component which can add two n-bit binary numbers. If n is
32, it will consist of 32 full adders, one full adder for each bit in the 32-bit word.
Designate the bit positions as 0..31, where position 0 is the low order bit and
41 See the open source textbook on Computer Organization for general methods of deriving
logical expressions from truth tables.
54 CHAPTER 2. ABSTRACTION
x
S
FA y
3x2
Cout cin
Figure 2.28: Block diagram for a Full Adder. S is the one-bit sum, x + y + cin ,
and Cout is the carry-out.
x3 y3 x2 y2 x1 y1
x x x x x0
S S S S
FA y FA y FA y FA y y0
3x2 3x2 3x2 3x2
cout Cout Cout Cout Cout
Cin Cin Cin Cin 0
s3 s2 s1 s0
Figure 2.29: Design of a 4-bit adder to find the sum x + y, using four full adders
position 31 is the high order bit. Let F Ai designate the full adder at position i.
Each full adder will produce one bit of the sum. The S output of F Ai is Si , the
ith bit of the Sum. The Carry out from each full adder will be the Carry in to
the next bit position. The Cout output of F Ai is the Cin input to F Ai+1 . The
Cout output of the high-order fll adder is normally discarded.42
The logic diagram for a 4-bit adder is shown in Figure 2.29 in which the low
order bit (position 0) is at the right, and the high order bit (position 3) is at
the left.
Having completed our design of a 4-bit adder, it is easy to visualize the
design of a 16-bit adder, 32-bit adder, or an adder for any word size.43 We show
a block diagram for a 32-bit adder in Figure 2.30 which shows the inputs, A and
B, and the outputs for the sum A+B, but the internal details are not shown;
that is abstraction!
42 As noted below the carry out from the high order bit can be used to detect an overflow
condition.
43 Most personal computers currently use a 64-bit word, and thus have a 64-bit adder.
2.10. LEVELS OF ABSTRACTION IN HARDWARE⊗ 55
(32)
A
(32)
ADD A+B
(32)
B
Figure 2.30: Block diagram of a 32-bit adder, to add A + B
In Figure 2.30 we have introduced a few concepts:
• The shape of the adder is not rectangular, unlike other components.
Adders are normally drawn like this (but not sometimes they are drawn
as rectangles) for historic reasons.
• Rather than showing 32 input lines for A and 32 input lines for B and 32
output lines for the sum, we show a single heavy line in each case, with a
label showing the actual number of lines (32) in each case. This is known
as a bus.
[Link] Overflow⊗
While we are discussing adders, we should discuss what happens when the mag-
nitude of a sum is to big to fit in a word. This is known as overflow, and we
can show how to detect overflow. Before discussing the detection of overflow,
we should emphasize that the carry out from our adder in Figure 2.29 is not an
overflow signal. For example, we can add 3 + -2, with the carry bits shown at
the top:
111
0011 = +3
+ 1110 = -2
-------
0001 = +1
There is a carry out of the high order bit, but there is no overflow - the sum
is +1, and that easily fits in a 4-bit word. Now consider the addition of 3 + 5,
and again we show the carries at the top:
111
0011 = +3
+ 0101 = +5
-------
1000 = -8
56 CHAPTER 2. ABSTRACTION
We get an incorrect result, because the true result, +8, is too big to fit in
a 4-bit word. In this example, there is overflow, but the carry out of the high
order bit is 0.
There are a few ways that the overflow condition can be detected:
• One way to detect the overflow condition is to compare the carry in to
the high order bit with the carry out of the high order bit. If they are
different, overflow has occurred, and the result is incorrect.
• Another way to detect overflow is to check the signs44 of the numbers
being added. If the signs are equal, the sign of the result should be the
same as the signs of the operands:
– When adding two non-negative numbers, the result must also be non-
negative.
– When adding two negative numbers, the result must also be negative.
– When adding a negative number to a non-negative number there can
never be overflow.
The easiest way to detect overflow in our binary adder is to use an Exclusive-OR
gate45 with two inputs: the carry-in to the high order bit and the carry-out of
the high order bit. This could easily be included in our binary adder.
[Link] Further abstractions with hardware
Using logic gates as fundamental building blocks, we have seen how higher-level
components can be constructed. This abstraction process is continued to even
higher levels. Logic circuits can be printed onto a circuit board, or embedded
in a semiconductor chip, thus producing a higher level component such as:
• Central Processing Unit (CPU)
• Device controller (such as a disk controller)
• Video card (used to display high quality graphic images)
• Radio Frequency Identification Devices (RFID) which can be used to tag
and track packages or products for sale.
• Camera components in phones and security devices
44 The sign of a two’s complement number is the high order bit, which determines whether
the number is negative. To determine whether the number is positive, one would have to
exclude the case where the number is zero.
45 Exclusive-OR will produce a 1 result only when the inputs are different.
2.11. LEVELS OF ABSTRACTION IN MODELS AND SIMULATIONS 57
2.10.1 Exercises
1. Use a truth table to prove each of the following:
(a) AND distributes over OR, i.e. x · (y + z) = x · y + x · z
(b) OR distributes over AND, i.e. x + (y · z) = (x + y) · (x + z)
(c) x ⊕ y = x′ · y + x · y ′
(d) Exclusive OR is associative, i.e. (x ⊕ y) ⊕ z = x ⊕ (y ⊕ z)
(e) DeMorgan’s first law: (x + y)′ = x′ · y ′
(f) DeMorgan’s second law: (x · y)′ = x′ + y ′
2. Show a digital logic diagram corresponding to each of the following logic
expressions:
(a) x + y · z
(b) (x + y) · z
(c) (x ⊕ y) · y ′
3. Show how to build a full adder without using a half adder. Refer to the
truth table in Figure 2.26
Hint: Use Exclusive OR
4. We are using our 4-bit adder in Figure 2.29 to add two values:
x = 0110, y = 1101
(a) Copy Figure 2.29 and fill in 0’s or 1’s on each input arrow (i.e.
x0 , x1 , x2 , x3 , y0 , y1 , y2 , y3 )
(b) Fill in 0’s and 1’s on all the output arrows.
(c) What is the 4-bit result?
⊗
(d) Did overflow occur in this example?
2.11 Levels of Abstraction in Models and Sim-
ulations
Computers have been programmed to be very effective in understanding natu-
ral, or man-made, processes. The computer can be programmed to simulate a
process, such as the evolution of a biological species. Of course the process itself
is separate and possibly very different from the simulation, but the simulation
can help us achieve a better understanding of the process. When the computer
is programmed to behave like some natural or physical object, we call it a model
for that object. A model is separate and distinct from the object that it models,
but it captures the essential aspects of that object.
58 CHAPTER 2. ABSTRACTION
As with other kinds of abstractions, models and simulations will normally
hide the unimportant details, and reveal the observable behavior of the process
being simulated or of the object being modeled. We now present just a few of
the important models and simulations that have been developed.
2.11.1 Weather
Everyone is interested in weather forecasts. You’ve seen them on TV news
broadcasts, in newspapers, on the internet. Weather forecasts serve an impor-
tant function for all of us, but there are some entities for which weather forecasts
are vitally important and extremely valuable. Some examples of these entities
are in:
• The transportation industry (primarily airplanes, but also land and sea-
5.
based transportation)
• The military; not only transportation of troops and material, but also
battle strategy and plans
• Agriculture; farmers need to plan ahead for droughts, monsoons, and other
unusual weather patterns
• Local government services; first responders and city officials need to plan
ahead for snow, tornadoes, hurricanes, etc.
The importance of weather prediction is so great that most nations of the
world invest huge amounts of money annually to achieve accuracy. This is gen-
erally done using arrays of supercomputers.46 It is possible that more money is
spent world-wide, on predicting the weather than on any other single computa-
tional problem.47
How can a computer predict the weather? Atmospheric conditions can be
simulated by the computer; this is generally done using large arrays of numbers.
Each number represents some atmospheric condition at a point in time and
space. Using three-dimensional arrays, each can represent some atmospheric
condition for a large volume of the earth’s atmosphere. The rows in the array are
lattitude positions, the columns are longitude positions, and the third dimension
is for altitude. The atmospheric conditions represented by an array could be:
Temperature, Air pressure, Humidity, or Wind velocity (speed and direction).
Simulations generally execute a sequence of steps, in which each step makes
incremental, and minor, changes to the state of the simulation. In the case
of atmospheric simulation, each step represents some unit of time, perhaps a
few seconds. In each step the current state of the simulation (temperature,
46 A supercomputer is one which has significantly more memory, can compute at very high
speeds, and has a high degree of parallelism (can do many different things at the same time),
as compared with ordinary desktop or laptop computers.
47 With the advent of social media, some may argue that facebook, amazon, google, or
twitter now holds that distinction.
2.11. LEVELS OF ABSTRACTION IN MODELS AND SIMULATIONS 59
pressure, humidity, etc.) is used to determine the atmospheric conditions for
the next step, i.e. at a small incremental time in the future.
The condition known as wind velocity is critical here; wind velocity can be
used to determine how the other conditions are affected at each step.
Figure 2.31 is a diagram of some small arrays representing temperature and
wind velocity at some step in the simulation, and at the next step. The numbers
in the Wind Velocity table represent the wind speed (km per hour) and the wind
direction:
• 0 = 360 = East →
• 90 = North ↑
• 180 = West ←
• 270 = South ↓
Thus an entry of (6,0) represents a wind velocity of 6 km/hour in a direction
directly to the east.
Note that the wind velocities are in a generally eastern direction. We would
expect that atmospheric conditions would be moving from west to east. This
is verified by noting that the temperatures appear to move to lower longitudes
(to the east), when comparing step n with step n+1.
In this manner all the atmospheric conditions can be calculated at each point
in time and space, from a prior time. These tables of numbers constitute a model
for atmospheric conditions, which can be used to predict the weather at some
time in the future.
Here we see that a model is not a perfect representation of the object being
modeled, but is generally just an estimate. Conclusions which are drawn from
the model (in this case weather prediction) can be no more accurate than the
model and are often less accurate.
2.11.2 Evolution
In 1859 Charles Darwin, a British scientist, published The Origin of Species by
Means of Natural Selection. This theory of evolution is now widely accepted as
the true means by which humans and other species came to exist on earth.48
Darwin’s theory, in a nutshell, is based on the occurrence of mutation(s) during
reproduction. A mutation is a rare change in a species’ DNA sequence, caused
by radiation or other environmental conditions. In most cases the organism with
the modified DNA will be affected in some non-beneficial or harmful way (think
of birth defects), and the organism will be unlikely to survive, and even less
likely to reproduce. However, in even more rare cases the mutation may result
in a beneficial change to the species. For example, at one time apes had paws
similar to other mammals. A mutation in their DNA might have, by chance,
48 This theory was challenged by many, including those who felt it contradicted the Book
of Genesis in the Old Testament. Today most religious scholars accept Darwin’s theory, but
nevertheless point out the metaphorical significance and value of Genesis.
60 CHAPTER 2. ABSTRACTION
!"#$%&
'#($#)*"+)# ,-&.%/#012-"3%4!$##.5%.-)#2"-1&6
71&8-"+.# 71&8-"+.#
7*""-"+.# 9:1%;<= 9:1%>?= 9:1%>9= 9:1%>:= 9:1%;<= 9:1%>?= 9:1%>9= 9:1%>:=
>@1%A<= A< A< A< AB ;5< C5A ;5B :5@C>
1%
>@ B?= A< AB AB AA C5A ;5@ ;5B :5<
1%
>@ B9= B? AB AB AB ;5> C5< C5B :5B
1%
>@ B:= B? B? A< A< C5@ C5B :5< :5A
1%
>@ BC= B9 B? B? A< C5A C5A :5B :5<
!"#$%&DB
'#($#)*"+)# ,-&.%/#012-"3%4!$##.5%.-)#2"-1&6
7*""-"+.#
>@1%A<= B? A< A< A< ;5< C5A ;5B :5<
>@1%B?= B? A< AB AB C5A ;5@ ;5B :5<
>@1%B9= B9 B? AB AB ;5> C5< C5B :5B
>@1%B:= B9 B? B? A< C5@ C5B :5< :5A
>@1%BC= B9 B9 B? B? C5A C5A :5B :5<
Figure 2.31: Representing temperature (degrees Celsius) and wind velocity
(km/hour, degrees from East) at a particular altitude, showing the transition
from one step to the next step
2.11. LEVELS OF ABSTRACTION IN MODELS AND SIMULATIONS 61
A❥
0.7
0.3
0.4
❥ 0.6
E
Figure 2.32: A diagram of a Markov Chain model, with two states, and proba-
bilities of change in state.
resulted in an opposable thumb on their front paws, enabling them to grasp tree
branches and other objects. These apes were more likely to survive, reproduce,
and pass on the trait of opposable thumbs to future generations of apes. This
process of random mutations, with certain mutations being passed to future
generations is called natural selection.
More recently scientists have questioned whether it is possible to model the
DNA for a species, using a computer. With appropriately chosen probabilities,
the model should enable us to understand what kinds of mutations might occur,
and which could effect the evolution of new species.
Most such models involve a Markov chain. A Markov chain is a more general
model involving transitions from one state to another, with a built-in random
factor. Simulations using a Markov chain over long periods of time can provide
information on the object or process being modeled. Figure 2.32 shows a dia-
gram of a Markov chain. In this diagram there are two states, labeled A and E.
As the model executes it can cycle through a series of states:
• If it is in state A, the probability that it will change to state E is 0.7, and
the probability that it will remain in state A is 0.349
• If it is in state E, the probability that it will change to state A is 0.4, and
the probability that it will remain in state A is 0.6
2.11.3 Warfare
The military forces use simulations to gain a better understanding of battlefield
tactics, resource allocation, supply line maintenance, personnel training, and
other aspects of military preparedness.
The use of battlefield simulations is often referred to as war games, and
allows officers to make battlefield decisions without risking lives or material,
since the simulation is done entirely with computers. In this way officers can
replay the same battlefield situation several times, trying different strategies to
see what works best.
These war games can involve land, sea, and air battles, or some combination
of all three into one simulation. In addition to battlefield simulation, the military
49 Probability is a fraction of 1, meaning that a probability of 0.3 represents a 30% chance.
62 CHAPTER 2. ABSTRACTION
makes extensive use of simulation to train members of the armed forces in the
proper use of military equipment (see Flight Simulators below).
Some war games could even be coupled with weather forecasts, as described
above, to understand how weather would affect battle strategies and transporta-
tion of troops and material.
Military simulations can be divided into two general types:
• Heuristic 50 simulations are deterministic simulations which have consis-
tent behavior.
• Stochastic simulations involve an element of chance; thus multiple plays
of the same situation can have different outcomes. Various aspects of the
simulation are determined by the generation of random numbers.
2.11.4 Biological Populations and Environments
Scientists have developed software which model specific kinds of animals and/or
plants. Together with models of their environment, a simulation over time can
produce information concerning:
• The organisms’ migration patterns, as a result of environmental change
• The organisms’ likelihood of population growth or decline
• The organisms’ likelihood of extinction
A fairly simple, but interesting, example of such a model was introduced by
John Conway51 in 1970. It is known today as Conway’s Game of Life. This
game is played on a grid of any size; imagine a large checkerboard, with rows
and columns of squares. Each position is either occupied by an organism or not
occupied. The game is actually a simulation, consisting of a series of steps, or
generations. It begins with an initial configuration of occupied squares. Each
step of the game then proceeds according to the following rules:
1. Any organism which has fewer than two organisms on neighboring squares52
will not survive to the next generation (it dies from lack of resources, sup-
port, loneliness perhaps)
2. Any organism which has more than three organisms on neighboring squares,
will not survive to the next generation (it dies from overcrowding, lack of
food perhaps).
3. Any organism which has two or three organisms on neighboring squares
will survive to the next generation.
50 A heuristic, as contrasted with an algorithm, is not guaranteed to reach a perfect soluition
to a problem. Heuristics are often used when there are no known efficient solutions to a
problem.
51 John Conway was a Mathematics Professor at Princeton University,
52 On a grid, each square has exaclty eight neighboring squares.
2.11. LEVELS OF ABSTRACTION IN MODELS AND SIMULATIONS 63
x
x x
x
Figure 2.33: Game of Life simulation - a blinker. From left to right showing the
simulation from an initial configuration to the first generation: Initial configu-
ration; two deaths(x) and two births(o); first generation; two deaths and two
births.
4. A new organism is born on any unoccupied square which has exactly three
organisms on neighboring squares.
An example of this simulation is shown in Figure 2.33. In this example the
initial configuration consists of three vertical occupied squares (left diagram in
the figure). We calculate the next generation as follows:
• According to rule 1 above, the top organism and the bottom organism
both die, because they each have only one neighbor.
• According to rule 3, the center organism survives to the next generation
because it has two neighbors.
• According to rule 4, there are births in the squares directly to the left
and directly to the right of the center square, because they each have
organisms in exactly three neightboring squares.
This is shown in the second board from the left. The first generation of
the game is then shown in the third board from the left (we assume the initial
configuration is generation 0).
To calculate the second generation, we apply the same rules, and see that
there are again two births and two deaths. This is shown in the board on
the right in Figure 2.33. Thus we see that the second generation is the same
as the initial configuration, and future generations will be alternating: three
vertical squares and three horizontal squares. We call this initial configuration
a Blinker ; it is an example of a class of initial configurations called oscillators.
They cycle through two or more configurations, before arriving back at the
initial configuration. There are other initial configurations which oscillate; this
is left as an exercise.
There are also stable configurations, also known as still life. An example is
the so-called Beehive shown in Figure 2.34. In this configuration each organism
has exactly two neighbors, so they all survive to the next generation. Also, no
unoccupied squares have organisms in exactly three neighbors, so there are no
births. All subsequent generations are exactly the same as the initial configu-
ration.
64 CHAPTER 2. ABSTRACTION
Figure 2.34: Game of Life simulation - a stable configuration, known as a Bee-
hive.
Figure 2.35: Game of Life simulation - initial configuration known as a Toad.
Generations 0-2.
A more interesting initial configuration, known as the ‘Toad’, is shown in
Figure 2.35, in which we also show generations 1 and 2. The Toad is an oscil-
lating pattern, similar to the Blinker.
Conway’s Game of Life has had some academic interest over the years, but
is not generally considered to be an accurate simulation of any real biological
populations or environments. We introduce it here mainly to provide the student
with an accessible example of a simulation.
2.11.5 Climate
Recently, scientific research on climate change has been in the news. There are
two different questions which have been raised:
• Has the climate been changing, and if so, how has it been changing? I.e.
what are the measurements that indicate consistent change?
• If the climate has been changing, is this change a direct result of human
artifacts or human-generated processes?
To answer these questions, scientists take measurements all over the world.
These include atmospheric measurements, as well as measurements in the oceans,
at all depths, and on land. Of particular interest are measurements taken at
the polar ice caps in which an historic record of the climate can be obtained by
ice core samples at various depths. Scientists note in particular the land/ocean
areas which are no longer covered by ice, and glaciers which have been melting.
Some fairly obvious evidence:
2.11. LEVELS OF ABSTRACTION IN MODELS AND SIMULATIONS 65
• Anyone flying over Greenland in an airplane can see large areas of land
where only 10 years earlier the land had been entirely covered with ice.
• Anyone who has traveled the Ice Highway in Canada can walk on glaciers
which have receded far from the highway.
• There are new shipping routes. Ships traveling between China and Europe
formerly took the Suez Canal. During the months of May - September,
they can now travel above the Arctic Circle, north of Russia and Siberia,
for a much shorter route.53
Using the measurements taken across the globe, scientists construct a model
for the climate, and use the model to attempt to predict the effects of climate
change.
• Is the average global temperature increasing? If so, by how much?
• Are sea levels rising? If so which coastal cities will be flooded, and when
will this happen?54
• Does climate change produce unusual, or potentially harmful, weather
patterns such as hurricanes, tornadoes, or monsoons?
Many scientists have used models which include atmospheric conditions over
long periods of time. It is claimed that gases in the atmosphere (principally car-
bon dioxide) affect the composition of sunlight which reaches the earth. These
scientists are using models to answer questions about climate change:
• If humans continue to generate carbon compounds in the atmosphere,
what will the impact be on climate?
• If humans decrease the amount of carbon being put into the atmosphere,
will the climate continue to change anyway?
• Are there other compounds in the atmosphere which affect the climate?
• What kinds of climate change have occurred in the past, and how are
they similar to, or different from, climate change that is currently being
observed?
2.11.6 Training
Simulation software has played an important role in training, or educating,
people to perform certain difficult tasks. Often it is too expensive or dangerous
for the trainee to attempt the actual task. In this case the trainee can perform
53 The shipping companies may see this as a good thing, as it improves their profit margins,
whereas climate scientists see the melting polar icecap as a sign of climate change.
54 Some scientists note that the flooding will occur because of the thermal expansion of the
oceans, in addition to the melting polar ice caps.
66 CHAPTER 2. ABSTRACTION
the task on a computer and observe the consequences of actions and decisions
with no danger involved.
One of the most important such training simulations is known as a flight
simulator. Commercial flight simulators are special-purpose full-size cockpits
with realistic panels displaying sensor information (airspeed, groundspeed, di-
rection, altitude, aircraft orientation, etc.). They also have realistic controls:
joystick, switches, hydraulic controls, etc. These simulators were first devel-
oped in the 1920’s and have been used extensively by the military and large
airline companies. These simulators are so realistic that would-be pilots can be
trained in a matter of days, before attempting to fly (with a co-pilot) an actual
aircraft.
More recently personal computers have been programmed to provide a sim-
ilar experience for the hobbyist. The display panels are on the computer’s
display. The controls are simulated by the mouse and keyboard.55 The most
popular amateur flight simulator was marketed by Microsoft since 1982 for the
IBM PC. In addition to showing cockpit panels, the computer’s display also
provides a view of what the pilot would see out the window, with a horizon line
and runways, when approaching an airport.
2.11.7 Exercises
1. Refer to Figure 2.31. Show the values for temperature and wind velocity
at step n+2. Your values should be close approximations of the values
which would actually occur.
2. DNA consists of strands of nucleotides. There are four kinds of nucleotides,
labeled C, G, T, A. The Markov Chain shown in Figure 2.36 shows the
probabilities that each nucleotide will or will not mutate when the DNA
molecule replicates. Using this model, and given the string of nucleotides
shown below, assume exactly one mutation occurs. Show a possible string
of nucleotides which is most likely to exist after one reproduction.
gctcagatcggcattacgct
3. List the names of several board games, and/or video games, which simulate
warfare.
4. Using the rules of Conway’s Game of Life, show at least 4 generations for
each of the following start configurations:
(a)
55 Game joysticks are also used to simulate the real joystick in an aircraft.
2.11. LEVELS OF ABSTRACTION IN MODELS AND SIMULATIONS 67
99
A❥
.6 0.8
99 C❥ .2 .2
❥ 99.1
G
.4
.7
.3
T❥ 99.7
Figure 2.36: A diagram of a Markov Chain model for replication of a DNA
molecule
(b)
(c)
5. Build an Excel spreadsheet to simulate Conway’s Game of Life.
Hint: Put each generation on a separate sheet. On each sheet use three n
x n grids showing:
• The configuration, with a ’*’ in each occupied square
• The same configuration, substituting 1 for occupied squares, and 0
for unoccupied squares
• A grid showing the number of occupied neighbors for each square.
6. (a) Search the internet for reliable sources which claim that the earth’s
climate is undergoing a sudden change.
(b) Search the internet for reliable sources which claim that the earth’s
climate is not undergoing a sudden change.
(c) Search the internet for reliable sources which claim that the earth’s
sudden change in climate is caused by artificially produced gasses in
the atmosphere.
68 CHAPTER 2. ABSTRACTION
(d) Search the internet for reliable sources which claim that the earth’s
sudden change in climate is not caused by artificially produced gasses
in the atmosphere.
(e) Which of the above sources make use of digital models of the climate?
7. In addition to flight simulators, what other useful kinds of training can be
done with simulators?
Chapter 3
Data and Information
In this chapter we examine data and information. Although these words are
often use interchangeably, we make a careful distinction:
• Data might well be thought of as raw data. Binary data is merely a
sequence of 1’s and 0’s with no particular meaning or interpretation asso-
ciated with the sequence.
• Information is data which has been assigned meaning or interpretation.
Subsequences of bits can be grouped in a meaningful way, and given a
particular interpretatioon which is useful or meaningful in some way.
3.1 Information Processing
Once we have information stored in a computer, in digital form, we can work
with that information to gain insight and knowledge. This is known as infor-
mation processing.
3.1.1 Processinig Information to Gain Insight or Knowl-
edge
The primary objective when processing information is to deduce knowledge, or
gain insight of some sort, into the domain of the information.
As an example, suppose we have the information shown in Figure 3.1.1 For
each student we have stored their Grade Point Average (GPA) on a scale of 4.0
maximum. We have also stored whether they are a commuter, versus residential
student, whether they belong to a fraternity or sorority, and the number of
credits completed.
What insight can be gained from this limited amount of data? We will
attempt to find a correlation, or relationship, between various attributes in the
table and the students’ GPA.
1 This data is fictitious, and all conclusions drawn from this data are not necessarily valid.
69
70 CHAPTER 3. DATA AND INFORMATION
First we look at whether the student was a member of either a fraternity
or a sorority. Of those who belonged to either a fraternity or a sorority, the
average GPA is 2.3, on a scale of 4.0 maximum, whereas for those students who
belong to neither a fraternity nor a sorority, the average GPA is 3.6. This is
a fairly large difference, indicating a correlation between a student’s GPA and
membership in these social organizations.
Note that a correlation does not imply a cause and effect relationship. We
cannot conclude from this analysis that membership in a fraternity or sorority
causes a student to have a lower GPA. It is possible, for example, that students
with poor study habits are attracted to social organizations, or that students
with good study habits are not attracted to social organizations. It is also possi-
ble that students who are struggling academically seek out social organizations
for help with their studies.
Next we look at whether the student is a commuter. With some calculations
we see that the average GPA for this group of students is about 2.7. We compare
that with the average GPA of those students who are commuters (2.8) with the
average GPA of those students who are not commuters (2.6). We might be
tempted to see a positive correlation here between GPA and being a commuter,
but the difference, only one tenth on a scale of 4, is not large enough to be
statistically significant.2
Finally we examine the number of credits completed by the students. To
do this we divide the students into two groups: those who have completed
more than 40 credits, and those who have completed 40 credits or fewer.3 We
see that the average GPA of those students who have completed more than
40 credits is 3.2, and the average GPA of those students who have completed
40 credits or fewer is 2.4. A statistician is likely to consider this difference
statistically significan, but would call it a weak correlation between GPA and
credits completed.
In this example of information processing we have gained some limited in-
sight into aspects of college life which may or may not be correlated with a high
GPA.
3.1.2 Collaboration
The example in the previous section consisted of only 12 students. This is a
small number of cases, and is certainly too small to reach any real conclusions.
It would certainly be better to use actual data from a university, consisting of
thousands of students. The reliability of the conclusions is a direct result of the
number of cases (students) for which we have data.
Even better would be the amalgamation of data from several universities.
This could conceivably lead us to gain insight in the practice of fraternities and
2 Statistical significance is beyond the scope of this course, and is covered in most intro-
ductory statistics courses.
3 Statisticians have developed procedures for determining correlations without grouping the
cases as we are doing here; this is also beyond the scope of this course.
3.1. INFORMATION PROCESSING 71
Fraternity/ Credits
Name GPA Commuter? Sorority Completed
al 2.4 Y Fraternity 12
bart 1.4 N Fraternity 60
beth 3.4 Y 45
chas 3.7 Y 90
jen 2.0 Y Sorority 25
jim 2.0 N Fraternity 22
joe 3.6 N 90
mary 3.8 Y 25
mike 1.9 N Fraternity 25
sue 2.2 Y Sorority 30
susie 3.9 N Sorority 60
tom 2.4 Y Fraternity 30
Figure 3.1: Some information for several college students
sororities at various institutions. It would certainly improve the reliability of
our conclusions because of the large number of students.
In order for this kind of collaboration to occur, it is often necessary for
information to be ‘massaged’ in some way. For example, universities which
have residential social organizations probably should not be compared with
universities that have non-residential social organizations. Also, the maximum
GPA at a university can vary; it may be 4.0 at some universities, but 5.0 at other
universities. In this case the GPA calculation should be, perhaps, a fraction of
the maximum: a GPA of 4.2/5.0 is lower than a GPA of 3.8/4.0, for example.
In general, collaboration allows for:
• An increased quantity of data, resulting in more information and greater
reliability of insight, knowledge, and conclusions
• An increased number of ways that the information can be processed, as
various researchers offer their own processing schemes
• A way of cross-checking the validity of information processing schemes and
conclusions, as various researchers examine the work of other researchers
3.1.3 Explanation with Visualization or Notation
In the example given above we showed how information processing allows us to
gain some insight or understanding of college life and students’ GPA. However,
often the insight is more clear if presented in a non-numeric form, such as graph-
ical charts or pictures. This kind of display is usually described as information
visualization. Information can take many forms: bar charts, line charts, scatter
charts, pie charts, and other forms.
72 CHAPTER 3. DATA AND INFORMATION
4
3
2
1
F F S F F S S F
0
Figure 3.2: A bar chart showing student GPAs and social organizations, F =
Fraternity, S = Sorority (refer to Figure 3.1)
Fraternity/ Credits
Name GPA Commuter? Sorority Completed Age
al 2.4 Y Fraternity 12 18
bart 1.4 N Fraternity 60 18
beth 3.4 Y 45 48
chas 3.7 Y 90 20
jen 2.0 Y Sorority 25 19
jim 2.0 N Fraternity 22 25
joe 3.6 N 90 20
mary 3.8 Y 25 18
mike 1.9 N Fraternity 25 19
sue 2.2 Y Sorority 30 21
susie 3.9 N Sorority 60 18
tim 2.4 Y 32 52
tom 2.4 Y Fraternity 30 18
Figure 3.3: Some information for several college students, including age
In Figure 3.2 we show an example of information visualization; it is a bar
chart of our students’ GPAs, but it also shows which students belong to frater-
nities, which belong to sororities, and which do not belong to any of these social
organizations.
The bar chart makes it visually clear that there is an apparent correlation
between GPA and membership in social organizations.4
3.1.4 Exercises
1. The information on students has been expanded to include the students’
ages, as shown in Figure 3.3.
(a) Is there a correlation between GPA and the student’s age? If so, is
it a positive or negative correlation?5
4 The sorority member who has a GPA of 3.9 does not contradict the correlation; this data
point is called an outlier.
5 A positive correlation would mean that students with a greater age generally have a
3.2. INFORMATION: EXPLORATION AND DISCOVERY 73
(b) Is there a correlation betwwen student’s age and membership in a
social organization?
2. (a) Show a chart which supports your solution to the previous exercise
on the correlation between age and GPA.
Hint: Use a scatter chart in which the X axis is GPA, and the Y axis
is the student’s age. Each student will appear as a point on the XY
plot.
(b) Show a chart which supports your solution to the previous exercise
on the correlation between a student’s age and and membership in
social organizations.
3.2 Information: Exploration and Discovery
Since the advent of the Internet in 1982 exploration and discovery has become
commonplace. Search engines offered by corporations such as Google and Yahoo
are capable of visiting a huge number of web sites in a short period of time to
find information relevant to a particular search problem.
3.2.1 Extracting Information from Large Datasets
Today there are numerous examples of large datasets, from which useful in-
formation can be extracted. This is not a simple and straightforward task.
Because of the large quantity of data available, efficient methods are required.
Some examples of large datasets containing useful information are shown below.
[Link] Cable TV
When you use a remote control device to change TV channels, search for a par-
ticular program, mute the sound, or browse what is available, all of your actions
are recorded by the cable TV provider. Multiply these actions by millions of
viewers, and the provider has a huge dataset from which valuable information
can be obtained. From this huge dataset the cable TV company can extract the
following:
• How many people are watching each program at a given time
• How many people are watching each advertisement, with or without sound
• When are people most likely to have the TV on
• What are the trends in switching from one program to another
greater GPA. A negative correlation would mean that students with a greater age generally
have a lower GPA.
74 CHAPTER 3. DATA AND INFORMATION
• What frequency and length of advertisements cause people to switch chan-
nels, or turn off the TV
• Which advertisements are most/least objectionable
• For what kinds of programmatic material are people most often searching
[Link] Telephone use - communication
When you use your phone to communicate with voice or text, this is recorded
by the provider. The provider has a dataset known as metadata. This is not the
actual content of the voice or data communications, but it includes the source,
the target(s) being called, the date and time, the duration of the call.
From this huge dataset the provider can extract useful or valuable informa-
tion:
• When are the most common days/times of the week for phone communi-
cation
• In what geographic locations are most phone users likely to need service
• What resources are needed to accommodate voice versus text
• Who has communicated with terrorist, or other illegal, organizations or
people6
[Link] Cellular phone use - tracking
Smart phones, fitness wathches, and other digital devices make use of the Global
Positioning System (GPS) to find the device’s position on the surface of the earth
(lattitude, longitude, and altitude). This is one of the most sought-after features
for individual users, as well as vehicles such as automobiles, trucks, airplanes,
and ocean-going ships. The device with GPS sensors and software receives
signals from three or more satellites, which are used to determine position.7
The provider of these services has access to this data, for potentially millions
of users, and can extract useful and valuable information from this huge dataset:
• Where are traffic jams occurring on the roadways
• What routes are people likely to take from one location to another
• Where are people likely to stop when traveling from one location to an-
other
• When will traffic volume be at its highest
6 Legal questions have been raised when law enforcement officials have requested access to
metadata, as well as access to the data on an individual’s phone.
7 See the Oct 2020 issue of the Communications of the ACM for an article on privacy with
respect to cellular phones.
3.2. INFORMATION: EXPLORATION AND DISCOVERY 75
• Where do people tend to exceed the speed limit, and by how much
• How can criminals at large be tracked and apprehended8
[Link] Social media
Popular applications accessible on the web or on smart phones include Facebook,
Twitter, Instagram, LinkedIn, and other so-called social media. As opposed to
email, which is a one-to-one or one-to-many form of communication, social media
allow for many-to-many forms of communication. Much of the communication
provided by these social media could be completed using email; however, the
convenience and power of the social media has won over many users.
A social medium such as Facebook establishes direct connectivity among
users all over the globe. By indicating a ‘like’ on Facebook, one is instantly
connected with someone else, who in turn is connected to others. This extensive
connectivity among users has been an attraction for some, but a negatvie feature
for others who fear the potential consequences of excessive connectivity.9
All this data is available to the provider (Facebook, Twitter, etc). The
provider is able to extract useful or valuable information from this huge dataset:
• At what times are people most likely to be accessing social media
• Who is ’liking’ various retailers or vendors
• Who is registered to receive an individual’s Tweets
• Analysis of various job markets, via LinkedIn
• Data can be used to impact elections and politics10
[Link] Purchasing
Purchasing habits, preferences, and trends constitute extremely valuable infor-
mation for vendors. The Amazon corporation began as a distributor of books,
but later distibuted everything from appliances to clothing, electronics, and
vehicles.
Amazon’s business model entails distribution and storage only, with no man-
ufacturing involved. However, because it is directly connected to the manufac-
turers and because it has extensive data on inventories and customer preferences,
with a strong on-line presence, it has been able to grow into one of the leading
enterprises in the world today.
8 Legal questions have been raised here as well.
9 Social media are prime targets for the spread of digital viruses and other malware.
10 In the 2016 presidential election, it was later discovered that Cambridge Analytica used
Facebook to promulgate false information on candidates for office in the United States. In
light of this scandal, it is a mystery to this author why supporters of Hillary Clinton continue
to use Facebook.
76 CHAPTER 3. DATA AND INFORMATION
3.2.2 Data analytics⊗
Also known as data science 11 , data analytics is the systematic computational
analysis of data or statistics. A data analyst, or data scientist, develops and/or
uses software designed to search large quantities of raw data for patterns or
information leading to knowledge of a targeted content area. Data analytics
includes web analytics, in which the search is restricted to the world-wide-web.
For example, a communications provider such as Comcast or Verizon may
search a database of television viewer selections which include the following:
• A viewer switches their TV on or off
• A viewer changes the channel selection
• A viewer mutes, or adjusts the volume
• A viewer searches for particular programming
• A viewer records content
Using this raw data, the provider can use data analytics to provide potential
advertisers with information promoting the value of program sponsorship.
3.2.3 Machine learning⊗
Machine learning is the area of study in which we build software that automat-
ically improves in some way as a result of its own experience. Machine learning
is considered a specialty area of artificial intelligence.
A company such as Netflix uses software to predict a user’s preferences in
streamed video content. Initially the software may not provide the user with
good suggestions, but over time the program ‘learns’ better ways of predicting
preferences, and ultimately evolves into a system which successfully predicts
user preferences.
In the future we are likely to see increased use of machine learning in medical
diagnoses, either as an aid to human physicians, or eventually in place of human
physicians.
In the area of machine learning there have been more failures than successes,
but this remains a widely pursued area of research.
3.2.4 Exercises
1. Explain how each of the following can extract useful or valuable informa-
tion from large datasets:
(a) Banks and other financial institutions such as inssurance companies
(b) Hospitals or other healthcare corporations
11 More accurately, data science is to chemistry as data analytics is to chemical engineering
3.3. DIGITAL DATA 77
(c) Government agencies, such as the Internal Revenue Service, Social
Security Administration, etc.
(d) Military organizations
(e) Airlines and other transportation organizations such as railroad and
bus companies.
2. How are data analytics used in professional sports?
3. What are some of the advantages and disadvantages of using machine
learning in medical diagnoses?
3.3 Digital Data
3.3.1 Time and Space Efficiency
When data is stored in a digital format, there are various forms and trade-offs
possible. For small datasets, this is not an issue; we simply store or transmit data
as a sequence of 0’s and 1’s. However, for extremely large datasets, efficiency
in both time and space is critical. When storing digital data such as music or
video, we must be aware of the fact that billions, or trillions, of bits are involved
in the storage of one music or video clip. Even more serious is the transmission
of this information from one device to another, or even from one part of a
device to another (for example, from a magnetic disk, or solid-state storage, to
a computer’s memory). In this case it is not the storage space with which we
are concerned, but the time that is taken for the transmission to occur.
For these reasons, various data compression techniques have been developed.
There are two main categories of data compression: lossy and lossless. Lossy is
not perfect; when the data is compressed and then decompressed to its original
format, there may be a small number of bits which are not correct. With lossless
compression, no information is lost; when compressing and decompressing data,
the result is exactly the same as the original data that was compressed. Lossy
compression results in greater savings, with an approximation of the original
data. Lossless compression produces the original data. In either case space
is saved by storing the compressed data, and transmission time is reduced by
transmitting the compressed data. More details on compression algorithms was
presented in Chapter 2.
3.3.2 Security and Privacy
Much sensitive information is stored on digital devices. This could include:
• Financial information such as bank account numbers. If this information
were to fall into the wrong hands the owner could be a target of digital
theft.
78 CHAPTER 3. DATA AND INFORMATION
• Identity information such as social security numbers and personal informa-
tion used for authentication.12 The compromising of identity information
is known as identity theft. Once an individual’s identity has been stolen,
the thief can then pose as the victim to invoke financial transactions for
the purpose of digital theft.
• Various entities may have an interest in discovering an individual’s web
browsing habits for various reasons, including, but not limited to, financial
reasons. Many users consider this an invasion of personal privacy.
To protect personal information and privacy, software is being developed to
authenticate users and encrypt data. For example, speech recognition software
is now available to authenticate a bank customer’s voice on the phone.
Most computer operating systems now have the capability of encrypting all
data on permanent storage. Encryption is the process of scrambling the bits
of a data segment in such a way that the bits can be unscrambled only by
an authorised user. This encryption and decryption process now takes place
automatically, in such a way that the user does not know it is taking place; we
say that the encryption is seamless. An unauthorised intruder, however, would
not be able to retrieve any meaningful information from the encrypted data in
permanent storage.
3.3.3 Access to Data
Care must be taken when providing access to data for many users. If the users
are given read access, they can examine the data but cannot make updates
(changes) to the data. If the users are given write access to data, they are
permitted to make updates. However, in this case only one user may have write
access at a particular time to avoid contradictions. A contradiction would result
in the following scenario:
1. Joe opens a data file with write access. He is working with his own copy
of the file.
2. Mary opens the same data file with write access. She is working with her
own copy of the file.
3. Joe changes the number 100 to -100, saves the data file, and closes it.
4. Mary does not see Joe’s change to the data. She changes the number 200
to -200, saves the data file, and closes it.
5. Joe opens the data with read access and sees a contradiction: the value
that he had set to -100 is now 100. Joe’s edits have been lost.
To avoid contradictions only one user should be able to open a file with write
access at any one time.
12 Authentication is the process of establishing the true identity of a person or other entity.
3.3. DIGITAL DATA 79
This is a major concern in any distributed 13 reservation system, such as an
airline reservation system. At any one time multiple airline agents may attempt
to reserve a seat on a given flight. The system will queue the requests for a seat
and handle one at a time to avoid over-booking a flight.14
3.3.4 Exercises
1. Show how the following sequence of data values can be compressed to save
storage space and transmission time:
9805743121 9805743122 9805743121 9805743120 9805743121 9805743119
9805743125 9805743121 9805743122 9805743112 9805743123 9805743123
2. When you login to your bank’s web site to check the status of your checking
account, the bank needs to ensure that you are who you claim to be.
This is called authentication. List several techniques that can be used for
authentication.
3. List some distributed systems, other than airline reservation systems,
which must ensure that contradictions do not occur.
13 A distributed system is one which is used simultaneously by several users on a network.
14 Airlines often over-book intentionally, but this is a different matter altogether.
Chapter 4
Algorithms
An algorithm is a precise sequence of instructions, or steps, which can be used
to solve a given problem. The algorithm must eventually terminate with a
correct solution to the problem. In this chapter we expose the notion of algo-
rithm without concrete implementations that can be executed; we will discuss
programming in chapter 5.
An algorithm may be designed, or described, in a fairly abstract way, as
long as it clearly specifies the steps that are required to solve the given prob-
lem. The algorithm can be implemented by writing a computer program in any
programming language, or by building a digital device to implement the algo-
rithm. We emphasize the distinction between the algorithm and a particular
implementation of the algorithm.
In this book we offer two ways of describing an algorithm:1
• We will describe algorithms using a Text language, which is amenable to
text-only document systems, such as Notepad, Textedit, etc.
• We will describe algorithms using a Block language, which uses non-
textual graphic structures to describe an algorithm. The block language is
easier to read, particularly for non-programmers. However, it is not easily
generated in machine-readable form.
4.1 Algorithm design and implementation
In any algorithm there are three fundamental building blocks, known as con-
trol structures. These are sequence, selection, and iteration. Using only these
building blocks, complex algorithms can be defined.
1 These algorithm description languages are used in the Computer Science Principles AP
exam.
80
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 81
Text: Block:
x ← 23 x ← 23
Figure 4.1: An assignment operation in both text language (left), and block
language (right).
4.1.1 Variables, assignments, and the sequence control struc-
ture
Sequence is the most fundamental, and simplest, control structure in an algo-
rithm. It means that the steps can be listed sequentially. When the algorithm
is executed, the steps are executed one at a time in the order in which they are
listed in the algorithm. 2
In our examples, we must assume certain primitive operations and storage
are available, in addition to the control structures. These are:
• A variable may store a number as its value. For example the variable x
may store the value 23. We denote this as x ← 23. We would read this
as ‘x gets 23’ or ‘x is assigned 23’. We would not read this as ‘x equals
23’. This operation is depicted in both the text language and the block
language in Figure 4.1.
A variable may consist of more than one letter, are case sensitive, and may
even include numeric characters. Examples of variables are: sum, result,
result32, finalResult Result.
• Move the value of a variable to another variable. This is called an assign-
ment operation. We denote this as x ← y and read this as ‘x gets y’. Note
that the former value of x, if it had one is replaced by the value of y. We
say that this operation clobbers the variable x.3
• Addition, subtraction, multiplication, and division of numbers are denoted
with operators: +, -, *, /, respectively. To the right of the arrow in an
assignment one may have an arithmetic expression, composed of these
operations, variables, constants, and parentheses. For example: x ←
(a + b) ∗ 3.
As an example of an algorithm which uses only the sequence control structure
we define an algorithm to find the sum of 5 given integers, stored in the variables
a, b, c, d, e. This algorithm is shown in Figure 4.2.4
2 The Computer Science Principles AP course description refers to the sequence control
structure as a block, not to be confused with the Block algorithm description language.
3 Many students forget that x ← y changes x but does not change y.
4 The algorithm in Figure 4.2 could have been done with a single assignment statment, but
we wish to expose the sequence control structure. Also this algorithm serves as a lead-in to
the discussion of the iteration control structure, below.
82 CHAPTER 4. ALGORITHMS
Text: Block:
result ← a
result ← result + b
result ← result + c result ← a
result ← result + d
result ← result + e
result ← result + b
result ← result + c
result ← result + d
result ← result + e
Figure 4.2: An algorithm to sum the values of the variables a,b,c,d,e using the
sequence control structure, showing the Text version on the left and the Block
version on the right.
4.1.2 Boolean expressions and selections
The selection control structure5 allows us to choose one of two possible options
in any step of an algorithm. But before describing the selection control structure
we must introduce the concept of a boolean expression.
[Link] Boolean expressions
A boolean expression 6 is an expression which has a true/false value. More for-
mally, if .be. represents a boolean expression, then a boolean expression may
be defined as any one of the following:
1. A comparison of arithmetic (or boolean) expressions
2. .be. OR .be.
3. .be. AND .be.
4. NOT .be.
These boolean operations can be formally defined by a truth table, as shown in
Figure 4.3.
An example of a boolean expression is shown in Figure 4.4.
5 The Computer Science Principles AP course description refers to the selection control
structure as a conditional.
6 Named for the British logician George Boole
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 83
x y x OR y x AND y NOT x
false false false false true
false true true false true
true false true false false
true true true true false
Figure 4.3: Truth table showing three boolean operations
Text:
b < c AN D (a = 3 OR a > b)
Block:
b<c AND a=3 OR a>b
Figure 4.4: Example of a boolean expression, showing the Text version (top)
and the Block version (bottom).
To form a comparison of arithmetic expressions we may use any of the six
operators shown here: = < ≤ > ≥ 6=
A selection structure will evaluate a boolean expression, and based on the
result, select a block of statements to be executed. There are two kinds of
selection structures:
[Link] One-way selection
A one-way selection will select a given block to be executed only if the boolean
expression is true. A flow diagram for a one-way selection is shown in Figure 4.5
A one-way selection structure is included in an algorithm using the word IF.
An example of a one-way selection, in both text and block formats is shown in
Figure 4.6. In that example, the assignments to the variables b and x are made
only if the value of the variable a is 0.
[Link] Two-way selection
A two-way selection will select one of two given blocks; if the boolean expression
is true, execute the first block; if the boolean expression is false, execute the
second block. Figure 4.7 is a diagram which represents a two-way selection
structure.
An example of a two-way selection is shown in Figure 4.8. In this example
the variable a is assigned a value only if the current value of the variable a is
greater than the value of the variable b, and the variables b and x are assigned
values only if the value of the variable a is less than or equal to the current
value of the variable b.
84 CHAPTER 4. ALGORITHMS
false
Condition
true
block of
statements
Figure 4.5: Flow diagram for a one-way selection structure
Text:
IF (a=0)
{
b = 3;
x = b*17;
}
Block:
IF a=0
b←3
x ← b ∗ 17
Figure 4.6: Example of a one-way selection structure, showing the Text version
(upper left) and the Block version (lower right).
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 85
Second block of false true First block of
Condition
statements statements
Figure 4.7: Flow diagram for a two-way selection structure
Text:
IF (a>b)
a = b*3;
ELSE
{
b = 0;
x = 0;
}
Block:
IF a<b
a ← b∗3
ELSE
b←0
x←0
Figure 4.8: Example of a two-way selection structure, showing the Text version
(upper left) and the Block version (lower right).
86 CHAPTER 4. ALGORITHMS
IF x>y
temp ← x
x←y
y ← temp
Figure 4.9: Example of an algorithm to order the variables x and y so that the
smaller value is stored in x and the larger value is stored in y.
A one-way selection has no ELSE part; this is the only significant difference
between a one-way selection and a two-way selection. 7
As an example of an algorithm, we pose the following problem: Given two
variables with values, x and y, terminate with the smaller value stored in x, and
the larger value stored in y. This algorithm will need to use a third variable,
we’ll call it temp. An algorithm to solve this problem uses a one-way selection,
and is shown in Text format below:
IF (x > y)
{
temp ← x
x←y
y ← temp
}
This algorithm is shown in block format in Figure 4.9. In this example,
nothing need be done in the case where x ≤ y, thus there is no ELSE part, i.e.
a one-way selection is sufficent.
[Link] Equivalent algorithms
When developing algorithms, it is often the case that algorithms which are very
different in appearance provide solutions to the same problem. We say these
algorithms are equivalent if they have the same result and the same side effects.8
7 A block of statements in a selection may be a single statement (as in Figure 4.8), though
many educators, and the Computer Science Principles course description, tend to use a block
even if it consists of just one statement.
8 Explicit results and side effects will be discussed below.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 87
As an example consider the boolean expression:
x > y AND b = 0
We could use this in a conditional statement in two ways:
• IF (x > y AND b = 0)
<Consequent Statement or Block>
• IF (x > y )
IF (b = 0)
<Consequent Statement or Block>
In either case the consequent statement will be executed only when both com-
parisons are true.
4.1.3 Iteration
An iteration control structure specifies the repetition of a block.9 We must take
care to ensure that the block is executed the correct number of times. There are
a few ways of specifying a repetition in an algorithm. Here are some methods
for controlling the number of repetitions:
[Link] Specify the number of iterations
In an algorithm we can specify the number of times that a block10 is to be
executed:
REPEAT n TIMES
where n may be any arithmetic expression. The expression is evaluated, and
that is the number of times the block is executed. For example, an algorithm
which calculates 212 is shown in Figure 4.10.
[Link] Specify a termination condition
We can also control an iteration by specifying a termination condition. This
will be a boolean expression, evaluating to either true or false. If the boolean
expression is false, the block is repeated; if the boolean expression is true, the
block is not repeated, i.e. the iteration terminates. The form of the iteration is:
REPEAT UNTIL < boolean expression >
We can describe the same algorithm, to calculate 212 , using a termination
condition, as shown in Figure 4.11.
Care must be taken when using a termination condition; if the condition
never becomes true, the body is repeated indefinitely, and never terminates.11
This would not be an algorithm, since algorithms must terminate.
9 An iteration is often called a loop.
10 theblock which is repeated is often called the loop body.
11 This is known as an infinite loop.
88 CHAPTER 4. ALGORITHMS
Text: Block:
result ← 1
REPEAT 12 TIMES
{ result ← 1
result ← result ∗ 2
}
REPEAT 12 TIMES
result ← result ∗ 2
Figure 4.10: An algorithm to calculate 212
Text: Block:
result ← 1
counter ← 12
REPEAT UNTIL counter = 0 result ← 1
{
result ← result ∗ 2
counter ← counter − 1 counter ← 12
}
REPEAT UNTIL counter = 0
result ← result ∗ 2
counter ← counter − 1
Figure 4.11: An algorithm to calculate 212 , with a termination condition
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 89
Termination true
Condition
false
Block of
Statements
Figure 4.12: Flow diagram for an iteration structure
Text: Block:
myList ← [−3, 12, 0, 12]
myList← −3, 12, 0, 12
Figure 4.13: A list of numbers; Text version on the left and Block version on
the right.
Note that the algorithm given in Figure 4.10 is equivalent to the algorithm
given in Figure 4.11; they have the same result.
Figure 4.12 is a diagram representing an iteration structure in which a
logical condition is used to determine whether the steps are to be repeated.
4.1.4 Lists
A list is an aggregation of several data values into one component, which may
be assigned to a variable. In most of our examples these data values will be
numbers, but they may be alphabetic characters, or other kinds of data. An
example of a list consisting of the data values -3,12,0,12 is shown in Figure 4.13.
Note that a list of numbers may contain negative numbers, and any list may
contain duplicate values, unless otherwise stipulated.
90 CHAPTER 4. ALGORITHMS
Text: Block:
aList ← [5, 4, 9]
x ← aList[1]
aList[0] ← 17 aList← 5, 4, 9
x ← aList 1
aList 0 ← 17
Figure 4.14: An algorithm which selects values from a List. At termination, x
is 4, and aList is [17,4,9].
[Link] List selection
We can select a single value from a List of values by giving its position, or index,
in the List. The position of the first value is always 0; if the size of the List is
n, the position of the last value is n-1. In our Text format for algorithms, List
selection is specified by placing the index in square brackets. Thus, myList[3]
refers to position 3 (actually the fourth position) in myList. In Block format,
we show the index in a rectangle. To change a value in a List we can place
the List selection to the left of the assignment arrow. Figure 4.14 shows a List
of three numbers, the selection of the value at position 1, and a change to the
value at position 0.
Note that the index can be any expression which evaluates to a valid position
in the List.
[Link] Other List operations
Four operations are designed to be used specifically with Lists.
• The INSERT operation will insert a value into a List, increasing the size
of the List by one. When applying this operation, one must give the name
of the List, the position at which a value is to be inserted, and the value
to be inserted, in that order, as shown in Figure 4.15.
• The APPEND operation will add a value at the end of a List.12 One
12 APPEND is equivalent to an INSERT after the last position in a List.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 91
Text: Block:
aList ← [5, 0, 3, 6]
INSERT(aList,2,15)
aList← 5, 0, 3, 6
INSERT aList,2,15
Figure 4.15: Inserting the value 15 at position 2 of the List [5,0,3,6]. After the
insertion, aList is [5,0,15,3,6].
Text: Block:
aList ← [3, −2, 16]
APPEND(aList,-4)
aList← 3, −2, 16
APPEND aList,-4
Figure 4.16: Appending the value -4 to the List [3,-2,16]. After the append
operation, aList is [3,-2,16,-4].
must give the name of the list and the value to be added, as shown in
Figure 4.16.
• The REMOVE operation will remove the value at a given position from
a given List. After the operation is complete, the size of the List will be
reduced by one. It is an error to REMOVE from an empty List, i.e. a List
which has no values. One must give the name of the list and the position
of the value to be removed, as shown in Figure 4.17.
• The LENGTH operation returns the number of values in a List. The
previous three operations change the List (this is a side effect), but have
no explicit result. The LENGTH operation has no side effects, but does
have an explicit result, which may then be assigned to a variable, as shown
in Figure 4.18. Note that the result of the LENGTH operation may be
used in an arithmetic expression. For example,
doubleLen ← 2 ∗ Length(aList)
[Link] Iterating through a List
Previously we showed two ways of creating an iteration control structure. We
now show another iteration control structure, specifically designed for Lists. It
92 CHAPTER 4. ALGORITHMS
Text: Block:
aList ← [3, −2, 16, 7]
REMOVE(aList,2)
aList← 3, −2, 16, 7
REMOVE aList,2
Figure 4.17: Removing the value at position 2 from the List [3,-2,16,7]. After
the remove operation, aList is [3,-2,7].
Text: Block:
aList ← [2, 5, 8, 11]
len ← LEN GT H(aList)
aList← 2, 5, 8, 11
len ← LENGTH aList
Figure 4.18: Finding the length of the List2,5,8,11. After the LENGTH opera-
tion, the value of len is 4.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 93
Text: Block:
FOR EACH variable IN list
{
block of FOR EACH variable IN list
statements
}
block of
statements
Figure 4.19: General format of a FOR EACH structure
is called a FOR EACH iteration. One specifies the name of a List, and the name
of a variable. The iteration cycles through the values in the List, assigning each
one to the specified variable on each iteration. Figure 4.19 shows the general
format for a FOR EACH iteration.
As an example we present an algorithm to find the sum of the numbers in
a List of numbers. It uses a FOR EACH ietration to cycle through the List,
storing each number in the variable value, and accumulating the sum. It is
shown in Figure 4.20.
4.1.5 Nested control structures
Any step within a block can itself initiate one of the three control structures -
sequence, selection, and iteration. Thus, these control structures may be nested,
one within another.13 More formally, control structures are recursive structures.
We will see examples of nested control structures below.
As an example of nested control structures we will present an algorithm
which finds the smallest value in a given List.14 The algorithm will choose the
first value in the list as the presumed smallest, and store it in a variable, e.g.
smallest. Then it will iterate through the remaining values, comparing each
with smallest. If a value is smaller than smallest, smallest is changed to that
value. The variable smallest is always storing the smallest value seen thus far
as we iterate through the List. When the algorithm terminates, the variable
smallest is storing the smallest value in the List. The algorithm is shown in
Figure 4.21.
Note that we can select position 0 of the List at the beginning of the algo-
rithm because we know the List is not empty. In this algorithm we have nested
a conditional control structure within an iteration.
The problem which this algorithm solves is an example of an extremum
problem, which is a more general class of problems involving a search for the
largest or smallest in some collection.
13 We see no apparent need to nest a sequence block within a sequence block.
14 In this algorithm we assume the List is not empty.
94 CHAPTER 4. ALGORITHMS
Text: Block:
numbers ← [5, 3, 99, 3, −3]
sum ← 0
FOR EACH num IN numbers numbers← 5, 3, 99, 3, −3
{
sum ← sum + num
sum ← 0
}
FOR EACH num IN numbers
sum ← sum + num
Figure 4.20: Algorithm to find the sum of the numbers in the List [5,3,99,3,-3].
At termination the value of the variable sum should be 107.
4.1.6 Abstraction of Algorithms: Procedures
Recalling from chapter 2 that abstraction is the process of hiding the details of
an artifact so that only the essential parts are visible to a user of the artifact,
we now apply abstraction to algorithms. We will do this by introducing the
concept of a procedure. A procedure encapsulates an algorithm for use by other
algorithms. There are two aspects to procedures:
• The procedure definition consists of:
– A name for the procedure
– Zero or more inputs to the procedure, known as parameters 15
– A block of statments known as the procedure body
– An explicit result, or return value, which is optional
The format of a procedure definition is shown in Figure 4.22.16
• The procedure can be called or invoked from another procedure by pro-
viding:
– The name of the procedure being called
15 What we are calling parameters are sometimes called formal parameters
16 This notation is derived from the mathematical notation for a function, though an algo-
rithm need not have an explicit result, and may have ‘side effects’.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 95
Text: Block:
numbers ← [5, −3, −99, 2, 3]
smallest ← numbers[0]
FOR EACH num IN numbers numbers← 5, −3, −99, 2, 3
{
IF (num < smallest)
{
smallest ← numbers 0
smallest ← num
}
}
FOR EACH num IN numbers
IF num < smallest
smallest ← num
Figure 4.21: Algorithm to find the smallest number in the List [5,-3,-99,2,3];
when the algorithm terminates the variable smallest is storing the smallest value,
-99.
96 CHAPTER 4. ALGORITHMS
Text:
PROCEDURE procedure name (parm1,parm2,...)
{
block of
Block:
statements
} PROCEDURE procedure name parm1
parm2
...
block of
statements
Figure 4.22: General format of a Procedure definition; parm1, parm2, etc. rep-
resent the procedure’s parameters
Text: Block:
RETURN (expr) RETURN expr
Figure 4.23: Format for a RETURN statement in a procedure; the expression
(expr) is optional.
– The values for the inputs to the procedure, known as arguments 17
The arguments must agree with the parameters in the procedure
definition, both in number and type
When a procedure is called, execution of the calling procedure is temporarily
paused, the values of the arguments are assigned to the parameters, and the
called procedure is executed. When the called procedure terminates, the calling
procedure resumes execution at the point where it was paused.
[Link] Return value
A procedure may have an explicit result, or return value, in which case that re-
sult can be used as part of an expression. The format of the RETURN statement
is shown in Figure 4.23.
The RETURN statement always terminates the procedure, returning control
to the calling procedure. A procedure which returns no explicit result can
be terminated with a RETURN which specifies no value to be returned.18 A
17 What we are calling arguments, are sometimes called actual parameters, to distinguish
from formal parameters
18 Many educators advise using a RETURN only at the end of a procedure.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 97
Text: Block:
P ROCEDU REsumList(someList) PROCEDURE sumList someList
{
sum ← 0
FOR EACH num IN someList sum ← 0
{
sum ← sum + num
}
FOR EACH num IN someList
RETURN sum
}
sum ← sum + num
RETURN sum
Figure 4.24: Definition of a procedure to return the sum of the numbers in a
given List
procedure which does not return an explicit result may be useful for any side
effects which it produces. Side effects include assignment of values to variables
accessible to other procedures, producing output (see below), or any operation
which changes the state of the computation.
As an example of a procedure which returns a value, we return to the al-
gorithm which finds the sum of the numbers in a list (Figure 4.24). Here we
show a procedure named sumList, which finds the sum of the numbers in any
list; the list will be a parameter of the procedure. The procedure uses the same
logic as our original algorithm, but it returns the resulting sum.
[Link] Output: DISPLAY
Algorithms are capable of producing output. We will not define exactly what
this means, except to say that the value of an expression can be displayed in
some form to a person who is using the algorithm. Think of it as a message to
the user. The DISPLAY19 statement can display the value of a given expression;
the format of the DISPLAY statement is shown in Figure 4.25.
We can redefine our procedure to sum the numbers in a List, so that it
will display the sum, instead of returning the sum. This algorithm is shown in
19 The Computer Science Principles AP course description implies that the DISPLAY state-
ment occurs only in procedures; however, it can conceivably be used anywhere in an algorithm.
98 CHAPTER 4. ALGORITHMS
Text: Block:
DISPLAY (expr) DISPLAY expr
Figure 4.25: Format for a DISPLAY statement
Text: Block:
P ROCEDU REsumList(someList) PROCEDURE sumList someList
{
sum ← 0
FOR EACH num IN someList sum ← 0
{
sum ← sum + num
}
FOR EACH num IN someList
DISPLAY sum
}
sum ← sum + num
DISPLAY sum
Figure 4.26: Definition of a procedure to display the sum of the numbers in a
given List
Figure 4.26.
The student may be wondering which of these algorithms is preferable, Fig-
ure 4.24 or Figure 4.26. In situations where it is not clear whether the algorithm
is to have side effects, either may be used. In cases where the result of a pro-
cedure is to be used by other procedures, it is best to use a return. On the AP
exam, if you are asked to show a procedure, read the question carefully; it will
probably tell you whether the result is to be returned or displayed.
[Link] Input: INPUT
A procedure has the capability of obtaining data values from the user of the
procedure as it executes, a process known as providing input. In our Text and
Block languages this is done with an INPUT statement, as shown in Figure 4.27.
Think of the INPUT statement as a call to a Procedure which returns a
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 99
Text: Block:
variable ← IN P U T ()
variable ← IN P U T
Figure 4.27: Format for an INPUT statement; the variable is assigned the value
of the input provided by the user.
value; the value provided by the user.20 An INPUT is typically preceded by an
OUTPUT, to prompt the user to provide data, perhaps in a specific format.
[Link] The power of abstraction in procedures
We now present an example which we hope will expose the power of procedures.
We define a procedure with three parameters, a List of (at least two) numbers
and two indices (i.e. positions) in the List. The procedure’s purpose will be
to reorder the two given positions in the List, if necessary, so that the smaller
number precedes the other number. For example, if the given List is [5,7,4,3,9],
and we wish to order positions 1 and 3, the List would be changed to [5,3,4,7,9].
The procedure has no return value.21 The name of the procedure is order2, and
it uses a single conditional statement to determine whether the values at the
given positions in the given List need to be exchanged; it is shown in Figure 4.28.
The order2 procedure needs to exchange or swap the two values in the
List. This can be done in a few ways. In Figure 4.28 the text version uses a
variable, temp, to store one of the values. The Block version in that figure uses
two variables, val1 and val2, to store the values at positon p0 and position p1,
respectively. Either of these strategies is acceptable.22
[Link] Combining Procedures
In an algorithm a procedure can be invoked from another procedure by provid-
ing the procedure name and the the arguments ,if any, in parentheses, as shown
below:
procedureName(arg1,arg2,arg3...)
Each argument is an expression which is evaluated, and the value is copied to
the corresponding parameter in the procedure definition. For example, to call
the procedure order2 on the List fourNums, to order positions 1 and 3:
order2(fourNums,1,3)
The procedure order2 has no explicit return value. However, for procedures
which do have a return value, the call may be part of an expression, using the
procedure’s returned value, just as it would a variable’s value. For example, if
20 We are not concerned here with how the user provides input, e.g. keyboard, microphone,
storage device, etc.
21 The reordering of the List is a side effect.
22 It should be noted that this algorithm presumes that position p1 is smaller than position
p2, i.e. position p1 precedes position p2 in the List.
100 CHAPTER 4. ALGORITHMS
Text: Block:
PROCEDURE order2(someList, p1, p2) PROCEDURE order2 someList
p1
{
p2
IF (someList[p1] > someList[p2])
{
temp ← someList[p1]
someList[p1] ← someList[p2]
someList[p2] ← temp val1 ← someList p1
}
}
val2 ← someList p2
IF val1 > val2
someList p1 ← val2
someList p2 ← val1
Figure 4.28: Definition of a procedure to order two of the the numbers in a
List of (at least two) numbers, so that the smaller number precedes the other
number
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 101
Text: Block:
PROCEDURE order3(someList, p1, p2, p3) PROCEDURE order3 someList
p1
{
p2
order2(someList, p1, p2) p3
order2(someList, p1, p3)
order2(someList, p2, p3)
} order2(someList,p1,p2)
order2(someList,p1,p3)
order2(someList,p2,p3)
Figure 4.29: Definition of a procedure to order three of the numbers in a List
of (at least three) numbers, so that they are ordered from smallest to largest.
the procedure square returns the value of its parameter multiplied by itself:
area ← pi * square(radius)
We now wish to develop a procedure to order three given positions in a given
List. Rather than developing it from scratch, we will use the order2 procedure.
We call this new procedure order3(list,p1,p2,p3); all that is needed are
three steps, invoking the order2 algorithm on each step:
1. order2(list,p1,p2)
2. order2(list,p1,p3)
3. order2(list,p2,p3)
The order3 procedure is shown in Figure 4.29.
To see that this algorithm is correct, we provide a trace of its execution for
the List [17,7,3] in Figure 4.30.
After the third invocation of the order2 algorithm, the three values are
ordered from smallest to largest.
In general there can be several different algorithms which solve the same
problem. Our order3 algorithm could have been defined as follows:
order3(list,p1,p2,p3):
1. order2(list,p2,p3)
2. order2(list,p1,p3)
102 CHAPTER 4. ALGORITHMS
Instruction p1 p2 list
[17,7,3]
order2(list,p1,p2) 0 1 [7,17,3]
order2(list,p1,p3) 0 2 [3,17,7]
order2(list,p2,p3) 1 2 [3,7,17]
Figure 4.30: Ordering the List [17,7,3] by calling order3(list,0,1,2); this diagram
shows a trace of the algorithm.
3. order2(list,p1,p2)
Sometimes developing a new algorithm to solve a problem can yield insight
into the problem itself. In the case of order3, it appears that three invocations
to the order2 algorithm are needed to solve the problem.
We stated above that the three fundamental building blocks, or control struc-
tures, for algorithms are sequence, selection, and iteration. We now include the
combination of algorithms, or procedures, as the fourth building block.
[Link] Search
We often wish to search a List for a particular value; we’ll call it the target.
There are several algorithms which solve this problem; we’ll examine two of
them:
• One solution to this problem is to start at the beginning of the List and
compare each value with the target, terminating when the target is found,
or the end of the List is reached. This is called a sequential search algo-
rithm. A sequential search procedure is shown in Figure 4.31; it returns
the position of the target, or -1 if not found.
The sequential search algorithm works fine for small lists, but for longer
lists we would like to have an algorithm that doesn’t take so much time.
If we are to be searching, repeatedly, for many targets, it might be helpful
to sort the list first, i.e. arrange the values in increasing (or decreasing)
order. Once the list has been sorted, we can use a much faster search
algorithm.
• The binary search algorithm applies only to lists which are sorted. In this
case we can devise an algorithm which is much faster than the sequential
search algorithm. In a binary search we begin by comparing the target
with the value at the midpoint of the list.23 There are four possible cases:
– The value at the midpoint is equal to the target. The result is the
midpoint.
– The value at the midpoint is smaller than the target. Search the
right half of the list for the target.
23 In this algorithm we are assuming that the list has been sorted in increasing order.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 103
Text: Block:
PROCEDURE sequentialSearch(list, target) PROCEDURE sequentialSearch list
target
{
ndx ← 0
FOR EACH num IN list
{ ndx ← 0
IF (num = target)
RETURN ndx
ndx ← ndx + 1 FOR EACH num IN list
}
RETURN −1
}
IF num=target
RETURN ndx
ndx ← ndx + 1
RETURN -1
Figure 4.31: Definition of a procedure to search a List for a given target value.
It returns the position of the target, or -1 if not found.
104 CHAPTER 4. ALGORITHMS
– The value at the midpoint is greater than the target. Search the left
half of the list for the target.
– The portion of the list we are searching is empty. The target is not
found; the result is -1.
The important aspect of this algorithm is the fact that after each com-
parison, we eliminate half the values from consideration. The algorithm
is shown in Figure 4.32.
Note that the termination condition for the REPEAT UNTIL loop in this
algorithm is start > end. As the loop repeats, start and end get closer
and closer to each other; on each iteration either start is increased, or end
is decreased. If start becomes greater than end, the target is not found in
the list, and the algorithm returns -1.
You may have used this algorithm often without realizing it. Examples:
– When searching for a word in a (paper) dictionary, encyclopedia, or
telephone book,24 a sequential search, looking at every word until
you find the one for which you are searching, will take too much
time. Instead you start in the middle (or somewhere close to where
you think the word would be) and move forward or backward several
pages.
– When searching for your flight on an electronic display of arrivals or
departures at an airport. If there are many flights shown, it is best
to find the sort field first, and do a binary search.
– When searching for an office name on the directory for a large build-
ing or hospital, a binary search is used.
– When searching for a course in your school registrar’s list of courses
offered, a binary search is used.
[Link] Simulation and random numbers
The importance of simulation was discussed in chapter 2. In order to implement
a simulation which utilizes random behavior we use a random number generator.
This would be software that produces a sequence of numbers with no apparent
relationship. More formally this sequence of numbers should be called a pseudo-
random sequence; anything produced by an algorithm cannot be truly random.
In our algorithmic languages we have a procedure named RANDOM(start,end)
which returns a pseudo random number in the range [start..end], inclusive, each
time it is called. The format of this procedure is shown in Figure 4.33.
As an example we define a procedure to roll dice, cubes with faces having
1,2,3,4,5, or 6 pips. Our procedure will have 1 parameter: the number of dice
cubes to be rolled. It will return a list of numbers, each of which is in the
24 In today’s world many of these searches are done with personal digital devices, which
probably expedite the search with hash tables; many students have no experience with binary
search, and may have forgotten the sequence of letters in the alphabet.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 105
Text: Block:
PROCEDURE binarySearch(list, target) PROCEDURE binarySearch list
target
{
start ← 0
end ← LEN GT H(list) − 1
REPEAT UNTIL start > end start ← 0
{
mid ← (start + end)/2 end ← LENGTH list
value ← list[mid]
IF (value = target) end ← end − 1
RETURN mid
IF (value < target)
start ← mid + 1 REPEAT UNTIL start > end
IF (value > target)
end ← mid − 1
} mid ← (start + end)/2
RETURN −1
} value ← list mid
IF value = target
RETURN mid
IF value < target
start ← mid + 1
IF value > target
end ← mid − 1
RETURN -1
Figure 4.32: Definition of a procedure to search a sorted List for a given target
value, using the binary search algorithm. It returns the position of the target,
or -1 if not found.
106 CHAPTER 4. ALGORITHMS
Text: Block:
x ← RANDOM (start,end)
x← RANDOM start,end
Figure 4.33: Format for a RANDOM(start,end) statement in a procedure; it re-
turns a random integer in the range [start..end], inclusive, which is then assigned
to the variable x
range [1..6], one number for each die that is rolled. The algorithm is shown in
Figure 4.34.
4.1.7 Languages for Algorithms
The two languages that we have introduced to describe algorithms (Text and
Block25 ) are somewhat formal and precise, yet we do not intend to execute either
of them on a computer. They are used purely for the description of algorithms.
This kind of language is often called pseudo code. It is precise enough to convey
the behavior of the algorithm, yet is not intended for actual automatic execution
on a computer.
Sometimes people also use natural language, such as English, to describe al-
gorithms. We should be careful, however, to understand that natural languages
are not precise and are susceptible to ambiguities and misinterpretation.
[Link] Programming languages
More precise languages for describing algorithms are known as programming
languages; at least one of these will be examined in detail in chapter 5. Stu-
dents often ask “Why is there more than one programming language? Why
not simply use the best language for all programming tasks”? We will see that
some programming languages are better suited for certain kinds of problems,
known as problem domains. For example, some languages are better for busi-
ness related problems, while other languages are better suited for scientific or
engineering problems, and other languages are better suited for working with
text. However, the control structures that we have introduced: sequence, selec-
tion, and iteration, together with the combination of algorithms, are sufficient
to solve any problem that has a solution.26 Thus the existence of several dif-
ferent programming languages is a result of the need for ease or convenience in
programming, which turns out to be fairly difficult for many problems.
25 The Block language described here was designed by the Computer Science Principles AP
Committee and is not one that is favored by this author.
26 As we will see later in this chapter, there are some problems which have no algorithmic
solution.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 107
Text: Block:
PROCEDURE roll(n)
PROCEDURE roll n
{
result ← { }
REPEAT n TIMES result←
{
die ← RANDOM(1,6)
APPEND(result, die)
REPEAT n TIMES
}
RETURN result
}
die ← RAN DOM (1, 6)
APPEND result,die
RETURN result
Figure 4.34: Procedure to roll a given number of dice. It returns a list of the
values shown on the dice, each of which is in the range [1..6].
108 CHAPTER 4. ALGORITHMS
⊲
Figure 4.35: Diagram of a robot’s environment, showing a start location (lower
left) and a target destination (upper right)
[Link] Clarity and readability of a language
In addition to ease and convenience, we also note that clarity and readability of
an algorithm can be affected by the choice of a language. Clarity and readability
are important when collaborating with other people in the development process.
Clarity and readability are also important for the developer who is struggling
to understand his/her own programs.
4.1.8 Robot algorithmic language
As an example of an algorithmic language the AP course includes a fairly simple
robot language which is used to guide an imaginary robot through a grid-like
environment. The robot’s environment is similar to a checker board, as shown
in Figure 4.35, though not limited to an 8x8 grid.
The robot is capable of moving in a horizontal or vertical direction, one
square at a time. The robot is also capable of sensing when it has reached the
edge of the grid. At any point in time the robot is facing either north, south,
east, or west, which is known as the robot’s direction. The movement of the
robot, and changes to its direction, are controlled by an algorithm using the
following commands:
• MOVE FORWARD()
The robot will move one square in the direction that it is currently facing
• ROTATE LEFT ()
The robot will change its direction to the left of its current direction:
(north-west-south-east-north)
• ROTATE RIGHT ()
The robot will change its direction to the right of its current direction:
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 109
Text: Block:
PROCEDURE step() PROCEDURE step
{
REPEAT UNTIL
REPEAT UNTIL NOT CAN MOVE(forward)
NOT CAN MOVE(forward)
{
MOVE FORWARD
MOVE FORWARD()
ROTATE LEFT() ROTATE LEFT
MOVE FORWARD() MOVE FORWARD
ROTATE RIGHT() ROTATE RIGHT
}
}
Figure 4.36: Definition of a procedure to move the robot in a step-like pattern
from the lower left corner to the upper right corner
(north-east-south-west-north)
• CAN MOVE (direction)
This is a boolean operation which returns true if the robot is capable of
moving in the given direction (i.e. it will not go off the edge of the grid).
The direction can be left, right, forward, or backward.
An example of a procedure that controls the robot is shown in Figure 4.36.
This procedure causes the robot to move in a ‘step-like’ manner from the lower
left corner of the grid to the upper right corner of the grid, as shown in Fig-
ure 4.37.
4.1.9 Exercises
1. Define procedures to solve each of the following problems:
(a) A procedure, named isOrdered with two parameters. It should de-
termine whether the parameters are ordered, i.e. whether the first
parameter is less than or equal to the second parameter, and return
a true/false value.
(b) A procedure, named order3, with four parameters. It should have
the same effect as the order3 procedure defined in this section, but
should be done without invoking the order2 procedure.
110 CHAPTER 4. ALGORITHMS
⊲
Figure 4.37: Robot moving in a step-like pattern on an 8x8 grid
(c) The Fibonacci sequence is a sequence of positive integers, beginning
with 1,1, in which each number is the sum of the previous two num-
bers in the sequence:27
1,1,2,3,5,8,13,21,34,55,...
Define a procedure named fib with one parameter, n. It should re-
turn the value of the nth number in the Fibonacci sequence (let the
first position be 0).
fib(0) = 1
fib(1) = 1
fib(2) = 2
fib(3) = 3
fib(5) = 8
(d) The modulus operation produces the remainder upon integer division
(see Figure 4.38). Define procedures (using two different algorithms)
named mod with two parameters, x and y. The procedure should find
the remainder when x is divided by y. Assume that x and y are both
positive integers.
• Use an iteration, inolving repeated subtraction
• Use no iterations. Assume that the / operator produces the
integer quotient.
(e) A procedure named isDivisibleBy with two parameters x and y.
It should determine whether the value of x is divisible by the value
of y. Assume that both parameters are positive integers.
Hint: Use the mod algorithm.
27 The Fibonacci sequence appears in many natural biological formations, and has been
studied extensively by mathematicians and scientists.
4.1. ALGORITHM DESIGN AND IMPLEMENTATION 111
Quotient of Remainder of
x y x÷y x÷y
6 3 2 0
17 5 3 2
9 13 0 9
6234327 10 623432 7
Figure 4.38: Table showing the integer quotient and remainder (modulus) when
x is divided by y.
Figure 4.39: Robot moving in a spiral-like pattern on an 8x8 grid
(f) A procedure named even, with one parameter, x. The procedure
should determine whether the value of x is an even number.
Hint: Use the isDivisibleBy algorithm.
2. In the previous problem you defined the order3 procedure without invok-
ing the order2 procedure. Which definition of order3 do you think is
more clear and readable?
3. What are some of the programming languages that you may have heard
of?
4. Define a procedure named spiral for a robot on the grid of a given size.
This algorithm should cause the robot to move in a path that resembles
a spiral, beginning at the center of the grid, as shown in Figure 4.39.
5. Show the path of the robot on a 12x12 grid, beginning at the lower left
corner, which is generated by the following procedure:
112 CHAPTER 4. ALGORITHMS
Procedure exercise()
{
n←1
REPEAT 4 TIMES
{
REPEAT n TIMES
MOVE FORWARD();
ROTATE LEFT();
REPEAT n TIMES
MOVE FORWARD();
ROTATE RIGHT();
n←n+1
}
}
4.2 Limitations of algorithms
In the previous section we have introduced the notion of algorithm and provided
several examples of algorithms. In this section we raise some crucial questions
regarding algorithms:
• Can all precisely stated problems be solved with an algorithm?
• If not, what are some examples of problems which have no algorithmic
solution?
• For any given solvable problem, does it have equally usable algorithmic
solutions?
4.2.1 Algorithm performance
We have seen that for any given problem, there can be more than one algorithm
to solve that problem. It would be helpful to determine which algorithm is better
from a standpoint of performance.28 Here we attempt a somewhat formal effort
to describe the quality of an algorithm’s performance. We attempt to answer
the questions, in a mathematical way:
• How fast is this algorithm?
– This should be a measure of the running time, independent of the
computing platform on which it may execute (i.e. the computer hard-
ware and software used to execute the algorithm’s implementation).
– The running time will typically be a function of the size of the input
to the algorithm.
28 It might also be helpful to measure an algorithm’s quality by assessing its readability and
clarity, but that is beyond our scope.
4.2. LIMITATIONS OF ALGORITHMS 113
Algorithm Run time Run time
name formula description
order(x,y) 1 Constant
order3(x,y,z) 1 Constant
isOrdered(x,y)* 1 Constant
fib(n)* n Linear
mod(x,y)* x/y Linear
isDivisibleBy(x,y)* x/y Linear
even(x)* x/2 Linear
Figure 4.40: Table showing a running time formula for several algorithms defined
in the previous section. * This algorithm was introduced as an exercise.
– We would like to measure the running time as the size of the input
becomes very large.29
• How much memory does this algorithm require?
– Does this algorithm require a lot of temporary memory, in addition
to the memory used for the input?
– We give less attention to this question. With today’s technology,
most algorithm implementations will be limited by the time required
to execute, rather than the space required for execution; most algo-
rithms tend to ‘run out of time’ before they ‘run out of space’.
[Link] Reasonable time
As we examine the time performance of algorithms, we will see that some al-
gorithms are generally faster than others. We will pay particular attention to
those algorithms which require so much time to complete execution, that they
are essentially unusable for large input values; thus we distinguish between rea-
sonable run time and unreasonable run time, for an algorithm’s performance
measure. All of the examples of algorithms that we have seen thus far have a
reasonable run time. More mathematically, we can describe the run time as a
function of the size of the input. In doing so, we we will provide a formula for
the run time such that it will be proportional to 30 the actual run time for a
particular implementation of that algorithm.
Figure 4.40 shows the run time formula for several algorithms defined in the
previous section. All of these algorithms execute in reasonable time. The first
three algorithms shown in that table do not involve any loops. Thus the run
time does not depend on the size of the input. A formula which is proportional
to a fixed run time is simply 1. We call this constant run time.
29 Thephrase ’becomes very large’ is intentionally undefined.
30 Aformula, f, is proportional to a measurement, m, if there is some constant, c, such that
f = c × m.
114 CHAPTER 4. ALGORITHMS
The algorithm fib(n) however, does involve a loop which repeats n-2 times.
Thus the formula n will be proportional to the actual run time, which increases
as the the value of n increases. In this case we say that the run time is linear
because the formula is a linear function of the input.
The algorithm mod(x,y) also involves a loop.31 The number of times the
loop repeats will be the quotient of x / y. For example, if x = 102, and y = 7,
the loop will repeat 14 times, because 102 / 7 produces a quotient of 14. This
algorithm also has a linear run time.32
The next algorithm in Figure 4.40 is isDivisibleBy(x,y). It has no explicit
loops; however, it invokes the mod(x,y) algorithm which does have a loop. We
call this a hidden loop. Therefore, the run time of isDivisibleBy(x,y) will be
the same as the run time for mod(x,y).33
The run time for the even(x) algorithm follows a similar argument. There
is a hidden loop in even(x) because it invokes isDivisibleBy(x,y), which has
a run time of x / y. In this case the value of y is always 2, thus even(x) has a
run time of x /2.34
All of the algorithms that we have seen so far have a run time which is either
constant or linear. We now examine a somewhat slower algorithm (greater run
time). The problem we wish to solve is:
Find the sum of the first n numbers in the Fibonacci sequence.
To solve this problem we will find the values of the first n numbers in the se-
quence, and add them up. We do this with a variable known as an accumulator,
which stores the sum of all the numbers seen so far in the loop. The algorithm
is called sumFib(n) and is shown in Figure 4.41.35
In this algorithm we assume that decrementing the loop variable, n, does
not affect the number of times that the loop repeats.36
In this algorithm sumFib(n) we are invoking the fib(n) procedure. We use
the result of fib(n-1) in a calculation. The result of fib(n-1) is added to the
value of sum, and then stored back into the variable sum.
The algorithm sumFib(n) is our first example of an algorithm where there
is a loop within a loop. We call this a nested loop. The outer loop is expicit in
sumFib(n). When it invokes the fib(n) algorithm, this also contains a loop;
this is the inner loop. Each time the outer loop in sumFib(n) repeats the inner
loop in fib(n) executes several repetitions.37 The run time performance of
31 Here we are referring to the algorithm which uses repeated subtraction.
32 It is true that for some inputs, such as x = 1000 and y = 1000, the run time will be very
small, but here we are talking about average case performance, a concept which is beyond
our scope.
33 It is true that there are some extra steps in isDivisibleBy(x,y) which are not included in
mod(x,y), but the time required for these steps will be negligible, as the size of x / y becomes
very large.
34 It would also be correct to describe the runtime as simply x: If x/2 is proportional to the
run time, then x is also proportional to the run time.
35 This is not the most efficient solution to this problem.
36 Many educators would discourage the practice of modifying loop control information in
the body of the loop, since this could have different effects in various programming languages.
37 The number of times the inner loop executes will decrease by 1 each time fib(n) is
invoked, but including this in our analysis is beyond our present scope.
4.2. LIMITATIONS OF ALGORITHMS 115
Text: Block:
PROCEDURE sumF ib(n) PROCEDURE sumFib n
{
sum ← 0
REPEAT n TIMES sum ← 0
{
sum ← sum + f ib(n − 1)
n←n−1 REPEAT n TIMES
}
RETURN sum
}
sum ← sum + f ib(n − 1)
n←n−1
RETURN sum
Figure 4.41: Definition of a procedure to return the sum of the first n numbers
in the Fibonacci sequence
116 CHAPTER 4. ALGORITHMS
Text: Block:
PROCEDURE f ibSlow(n) PROCEDURE fibSlow n
{
IF (n < 2)
RETURN 1 IF n<2
RETURN f ibSlow(n − 1)+
f ibSlow(n − 2) RETURN 1
} sum ← f ibSlow(n − 1) + f ibSlow(n − 2)
RETURN sum
Figure 4.42: Definition of a procedure to return the nth number in the Fibonacci
sequence, using a recursive call
sumFib(n) will be proportional to n2 . We call this quadratic performance. The
algorithm sumFib(n) will be somewhat slower than the algorithms we have seen
so far, and the difference in performance will be more evident when the value of
the parameter, n, is larger. However, we still classify the run time of sumFib(n)
as reasonable time.
[Link] Unreasonable time
There are some algorithms which take so long to execute that we say the run
time is unreasonable. In such cases for a fairly large input value, we can wait
while the computer executes the algorithm, and never see a solution even though
we know the algorithm must eventually terminate with a solution.
As an example of an algorithm which has an unreasonable run time, we
return to the problem in which we wish to find the value of the nth number in
the Fibonacci sequence. In this case we use a different algorithm, one which is
much slower. We call it fibSlow(n); it is shown in Figure 4.42.
Note that the fibSlow(n) algorithm invokes the fibSlow(n) algorithm in
the case where n is not less than 2. It invokes itself! We call this a recursive
algorithm, and the usage of recursive algorithms is called recursion. In this case
each call to fibSlow(n) results in two more calls to fibSlow(n). Figure 4.43
depicts a diagram showing these recursive calls for an initial input value of 4.
To analyze the run time performance of fibSlow(n) we note that if we were
to call fibSlow(5) there would be almost twice as many calls to fibSlow(n)
in our diagram. Increasing the input by only 1 will cause the run time to
4.2. LIMITATIONS OF ALGORITHMS 117
fibSlow(4)=5
fibSlow(3)=3 fibSlow(2)=2
fibSlow(2)=2 fibSlow(1)=1 fibSlow(1)=1 fibSlow(0)=1
fibSlow(1)=1 fibSlow(0)=1
Figure 4.43: A diagram showing recursive calls to the fibSlow(n) algorithm
double! Thus the formula for the run time of fibSlow(n) is 2n . 38 We call this
exponential run time. Note there is a very significant difference between 2n and
n2 (quadratic run time). As n becomes large, 2n increases much more sharply
than does n2 . Moreover, as n becomes large, 2n increases much more sharply
than does np , for any value of p.
An implementation of an algorithm with exponential run time on any com-
puter will take so long to run that we will not see a result in our lifetime (for a
fairly large input value). Such algorithms are essentially useless. In chapter 5
we will implement this algorithm and experiment with its run time.
Fortunately, if we wish to find the value of the nth number in the Fibonacci
sequence, we can use our original fib(n) algorithm, which has linear perfor-
mance. However, there are some problems for which we are not so fortunate:
• There are problems for which we are unable to find an algorithm with
reasonable run time, though in theory there might be such an algorithm.
• There are problems for which we are sure that there are no algorithms
with reasonable run time.
In either case we often resort to a strategy in which we use a heuristic. A
heuristic is similar to an algorithm, in that it consists of a finite number of
well-defined steps. However, a heuristic is not guaranteed to terminate, nor is it
guaranteed to produce a correct solution to the problem if it does terminate. It
will often produce an approximation to a correct solution in a reasonable time.
Despite these limitations of heuristics, we use them as a last resort, when we
are unable to find an algorithm that runs in reasonable time. The bottom line:
an approximation to a correct solution is better than no solution at all.
Problems which have no reasonable algorithmic solution are often optimiza-
tion problems, i.e. find the best way of doing something, or find the easiest way
to get somewhere.
An example of such a problem is known as the traveling salesman problem:
Given a map with several cities, and the distances between the cities, what path
38 We do not mean to imply that recursion causes unreasonable run time; many recursive
algorithms are quite efficient.
118 CHAPTER 4. ALGORITHMS
should a salesman take to visit all cities, such that the total distance covered is
minimized? Several algorithms to solve this problem have been proposed, but
none of them have a reasonable run time; thus a heuristic is usually used if the
number of cities is not very small. People have searched for an algorithm with
reasonable run time for this problem, to no avail. Yet no one has been able to
prove that no such algorithm exists.
There are many problems which can be shown to be equivalent to the trav-
eling salesman problem in this respect. They are called NP-complete (or some-
times NP-hard ) problems.39 Two important results are:
• If we could find a reasonable algorithm for any one of these problems, we
would have reasonable algorithms for all of them!
• If we could prove there is no reasonable algorithm for any one of these
problems, we would have a proof that there is no reasonable algorithm for
any of them!
When we say that a problem is NP-hard we don’t mean that it is difficult to
find an algorithm which solves the problem; we mean that it is hard to find an
algorithm that has a reasonable run time.
4.2.2 Solvable problems
In this section we are interested in determining whether there are problems
for which no algorithmic solution exists. We are less concerned with run time
performance here. For those problems which have no algorithmic solution we
have no choice but to use a heuristic, which will not find a perfect solution to
the problem.
There are many problems in today’s world which may not have an algorith-
mic solution:
• How can we persuade people of different cultures, religions, and national-
ities to live together peacefully?
• Is Bach’s Toccata and Fugue the most enjoyable music ever written?
• Is N’Sync better than FiftyCent?
• Is there a God?
These are all significant problems, and we may be very interested in finding
algorithmic solutions to them. However, these problems are not stated precisely
enough for our purposes; they are not mathematically formulated. In our usage
of the word ‘problem’, they really are not problems. In order for a problem to
have an algorithmic solution, it must be stated precisely in somewhat mathe-
matical terms.
39 The origin and meaning of these terms is beyond the scope of this course. Instructors are
referred to Donald Knuth’s January 1974 letter to ACM SIGACT News.
4.2. LIMITATIONS OF ALGORITHMS 119
4.2.3 Undecidable problems
A decision problem is a problem for which the result is a simple yes or no (true or
false). In the exercises of the previous section, the algorithms isOrdered(x,y)
and even(x) are solutions to decision problems.
A decision problem which has no algorithmic solution (not even an unrea-
sonably slow one) is called undecidable. Here is an example of an undecidable
problem:
Given a computer program,40 determine whether that program, when
executed on a computer will ever terminate.
Recall in the section on algorithm design and implementation, that the fun-
damental building blocks, or control structures of an algorithm are sequence,
selection, and iteration, along with combining algorithms. An iteration can be
specified using a complex logical expression, making it impossible to determine
whether the iteration will ever terminate.
4.2.4 Evaluation of algorithms
Here we try to answer the question: How good is a given algorithm? There are
several different aspects of algorithms which can be examined to answer this
question:
[Link] Run time
Does this algorithm run faster, for a given input, than other algorithms which
solve the same problem?
The time required for an algorithm to run to completion generally depends
on the size of the input to the algorithm. We have seen that:
• An algorithm with constant run time will execute faster than an algorithm
with linear runtime, for large inputs.
• An algorithm with linear run time will execute faster than an algorithm
with quadratic runtime, for large inputs.
• An algorithm with polynomial run time will execute faster than an algo-
rithm with exponential runtime, for large inputs.
[Link] Memory required
Does this algorithm require less temporary memory, for a given input, than
other algorithms which solve the same problem?
We can use the same kind of measure on memory that we used above for
time:
40 A computer program is just plain text, written with a particular syntax, that can be
translated to executable code on a computer.
120 CHAPTER 4. ALGORITHMS
constant < linear < quadratic < non-quadratic polynomial < exponential
where we are now measuring the space required, rather than the run time. With
today’s technology, an algorithm will usually run out of time before it runs out
of space; consequently, most algorithms are assessed for time efficiency, and are
assessed for space efficiency only when memory requirement is a limiting factor
or when algorithms with the same time efficiency need to be compared.
[Link] Efficiency by input
Is this algorithm more efficient in time and/or space for some inputs than it is
for other inputs?
This question is somewhat subjective. There are many problems where
knowledge of the data involved can lead to more efficient algorithms. For exam-
ple, if you are searching a list of names for a particular name (a ‘target’), you
could start at the beginning of the list and examine every name until you found
the target, or reached the end of the list. If however, you knew that the names
were in alphabetic order, the algorithm could terminate when reaching a name
that comes after the target name alphabetically.41
[Link] Size of the algorithm
How many steps are there in this algorithm? Shorter algorithms are generally
preferable to longer algorithms; short algorithms are generally easier to read,
understand, and implement. We saw evidence of this in the exercises for the
first section of this chapter (the order3(list,p1,p2,p3) algorithm which does
not make use of the order2(list,p1,p2) algorithm; it is much longer, making
it more difficult to read and understand). In general we will seek short, simple
algorithms to solve complex problems, and we will not seek long complex algo-
rithms to solve simple problems. Simple problems are often best solved without
the aid of an algorithm.
[Link] Clarity and readability
How clear and readable is this algorithm? Algorithms are most useful when
they can be shared and used by many people in a variety of contexts. If an
algorithm is neither clear nor readable, it is difficult for others to use and/or
customize it for a particular problem or data set.
The clarity and readability of algorithms relates directly to the benefits
of collaboration when implementing the algorithms and when developing new
algorithms.
Exact measurements of clarity and readability are not generally used; this
is a more subjective measure of an algorithm’s quality.
41 This is known as a sequential search algorithm; a binary search algorithm (of a sorted
list), which looks at the name in the middle of the list first, and eliminates half the names
from consideration, is a different algorithm.
4.2. LIMITATIONS OF ALGORITHMS 121
4.2.5 Exercises
1. What is the run time efficiency of each of the following algorithms? In
each case your response should be one of the following:
Constant, Linear, Quadratic, Exponential
Also indicate whether the algorithm runs in reasonable time.
(a) PROCEDURE gauss(n)
{
sum ← 0
ctr ← n
REPEAT n TIMES
{
sum ← sum + ctr
ctr ← ctr − 1
}
RETURN sum
}
(b) PROCEDURE gaussFast(n)
{
sum ← (n × (n + 1))/2
RETURN sum
}
(c) PROCEDURE looper(n)
{
sum ← 0
REPEAT n TIMES
{
i←n
REPEAT n TIMES
{
sum ← sum + i
i←i−1
}
}
(d) PROCEDURE slow(n)
{
ctr ← 0
i←1
REPEAT n TIMES
{
REPEAT i TIMES
{
ctr ← ctr + 1
122 CHAPTER 4. ALGORITHMS
}
i← i∗2
}
RETURN ctr
}
2. Refer to the previous exercise:
(a) What is the result of gauss(5)?
(b) What is the result of gaussFast(5)?
(c) What is the result of looper(5)?
(d) What is the result of slow(5)?
3. (a) What is the difference between a heuristic and an algorithm?
(b) Give an example of a real problem which we may wish to solve with
a heuristic rather than an algorithm.
4. Search the internet to find a decision problem which is undecidable.
5. Referring to the first exercise, the algorithms gaussFast(n) and gauss(n)
solve the same problem.
(a) Describe the problem which those two algorithms solve.
(b) In what respect(s), if any, is the algorithm gaussFast(n) better than
the algorithm gauss(n) ?
(c) In what respect(s), if any, is the algorithm gauss(n) better than the
algorithm gaussFast(n) ?
Chapter 5
Programming (with Java)
As we mentioned in chapter 4, an algorithm can be implemented with a computer
program. Each step of an algorithm will correspond to a statement in a computer
program. The program is the realization of the algorithm.
5.1 Program development
5.1.1 Why program?
Advantages of a program over an algorithm:
• With a program (and a computer) we can test an algorithm to verify that
it is producting the correct result(s).
• Since programs run on real machines, they can interact with the outside
world (drive a car, control household security systems, perform retail and
financial transactions, etc.)
• Programs are often more precise than algorithms; sometimes algorithms
are expressed with pseudo-code. A program must conform to the proper
syntax and semantics of the programming language in which it is written.
Programming results in the creation of software, and software (which can be
exectuted on a computer or other digital device) has changed our lives. All digi-
tal devices: computers, tablets, phones, automobile components, music players,
tv sets, electronic games, etc. must be programmed with the appropriate soft-
ware to provide services. Thus, programming has enabled the creation of digital
artifacts.
This chapter contains an introduction to the programming process and prin-
ciples which apply to most programming languages. Examples of these princi-
ples are provided for a particular programming language - Java. The concepts
123
124 CHAPTER 5. PROGRAMMING (WITH JAVA)
explained here generally apply to other languages, with minor differences in
syntax and approach.1
There are many possible motivations for software development. We may
wish to:
• Solve a problem
• Build a tool for others to use
• Express something creatively
• Create new knowledge
Programs are often used in conjunction with visual displays, such as the
one on your phone. Programs also produce sound, listen for sound, sense your
touch, determine your location, and interact with the world in many ways.
People sometimes develop programs to satisfy their own personal curiosity.
This can lead to advancements in their own field of study or in other fields of
study.
Programs which you develop for your own personal use may often be simple,
short, and relatively easy to develop. Programs developed for widespread use
by many people often need to take extensive precautions for safety and security,
particularly if they provide access to the internet.
5.1.2 Problem solution
When tackling the solution to a problem by implementing an algorithm, it is
rarely the case that the first attempt will be succesful. Programming, and
software development for all but the simplist of problems, is a rather tedious
and error-prone process. Some sort of iterative process is generally used:
1. A precise statement of the problem to be solved is needed. This phase of
development is called analysis. For large software development projects
the analysis is done by a systems analyst, who is knowledgable in the
problem domain, as well as in programming.
A data set, called test data 2 needs to be created or derived from real data.
2. For large projects the software needs to be divided into smaller, more
manageable pieces, called modules. This is the design phase and is usually
done by a software engineer. Each module has a clearly defined purpose,
with clear expectations of its inputs and outputs, known as an interface.
3. Programmmers, working as a team, are each assigned one or more mod-
ules. They generally work independently and combine the modules into
the final program when all modules are complete.
1 Opensource textbooks for this course based on Python and C++ are in development.
2 Thecreation of adequate test data is often more time consuming or complex than the
programming.
5.1. PROGRAM DEVELOPMENT 125
4. The final system is tested using the test data. If the result is not correct,
there are three possible courses of action:
(a) An error in programming implies that the module needs to be fixed.
(b) An error in design implies that the design needs to be corrected, and
all affected modules need to be made consistent with the new design.
(c) An error in the specifications means that the specifications must be
corrected. This implies that the design of the affected modules need
to be corrected, and the affected modules all need to be made con-
sistent with the new design.
This process is repeated until the testing indicates that the output or result is
correct.3
After testing is finished, it is often the case that there are changes to the
original specifications. Customers are often unable to predict all of the potential
uses and problems with the software. As specifications change, more modules
can be added to the system, often without changing existing modules.
[Link] Program documentation
Large programs can be complicated, unwieldy, and difficult to work with. No
matter how carefully we may modularize our software, more effort is needed to
clarify and simplify our understanding of a program. Clarification is definitely
necessary to understand programs which have been written by other people,
but also for programs written by ourselves. Program documentation is one
way of providing this clarification. Documentation consists of natural language
(e.g. English) narrative description(s) of modules and individual statements in
a module, to explain their purpose as well as any nuances which are essential
to understand and make changes to the program. There are two fundamental
kinds of documentation:
• Internal documentation consists of narrative descriptions in the code itself.
These program lines are often called comments, and they serve to elucidate
various aspects of the program. Internal documentation has no effect on
the actual workings of the program; the computer ignores all comments.
However, internal documentation greatly facilitates program maintentance
and enhancement.
In the Java programming language internal documentation may take two
forms:
– Single line comments:
Any text following // up to the end of the line is considered a com-
ment, and has no effect on program execution.
3 For large projects, an additional testing step is used: acceptance testing involves testing
the program at the customer’s site with real test data.
126 CHAPTER 5. PROGRAMMING (WITH JAVA)
– Multi line comments:
All text between /* and the next occurrence of */ is considered a
comment, and has no effect on program execution.
• External documentation consists of narrative descriptions stored sepa-
rately from the program. This documentation typically describes module-
level or system-level components, and does not generally describe individ-
ual statements in a program.
Substantial documentation is essential when working collaboratively, as pro-
grammers will need to understand the intent of other programmers when writing
software to interact with other programmers’ software.
5.1.3 Collaboration
When developing large software systems, large teams of programmers are often
used to reduce development time. However, even for smaller projects teamwork
can be beneficial. When working with teams, the complexity and extent of a
problem can be reduced for each team member.
[Link] Separation of responsibilities
As described above, when the design of a system specifies modules, each member
of a team can be assigned responsibility for one (or a few) module(s). With a
well designed system, this greatly simplifies the task of each team member.
Each team member can work independently and test their work, up to a point.
Eventually, modules will have to be merged into a complete system for testing.
[Link] Working together
Often team members will work together on a particular module. For cases where
the implementation of a single module is very difficult, it can be helpful to have
two people working on it together. This is often called pair programming. In
this mode, one member is in the ’driver’ seat, i.e. typing code on the keyboard,
and the other team member is watching and carefully understanding everything
that the first member is typing. They are in constant verbal communication,
ensuring that everything is sensible and correct. It might seem that this is an
expensive way to develop software, since both team members are paid to develop
one module. However, it is often the case that this investment reduces the time
spent on debugging and maintenance by more than a factor of 2.
5.1.4 Exercises
1. What is the difference between a program and an algorithm?
2. What are the names of the four steps in the software development process?
5.2. ALGORITHM IMPLEMENTATION 127
Name Meaning Examples
int whole number 17 0 -500
float number 17.0 -3.1415 6.02e23
char A single character ’w’ ’7’ ’$’
boolean A true/false value true false
Figure 5.1: Table showing some of the primitive data types in a programming
language
3. Describe the difference between internal and external documentation for
a software system.
4. How can collaboration reduce the complexity of the software development
process?
5.2 Algorithm implementation
Once we have developed an algorithm to solve a particular problem, we generally
will wish to implement that algorithm by writing a program. The statements
in the program will correspond directly to steps of the algorithm. Most pro-
gramming languages have control structures that correspond directly with the
control structures inroduced in chapter 4: sequence, selection, and iteration.
5.2.1 Sequence
As with algorithms, the statements in a program are execured sequentially, in
the order in which they appear in the program. An example of a step in an
algorithm could be
1. x ← 17
which means that the value 17 should be stored in the variable x. The corre-
sponding statement in the Java language would be:
x = 17;
We read this as “x gets 17” or “x is assigned 17”. It should NOT be read as “x
equals 17”. Though it is true that x equals 17 after this statement has executed,
consider the statement:
x = x + 1;
which means add one to the value of x, and store the result back into x. Those
who read this statement as “x equals x+1” will usually end up in confusion.
In Java, there are several types of data. Some examples of data types are
shown in Figure 5.1. Java requires the programmer to declare the type of a
variable before using it. So a sequence of Java statements could be:
int x;
x = 73;
x = x * 2;
128 CHAPTER 5. PROGRAMMING (WITH JAVA)
Operation Meaning Example result
+ addition 3 + 25 28
- subtraction 3 - 25 -23
∗ multiplication 3 * 25 75
/ division of floats 25 / 7.0 3.5714286
/ division of integers 25 / 7 3
% modulus 25 % 7 4
Figure 5.2: Table showing arithmetic operations in a programming language
The first statement is a declaration. It means that the variable x is to store
whole numbers only. A variable should be declared just once in any program
block; after it is declared it may be used and changed many times. After
execution of these statements, the value of the variable x would be 146.
The arithmetic operations in Java are shown in Fig 5.2. Note that:
• In addition to the four operations introduced in chapter 4, we have an
operation to find the remainder following the division of integers. The
/ operator finds the quotient and the % operator finds the remainder,
otherwise known as modulus. 4
• In an ambiguous expression such as 30/3 + 2 we note that multiplication
and division take precedence over addition and subtraction. (The result is
12, not 6)
• In an ambiguous expression such as 30 − 3 + 2 we note that when two
operations have equal precedence, the leftmost operation is performed
first. (The result is 29, not 25)
5.2.2 Selection
The selection control structure in Java is very similar to its algorithmic coun-
terpart. It consists of the following:
• The keyword if. A keyword is a word in a programming language used
for one specific purpose.
• A true/false condition inside parentheses. This is known as a boolean
expression;5 it is something that is either true or false. An example of a
boolean expression is:
(x + y < z + 2)
The comparison operators which may be used in a boolean expression are
shown in Figure 5.3.
4 We discourage the use of modulus with negative operand(s). The result is not consistent
across programming languages and computing platforms.
5 Boolean expression is named after the English logician George Boole.
5.2. ALGORITHM IMPLEMENTATION 129
Comparison operator Math symbol Meaning
== = equals
< < is less than
<= ≤ is less than or equal to
> > is greater than
>= ≥ is greater than or equal to
!= 6= is not equal to
Figure 5.3: Table showing the comparison operators for a programming language
• A Java statement. This is the statement which is executed only if the
boolean expression is true.
• The keyword else.
• A Java statement. This is the statement which is executed only if the
boolean expression is false.
As with algorithms, the else part of an if statement is optional.
Some examples of Java statements are:
if (x > 0) y = 3; else z = 0;
if (x+3 == (y+3)*2 - 1)
x = z - 31;
In the first example the variable y is assigned the value 3, only if the value of x
is greater than 0. There is an else part for the if statement; the variable z is
assigned the value 0 only if the value of x is not greater than 0.
In the second example, the variable x is assigned the value of z-31, only if
x + 3 is equal to (y+3)*2 - 1
Note that, unlike algorithms, a Java program is free format. The line breaks
generally have no effect on the program’s intent. There may be several state-
ments on one line, or a single statement may be split across several lines. It
is the programmer’s responsibility to format the program for maximum clarity
and readability. We will generally indent nested control structures to enhance
readability.
[Link] Statement blocks
Another example of an if statement is shown below:
if (x == 0)
{ y = y + 3;
x = 1;
} // if statement ends here
130 CHAPTER 5. PROGRAMMING (WITH JAVA)
In this example the consequence of the if is a block of statements, enclosed in
curly braces. If the value of x is 0, both statements in the block are executed; if
the value of x is not 0, neither of the statements in the block is executed.6 We
also included a single line comment clarifying the end of the if statement.
Note that any statement in an if statement may itself be an if statement;
thus, if statements may be nested, as they were with algorithms.
5.2.3 Iteration
An iteration in Java may be implemented with the key word while. It corre-
sponds to the repeat instruction of an algorithm. An iteration in Java, often
called a loop, consists of:
• The key word while
• A true/false condition inside parentheses. This is the condition which
determines whether the iteration is to continue. If the condition is false,
the iteration terminates. The format of the condition is exactly the same
as the format of the condition in an if statement.
• A Java statement. This is the statement which is executed repeatedly as
long the boolean expression is true. This statement may be a block of
statements; it is known as the body of the loop.
Some examples of Java iterations are:
while (x > 0)
{ y = y * 2;
x = x - 1;
}
while (x <= y)
{ x = x + 1;
y = y - 2;
}
We make a few points on iterations:
• There should be at least one statement in the body of the loop which has
an impact on the condition. In the first example, x is decremented by 1 on
each iteration, thus x must eventually reach 0, terminating the iteration.
If the iteration never terminates, it known as an infinite loop, which is
generally an error.
• If the condition is initially false, the loop repeats 0 times.7 This is often
a desirable feature.
6 Many authors recommend using the curly braces even when they are not needed, i.e. for
a block consisting of one statement.
7 The while statement is a pre-test loop. Java also has a post-test loop.
5.2. ALGORITHM IMPLEMENTATION 131
Note that any statement in the body of the loop may be an if statement or
a while statement. As with algorithms, the control structures may be nested
to any depth.
We conclude this section with an example of a Java program that determines
whether a given positive integer is a prime number. An integer greater than 1 is
prime if it is not divisible by any integers other than 1 and itself. The following
is a list of some small prime nubmers:
2, 3, 5, 7, 11, 13, 17, 19, 23, 29, ...
To solve this problem, we will use the Java modulo operator. It is denoted
with a percent symbol: %8 If x and y are integers, then x % y is the remainder
produced when x is divided by y. For example, 17 % 3 is 2.
In the Java code shown below,9 it is assumed that the variable x has been
assigned some positive integer value.
// Determine whether the value of x is prime.
int i;
i = 2;
while (i < x)
if (x % i == 0)
// terminate, x is not prime.
else
i = i + 1;
// terminate, x is prime.
Since we have not yet learned how to terminate a program, we indicate termi-
nation, and the result, with comments.
In this program there is only one statement in the body of the loop; it is an
if statement (with an else) part; consequently curly braces were not needed
to enclose the body of the loop.
5.2.4 Exercises
1. Show Java statements to perform each of the following:
(a) Declare w and z to be variables, each of which stores an integer.
(b) Store the value 18 in the variable z.
(c) Store the value -3 in the variable w.
(d) Store the sum of w and z into the variable z.
(e) Store the value 16 into w, only if w is positive.
(f) Store the value 6 into w, if the sum of w and z is negative, and store
the product of w and z into z if the sum of w and z is not negative.
(g) Find the sum of all the integers from 1 to 100 and store into the
variable sum.
Hint: Declare a variable which is increased by 1 in each iteration.
8 This operator has nothing to do with percentages.
9 There are more efficient ways to test for primality.
132 CHAPTER 5. PROGRAMMING (WITH JAVA)
(h) Find the sum of all the integers from 555 to 1000, and store into the
variable sum.
5.3 Program abstractions
In chapter 4 we described the process of combining algorithms, i.e. invoking an
algorithm from another algorithm. This is an example of program abstraction.
We can develop software tools, and use those tools to build more complex tools,
which are in turn used to build even more complex and powerful tools. This is
how technology evolves.
In various programming languages many different words are used for the
notion of a portion of a program that can be invoked from other programs:
subprogram, subroutine, procedure, function, method
In Java, the appropriate term is method. A Java method definition consists
of:
• A return type, describing the type of the data which is to be the result
of the method, if any. For a method which returns a whole number, the
return type would be int. For a method which returns a true/false value,
the return type would be boolean. For a method which has no explicit
result, the return type is the key word void.
• The method name10
• A list of parameter types and names, in parentheses, and separated by
commas. The parentheses are required, even if the method has no param-
eters.
• The method body, consisting of a block of Java statements with sequence,
selection, and iteration control structures.
As an example of a Java method, we will define a method named sumOfSquares
which has two parameters, both whole numbers. It should return the sum of
the squares of those two numbers. For example, if the parameter values are 3
and 4, the value returned should be 25 because 32 + 42 = 9 + 16 = 25. The
method definition is shown below:
// Return the sum of the squares of the two parameters
int sumOfSquares(int x, int y)
{ return x*x + y*y; }
Mathematicians know from the Pythagorean theorem that the length of the
hypotenuse of a right triangle is equal to the square root of the sum of the squares
of the two legs. Thus three whole numbers a, b, and c are called a pythagorean
triple if a2 + b2 = c2 . An example of a pythagorean triple is {3,4,5}.
10 Conventionally, the method name must begin with a lower case letter.
5.3. PROGRAM ABSTRACTIONS 133
Type Value Represented by
int 37 0000000000000000000000100101
char ’w’ 01110111
boolean false 0
boolean true 1
Figure 5.4: Examples of bit sequences representing primitive data types in a
programming language
We now wish to define a method with three parameters which will deter-
mine whether three whole numbers form a pythagorean triple. We will use our
previous method sumOfSquares in this method:
// Return true only if the values of a,b,c form
// a pythagorean triple.
// Assume c is the largest value.
boolean pythagoreanTriple (int a, int b, int c)
{ if (sumOfSquares(a,b) == c * c)
return true;
else
return false;
}
5.3.1 Reducing complexity with abstractions
Program abstraction is a way of hiding details. We can develop a program seg-
ment (such as a Java method), test it, and convince ourselves that it is correct.
We can then make use of that program segment in other programs, simply by
invoking it when necessary. As long as we understand the constraints on the
parameters, known as preconditions and the expected result of the methods, we
can use it without concerning ourselves with all the details of its inner workings.
That is the beauty of program abstraction.
[Link] Data abstraction
In chapter 2 we learned that all data is binary: a sequence of 1’s and 0’s. We
then can interpret that binary data in various ways. This provides a means of
hiding the details (the 0’s and 1’s) and viewing the data in a way that is easier
to understand. This is known as data abstraction.
In the Java language there are several primitive data types provided, as
shown in Figure 5.1. Each of these actually is represented by a binary se-
quence. For example, we use the number 17. Internally it is represented
by 00000000000000000000000000010001.11 Other examples are shown in Fig-
ure 5.4.
This is the first level of data abstraction.
11 In Java an int is 32 bits; a long is 64 bits.
134 CHAPTER 5. PROGRAMMING (WITH JAVA)
At the next level, we can use the primitive data types to define more useful
data types, in which the primitive values are hidden to reduce complexity. Here
are a few examples:
• Strings of characters. We often wish to deal with several characters as a
self-contained data item, known as a character string, or simply string. In
some programming languages this is provided as a primitive type; in Java
it is a defined type, i.e. it is defined using existing primitive types. Strings
are normally implemented as a sequence of characters. When scanning
this sequence of characters, it is necessary to determine when the end of
the string is reached. In some languages there is a terminating character,
known as a null character. In Java, the length of the String is stored with
the string, as an int.
• Rational numbers. When working with numbers that are not necessarily
whole numbers, we can use a floating point data type, in which we allow
for values like 1.5. However, for the result of the division 1.0 / 3.0, for
example, we will never get a perfect result. There are many numbers
that cannot be represented perfectly. This justifies the need for a defined
type, which could be called Rational or Fraction, in which each value is
represented by two integers: a numerator and a denominator. Thus the
value 1/3 would be represented by the pair (1,3). Arithmetic operations
on Rational numbers can provide perfect representations, where floating
point representations can only provide approximations.
At the next level, we are working in a particular problem domain, and wish
to perform further data abstractions. If we are working with an application at an
educational institution where we need to store information about the students,
this is an ideal opportunity for data abstraction.
We could define a new data type called Student. Each Student would be
composed of several items, called fields.12 Some of the fields defining a Student
could be:
• The Student’s name: A String
• The number of credits completed: an integer
• The Student’s grade point average: A floating point number, storing an
approximation, or a Rational storing an exact value.
• The Student’s address: A defined type, Address
• Courses: A List13 of the Courses in which the Student is currently enrolled,
where Course would be another defined type
In order for this to work we would need defined types for List, Address and
Course, each of which would be composed of several fields.
12 In Java, fields are called instance variables.
13 We discuss Lists below
5.3. PROGRAM ABSTRACTIONS 135
Number Can be coded as
37 37.0 3.7E1 0.37E2
−43.06 -43.06 -4.306E1 -4306E-2
6.02 × 1023 6.02E23 602E21 0.602E24
1 × 10−12 1.0E-12 0.1E-13 1000E-9
Figure 5.5: Table showing some examples of floating point constants in a pro-
gramming language
In this manner we continue building new data types, using existing data
types. This is data abstraction.
[Link] String processing
Here we elaborate on character strings. With this data type there are several
operations which could be defined:
• Compare two strings to see which comes first, alphabetically. In this
operation the ascii codes of the characters are used, because they are in
alphabetic order.
• Make a copy of a given string.
• Search a string for a given substring. For example, searching the string
"Princetonian" for the substring "ton" would produce the value 6, be-
cause "ton" begins at position 614 in "Princetonian"
• Extract a substring from a given string. This operation usually requires
a string, a start position in the string, and a length for the substring
to be extracted. For example, substring("Princetonian", 2,3) would
produce the string "inc".
[Link] Numbers
We have seen that Rational numbers can be implemented using only integers.
The same is true of floating point numbers. These are numbers which need not
be whole numbers. We also include here numbers that are very large, or very
close to 0. Most programming languages allow these numbers to be specified
with decimal points and/or scientific notation, in which we include an exponent
of 10. Because most programming languages do not permit superscripts in the
program code, the letter E (or e) is used to indicate an exponent of 10. Figure 5.5
shows some examples of floating point values in Java.
Much can be learned by examining the construction of floating point num-
bers. These numbers an be constructed using only integers; a floating point
number consists of only two integers:
14 Position numbers begin at 0, in most programming languages.
136 CHAPTER 5. PROGRAMMING (WITH JAVA)
Array List Meaning
3 + myArray[2] 3 + [Link](2) Add 3 plus value at position 2
myArray[17] = 2 [Link](17,2) Store the value 2 at position 17
myArray[0] = 53 + [Link](0,53 + Add 53 plus the value at
myArray[7] [Link](7)) position 7. Store at position 0.
[Link] [Link]() Number of items
[Link](35) Append the value 35 at the end
of the list
[Link](2,35) Insert the value 35 at position 2
of the list
[Link](3) Remove the value at position 3
of the list
Figure 5.6: Some operations on arrays and lists; add and remove cannot be
applied to an array.
• A signed mantissa: The digits in the number, excluding the exponent
• A signed exponent: An exponent of 1015
Storing only these two values, any floating point number can be constructed.
[Link] Lists
A sequence of values of some type is called a List. We have already seen that a
String is a List of characters. Most programming languages have the capability
of working with Lists of arbitrary data types. Lists are generally homogeneous,
meaning that all the values in the List are of the same data type.16 Figure 5.6
shows some examples in which we wish to access and/or change values in a List.
[Link] Arrays
Most programming languages have arrays, which are similar to Lists, in that
they consist of a homogeneous sequence of values. There are a few differences
between arrays and Lists:
• An array has a fixed length, whereas a List may grow or shrink as a
program executes.
• The syntax used to obtain a value from an array, or change a value in an
array, is different from the syntax used for Lists. Figure 5.6 shows some
examples in which we wish to access and/or change values in an array and
in a List.
15 In actual floating point implementations the exponent is usually an exponent of 2 or of
16, because the mantissa is binary.
16 Object-oriented languages such as Java can circumvent this restriction by using a List of
Objects.
5.3. PROGRAM ABSTRACTIONS 137
[Link] Application Program Interface
Suppose we write a program named P1, which can perform several useful calcu-
lations. Another person writes a program named P2 which makes use of program
P1 to perform those calculations. Program P1 is known as a server because it
is providing a service. Program P2 is known as a client because it needs the
services offered by a server. This is known as client/server terminology.
An Application Program Interface (API) is another form of program abstrac-
tion. An API generally accompanies a server, and provides all the information
that a client would need (and no more) in order to make use of the services.
The API would specify not only all the services that are available, but would
also provide a description of what information they would need (parameters),
what restrictions there may be on that information, and in what circumstances
the server might be unable to perform the desired service. The details of how
the services are performed are not part of the API. These details are hidden
from the client, thus this is an example of abstraction.17
[Link] Software libraries
Once we see the need for certain functionality, to be used in many different
applications, we can develop a repository, or library of software modules to be
used when needed. In Java this would be a package of classes with related
purposes. Some examples of Java packages are:
• [Link] - Classes involving lists, sets, maps, and other data structures
• [Link] - Classes which can be used to build a graphical user interface
(menus, buttons, drop-down lists, etc. (Abstract Window Toolkit))
• [Link] - Classes which can be used for encryption and authentica-
tion.
• [Link] - Commonly used classes such as String and Math
• [Link] - Classes used for input and output
Libraries are a fundamental example of program abstraction. The libraries
have been well tested. They have clearly defined interfaces, i.e. APIs which ex-
plain exactly how they are to be used, what they do, and what, if any, side effects
they may have. Once the APIs are produced, the libraries may be used without
looking inside the classes at the details of their implementation. Libraries are
helpul in preventing a developer from ‘reinventing the wheel’.
17 To build its Android operating system for smartphones, Google made extensive use of the
API for Java’s class library, for which the copyright was held by the Oracle Corp. Oracle
filed a lawsuit against Google for about $1B, claiming copyright infringement. After several
appeals, the U.S. Supreme Court recently ruled in favor of Google, since Google was using the
API, and not the implementation of that API, and this constituted fair use of copyrighted
material.
138 CHAPTER 5. PROGRAMMING (WITH JAVA)
5.3.2 Exercises
1. Show a Java method which evaluates the function:
f (x) = x3 + 3x2 − 5x + 2
int f(int x)
2. Show a Java method which evaluates the absolute value function.
abs(25) = 25
abs(−3) = 3
abs(0) = 0
int abs(int x)
3. Show a Java method which finds the sum of all the integers from 1 to a
given max value.
int sum(int max)
4. Show an algorithm which can be used to multiply two numbers represented
as Rational. Each number has a numerator and a denominator, both of
which are integers.
Rational mult(Rational x, Rational y)
Some tips:
• If r is a Rational number, you can refer to its numerator as [Link]
• If r is a Rational number, you can refer to its denominator as [Link]
• To create a new Rational number in a variable named r:
Rational r = new Rational();
5. In this section we defined a data type, Student, with 5 fields. Define the
following data types, which are used by the Student data type:
(a) Address
(b) Course
6. Show an algorithm which can compare two strings of characters to deter-
mine which comes first alphabetically.
strCmp(s1,s2)
Some tips:
• The ith character of a string s is si , where the first character is s0 .
• Characters can be added and subtracted (It is actually done with
ther ASCII codes.) d - b = 2
• The length of a string, s, can be obtained with length(s).
7. Show an algorithm which can extract a substring from a given string.
substring(s,start,length)
Some tips:
• A string of length 0 is ””.
5.4. PROGRAM DEVELOPMENT AND MAINTENANCE 139
• Two strings can be concatenated with a raised dot:
john · son = johnson
8. Show an algorithm which can be used to multiply two numbers which are
in floating point representation. Each number has a mantissa, and an
exponent of 10, both of which are integers.
mult(x,y)
Some tips:
• The mantissa of a floating point number, x, is xmant .
• The exponent of a floating point number, x, is xexp .
9. Show a Java method to find the position of the largest value in a given
List of numbers. The position of the first value is 0. The position of the
last value is one less than the size of the List. Your method should return
-1 if the List is empty.
int getLargest(List<Integer> numbers)
Some tips:
• The declaration List<Integer> numbers means that the list may
contain nothing other than integers.
• The size of myList is [Link]()
• Check for an empty list first (size = 0)
• Use the first value as the largest, search the list for larger values,
replacing the largest as larger values are found.
10. Show a Java method to find the position of the largest value in a given
array of numbers. The position of the first value is 0. The position of the
last value is one less than the length of the array. Your method should
return -1 if the array is empty.
int getLargest(int [] numbers)
Some tips:
• The declaration int [] numbers means that numbers is the name
of an array of integers.
• The length of myArray is [Link]
• Check for an empty array first (length = 0)
• Use the first value as the largest, search the array for larger values,
replacing the largest as larger values are found.
5.4 Program Development and Maintenance
The software development process has been studied and refined over the years.
For large projects, a sequence of steps can be used, as shown in the section on
Problem solution (in section 1 of this chapter). Referring to those steps:
140 CHAPTER 5. PROGRAMMING (WITH JAVA)
• If an error is detected in step 3 (unit testing), the error is corrected in
that unit and testing continues.
• If an error is detected in step 4 (system testing), the mistake may be in
the design, in which case the design error is corrected, affected modules
are modified, and the relevant unit tests are repeated.
• If an error is detected in step 4 (or in Acceptance Testing), the mistake
may be in the analysis phase, in which case the system requirements need
to be corrected, affected modules need to be redesigned, and affected units
need to be modified and retested.
5.4.1 Program correctness
How can we verify that a program is correct and will always produce correct
output, according to the original specifications? There is no simple answer to
this question. Here we provide some guidelines that will often lead to program
correctness.
[Link] Programming style
Programs should be written in a style which is readable, and easy to under-
stand. Most programming languages are free format, meaning that white space
(spaces, tabs, newlines) in the code is ignored; white space has no impact on
the program’s functionality. This can lead to code with poor style, such as:
// Determine whether the value of x is prime.
int
i; i =
2;
while ( i <
x)
if (x % i == 0) { // terminate, x is not prime.
i = i + 1; }
// terminate, x is prime.
As far as the compiler is concerned, this is a perfectly good program to determine
whether a given integer is prime. However, it is extremely difficult to read. It
can be formatted to read as shown below for clarity:
// Determine whether the value of x is prime.
int i;
i = 2;
while (i < x)
if (x % i == 0)
{
// terminate, x is not prime.
i = i + 1;
5.4. PROGRAM DEVELOPMENT AND MAINTENANCE 141
}
// terminate, x is prime.
Also notice that control structures are clearly indented, as we did in chap-
terch:algorithms. Some programming languages (Python) require this indenta-
tion.
Appropriate comments in the code also help a reader to understand how a
program is supposed to work.
[Link] Meaningful names
The programmer must choose names for the variables, procedures, etc. in a
program. Choosing meaningful names greatly improves the readability of a
program. For example, the name of the Java method shown above could be
foo. It is much better to give it a meaningful name:
boolean isPrime(int x)
That method uses a variable i, and determines whether the given integer is
divisible by i. It would have been better to name that variable factor, because
we are really trying to determine whether it is a factor of the given value, x.
[Link] Duplicated code
It is often the case that some sequence of statements in a program needs to
be inserted at several different places in a program. This is what is known
as duplicated code, which is not advisable. If the same sequence of statements
occurs at 10 different places in a program, what happens if there is an error in
the duplicated code? What happens if the program specifications change (as is
often the case)? The code would have to be fixed in all 10 places that it was
inserted. In large programs this can be a huge job.
Rather than duplicating the code, it is better to isolate it in one place, such
as a method. Then whenever it is needed the method is called. Now if a fix
is needed, there is only one place that needs fixing. Sometimes this is called
factoring duplicated code.
For example, if we needed to test numbers for primality at several places in
a program, all we need to do is call the isPrime method shown above, rather
than duplicating the code everywhere it is needed.
[Link] Strive for short program segments
As we write larger programs, it becomes clear that the complexity of these
programs increases to the point that verifying correctness becomes extremely
difficult. For that reason we will divide a program into shorter segments, oftem
called code segments. This can be done with abstraction, as we write proce-
dures (Java methods) to perform various services, and then use those services
as needed. Each method can be tested individually. If this is done properly,
each method will not be excessively complicated, and the entire program will
be manageable.
142 CHAPTER 5. PROGRAMMING (WITH JAVA)
[Link] Debugging
It is rare that a program of reasonable size will perform correctly the first time
it is executed. The flaws, or errors in a program, are often called bugs.18 The
process of locating, identifying, and correcting these flaws is called debugging.
There are a few different kinds of bugs:
• Compile-time bugs: These are errors which are often called syntax errors.
The compiler19 can provide diagnostic information on these bugs, such as
the exact location in your program, and a description of the error.20 .
An example of a syntax error would be:
x = (2+3)*y);
The parentheses are not correctly balanced.
• Run-time bugs: These are errors which occur after the program has been
compiled, and it has started executing. These bugs will usually result in
one of the following:
– An Exception: Something happened which caused the program to
terminate abnormally. For example, the program attempted to divide
a number by 0.
– The output which was produced is incorrect.
– The program continues to execute, never terminating. This is called
an infinite loop.
All three of these errors are the result of incorrect statements in the pro-
gram, known as logic errors. These errors are very difficult to fix because
the logic error could cause the program to fail after many more statements
are executed, i.e. the logic error and the location at which evidence of an
error appears can be far apart from each other, as shown in Figure 5.7.
In Figure 5.7. the value of y was incorrectly set to 17 (it should have
been 27). When execution reached z = (z-x) / (y-17), the value of y
was still 17, and the divisor, y-17 was 0, causing an Exception known as
an Arithmetic Exception. The program then terminates before reaching
a normal termination.
The debugging process involves a diagnostic process during which it is
necessary to:
1. Understand the Exception or incorrect output.
2. Find the location of the error.
3. Understand the effect of the error on the progam’s execution.
18 A moth that had flown into the circuitry of an early computer in the 1950’s caused the
machine to fail, hence the origin of the term bug.
19 A compiler is the program translates your Java program to a form that can be directly
executed by the computer’s CPU.
20 Some software can even offer suggestions on how to correct the error
5.4. PROGRAM DEVELOPMENT AND MAINTENANCE 143
int x,y,z;
y = 17; // Error is here; y should be 27.
. . . // much intervening code here,
// not affecting y.
x = 12;
z = x + y;
z = (z-x) / (y-17); // Exception occurs here,
// division by 0.
Figure 5.7: The location of an Exception and the location of the program flaw
which caused the Exception can be far apart
4. Correct the error and test the program again.
The debugging process is so important, and so difficult, that software
called a debugger has been developed to aid in the process of debugging
run-time errors. The debugger can help determine the location of the ac-
tual error, and can help the programmer understand flaws in the program,
but the debugger cannot fix the error; that task is left for the programmer.
Most debuggers are capable of:
– Setting breakpoints in a program. When execution reaches a break-
point, there is a pause until the debugger is given a command
– Showing the values of variables as the program executes
– Stepping through the statements in the program one at a time
– Stepping into a called method, versus running the called method at
full speed
– Continue executing at full speed until the next breakpoint is encoun-
tered
In summary, the debugger provides a visual display of the program’s state
during execution, which is very helpful to the programmer.
[Link] Overall purpose of the programm
In order to test the program, and ensure its correctness the programmer must
be aware of the program’s purpose. A program has an input/output relation.
For every input there is an expected output, and if the programmer does know
what the expected output should be, the programmer will not be able to debug
the program.
144 CHAPTER 5. PROGRAMMING (WITH JAVA)
[Link] Use cases
Examples of certain inputs, and their corresponding desired outputs are called
use cases. These use cases are provided to the programmer to help reach an
understanding of the overal purpose of the program, and to aid in the testing
process.
[Link] Is the program correct?
Complex programs undergo extensive testing to determine correctness. How-
ever, the set of possible inputs is so huge, that it is usually not possible to test all
possible inputs. In particular, software which interacts with the outside world
will be very difficult to test for correctness.21
Much research has been conducted in the area of program correctness. There
are algorithms which are designed to prove that a program is correct. However,
in order for this to be effective, the input/output relation must be specified
precisely, and in a form that the proving algorithm can utilize. Programs which
interact with the world, such as the software in an airplane’s cockpit cannot
be proven correct. Another criticism of correctness algorithms: After you have
proven a program to be correct, how do you know that your proof is correct?
Many programming shops require the programmers to provide logical expla-
nations and justification for the correctness of their programs, in addition to
extensive testing.
When attempting to verify program correctness, it is helpful if the program
has been divided into smaller modules, or methods. If each of these smaller
methods is correct, and they are used correctly, it is more likely that the en-
tire program is correct. If any one unit is not correct, the entire program is
considered incorrect.
[Link] Code review
In determining correctness testing is important. But there is another technique,
called code review which is also used. Code review involves reading through
the statements in a program and providing an explanation or justification for
each statement. Often code review is done in pairs, or groups, of people. The
original programmer provides the explanations and the others listen critically,
attempting to point out fallacies in the explanations or code which does not
agree with the explanations.
[Link] Program functionality
The function, or purpose, of a program can be described as an input/output re-
lation. Often this is not possible or not sufficient. In such cases the functionality
is described by how a user interacts with the program, or by how the program
21 Consider, for example, the software which aids an airplane pilot. It utilizes information
such as air speed, altitude, the plane’s orientation, etc. to help the pilot fly the plane. This
software is difficult to test for all possible situations, and a software error can be catastrophic.
5.4. PROGRAM DEVELOPMENT AND MAINTENANCE 145
interacts with the world outside.. The functionality is generally described from
the user’s perspective; it would not be likely to be described by internal details,
such as program variables and statements.
5.4.2 Exercises
1. Rewrite the Java code segment shown below so that it is clear and read-
able. Be sure to indent control structures properly.
if (x >
17
) if (y < x) { while (x > 0) x = x -1
; y = y * 3; } b =
0
;
2. The code segment shown below is supposed to find the average of a List
of floating point numbers (myList). Rewrite this code segment using
meaningful variable names. Assume the List is not empty. Be sure to
indent control structures properly. Also include comments to describe the
internal intention of various variables and/or statements. 22
float x1 = 0.0;
float x3;
int x2 = 0;
while (x2 < [Link]())
{
x1 = x1 + [Link](x2);
x2 = x2 + 1;
}
x3 = x1 / [Link]();
3. Eliminate the duplicated code from the following code segment, without
changing the intent of the code segment.
if (x > 0)
{ y = 17;
x = x + 1;
}
else
{ y = 17;
x = 0;
}
22 If you were to run this code on a computer, you would change all the declarations of
float (single precision floating point) to double (double precision floating point) to avoid
error messages from the compiler.
146 CHAPTER 5. PROGRAMMING (WITH JAVA)
4. Eliminate the duplicated code from the following code segment, without
changing the intent of the code segment.
while (x > 0)
{ y = 17 * a - 4;
z = x*3;
x = x + 1;
}
5. Reduce the size of the code segment shown below without changing its
intent. It is supposed to find the average values of three lists of floating
point numbers: numbers, grades, and scores.
float averageNumber, averageGrade, averageScore;
float sum = 0.0;
int i = 0;
while (i < [Link]())
{
sum = sum + [Link](i);
i = i + 1;
}
averageNumber = sum / [Link]();
float add = 0.0;
int ctr=0;
while (ctr < [Link]())
{
add = add + [Link](ctr);
ctr = ctr + 1;
}
averageGrade = add / [Link]();
float total = 0.0;
ctr = 0;
while (ctr < [Link]())
{ total = total + [Link](ctr);
ctr = ctr + 1;
}
averageScore = total / [Link]();
Hint: Use abstraction. To pass a List to a method, provide the name of
the List as the parameter. In the method declare a parameter as a List.
6. True or False:
(a) Debuggers can help you fix syntax errors.
(b) The compiler will find run-time errors.
5.5. PROGRAMMING WITH MATHEMATICS AND LOGIC 147
(c) After locating the source of a run-time error, the Debugger will cor-
rect the error for you.
(d) Code review means the same thing as testing.
(e) Use cases are valuable when testing a program.
(f) All software can be verified for correctness, thus eliminating the pos-
sibility of failures when the software has been released for general
use.
5.5 Programming with Mathematics and Logic
5.5.1 Using mathematics and logic
The computer’s memory consists of a linear sequence of 1’s and 0’s. Though
we may place various interpretations on this sequence of bits, the concept of a
number is fundamental in computer science.
[Link] Working with numbers
We have seen in chapter 2 how to represent positive or negative whole numbers
as binary values. We also saw that whole numbers can be used to represent
non-whole numbers, very large numbers, and numbers very close to zero using
a floating point representation, with a mantissa and an exponent.
We repeat that there are inevitable approximations and inaccuracies with
floating point numbers.23
Once we have a representation scheme for various kinds of numbers, fun-
damental operations such as addition, subtraction, multiplication, and division
can be defined (usually done with hardware). The numbers and operations can
be used to define more interesting numbers, such as rational numbers, complex
numbers, or numbers with unlimited precision.24
Most programming languages permit the programmer to specify calculations
algebraically. I.e. an expression such as (a+b)-(c*d) written in a program
is actually translated by the compiler to a series of three operations by the
computer:
1. Add a+b, leaving the result in a temporary memory location, T1
2. Multiply c*d, leaving the result in another temporary memory location,
T2
3. Subtract T1-T2, leaving the result in yet another temporary memory lo-
cation, T3
23 In many programming languages 0.1 + 0.1 + 0.1 6= 0.3 because of these inherent inaccura-
cies.
24 Data types in many programming languages have limited precision; there is a maximum
value and a minimum value for a Java int, for example.
148 CHAPTER 5. PROGRAMMING (WITH JAVA)
Numbers and numerical computations are fundamental to everything we do
with computers. Even applications such as character string processing, graphics
images, sound clips, and video formats require extensive numerical calculations.
[Link] Working with logic
Logical concepts are everywhere in hardware design25 , software, and computer
science. We often work with an algebra similar to ordinary algebra, called
boolean algebra. With boolean algebra the only values are true (i.e. 1) and
false (i.e. 0). In chapter 2 we studied the boolean operators which are used in
boolean algebra (AND, OR, NOT, and XOR).
A good understanding of boolean algebra is essential when programming the
computer. For example, a Java programmer might code:
if (a != b && (c == 0 || a != b))
and realize that it can be simplified to:
if (a != b)
according to a well-known boolean identity:
x && (y || x) = x
where x and y are boolean variables (i.e. they can store true/false values).
Logic concepts are also useful when reasoning about a program’s correctness.
We often make assertions, either in comments or in the code, about the state of
a program, values of variables, etc. For example, if we had the statement:
x = (y+z)/w
we might want to be sure that w is not 0, which could cause the program
to terminate with an error. With a series of steps in this reasoning process,
we could assert: w 6= 0. Many programming languages allow for this kind of
assertion, which would alert the programmer when the assertion is false (early
detection of errors is always desirable).
[Link] Working with abstraction
As we saw in chapter 2, abstractions are everywhere in computer science. A
fundamental property common to all computers is the notion of an array of
values, which are stored in contiguous memory locations. Arrays provide for
quick and direct access to any of the values.
Using the fundamental properties of arrays, binary integers, and addresses,26 ,
we can employ a series of abstractions to develop more powerful and efficient
structures:
1. Using integers, arrays, and addresses, we can develop lists, which can grow
and shrink as a program executes.
2. Using lists, we can develop stacks (last-in, first-out lists).
3. Using lists, we can develop queues (first-in, first-out lists).
25 Hardware design is often called logic design.
26 The location of a value in memory is known as its address.
5.6. HANDS-ON PROGRAMMING: BLUEJ IDE⊗ 149
4. Using lists, we can develop hashtables providing quick access to large quan-
tities of data.
5. Using addresses, we can develop trees providing quick access to large quan-
tities of data.
6. Using either hashtables or trees, we can develop sets, in which there are
no duplicate values, and which provide quick access to data.
7. Using either hashtables or trees, we can develop maps, also known as
dictionaries, which allow for quick access to data.
And the list goes on... We are constantly building new tools using existing tools.
With all the tools described above we develop efficient ways of extracting what
we want, and possibly iterating over the data, i.e. extracting all of the values,
sequentially.
5.5.2 Exercises
1. If you were to write a Java program to average a List of integers, you
would need to find the sum of the integers, then divide the sum by the
size of the List (i.e. the number of integers in the List).
(a) Should the variable storing the sum of the integers be declared as an
int, or as a double (i.e. floating point)?
(b) Should the variable storing the average of the integers be declared as
an int, or as a double (i.e. floating point)?
2. Explain briefly how a program designed to compare strings of characters
might make use of integer arithmetic.
3. If x and y are boolean variables, they can store true/false values. Prove
that the boolean expression
x && (y || x)
simplifies to the equivalent expression
x
Hint: Show the value of the given expression for every possible assignment
of values to x and y. This is called a truth table.
4. When abstraction is used to build new tools from existing tools, the inner
workings and details of the tools being used should be hidden from the
client. Explain briefly why they should be hidden.
5.6 Hands-on programming: BlueJ IDE⊗
This section will help you get started with hands-on programming in Java. For
a more complete description of Java programming, including object-oriented
principles, see the open source textbook on Introduction to Computer Science.27
27 see http : //[Link]/ ∼ bergmann/books
150 CHAPTER 5. PROGRAMMING (WITH JAVA)
5.6.1 Java classes
The fundamental unit of a Java program is known as a class. A class may
contain:
• Fields: Variables known as instance variables, accessible from all methods
in the class
• Constructors: Methods which have no return type, not even void. The
name of a constructor must be the same as the name of the class. Con-
structors are used to initialize the fields when an object of the class is
created.
• Methods:
– static methods (also known as class methods) can be invoked directly
from the BlueJ project window.
– non-static methods (also known as instance methods) can be invoked
from other methods or from objects in the project window.
An example of a Student class is shown in Figure 5.8. This class has:
• Two fields: name and GPA
• A constructor with two parameters
• Two accessor methods (getters)
• Two mutator methods (setters)
Though we have not done so here, the mutator methods can be designed so
as to ensure that the fields always have appropriate values. This is known as
encapsulation.
Having seen some of the rudiments of defining a class, we can now see how to
work with these concepts on the computer. To create and test Java programs,
we generally use an Integrated Development Environment (IDE).
Most beginning users will prefer to use a simple IDE, such as BlueJ, but
other IDEs are available for free download on the internet.
5.6.2 Java collections: Lists and Sets⊗
The Java programming language has an extensive compendium of classes and
interfaces, with a clear and readable API. The API describes how to use these
classes and interfaces, so the user does not need to examine the code; this is a
good example of abstraction.
A Java inteface is similar to a class, but its methods are left undefined. Every
interface must have one or more classes which implement the interface, and this
is where the methods are actually defined. A List cannot be instantiated, i.e.
one cannot create an instance of a List, a List object, as one would with a class.
However, the implementing classes can be instantiated.
5.6. HANDS-ON PROGRAMMING: BLUEJ IDE⊗ 151
/**
* Student has a name, ssn, and gpa
*
* @author (sdb)
* @version (Sep 2020)
*/
public class Student
{ private String name;
private String ssn;
private double gpa;
private int credits;
public Student (String n, String ssn)
{ name = n;
[Link] = ssn;
}
public int getCredits()
{ return credits; }
public String getName()
{ return name; }
public String getSSN()
{ return ssn; }
public double getGPA()
{ return gpa; }
public void setCredits(int cr)
{ credits = cr; }
public String toString()
{ return "Name: " + name +
", ssn: " + ssn +
", gpa: " + gpa +
", credits: " + credits;
}
}
Figure 5.8: A Student class in an example of a Java program
152 CHAPTER 5. PROGRAMMING (WITH JAVA)
One of the most commonly used interfaces is the List interface. A List is
similar to an array, with the exception that a List can grow and shrink as a
program executes, whereas an array must have a fixed length. When using a
List, one may specify the type of the values in the List in angle brackets. Thus
a List of strings could be declared as:
List<String> names;
The type in angle brackets is known as a generic type, and is referred to as E
below. Some of the common operations on Lists are:
• E get(int ndx) - Returns the value at a given index in the List
• E set(int ndx, E value) - Changes the value at a given index in the List
to the given value; returns the old value at that index
• void add(E value) - Adds the given value at the end of the List
• void add(int ndx, E value) - Inserts the given value at the given index in
the List
• int indexOf(E value) - Returns the position of the given value in the List,
or -1 if not found.
• E remove(int ndx) - Removes the value at the given position in the List;
returns the value removed.
The List interface is implemented in two classes: ArrayList and LinkedList.
These classes have identical capabilities because they both implement the List
interface. They differ in their performance characteristics: ArrayLists are fast
when the size of the List does not change often, and LinkedLists are fast when
the size of the List is often changing (i.e. there are insertions and/or deletions).
This interface and these classes are in a package 28 called [Link].29 To
use any of them in a program they must be imported :
import [Link].*; // import everything from [Link]
5.6.3 Starting up: A main method
To execute a program, the Java runtime system will look for a method named
main, with one parameter: an array of Strings. This array corresponds to
command line arguments when a program is initiated form the command line.
If using BlueJ (see below), the parameter may be omitted. In any case, any
class containing this method can be used to initiate execution of a program:
public static void main(String [ ] args)
28 A Java package is a collection of interfaces and classes which are related, or serve a
particular function.
29 see [Link] for a complete API of the [Link]
package.
5.6. HANDS-ON PROGRAMMING: BLUEJ IDE⊗ 153
5.6.4 A complete Java program
Here we give an example of a complete Java program. It consists of two classes:
• A class named Student.30 Every Student has a
– A name, which is a String
– An ssn, which is a String
– A gpa, which is a floating point value, double precision31
– A number of credits completed, which is an int.
The names shown above are the fields or instance variables of the Student
class. The Student class also has:
– A constructor named Student(String n, String ssn). The con-
structor is called automatically when a Student object is created.
The main purpose of a constructor is to ensure that the fields are ini-
tialized appropriately. The name of a constructor must be the same
as the name of its class. A constructor has no return type, not even
void.
– Methods which return the current values of the fields. These are
called accessor methods, or more succinctly, getters. Examples are
the methods getName() and getSSN().
– A method which allows the client to change a field. It is the setCredits(int cr)
method. Such methods are known as mutator methods, or setters.
– A method named toString() which returns a String. It produces a
String representation of a Student object. The toString() method
is called automatically, when:
∗ concatenating a Student with a String32
∗ printing a Student with println or print method calls in the
System class.
The Student class is shown in Figure 5.8.
• A class named Enrollment, which has one field, roster. This field is
declared as a List of Students. The Enrollment class has a constructor
and three methods:
– The constructor instantiates an ArrayList, and assigns it to the field,
roster. This is where we intend to store the enrolled Students.
30 InJava the convention is that only class and interface names begin with uppercase letters.
31 We use double precision rather than single precision (i.e. float), even though the extra
precision may not be needed. In Java all floating point constants are assumed to be double
precision, so it is convenient to make all variables double precision as well to avoid mixing
types.
32 Concatenation of Strings is done with a ‘+’ operator.
154 CHAPTER 5. PROGRAMMING (WITH JAVA)
– A main method, which instantiates the Enrollment class and assigns
it to the local variable, e. At this point the roster is a List of size
0. The main method then adds several students, each of which has a
name and an ssn.33 Finally the main method calls showStudents()
to display the roster to the user.
– A private (i.e. local to this class) method named addStudent(String
name, String ssn) to add a Student to the roster.
– A private method to display all the students to the user. This method
uses a for each loop to access each Student in the List.
The Enrollment class is shown in Figure 5.9.
For a more comprehensive introduction to Java programming the reader is
referred to the open source textbook, Introduction to Computer Science with
Java at
[Link]
5.6.5 Using an IDE
Some examples of IDEs which can be used to develop Java software are:
• BlueJ - A fairly simple, yet powerful, IDE which can be used to edit and
execute Java source files, and inspect objects. It also allows the user to
test code snippets to find out what effect they have. BlueJ is available for
free download at [Link].
• NetBeans - This IDE began as a student project in Czechoslavakia and
was later acquired by Sun Microsystems (now Oracle). Like BlueJ it is
designed specifically for Java development. It differs from BlueJ in that it
has tools specifically for the automatic creation of graphical user interfaces.
• Eclipse - This IDE has so many features that it is rather difficult to learn.
The main advantage of Eclipse is that it can be used for many different
programming languages, not just Java. Once you learn Eclipse, you can
use it on many different projects. Another interesting feature of Eclipse
is that the debugger can step backwards.
All three of these IDEs are free for download on the Internet; in addition,
they are all open source and have many optional plug-in features.
5.6.6 The BlueJ IDE
Since BlueJ is the easiest IDE for novices to learn, it is the one we choose to
look at here. After learning BlueJ, many users will opt for a more powerful IDE
at a later time.
33 The new operator is used to create an object of a class, this is known as insantiation, i.e.
creating an instance of a class.
5.6. HANDS-ON PROGRAMMING: BLUEJ IDE⊗ 155
import [Link].*; // import Lists and Sets
/**
* Set up a roster of students.
*
* @author (sdb)
* @version (Sep 2020)
*/
public class Enrollment
{ List <Student> roster;
/** Constructor */
public Enrollment()
{ roster = new ArrayList<Student>();
}
/** Execution begins here */
public static void main(String [] args)
{ Enrollment e = new Enrollment();
[Link]("jim", "4023");
[Link]("mary", "3020");
[Link]("joe", "3022");
[Link]("mary", "4099");
[Link]();
}
/** Add a new Student with given name and ssn to the roster*/
private void addStudent(String name, String ssn)
{ [Link](new Student(name,ssn));
}
/** Display all students in the roster on stdout */
private void showStudents()
{ for (Student s : roster) // for each Student s in roster
[Link] (s);
}
}
Figure 5.9: An Enrollment class in an example of a Java program
156 CHAPTER 5. PROGRAMMING (WITH JAVA)
[Link] Getting started with BlueJ
The basic development unit in BlueJ is the project. A project may consist of
several related classes (a project is really a folder, or directory, containing a
source file and related files for each class in the project). When starting up
BlueJ, use the menu to open a new project, or to open an existing project. Be
sure to save the project to a disk or storage device for which you have write
access. As you make changes to your source files, BlueJ will automatically save
the project.
To create a new class for your project, click the button New Class.... This
will bring up a dialog box allowing you to enter the name of the class (the name
should begin with an uppercase letter) such as Student. There will now be a file
with suffix .java in your project folder, such as [Link].
An example of a BlueJ project window is shown in Figure 5.10 in which the
project has three classes, and one Student object has been created.
To edit a class, double click on the (tan) icon for the class. This brings up
the BlueJ editor window, showing the lines of Java code in the class. BlueJ will
provide a template of sorts for you to get started; you will want to modify or
delete most of what BlueJ has provided. Note that Java source files are plain
text documents (like Notepad documents), and the BlueJ editor is nothing more
than a text editor (like Notepad for Windows or TextEdit for MacOS).
To test your work two steps are needed:
1. Compile - Translate your source code to ‘byte code’, a language that can be
understood by the Java runtime environment. If there are syntactic errors
in your class, the compiler will advise you of these. You must correct these
errors before going further. BlueJ will draw hashmarks on classes which
need to be compiled. If there are no syntactic errors, the compiler will
create the byte code file, with a .class suffix, such as [Link].
Do not try to examine a .class file; it will be unintelligible and is strictly
for Java’s use.
2. Test - Execute the byte code by invoking a method in one of your classes.
Right-click on a class:
• If the class has a static method, select it to run it directly from the
selected class. If that method has parameter(s), a dialog box will be
opened allowing you to enter the parameter value(s).
• Otherwise, instantiate a class (i.e. create an object of the class)
by selecting new .... If the class’ constructor has parameters, a
dialog box will allow you to enter the parameter value(s) at this
point (caution: remember the double quote-marks if the parameter
is a String). The object should appear as a red box in the object
window at the lower left. Right-click on the red object to inspect it
(look at the values of its fields) or to invoke an instance method. If the
method has parameters, a dialog box will allow you to enter values
5.6. HANDS-ON PROGRAMMING: BLUEJ IDE⊗ 157
Figure 5.10: An example of a BlueJ project with three classes. One object of
class Student has been instantiated. The CodePad shows that the value of the
expression 2+3 is 5
158 CHAPTER 5. PROGRAMMING (WITH JAVA)
for the parameters (caution: remember the double quote-marks if the
parameter is a String).
[Link] The BlueJ Terminal Window
If an executing method produces output, it will be sent to the BlueJ Terminal
Window. Some options available for the terminal window include:
• Unlimited Buffering. The window acquires a scroll bar on the right, and
will retain an unlimited amount of output. Use the scroll bar to view any
output.
• Clear. Clear the output window so that you do not confuse the output of
multiple executions.
• Clear Screen at Method Call. Clear the screen automatically each time
BlueJ starts up a method. This is often the preferred option.
• Record Method Calls. Show all methods which have been invoked from
BlueJ.
• Save to file... Open a dialog box to allow all output to be saved in a text
file.
[Link] The BlueJ Debugger
A debugger is a tool designed to help the programmer locate the source of a
logic error in the program. A debugger will not tell you where to find a bug,
nor will it correct the mistake for you; this is the programmer’s job. With a
debugger, the programmer can step through the statements of a program, one
statement at a time, while watching the values of variable change. This kind of
tool is often essential in diagnosing an error. Debuggers are used at runtime,
not at compile time.
To start up the debugger, open a BlueJ Editor window, and click the mouse
in the left margin (on a line number). You should see a red stop sign appear;
this is known as a break point. When execution reaches this point, it will pause
and wait for you to direct the debugger to continue execution, either single-step,
or at full speed.
[Link] The BlueJ Codepad and inspections
The BlueJ Codepad is in the lower right corner of the project window. The
Codepad can be used to execute small code snippets to see how they work.
BlueJ will invoke the compiler and runtime environment to evaluate expressions
as you enter them in the Codepad. Figure 5.10 shows the expression 2 + 3 in
the Codepad, along with its result, 5. It is possible to instantiate classes in the
Codepad and inspect the objects which are created.
5.6. HANDS-ON PROGRAMMING: BLUEJ IDE⊗ 159
Any object on the object bench (lower left corner) can be inspected by
right-clicking on the object and selecting inspect. You will see the values of all
fields; if any are references to objects, you can select the reference and inspect
the object to which it refers.
5.6.7 Exercises
1. What is the full name of the source file for the University class?
2. What will be the name of the output file when compiling the University
class?
3. True or False: If the compiler produces no error messages, your program
must be correct.
4. Complete the definition of a mutator method for the field gpa in the
Student class in Figure 5.8
5. Which of the IDEs mentioned in this section have a debugger?
Chapter 6
The Internet
The internet pervades modern computing; the internet and systems built on
it have had a profound impact on society. In this chapter we will take a look
at some of the design principles used to establish the internet, and we will
see how those principles have allowed the internet to perfrom well even as it
has grown to accommodate a huge amount of traffic. We will also examine
some issues of security, which enable us to use the internet for confidential
and/or sensitive transactions. Not only consumer finance, but also government,
military, transportaion, and scientific research applications rely on the internet
for security.
6.1 Brief history
The internet’s prototype was a network of mainframe computers at sites (mostly
university research and DOD sites) funded by the Department of Defense Ad-
vanced Research Project Agency (ARPA). It was known as ARPANET and
existed as early as 1969. Another network, known as CSNET, was a connection
of the computers of various universities’ computer science departments. There
was also a consortium of universities connected with BITNET at about the
same time. In 1982 with the specification of a standard communication proto-
col, Transmission Control Protocol/Internet Protocol (TCP/IP), these networks
were able to communicate with each other, forming a network of networks, and
the internet was born.
6.2 A Network of Autonomous Systems
Here we attempt answers to some questions about the internet:
• What is the internet?
• What are the components of the internet?
160
6.2. A NETWORK OF AUTONOMOUS SYSTEMS 161
• How do the characteristics of the internet impact the systems which are
hosted by the internet?
6.2.1 How the internet functions
[Link] World-wide connection
As a network of networks, the internet is able to connect devices and networks
world-wide. Any device which has TCP/IP software can attach to the internet.
Any foreign network of devices which may or may not have the TCP/IP software
may connect to the internet as long as the foreign network’s host computer has
TCP/IP software; the foreign network’s host computer can act as a gateway to
the internet for non-compliant devices.
[Link] End-to-end architecture
Most devices connect to the internet by using TCP/IP software, rather than by
connecting through a gateway network. The trend is toward usage of TCP/IP
around the world. This allows for greater efficiency and compatibility. Because
new devices are always being created, they are designed to be TCP/IP com-
patible from the start, and can communicate with all other devices through
TCP/IP.
[Link] IP addresses
Each device which is directly connected to the internet is assigned a unique
number, known as its IP Address. IP addresses were originally 32 bits, but
because of the amazingly rapid expansion of the internet, IP addresses were
extended to 128 bits in 1998 with version 6 of IP (IPV6). Thus, the internet
architecture is evolving to accommodate growth.1
[Link] Domain names
Because internet users generally do not wish to communicate with numeric IP
addresses, a naming system has been established, to make the specification of
an internet device more convenient. This naming system is called the Domain
Name System (DNS). Internet software is capable of translating between IP
addresses and their associated domain names. For example, you can attempt to
visit ‘[Link]’, which is then translated to the IP address of Amazon,
to establish a connection.
Domain names form a hierachy with multiple levels. For example, the fol-
lowing domain names can be viewed as being composed of several levels, in a
structure that we call a tree.2
1 When we way that a technology scales, we mean that it is capable of performing well
when loaded with increasing quantities of data or responsibilities.
2 This diagram is called a tree, because the components branch out like the branches on a
tree. Paradoxically the root of the tree is at the top, and the leaves are at the bottom.
162 CHAPTER 6. THE INTERNET
com edu
amazon rowan rutgers
www browse shop www cs math
theory applied
Figure 6.1: Tree diagram of several domain names, showing a hierarchical struc-
ture.
• [Link]
• [Link]
• [Link]
• [Link]
• [Link]
• [Link]
• [Link]
• [Link]
• [Link]
Figure 6.1 shows these domain names in the form of a tree.
At the top (i.e. root) of the tree we have com (company) and edu (educa-
tion). Other common top-level labels are gov (government), mil (military), org
(organization) and net (network). Nations other than the United States use
a two-letter abbreviation for their country name at the top level, as shown in
Figure 6.2.3
Domain names are assigned by the Internet Corporation for Assigned Names
and Numbers (ICANN). Anyone can apply to ICANN for a new domain name.
If it is a pre-existing name, it would have to be purchased from the owner for
a negotiable price. In the early days of the internet it was not unusual for
savvy individuals to apply for domain names such as [Link], [Link], or
[Link]. These domain names were correctly thought to be very valuable to
the named organizations, and the original owners were able to sell these domain
names at a huge profit.
3 The small pacific island nation of Tuvalu sold its top level name .tv to the corporation
dotTV; Tuvalu now owns 20% of that company.
6.2. A NETWORK OF AUTONOMOUS SYSTEMS 163
Abbreviation Country Name
at Austria
au Australia
ca Canada
eu European Union
mx Mexico
nz New Zealand
tv Tuvalu
uk United Kingdom
us United States
Figure 6.2: Some common country abbreviations in internet domain names.
[Link] Internet standards
When digital devices need to communicate with each other it is important that
they agree on how information is to be represented, how a connection is to be
established, how to check for transmission errors, how to signal for termina-
tion, etc. These agreements are called standards. Some examples of internet
standards are:
• HyperText Transfer Protocol (http): HyperText is derived from Apple’s
hypercard application (circa 1987), in which there may be links in a text
document to other text documents. The transfer protocol is a standard
way of sending these text documents (e.g. web sites) from one device on
the internet to another.4
• Simple Mail Transfer Protocol (SMTP): This protocol, first defined in 1982,
was used to standardize the transmission of email on the internet. It
has evolved over the years to enable the inclusion of non-text in email
messages, such as images and video clips.
• Transmission Control Protocol / Internet Protocol (TCP/IP): This is the
protocol referred to above in the section on IP addresses. It standard-
izes the protocol used by any digital device to access the internet. TCP
includeds checking for transmission errors.
• User Datagram Protocol (UDP): This is similar to TCP, but does not include
error checking, and is more efficient.
6.2.2 Exercises
1. Spell out the full name of TCP/IP, and describe its purpose.
2. What is an IP address?
4 https is a cryptographically secure version of http which ensures confidentiality and
authenticity of the text which is transmitted.
164 CHAPTER 6. THE INTERNET
3. What is a domain name? Give an example.
4. Spell out the full name of HTTP, and describe its purpose.
6.3 Some Characteristics of the Internet
6.3.1 Hierarchical design and redundancy
[Link] Hierarchical design
A hierarchy is an ordered list of items. Some examples of hierarchies on the
internet are:
• The components of a domain name, such as [Link]
may be thought of as an ordered list; in Figure 6.1 we view that list in a
vertical format, showing that edu is the top-level component and applied
is the bottom-level component.
• An IP address might also be considered a hierarchy. The original IP ad-
dresses were 32 bits and were usually shown as 4 integers in the range
0..255 separated by dots. For example:
[Link]
Each number in the range 0..255 may be thought of as an 8-bit binary
value, since 28 = 256 the binary values range from 00000000 = 0 to
11111111 = 255.
These IP addresses form a hierarchy with the first number considered the
top level. At the author’s institution, all of our IP addresses originally
began with 150.250.
• The architecture of the internet itself is a hierarchical structure.⊗ The
Open Systems Interconnection (OSI) model is used to describe the design
of the internet as a stack of 7 layers. Each layer is an abstraction of the
more detailed layer beneath it. Figure 6.3 contains a brief description of
each of the OSI layers. Further description of these layers is currently
beyond the scope of this text.
[Link] Redundancy: Packet switching
In order to be resilient to transmission errors, outages, tampering, etc. there
is much redundancy built into the internet. In general redundancy inolves du-
plicating a solution or implementation, so that if one solution fails, the system
could still continue to function with the duplicated solution. One good example
of redundancy is known as packet switching.
When a device on the internet needs to send a large message5 to another
device on the internet it is not sent as one long string of bits. This would
5 Here the word message refers to any digital information, whether it be text, image, sound
clip, video clip, or random bits.
6.3. SOME CHARACTERISTICS OF THE INTERNET 165
Layer Protocol Data Unit Function
7 Application Data High-level APIs
6 Presentation Translation of data (e.g. encryption)
5 Session Back-and-forth between pair of nodes
4 Transport Segment, Datagram Transmission of segments
3 Network Packet Routing, Addressing
2 Data Link Frame Transmission of a Frame from Node to Node
1 Physical Symbol Transmission of bit streams
Figure 6.3: The seven hierarchical layers of OSI, defining protocols for traffic
on the internet
be susceptible to transmission errors and/or failures. Instead the message is
broken into packets of variable size.6 A typical message will then consist of
several packets, in a specific sequence. Each packet consists of:
• A header, which contains origin and destination information, as well as a
sequence number for the packet within the message.
• The data itself, i.e. bits of the actual message.
When the message is sent to another device on the internet (i.e. another IP
address), the packets are sent individually to one or more internet nodes. Each
node then attempts to forward packets as they are received until they eventually
reach their intended destination. When the receiving device receives all the
packets of a message, it reassembles those packets into a complete message
using the sequence numbers in the packet headers. Figure 6.4 is a diagram
showing how packets are sent from an origin to a destination.
In that figure the original message consists of 5 packets, labeled P0, P1, P2,
P3, P4. The originating device may put out these packets to one or more internet
nodes. It may duplicate the packets being sent out (e.g. the packet P0 and P4
are sent to the nodes c1 and c4). This duplication is an example of redundancy.
Some of the packets that have been sent out may take a long time to reach the
destination, or fail to reach the destination at all, which is why redundancy is
important.
At the destination (Dest) the device receives the packets P4, P1, P3, P2, P1,
P0, P4 in that order. Note that some of the packets are received twice due to the
redundancy. The destination device then reassembles the packets in the correct
sequence, discarding duplicate packets, to obtain the original message.7
Because of the redundancy inherit in the packet switching algorithm, the
internet is said to be fault tolerant. A fault tolerant system can continue to
function even after encountering unexpected errors.
6 In
IPv4 the packet size ranges from 20 bytes to 64K bytes.
7 If,
after a period of time, the destination device has not received all the packets of a
message, it can signal to the originating device to resend the message.
166 CHAPTER 6. THE INTERNET
Msg = P0 P1 P2 P3 P4
P0,P4 c1
Origin
P2
P1,P3 c2
P0,P4
P2 P4
c4 c3
P1,P3
P1
P0,P4
c5 P1,P3,P2
c6 Dest
P1,P0,P4 P1,P0,P4
c7
Received = P4 P1 P3 P2 P1 P0 P4
Msg = P0 P1 P2 P3 P4
Figure 6.4: Diagram of packet switching on a network. The original message is
divided into 5 packets which are put onto the network and reassembled at the
destination (Dest).
6.3. SOME CHARACTERISTICS OF THE INTERNET 167
6.3.2 Standards, growth, and scalability
When we say that a system scales well, or that it is scalable, we mean that
as its load increases it continues to function well; i.e. it does not slow down
excessively. The internet was designed with this in mind.
The hierarchical design and redundancy described in the preceding section
are principally responsible for the remarkable scalability of the internet. In 1980
none of us dreamed that the internet would become ubiquitous and valuable all
over the world, yet it continues to function with very little latency (the time
between a request and a response to that request).
Aspects of the internet which have enabled this growth are:
• Redundancy of message routing: multiple routes to a destination
• Hierarchy of the domain name system
• Open standards (as opposed to proprietary standards) for interfaces and
protocols, such as TCP/IP and http
• Packet switching
• TCP/IP software manages the effective routing of packets
• World-wide web standards: http and https
• World-wide web starndards for secure communication: SSL (Secure Socket
Layer) and TLS (Transport Layer Security)
All these have an effect on the performance of the internet; if the internet did
not scale well, people would resort to other communication strategies, and the
internet as we know it would wither. One result of this amazing capability for
scalabilty is what is known as the Internet of Things (IOT). Small devices such
as digital cameras, weather sensors, advertising kiosks, etc. each have their own
IP addresses and can communicate directly with other devices on the internet.
One way of measuring the performance of the internet is by bandwidth, which
is the number of bits that can be sent from an origin to a destination per unit
of time. Depending on the mode of connection to the internet, the bandwidth
can range from 1 Mbit/second 8 to 100 Gbit/second. 9
6.3.3 Exercises
1. How many hierachical levels are there in each of the following?
(a) The domain name [Link]
(b) The IP address [Link]
(c) The OSI model of the internet
81 Mbit = 1 Megabit = 220 bits ≈ 1 million bits
91 Gbit = 1 Gigabit = 230 bits ≈ 1 billion bits
168 CHAPTER 6. THE INTERNET
2. Describe how redundancy is built in to the packet switching communica-
tion protocol on the internet.
3. Describe what is meant by scalability.
4. What is the popular name usually used to describe the huge number of
devices currently connected to the internet?
6.4 Cybersecurity
Cybersecurity, otherwise known as computer security, or information technology
security, involves the protection of computer networks, computers, and other
digital devices which have access to the network. Software which is designed
to cause harm is known as malware.10 Cybersecurity systems are designed to
protect from possible:
• damage to hardware, software, or data
• disruption of service
• unathorized access to private or confidential information, including trans-
mitted information (email, etc.)
• unathorized intrusion to a component not intended for public access
• criminal or unethical uses of the internet
6.4.1 Addressing cybersecurity concerns
How are the concerns listed above being addressed to ensure security?
[Link] End-to-end encryption
Normally communication systems on the internet, such as email, have no built-
in encryption. The content is available to whomever may intercept the trans-
mission.11 The solution is to encrypt messages, in such a way that only the
intended recipient can decrypt the message to see the original plain text. There
are many well designed software packages12 many of which are freely available
on the internet.
However, the typical user may not have the expertise required to download
and use the encryption software properly; or it may be inconvenient. Moreover,
the intended recipient(s) would need to download the same software, and would
10 Malicious software
11 An email is broken into packets, which are sent via various redundant routes to the
receiver; however, some, or all, of the packets can be intercepted at an intermediate point and
reassembled. Confidentiality is not preserved. Unlike letters sent via the US Postal Service,
there is no federal law protecting against intrusion of email. An unencrypted email is like a
postcard, the content is available to anyone who happens to see it.
12 See Gnu Privacy Guard (GnuPg or GPG) which is free and available on the internet
6.4. CYBERSECURITY 169
face the same hurdles: expertise required, and inconvenience. To address these
problems, end-to-end encryption packages have been developed. These pack-
ages provide encryption which, to various extents, is easy to install, seamless,
and effective. After installation, the encryption is applied, by default, and the
software is working ‘behind the scenes’ in such a way that the user does not
even notice its effects.
One such package, Signal13 , is open source and free on the internet. It was
created in 2014, but saw a substantial increase in downloads in 2019-2020. Signal
not only provides end-to-end encryption (for email and telephone transmissions)
services, but also provides authentication14 and integrity15 services.
[Link] Trust model
Much of the security built into the internet is based on the notion of trust.
When we make a purchase online, we trust that our credit card information will
remain confidential (to prevent financial fraud or theft). When we file our taxes
online, we trust that our social security number remains confidential (to prevent
identity theft ). When a corporation’s employees communicate trade secrets to
other employees they trust that the trade secrets will remain confidentialial.
This is not implying that we should trust anyone or anything we encounter
on the internet; to the contrary. However, all of the examples given above use
cryptographic algorithms 16 to ensure that the internet can be trusted.
Digital certificates are like virtual id cards. They can be used to ensure
authenticity of a person or entity on the internet. Once a group of people or
entities who have shared their digital certificates have communicated safely they
have formed a web of trust ; others can then join the web of trust. A large web of
trust ensures safe and secure communication. Also, there are trusted authorities
or certificate authorities, large corporations with many clients, which can issue
digital certificates, for a fee, to private individuals or corporations. An example
of a digital certificate, issued to an author of this book, by Verisign is shown in
Figure 6.5.
[Link] Caveat on domain names
There is no inherent trust built into the domain name system. Anyone can ob-
tain a domain name (though they would have to identify themselves to ICANN).
Users should be careful to check for correct domain names. For example, you
may receive an email with a link, or visit a web page with a link, that appears
as ”Amazon”. However, when you mouse over 17 the link, your browser reveals
13 For an interesting interview with the founder of Signal, Moxie Marlinspike, see the New
Yorker magazine, Oct 26,2020
14 Authentication is the process of assuring the true identity of a person.
15 Integrity is the process of ensuring that there has been no tampering, or altering, of
communications.
16 Cryptography is used not only for confidentiality, but also for authenticity and integrity
in internet communication.
17 Move your mouse pointer over a link, without clicking on the link
170 CHAPTER 6. THE INTERNET
X.509 Certificate
Issued To
Common Name (CN) Seth D. Bergmann
Organization Rowan University
Organizational Unit (OU) Computer Science
Serial Number 46:3c:2a:01:33:30:ba:91:22:4c:25:71
Issued By
Common Name (CN) Verisign, inc.
Organization Verisign, inc.
Organizational Unit (OU)
Serial Number 33:34:1a:9b:21:30:0a:31:42:4d:24:22
Period of Validity
Begins on 19 June 2020
Expires on 18 June 2024
Fingerprints
SHA-256 23:a3:c3:55:ac:8f:32:23:98:9a:02:23:34:5b:ff:9a:bc:b0:97:23:32:e3:
22:bb:32:90:02:32:49:a8:3c:d0:13:82:e1:cd:35:88:bc:21:34:ab:c9:23
SHA-1
23:a3:c3:55:ac:8f:32:23:98:9a:02:23:34:5b:ff:9a:bc:b0:97:23:32:e3:f3
Figure 6.5: An example showing some of the information in a digital certificate
issued to Prof. Seth Bergmann; issued by Verisign
the actual URL18 of the linked site. If it is not ”[Link]”, it is probably a
hoax, possibly dangerous, and should be avoided.
[Link] Hardware, software, and human components of cybersecu-
rity
Security can be built into hardware. A few examples:
• It is now possible to encrypt the entire contents of a computer’s disk
storage. If an intruder attempts to access data from the disk, it will
have no useful meaning since, without the appropriate key information,
it cannot be decrypted. Amazingly, this encryption/decryption process is
fast and transparent to the owner of the data.
• Desktop telephones and other communication devices can be equipped
with encryption technology for secure and confidential communication.
These devices are used primarily in the military and in high-level govern-
ment communications, but also in some business environments.
• Smartphones and other wireless phones must have security built in for
confidentiality, even for the most casual users, as the transmissions are
broadcast ‘over the air’.
18 Universal Resource Locator: This includes the domain name of the selected web site.
6.4. CYBERSECURITY 171
Security can be built into software. As we have seen, the http protocol
which is used to navigate the world wide web has a secure version, https. It uses
standard protocols to encrypt and authenticate transactions on the web (SSL
and TLS).
In addition to hardware and software there are human components of secu-
rity. People need to be aware that they are vulnerable to attack and/or cyber
crime if they:
• Choose passwords which can be guessed easily
• Make their passwords available to casual acquaintances
• Leave a computer or phone unattended, especially if it is logged into a
secure cite
• Respond to suspicious emails
• Click on strange links in emails or web sites
• Trust people who have been met on social media, with no knowledge of
their true identity
[Link] Cyberwarfare
When a nation-state or adversary of a nation-state uses digital communications
to infiltrate and/or attack the information systems of another nation-state, it is
known as cyberwarfare.
• Infiltration may involve accessing classified data, snooping around, gath-
ering as much information as possible without being detected. The nation-
state being attacked would presumably be unaware that its classified in-
formation has been compromised.
• In attack situations the attacker will modify and/or delete critical classified
information. In particular, information on the attacker could be altered
or removed. If the nation-state being attacked did not notice the break-
in, the modified information could be copied to back-up locations, and it
would be difficult to restore the damaged files.
• Weapon systems are often controlled through digital communication chan-
nels. If not secure, those weapons could be disabled or otherwise taken
over by an adversary.
• Defensive systems can be used to thwart an enemy’s attack. Missile sys-
tems such as the Patriot Missile are designed to detect attacking missiles
or aircraft and destroy them before they can deliver payloads. This kind
of weapon is known as Anti-Ballistic Missile (ABM).
• Drone aircraft are increasingly being used for reconnaisance (when equipped
only with cameras) and warfare (when equipped with weapons).
172 CHAPTER 6. THE INTERNET
[Link] Cybercrime
Cybercrime is similar to Cyberwarfare, but the attacker and victim are typi-
cally not nation-states. Motives for cybercrime are generally financial (theft),
but could also include revenge, illegal transactions, money laundering to avoid
income taxes, and vice-related motives.
Some examples of cybercrimes are:
• Breaking into the information system of a financial institution such as a
bank to obtain or modify financial records.
• Breaking into a company’s data storage, encrypting the data with a se-
cret key, and demanding a ransom (usually in bitcoin) for the key (see
ransomware below).
• Intercepting credit card information on the internet.
• Accessing a retailer’s database to obtain account numbers and credit card
numbers.
• Accessing a government database to obtain social securiy numbers for the
purpose of identity theft.
• Vice-related crimes such as child pornography, human trafficking, and
illegal drug transactions.
[Link] Attacks on the Internet
Since its inception the internet itself has been the target of attacks, some mali-
cious, and some less serious.
• In 1988 Robert Morris, a graduate student in Computer Science at Cornell
University, thought he discovered a flaw in the internet’s email protocols.
He thought that if he sent an email to all his contacts, with an attached
program to send to all of their contacts, recursively, that his original email
would propagate through the internet. He tried it, and it worked. Soon
many computers on the internet were doing nothing but forwarding Mor-
ris’ original email, effectively shutting down those computers for other
purposes. This also increased traffic on the internet to such an extent
that everyone experienced serious delays. This kind of self-propagating
software is known as a Worm, and this particular Worm was known as
the Morris Worm. Robert Morris became the first person tried and con-
victed under the 1986 Federal Computer Fraud and Abuse Act.
• A more general kind of attack is known as a Denial of Service (DoS) attack.
A DoS attack will typically flood a targeted computer or host with many
superfluous requests for service, thus overloading the host with requests
and limiting service for legitimate requests. Perpetrators often target sites
6.4. CYBERSECURITY 173
or services hosted on web servers, such as banks, or credit card payment
gateways.
A Distributed DoS attack is an attack which is launched from several
different IP addresses on the internet, all targeting the same service or
host.
[Link] Attacks on Individuals
Malware which targets individuals rather than networks include viruses, phish-
ing, cryptolocking, ransomware, and trojan horses.
• A software virus is capable of replicating itself and modifying other pro-
grams on the same computer so as to include the virus, which then infect
still more programs. Anti-virus software is designed to protect your com-
puter from a virus attack, but new viruses are always forthcoming. To be
safe you need to update your anti-virus software frequently.
• A phishing attack is an attempt at identity theft, generally by an email,
instant message, or website posing as a trusted entity. It will attempt
to obtain sensitive information such as passwords, credit card numbers,
and social security numbers. To thwart phishing attacks always check the
actual email address of the sender (not the name) or check the actual URL
of a website (not the link text). If they are unfamiliar, they are not to be
trusted.
• Cryptolocking software is malware which gains access to a storage medium
such as a fixed disk, and encrypts the data using a secret key. The owner
of the data must then pay a ransom to obtain the key and decrypt the
data.
• Any malware which poses the threat of permanent damage and demands
a payment is known as ransomware. Often to avoid being identified, the
payment is made with a cryptocurrency, such as Bitcoin.
• A trojan horse is named after the legendary Greek attack on the city of
Troy, in which Greek soldiers hid in a large wooden horse and gained access
to the fortified city. A computer trojan horse is any malware which is
hidden in some vehicle, such as an email (with malware in an attachment),
or a web site (with malware in a link).
[Link] Firewalls
One commong strategy used for cyber security is known as a firewall. This is
network security softare on a local network which monitors and controls incom-
ing and outgoing network traffic. It is capable of filtering out incoming malware,
as well as vulnerable outgoing traffice. Often
• Incoming malware can be recognized and rejected, or suspicious emails
can be automatically stored in a ’junk’ email folder.
174 CHAPTER 6. THE INTERNET
• Outgoing traffic, emails containing sensitive information such as social
security numbers, financial account numbers, and credit card numbers, can
be automatically encrypted. Instructions are then sent to the legitimate
recipient on how to decrypt the information.
[Link] Personal cybersecurity
Cybersecurity can be improved by using smart personal habits:
• Use strong passwords on financial and academic sites.
• Change passwords often.
• Use different passwords on different sites.
• Do not leave sensitive information in public areas; do not send sensitive
information in the ’clear’ (i.e. unencrypted).
• Do not store passwords and other sensitive information on public comput-
ers.
• Do not open nor respoond to suspicious emails.
• Do not click on suspicious links.
[Link] Cryptographic cybersecurity
Other strategies for improving cybersecurity involve cryptographic algorithms
which use mathematical computations to ensure security. These include:
• Confidentiality: Communication can be encrypted by the sender of a mes-
sage, in such a way that it can be decrypted only by the intended recipient.
There are two fundamental types of encryption algorithms:
– Private key cryptography: The sender and the receiver share a com-
mon secret key. Only those who hold the key can decrypt messages
which were encrypted with that key.19
– Public key cryptography: Each user has a pair of keys - a public key
and a private key. The public key is known to everyone. The private
key is not shared with anyone, not even the intended recipient(s).
The two keys are mathematically related. When encrypting a mes-
sage to an intended recipient, the sender encrypts the message using
the recipient’s public key. The recipient decrypts the message with
his/her private key. Noone else can decrypt the message.20
19 How can the sender and recipient share a key safely? This is known as the key distribution
problem.
20 Public key cryptogaphy also provides a solution to the key distribution problem: A session
key is encrypted using a public key cryptosystem, and sent to a recipient, who then decrypts
it.
6.4. CYBERSECURITY 175
• Integrity: There is malware which is capable of intercepting messages
being transmitted on the internet. The malware can make changes to the
message and forward the altered message to the recipient, as though it
was coming directly from the sender. A mathematical hash function can
be used to thwart this attack, thus ensuring integrity. The input to a
hash function is a message consisting of an unlimited number of bits. The
output of the hash function is a bit sequence of fixed length, typically
about 200 bits, which has no apparent relation to the message.
1. The sender uses the hash function to produce a hash value:
hash(msg1) = h1
2. The sender sends the hash value, h1, to the recipient.
3. The recipient receives the hash value, h1.
4. The sender sends the message, msg1, to the recipient.
5. The recipient receives a message, msg2.
6. The recipient uses the message, msg2, as input to the hash function
hash(msg2) = h2
7. The result, h2, should be equal to h1. If not, the recipient does not
trust the message; malware has tampered with either the message or
the transmitted hash value.
• Authenticity: When communicating on the internet, how can we be sure
that the person/entity with whom we are communicating is really who
they claim to be? For example, when sending your credit card number to
Amazon, how do you know that it is really going to Amazon, and not some
other site controlled by malware? Public key cryptographic algorithms
provide a solution to this problem, using digital signatures.
1. A message can be signed by a sender using a public key algorithm,
shown here as Decr(msg):
sig = Decr(msg)
2. The message (either encrypted or sent in the clear) and the signature
are both sent to the recipient.
3. The recipient verifies the signature by encrypting the signature, shown
here as Encr(sig).
verify = Encr(sig) = Encr(Decr(msg)) = msg If necessary, the
recipient also decrypts the message.
4. If verify is not equal to msg, verification fails and the recipient as-
sumes that the message is not authentic, i.e. the sender is not who
he/she/it claims to be.21
21 Digital signatures are, in a sense, the reverse of usual practice. Instead of encrypting
plain text, the sender decrypts the plain text. Instead of decrypting cipher text, the recipient
encrypts cipher text.
176 CHAPTER 6. THE INTERNET
[Link] Open standards for cryptography
In the early days of cryptography, people sought security by keeping algorithms
secret. They believed that they were more secure if their enemies did not know
their encryption algorithms. Eventually, however, whether by means of statis-
tical methods, or other methods, our enemies will ’break’ our codes.22
Today we generally believe in the efficacy of publicly known algorithms, also
known as standard algorithms. Instead of hiding our algorithms, security is
obtained by
• Using sufficiently large keys so that a brute force attack will take too much
time, computationally
• Using public algorithms to ensure integrity
• Using public algorithms to ensure authenticity
• Generating a new session key for every communication session, and dis-
tributing those keys using a public key cryptosystem.
When algorithms are public, teams of researchers can collaborate to improve
their strength.
[Link] Certificate authorities
Returning to the problem of authenticity: How can we prove that we are really
who we claim to be? How can we prove our identity, cryptographically? In the
description of public key cryptograpy, above, what is to prevent some malware
from claiming to be Amazon, and providing a public key? A digital certificate
serves the same purpose as a passport or driver’s license. It can be used to
authenticate identity. A digital certificate for a person or entity typically consists
of:
• Identification information, such as full name
• Affiliated organization, such as the company for whom the person is work-
ing, or the educational institution which the person is attending
• Geographic location
• Expiration date
• A public key
The certificate itself does not ensure authenticity. However, there are organi-
zations which are in the business of ensuring the authenticity or their clients.
These organizations are known as certificate authorities. A certificate authority
can issue a digital certificate for an individual person. That certificate is signed
22 It has been said that every code can be broken.
6.4. CYBERSECURITY 177
by the certificate authority, which has its own public/private key pair. To ver-
ify a certificate, one merely verifies using the certificate authority’s public key.
Once the certificate has been verified, it is known that the public key it contains
can be trusted. Some examples of certificate authorities are (with their market
share, as of March 2020):23
• Comodo (41%)
• Symantec (30%)
• GoDaddy (13%)
6.4.2 Exercises
1. How can one check for a suspicious domain name in a web page link?
2. How can one check for an email with suspicious attachments?
3. What are some hardware devices that have built-in cybersecurity features?
4. What steps can an individual person take to improve their own cyberse-
curity?
5. Distinguish between infiltration and attack in cyberwarfare.
6. True or False: Robert Morris, a Cornell graduate student, was never tried
and convicted of Computer Fraud and Abuse, for bringing down the in-
ternet with a worm that he had created.
7. What is a phishing attack?
8. What is the name given to software on a local network which serves to
filter out incoming malware, and protect outgoing information?
9. Give some examples of weak passwords.
10. What kind of cryptographic algorithm is used for each of the following?
(a) Confidentiality
(b) Integrity
(c) Authenticity
11. True or False: We would be more secure if we did not share our crypto-
graphic algorithms with our enemies.
12. What information is usually included in a digital certificate?
23 Large certificate authorities have a clear advantage over smaller certificate authorities in
this business; as a result of of the large number of certificates issued, their level of trust is
higher.
Chapter 7
Fault Tolerance
As described in chapter 6, the internet continues to work 24/7 despite occasional
local outages or failures. This is known as fault tolerance. More generally, fault
tolerance is the capability of a digital system, whether it be a single computer,
a collection of connected devices, or a network, of recovering from the failure
of some component. The form of the recovery can vary, and thus the extent to
which a fault tolerant system is tolerant can vary:
• The system may avoid a complete termination, and provide information
about the location, cause, and nature of the failure.
• The system may continue to function, with limited capabilities, or with a
loss of the state and/or data from the component which failed.
• The system may make a complete recovery and continue to function as
though there had been no failure at all.
7.1 Fault tolerance in a single device
In many applications or environments a system failure is unacceptable. Some
examples are:
• A medical device used to control life-sustaining equipment in an intensive
care unit (ICU) or coronary care unit (CCU).
• Navigational and/or control devices in aircraft and space missions. NASA’s
early Gemini and Apollo missions were equipped with two identical com-
puters. At that time hardware faults were not very uncommon, and if one
computer failed, the other would take over. This is known as redundancy
and is still used today.
• Failure of a device in autonomous land vehicles can result in serious injury,
or worse.
178
7.2. FAULT TOLERANCE IN A NETWORK 179
• Certain military operations need to be fault tolerant, such as drone attacks
and missile detection systems for defense.
• Electric power grid control is done with computers which must be fault
tolerant to provide service 24/7.
• Electronic voting systems, if ever implememnted, need to be fault tolerant
to the extent that votes which have been cast are not lost if a component
fails.
7.2 Fault tolerance in a network
In order for a network to scale, it must be fault tolerant. This means that as
the size of the network increases, the probability of a fault somewhere in the
network also increases; if a fault in any one node were to cause the network to
fail, the network would not be fault tolerant.
The packet switching protocol of the internet is fault tolerant in the sense
that there are multiple routes for a packet to reach its destination, as shown in
Figure 6.4. In that diagram, if the node labeled c1 were to fail, the packets P0
and P4 could still reach the destination by going through nodes c4, c6, and c7.
Thus the reliability of the internet is improved by redundancy.
7.3 Redundancy
As described above fault tolerance is usually achieved by including some form
of redundancy into the system. This entails the addition of extra, non-essential
components, similar, or identical, to other components which can perform the
same function if needed. In the case of a local system, redundancy can be
achieved by including components which serve no other purpose than the repli-
cation of a critical component. Some examples of redundant systems are:
• The example of multiple computers on a mission to outer space, described
above, is one example.
• An autonomous vehicle may have overlapping sensors which can view the
surrounding terrain for pedestrians, other vehicles, or obstacles.
• In a network such as the internet, redundancy takes the form of multiple
paths from an origin to a destination, as shown in Figure 6.4.
• In the 1980’s a group of scientists at the University of California, Berkely,
developed a fault tolerant data storage system known as RAID (Redun-
dant Array of Inexpensive Disks).1 These storage devices are capable of
making automatic backup copies of all data in real time. Every time an
1 Other systems which predated RAID, such as the ‘Mirroring’ system of Tandem NonStop
Systems were similar to RAID.
180 CHAPTER 7. FAULT TOLERANCE
item of data is written to a primary disk, the same data item is automat-
ically written to a secondary disk. Thus the secondary disk contains an
identical copy of all data on the primary disk, and serves no other purpose
but to ensure that all the data survives if the primary disk should fail.
• All important transaction processing systems, such as airline reservations
and financial transactions of banks, as well as medical devices incorporate
some level of redunancy in order to tolerate a failure.
It is clear that redundancy increases the cost of a system, but in systems
where a failure is not acceptable, the cost is justified. Also, as the cost of
hardware continues to plummet, redundancy will be used more widely, and
future systems will be more fault tolerant.
7.4 Fault tolerance in software
Redundancy is used to implement fault tolerance primarily in hardware. If two
programs are identical, and the first program has a logic error (i.e. a bug), the
identical copy of that program will contain the same bug. Redundancy does not
appear to have any benefit for software.
However, there are features of C++, Java, Python, and other programming
languages, which allow the programmer to build in a form of fault tolerance
in software. A Java Exception is like a class, but it is designed to provide the
programmer with an easy way to intercept the flow of control when a run-time
error has occurred. The programmer can then handle, or recover from, the error
and allow processing to continue. The Java try statement is used to specify a
block of code that could conceivably fail, and the catch statement is used to
handle the exception and continue processing, rather than coming to a crashing
halt.
7.5 Exercises
1. List some fault tolerant systems other than the ones described here.
2. Does redundancy apply primarily to hardware, to software, or to both
hardware and software, equally?
3. What were some applications which made use of Tandem NonStop Com-
puters.
Chapter 8
Parallel and Distributed
Computing
In this chapter we explore tactics that have been employed to speed up com-
putations. In today’s world we are either dealing with large amounts of data,
or we are dealing with computational processes which require an exhorbitant
amount of time to complete. In either case we are always looking for ways to
make our computations more efficient, and terminate in a reasonable amount of
time. This chapter explores two common approaches to this problem:
• Parallel computing - The process of executing more than one task, or
more than part of a single task, simultaneously. This is typically done on
a single computer or an array of local computers.
• Distributed computing - The assignment of subtasks to different, au-
tonomous, users for mutual cooperation in the completion of a task. This
is typically done by several computers on a network.
8.1 Parallel computing
Parallel computing was introduced by the Burroughs Corporation in the early
1960’s. This term can relate to computations done at different levels:
• Instruction level parallelism attempts to execute different phases of in-
structions at the same time. A processor can do all of the following simul-
taniously:
– Execute an instruction in the CPU
– Fetch, from memory, the operands for the next instruction
– Fetch, from memory, the instruction after that one
181
182 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
Figure 8.1: The supercomputer known as IBM Blue Gen/P “Intrepid”, at Ar-
gonne National Laboratory
• Process level parallelism attempts to execute different parts of a program
simultaneously.
• System level parallelism attempts to execute different programs, or tasks,
simultaneously.1
• An array of local processors can be assigned different aspects of a problem,
to arrive at a quick solution. An example of a local array of processors is
shown in Figure 8.1.
• At a higher level, several independent computers on a network can be
assigne different (or the same) aspects of a problem. This is normally
called ‘distributed computing’, and will be discussed in the next section.
8.1.1 Run-time savings with parallelism
Parallel computing tasks can be broken up into 2 portions - a parallel portion
and a sequential portion. The efficiency of a parallel computing task is limited
by the sequential portion. Hence there is a limit to the number of parallel
processing units which can be used to increase efficiency.
Parallel computing assumes that 2 tasks are not dependent on each other. If
each task or step is dependent on the previous task or step then each step will
1 This is probably the origin of the term multitasking.
8.1. PARALLEL COMPUTING 183
P1 Time Needs
T1 5 -
T2 2 T1
T3 7 T2
T4 9 -
T5 8 T2
T6 5 T3
Figure 8.2: Diagram of six tasks executed sequentially by a single processor,
P1; total time required is 36. Some tasks need the results of prior tasks.
have to wait for the previous step to complete before starting itself. This would
instead imply sequential computing. Thus, the efficiency of parallel computing
is limited by the sequential portion of the task.
The speedup rate of a parallel solution is measured in the time it takes to
complete the task sequentially divided by the time it takes to complete the task
when done in parallel:
time to complete the task sequentially
speedup rate = time to complete the task in parallel
For example if the time it takes to complete a task in sequential mode is 70
seconds and the time it takes to complete the task in parallel is 14 seconds then
the speed up rate is:
speedup rate = 70/14
= 5
Note the speedup rate is a ratio.
At any of the levels mentioned above, the use of parallelism will generally
result in smaller execution times. However, there are limitations on the use of
parallelism. For example, at the task level, if a task, T1, requires data produced
by another task, T2, then T1 and T2 cannot be executed simultaneously. T2
must complete before task T1 can begin.
Also, suppose the two tasks have side effects, such as producing output. If
they are executed simultaneously, there is no guarantee that they will produce
the same output each time they are invoked; they are not independent tasks.
184 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
P1 Time Needs P2 Time Needs P3 Time Needs
T1 5 -
T4 9 -
T2 2 T1
T3 7 T2 T5 8 T2
T6 5 T3
Figure 8.3: Diagram of the same six tasks executed in parallel by three proces-
sors, P1, P2, P3; total time required is 19. Some tasks need the results of prior
tasks.
As an example, we examine six tasks executed sequentially on one processor2
in Figure 8.2. Each of the tasks has a running time (in some fixed unit of time).
Each task also may need results of computations from another task (shown in
the Needs column of the diagram.3 Tasks T1 and T4 do not need data produced
by any of the other tasks. Because there is only one processor, only one task
can execute at a time; i.e. the execution is strictyly sequential, with no parallel
execution. The total time required for all 6 tasks to run is 36 time units.
Now consider the same example, with 3 processors, each of which is capable
of executing a task simultaneously with the other two processors. Figure 8.3
shows a diagram in which the same six tasks are executed. We see that tasks
T1 and T4 can execute at the same time because they do not need to wait
for another task to terminate. After task T2 terminates, task T5 can start
executing on processor P3. After task T2 terminates, tasks T3 and T6 can
execute. The six tasks can be completed in only 5+2+7+5 = 19 time units, a
savings of almost 50% over the sequential model.
These diagrams are intended to be general in nature. The parallelism could
be at the instruction level, the task level, or the system level.
8.1.2 Parallelism in personal computers
Today’s personal computers have several core processors, each of which is capa-
ble of executing a sequence of machine language instructions. One of the most
difficult aspects of designing compilers4 and operating systems5 involves making
use of more than one core to achieve the run-time advantages of parallelism.
Many programming languages have features which allow the programmer to
2 Processor is a general term for the hardware or software responsible for execution of a
task.
3 We assume that the needed data is not available until the task terminates.
4 A compiler is the software which translates a program from a high level language to
machine language.
5 An operating system is the software which manages the computer’s resources. Windows,
Linux, and MacOS are examples of operating systems.
8.1. PARALLEL COMPUTING 185
0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9
+ + + + + + + + + + Add
0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9
Figure 8.4: Left diagram: single data stream; a loop is needed to add two
vectors. Right diagram: multiple data streams; two vectors are added with a
single Add operation.
specify explicitly which sections of a program can run in parallel. For example,
Java Threads allow the programmer to specify subprograms, or blocks of code,
which can be executed independently, allowing the operating system to schedule
them for simultaneous execution with other Threads.
8.1.3 Instruction stream and data stream parallelism
There are two kinds of parallelism which can be made available by a program-
ming language compiler and/or operating system:
• Instruction stream parallelism corresponds to what was described in Fig-
ure 8.3. Separate sequences of instructions are executed simultaneously
on separate processors.
• Data stream parallelism involves a vector 6 processing capability. In most
programming languages, if we wish to add the values in two arrays, we
need to code a loop, as described in chapter5. However, some languages,
such as Fortran 907 introduced vector operations, in which arrays could
be treated as primitive types. Thus, to add two arrays, no loop is needed,
but a single operation such as v1 + v2 would specify the addition of cor-
responding positions in the two arrays, v1 and v2. Fortan 90 compilers for
supercomputers, such as those made by Cray would then generate code to
specify that the the addition be done in parallel.
These two types of parallelism brought into use the terminology, stream to
describe parallelism (or lack thereof) of either of the two types described above.
If there is no parallelism, it has a single stream, and if there is parallelism, it
has multiple streams.
To contrast multiple data streams with single data streams, we show a dia-
gram in Figure 8.4 in which a single data stream architecture is shown on the
left (a loop is used to add the elements of a vector), and a multiple data stream
architecture is shown on the right (a single Add operation adds the two vectors).
6 Vector is another term for array or list.
7 Fortran was one of the first programming languages and is still used today, primarily for
scientific or engineering applications.
186 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
Task1 Task1 Task2
Load .. Load .. Load ..
Add .. Add .. Mult ..
Mult .. Mult .. Sub ..
Store .. Store .. Store ..
Task2
Load ..
Mult ..
Sub ..
Store ..
Figure 8.5: Left diagram: a single instruction stream; tasks are executed se-
quentially by a single processor. Right diagram: multiple instruction streams;
two tasks are executed at the same time on different processors.
To contrast multiple instruction streams with single instruction streams, we
show a diagram in Figure 8.5 in which a single instruction stream architecture
is shown on the left (two tasks are executed sequentially by a single processor),
and a multiple data stream architecture is shown on the right (two tasks are
executed at the same time by two processors).
Thus we have four ways of specifying parallelism:
• A system which executes only one sequence of instructions at a time, and
does not have a vector processor is classified as Single Instruction stream,
Single Data stream (SISD). A diagram of the SISD architecture is shown
in Figure 8.6.
• A system which executes only one sequence of instructions at a time, but
does have a vector processor is classified as Single Instruction stream,
Multiple Data stream (SIMD). A diagram of the SIMD architecture is
shown in Figure 8.7.
• A system which executes several sequences of instructions simultaneously,
but does not have a vector processor is classified as Multiple Instruction
stream, Single Data stream (MISD). A diagram of the MISD architecture
is shown in Figure 8.8.
• A system which executes several sequences of instructions simultaneously,
and also has a vector processor is classified as Multiple Instruction stream,
8.1. PARALLEL COMPUTING 187
Task1
Load ..
Add ..
Mult .. 0 1 2 3 4 5 6 7 8 9
Store ..
+ + + + + + + + + +
0 1 2 3 4 5 6 7 8 9
Task2
Load ..
Mult ..
Sub ..
Store ..
Figure 8.6: Diagram of an SISD architecture; single instruction stream, single
data stream
Task1
Load ..
Add ..
Mult .. 0 1 2 3 4 5 6 7 8 9
Store ..
Add
0 1 2 3 4 5 6 7 8 9
Task2
Load ..
Mult ..
Sub ..
Store ..
Figure 8.7: Diagram of an SIMD architecture; single instruction stream, multi-
ple data streams
188 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
Task1 Task2
0 1 2 3 4 5 6 7 8 9
Load .. Load ..
+ + + + + + + + + +
Add .. Mult ..
Mult .. Sub ..
Store .. Store .. 0 1 2 3 4 5 6 7 8 9
Figure 8.8: Diagram of an MISD architecture; multiple instruction streams,
single data stream
Task1 Task2
0 1 2 3 4 5 6 7 8 9
Load .. Load ..
Add .. Mult .. Add
Mult .. Sub ..
Store .. Store .. 0 1 2 3 4 5 6 7 8 9
Figure 8.9: Diagram of an MIMD architecture; multiple instruction streams,
multiple data stream
Multiple Data stream (MIMD). A diagram of the MIMD architecture is
shown in Figure 8.9.
This classification scheme, known as Flynn’s Taxonomy, defined in 1966 by
Michael J. Flynn, is still used today.
8.1.4 Exercises
1. Which of the following tasks can be executed in parallel (i.e. simultane-
ously on different core processors)?
(a) Task T1: Uses data provided by the user on the keyboard, to establish
the current local ambient temperature, air pressure, wind velocity,
and humidity.
(b) Task T2: Uses data obtained from the internet to store the tem-
perature, air pressure, wind velocity, and humidity at surrounding
locations.
(c) Task T3: Uses the data obtained from tasks T1 and T2 to predict the
local ambient temperature, air pressure, wind velocity, and humidity
at some time in the future.
8.2. DISTRIBUTED COMPUTING 189
2. Refer to Figure 8.2. How much time would be required to execute the six
tasks shown, in parallel, if only two processors were available?
3. Use Flynn’s taxonomy to identify each of the following as either SISD,
SIMD, MISD, or MIMD.
(a) A personal computer with one core, which is not a vector processor.
(b) A personal computer with eight cores, none of which are vector pro-
cessors.
(c) A personal scientific workstation with one core that is a vector pro-
cessor.
(d) A supercomputer with many CPUs, each of which has a vector pro-
cessor.
8.2 Distributed Computing
For a more detailed introduction to distributed computing, see The Essence of
Distributed Systems by Joel Crichlow, Prentice-Hall.
8.2.1 Client-server terminology
In computing systems a module (hardware of software) which provides a service
to other modules is known as a server. The modules which make use of that
service are known as clients. For example, when you use your computer to
access [Link] for a purchase, your computer (actually the browser on
your computer) is the client, and Amazon’s computer systems are the server.
8.2.2 Distributed computing and parallel computing
Closely related to parallel computing is the area of distributed computing which
involves the parallel solution of problems with many clients or users. Distributed
computing can be helpful in two primary ways:
• Your computer does not have enough memory to solve a problem. The
solution is feasible only if several computers are used, each contributing
to the total memory required to solve the problem.
• The solution to the problem takes so long that it can be solved only if
several computers attempt the solution at the same time. This is feasible
only if the problem lends itself to a separation of the search space for a
solution, so that no two computers are working on the same aspect of the
problem.
Some communication among the participating computer systems will be nec-
essary; thus distributed computing normally implies the use of a network. How-
ever, if several clients are on a network, this does not necessarily mean they are
190 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
I need Plenty of
Almost
more resources
finished
resources available
Client 1 Client 2 Client 3
Task 1 Task 2 Idle
Network
Figure 8.10: A non-distributed system, with three clients on the network
using distributed computing. In Figure 8.10 three clients are on the network.
The first client is having trouble solving a problem; it lacks the necessary re-
sources, such as memory, storage, CPU time, etc. The second client is working
on a relatively easy problem and is almost finished. The third client is currently
not working on any problems, and has lots of resources available. Figure 8.10 is
NOT an example of distributed computing.
In Figure 8.11 all three clients are working on Task 1, in addition to whatever
else they need to do. All three clients are sharing the burden by contributing
resources to the solution of a difficult problem.
8.2.3 Types of distributed systems and examples
[Link] Distributed computation
When a problem solution involves extensive calculations, or searching for solu-
tions, the problem can be solved faster when several computers work on it in
parallel. In such cases the calculations, or search space, must be separated into
several components, with one or more components assigned to each of the par-
ticipating computers. These components should not overlap in their scope, and
to be effective, the aggregate of all the components should be equal to the total
search space of the problem to yield a solution. Some examples of distributed
computation are:
• The search for extra-terristrial intelligence (SETI) involves searching the
sky for radio signals which may have originated from intelligent beings
on other planets. These signals can be received by large radio telescopes
8.2. DISTRIBUTED COMPUTING 191
Almost Almost Almost
finished finished finished
Client 1 Client 2 Client 3
Task 2
Task 1 Task 1
Task 1
Network
Figure 8.11: A distributed system, with three clients on the network, sharing
the burden of Task 1
such as the one operated by NASA at Arecibo, Puerto Rico. The prob-
lem is that there is so much information (mostly random noise) that a
single computer does not have the speed to search for patterns that could
be from intelligent life. In 1999 a distributed computing project known
as SETI@home was initiated at the University of California, Berkeley.
Software was developed which enabled volunteers from all over the world
to offer time on their personal computers to search the data collected at
Arecibo. Some 200,000 home computers were ultimately used; each of
these computers each searched a small section of the sky for ‘intelligent’
signals. They did this while otherwise idle, and also in parallel with other
tasks that the owners were running. The project was temporarily put
on hold in 2020 when the Arecibo radio telescope failed due to a struc-
tural collapse. SETI@home was one of the first large scale distributed
computing systems to use the internet.
• Bitcoin is the first successful, and most popular, crypto-currency. It is a
digital virtual currency (no physical coins, nor paper, are used) which relies
on cryptographic algorithms for security and verification of transactions.
Bitcoin is a peer-to-peer distributed system based on the internet; the
software is free and open source. An important component of the Bitcoin
sofware is known as mining software, which involves rewarding a user with
a new Bitcoin for solving a computational problem. The difficulty of the
problem is such that a miner succeeds in solving it about once every 10
192 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
Client Client Client
File File File
System System System
Network
Disk
Server Storage
Figure 8.12: Diagram of a distributed file system
minutes. Since a Bitcoin is so valuable,8 people interested in mining form
mining pools to solve the problem in a cooperative way, and sharing the
reward among those who contributed to the problem solution, if successful.
This works because the search space can be easily partitioned into non-
overlapping components.
[Link] Distributed file systems
Data stored in non-volatile devices such as disks or flash memory are critical
to most computing applications. In cases where there is so much data that one
computing system cannot store all of it, a distributed file system is useful. Also
when an application needs to run at several different locations it may be more
cost effective to store a subset of the data set at each of the local sites, and
make all the data available at all sites through a network.
An example of a distributed file system, developed at Sun Microsystems (now
Oracle) is Network File System (NFS), shown in Figure 8.12. Users (i.e. clients)
of NFS can enter and retrieve an entire file, or a portion of a file at their local
workstations. When the desired data resides on another client’s workstation,
the NFS software seamlessly provides the data through the network.
[Link] Distributed databases
A database is a collection of files with structure, or organization, imposed to fa-
cilitate entry, retrieval, updates, and relevant statistics of a data set. A database
management system (DBMS) is software which includes a user interface and
functionality to work with a database.
When working with large databases, or when many clients will be accessing
the database, it will be advantageous to distribute the work among several
clients. This is a distributed database. Each client would typically store some
portion of the complete database. If a client needs to update or access its own
portion of the database, the network is not involved. However, when a client
attempts to access a portion stored at a different client, the distributed database
8 According to [Link] one Bitcoin is worth over $US 34,000, at the time of that this
chapter was written. The value of a Bitcoin fluctuates greatly due to speculation.
8.2. DISTRIBUTED COMPUTING 193
management system will seamlessly provide this access to the client. The users
at each client system should not need to see a distinction between local access
and network access to the data.
Some distributed database systems maintain a complete version of the database
at a central host site. When a client makes an update, it is stored on a client’s
system, and also on the central site.
Examples of distributed databases are:
• An airline reservation system. Changes are made to the database
– by customers, on the airline’s web site
– by airline agents at multiple airport check-in or gate stations
– by agents at a phone call center
– by the airline’s central flight scheduling office
Each of these clients is sharing the burden of maintaining an accurate and
consistent representation of reservations on the airline’s flights.
• The account records of a bank or savings and loan association
• The inventory, order, accounting for a retailer with many outlet stores and
inventory sites
• The inventory, order, accounting for a super retailer, such as Amazon.
Amazon also uses search techniques to locate items not directly available
in its own inventory.
[Link] Distributed real-time systems
When a bank updates interest holdings on all savings accounts, this is gener-
ally done overnight when transactions are not being processed. Whether the
process takes 5 minutes or 5 hours is not a concern. This kind of process,
sometimes called batch processing is NOT done in ‘real’ time. However, when a
computational task produces a result, it is sometimes critical that the result be
produced within certain time constraints. When events or components in the
physical world need the results of the process within a very limited time con-
straint, we say the system providing the results is a real-time system. Examples
of real-time systems are:
• A robot on an automobile assembly line needs to form an image of the
component being assembled, process that image, and assemble the com-
ponent before the next component to be assembled arrives on a conveyor
belt.
• An autonomous automobile has sensors which have images of the sur-
rounding roadway. Those images need to be processed to determine
whether there are pedestriand, obstacles, or other vehicles nearby. This
image processing must be done within time constraints, depending on the
speed of the automobile.
194 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
• Many game-playing systems must perform real-time computations to sim-
ulate a human opponent.
• Flight simulators need to respond to the user’s input in real-time, to sim-
ulate real conditions.
[Link] Distributed multimedia systems
In chapter 2 we discussed the digital representation of sound, images, and video.
• A sound consists of numbers representing changes in air pressure (i.e.
pressure waves). A one minute, uncompressed sound clip requires about
10M bytes of storage.
• An image consists of pixels, many numbers each of which represents the
color of a tiny section of the image. The Samsung Galaxy Note 5 smart
phone displays 1440x2560 pixel values. Thus a single uncompressed image
on that phone would consist of 3,686,400 numbers, requiring over 12M
bytes of memory.
• A typical video clip consists of about 30 frames, or images, per second.
Using this information we estimate that a 10 minute uncompressed video clip
requires 120M bytes for the sound, and 12M * 30 * 60 * 10 = 216G bytes for
the images! Clearly compression of this data is necessary for anyone wishing to
store video clips. Streaming services such as Netflix make extensive use of data
compression.
Even with compression, multimedia content such as movies, video clips, and
podcasts, requires a lot of storage. Multimedia servers, such as the ones op-
erated by Netflix, YouTube, Hulu, and Peacock not only have a huge storage
requirement, but must also respond to many simultaneous requests for video
content. These servers are often called streaming servers because they send the
information in separate sections. The client then decompresses a section while
the previous section is being viewed. The entire file is never downloaded to the
client.
Because of the huge storage requirements and concurrent service requests,
multimedia systems are a prime candidate for distributed processing. A service
such as Netflix would have multiple servers, each with its own storage (disk)
media. When a server receives a request through the server network, it will
respond directly if it is storing the requested item. If not, it will forward the
request automatically to the appropriate server. A diagram of a multimedia
server system is shown in Figure 8.13. In that diagram the distributed system
consists of three servers, each of which has its own storage unit with several
disks. These servers are networked separately from the internet.
[Link] Distributed operating systems
An operating system is software installed on every computer, without which the
hardware is not capable of anything. The operating system is responsible for
8.2. DISTRIBUTED COMPUTING 195
Client 1 Client 2 Client 3
Internet
Server
Network
Server 1 Server 2 Server 3
Disk Disk Disk
Disk Disk Disk
Disk Disk Disk
Disk
Figure 8.13: A distributed multimedia system with three servers and its own
network, storing items such as movies, video clips, and podcasts stored in mul-
tiple storage units
196 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
managing the computer’s resources:
• It loads programs to be executed from the disk to main memory.
• It schedules processes executing concurrently for execution by CPU cores.
• It manages memory usage which involves:
– allocation and deallocation of memory to/from executing processes
– making efficient use of memory, or expanding addressable memory
using high-speed cache memory and virtual memory on secondary
storage
• It provides access to files and directories (i.e. folders) on secondary storage
(e.g. disk)
• It allows for input to and output from peripheral devices, such as key-
boards, monitors, USB ports, etc.
• It provides an interface for interaction with a network.
• It provides an interface for interaction with a user (often known as a shell ).
Some examples of operating systems are:
• Windows
• MacOS
• iOS (for Apple smart phones)
• Android (for smart phones other than Apple)
• Unix (or Linux)
Each operating system has its own user interface (also known as a shell ).
Also software written to run on a computer with a given operating system will
not run under any other operating system.
A distributed operating system provides the user with the capabilites of
several different operating systems over a network. A user with a PC running
Windows would be able to run programs designed to run under MacOS if some
other user on the distributed operating system was using MacOS on an Apple
Macintosh computer. Moreover, execution of the program would be seamless,
or transparent, to the user; the user would not be aware that the program is
actually executing on another computer. A diagram of a distributed operating
system is shown in Figure 8.14.
In Figure 8.14 there are three clients:
• The client at the top is running MacOS, with a bash shell for user com-
mands.
8.2. DISTRIBUTED COMPUTING 197
Application
processes
bash
shell
MacOS
Network
Application Application
processes processes
DOS cmd csh
shell shell
Windows Linux
Figure 8.14: A distributed operating system with three clients, running different
operating systems
• The client at the lower left is running Windows, with a DOS command
shell for user commands.
• The client at the lower right is running Linux, with a shell known as csh
for user commands.
Any one of the three clients can execute a program for any of these three oper-
ating systems. Moreover, this is transparent, meaning that the user is unaware
that the program is executing on a different computer.
8.2.4 Exercises
1. I am using my desktop iMac at home to access my university’s Unix sys-
tem, named elvis, which allows many simultaneous users.
(a) Is my iMac a client or a server?
(b) Is elvis a client or a server?
2. What are the six kinds of distributed computing systems described in this
section?
3. Describe how the Bitcoin mining problem can be attempted by several
cooperating clients.
198 CHAPTER 8. PARALLEL AND DISTRIBUTED COMPUTING
4. In what sense is a distributed computing system fault-tolerant?
5. In a multi-media system, when is a file decompressed?
(a) When it is recorded
(b) When it is stored on the server’s storage system
(c) When it is requested by a client
(d) Prior to downloading or streaming it to a client
(e) When the client has received at least the first section and wishes to
convert it to sound and images.
Chapter 9
Global Impact
Computation has changed the way people think, work, live, and play. Computa-
tion in today’s world is pervasive, and is becoming increasingly so - computing
devices are everywhere; often we are not even aware of their presence. In this
chapter we expose ways in which computation has fostered or improved com-
munication, innovation, and personal cognition. We will also examine computa-
tional artifacts which can be harmful to individuals, or to our society. Finally,
we examine the ways in which economics, society, and culture have driven de-
velopments in the field computation.
9.1 Communication, Interaction, and Cognition
Today it is easy for people to communicate with others all over the world; as
recently as 1980, this was not the case. Long distance telephone calls were
expensive, written communication took days in transit, and live video commu-
nication among individuals was unheard of. Today these are things which are
taken for granted. As a result the way we think and solve problems has been
altered.
9.1.1 Computing innovations
[Link] Written communication
Today we are using digital devices to send written communication more than
ever, with the following artifacts:
• Email - was the application which was first to have an impact on writ-
ten communications, in the late 1970’s.1 Today, with digitally encoded
attachments, much more than text can be sent with email.
1 The author sent his first email in 1973, albeit local email on a mainframe computer.
199
200 CHAPTER 9. GLOBAL IMPACT
• SMS - Short Message Service, commonly known as “texting”, was origi-
nally implemented to allow for cheaper communication via mobile phones.
There are far fewer bits in 10-20 ASCII characters, than in compressed
audio. This enabled the carriers to accommodate more usage per unit of
time, and pass the savings on to customers in a very competitive busi-
ness. As users became accustomed to this form of communication, usage
eventually exceeded audio communication.2
• Chat - is a term usually used to describe a world-wide web application
which allows two or more users to enter text in real time. Each user
can see the other user(s)’ text as those texts are entered. Chat is often
used by corporations who need to respond to clients’ requests for help or
information; chat enables the corporation to respond to more requests per
day than would a voice phone system.
[Link] Video communication
Bandwidth is a measure of the quantity of information which can be transmitted
over a communications channel per unit of time. Bandwidth is usually expressed
as bits per second. Because our bandwidth has increased in recent years,3 large
bit-sequences, such as those encompassing voice, images, and video, can now be
sent in real time over the internet. Several applications which allow for virtual
conferencing have been created:
• Skype - Audio and video only
• Facetime - Audio and video only
• Zoom - Audio, video, application sharing, screen sharing
• Cisco Webex - Audio, video, application sharing, breakout rooms for pri-
vate sessions, and many other features
• Microsoft Team - Audio, video, application sharing, breakout rooms for
private sessions, and many other features
• Learning Management Systems, such as Blackboard Collaborate - Audio,
video, application sharing, breakout rooms for private sessions
[Link] Social media
So-called social media are internet-based services which allow users to interact
with others in a way that was previously less convenient. Social media allow
people to connect with other people with whom they may have common inter-
ests. Social media have evolved to include audio, images, and video, in addition
2 SMS was the most widely used data application at the end of 2010, with an estimated
3.5 billion active users, or about 80% of all mobile subscribers (Source: [Link], March
2020)
3 Fiber-optic technology, and undersea cables are largely responsible for this.
9.1. COMMUNICATION, INTERACTION, AND COGNITION 201
to text. Because of their popularity, and because they deal with dense informa-
tion, such as video clips, social media organizations have a need for extensive
data storage capabilities, high bandwidth communication channels, and tech-
nical staff. These are generally funded by advertising. Some common social
media sites, in order of popularity are:4
• Facebook - Founded by Mark Zuckerburg, a student at Harvard University
in 2003, Facebook was based on a pamphlet distributed to all undergradu-
ate students, showing pictures and some limited biographical information
of all their classmates. Zuckerburg created a digital version of this pam-
phlet, which he eventually made available to other Ivy League universities,
then other universities, and high school students. Finally in 2006 it was
made publicly available. Registered users can post text, photographs and
multimedia; with various levels of accessibility. Despite controversial is-
sues (described below), Facebook was the most downloaded mobile app of
the decade 2010-2019, globally.
• YouTube - A video-sharing platform created by former PayPal employees
in 2005. Users are able to view, rate, share, and comment on video clips.
YouTube was purchased by Google in 2006 for US$1.65 billion.
• WhatsApp - A text and voice messaging service. For voice it uses Voice
Over IP (VoIP) technology to digitize audio, and transmit via the inter-
net to another WhatsApp client thus bypassing the traditional telephone
network system. WhatsApp is available on computers as well as smart
phones. WhatsApp was acquired by Facebook in 2014 for US$19 billion.
• Facebook Messenger - A text messaging application. Facebook messag-
ing is a descendant of Facebook Chat, which in turn is a descendant of
America Online (AOL) Instant Message (IM). Messenger is now available
on computers as well as tablets and smart phones. Users can also attach
digital files containing photos, audio clips, etc.
• WeChat - A Chinese version of Messenger.
• Instagram - A photo and video sharing service. Users can upload photo
and video files, to be shared publicly, or to restricted access lists. Users can
rate other users posts (like) and follow other users. As of 2020 the most
followed person is footballer Cristiano Ronaldo (210 million followers), and
the most followed woman is singer Ariana Grande (179 million followers).
Instagram was acquired by Facebook in 2012.
• Twitter - An internet-based service which allows users to post messages,
known as “tweets”. Others can view the tweets, and follow particular
users, as with Instagram. Twitter was known as the ‘SMS of the Internet’
because it was designed to be used with short text messages for inexpensive
and efficient transmissions. Twitter is banned in Iran, China, and North
4 Source: [Link], March 2020
202 CHAPTER 9. GLOBAL IMPACT
Korea; it has been intermittenly blocked in numerous countries including
Eqypt, Iraq, Turkey, and Venezuela.
• LinkedIn - A business and employment-oriented service. LinkedIn is pri-
marily used for professional ‘networking’5 As of 2015, most of the com-
pany’s revenue came from selling access to information about its members.
In 2016 LinkedIn was purchased by Microsoft.
[Link] Cloud Computing
Since the early 1980’s people have been using applications on their personal
computers to perform tasks such as word processing, spreadsheets, graphic de-
sign, etc. These applications were programs, with a separate copy on each
individual’s computer6
As the internet developed, and bandwidth improved, it became clear that
these applications could reside at one central computer. This enabled users
to produce word processing documents and spreadsheets without installing the
software on their own computers. The documents themselves could also be
stored on the central computer. Because we visualize the software and data at
some distant location, perhaps upward, this became known as cloud computing.
Google has been offering cloud computing services, allowing for free usage of
office applications (Google G suite), free storage of data (Google Docs), and free
conferencing software (Google Hangout) in addition to the company’s traditional
search engine. Amazon is also a major player in cloud computing with its
offering of Amazon Web Services (AWS).
Today the phrase ‘cloud’ refers to anything which is at a remote central
location, which gives us a convenient way of remembering the meanings of two
new words:
• Upload: Transfer of data or a document from a local computer to the
central server, i.e. up to the cloud
• Download: Transfer of data or a document from a central server to a local
computer, i.e. down from the cloud
[Link] Problem solution and dissemination of results
Prior to the advent of the internet research and collaboration among people
working in the same area of research took place at a relatively slow pace. An
individual would conduct research, submit a paper to a journal, wait for the
review process (several months), wait for the paper to be published if it was
accepted (several more months) only to discover that someone published similar
or contradictory information in another journal.
5 The author notes the common usage of ‘networking’ to mean the inter-communication
of a group of people for the purpose of discovering or filling employment opportunities or
establishing business relationships. It really has nothing to do with computer networks.
6 The Microsoft corporation built an empire by selling this software, packaged with its
Windows operating system.
9.1. COMMUNICATION, INTERACTION, AND COGNITION 203
Today, though the review process still takes time, the publication and dis-
semination of results is much faster. Digital versions of the journals are obtained
by libraries and individuals all over the world.
In addition researches at geographically separated locations can collaborate
on research, particularly if the research is computing-related.
For problems which require a lot of computing power, the problem can be
developed as a distributed application, meaning that several computers can be
working on the same problem at the same time, and coordinate their efforts. A
few examples of this kind of problem solution are:
• SETI At Home: Search for Extraterrestrial Intelligence involves the pro-
cessing of radio signals from distant galaxies to determine whether any
patterns can be extracted from the usual noise emanating from the skies,
as detected by radio telescopes. This requires much computing power.
The SETI At Home project enabled anyone with a computer to download
the software and take part in this project, without duplicating the efforts
made by others.
• Bitcoin mining: Bitcoin is a cryptocurrency based on a peer-to-peer dis-
tributed network. There is no central repository for Bitcoin. To ‘mine’
a Bitcoin, one needs to download the software, and use it to solve a
computing-intensive problem. The first miner to solve the problem gets
a few newly ‘minted’ Bitcoins, in addition to other monetary rewards.7
Because of the intense competition involved in mining, miners often col-
laborate in ‘mining pools’ where all miners in the pool work to solve the
problem. If successful, all the miners in the pool are rewarded in pro-
portion to the amount of computational work that they provided to the
effort.
• DNA sequencing is the process of determining the nucleic acid sequence
in a molecule of DNA for a particular species. There are four kinds of nu-
cleotides in the sequence, denoted ad C,T,A,G. The number of nucleotides
in one molecule can be in the millions, and the computation time involved
in discovering the sequence is enormous. By assigning separate sections of
the molecule, or separate genes, to various researchers, the DNA sequenc-
ing problem has been solved for many species, including humans.
[Link] Access to public data
Access to publicly available data has enabled the solution of many important
problems. The ability to store large quantities of data, the ability to trans-
mit these data efficiently, and the connectivity of the internet have all had a
significant impact on our lives.
7 As of April 2020, one Bitcoin was worth about US$6,750
204 CHAPTER 9. GLOBAL IMPACT
• The National Weather Service maintains a database of atmospheric con-
ditions throughout the US.8 Using this data, the weather service is able to
make fairly accurate weather forecasts, specific to local geographic loca-
tions. Weather forecasting has become extremely important in our econ-
omy, affecting transportation, commerce, agriculture, and military con-
cerns. The data, as well as the forecasts, are publicly available.
• Census data, updated every 10 years, allows us to plan for infrastructure
improvements: roads, bridges, housing, schools, etc.
• The coronavirus COVID-19 pandemic of 2020 would have been worse if
governments had not made available information on the locations of the
confirmed cases. Using this information, the virus was, to a small extent,
contained to several areas, while the search for treatments and vaccinations
took place.
After vaccines were developed, the process of vaccine acquisition and
delivery was developed using public information, such as web sites and
databases.
[Link] Value of search trends
When people need to find information, they usually go to the internet, and use
a search engine, such as Google to find what they need. Google has profited
immensely by maintaining a database of what people search for. This is valu-
able information, for marketing purposes, and Google sells this information to
interested companies.9 For example, if you are in the business of selling real
estate, it would be very helpful to know whether people are currently searching
for single-family homes, duplexes, condominiums, or apartments, and in which
geographic locations they have an interest.
[Link] Global Positioning System
Originated by the military, the Global Positioning System (GPS) consists of sev-
eral satellites, some of which are in geosynchronous orbit10 around the earth.
Using signals from these satellites, a digital device can determine its own loca-
tion, including lattitude, longitude, and altitude above sea level. This has had
an enormous impact on navigation, not only for individual travelers, but also
for air traffic, seafaring ships, and military units.
[Link] Networks of sensors
Inexpensive digital devices can sense local information, and make that informa-
tion available on the internet. These sensors are part of the internet of things:
8 By coordinating with other countries, and by using data from satellites, this database is
now worldwide.
9 Google also profits by selling advertising opportunities targeting specific searches.
10 A geosynchronous orbit is one which has a period of one day; thus the satellite appears
to be stationary to an observer on the earth.
9.1. COMMUNICATION, INTERACTION, AND COGNITION 205
• Networks of weather balloons and satellites sense atmospheric conditions
to facilitate weather information and forecasting.
• Satellites and toll road sensors provide information on traffic patterns and
problems in real time. In the near future, GPS devices in vehicles will
enable the vehicles to communicate with each other for similar purposes.
• Vehicles can now sense the presence of hazards and other vehicles, warning
the driver and/or averting danger automatically.
• Digital chips are now embedded in bridges to sense strain or movements
of the bridge under the load of traffic. This information can be forwarded
to a central site, alerting engineers of a forthcoming bridge failure.
• Agricultural products can be packaged with digital devices which track
their location, and which coordinate with a central database. If a product
is found to be tainted in some way, the source of the problem can be
tracked to determine which products need to be removed from the shelves
in stores.
[Link] Built-in smarts
With digital devices, certain intelligence can be incorporated in buildings, roads,
and transportation networks. A smart building would know whether its foun-
dation is sinking, whether its roof is defective, whether its elevator systems are
operating efficiently, etc. Smart roads can sense traffic patterns and alert drivers
of traffic jams. Traffic information is then stored in a centralized database, and
is updated in real time.
[Link] Human assistive technologies
Digital devices can be used to augment human capabilities:
• Hand amputees can now have prosthetics with electrical nerve attach-
ments, giving the patient sensory information similar to what they would
receive from an actual hand. The prosthetics can also receive nerve signals
from the patient’s brain to effect the grasping of objects and other hand
movements.
• Leg and foot amputees can now have prosthetics which are more than just
stabilizers. They can receive and send nerve signals to facilitate walking.
• Hearing impaired people have been using digital hearing aids for several
years. Digital technology allows them to hide noise and amplify important
auditory signals. Newer technology for the totally deaf connects directly
to auditory nerves, enabling them to learn to hear over time.
• Digital gloves permit those who cannot speak to communicate using hand
movements.
206 CHAPTER 9. GLOBAL IMPACT
• Virtual reality systems consist of a digital image viewer worn over the
eyes and headphones on the ears. These systems permit an individual to
experience a simulated environment for training or educational purposes.
[Link] Impact on society
The internet has impacted several aspects of our society and our daily lives:
• E-commerce is the name given to the capability of selling and purchasing
items using the internet. E-commerce is the opposite of bricks-and-mortar,
a more traditional business model in which the customer visits a store to
select purchases. Most large retailers use a combination of the E-commerce
and brick-and-mortar business models.
• Health care has been affected in many ways. Large health-care conglom-
erates now consist of a network of hospitals, doctors offices, rehabilitation
centers, etc. The process of scheduling appointments, obtaining referrals,
filling prescriptions, and communication among health care providers is
now done on the internet. Health insurance, including Medicare and Med-
icaid, claims and transactions are now done on the internet.
• Today when people need information on almost any subject, they use an
online search engine, such as Google. Where can I get a hoagie? How
do I get to my cousin’s house? How can I reset my digital watch (I lost
the instruction paper years ago)? What can you tell me about Zachary
Taylor (I’m writing a term paper)?11 The answers to all these questions,
and more, can be found on the internet.
• The internet has become a source of entertainment for many people. TV
shows, movies, etc. are now streamed 12 on the internet. Companies such
as Netflix have succeeded whereas companies such as Blockbuster have
failed.13 The internet has also been a source of entertainment in the form
of game-playing with many players, and sports gambling14
• Online learning has gained popularity in recent years.
– Most universities now offer a large segment of their curriculum as
online courses, or hybrid courses.15 A few universities are entirely
on-line, with no classroom buildings.
11 Many educators discourage the use of internet sources for purposes such as this; there is
little guarantee that the information is complete and correct, and that the source is permanent.
Most educators agree that sources should always be cited.
12 Because of the huge size of a digital video file, it is more efficient to transmit the bits as
needed, rather than the entire file at once. This is known as streaming.
13 In his 1995 seminal work, Being Digital, Nicholas Negroponte predicted that the shipping
of bits would eventually replace the shipping of atoms.
14 Sports gambling, as with any organized gambling, is a long-term loss for the participants;
we have to assume that people take part in sports gambling for its entertainment value.
15 A hybrid course is one in which some components are done online and others are done
face-to-face.
9.1. COMMUNICATION, INTERACTION, AND COGNITION 207
– In the early 2000’s many universities, most notably Stanford and
MIT, began offering Massive Open Online Courses (MOOC). These
are essentially just video clips of lectures, with no interaction be-
tween the instructor and students. However, they are free, and the
instructors are often well-known in their respective fields.
– Private companies now offer online courses with substantially more
interaction between the instructor and the students. One such com-
pany is Coursera, which offers courses that generally involve exer-
cises, quizzes, peer-graded assignments, and sometimes a final exam
or project.
– During the Corona virus pandemic of 2020, all education would have
had to terminate instruction if it had not been for the internet. Most
institutions were able to continue using conferencing software such as
Zoom, Cisco Webex, Blackboard Collaborate, Microsoft Team, and
Google Hangout.
[Link] Impact on productivity
The internet has had an impact on productivity. Tasks which previously took
days, can now be accomplished in a few seconds, given the appropriate tools.
Employees can interact with colleagues even when traveling on business (or
on vacation, which could be seen as a disadvantage). Also the internet has
engendered distributed systems. A good example is an airline’s reservation
system. People can reserve seats on flights from any location.
For all the benefits accrued from the internet, there is one major disadvan-
tage. We now rely on the internet for almost everything - commerce, trans-
portation, education, weather, communication. If the internet were to fail,
there would be global chaos, for which the recovery could take years. This is
why network security is so important.
9.1.2 Scaling of the problem-solving process
Above we defined the notion of a problem solution which scales. As the size of
the problem increases, the resources required to solve the problem increases at
a manageable rate.16
The question of scaling is most appropriate in distributed systems, in which
many separate computers are attempting to solve the problem in parallel. The
best example is the SETI at Home project, in which people all over the world
download software to search data obtained from radio telescopes. They are
attempting to extract patterns, or meaningful signals, from the random noise
emanating from distant galaxies (and from our own galaxy). The developers of
SETI at Home were careful to ensure that the solution scaled.
16 Mathematically, if the need for resources increases at an exponential rate as the size of
the problem increases, the solution definitely does not scale.
208 CHAPTER 9. GLOBAL IMPACT
Search engines are another example of a problem-solving process which
scales. A search engine is faced with a mind-blowing task: search the entire
world-wide web for some artifact. The amount of data presented to the search
engine is enormous, and growing every day; yet, the time required for a search
does not increase appreciably, for a successful search engine.
[Link] Problems which do not scale
There are, however, problems for which no one has been able to find a solution
which scales. An example is known as the traveling salesman problem: Given a
group of cities, and roads connecting the cities,17 find a shortest path from city
to city, in which each city is visited exactly once. It is easy to write a computer
program that solves this problem, but if the number of cities is modestly large
(100 or so), it will take too much time to execute. No one has found a way of
solving the traveling salesman problem which scales, yet no one has been able
to prove that no such solution exists.
There are many other problems which can be shown to be equivalent to the
traveling salesman problem. If a solution which scales could be found for any
one of those problems, we would have a solution which scales for all of them.
These problems are known as NP-Complete problems.
[Link] Benefits from the contributions of many
Some online services use the contributions of many people to benefit both indi-
viduals and society. An example is the web service known as ‘Meetup’. Meetup
allows people to establish groups with a common interest. Once formed, mem-
bers of the group, designated as leaders, can schedule and organize meetings
of the group. Examples of Meetup groups are: Yoga enthusiasts, dog breeders,
hiking and outdoor activity clubs, chess players, World War II history buffs,
and many more.
The ‘LinkedIn’ site is primarily for people seeking employment, or companies
seeking to hire employees. This is often called networking. The data collected
by LinkedIn has some valuable features:
• LinkedIn can determine which fields have a glut of workers, and which are
seeing a scarcity of workers.
• LinkedIn can determine which geographic locations have a glut of workers,
and which have a scarcity of workers.
• LinkedIn can use trends in employment history to predict future employ-
ment statistics
17 Mathematically, this is called a graph.
9.1. COMMUNICATION, INTERACTION, AND COGNITION 209
[Link] Crowdsourcing
When individuals or organizations obtain goods and services, including ideas,
labor, and/or finances, from a large group of internet users, it is called crowd-
sourcing.18
The best example of crowdsourcing is Wikipedia, which is an online version
of an encyclopedia. Wikipedia is built by people with some degree of expertise
on a particular subject; they provide information on that subject, much like an
encyclopedia entry. The contributors receive no financial payment, but since
each contribution is relatively brief and many people may contribute to the
same entry, Wikipedia has been able to produce a rather large collection of
entries, many with well-drawn figures and diagrams. As people discover errors
or poorly written sections, the Wikipedia articles are gradually improved over
time. There are now Wikipedias in the languages of the world.19
[Link] Mobile computing
Recent years have seen an explosion in the usage of mobile digital communi-
cation devices. There are two general classifications of these devices: smart
phones and tablets This new technology resulted from a combination of:
• Inexpensive, dense, and non-volatile semiconductor storage, known as
flash memory
• Touch screen technology as a user interface
• High resolution digital photographic equipment
• Greatly improved battery technology
When coupled with the internet, phones can be used for much more than
speaking with other people. Mobile phones are equipped with:
• GPS sensors for interactive maps and navigation
• Cameras, including video capability
• Sound recording and playback
• Intelligent software, natural language communication
9.1.3 Exercises
1. Today, written communication is primarily digital. In your own words,
define each of the following forms of digital communication and briefly
18 The term crowdsourcing is derived from outsourcing in which a specific source of the ideas
or finances is named.
19 There are 6.1 million articles in the English Wikipedia, which is the largest of more than
300 Wikipedia encyclopedias. Source: Wikipedia, April 2020
210 CHAPTER 9. GLOBAL IMPACT
describe a situation in which the digital communication form may be pre-
ferred (i.e. when Chat would be the preferred method of digital commu-
nication over SMS and Email):
(a) Email
(b) SMS
(c) Chat
2. During the coronavirus COVID-19 pandemic of 2020, almost all learning
became remote and relied on video communication:
(a) Please list the types of video communication you have used for an
academic purpose (e.g. Zoom).
(b) Explain bandwidth and explain how did bandwidth has impacted your
personal academic experience.
3. Social Media is part of the daily life of many people. However, there are
some concerns about the amount of time spent using these platforms.
(a) If you are a social media user: how many total hours per day, on av-
erage, are you on these platforms? Can you identify some advantages
and disadvantages of your Social Media use?
(b) If you are not a social media user: can you identify instances of others
pressuring you or questioning you about being “off” social media? Do
you think you will one day join a social media platform?
4. What is the difference between an upload and a download ? Please give
an example of something you would upload and something you would
download.
5. Can you give some specific examples of ways access to public data helped
many people?
6. What is your “go to” search engine and why?
7. Computing innovations have had a huge impact on E-Commerce. Please
think broadly about the benefits and consequences of E-Commerce growth.
Briefly outline and describe the benefits and consequences.
8. Today, we rely heavily on the internet. Let’s say tomorrow, you no longer
had access to the internet and needed to travel a far distance to a new
place. What would you do to successfully make this trip? Remember, you
have no access to the internet so you can’t use GPS or GoogleMaps.
9. (a) What is meant by a problem solution which scales?
(b) Give an example of a problem, and a solution to that problem which
scales.
(c) Give an example of a problem, and a solution to that problem which
does not scale.
10. Explain how crowdsourcing works for Wikipedia.
9.2. IMPACT ON INNOVATION 211
9.2 Impact on Innovation
9.2.1 Impact on other fields
Advances in computer technology and intelligent software, coupled with the
proliferation of the internet have had a huge impact on many other fields and
endeavors.
[Link] Machine learning and data mining
When we devise an algorithm which automatically improves itself as it processes
data, we say the algorithm is learning, The study and development of such
algorithms is currently called machine learning (ML), and this is a branch of
artificial intelligence 20 (AI). AI has been in existence for many years, but the
problems which fall in this area has changed. When a problem has an efficient
soution, it is no longer considered a problem in AI. For example, it was once
thought that if a computer could outplay a human at chess, we would consider
the computer intelligent; i.e. the game of chess is a measure of intelligence.
However, as computers became faster, and as chess software discovered ways of
trimming the search space of possible moves, chess-playing computers eventually
outplayed the world’s best chess players. At this point chess was no longer
thought to be in the domain of AI.
However, chess is a good example of machine learning, when chess software
improves automatically as a result of many chess games played against human
opponents or other chess machines. The learning software is able to recognize
patterns which are associated with winning or losing strategies.
There are examples of machine learning systems in banking, bioinformatics,
computer vision, linguistics, robot locomotion, and many other areas.
Data mining is related to machine learning. When presented with a huge
quantity of data, programs which search the data, and gradually accumulate
knowledge of patterns or information in the data, we say the program is mining
the data. As this is done, the program is able to impose a structure on the
data, disregarding data values which are not relevant. The data mining soft-
ware will extract previously unknown, but interesting patterns, such as groups
of records (cluster analysis), unusual records (anomaly detection), and depen-
dencies (implication of patterns). As opposed to information retrieval, data
mining software is provided with little or no information on a search target;
rather, it works independently to discover general features of the data.
[Link] Innovation in science and business
Advances in computing have had enormous impacts on developments in science
and business. We have previously mentioned a few of the ways that computing
has impacted science, some of which are mentioned here:
20 A famous computer scientist, Saul Gorn, once remarked, ”Aritificial intelligence is the
opposite of natural stupidity”.
212 CHAPTER 9. GLOBAL IMPACT
• Computers have enabled us to decode the sequence of nucliotides in a DNA
molecule for many species, including humans. This has led to many impor-
tant applications. We can determine ancestral relationships among people;
we can identify people accused of a crime; we can determine whether a per-
son is predisposed to a genetic disease: breast/ovarian cancer, alzheimer’s
disease, Huntington’s chorea, and many more.
• Pharmaceutical research often uses computationally intensive algorithms.
Simulated models of large organic molecules can be used to develop new
drugs.
• In the past astronomers painstakingly perused photographs of the night
sky, searching for new galaxies, nebulae, comets, planets, and asteroids.
Now the searching is done with pattern-matching software. Also, the
discovery of a non-visible object such as a planet is often accomplished by
noting the slight, but unexplained, motion of a larger nearby object, such
as a star. Computers can detect these miniscule changes in position far
better than human observers.
• Geographers and cartographers can make relief maps from satelite images.
Political maps are easily drawn and edited with graphics software; maps
can be enhanced with database information, such as population, clmate,
altitude, etc.
• Archaeologists and anthropologists have a new tool known as Lidar (Light
Detection and Ranging)21 Most often used from aircraft, a Lidar machine
uses a combination of laser and radar technology to see ’through’ dense fo-
liage to the ground surface below. The reflected laser beams are converted
by a fast computer to a database of ground elevation levels. Using this
technology, scientists have discovered lost cities of ancient civilizations,
which had constructed pyramids, in the jungles of Central and South
America.22
• Mathematicians spend their lives trying to find proofs of important the-
orems. Recently, the proof process has been formalized, so that a proof
can be ’discovered’ automatically, or a computer can be used to assist a
mathematician in searching for a proof. Automated Reasoning software
has been successful in finding difficult proofs. The most notable example
of such a proof was a proof of the four color theorem in 1976 by Appel
and Haken, with an improved version in 2005 by Gonthier. The four color
theorem states that the regions of any map can be colored with four colors,
with the constraint that adjacent regions must have different colors.
There have been numerous innovations in the busineess world resulting from
advances in computation.
21 Also known as LIDAR, LiDAR, and LADAR. Lidar was originally a portmanteau of light
and radar. It is also known as 3D laser scanning.
22 See The Lost City of the Monkey God [2017] by Douglas Preston.
9.2. IMPACT ON INNOVATION 213
• In marketing research we attempt to discover the demographics of a mar-
ket: What do people want? What are they willing to pay? Where are
they located? How are their decisions influenced: by TV? by billboards?
by the internet? by word-of-mouth? In the past this kind of information
was obtained by either informal surveys or trial-and-error. Surveys took
the form of mail, phone, or in-person surveys. Trial-and-error consisted of
putting out a product or prototype to discover the market.
Today this information is available in much larger quantities, and with
much more detail. When you switch on your TV or change channels,
the cable company maintains a record of what you are watching. This
information can be used to sell advertising, or the record of what peo-
ple are watching can be sold to individual companies or market research
companies.
• When you use social media, such as Facebook, Twitter, or Instagram,
your likes and preferences are maintained in a central database. This is
valuable marketing information
• International corporations have probably gained the most from the inter-
net. A company can have offices all over the world, with instant commu-
nications among offices. Teleconferencing facilitates meetings without the
expense and down time of travel.
• There has been an expansion of business in the area of data analytics.23 As
a result of the huge amount of data available on the internet, the process of
extracting useful information from the raw data is now being automated.
• There have been drastic changes in the stock markets resulting from the
internet. In the past individual investors would contact an agent autho-
rized to buy or sell shares of a stock. Today transactions can be done
instantaneously on the internet. Some have exploited this capability by
buying and selling quickly several times in one day, which is known as
high-frequency trading.24
[Link] Accessing and sharing information
Modern computing has fostered innovation in many areas by providing the abil-
ity to access and share information.
Researchers in the sciences, social sciences, and other areas collect data
before analyzing the data. This data can be shared with other researchers
working on the same problems. It is not unusual for different researchers to
draw different conclusions from the same data; this would encourage them to
re-examine their research methods and agree on a conclusion which is more
likely to be correct.
23 Data analytics is the practical application of data science.
24 See the book Flash Boys: A Wall Street Revolt by Michael Lewis, 2014
214 CHAPTER 9. GLOBAL IMPACT
[Link] Open access, open source, and Creative Commons
Copyright laws in the United States are intended to encourage the creation of
art and culture by giving the artists and authors exclusive rights to sell copies of
their works.25 Many people, including the authors of this book, have discovered
that by foregoing the copyright, a work is often distributed much more widely.
Open source software and open source textbooks, such as this one, are cre-
ated with this in mind. The authors receive no financial compensation (royal-
ties). The textbook usually goes through no formal review process. However,
as a result of widespread usage, and multiple authors, the work is gradually im-
proved over time. The work may even fork several times, meaning that it splits
into two different development projects with a separate team on each project.
As users adopt a particular version of the project, one branch may wither and
the other branch will thrive, forming a natural selection process. In this way
quality is achieved with an open source work. Examples of open source software
are Linux, Mozilla Firefox, and Apache internet server software.
The Creative Commons organization, founded in 2001 by Lawrence Lessig et.
al., has codified the various ways in which copyrights can be modified. This has
resulted in Creative Commons licenses which define the procedures and rights
to copy for a creative work. Some examples of Creative Commons licenses are:
• Attribution (BY): The work may be copied and distributed only if they
give the original author attibution (i.e. they cite the author).
• Share-Alike (SA): Derivative works26 can be distributed, but only with a
license that is no more restrictive than the original work’s license.
• Non-commercial (NC): The original work may be copied, distributed, per-
formed, etc., but only for non-commercial purposes. The copies may not
be sold for profit.
• No Derivative Works (ND): The original work may be copied and dis-
tributed, but not modified.
These licenses are not mutually exclusive. A work may have more than one of
these licenses, as long as they are not contradictory. This copyright license for
this book is NC + BY.
[Link] Open and curated scientific databases
To foster collaboration among scientists, they often make their research data
available to other scientists. With this kind of collaboration, all scientists can
benefit from the work of other scientists. These databases include not only
research data, but also references or citations to publications or other web sites.
Some examples of open data are:
25 Copyrights expire after 70 years.
26 Aderivative work is one that is derived from the original work. For example, web browser
software with features added to the original work is a derivative work.
9.2. IMPACT ON INNOVATION 215
• Geographic maps
• Genome maps for various animal and plant species
• Connectomes - A ‘wiring diagram’ of the human brain
• Chemical compounds
• Mathematical formulae and identities
• Medical data - Diagnostic techniques, medication recommendations, suc-
cess history
• Pharmaceutical data - Drugs, showing proprietary and generic names
Some examples of search engines for research publications are:
• CiteSeer: Database of research for Computer Science, Mathematics, and
Statistics
• FSTA: Food Science and Technoloty Abstracts
• GeoRef: Geographical Sciences sources
• Google Scholar: Multidisciplinary
• IEEE Xplore: Computer Sience, Engineering, Electronics
• INSPIRE-HEP: High Energy Physics
• JStor: A multidisciplinary collection of journals, books, and research find-
ings, with search capabilities
• MEDLINE: Medicine, Healthcare
• Science Acclerator: Department of Energy research and development
[Link] Impact of Moore’s Law
In 1965 Gordon Moore, of the Fairchild Semiconductor Corporation, predicted
that the number of components in an integrated circuit would double every two
years. This statement implies exponential growth in the density of an integrated
circuit. Amazingly, this prediction held true through 2012.27 One consequence
of this growth in density is that the speed of a computer’s CPU would double
every 18 months.
Because of this prediction, from the 1960’s through the end of the millenium,
software engineers developing new products could often assume that programs
which take too long to execute during development and testing would run quickly
27 One of the main obstacles that prevented further improvements is the heat dissipation
problem. As integrated circuits become increasingly dense, they require more electric power,
and generate more heat, which must be dissipated to avoid failure.
216 CHAPTER 9. GLOBAL IMPACT
after the software is released, simply due to the faster CPUs which would be
available at that time.
It has been said that if the automotive industry had made engineering ad-
vances similar to those made in the computer hardware industry, a Rolls-Royce
would get 5000 miles per gallon of fuel, have a top speed of 2000 miles per hour,
and would cost $1.75.
[Link] Impact on creativity in other fields
Computing has had an impact in virtually every path of life.
• Music composers do not need to copy scores freehand, but instead use
software packages which speed up the process immensely. They can also
get immediate feedback by listening to a digital performance of their com-
position.
There are also packages which aid a composer in suggesting melodies
and/or harmonies. Research in the automatic compostion of music con-
tinues to have an impact.
• Writers no longer sit at a typewriter, with white-out, carbon paper, ink
ribbons, etc. The computer also helps to correct spelling and grammatical
errors.
Researchers have experimented with automatic literature generation, thus
far with little success, but poets searching for a rhyme have undoubtedly
used a computer.
• Architects and civil engineers can produce aesthetic and complex designs
in a fraction of the time required before the computer age. Think of all
that goes into the design of a modern hospital, including the electrical and
data wiring.
• Computer Aided Design (CAD) software has assisted engineers in produc-
ing blueprints, circuit diagrams, industrial plant designs, etc.
• Until the year 2010 people with type 1 diabetes injected themselves with
insulin to avoid high blood sugar. Too little insulin resulted in high blood
sugar causing complications such as infection, kidney disease, eye disease,
etc. Too much insulin caused low blood sugar; patients sometimes died
while sleeping when their sugar levels dropped too low. Injection of just
the right amount of insulin, even while sleeping, is expected to be possible
and in widespread use by the time you read this. A digital device is used
to combine data from a continuous blood sugar level monitor, with an
insulin reservoir and pump attached to the patient’s skin.
9.2.2 Exercises
1. What is meant when we describe a computer as learning? What is meant
by machine learning?
9.3. GLOBAL IMPACT ON SOCIETY 217
2. Review the Marketing Research information located in this section (In-
novation in Science and Business, look specifically under innovations in
business). Consider all data gathered about you which may be used to
market to you from places like your cable provider, mobile provider, and
social media platforms. Were you previously aware this is how your data
could be used? Now that you know, what are your thoughts?
3. What are copyright laws and how do they impact open source software
and open source textbooks (like this one)?
4. Define the types of Creative Common licenses and identify the license(s)
associated with this textbook.
(a) Abbritution (BY)
(b) Share-Alike (SA)
(c) Non-commercial (NC)
(d) No Derivative Works (ND)
(e) The license(s) associated with this textbook
5. What is Moore’s Law? Identify an issue impacting continued, exponential
growth.
9.3 Global Impact on Society
Innovations in computing have had an impact on people and societies through-
out the world. This impact has not always been a positive, or beneficial, impact.
Computing has enabled breaches of security, invasion of privacy, fraud, identity
theft, and many other negative criminal or unethical activities.
9.3.1 Beneficial and harmful effects of computing
[Link] Legal and ethical concerns
Computing has had an impact on the law, as well as ethics. The protection of
intellectual property, by copyright and patent laws is discussed below.
• Copyright laws were intended to foster creativity; they ensure that authors
and other creative artists are compensated for their work. Computers
make it very easy to copy copyrighted works, making it difficult to enforce
copyright laws.
• In 1999 a peer-to-peer filesharing network named Napster gave users the
capability of sharing files. Many people used Napster to share digital au-
dio files, typically in MP3 format. MP3 is a digital audio format which
compresses the data significantly, while maintaining good quality sound.
Prior formats were too large to be shared easily. It wasn’t long before a
huge number of copyrighted audio files (songs, concerts, recordings) were
218 CHAPTER 9. GLOBAL IMPACT
available at no cost via Napster. The recording studios filed a lawsuit
against Napster for copyright violation. Napster claimed it had not vio-
lated any copyrights because it had not copied anything; it simply made
it convenient for users to make illegal copies.
• Patent laws are intended to foster innovation in engineering and scientific
areas. A patent gives the developer exclusive rights to produce and market
a device or process, typically for a term of 20 years. With the advent of
computing, software developers filed for patents. Also, researchers filed
to patent algorithms. Suddenly the courts were facing numerous cases of
patent fraud which were not at all clear. How can one determine whether a
program or an algorithm, similar but not identical to a patented program
or algorithm, is an illegal instance of patent fraud?
• With the advent of mobile phones and digital communications, the service
providers routinely maintained metadata on phone calls. Metadata is not
the actual content of the call, but involves relevant information such as
identity of the caller, identity of the person being called, date, and time
of the call. Many consider the retention of metadata to be an invasion
privacy, and object to the unethical usage of this data - it is sold as
valuable marketing information.
• When a suspect is charged with a crime, that suspect’s personal property
can be confiscated and used as evidence by the prosecution. Suddenly
we are faced with a confiscated mobile phone containing much pertinent
information; not only the phone calls, but information on the suspect’s
location at various times, apps used by the suspect, emails, etc. However,
if the phone is locked, there is no law requiring the suspect to unlock the
phone, and the suspect is further protected by the fifth amendment. There
have been cases where the FBI appealed to the manufacturer (Apple) to
provide a key to unlock the phone, but Apple claimed that it could not
provide any such key. Moreover, Apple claimed that it would not build
a back door 28 into future phones, as this would compromise the security
that it wished to provide to all customers.
• Related to the above item, the primary law in the United States govern-
ing access to private cellular phone data is the Electronic Communications
Privacy Act of 1986(ECPA). This act states that “some information can
be obtained from providers with a subpoena; other information requires
a special court order; and still other information requires a search war-
rant.” The PATRIOT Act of 2001 was passed in response to the terrorist
attacks of September 11 of that year. It eased restrictions on wiretaps
28 A back door on a cryptographic system is a built in key, maintained by the developers of
the system, and unknown to the users. With a back door, the developer can decrypt anything
encrypted by a user. Experts, such as Harvard professor Bruce Schneier, have repeatedly
decried the dangers and threats to security afforded by back doors.
9.3. GLOBAL IMPACT ON SOCIETY 219
and surveillance of US citizens, and was extended for several years, finally
expiring in 2020.29
• Social media originally allowed anyone to post information as long as
it was not considered pornography, slander, etc. Recently social media
corporations such as facebook have come under attack for permitting false,
and potentially damaging, information to be posted.
For example, in 2018 it was revealed that the British political consulting
firm Cambridge Analytical had been granted access to large amounts of
facebook data, and used it to discredit politicians running for office.
It was also claimed that other foreign countries, most notably Russia, used
facebook to influence the 2016 US presidential election. Since that time,
facebook, and other social media corporations (instagram, twitter, e.g.)
have taken stronger measures to censor, or limit, what kinds of things can
be publicly shared.30
[Link] Peer-to-peer networks
A peer-to-peer network has no central authority. Each member stores all the
necessary software and data to be shared by peers on the network. Napster,
described above, is an example of a peer-to-peer network.
Another example of a peer-to-peer network is a digital currency known as
Bitcoin. The Bitcoin software, developed in 2008 by Satoshi Nakamoto,31 Bit-
coin is, as of the writing of this book, a huge success, though the value of
a Bitcoin has fluctuated drastically, as a result of speculation. Bitcoin users
download the wallet software, and purchase Bitcoins, or fractions of a Bitcoin32
from a Bitcoin dealer on the internet. Bitcoins can then be used for legitimate
purchases from any vendor which accepts Bitcoin. All transactions are verified
by Bitcoin miners using cryptographically secure algorithms.
Since all Bitcoin transactions are anonymous, Bitcoin has been used for drug
deals, money laundering, and ransomware. Since there is no central authority
for Bitcoin, as there is with a bank, the FBI is unable to file charges against
Bitcoin.
[Link] Legal and ethical aspects of public information
Access to public information, whether it be anonymous or authenticated,33
raises legal and ethical concerns. Is it ethical to use a government repository
29 Source: Kirkpatrick, K, “Who Has Access to Your Smartphone Data?”, Communications
of the ACM, October 2020.
30 For a description of how facebook decides what should be censored, see the New Yorker
magazine, Oct. 19, 2020.
31 Satoshi Nakamoto is the name of the author of a paper presented at a virtual conference.
No one has ever met Nakamoto face-to-face. It could be a pseudonym for a group of people,
or a completely fictitious name.
32 A Satoshi is 10−8 Bitcoin
33 Authentication is the process of establishing a user’s true identity. When you tell the
bank your social security number, you are undergoing the authentication process.
220 CHAPTER 9. GLOBAL IMPACT
of information to aid marketing efforts? To discover your neighbor’s shopping
habits? To discover which doctors have been sued for malpractice? Is it legal to
break in to a government database, to find out who is being audited for income
tax purposes?
[Link] Censorship
When is censorship of digital information appropriate? Does the first ammend-
ment of the U.S. constitution (freedom of speech) give you the right to post
anything you like on Facebook? Most legal scholars would say that freedom of
speech is limited; speech, or expression, which infringes on someone elses rights
is not allowed by the first ammendment. Thus, social media, such as Facebook,
Twitter, and Instagram, go to great lengths to censor postings appropriately.
In addition, social media generally have an interest in limiting inappropriate
postings which they consider to be offensive to most people. This decision
is made to ensure that they maintain a strong user base, but it complicates
things for the social media corporations, because they are global organizations,
spanning many regions and cultures. What is acceptable to one culture may be
very offensive for another culture.
Some non-democratic governments will censor information on the internet
to disallow expression which is critical of the government or deemed otherwise
inappropriate by the government.
The Arab Spring was a series of uprisings and protests, beginning in Tunisia
in 2011, in which people discontented with the status quo used social media
to organize large protest demonstrations. More recently there have been fewer
organized protests, probably because the governments have utilized censorship
to maintain control.
[Link] Open source
To fully understand the phrase open source we must first describe the origin of
the word source in this context. A compiler translates a program written in
a high-level language, such as Java, into a series of binary coded instructions,
a language known as machine language. The original Java language version of
the program is known as the source version or source code. The source code
can be read and modified by programmers but cannot be directly executed by
a computer. The machine language version, also known as executable 34 , cannot
be read or understood by programmers35, but can be directly executed by the
computer. We can now distinguish between proprietary software, open software,
and open source software.
34 Afile with a .exe extension is typically an executable, machine language, program.
35 There is software which can decompile binary machine code, to a more readable form
known as assembly language, or even to a high level language such as Java. This process,
known as reverse engineering, does not produce the original source code which would have
meaningful names for data, and English descriptions of the code.
9.3. GLOBAL IMPACT ON SOCIETY 221
• Proprietary software is software which can be purchased. The customer
typically purchases the machine language version of the software, not the
original source version. The developers of the software maintain private
ownership of the source code, so that it can be improved by only the
original developers.
• Open software is available free of charge, but only the executable version is
available. The developers maintain private ownership of the source code.
• Open source software is software for which the source code is available,
generally free of charge. Users are then welcome to make improvements
and compile the source to obtain an executable version.
There are several varieties of licensing options available for open source soft-
ware.36 The original developers of open source software are not directly paid
for the time and effort put forth, but they may, individually, or collectively,
market their services and expertise to those who are using the software. For
example the open source linux operating system has become so popular that
companies such as Red Hat offer consulting services which provide support for
linux users.
Open source software raises some interesting ethical and legal issues:
• If someone violates the Creative Commons license, is that a violation of
copyright laws?
• If open source software causes financial, or other, losses, can the devel-
opers be sued? Faulty software controlling safety-critical systems such
as aircraft, x-ray machines, and medical equipment can cause injury or
death.
• Who should be named in the suit if many individuals have contributed to
the developement of faulty software?
• Can documentation in the software be legally copied to develop competing
software? A famous example of this legal question is a lawsuit for $8.8
billion filed by the Oracle corporation against Google in 2010. Oracle’s
Java programming language, including its API, 37 is open source, with
restrictions on use. Oracle claims that Google is making unfair use of that
API in its Android operating system. This lawsuit eventually came to the
U.S. Supreme Court, which was to have heard the case in March 2020,
but postponed it because of the COVID-19 pandemic.
[Link] Privacy and security
Privacy and security have become more important in today’s world. Identity
theft occurs when any information that can be used to identify a person is
36 See Creative Commons, above, in this chapter
37 API,or Application Program Interface defines the source-level components of a software
system, describing how they can be used.
222 CHAPTER 9. GLOBAL IMPACT
obtained illegally. Sometimes this information is obtained through legal means,
but it can be just as harmful to the victim. Clearly, if someone obtains your
credit card number, they can attempt to charge purchases to your account.
They can also use identity information to obtain a better credit rating, gain
access to your financial accounts, and in general wreak havoc on your life.
There are many instances where invasion of privacy may seem innocuous.
• When you make a personal phone call, or send a text message, who has
access to the content of the call? Who has access to the metadata38 for
that transmission?
• When you post information on Facebook or Instagram, or use Twitter, you
are providing those companies with valuable information about yourself.
You are also exposing this information to the world.39
• Your smart phone is equipped with GPS technology. As you travel, your
phone knows your location, and that information is useful to the phone
provider.
• As you browse and search using a web browser such as Google Chrome,
Apple Safari, or Mozilla Firefox, your browsing history is available to the
provider. This is valuable marketing information which can then be sold.
[Link] Anonymity
The question of the legality of anonymous expression has existed at least since
the origin of the United States. The US Supreme Court has repeatedly recog-
nized rights to speak anonymously derived from the First Amendment (freedom
of speech). The internet makes anonymous speech convenient, valuable, and
potentially dangerous.
When creating an email account, for example on Gmail, one does not need
to provide one’s actual identity (name, residence, ssn, etc) but Google does
store some information about you: your IP address, which is required whenever
accessing the internet.
[Link] Exploitation of information by social media, and cable providers
Technology anables the collection, and exploitation of information on individuals
and other entities. When you post something on Facebook, even a like or dislike,
you are providing Facebook with valuable information. It may not seem like
much, but in the aggregate over millions of users, this information is valuable
marketing information provided to Facebook.
This exploitation is also prevalent with cable providers. Many people con-
tract with the large cable providers, such as Comcast and Verizon, which offer
38 The metadata consists of the date, time, caller id, called id, etc. but not the actual
content of the voice or text transmitted.
39 Facebook, Instagram, and Twitter may claim security and privacy features, but these
claims have not always been as robust as one might wish.
9.3. GLOBAL IMPACT ON SOCIETY 223
voice, television programming, and/or internet acceess. When you choose a TV
channel to watch, the provider makes note of it. When you mute, search, turn
on closed captions - this is all valuable information for the provider.40
[Link] Exploitation of information by web services
Web searches and browser histories provide valuable information to companies
providing search engines, such as Google or Yahoo. Knowing who is searching
for what particular kind of apparel, their demographics (geographic location,
age, sex, occupation) is information maintained by Google, and sold to various
vendors and marketing information services. Did you search for a restaurant on
Google Maps? Google will remember this, and make use of it. Did you take a
selfie in Paris? Apple will remember this, and make use of it.
More recently, Google has been profiting immensely by selling advertising.
The advertising can be targeted to a user’s historical preferences.
[Link] Threats to curators of information
Governmental curators of information include the Social Security Administra-
tion, Medicare/Medicaid, the Internal Revenue Service, the various cabinet de-
partments: State, Defense, Energy, etc.
Private curators of information include banks, insurance companies, credit
databases, and retailers.
Each of these agencies is responsible for maintaining large amounts of data
necessary to meet their responsibilities and/or operate their business. This data
is usually sensitive and confidential. A security breach could be devastating. A
few examples of security breaches are:
• In December, 2013, the Target retailing coporation revealed a security
breach in which up to 110 million customer accounts had been accessed.
Hackers41 gained access to customers names, credit/debit card numbers,
card expiration dates, and CVV security codes.
• A credit bureau is a data collection agency which gathers account infor-
mation from creditors and sells that information to consumer reporting
agencies. This information us used to determine whether an individual
is a good credit risk for loans and purchases. In the summer of 2017 the
American credit bureau Equifax reported a security breach. The private
records of more than 140 million individuals had been compromised. This
was one of the largest instances of identity theft in history.
40 Some people think of cable TV as a means to ‘vote’; if you don’t like the political slant
of a TV news broadcast, you switch to a different channel. If many people do this, the TV
network gets the message.
41 The term hacker was originally used in the early days of computing to be a person who
worked late into the night developing software and/or learning about existing software. Today
the word takes on a more nefarious connotation as one who illegally breaks into secured sites
or databases.
224 CHAPTER 9. GLOBAL IMPACT
• Security breaches also occurred at government agencies. in April 2015 the
U.S. Office of Personnel Management42 discovered a data breach which
occurred some time in 2014. Approximately 21 million personnel records
were illegally accessed. Information such as social security numbers, names,
date and place of births, residences, and even fingerprints were compro-
mised. The victims included former government employees, and even those
who had undergone a government background check.
[Link] Targeted advertising
As mentioned above, advertising can be targeted depending on the demographics
of the users. This can have negative consequences; many people feel that this
kind of advertising is an invasion of privacy. Advertisements on web sites can
be distracting and/or obscure the important information. Users often have
an option to block ads, or to selectively block ads. Also, there is ad-blocking
software which purportedly will prevent ads from popping up. Most users are
not aware, that when they click on an option to block ads, they are providing
their IP address, and possibly other information, to the web server, and possibly
the advertising entity. A worst-case scenario is that the link to block ads is
actually malware which can infect the user’s computer.
[Link] Intellectual Property
Intellectual property encompasses original writings, data, analyses, and other
artifacts created by an individual for various reasons. When others access this
information, in a way that is not intended, it is considered an ethical violation.
If the information is copyrighted, unauthorized access is a violation of copyright
laws, and is punishable by law.
Most users of social media will share intellectual property with the social
media servers, and in consequence, with everyone in the world. This often
has negative consequences. The posting of offensive images or writing is one
example. Social media will often claim that the distribution will be limited to
a restricted access list of users. However, the security systems can be, and have
been, fallible. It is not recommended that people share sensitive intellectual
property on social media. When sending sensitive informaton via email, it
should be encrypted.
[Link] Copyright of derived work
In copyright law, a derivative work is one that includes elements of a copyrighted
original work. The derivative work becomes a second and separate work from
the original, and my be governed by a separate copyright.
Some examples of derivative works are translations, movie adaptations, move
remakes, and musical arrangements.
42 The Office of Personnel Management maintains records of civil servants - non-military
government employees.
9.3. GLOBAL IMPACT ON SOCIETY 225
Whether the original copyright holder is protected from derivative works
depends on the particular copyright laws of the country in which they are ap-
plied. Also, it is possible to specify in a copyright whether derivative works are
permitted.
With the Creative Commons licensing system described above, derivative
works are permitted, unless the license specifies ND (No Derivative Works). ND
may be specified in combination with the other rights, such as BY (Attribution),
SA (Share Alike), and NC (Non-commercial).
[Link] Digital Millenium Copyright Act
We have already described the issues of file-sharing systems such as Napster,
with respect to copyright laws. The Digital Millenium Copyright Act (DMCA)
of 1998 was a direct result of the problems caused by these file-sharing systems.
The DMCA made it illegal to produce and/or distribute artifacts which intended
to circumvent existing copyright laws. The question of intent was left open to
interpretation by the courts. This law also held accountable the internet service
providers (Comcast, Verizon, AOL, etc.) in cases where they enabled illegal
distribution of copyrighted materials.
[Link] Open and open source artifacts
The internet has become a vast source of valuable information, including doc-
uments and programs, often referred to as open software. Here we distinguish
between open and open source software.
• Open software is available free of charge.43 Examples of open software
include:
– Software distributed free in binary or executable form. This is the
output of a compiler, intended to be executed on a particular ma-
chine. It is unintellible to humans44 and thus is not amenable to
edits, corrections, or additions.
– A document in PDF format is another example of open software. It
can be viewed, copied, and distributed (pursuant to the particular
license), but it is not feasible to make edits to the document. An open
textbook is usable by students, but not amenable to corrections or
additions by anyone, including the teachers or faculty who may have
adopted the book.
Think of open software as similar to a free CD-ROM storing music.
43 Some examples of open software may impose a slight processing or storage fee, but are
still considered open.
44 It is possible to reverse engineer an executable program, converting the binary code to
readable text, using software known as a disassembler, or a decompiler; however the resulting
text is usually not sufficent to make significant improvements to the original software.
226 CHAPTER 9. GLOBAL IMPACT
• Open source software is also available free of charge, but the original source
documents which were used to create the software are also available. This
means that anyone who obtains the software can make edits, corrections,
or additions, presumably to improve the software. Open source programs
include not only the binary files, but the source files used to create the
binaries, and all relevant documentation needed to further develop the
software.
Software which is open source is subject to a process known as forking.
When an individual or entity uses the entire package of source programs
to produce a separate product for distribution, we say the project has
forked. This means that there are two separate development efforts taking
place, and the product may evolve into two distinct versions, the original
version and the forked version. Users, and other developers, then have
the option to choose the one which best meets their needs. If most choose
the forked version, it will thrive, and the original version may wither. If
most continue to choose the original version, it will continue to thrive, and
the forked version may wither. It is by this natural selection process that
open source software has the potential to achieve a high degree of quality.
Examples of open source software include:
– The operating system known as Linux, first released in 1991 by the
Finnish-American software engineer Linus Torvalds. Originally de-
veloped for the Intel x86 processor, it now runs on many different
platforms. Companies, such as Red Hat, have evolved to support
Linux.
– Google Chromium is open source software which is a web browser.
The source code enables users to develop web browsers with more
features. One such improved browser, known as Chrome, was also
produced by Google.45
– The Java programming language was originally developed by Sun
Microsystems. The software consisted of the compiler, interpreter,46
supporting libraries, and debugging software. Java was open, but not
open source. When Sun was acquired by the Oracle Corporation in
2009, Java became open source.
– LibreOffice is a package of programs, similar to Microsoft Office, for
word processing, spreadsheets, presentation, etc. It was forked from
OpenOffice in 2010. LibreOffice can read and produce documents in
Microsoft Office format. LibreOffice claims to be 100% compatible
with Microsoft Office.47
45 Chrome is not open source
46 The Java compiler does not compile to native machine code; it compiles to byte code,
which is then executed by an interpreter. The byte code is standard across all platforms. This
provides Java software with portability one of its strongest features.
47 It is a mystery to this author why entities in the public and private sectors continue to
outlay money for Microsoft Office.
9.3. GLOBAL IMPACT ON SOCIETY 227
– Textbooks, such as this one, which make the original source files
available, in addition to the PDF, are open source.48 Authors of
open source textbooks include:
∗ Allen Downey of Olin College of Engineering has authored at
least 7 books on programming, data structures, and statistics,
under the umbrella of Green Tea Press.49
∗ Seth Bergmann of Rowan University includes this book as his
fourth open source textbook.50
∗ David Eck and Carol Critchlow, of Hobart William Smith College
have produced an open source textbook on Computer Science
Theory.
– Open source textbooks are amenable to improvement by anyone with
the time and interest in doing so. People can correct errors, include
their favorite exercises, and provide entire sections or chapters for
addition to an existing textbook. This also means that open source
textbooks can be forked.
9.3.2 Exercises
1. This section of the chapter opens with a statement warning that with all
the great things that come from our developing, digital world, there are
negative consequences (like data breaches, fraud, privacy invasion, identify
theft). Can you find a current event article (within the past year) that
highlights a negative impact of technology and answer the following:
Summarize what happened. Identify the group(s) of people negatively
impacted. Identify if anyone benefitted from the event.
2. Explain what a peer-to-peer network is and provide an example of a peer-
to-peer network.
3. This section of the book explores censorship, which continues to be a
complicated, and often debated topic. Can you think of an example in
which you feel censorship is appropriate? Please explain why.
4. The “Privacy and Security” section of this chapter clearly identifies ar-
eas where your privacy could be invaded/compromised every day! Prior
to reading this section, did you consider that these are areas of privacy
concern? Will you do anything differently now to protect your privacy?
5. What is intellectual property?
48 See Publishing Research Quarterly, Vol. 30, No. 1, March 2014, for a more complete
description of Open Source Textbooks.
49 Although the source files for Prof. Downey’s works are freely available, copies are also
distributed for a nominal fee by Amazon.
50 See [Link]
228 CHAPTER 9. GLOBAL IMPACT
6. Regarding copyright of derived works:
Define derivative work. Provide an example of a derivative work. Explain
how you know whether it is legal to copy a derivative work.
7. What is the Digital Millenium Copyright Act?
8. What is the difference between open software and open source software?
Provide an example of open software which is not also open source, and
provide an example of open source software.
9.4 Social contexts for innovations in computing
Innovations in computing do not take place in a vacuum. New developments
are often the result of changes taking place in our society. Conversely, new
developments in computing have an impact, and cause economic and cultural
changes in our society.
9.4.1 Contexts
A context is the milieu in which something occurs. Innovations in computing
occur within the social, economic, and cultural contexts of our society. Comput-
ing innovations in one country, or socioeconomic context, can be very different
from the innovations which occur in a different country, or context.
[Link] Reaction to a pandemic
One example of computing innovations occurring as a response to events in a
social context has to do with the COVID-19 pandemic of 2020. Prior to this
time there was web conferencing software which allowed people to share voice,
video, and computer screens across the internet. However, these systems were
used primarily in some business contexts, and most business meetings continued
in a face-to-face manner. Simpler systems, such as Skype and Facetime were
popular, but did not have the features needed for conferencing.
The pandemic changed all this. Suddenly educational, health-care, financial,
legal, and other environments were suddenly faced with the need for high-quality
conferencing systems. More innovative systems, such as Zoom, Cisco Webex,
and Blackboard Collaborate soon became ubiquitous. These systems under-
went substantial revision to meet the much greater bandwidth (i.e. usage) and
functionality (features) requirements.
[Link] Cellular telephone technology
An example of a context which has been affected by innovations in computing
is the advent of cellular telephone technology in third world countries. In some
countries, African in particular, the poor economy did not allow for the con-
struction of a nation-wide telephone system (entailing connections with wiring
9.4. SOCIAL CONTEXTS FOR INNOVATIONS IN COMPUTING 229
to all inhabited regions); it was simply too expensive. In the late twentieth
century, with the advent of cellular technology, many of these countries went
directly to cellular systems, bypassing telephone poles and wires entirely. These
countries have stopped trying to establish new landlines, as the cellular system
is more cost effective.
[Link] Distribution of computing resources
Computing resources around the world are not uniformly distributed. People
living in wealthy nations have convenient access to the internet, and all that
implies. These people can communicate freely with friends, relatives, and total
strangers. They also have greater access to entertainment, games, music, sports,
gambling, etc.51
In many countries lack of access to computing is due to economic considera-
tions. In some countries access is intentionally limited by the governing officials
to maintain authoritarian control of the government.52
[Link] Digital Divide
The digital divide is the uneven distribution in the access to, use of, or impact of
information or computing technologies, among distinct groups of people. This
phrase was first used by Larry Irving of the U.S. National Telecommunicationd
and Information Administration in 1999. People in lower socioeconomic brackets
typically have minimal, if any, access to computing.
The most direct result of this lack of access has to do with the availability of
information. People cannot discover helpful resources, because the resources are
generally available on the internet; informatiion on resources such as medicare,
medicaid, affordable health care, food assistance, educational scholarships, etc.
is available primarily on the internet.
A less direct consequence of the digital divide is that lower-class children
entering school are lagging behind middle and upper-class children in ther ability
to use digital computers and devices.
[Link] Infrastructure
Who owns the internet? Who ensures that it is secure? Who is responsible for
its maintenance?
The internet is supported by a combination of commercial (private) and
government (public) entitites. The protocols and software were first developed
in universities, and funded by DARPA (the Defense Advanced Reserch Projects
Agency), an arm of the Department of Defense. Today the National Science
Foundation continues to support research and development which contribute to
the security and stability of the internet.53
51 Are these really a benefit of greater access to computing?
52 See the discussion of the Arab Spring uprising, above
53 Just imagine the impact to our society if the internet were to ‘crash’
230 CHAPTER 9. GLOBAL IMPACT
The software and algorithms which are the internet are in the public do-
main. They are accessible to everyone. The security lies in the cryptographic
algorithms which are used for authentication and confidentiality.
9.4.2 Exercises
1. This section begins in noting that computing innovations do not occur in
a vacuum. In what contexts do computing innovations occur?
2. Innovations in video conferencing systems were sparked by necessity in
response to the COVID-19 pandemic of 2020-21. Video conferencing be-
came not only an integral part of education but an integral part of daily
life. Based on your own experience, can you describe other ways you used
video conferencing technology as part of your life/routine.
3. Define digital divide. Explain how you think the digital divide impacted
access to virtual education for students of low socioeconomic status during
the COVID-19 pandemic of 2020-21.
4. Consider your daily reliance on the internet – maybe you need it to do
your job, to go to school, to order food. How would an internet “crash”
for a long period of time (think a month) impact your daily life?
9.5 Research
Research is an investigative process in which there is generally a specific ques-
tion to be answered, or a specific hypothesis to be tested. The research process
is facilitated, accelerated, and generally improved when the appropriate tech-
nologies and tools are used. The research process will often involve accessing
information, and evaluating the credibility of the sources of that information.
9.5.1 Information management
The research process will involve:
• Accessing the necessary information
• Managing that information
• Maintaining accurate attribution of the information (i.e. citations)
[Link] Online sources
Traditionally, information used in the research process has been primarily peer-
reviewed articles in journals and other periodicals. Reliability was generally
assumed to be rather high, if not perfect. Today most of these journals are
online, in addition to being bound hard copies. However, a number of other
sources are also online. Unfortunately they are often:
9.5. RESEARCH 231
• Not peer reviewed - The peer review process involves finding experts will-
ing to take the time to review a submitted manuscript. Once the reviewers
have been obtained, it could be several months before all the reviews are
complete. Peer reviewing improves the quality of publications but has
a major impact on the time it takes for a submitted manuscript to be
published.
• Not permanent - When something is posted online there is no guarantee
that it will persist. The article could be modified, or even removed, at any
time. This would have a serious impact on the credibility of all subsequent
research which has made use of the temporary article.
• Difficult to cite - All research making use of existing information should
list citations appropriately. If the only citation is a URL, the citation lacks
credibility.
[Link] Search tools
Years ago the best search tool that researchers had was known as the Read-
ers Guide to Periodical Literature which was a hard-bound reference updated
monthly. It contained citations for every peer-reviewed journal in the sciences
and social sciences. It had copies sorted by author, title, and subject to facilitate
quick search.
Modern search tools can be more helpful in finding specific information
quickly. Boolean criteria, and search categories, combine to afford logical ex-
pressions that expedite a search.
For example, we may be investigating the possible causes of a disease that
we believe is carried by a mosquito. We know that John Smith and Harriet
Jones have previously published articles on this disease. We could generate a
search expression such as:
FIND: AUTHOR="Smith, John" OR "Jones, Harriet" AND
SUBJECT="COVID-19" OR "CORONA" OR "Mosquito" AND
DATE=1990 - PRESENT
[Link] Plagiarism
Easy access to online information is a double-edged sword. It has many advan-
tages, discussed above, but it is also vulnerable to plagiarism. Plagiarism is the
unauthorized use of information produced by others, generally done in such a
way that it appears the information was originally produced by the plagiariser.
Plagiarism, whether it is scientific research or a school term paper, is a seri-
ous offense. If the plagiarised information is copyrighted, the plagiarism is a
violation of copyright laws and is a punishable offense.
Many teachers and college professors forbid the usage of online or non-peer
reviewed materials. Most, however, will insist on appropriate citations for any-
thing which is obtained, online or otherwise. A scholarly work which lists many
232 CHAPTER 9. GLOBAL IMPACT
URLs for the citations will have less credibility than a work which cites peer-
reviewed publications.
To help researchers establish the credibility of a citation, the International
Standards Organization (ISO) now approves a standard scheme known as DOI
(Digital Object Identifier).54 A published article is assigned a DOI, which is
independent of the article’s location or URL. The article’s URL can change, but
the DOI continues to provide access to the article. A DOI aims to be ‘resolvable’
to some form of access to the article to which the DOI refers. Referring to an
online document by its DOI supposedly provides a more stable link than simply
using its URL. An example of a DOI for an article on DOIs by Marc Langston
is:
doi:10.1016/[Link].2003.11.004
This article appeared in the journal, The Internet and Higher Education in
volume 7, issue 1, of 2004. It can be located by using the DOI website at
[Link].
9.5.2 Credible and appropriate sources
Given the nature of online information - it is easily available, temporary, often
not peer-reviewed; how can we assess its credibility? How can we determine
whether it is appropriate for use as a citation in our current research?
[Link] Credibility
The credibility of a source is a measure of its accuracy, reliability, validity, and
permanence. A particular experiment produces reliable information if repeated
experiments under the same conditions produce the same results. A particu-
lar experiment produces valid information if the results represent an accurate
measure. Note that the reliability and validity are independent. An experiment
can be reliable, but not valid. An experiment can be valid, but not reliable. To
determine the credibility of a source we should examine:
• The reputation of a source - Have we seen this source cited elsewhere, in
many other works. Have colleagues reported good things about the pub-
lications coming from this source? Does this source have a long-standing
reputation, or did it just begin in the last year?
• Credibility of the author(s) - Do they have appropriate credentials? Do
they have advanced degrees in the appropriate areas? Were those degrees
awarded by accredited, and preferably prestigious universities.
• Credibility of a web-site - Does the web-site have a long-standing rep-
utation for credibility? In this text we have numerous citations from
Wikipedia; we believe that Wikipedia has met most of the critera for
54 DOI was first developed by the International DOI Foundation in 2000, and is responsible
for its maintenance, credibility, and security.
9.5. RESEARCH 233
credibility mentioned above. Wikipedia is constantly evolving toward im-
proved reliability, accuracy, and validity.
• Sponsorship, if any - Research sponsored by a large government agency
such as the National Science Foundation, the National Institutue of Health,
etc. is likely to be credibile; it has already undergone extensive review in
order to obtain funding from those institutions. Research from an entity
attempting to further its own predetermined viewpoints is less credible.
Examples would be political parties, organizations known to be affiliated
with a political party, and possibly religious groups.
[Link] Appropriate information
Simply because an information source is credible does not mean that we should
use it. It must also be relevant to our research. If it clearly supports our
hypothesis, or includes results which are preconditions for our results, then it is
probably appropriate.
9.5.3 Exercises
1. This section of the textbook focused on Research, and it begins with a list
of problems associated with online research. List the three main problems;
which one do you believe is the most problematic and why?
2. (a) Define plagiarism.
(b) Most institutions of secondary and higher education have strict poli-
cies against plagiarism and consequences associated with plagiarism.
Describe your understanding of plagiarism policies and consequences
associated with your secondary or higher education institution.
3. (a) Define credibility of a source.
(b) List the recommended ways of examining source credibility.
4. This section of the textbook was focused on research. Imagine you have
to write a research paper on the impact of COVID-19 on mental health.
How will the information provided in this section assist you with your
research?
Glossary
abstract - Having no evident details; non-concrete
abstraction - The process of separating ideas from specific instances of
those ideas
accessor method - A method which returns the value of a field, also known
as a getter
actual parameter - A parameter value to be passed to a called method,
also known as an argument
adder - A hardware component capable of adding fixed-length binary inte-
gers
AI - artificial intelligence
algorithm - A well-defined sequence of steps to solve a given problem, which
terminates with a correct solution
Amazon - Originally a vendor of books, online. Evolved into other products
as a distributor and software services
American Standard Code for Information Interchange - An 8-bit
numeric code for each character (ASCII); a subset of Unicode
AND - A boolean operation which results in true only if both operands are
true
API - Application Program Interface
application program interface - The information needed to use a software
module, (API)
argument - A parameter value to be passed to a called method, also known
as an actual parameter
array - A homogeneous collection of values which is mapped directly to the
computer’s main memory
artifact - Something created by humans, using tools; not occurring naturally
234
Glossary 235
artificial intelligence - A quality or feature of a computational artifact
which makes it appear to have natural intelligence (AI)
ASCII - American Standard Code for Information Interchange
assembler - Software which translates symbolic machine instructions pro-
grams to binary machine language
assembly language - A version of machine language with symbolic opera-
tions and memory locations
assignment - The binding of a data value with a variable
AWS - Amazon Web Services: Cloud computing services such as storage,
fast computing, and applications
bandwidth - A measure of the quantity of information which can be trans-
mitted over a communications channel per unit of time; usually measured in
bits per second
base - In mathematics, the value of b in be ; radix
binary - Base 2 number system
binary search - A search algorithm applied to a sorted List, which elimi-
nates half the values from consideration on each comparison
bit - A binary 0 or 1; a binary digit
Bitcoin - A a digital currency which uses cryptographic algorithms to ensure
security
Bitcoin mining - The process of creating new Bitcoins computationally
block - A group of statements in an algorithmic procedure
Block - A language for expressing algorithms, using graphic diagrams
byte - 8 bits
boolean - A data type with only two possible values: true and false
Cambridge Analytica - A British political consulting firm which was in-
volved, with Google, in a scandal during the 2016 US presidential election
client-server - A client makes use of resources provided by a server
cloud computing - Software services, such as applications and data storage
provided over the internet
combination - In algorithms, the process of calling a procedure from an-
other procedure
code review - A software development practice in which bugs are discovered
by carefully reviewing the source statements
comment - A programmer-supplied description, ignored by the compiler
236 Glossary
compiler - A program which translates a program written in a high-level
language to an equivalent program in machine language
conjunction - A logical operation which is false only when both operands
are false: OR
constant - A data value in a program, supplied by the programmer
control structure - A programming construct enabling an altered flow of
execution
core - A CPU within a (personal) computer
crowdsourcing - Usage of the internet to obtain ideas, goods, or services
from a large group of people
data compression - The process of manipulating information so that it
requires fewer bits
conditional - In an algorithm a decision operation; an IF statement
control structure - In an algorithm or program, a construct which deter-
mines which statement(s) are to be executed
data analytics - The application of data science
data science - The study of accessing and interpreting (large) quantities of
raw data
data stream - A specification of parallelism involving vector operations (see
Flynn taxonomy)
data structure - An organization of data to facilitate operations such as
search or sort
database - Software which enables one to organize and access data
De Morgan’s Laws - Boolean identities: The negation of a conjunction is
the same as the disjunction of the negations; The negation of a disjunction is
the same as the conjunction of the negations
debug - To remove the errors from a program
decision problem - A problem which as a solution of either ‘yes’ or ‘no’
decryption - The process of restoring information to its original form after
it has been encrypted
digital - The quality of discrete components of information, as opposed to
analog
digital logic - Components of a digital device performing boolean opera-
tions
disjunction - A logical operation which is true only when both operands
are true: AND
DISPLAY - An output statement in algorithms
Glossary 237
distributed system - A system in which many computers/users are simul-
taneously collaborating to share resources
distributed computation - A distributed system designed to solve a computation-
intensive problem
distributed file system - A distributed system designed to allow seamless
access to file systems on a network
distributed database - A distributed system designed to allow seamless
access to multiple file systems on a network
distributed operating system - A distributed system designed to allow
seamless access to multiple operating systems on a network
download - Transfer information from a remote, central computer, in the
’cloud’, to a local computer or digital device
encapsulation - A feature of object-oriented programming languages in
which the internals of an object are not directly available to the client
encryption - The process of modifying information for the purpose of con-
fidentiality, such that it can be restored to its original form
equivalence of algorithms - The determination that two different algo-
rithms always produce the same result and the same side effects for a given
input
exception - A software artifact which permits the programmer to trap and
handle run-time errors or failures
exponent - The e in be
expression - A variable, a constant, or an operation on two expressions
extremum problem - The problem of finding a minimum or maximum
value in a List of values
Facetime - A communications application which includes audio and video
fault tolerance - The capability of a computer, digital device, or network
to recover from the failure of one or more components
floating point - An approximate data representation for numbers which
need not be whole numbers, and which may be very large, or very close to 0
Flynn taxonomy - Nomenclature expressing the type(s) of parallelism in
a computer
FOR EACH statement - An iteration structure in an algorithm, associ-
ated with a List
formal parameter - A parameter in a method definition
free format - A lexical property in some programming languages in which
white space is ignored by the compiler
238 Glossary
G suite - Office applications offered by Google in the cloud, via a web
browser
getter - See accessor method
Global Positioning System - System of satellites sending signals to earth,
enabling devices to determine their exact location (GPS)
Google - Originally a search engine, evolved into email, computers, tablets,
browsers, and cloud computing services
GPS - Global Positioning System
heuristic - A series of steps which attempts to solve a given problem but
which may terminate with an incorrect, or approximate, solution
high-level language - A language such as Java, Python, or C++ which
enables humans to develop software; a programmming language
IDE - interactive development environment
IF statement - A one-way selection structure in an algorithm
IF-ELSE statement - A two-way selection structure in an algorithm
input - Data supplied by the user of a program
instagram - A photo and video sharing service
interactive development environment - software used to edit, compile,
and test programs being developed; IDE
interface - An adapting layer between two or more entities
instruction stream - A specification of parallelism in executing processes
(see Flynn taxonomy)
IO - Input and output
iteration structure - A control structure permitting repeated exection of
a statement, or block, in an algorithm; a loop
java - A high level programming language developed by Sun Microsystems,
later acquired by the Oracle corporation
learning management system - Software serving as an aid for teachers
library - A collection of software modules, such as classes
linkedin - A business and employment-oriented service
List - A Collection in which order is maintained, and duplicate values are
permitted
loop - An iteration structure in an algorithm or program
loop body - The statement, or block of statements, to be executed repeat-
edly in a loop
Glossary 239
machine language - The language of binary coded instructions which can
executed by the CPU
machine learning - Software or hadware capable of improving its own
performance as it executes.
massive open online course - Educational material available free on the
internet (MOOC)
Messenger - A Facebook application which can be used for transmission of
plain text
method - In Java, a procedure with optional parameters and an optional
returned value
MIMD - Multiple instruction streams, multiple data streams, in Flynn’s
taxonomy for parallelism
MISD - Multiple instruction streams, single data stream, in Flynn’s taxon-
omy for parallelism
mobile computing - Devices such as smartphones and tablets which are
easily portable, and which can be used for communication and sensing the en-
vironment
MOOC - Massive Open Online Course
mutator method - A method which permits the client to change the value
of a field, also known as a setter
nested loop - In an algorithm, or program, a loop defined to be entirely in
the loop body of another loop
NOT - A boolean operation which results in the logical complement of its
operand
one-way selection - In an algorithm, or program, a control structure with
only one possible choice of execution paths; an if statement with no else part
operation - A calculation on one or two data values, producing a new data
value, with possible side effects
OR - A boolean operation which results in false only if both operands are
false
output - Data produced by a program for a user
parallel computing - The simultaneous computation of independent tasks,
programs, or instructions
parameter - A variable used to send information to a procedure
pixel - One of the small dots making up an image; a picture element
post-test loop - In an algorithm or programming language, an iteration
240 Glossary
structure in which the loop body is executed once before the termination con-
dition is tested
pre-test loop - In an algorithm or program, an iteration structure in which
the termination condition is tested before the first execution of the loop body
program - A sequence of binary coded instructions in the computer’s mem-
ory
programming language - A language such as Java, Python, or C++,
which enables humans to develop software; a high-level language
radix - The base of a number system, e.g. 2, 8, 10, 16
RAID - Redundant Array of Inexpensive Disks; a fault tolerant storage
system recursive procedure - In an algorithm, a procedure which invokes
itself
redundancy - The replicaton of a component of a computer, digital de-
vice, or network which will allow it to continue processing after a failure of the
compenent. Used for fault tolerance.
RETURN - A statement in a procedure which terminates the procedure,
and which may return a specific value to the calling procedure
robotics - The discipline in which artifacts with human-like attributes and
capabilities are constructed
run time - The execution of a program, as opposed to the compilation
run-time error - An error in a machine language error, detected when the
program is executing
scale - A property of a system which performs well when provided with
much data to process
search - The problem of finding a given target value in a List of values
selection structure - A programming construct enabling a program to take
one of a few possible execution paths
sensor - A digital device capable of gaining information from its environ-
ment, such as a motion detector
sequence structure - A control structure in which statements are executed
sequentially in the order in which they occur in the program or procedure
sequential computing - Execution of instructions, tasks, or programs one
at a time (non-parallel computing)
sequential search - A search algorithm which examines all elements of
a collection until the desired value is found, or determined not to be in the
collection
client-server - See client-server
Glossary 241
SETI - Search for ExtraTerrestrial Intelligence
SETI at Home - A distributed computing project in which anyone could
participate in SETI
setter - See mutator method
side effect - A change in a program’s state, or output, resulting from an
operation
SIMD - Single instruction stream, multiple data streams, in Flynn’s taxon-
omy for parallelism
simulation - A process in which a natural or artificial phenomenon is mod-
eled in a computational artifact
SISD - Single instruction stream, single data stream, in Flynn’s taxonomy
for parallelism
Skype - A communications application which includes audio and video
social media - Communication media which enable people to communicate
through text, images, and video
sorting - The process of arranging the values in a collection in ascending
(or descending) order
space - Computer memory or secondary storage for data, usually measured
in bits or bytes
statement - In a procedure or program, an executable assignment operation,
procedure call, IF statement, or REPEAT statement
stochastic simulation - A simulation with probabilistic element(s)
string - Data consisting of a sequence of characters
TCP/IP - Transmission Control Protocol / Internet Protocol
Team - A communications application (Microsoft) which includes audio and
video
Text - An algorithm description language using plain text
thread - An independent process which can execute simultaneously with
other threads on a computer
Transmission Control Protocol / Internet Protocol - A standard com-
munication protocol on the internet (TCP/IP)
traveleing salesman problem - A shortest path problem in graph theory
truth table - A table showing all possible values of a boolean expression
involving several variables
twitter - An internet based service allowing users to post messages known
as ‘tweets’
242 Glossary
two’s complement - A binary representation system for negative, as well
as positive, whole numbers
two-way selection - In an algorithm or program, a selection structure with
a choice of two possible execution paths; an if - else statement
upload - Transfer information from a local computer to a remote, central
computer, in the ’cloud’.
user interface - Hardware and/or software used for human interaction with
a device or program
variable - In an algorithm or program a name representing a memory loca-
tion which may be assigned a value
virtual reality - Hardware and software which can give a person the the
auditory and visual information needed to effect any surroundings
visualization - The process of displaying information or natural phenomenon
in a form easily understood by humans
Webex - A communications application which includes audio and video
WeChat - A Chinese version of Messenger
WhatsApp - A text and voice messenging service
wikipedia - A free online encyclopedia in which articles are submitted by
experts from all over the world.
world wide web - The linking of documents on the internet
world wide web - The linking of documents on the internet
youtube - An internet based repository for digital video/audio
Zoom - A communications application which includes audio and video
The following glossary entries are for the Java version of this text-
book
! - Logical NOT operator, in Java
& - Bitwise AND operator, in Java && - Logical AND operator, in Java
| - Bitwise OR operator, in Java || - Logical OR operator, in Java ˜ - Bitwise
NOT operator, in Java
abstract class - A Java class which has one or more abstract methods, and
cannot be instantiated
application program interface - The information needed to use a Java
class or package (API)
Glossary 243
BlueJ - An IDE used to develop Java software
if statement - A one-way selection structure in a Java program
if-else statement - A two-way selection structure in a Java program
interface - In Java a class which has no fields and all methods are public
abstract; can be implemented by a class
signature - The part of a Java method, Python function, or C++ function
defining the access mode, return type, method name, and parameter list
toString() - In Java, a standard method used to convert a data object to a
String
void method - In Java, a method with no explicit return value
while statement - In Java, an iteratioon structure which does not specify
the number of times the loop body is to be executed; a pre-test loop
Index
cellular phone usage tracking, 74 reasonable time, 113
unreasonable time, 116
abstraction, 15 algorithmic languages, 80
data, 133 amazon web services (AWS), 202
in algorithms, 94 analysis phase
in hardware, 46 software development, 124
in procedures, 99 analytics, 12, 76
in programming languages, 42 AND
in programs, 38, 132, 148 logic gate, 46
in software, 41 anonymity, 222
reducing complexity, 133 API, 137
access APPEND, List operation, 90
to computing, 229 Application Program Interface, 137
to data, 78 Arab Spring, 220
accessor methods, in Java, 153 ArrayList, in Java, 152
adder arrays
binary, 53 in programs, 136
full, 51 artifact
half, 49 computational, 1
addition facebook, 2
overflow , 55 artificial intelligence (AI), 7
advertising, 224 ASCII , 29
AI, 7 assembler, 43
algorithm, 39, 80 assembly language, 43
abstraction, 94 assignment, 81
clarity, 108 assistive technology, 205
combination, 101 authenticity
control structures, 80 for cybersecurity, 175
nested, 93
equivalence, 86 bandwidth, 200
expressed with programming lan- base 16 numbers, 19
guages, 106 base 2 numbers, 17
implementation , 127 base 8 numbers, 17
languages, 106 binary adder, 53
performance, 112 binary number system, 17
performance evaluation, 119 binary search algorithm, 102
pretest loop, 89 binary sequences, 15
244
INDEX 245
biological populations combination
simulation, 62 in algorithms, 101
bitcoin, 191, 203, 219 commerce, 206
Block algorithmic language, 80 communication, 199
block, control structure, 81 communication systems, 12
BlueJ, 156 compile, 156
codepad , 158 compile-time bugs
debugger, 158 in programs, 142
IDE, 149 compiler, 3, 220
terminal window, 158 compression
boolean expression, 82 of data, 77
bugs computational artifacts, 1
compile-time, 142 concatenation of Strings, in Java, 153
run-time, 142 conditional, 82
conferencing software, 228
cable TV information, 73 confidentiality
Cambridge Analytica, 219 for cybersecurity, 174
cellular phone, 228 construction projects, 12
censorship, 220 constructor, in Java, 153
certificate context, 228
digital, 169 control structure
certificate authority, 176 iteration, 5
chat, 200 repetition, 5
Chrome selection , 5
web browser, 226 control structures, 5
Chromium in algorithms, 80
web browser, 226 iteration, 87
circuits nested, 93
logic, 49 selection, 82
classes sequence, 81
in java, 150 in programs, 127
client-server terminology, 189 Conway
climate Game of Life, 62
simulation, 64 copyright, 214, 217
climate change derived work, 224
model, 65 DMCA, 225
cloud computing, 202 of API, 137
code review core memory
in software development, 144 magnetic, 15
codepad core processors, 184
in BlueJ, 158 correctness
cognition, 199 of programs, 140
collaboration creative commons, 214
in processing information, 70 creativity, 1, 9, 216
in software development, 126 credibility
color images, 32 information source, 232
246 INDEX
crowdsourcing, 209 Digital Millenium CopyRight Act
cryptography (DMCA), 225
open standards, 176 discovery
cryptolocking software, 173 with information, 73
cybercrime, 172 DISPLAY statement in algorithms, 97
cybersecurity, 168 DISPLAY,in algorithm, 97
authenticity, 175 distributed application, 203
confidentiality, 174 distributed computing, 189
cryptographic , 174 application: computation, 190
human components, 171 application: databases, 192
in hardware, 170 application: file systems, 192
in software, 171 application: multimedia systems,
integrity, 175 194
personal, 174 application: operating systems, 194
with passwords , 174 application: real-time systems, 193
cyberwarfare, 171 compared with parallel computing,
189
distributed computing, definition, 181
data
distributed system, 79
in memory, 37
DMCA, 225
data , 69
DNA sequencing, 203
data abstraction, 133, 148
documentation
data analytics, 12, 76
external
data compression, 77
in software development, 126
data mining, 211
internal
data science, 12, 76
in software development, 125
data stream, 185
domain name, 161
data structure, 5
download, 202
database language, 43 duplicated code
database management, 7 in programs, 141
databases
scientific, 214 ECPA, 218
debugger, 158 education
in BlueJ, 158 online, 206
debugger software, 143 efficiency
debugging time and space, 77
programs, 142 election interference, 219
decision problems, 119 Electronic Communications Privacy Act
derived work (ECPA), 218
copyright, 224 email, 199
design phase encapsulation, 150
software development, 124 encryption, 78
digital certificate, 169 end-to-end architecture
digital devices, 15 of internet, 161
digital divide, 229 end-to-end encryption, 169
digital logic, 46 entertainment, 206
INDEX 247
equivalent algorithms, 86 global positioning system, 74
evaluation global positioning system (GPS), 204
of algorithms, 119 glove
evolution, 59 digital, 205
exceptions, 180 Google
exploitation lawsuit vs Oracle, 137
of information, 222 Google Chromium, 226
exploration GPS, 74, 204
with information, 73 graphic image
exponent representation, 30
in floating point numbers, 26 growth
expression, 81 internet, 167
external documentation, 126
extremum problem, 93 half adder, 49
hardware
facebook, 2, 201 levels of abstraction, 46
facetime, 200 health care, 206
fault tolerance, 178 heuristic, 62
in a network, 179 hexadecimal number system, 19
local, 178 hierachical design
fault tolerant system, 165 of internet, 164
Fibonacci sequence, 116 hierarchy
field, in Java, 153 of domain names, 161
firewall, 173 high level programming language, 3
flight simulator, 66 http, 163
floating point hypertext transfer protocol, 163
inaccuracy, 26
floating point numbers, 26, 135 IDE, 3, 154
exponent, 26 identity
mantissa, 26 logical, 48
Flynn, taxonomy for parallelism, 188 identity theft, 78
FOR EACH iteration, 91 IF statement, in algorithms, 83
formal logic, 46 image
four-color-map theorem, 12 representation, 30
full adder, 51 image processing, 6
function images
program, 6 color, 32
functionality import statement, in Java, 152
of programs, 144 infinite loop
in programs, 130
game development, 7 information
Game of Life cellular phone usage tracking, 74
Conway, 62 for discovery, 73
gates for exploration, 73
digital logic, 49 from cable TV, 73
global impact, 199, 217 from telephone usage, 74
248 INDEX
in purchasing, 75 languages
information , 69 for algorithms, 106
information visualization, 71 lawsuit
infrastructure, 229 Google vs Oracle, 137
innovation, 211 learning management system (LMS),
input, to a procedure, 98 200
input/output, 6 LENGTH, List operation, 91
INSERT, List operation, 90 library, software, 137
instagram, 201 LibreOffice, 226
instance variable, in Java, see field, 153 linkedin, 202
instantiation, of a class, 156 LinkedList, in Java, 152
instruction stream, 185 linux, 226
integer List interface, in Java, 150
representation in binary, 17 list,in algorithms, 89
integers lists
unlimited precision, 28 in programs, 136
Integrated Development Environment, logic
3, 154 formal and digital, 46
integrity in programs, 147
for cybersecurity, 175 logic circuits, 49
intellectual property, 224 logic errors
interaction, 199 in programs, 142
interface logic gate
Java, 150 AND, 46
internal documentation, 125 NOT, 46
internet, 160 OR, 46
XOR, 46
end-to-end architecture, 161
logic gates, 49
growth, 167
logical identity, 48
history of, 160
loop
packet switching, 164
in programs, 5, 130
redundancy, 164
scalability, 167 machine language, 220
standards, 163, 167 machine learning, 76, 211
interpreter, 3 main method, in Java, 154
inventory applications, 12 mantissa
IP address, 161 in floating point numbers, 26
iteration structure, 5 Markov chain, 61
in algorithms, 87 mathematics
in programs, 130 in programs, 147
iteration, through lists, 91 memory, 36
messenger, 201
java, 226 metadata, 218
classes, 150 method
java method, 132 in java, 132
java programming, 123 program, 6
INDEX 249
mimd, 188 in addition , 55
misd, 186
mobile computing, 209 package, in Java, 152
mobile phone, 228 packet switching, 179
model internet, 164
climate change, 65 parallel computing, 181
models, 57 parallel computing, definition, 181
modules parallel computing, instruction level,
in software development, 124 181
MOOC, 207 parallel computing, process level, 182
Moore’s law, 215 parallel computing, system level, 182
mutator methods, in Java, 153 parallel computing, vs. sequential com-
puting, 183
napster, 217 parameter
negative integers representation, 22 in subprogram, 6
Negroponte, Nicholas, 35 password , 174
network patent, 218
peer-to-peer, 219 peer-to-peer network, 219
network file system (NFS), 192 performance
non-integer representation, 26 of algorithms, 112
NOT performance evaluation
logic gate, 46 of algorithms, 119
NP-complete problem, 118 peripheral device, 6
NP-hard problem, 118 personal cybersecurity, 174
number systems, 17 phone
numbers, cellular, 228
floating point, 135 mobile, 228
seizure, 218
octal number system, 17 pixel, 31
one-way selection structure, 83 plagiarism, 231
open access, 214 plain text representation, 29
open software, 221, 225 pretest loop
open source, 214, 220 in algorithms, 89
textbooks, 227 primality testing
open source software, 225 program, 131
open standards privacy, 77, 221
for cryptography, 176 problem solution
optimization problems, 117 with program, 124
OR procedure
logic gate, 46 definition, 94
Oracle input, 98
lawsuit vs Google, 137 invocation, 94
output program, 6
and input, 6 return value, 96
output, in Java, 153 procedure, in an algorithm, 94
overflow processing information, 69
250 INDEX
program, 4 repetition structure, 5
compile-time errors, 142 research, 230
debugging, 142 resolution
duplicated code, 141 graphic image, 31
in memory, 36 RETURN statement in algorithm pro-
iteration structure, 130 cedures, 96
readability, clarity, 140 return value
run-time bugs, 142 procedure, 96
selection structure, 128 RGB , 32
sequence structure, 127 robotics, 8
program abstraction, 38, 132, 148 rubik’s cube, 13
program correctness, 140, 144 run-time bugs
program documentation, 125 in programs, 142
program functionality, 144
program verification, 140 scalability
programming internet, 167
java, 123 scale, 179
with BlueJ, 149 scaling, 207
programming environment, 3 search, 204, 206, 231
programming language, 220 binary, 102
abstraction, 42 sequential, 102
high level, 3 search algorithm, 102
programming languages, 106 search for extra-terrestrial intelligence
proof (SETI), 190
computer assisted, 12 security, 77, 221
property breach, 223
intellectual, 224 on networks, 168
proprietary software, 220, 221 selection structure
proving theorems in algorithms, 82
automatic, 13 in programs, 128
pseudo code one-way, 83
in algorithms, 106 two-way, 83
public data, 203 selection structure , 5
purchasing information, 75 sensors, 204
pythagorean triples, 13 sequence structure
program , 132 in algorithms, 81
in programs, 127
RAID, 180 sequential computing, vs. parallel com-
random numbers, 104 puting, 183
ransomware, 173 sequential search algorithm, 102
reasonable time servery, 189
for algorithms, 113 SETI, 203
redundancy, 178, 179 Short Message Service (SMS), 199
in internet, 164 side effects in algorithms, 96
REMOVE, List operation, 91 simd, 186
REPEAT iteration structure, 87 simple mail transfer protocol, 163
INDEX 251
simulation, 57 team, 200
climate, 64 telephone usage information, 74
flight simulator, 66 terminal window
for training, 65 in BlueJ, 158
in warfare, 61 testing phase
of biological populations, 62 in software development, 125
random numbers, 104 Text algorithmic language, 80
stochastic, 62 text representation, 29
sisd, 186 textbooks
skype, 200 open source, 227
smart infrastructure, 205 theorem proof, 13
sms, 199 theorem proving, 12
SMTP, 163 threads, Java, 185
social media, 75, 200 time
software efficiency, 77
conferencing, 228 tool
open, 221, 225 computational, 3
open source, 225 office package, 3
proprietary, 220, 221 programming environment, 3
software development, 123 toString() method, in Java, 153
analysis phase, 124 training
collaborative, 126 with simulation, 65
design phase, 124 Transmission Contol Protocol / Inter-
modules, 124 net Protocol, 163
program documentation, 125 transportation systems, 12
testing phase, 125 traveling salesman problem, 117
solvable problems, 118 trust model
sort algorithm, 102 of internet security, 169
sound truth table
representation, 33 logic, 48
source code, 220 twitter, 201
space two-way selection structure, 83
efficiency, 77 twos complement representation, 22
standards
for internet, 163 UDP, 163
internet, 167 undecidable problems, 119
stochastic simulation, 62 unicode, 29
stream, data, 185 unreasonable time
stream, instruction, 185 for algorithms, 116
stream, types of parallelism, 185 upload, 202
string processing use cases
in java, 135 in program testing, 144
subprogram, 6 User Datagram Protocol, 163
supply chain applications, 12
variable, 81
TCP/IP, 1, 161, 163 verification
252 INDEX
of programs, 140
video, 200
representation, 33
video production tools, 7
virtual reality, 206
visualization
of information, 71
Von Neumann, John, 37
warfare
simulation, 61
weather forecasting, 10, 58
webex, 200
wechat, 201
whatsapp, 201
whole numbers
representation in binary, 17
world wide web
page development, 7
XOR
logic gate, 46
youtube, 201
zoom, 200