0% found this document useful (0 votes)
7 views20 pages

Tip-Enhanced Raman Scattering Primer

Tip-enhanced Raman scattering Authors: - Christiane Höppener - Javier Aizpurua - Huan Chen - Stefanie Gräfe - Ado Jorio - Stephan Kupfer - Zhenglong Zhang - Volker Deckert 

Uploaded by

Matheus Vieira
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
7 views20 pages

Tip-Enhanced Raman Scattering Primer

Tip-enhanced Raman scattering Authors: - Christiane Höppener - Javier Aizpurua - Huan Chen - Stefanie Gräfe - Ado Jorio - Stephan Kupfer - Zhenglong Zhang - Volker Deckert 

Uploaded by

Matheus Vieira
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

nature reviews methods primers [Link]

1038/s43586-024-00323-5

Primer Check for updates

Tip-enhanced Raman scattering


Christiane Höppener 1,2, Javier Aizpurua3,4,5, Huan Chen6, Stefanie Gräfe , Ado Jorio8, Stephan Kupfer
1,7
,
1

Zhenglong Zhang6 & Volker Deckert 1,2


Abstract Sections

Tip-enhanced Raman scattering (TERS) is one of the few methods Introduction

to access the molecular composition and structure of surfaces with Experimentation


extreme lateral and depth resolution, down to the nanometre scale Results
and beyond. This Primer examines the underlying physical principles
Applications
driving signal enhancement and lateral resolution of TERS, laying
Reproducibility and data
the foundation for both theoretical understanding and practical
deposition
applications. Addressing critical factors such as reproducibility,
Limitations and optimizations
averaging and general limitations, we delve into the nuances of TERS
experiments. Various TERS modifications are introduced, highlighting Outlook

diverse optical geometries and tip feedback schemes tailored to


the specific experimental needs. State-of-the-art TERS studies are
showcased to illustrate its versatility, encompassing structural analysis
of biomolecules, nanoscale investigation of chemical reactivity
and exploration of the intrinsic physical properties of 2D materials.
These TERS applications serve as a comprehensive overview of
current advancements in the field, encapsulating the breadth of TERS
experiments.

Institute of Physical Chemistry and Abbe Center of Photonics, Friedrich-Schiller University, Jena, Germany.
1

2
Leibniz Institute of Photonic Technology, Jena, Germany. 3Donostia International Physics Center DIPC,
Donostia-San Sebastián, Spain. 4Ikerbasque, the Basque Foundation for Science, Bilbao, Spain. 5Department
of Electricity and Electronics, EHU/UPV, Donostia-San Sebastián, Spain. 6School of Physics and Information
Technology, Shaanxi Normal University, Xi’an, China. 7Fraunhofer Institute for Applied Optics and Precision
Engineering, Jena, Germany. 8Departamento de Física, Universidade Federal de Minas Gerais, Minas Gerais, Brazil.
e-mail: [Link]@[Link]

Nature Reviews Methods Primers | (2024) 4:47 1


0123456789();:
Primer

Introduction processes are mainly modulated by the surface properties of the given
Tip-enhanced Raman scattering (TERS) is a powerful vibrational plasmonic metal and by the binding mode, particularly the orientation
probing technique combining the inherent spectroscopic abilities of the adsorbed sample molecule with respect to the surface. Owing
of Raman scattering with substantial signal amplification and excep- to very accurate positioning of the plasmonic tip with respect to the
tional spatial resolution achieved through localized optical fields at the sample molecule, site-specific interactions lead to the modification
scattering tip apex1–3. Unlike other optical near-field microscopy tech- of the local chemical environment affecting the electronic structure of
niques, TERS enables chemical imaging with sub-molecular spatial the plasmonic hybrid system. These tip–molecule site-specific spec-
resolution. The localized optical fields at the plasmonic tip lead to tral modifications contribute to further enhancement of the lateral
strong enhancement of otherwise weak Raman signals, amplifying resolution.
them by several orders of magnitude, thus enabling sensitivity down
to the single molecule4–6. This unique combination offers chemical Optical properties of a plasmonic tip
specificity, allowing the resolution of vibrational signatures of materials The strong and ultra-resolved Raman signal obtained from scattering
and molecular species even at the subnanometre range7. tips is attributed to ability of metallic probes to localize electromag-
TERS facilitates the experimental exploration of the molecular netic fields below the diffraction limit. This localization arises from
structures of surface-bound molecules, overcoming the resolution the collective response of the electrons to the incoming light, which
limitations of diffraction optics by operating within the near-field sustains electromagnetic resonances and produces localized surface
optical regime. The signal amplification in TERS arises from the plasmon excitations at the tip apex. These excitations serve to confine
enhancement of the non-resonant or resonant excitation at a defined propagating light into tiny effective mode volumes around the nano-
wavelength. As a result, lateral resolutions much finer than conven- structure, thus overcoming the diffraction limit. Owing to this light
tional optical microscopes can be achieved, reaching single-molecule localizing and enhancing effect, metallic nanostructures have been
or sub-molecular sensitivity. Understanding the underlying physical often called optical nanoantennas, with different geometrical configu-
mechanisms driving TERS applications at the nanometre and subna- rations developed to tailor the wavelength and properties of the local
nometre scales has led to continuous theoretical advancements in field associated to these resonances. Commonly used nanostructures
describing the specific contributions to signal amplification, even include nanorods, nanoshells, nanodimers, nanogaps and metallic tips.
within a quantum mechanical framework. The optical response and localization of electromagnetic fields around
The remarkable TERS capabilities were initially demonstrated metallic tips can be modelled using methods such as finite element
through detailed investigations into intrinsic material properties of methods43, finite-difference time-domain methods44 or boundary
condensed matter and structural properties of biomolecules, such element methods45,46 (Fig. 1a). The field enhancement produced by a
as high-resolution studies of carbon nanotubes8,9 revealing chirality typical metallic tip (radius of ~20 nm) is approximately 10-fold larger
changes10, defect identification11 and strain probing12,13. Similar aspects than the incident field below the tip apex. This enhancement can be
are now being explored in TERS studies of a variety of 2D materials14. intensified when the tip is located on a metallic surface, generating a
TERS is also highly valuable for studying molecular interactions15–19, coupled plasmonic gap47. Although the enhancing power of a standard
molecular monolayers20,21, molecular orientations22, biopolymers plasmonic gap is remarkable, this alone is not capable of explaining the
such as peptides, proteins and fibrils23–31, polymer films and nano- ultrahigh spatial resolution (<1 nm) recently achieved. Atomic-scale
structures32–36, as well as nanoscale chemical reactions37–42. This Primer protrusions at the tip are capable of further confining light to single
focuses on selected applications in solid-state physics, chemical reac- atoms, with a threefold to fivefold signal enhancement48,49, leading to
tivity and biological nanoscale analysis to illustrate the broad scale of the term picocavity to refer to atomic-scale light localizing features of
potential applications. these atomic protrusions50,51. The use of picocavities in scanning tips
has enabled state-of-the-art TERS experiments where intramolecular
Theoretical description of TERS vibrational features are now routinely resolved52–55.
To understand the remarkable resolution and enhancement prop-
erties of TERS theoretically, various electromagnetic and chemical Chemical aspects of tip–sample interaction
interactions must be considered. Chemical effects become prominent at close tip–sample ranges
The enhancement in TERS involves two main contributions. (<1 nm), forming site-specific hybrid systems of metal atoms from
First, the electromagnetic enhancement results from locally con- the plasmonic tip and the sample molecule (Fig. 1b). These effects
fined and intensified enhanced electric fields and gradients near a include ground state interactions between the tip and sample, reso-
metal interface, typically resonantly enhanced owing to plasmonic nance contributions and from charge-transfer phenomena, collectively
modes in specific geometrical configurations, such as the plasmoni- referred to as non-resonant, resonant and charge-transfer contribu-
cally active tip apex used in TERS. This enhancement substantially tions, respectively. Theoretical approaches48,51,56–66, such as the dis-
improves the Raman signal of molecular species within this near field. crete interaction model or quantum mechanical model60–62, combine
Second, chemical interactions arise from close-range, site-specific time-dependent density functional theory (TDDFT) simulations for
interactions between the surface-bound sample and the metallic the molecular sample with atomistic electrodynamics simulations
nanoparticle. These interactions include non-resonant and resonant for the nanoparticle to model such plasmon-molecule hybrid systems
contributions, as well as charge-transfer phenomena between the sam- accurately. Charge-transfer contributions are particularly relevant
ple and the plasmonic nanoparticle. Such charge-transfer processes at close tip–sample distances, influencing resolution and plasmon-
are particularly prominent at close tip–sample distances and when induced catalysis. Incorporating sufficient metal atoms from the tip
sample molecules are adsorbed on metallic surfaces; they modify at short tip–molecule distances into the quantum chemistry is essen-
the electronic structure of the molecule when located near the plas- tial for an accurate description of charge-transfer states in scanning
monic subsystem. In surface–sample interactions, such charge-transfer tunnelling microscopy (STM)-TERS studies.

Nature Reviews Methods Primers | (2024) 4:47 2


0123456789();:
Primer

a Electromagnetic effect

Plasmonic gap Plasmonic nanocavity Picocavity


Picocavity

Tip

5–10 nm
substrate

b Chemical effect c Combined 'chemical' and 'electromagnetic effect'

44
7

Silver sphere (r = 100 Å) z=5Å 6

4
z=0Å
3
z=5Å
2
z = 10 Å
1

0
–3.38

Fig. 1 | Simulation of plasmon-enhanced Raman signals, combining shown adenine molecule, the chemical effect stems from locally enforced
electromagnetic and chemical enhancement. a, Scaled interactions of an molecule–tip configurations, based on the overlap of the semi-occupied silver
illuminated tip: nanoscale enhancement owing to a gap formation between orbital and the π-system of adenine. At larger (z-)distances, the electromagnetic
two plasmonic particles; additional field enhancement owing to atomic- effect dominates the modulation of the Raman signal. c, A full description of
scale protrusions (picocavities); representation of the strong localization the chemical and electromagnetic effects can be obtained by incorporating the
of a picocavity (here with an additional gap mode); full representation of electric near-field, which can be obtained by finite-element method simulations,
extreme field localization with respect to a molecule184. b, Site-specific local into the quantum chemical simulation. As a model, a tin(II) phthalocyanine
chemical interactions between sample and plasmonic tip, mimicked by a molecule is placed below the tip as shown in xz and xy plane (left and right,
single silver atom and a sample molecule (xy plane). Three-dimensional grid respectively). Part b reprinted from ref. 67, CC BY 3.0. Part c adapted with
calculations with varying tip–sample positions are performed to chemically permission from ref. 80, American Chemical Society.
map the localized interaction of the sample with the plasmonic tip. For the

When simulating TERS and resonance Raman spectra67–70, the plas- excited states are energetically close to the incident wavelength in the
monic tip scanning over the substrate can be represented by an individ- experiment, both non-resonant Raman and resonance Raman spectra
ual metal atom or a small cluster, such as the Ag20 and Au20 clusters69,71,72. need to be calculated, as these contribute substantially to resonance
At each relative tip–sample position, the electronic structure is cal- excitation69,70,75. Notably, the properties of charge-transfer states are
culated using quantum-chemical methods such as density functional highly sensitive to the local tip–molecule interaction, in particular
theory (DFT) for non-resonant terms and TDDFT for resonance and if polarized along the electric field, whereas locally excited states of the
charge-transfer terms, as well as the corresponding Raman and possibly sample are typically less affected by chemical modifications induced
resonance Raman spectra67,70,73,74. These calculations enable tracking by the metallic nanoparticle. The combination of these contributions
of potential site-specific changes in the electronic structure and the generates a TERS map of the molecule, facilitating chemical imaging.
occurrence of charge-transfer states. This includes characteristics such
as metal-to-molecule charge-transfer, which can result in a partially Electromagnetic and chemical effects
positively or negatively charged tip, inducing dipole moments, bond The electromagnetic and chemical contributions to TERS have tradi-
order changes and the energetic position of the state. If electronically tionally been treated separately. However, recent approaches have

Nature Reviews Methods Primers | (2024) 4:47 3


0123456789();:
Primer

aimed to integrate these contributions to understand their combined transitions90. Similarly to all Raman spectroscopies, optical filter com-
impact on signal enhancement, spatial resolution and chemical speci- binations are crucial for rejecting unwanted wavelengths — such as
ficity. Hybrid multi-scale calculations, such as those using the GPAW cleaning the excitation wavelength — and suppressing the Rayleigh
code76,77, allow for the inclusion of electromagnetic near-fields into line in the detection path91,92.
electronic structure calculations at the tip–sample interface78–80. TERS signal detection can involve capturing full spectroscopic
Additionally, methods have been developed to incorporate the effect information using a charge-coupled device (CCD) camera-coupled
of strongly inhomogeneous local fields, such as those in picocavi- spectrograph or focusing on intensity maps of specific marker bands
ties formed by atomic protrusions, into quantum calculation of the using a single-point photodetector. The latter approach accelerates
Raman polarizability tensor81. This captures the effects of inhomoge- data acquisition times, enabling mapping at smaller step sizes within
neous fields but misses important quantum effects connected with acceptable acquisition times. Faster acquisition time trades off with
charge-transfer to the metal. Alternatively, the near-field around the tip the amount of information obtained, as information encoded in the
apex including atomic-scale protrusions can first be calculated43,51,82,83 entire spectrum — such as the band shifting related to specific bond
using a standard Maxwell’s equation solver43. The resulting near-field is conformations — is lost. Careful consideration of total recording time
represented by carefully placed point charges, which can be included is necessary to address the effects of mechanical and thermal drift,
in the quantum chemical calculations, enabling the assessment of the particularly in ambient and liquid environments. Additional drift compen­
impact of the near-field on the electronic structure and the correspond- sation approaches can be optionally implemented into TERS setups.
ing Raman spectra80. The sample molecule is subsequently mapped by These use in situ drift correction to maintain the tip within the optimal
the tip and the local field that follows the tip position (Fig. 1c), disen- illumination volume, enabling ultra-stable tip-enhanced scattering
tangling the effects of the metal proximity’s chemical contribution, the conditions for robust long-term mapping and imaging over large sam-
electromagnetic near-field and the combination of both. Such analysis ple areas and at sufficiently small step sizes. Both lateral drift compen-
shows that particularly the charge-transfer states are affected when sation of the tip position and axial focus drift correction systems rely
including the contribution of the electromagnetic field. This approach on a feedback-controlled piezoelectric actuation to adjust the tip or
has demonstrated that the atomic-scale site sensitivity originates from focus position, relying on optical readouts93–96 such as Rayleigh scat-
chemical effects while incorporating the electromagnetic near-field tering at the tip.
leads to an additional overall enhancement of the signal80. The second sub-system of a TERS microscope deals with the
This Primer aims to provide a concise introduction of the current precise spatial manipulation of the tip and the sample. Lateral manip-
theoretical and experimental aspects of TERS. As applications continue ulation of the sample is achieved using a close-loop piezoelectric
to diversify, ranging from nanoscale compound identification to the scanner, while maintaining the vertical tip position usually relies on the
investigation of chemical reactivity, the selected results achieved using principles of atomic force microscopy (AFM)97 or scanning tunnelling
TERS represent the current state-of-the-art in this evolving field. Finally, microscopy (STM)98.
general challenges inherent in working with sample volumes deviating
from bulk behaviour are addressed. AFM-based TERS. In AFM-TERS the tip–sample distance is regulated
by probing the normal forces, such as short-range repulsive Coulomb
Experimentation interactions99, attractive van der Waals interactions and superimposed
Instrumentation long-range electrostatic and capillary forces (Fig. 2). Alternatively,
TERS experiments typically involve mapping a region of interest using shear-force interactions100 between the tip apex and the sample can be
a TERS tip in a predefined pattern to record the Raman signal at speci- used, offering the advantage of eliminating the need for an additional
fied positions. The number of pixels of the pattern usually determines light source for control.
the lateral resolution, ensuring that the resulting step size is equal to or Force detection involves sensitive force sensors, such as can-
smaller than the lateral confinement at the tip apex. TERS instrumen- tilevers or piezoelectric quartz tuning forks. A sensitive feedback
tation consists of an optical setup to excite and collect the scattered loop controls the vertical tip–sample distance and prevents the tip
Raman signal, either in transmission or reflection mode, and a tip– from crashing into the sample (Fig. 2). Contact and non-contract AFM
sample manipulation system to precisely control the movement of operation modes are distinguished based on the applicable tip–sample
the tip with subnanometre precision (Fig. 2). interaction97,101,102 (Fig. 2), with their impact TERS signal enhancement
The optical setup includes an illumination system to focus laser outlined in Box 3.
light with controlled polarization onto the apex of a plasmonic tip, Long-range capillary forces are a frequent issue under ambient
a collection system to gather the scattered light while suppressing conditions, and can strongly influence feedback and the minimum
unwanted contributions using suitable filter and a detection system. stable tip–sample distance. This can be addressed by moving from
Various illumination schemes have been developed to accommodate ambient conditions to ultrahigh-vacuum (UHV) or liquid environments.
sample and spatial constraints (Box 1). Plasmonic nanofocusing-based In the latter case, additional liquid-substrate and liquid-cantilever
tip concepts have been introduced84–86 to separate the bulk excitation force interactions generally require different feedback parameters to
volume from the nanoconfined excitation volume at the tip apex, maintain a stable tip–sample distance.
effectively suppressing background noise (Box 2). Spatial coher-
ence and momentum matching of the incident field can be achieved STM-based TERS. STM-based TERS uses precise positioning and gap
through adaptive optics87, enhancing light coupling to the tip88,89. The separation distances provided by the tunnelling current between
use of a fixed or tunable excitation wavelength depends on experi- a conductive tip and a conductive sample. Applying a bias voltage
mental requirements, with fixed being the most frequent approach, between tip and sample generates a net electron flow that is highly
and excitation-dependent TERS using the tunable approach ena- dependent on the distance between them, allowing for a very sta-
bling, for instance, the distinguishing of species with varying optical ble tip–sample distance regulation via a feedback loop. Although

Nature Reviews Methods Primers | (2024) 4:47 4


0123456789();:
Primer

Aa AFM-TERS with bottom illumination Ab Distance dependence Ac Feedback Loop


of the tip-sample
Mirror interaction force
4-quadrant
photodiode
Photodiode Contact

Short-range repulsive
P Laser mode
3 A
diode A–B
Uout= Piezo
A+B
2
B +
Cantilever

Force (nN)

forces ~z-13
Beam BS 1
expander Tapping
LF – Ucorr
LF/BF mode Long-range forces
CCD Lens 0 +
Slit Contact Uref PID
Photon Short-range attractive controller
Lens -1 point
Laser counting VdW-forces ~z-7
module
0 1 2 3 4
SM
Distance (nm)
Spectrograph
Ba STM-TERS with side illumination Bb Distance dependence of Bc Feedback Loop
the tunneling current
Tip
25 10
Laser Φ Vbias
0 EF
-10
20

ln(It)
Beam expander -20
Photon Mirror -30 Sample
counting 15 -40
module fA current -50 +
Lens LF/BF BS P
It (pA)

amplifier 0 4 8 12 16 20 Piezo
Ucorr –
10 Distance (Å) It
LF Ubias
It = Io e - 2 kt z
CCD Grating Lens 5
kt = √(2 me Φ) / ħ
Slit Uerr –
Metal tip 0 +
3 4 5 6 7 8 PID
SM Spectrograph Distance (Å) controller Uref

Fig. 2 | TERS setup configurations. A, Transmission mode AFM-TERS (atomic and monotonically changing tunnelling current It (bottom) used as a feedback
force microscopy combined with tip-enhanced Raman scattering spectroscopy), signal in AFM and STM. Ac,Bc, Outline of AFM (part Ac) and STM (part Bc)
with bottom illumination. B, Reflection mode STM-TERS (scanning tunnelling feedback loop to control the tip–sample distance. A bias voltage Ubias is applied
microscopy combined with tip-enhanced Raman scattering spectroscopy) with to shift the Fermi-level Ef of the tip and sample to enable electron tunnelling. The
side illumination. Aa,Ba, Outline of the respective excitation, collection and measured sensor signal is compared with a predefined reference signal Uref (set
detection path, based on stable narrow linewidth laser, a beam expander often point). After amplification, this signal is further processed in a feedback loop
in the form of a spatial filter, polarization optics (P) for laser mode conversion (here, a proportional-integral-differential (PID) controller), yielding an accurate
(optional), and an objective to tightly focus the laser beam to the tip–sample area correction function Ucorr, resulting in a sensitive and stable tip–sample distance
and to collect the scattered Raman signal. The collected signal is either focused with subnanometre precision. BS, dichroic beam splitter; CCD, charge-coupled
onto the active area of a photodiode (point detection) or is focused onto the device; LF/BF, ultra-steep edge long pass or band pass filters; SM, spherical
entrance slit of the spectrograph for spectrally resolved multichannel detection. mirror; Uerr, error signal; vdW, van der Waals.
Ab,Bb, Distance dependence of the non-monotonically varying force (top)

STM-TERS and AFM-TERS use different physical properties, both only for STM cryogenic UHV conditions, prospectively (sub-)molecular-
achieve similar experimental feedback. However, STM-TERS is lim- resolved TERS might be achieved with AFM-based modalities and
ited to conductive substrates or very thin non-conductive samples on ambient conditions in the future.
conductive substrates.
Comparing the two TERS systems, AFM-based TERS offers TERS tip concepts
flexibility, applicability to various sample types and environments, The quality of the tip directly impacts the resolution and image
large scanning ranges and fast scanning speeds. By contrast, STM- quality of scanning probe microscopy (SPM) and TERS measurement.
TERS systems provide greater stability, making tip–sample distances Parameters such as tip material, curvature radius, cone angle and sur-
easier to control. Both systems can achieve subnanometre resolution face morphology substantially influence TERS sensitivity by affecting
and single-molecule level sensitivity53,54, with further improvement plasmon resonance and electromagnetic field intensity. These param-
possible in low-temperature and high-vacuum environment. The UHV eters usually depend on the fabrication method and the precision at
environment eliminates the competitive adsorption interference of air the nanometre scale, and are tuneable via the size and shape of the
impurities and slows down the photobleaching of samples, reduces the plasmonic tip, respectively. TERS enhancement is generally greater
thermal drift of the sample and improves the stability of the system. when the tip surface plasmon resonances match the excitation and/or
Although, sub-molecular resolution currently has been demonstrated emission wavelength, and tips with sharp ends and smooth surfaces

Nature Reviews Methods Primers | (2024) 4:47 5


0123456789();:
Primer

dissipate less heat. Various tip designs have evolved to control these resolution; tips are usually bombarded with argon ions, then heated
parameters103, using fabrication methods such as focused ion beam with electron beams and modified on the flat metal surface of the single
milling, electrochemical etching methods104, physical vapour depo- crystal. This strategy is most often used for STM-TERS tips. Physical
sition and e-beam lithography. Simple shearing of wires is the easiest vapour deposition methods reliably produce TERS active tips, however,
machining method, albeit lacking reproducibility, whereas electro- intrinsically the precise localized plasmon resonances are variable.
chemical etching methods produce tips with the desired aspect ratios which is overcome by introducing nanostructures at the tip apex, such
and surface conditions by adjusting etching voltage, etching solution as thin silver film resulting in AgNP-decorated tips or plasmonic cavi-
composition and concentration and wire immersion105. Here subse- ties106–108. The incorporation of picocavities at the tip end can provide
quent formation of metal atomic clusters can further enhance spatial Ångström-scale resolution and electromagnetic field enhancement,
albeit with reduced lifetime under ambient conditions109.
To extend the lifespan of the tip, a dense protective layer is occa-
Box 1 | Basic TERS illumination schemes sionally applied to the metal tip110–113. Additionally, to minimize leakage
currents from the tip of STM-TERS at the liquid–solid interface, the
Side or top illumination (preferred in STM-TERS) tip may be coated with substrates such as polyethylene paraffin wax,
• Thick and opaque samples zapon or nail polish114,115.
• Long working distance, low numerical aperture (NA) objectives
• Direct (oblique) sample irradiation Data recording and processing
- Strong Raman background signal Modern SPM controllers facilitate fast acquisition channels, accu-
- Restriction to a Gaussian laser mode mulating transistor–transistor logic (TTL) output signals from point
- Low light coupling and collection efficiency detectors for intensity mapping as a function of the tip position.
- Poor image quality, owing to non-vertical arrangement of the Full spectral information acquisition requires synchronization of tip
imaging path and the sample–tip motion and spectrum acquisition, typically achieved through hand-
• Alternative use of a parabolic mirror185 (not shown in the figure) shaking procedures. The communication between the SPM and optical
to avoid the low NA drawbacks detection units involves TTL signals defining the start and stop signals
for the optical data acquisition. Various software tools are used for
Bottom illumination (preferred in AFM-TERS) data correction, storage and analysis. Self-written Matlab programs
• Thin and (semi-)transparent samples or commercial software packages such as Vista Control software are
• Applicability of high NA objectives (≫1) used to correlate individually recorded TERS spectra with the AFM
• Applicability of higher-order vortex beams tip position. SPM data are stored in controller brand-specific data
- Tightly focused laser spots file formats. Several freeware data analysis software tools, such as
- Strong longitudinal field components Gwyddion116, can be used for data treatment and statistical evalua-
- Reduced direct sample irradiation and smaller Raman tion of parameters. TERS spectra are stored usually as text files and
background signal are subject to univariate and multivariate data analysis. Combined
- Higher signal-to-noise ratio with quantum-chemical calculations, assignment of Raman bands
- Higher light coupling and collection efficiency can identify the composition and orientation of certain compounds.

Top
Results
TERS experiments target specific material properties and functions
NA ≤ 1 based on spectroscopic frameworks derived from preliminary exper-
imental and theoretical data sets or archived Raman spectroscopy
databases. The TERS spectrum of a compound should resemble the
Side Tip peak pattern of the corresponding conventional bulk Raman spectrum,
although the tip can slightly influence spectra, and also the number
of molecules observed in an experiment may not provide an average
1

result. Therefore, displaying unprocessed, representative TERS spectra



NA

is recommended to obtain an unbiased estimate and rule out potential


Opaque sample
experimental influences.
Transparent
sample
Tip-induced spectral deviations
TERS spectral patterns can deviate from conventional Raman spectra
owing to tip-induced variations. Additional instrument-specific Raman
NA >> 1 bands can arise; for example, silicon cantilever-based tips produce
Bottom
peaks at 520 cm−1 and ~900–1000 cm−1, corresponding to the silicon
phonon band and its overtone, respectively (Fig. 3a). Serious issues
Radially polarized beam
(linearly polarized beam) arise from tip aging, damage and inefficient light coupling, leading to a
gradual or abrupt signal intensity loss and affecting the signal-to-noise
AFM, atomic force microscopy; STM, scanning tunnelling microscopy; TERS, ratio (SNR). Transiently emerging or remaining undesired Raman bands
tip-enhanced Raman scattering. caused by molecules temporally or permanently residing at the tip apex
or on the tip shaft can be confused with desired surface-specific Raman

Nature Reviews Methods Primers | (2024) 4:47 6


0123456789();:
Primer

Box 2 | Advanced TERS modes for enhancing the sensitivity and stability
Plasmon nanofocusing84–86,186–189 • Minimization of energy losses demands for smooth metal surfaces
• Applicable to a broad wavelength range • Sophisticated nanofabrication tools with nanoscale accuracy are
• Spatial separation of the bulk excitation volume from the required
nanoconfined sample irradiation
• Use of integrated surface plasmon–polariton (SPP) couplers, for Adaptive illumination87,190
example, grating, cavities and photonic crystals • Momentum and phase matching according to the atomistic
• Gradual compression and propagation of the excited SPPs to the tip structure of the tip–sample
apex along the tapered tip shaft in the limit of adiabatic SPP damping • Compensation of distortions of the laser focus upon transmission
• SPP amplitude enhances along the propagation direction through thick samples and samples with varying index of
- Nanoscale energy compression of the incident light into refraction (IoR)
volumes of only several cubic nanometres • Iterative adjustment processes based on the optimization of
- Spot size is determined by the atomic structure of the tip and the a tip-induced reference signal, for example, tip-enhanced
non-local electronic response (spatial dispersion) luminescence
- Efficient background suppression - Tip-enhanced Raman scattering (TERS) with nearly perfect laser
- Low energy losses beam profiles
- SPP propagation depends critically on taper angle and length - Improvement of the light coupling efficiency and TERS signal
of the tip, metal film thickness, and material properties of the stability
metal–dielectric interface - High signal-to-noise ratios achievable

marker bands. Tip contamination is hallmarked by exceptionally high information depth, resulting in the absence of specific Raman marker
peak intensities which obscure these Raman bands. Permanent tip bands owing to shielding effects of certain functional residues in mac-
contamination can be assessed by retracting the tip 10–100 nm from romolecules128. Additionally, shifts in the peak position in TERS spectra
the sample surface or by comparing with a TERS substrate spectrum may occur owing to metal–molecule charge-transfer mechanisms, par-
and identifying whether the signal persists. ticularly evident when chemical enhancement becomes non-neglecta-
Various factors, including sample degradation and tip–plasmon- ble in TERS investigations using the STM point contact regime129,130.
induced reactions, can lead to additional peaks in the TERS spectra. These effects, tied to the high resolution capabilities of TERS, enable
For example, the dimerization of p-nitrothiophenol (pNTP) to 4,4′- conclusions regarding the immediate vicinity of the molecule under
dimercaptoazobenzene (DMAB)37,38,117–119 may show vibrational bands investigation.
of the newly formed azo group after the dimerization of pNTP, whereas
pNTP-specific modes decrease or completely disappear (Fig. 3a). Sam- Standardization and quality control
ple degradation owing to light irradiation can cause significant arti- Standardization of TERS experiments is crucial to ensure independent
ficial changes in a TERS spectrum, which are not representative for information gathering and to achieve high-quality, reproducible and
the analyte. Plasmon-induced charge-driven dissociation has been comparable experimental data. Standardization involves following well
identified as a major degradation mechanism for biological samples specified sample preparation protocols and measurement routines
such as peptides and proteins120. Thermal dissociation may occur at commonly used in Raman and surface-enhanced Raman spectros-
very high laser powers. Sample burning of organic compounds is often copy and in scanning probe microscopy. Particularly routine refer-
accompanied by strongly fluctuating peak patterns and the appearance ence measures and protocols, such as choosing a suitable feedback
of broad bands at 1350 cm−1 and 1570 cm−1 associated to the G-band and mode and illumination–detection configuration, as well as adjustable
D-band of carbonaceous species121,122. Other TERS spectral deviations procedures to adapt to experiment and sample properties. Careful
from Raman bulk spectra can be attributed to modified Raman selec- adjustment of laser power density, wavelength and data integration
tion rules thus, non-active Raman modes can become active owing to time per spectrum is necessary to optimize the SNR and prevent sample
strong transverse and longitudinal field gradients87,123–126, which couple damage. Additionally, obtaining a statistically meaningful number
to quadrupole–quadrupole interactions. Particularly, adaptive optical of spectra per area is essential for reproducibility. Beam alignment
irradiation schemes demonstrated that infrared-active Raman modes and spectrometer calibration must be monitored on a regular basis
can be selectively turned on and off through phase modulation87. to ensure data comparability.
In a TERS experiment, the absence of certain vibrational modes Quality control of experimental datasets is necessary, and it is
and differences in the intensity ratio of certain marker bands can be important to adhere to routine referencing and assignment for Raman
influenced by specific excitation conditions. TERS tips that provide and scanning probe microscopies. This involves impartially evaluat-
strong electromagnetic field enhancement factors typically gener- ing the TERS data based on SNR. Only high-quality data should be
ate strong longitudinal field components. These components are considered for reliable postprocessing. Each spectrum is inspected
orthogonal to the substrate and sample plane, and mainly excite vibra- for outliers and potential tip-induced alterations to obtain a set of
tional modes associated in this direction, whereas in-plane vibrational marker bands representative of a pristine TERS spectrum. Raman data
mode enhancement, typical for normal Raman microscopy, is less analysis may be hindered by detector sensitivity to cosmic rays, lead-
efficient127. Altered TERS spectra may arise also from the confined ing to occasional spikes in intensity, which can be identified by their

Nature Reviews Methods Primers | (2024) 4:47 7


0123456789();:
Primer

spectrum recorded at a retracted tip position (Fig. 3b). Alternative


Box 3 | Impact of different feedback modes methods such as asymmetric least square smoothing, derivative or
on the TERS signal enhancement nonlinear interactive peak clipping algorithms can be used. However,
these post-processing steps carry the risk of causing unwanted TERS
In scanning tunnelling microscopy (STM) and atomic force spectra modifications and should be applied cautiously, preferably
microscopy (AFM) contact modes, the tip remains continuously at only with high quality data to avoid over fitting.
a distance ≪1 nm, resulting in a nearly constant electromagnetic
field enhancement across the entire signal integration time. For TERS data analysis
an AFM shear-force mode, the small lateral oscillation of the Owing to various experimental effects on TERS spectra, displaying
tip (oscillation amplitude ≪1 nm) does not affect the vertical tip unprocessed TERS spectra for initial assessment is recommended.
position; therefore, the tip continuously remains at much larger Data analysis focuses on identifying peak patterns from molecular
distances (>1 nm), leading to lower enhancement capabilities. For functional groups via specific peak parameters such as wavenumber
the tapping mode AFM feedback, the tip–sample distance changes position, intensity and peak width. Individual peaks are fitted with a
across a range from <1 nm (contact regime) to over 5 nm, according Lorentzian or mixed Lorentzian–Gauss function. The fitted positions,
to the applied oscillation amplitude. Consequently, the obtainable intensity ratios and widths of all peaks ideally well match the raw spectra
enhancement continuously changes from high to low, and it only and allow to draw conclusions regarding molecular orientations and
remains for a minor period of the total signal integration time in the tip–sample interactions. The fitting of a band provides quantitative
optimal tip–sample distance regime associated with a maximum information about the numerical peak parameters, although direct
signal enhancement. Utilizing a tapping mode–feedback mode relation to structural parameters is generally not possible, instead
leads to an average signal enhancement much lower than for the requiring molecular modelling approaches.
AFM or STM contact modes191, at lower mechanical stress192. Hence, Univariate data analysis extracts information on selected Raman
to obtain a good signal enhancement, the oscillation amplitude bands in the form of averages and distributions. Advanced analysis
of the tip should be reduced as much as possible while enabling methods, such as multivariate data analysis methods27,54, reduce data
stable feedback conditions. Alternatively, time-gated illumination or dimensionality and extract relevant information from TERS spectra,
detection modes synchronized with the tip motion can be applied owing to the high correlation of some Raman bands that share the same
to record the TERS signal only for the small tip–sample distances source of variation131,132.
near the contact point.
TERS correlation with other properties
TERS signal Tapping Shear-force Contact Constant Understanding the collective and cooperative properties of, and the
enhancement mode mode (AFM) mode (AFM) current (STM) roles of electrical and mechanical forces involved in these processes,
is crucial for comprehending material behaviour and limitations. In
Tip oscillation ≥5 nm, ≪1nm, – –
amplitude vertical lateral recent years, there has been a focus on the development of multimodal
and correlative approaches in various fields. These approaches offer
Minimum <1 nm ~1 nm ≪1 nm ≪1 nm
the potential to enrich our understanding of molecular processes by
tip–sample
distance considering complementary sample properties or using different
spatial or time resolution capabilities.
Effective 0–6 nm ~1 nm ≪1 nm ≪1 nm
tip–sample
Initially aimed at elucidating chemical composition and structure
distance of materials, TERS has evolved to serve as a fundamental platform for
multimodal and correlative investigations when combined with AFM
Signal 5–75% <50% 100% ~90%
enhancement and STM modes; these combined techniques provide synchronous
information into chemical composition, structural properties, sample
The effective TERS signal enhancement critically depends on the applied feedback
mode to control and maintain the tip–sample distance, owing to the vertical tip–sample
topology and mechanical and electronic properties. The addition of
distance dependence43. other standalone methodologies, such as micro-Raman spectros-
copy, nano-infrared (nano-IR) spectroscopy, tip-enhanced photo-
luminescence and electron microscopy is also useful for extracting
ultranarrow band width and often removed without losing information. additional information. These integrated approaches using TERS as
Spectra normalization can mitigate experimentally induced inten- a pivotal method paired with complementary techniques are termed
sity variations caused by laser power fluctuations, mechanical drifts synergistic TERS.
or variations in tip enhancement capabilities. These fluctuations affect A crucial aspect of synergistic TERS approaches lies in the spa-
tip-specific bands, which can be used for peak intensity normalization. tial resolution capabilities of the paired methodologies. Although
Alternatively, Raman bands independent of molecular conformational analytical methods yielding information exceeding the nanoscale
or environmental changes can be used in spectra normalization. sampling volume of TERS typically aim at a discrimination between
Baseline correction procedures can address the non-homogenous different species or morphology differences within materials, direct
background in TERS spectra arising from substrate illumination, fluo- correlation of quantitative measure and chemical composition is often
rescence emission and electronic noise from the CCD camera chip. This redundant owing to this mismatch. However, this approach presents
can be done by subtracting the substrate’s TERS spectrum obtained new strategies for extracting information from nanoscale objects that
under the same experimental conditions as for the analyte sample. is not accessible by using either technique alone, relying on a qualita-
Ideal baseline correction involves procedures at each image or map- tive comparative approach. For example, the presence or absence of
ping pixel, the acquisition of a regular TERS spectrum and a Raman certain marker bands in TERS, with its shallow information depth,

Nature Reviews Methods Primers | (2024) 4:47 8


0123456789();:
Primer

can distinguish surface-related materials and structures from bulk between the structure of electrochemical interfaces and their proper-
properties. This differs and complements nano-IR or micro-Raman ties and functionality, which are governed by various processes such
techniques, which offer deeper information depths of several ten as molecular absorption140, desorption and diffusion, surface recon-
nanometres and several hundred nanometres, respectively. struction, charge-transfer, bond formation and chemical reactions141.
By contrast, quantifying material properties becomes meaning- Another example of synergistic TERS is correlative TERS-KPFM (Kelvin
ful when paired methods yield nearly identical information depth, probe force microscopy) studies, which pair chemical properties with
typically observed in scanning probe-based techniques. These the contact potential difference and capacitance of surfaces. These
techniques enable direct correlation between quantified surface studies are particularly useful for analysing 2D materials in terms of
properties and the chemical composition and molecular assembly local defect density133, spatial distribution of grain boundaries and
of the surface. Data interpretation aims to understand how chemical their charge carrier concentration142.
composition, structure and molecular assembly influence electrical
and mechanical properties, and vice versa. Such synergistic infor- Applications
mation is crucial for optimizing electrical and mechanical transport This section showcases the versatility of TERS in investigating a wide
properties. Although synergistic TERS modalities are still in their range of materials across disciplines. Through state-of-the-art studies,
early stages of development, recent case studies highlight their great we illustrate various analytical and experimental aspects relevant to
potential35,36,133–136. studying materials in the fields of biological and life sciences, chemistry
and solid-state physics. The selected applications demonstrate the
Case studies. Of particular interest are synergistic AFM-TERS (Fig. 4a) strength of TERS in identifying and discriminating nanoscale organic
and AFM force volume spectroscopy investigations (Fig. 4b). The latter materials, characterizing intrinsic material properties of both common
allows quantitative monitoring of the nanomechanical properties of 1D and 2D materials and driving chemical reactions at the nanoscale
materials by recording force–distance curves for each imaging pixel102. at smallest length scales.
The stiffness of the specimen can be determined from the strain curve
by analysing the linear part of the branch associated with the repulsive Biological applications
tip–sample interaction, corresponding to elastic deformation. In other TERS has garnered considerable interest for its ability to probe bio-
words, stiffer samples result in steeper curves. Young’s modulus can be logical matter with low or moderate Raman scattering cross-sections,
calculated using appropriate contact models, whereas adhesion force offering high sensitivity and chemical specificity143. TERS can discern
is determined by measuring the minimum of the retraction branch major biomolecular components such as genetic materials, proteins,
of the force curve. These quantities can be accessed with nanoscale
a
lateral resolution. When combined with TERS, these properties can 50

confocal Raman intensity


be interpreted in terms of the chemical composition, conformational Si Siovertone

Baseline corrected
40
changes and molecular assembly. ν(N=N) ν(ring)
TERS intensity

Synergistic AFM-TERS has been used to study the core crosslink- 30


ing process initiated by a furan–maleimide Diels–Alder reaction DMAB
20
within the confined core region of core–corona block copolymer ν(NO2)
micelles35. Information obtained on the chemical composition and the 4-NTP 10
structure of the block copolymer chains from the evolving marker band
0
intensity and position across the interfacial region was paired with the 400 800 1,200 1,600 2,000
quantitively determined the stiffness, Young’s modulus and adhesion Wavenumber (cm-1)
of the core, corona and core–corona interface from force–volume AFM
spectroscopy (Fig. 4c). This enabled the identification of influences b
affecting the crosslinking efficiency across the entire core region 1,200 TERS raw data
DMAB
associated with highly crosslinked polymer chains facilitated by a
Signal intensity

high density of furan moieties and sequestered crosslinker molecules, 800

which was supported by the TERS data. Conversely, a breakdown of Background


the crosslinking process was observed at the interface between the 400 (tip retracted)

glycidyl–polyethylene oxide core and corona owing to the exclusion


of the crosslinker from this region, resulting in a decreasing Young’s 0
Baseline corrected TERS
modulus towards the core-shell interfacial region. The efficiency of
the crosslinking process appeared to be influenced by the degree
400 800 1,200 1,600 2,000
of intermixing between the hydrophilic polyethylene oxide and the Wavenumber (cm-1)
hydrophobic furfuryl-glycidyl ether block in this region, leading to
Fig. 3 | Different processes and parameters determining the TERS peak
higher chemical heterogeneity and altered nanomechanical proper-
pattern and deviations from bulk Raman spectra. a, Comparison of a tip-
ties in the interfacial region (Fig. 4c). This synergistic AFM-TERS study
enhanced Raman scattering (TERS) spectrum recorded with a silver nanoparticle-
provided in-depth insights into how structure–property relations decorated Si-atomic force microscopy cantilever tip and a bulk Raman spectrum
control molecular processes in confined spaces. of 4-nitrothiophenol (4-NTP). Differences in the peak pattern arise from tip-specific
STM-TERS is particularly useful when combined with electro- modes (the silicon band at 520 cm−1 and its overtone at ~950 cm−1) and plasmon-
chemistry, known as electrochemical (EC)-TERS137–139. EC-TERS uses induced reaction (the dimerization of 4-NTP to dimercaptoazobenzene (DMAB)).
a bi-potentiostat to control the electrochemical environment and b, Baseline correction of a recorded TERS spectrum of DMAB by subtraction of a
monitor chemical changes through TERS, allowing for correlation background spectrum recorded after retraction of the tip.

Nature Reviews Methods Primers | (2024) 4:47 9


0123456789();:
Primer

a Chemical composition and structure c Synergetic information

Corona Interface Core


PEO corona Crosslinked core
Gauche
DAP DAP (1,200 cm–1)

Trans
CO bond FGE (1,510 cm–1)
FGE
800 1,200 1,600
Wavenumber (cm–1) 800 1,200 1,600
PEO Wavenumber (cm–1)
Block coplymer

TERS intensity (a.u.)


micelle PEO (1,420 cm–1)

b Nanomechanical properties Conformational BMA


change
Topography
dind k=dF/dind
PEO (1,355 cm–1)

dF
Repulsive

Young‘s
50 nm modulus

Young‘s modulus

average value
Force (nN)

Vertical displacement / nm

dind 0
Exte
nd

Adhesion
Attractive

Adhesion
Retr
act

0 5 10 15 20 25
Lateral displacement (nm)
Fadh

Fig. 4 | Synergistic TERS for correlating the chemical composition and core region, indicating a high crosslinking efficiency and a soft hydrophilic corona
nanomechanical properties of core crosslinked block copolymer core–corona region, which are separated by a highly hydrophilic interfacial area with lower
micelles. a, Tip-enhanced Raman scattering (TERS) of fractured PEO-b-P(FGE-co- crosslinking efficiency. c, Cross-sections across the interfacial region reveal a high
tBGE) micelles identifies corona-specific polyethylene oxide (PEO) and core- compartment selective chemical distribution of the PEO and glycidyl-ether blocks,
specific furfuryl-glycidyl ether (FGE) and Diels–Alder product (DAP) marker bands. a high crosslinking efficiency in the central core region (DAP), and quantitatively
b, Force–volume atomic force microscopy of the fractured micelles provide correlate these to the modified nanomechanical properties. a.u., arbitrary units;
information on the nanomechanical properties across the entire micelle area. BMA, 1,1′-(methylenedi-4,1-phenylene)-bis-maleimide. Adapted with permission
Topography, adhesion and Young’s modulus images reveal a stiff, hydrophobic from ref. 35, Wiley.

lipids and carbohydrates based on the specific Raman marker bands conditions to preserve function. Currently, TERS studies of biological
associated with each group. It enables identification of molecular matter in its native state owing to challenges in liquid AFM-TERS are chal-
orientations, various electronic, hydration and hybridization states, lenging145. Research targeting extracellular vesicles, cell membranes and
cis or trans isomerization, and can provide information on secondary or tissues have been primarily conducted under ambient conditions146–151.
tertiary structure of peptides and proteins. TERS studies offer insights
into various biological processes, including membrane morphogen- RNA and DNA sequencing. TERS, with its Ångström-scale lateral resolu-
esis, lipid raft formation, cell polarization and signalling pathways, tion, is being explored as a tool for sequencing RNA, DNA, peptides and
glycosylation, inflammation, interfacial cargo transport, drug–target proteins. It can distinguish individual nucleobases and amino acids with-
interactions, protein misfolding and toxicity. The technique holds out labelling strategies or material amplification, enabling detection at
promise for advancing understanding in fields such as treatment of picomolar levels152,153. TERS has been successful in label-free detection
cancer and infectious diseases. and sequencing of single-stranded and double-stranded DNA and RNA
A prominent area using TERS focuses on the structure, polymor- oligomers by identifying variations in nucleobase marker154–159. Single-
phism and formation of protein fibres23–28, their toxicity — particularly nucleobase resolution was achieved using TERS on M13mp13 phage
of amyloid fibres29–31 — and their interaction with lipids31,144. However, single-stranded DNA (ssDNA)160 and single-stranded RNA (ssRNA). This
studying biological materials often requires controlled environmental was accomplished with a step size of 0.5 nm in a gap mode configuration,

Nature Reviews Methods Primers | (2024) 4:47 10


0123456789();:
Primer

wherein the sample was sandwiched between a flat gold substrate occasional interferences with adjacent nucleobases can occur in their
and the tip, followed by multivariate data analysis for classification161 tight arrangement (Fig. 5Ac). Furthermore, differentiation of DNA
(Fig. 5Aa,Ab). A sequencing accuracy of >90% was obtained because hybridization states is feasible through observation of backbone-specific

Aa Ab Ac
1 4 8 12 16 20 Å
1
Spot 1 Spot 20

5 nm

Probability
Counts 0.5
1,600 1,200

10
Intensity (a.u.)

8
6 0
Nucleotides
4
exp. AAGAAAAAGAAAGGAACAUA
2
0
0 1,000 1,200 1,400 1,600
real AAGAAAAAGAAAGGAUCCUA
Wavenumber (cm–1)

Ba Coxsackie virus B3 Bb Bc

Raman intensity

2nd scan
Raman intensity

RNA

4 nm 1st scan
Protein
coat 1,800 1,400 1,000 600 1,800 1,400 1,000 600
Wavenumber (cm–1)
Wavenumber (cm–1)

Bd H1N1 virus Be Bf

Lipid
bilayer
Raman intensity

Raman intensity

Protein 2nd scan


capsid

RNP

20 nm 1st scan

Membrane 1,800 1,400 1,000 600 1,800 1,400 1,000 600


proteins Wavenumber (cm–1) 100 nm
Wavenumber (cm–1)

Fig. 5 | Application of TERS spectroscopy to biological samples. A, Single- chemical composition of the H1N1 virus. Bb,Be, TERS mapping of the virus surface
stranded RNA (ssRNA) imaging at the single-base level. Aa, Outline of the tip- by discrete spectra acquisition at randomly selected grid positions (inset). Marker
enhanced Raman scattering (TERS) approach. Ab, Top, integral peak intensity at bands correspond to proteins (green lines), RNA (red lines) and lipids (blue lines).
1,370 cm−1 comprising multiple nucleobases bands. Bottom, four spectra acquired Bc,Bf, Continuous TERS spectrum accumulation during scanning of the tip across
along the red arrow (spot 1) in part Ab at a step size of 0.5 nm. Ac, Measured a representative surface area of each virus leads to unique TERS peak pattern
sequence of 20 nucleobases along the strand in part Ab (top). The most probable representing the entire chemical virus composition. a.u., arbitrary units; exp.,
bases are labelled at the bottom and compared to the real sequence. Mismatches experimental; RNP, ribonucleoprotein. Parts Ab and Ac adapted with permission
are marked by the dashed boxes. B, TERS virus discrimination. Ba, Morphology from ref. 161, American Chemical Society. Part b adapted with permission from
and chemical composition of the coxsackie virus B3. Bd, Morphology and ref. 162, PNAS.

Nature Reviews Methods Primers | (2024) 4:47 11


0123456789();:
Primer

Raman marker bands158. These experiments demonstrate the lateral with a spatial resolution of up to 3 nm have been shown40. TERS is also
resolution capabilities and strength of combining structurally sensitive effective in characterizing nanoscale chemical reactions in both liquid
spectroscopy, such as TERS. Although it is unlikely to replace current environments and on solid–liquid interfaces39. Recent research indi-
PCR-based DNA sequencing methods, this approach can be applied cates that TERS in high-vacuum environments can further enhance its
to sequencing any chainlike molecules, including proteins or sugars. potential for ultra-sensitive spectral analysis of chemical reactions at a
nanoscale. By adjusting the tunnelling current, HV-TERS can effectively
Virus detection and differentiation. TERS shows promise as an alter- control the gap, enabling additional monitoring of surface catalytic
native tool for virus detection and differentiation on minute sample reactions. The high-vacuum environment prevents contamination
volumes, bypassing extensive material amplification steps required and facilitates high spatial resolution.
in PCR testing162,163. Preliminary TERS studies on different virus types,
including H1N1 virus and coxsackie virus B3 (CVB3), have demonstrated 2D materials
the need for substantial TERS datasets of the entire nanoscale chemi- One-atom or few-atoms thick 2D materials represent a new class of low-
cal heterogeneity across the virus surface (Fig. 5Ba,Bd), to overcome dimensional materials with applications in advanced electronics, opto-
spectral variability based on nanoscale composition of virus surfaces162 electronics, energy storage devices and twistronics164,165. Their electronic
(Fig. 5Bb,Be). To accomplish a meaningful averaging, the number and optical properties are highly adaptable owing to sensitivity to internal
of individual TERS spectra must match the covered area. Conserva- (defects, impurities, stacking order, twist angle) and external (strain,
tively, considering 1-nm-diameter TERS resolution this means that for doping)166 influences on their electronic and phononic properties.
a 100-nm-diameter virus at least 10,000 TERS spectra are required, The quantum coherence length (LC), a crucial property governing
which are time-consuming to obtain. Alternatively, viruses can be dif- 2D materials, typically ranges from 1 to 100 nm but has not yet been
ferentiated by averaging the spectral information in a single spectrum established in the spatial domain. Unlike incoherent micro-Raman scat-
across a selected region of interest. Here the tip is constantly moved, tering, the spatial coherence of phonons and electrons in 2D materials
and the spectral information is continuously collected. This way the controls TERS enhancement because LC is comparable to a spatial field
resolution is artificially reduced and, hence, representative of chemical confinement. Thus, TERS is ideal for investigating nanoscale electrical
composition of the entire area of the scanned virus (Fig. 5Bc,Bf). TERS and thermal transport mechanisms, defects, strain and doping effects
scans of the H1N1 virus provided information on the lipid and protein of 2D materials142,167–172. Spatial coherence Raman scattering theory for
content, whereas CVB3 TERS spectra were distinguishable by RNA and 2D materials accounts for the non-radiating near-field components
protein content. However, the variability of single TERS spectra is inher- and identifies the coherence properties of the inelastically scattered
ent to high lateral resolution and surface composition, emphasizing field173–175. The occurring field interferences can be either constructive
the importance of the averaging procedure for applications such as or destructive, depending on the sequence of the involved internal
virus discrimination. Point-by-point mapping would require a dense scattering processes, vibrational mode symmetry and dimension-
mapping grid, resulting in long acquisition times. Depending on the ality. Consequently, the TERS signal of different Raman modes can
application one has can choose between a fast averaging at the cost exhibit different amplification. Accordingly, when applying already-
of spatial resolution or a highly resolved experiment that can locally established micro-Raman metrological approaches to TERS datasets
distinguish, for example, lipids and proteins. for quantitative property assessments, adjustments (for example,
enhancement-specific corrections) are necessary as was demonstrated
Nanoscale chemical reactivity in a study quantifying defects in graphene176.
TERS offers a powerful and efficient method for observing and con-
trolling nanoscale chemical reactivity at specific reaction sites. TERS Probing the Raman spatial coherence length of 2D materials. The
uses the intrinsic plasmon properties of the tip to localize and amplify TERS signal depends on the tip–sample distance, facilitating experi-
electromagnetic fields for sensing, but it can also accelerate chemical mental nanoscale determination of the LC via numerical fitting, yielding
reaction rates and control reaction products through hot electron and values of ~50–60 nm in GaS (ref. 177) and ~20–40 nm in graphene174.
heat effects induced by the plasmons. Consequently, TERS serves as a TERS coherence theory was validated using the Fermi-energy depend-
valuable tool for elucidating nanoscale chemical reaction mechanisms, ence of LC (ref. 178), revealing to suppression of phonon-induced elec-
identifying specific molecular structures at the nanoscale, and even tronic excitations near the Dirac Point, with a subsequent shortening of
inducing novel specific reaction pathways. LC toward the neutrality point with decreasing doping levels178.
Initial investigations using AFM-TERS focused on the plasmon-
induced reaction of pNTP on gold nanoplates. Silver-coated tips were Interpretation of the spatial correlation length in terms of phonons
brought into contact with the pNTP monolayer on atomically flat gold or electrons. Light scattering involves electron–light and electron–
nanoplates, and illumination of the tip–sample system facilitated phonon coupling, raising questions about whether LC is dictated by
the conversion of pNTP to dimercaptoazobenzene (DMAB). Time- electron or phonon coherence length. The strength of TERS lies in
dependent TERS spectra clearly depicted the decrease in the pNTP gathering information near the Brillouin zone’s centre, providing
marker bands and the concomitant increase in the characteristic azo insights into the correlation of scattered electromagnetic field. Experi-
group signals of DMAB at 1,440 cm−1 (ref. 37) (Fig. 6). Subsequent in situ mentally accessible phonon coherence length indirectly determines
high-vacuum TERS (HV-TERS) experiments confirmed this chemical phonon group velocity178, indicating the presence of ultrasharp kinks
reaction under environmentally controlled conditions38. TERS tech- in phonon dispersion at the Brillouin zone centre. To date, calculations
nology, with its high detection sensitivity and precise tip control, is of the Kohn anomaly cannot confirm this behaviour179,180, whereas the
well-suited for determining the chemical properties and structure of LC experimentally determined values may be dictated by the electronic
materials at very high resolution. It enables characterization of elec- energy uncertainty rather than the phonon coherence length. Further
tronic properties and catalytic activity of different sites on the surface research is needed to clarify its nature.

Nature Reviews Methods Primers | (2024) 4:47 12


0123456789();:
Primer

Localization of lattice dynamics and electrons in graphene hetero­ TERS of reconstructed low-angle twisted bilayer graphene (rTBG)
structures. Superlattice-forming van der Waals heterostructures unveils lattice dynamics localization, such as strain solitons (SP) and
yield specific intrinsic phonon properties that differ from regularly topological (AA) points, separating triangular AB and BA stacked
constructed 2D materials and can, therefore, be probed by TERS. domains181. Although such structures cannot be imaged by AFM,

Aa Ab

v(NO2)

β(CH)
ν(NN)
ν(NN)
Silver-coated AFM-tip
(catalyst)
0.8
100

PNTP DMAB
0.6

Time (s)
pNTP monolayer
200
(reactant)
0.4
Gold nanoplate

Glass coverslip

300 0.2

hν Excitation laser
(532 nm or 633 nm)
1,600 1,400 1,200 1,000
Wavenumber (cm–1)

Ba Bc
1,165 cm–1
600
2.6 nm 2.6 nm
Au tip
400
Laser

200
Raman
TERS intensity (cps)

1,590 cm–1
900
Phenyl isocyanide
600

300

1,995 cm–1
300
Pd Au
200

Bb 100

10 nm High 6
PdML Au PdML
3
Height (Å)

0
Pd
Pd Au Pd –3
Au
–6
–9
Low
0 5 10 15 20 25 30 35 40 45 50
Tip position (nm)

Fig. 6 | Application of TERS technology in nanoscale chemical reactivity. palladium(sub-monolayer)–gold(111) bimetallic system. Ba, STM-TERS using
A, Catalytic processes of p-nitrothiophenol (pNTP) to dimercaptoazobenzene gold tips on palladium–gold(111) substrates coated with phenyl isocyanide
(DMAB) monitored at the nanoscale with atomic force microscopy combined molecules. Bb, STM image of the palladium–gold(111) phenyl isocyanide-coated
with tip-enhanced Raman scattering (AFM-TERS). Aa, Photo-catalysed surface. Bc, Height-correlated TERS intensities (1,165, 1,590 and 1,995 cm−1)
conversion of pNTP to DMAB by using the silver-coated AFM tip. Ab, Time- of phenyl isocyanide adsorbed on the surface palladium(sub-monolayer)–
dependent TERS spectra of the catalytic processes before (top) and after gold(111) bimetallic system. Error bars represent the standard deviation for each
(bottom) illumination at 633 nm. B, High-resolution scanning tunnelling measurement. cps, counts per second. Parts Aa and Ab adapted from ref. 37,
microscopy (STM)-TERS study of the electronic and catalytic properties of a Springer Nature Limited. Part B adapted from ref. 40, Springer Nature Limited.

Nature Reviews Methods Primers | (2024) 4:47 13


0123456789();:
Primer

because they do not change the surface topography, the line shape Reproducibility and data deposition
of the 2D (G′) band is sensitive to electron localization and local Achieving reproducibility in TERS experiments, particularly at the
electron–phonon coupling. While a typical 4 Lorentzian peak pattern nanometre scale, presents unique challenges, owing to its highly
is observed for AB stacked regions associated with the triangular localized measurement nature.
domains (Fig. 7a,b), the SP–AA domains are characterized by a devi- In TERS, as with any nanoscale experiment, there is an inherent
ating line profile (Fig. 7c,d). Furthermore, the rTBG exhibits unique inability to perform signal averaging at such a small scale. Unlike con-
phonon properties such as a split G-phonon band (Fig. 7e,f), revealing ventional macroscopic Raman spectroscopy, wherein signals from a
insights into the influence of formed solitons and topological points relatively large sample volume allow for statistical averaging to mini-
on vibrational and electronic properties. mize noise and enhance reproducibility, TERS experiments operate on
an extremely localized level. The interaction volume between the tip
Local doping variations in lateral graphene homojunctions. Lateral and the sample is confined to the immediate vicinity of the nanoscale
graphene homojunctions formed of graphene@talc–graphene@SiO2 tip or even to a single atom-sized edge. Consequently, the Raman sig-
consist of highly p-doped and lighter doped p′ areas, separated by a nal collected during TERS experiments lacks spatial averaging and is
p–p′ junction (p′ < p) at the talc–SiO2 interface (Fig. 7g). TERS inves- highly localized. Even small changes in the orientation of a molecule
tigations reveal abrupt changes in intensity, Raman shift and band can lead to variations in the Raman signals, primarily owing to the
width across interfacial regions182. Major contributing mechanism extreme resolution of the technique rather than reproducibility issues.
ascribes to doping effects rather than to strain, evidenced by 2D versus Although theoretical calculations can account for these effects, they
G frequency and intensity plot ratios. The 2D and G intensity ratio is complicate comparisons with existing databases typically used for
inversely proportional to the charge doping, and so the talc supported spectrum assignment in Raman microscopy.
graphene region shows a lower 2D/G intensity ratio compared to the One approach to address these variations is to use averaging over
SiO2 supported region (Fig. 7h). Oscillation of the 2D/G intensity ratio larger areas if the extreme resolution is not essential. In many cases,
across the interface suggests formation of a pp′pp′ junction, indicating a reduced lateral resolution of 10–20 nm is adequate, and in such
local doping variations similar to diode pn junctions. instances, averaging over larger sub-areas, as demonstrated in the

a c e g

SiO2 Talc

100 nm 100 nm 80 nm Topography (nm)


0 35
AB/BA contribution (%) SP/AA contribution (%)
80 100 0 34

b d f h

1.2
Gr− Gr+
1.0 6
Normalized intensity
Intensity (a.u.)

Intensity (a.u.)

0.8 Interface
AA 5
I2D/IG

0.6 SP
AB/BA
0.4 4

AB/BA SP/AA 0.2


3 Talc SiO2
0.0
2,600 2,700 2,800 2,600 2,700 2,800 1,500 1,550 1,600 1,650 200 300 400 500
Wavenumber (cm–1) Wavenumber (cm–1) Wavenumber (cm–1) Lateral distance (nm)

Fig. 7 | TERS imaging of reconstructed low-angle twisted bilayer graphene graphene@talc–graphene@SiO2 homojunction. h, Evolution of the averaged
and lateral graphene homojunctions. a–d, Different 2D (G′) line profiles 2D to G band intensity ratio across the interfacial region demonstrating the
observed in the triangular AB/BA stacked regions as compared to the strain occurrence of oscillation associated with the formation of a pp′pp′ junction. a.u.,
solitons and topological points separating the stacked regions. e,f, The G band arbitrary units; TERS, tip-enhanced Raman scattering. Parts a–f adapted from
exhibits new vibrational features that are also localized in space. g, Outline and ref. 181, Springer Nature Limited. Parts g and h adapted from ref. 182, Springer
atomic force microscopy (AFM) topography image of a pp′ junction in a lateral Nature Limited.

Nature Reviews Methods Primers | (2024) 4:47 14


0123456789();:
Primer

Glossary

Adaptive optics Electromagnetic effect Kohn anomaly Spatial field confinement


A technical approach to improve the Responsible for the locally confined An anomaly in the phonon dispersion The ability of a plasmonic nanostructure
quality of an optical system by reducing and enhanced electric field and field relation of graphene and metals, to convert free propagating radiation
the wavefront distortions (increasing the gradients near the plasmonic particle. which arises from electron–phonon into localized energy, that is, the
phase matching) imposed by diffractive interaction, leading to a failure of the obtained spatial extension of the
optical elements, light scattering in Finite-difference time-domain Born–Oppenheimer approximation. formed secondary electromagnetic
thick samples and the variation in the methods filed at the tip apex.
index of refraction along the light path Grid-based differential numerical Picocavity
by using deformable mirrors or liquid methods that allow to solve Maxwell’s Atomic-scale structure constituted by Strain solitons
crystal spatial light modulators. equations in an iterative scheme. one or few metallic atoms protruding Nonlinear quasi-stationary localized
from the surface, which enables strain waves in solids that occur at
Boundary element methods Finite element methods localization of light onto the atomic boundaries of symmetry-broken
Methods to solve Maxwell’s equation, Numerical approaches that can solve scale, often phrased as ‘atomic stacking domains (in the case of
which relies on the discretization of the partial differential equations by dividing protrusion’. graphene, AB and BA stacking domains).
surface elements of a configuration, the system into a certain number of
wherein the boundary conditions are smaller subsystems (finite elements). Polarizability tensor Synergistic TERS
applied to each finite element of the Describes the induced dipole moment A terminology to summarize
elements of the interface. Force–volume AFM along one direction as a function of the comparative approaches pairing tip-
spectroscopy local electric field in any given direction; enhanced Raman scattering (TERS) as a
Chemical effects An advanced imaging atomic force according to the general selection rules pivotal method with a secondary, ideally
Stem from close-range and site-specific microscopy (AFM) mode enabling a in Raman spectroscopy, a vibration is complementary analytical technique.
interactions between the surface- quantification of certain nanomechanical Raman active only if the polarizability
immobilized sample and the metallic properties (adhesion, stiffness, Young’s changes along the displacement vector
nanoparticle and comprises non- modulus, dissipation and viscoelasticity) of the specific vibrational normal mode.
resonant and resonant contributions of a sample by recording entire extend-
and charge-transfer phenomena and-retract force–distance curves for Rayleigh line
between the sample and the plasmonic each image pixel. Corresponds to the peak in a spectrum
nanoparticle. that arises from elastic scattering of the
GPAW incident light in a sample, that is, at a
Coherence length A python implementation of the time- frequency or energy corresponding to
The distance an electromagnetic wave dependent density functional theory the incident light.
can travel in a material and keeps its approach based on the projector
coherence, or maintain its phase. augmented wave method.

TERS virus example, is a viable approach. This differs from simply methods require precise, high-quality and reproducible datasets of
selecting larger step sizes for the TERS experiment, as that typically sufficient volume. Given the complexity of parameter entangle-
leads to inadequate sampling of the sample surface. ment in TERS studies, establishing high entry requirements for these
When comparing TERS experiments, the nature of scanning probe repositories is essential. These requirements depend on experimental
experiments must be considered. These experiments rely on the shape parameters that must be carefully considered and defined according
and properties of the tip, as well as the roughness of the specimen. to field standards.
Accurately capturing the topography of a sample depends on the
sharpness of the tip. If the surface is too rough, the tip may not properly Limitations and optimizations
approach it, resulting in plasmonic enhancement and topography As one of the few methods capable of achieving nanoscale lateral
being registered at different locations on the tip, potentially mislead- resolution under ambient conditions, TERS stands out as a crucial
ing interpretations. Therefore, comparisons should only be made for tool for obtaining structural information about surfaces. However,
smooth surfaces. this advantage comes with trade-offs. The extreme sensitivity and
Currently, TERS-specific data repositories are unavailable, local resolution of TERS mean that it samples only a small number
mirroring the absence of concise Raman or SERS repositories. Data of molecules, resulting in highly surface-sensitive measurements.
are typically provided either as supplemental information or upon Consequently, TERS cannot directly access the bulk properties of a
request from the authors of the respective publications. However, specimen. Like most scattering-type near-field optical techniques, TERS
establishing TERS data repositories in the next decade is imperative to combines far-field and near-field contributions, necessitating careful
meet the demands of new artificial intelligence-based data analysis and measures to isolate the near-field signal. However, the far-field signal
interpretation methods. A web repository for microbiological Raman already offers an initial insight into bulk properties. Laser damage to
data, including TERS data, has been proposed183. These data analysis the sample must also be considered, as is typical for any Raman setup.

Nature Reviews Methods Primers | (2024) 4:47 15


0123456789();:
Primer

The ultimate resolution limit of TERS remains unclear. Current Intrinsic TERS signal variability owing to extreme localization
experimental setups can localize the tip with a certain precision, dependency hinders quantitative assessment of sample composition.
depending on the feedback mechanism and general setup (cryogenic Developing standardized protocols, particularly for reduced resolu-
conditions, AFM or STM). Currently, a lateral resolution of less than tion approaches, could enable breakthroughs based on correct local
100 pm may be achieved. Theoretical considerations are particularly averaging.
intriguing in this regard. The electromagnetic component of the Most TERS investigations are static, focusing on samples in equi-
Raman spectrum is linked to the excitation volume and determines librium. Dynamic kinetic investigations could provide insights into
the resolution limit. Conversely, the chemical effects contributing reactivity on solid surfaces, such as catalytic reactions. Overcoming
to the Raman spectrum depend solely on the precise positioning of potential reactivity of the tip itself and acquisition restrictions of
the tip relative to the molecule. Therefore, the resolution is influenced current setups is a primary challenge.
by the technical precision and noise of the tip positioning, as well as
the SNR of the collected Raman spectra. Although achieving resolution Innovative approaches in TERS research
within the range of a bond length can be generally deemed sufficient Combining non-linear optical techniques such as coherent anti-
from a chemical perspective, appropriate equipment might go below Stokes Raman scattering and stimulated Raman scattering with tip
this scale. enhancement offers dramatically improved sensitivity. Enhancements
in measurement speed, such as picosecond-scale time resolutions
Limitations in liquid and overcoming sample drift, are expected. Automatically matching
Using TERS to study biological samples requires technical solutions the incoming light’s field to specific tip requirements using spatial
for investigating samples in their natural or native state. Liquid TERS light modulators can substantially improve TERS signal intensity. This
bio-applications, although intriguing, remain uncommon. Previous approach, along with non-linear optical methods, holds promise for
liquid TERS investigations have focused on simple sample systems such improving measurement time. The application of artificial intelligence
as lipid monolayers and bilayers and protein fibrils, typically under and machine learning principles in TERS spectra analysis could expedite
physiologically irrelevant ambient conditions. To establish liquid spectrum assignment, ideally during experiments, leading to faster
TERS as a routine method, issues related to tips and feedback mecha- data interpretation.
nisms must be addressed. STM-TERS in liquid environments requires
special tip treatment to reduce Faradaic currents whereas AFM-TERS Priorities for the next decade
is preferred for biological matter. Liquid AFM-TERS introduces addi- Experimental and theoretical evaluation of the resolution limit of TERS
tional hydrodynamic and sample interaction forces, leading to altered or other TERS-based experiments under varying environmental condi-
molecular orientation and the occurrence of periodic hydration forces tions is paramount. Addressing experimental challenges and deter-
and Derjaguin–Landau–Verwey–Overbeek (DLVO) forces. Typically, mining appropriate theoretical models are key aspects. Simplifying
the tip–sample distance increases for set points similar to ambient instrumentation systems is crucial for wider adoption of TERS across
settings. Liquid TERS may encounter significant tip lifetime issues; disciplines. Interdisciplinary collaborations are vital, and complex
metal-coated dielectric or semi-conducting tips exposed to aqueous experimental setups may pose barriers to potential users.
solutions may experience partial detachment of the metal film or metal
nanoparticles. Although intermediate adhesion layers can improve Potential applications
mechanical stability, the lifetime of TERS tips may still be significantly TERS finds applications in a range of fields, from biological and phar-
reduced owing to chemical damage by organic solvents, acids or buffer maceutical applications to solid-state physics. It enables the label-free
solutions. Tip contamination by residual analytes in the solution is study of surface structures beyond the optical diffraction limit, making
also a potential issue. Introduction of additional thin protective layers it applicable in materials science, medical diagnostics, pharmaceutical
can decrease the risk of chemical destruction and contamination, but analysis and environmental monitoring wherein target structures are
careful material selection and thickness considerations are crucial for smaller than 100 nm.
preserving enhancement capabilities. In conclusion, TERS holds immense potential as a tool for probing
the nanoscale world, with ongoing research and innovative approaches
Outlook driving the field forward. Its applications extend far beyond its imme-
As the field develops, it continues to face challenges, such as improv- diate domain, promising transformative impacts across scientific and
ing reliability and accessibility; novel approaches, innovative tech- technological realms in the years to come.
nology and interdisciplinary collaboration are constantly driving
the field forward. In this section, we explore the challenges in the TERS Published online: xx xx xxxx
field, innovative approaches being developed, questions TERS can
References
answer, priorities for the next decade and potential applications of 1. Anderson, M. S. Locally enhanced Raman spectroscopy with an atomic force microscope.
TERS beyond its immediate domain. Appl. Phys. Lett. 76, 3130–3132 (2000).
2. Hayazawa, N., Inouye, Y., Sekkat, Z. & Kawata, S. Metallized tip amplification of near-field
Raman scattering. Opt. Commun. 183, 333–336 (2000).
Challenges in TERS research 3. Stöckle, R. M., Suh, Y. D., Deckert, V. & Zenobi, R. Nanoscale chemical analysis by
Achieving stable, highly enhancing and reproducible TERS tips tip-enhanced Raman spectroscopy. Chem. Phys. Lett. 318, 131–136 (2000).
4. Domke, K. F., Zhang, D. & Pettinger, B. Toward Raman fingerprints of single
remains a challenge, especially for complex specimens such as those
dye molecules at atomically smooth Au(111). J. Am. Chem. Soc. 128, 14721–14727
in biological sciences. Although the atomic-scale edge required is (2006).
typically formed automatically, improving tip stability, particularly 5. Neacsu, C. C., Dreyer, J., Behr, N. & Raschke, M. B. Scanning-probe Raman spectroscopy
with single-molecule sensitivity. Phys. Rev. B 73, 193406 (2006).
in challenging environments, is crucial. Leveraging existing scanning
6. Zhang, W., Yeo, B. S., Schmid, T. & Zenobi, R. Single molecule tip-enhanced Raman
probe technologies for TERS experiments could be beneficial. spectroscopy with silver tips. J. Phys. Chem. C 111, 1733–1738 (2007).

Nature Reviews Methods Primers | (2024) 4:47 16


0123456789();:
Primer

7. Richard-Lacroix, M., Zhang, Y., Dong, Z. & Deckert, V. Mastering high resolution tip-enhanced 37. van Schrojenstein Lantman, E. M., Deckert-Gaudig, T., Mank, A. J. G., Deckert, V. &
Raman spectroscopy: towards a shift of perception. Chem. Soc. Rev. 46, 3922–3944 (2017). Weckhuysen, B. M. Catalytic processes monitored at the nanoscale with tip-enhanced
8. Hartschuh, A., Sánchez, E. J., Xie, X. S. & Novotny, L. High-resolution near-field Raman Raman spectroscopy. Nat. Nanotechnol. 7, 583–586 (2012).
microscopy of single-walled carbon nanotubes. Phys. Rev. Lett. 90, 095503 (2003). 38. Sun, M., Zhang, Z., Zheng, H. & Xu, H. In-situ plasmon-driven chemical reactions revealed
9. Chen, C., Hayazawa, N. & Kawata, S. A 1.7 nm resolution chemical analysis of carbon by high vacuum tip-enhanced Raman spectroscopy. Sci. Rep. 2, 647 (2012).
nanotubes by tip-enhanced Raman imaging in the ambient. Nat. Commun. 5, 3312 (2014). 39. Pfisterer, J. H. K., Baghernejad, M., Giuzio, G. & Domke, K. F. Reactivity mapping of
10. Anderson, N., Hartschuh, A. & Novotny, L. Chirality changes in carbon nanotubes studied nanoscale defect chemistry under electrochemical reaction conditions. Nat. Commun.
with near-field Raman spectroscopy. Nano Lett. 7, 577–582 (2007). 10, 5702 (2019).
11. Anderson, N., Hartschuh, A., Cronin, S. & Novotny, L. Nanoscale vibrational analysis 40. Zhong, J.-H. et al. Probing the electronic and catalytic properties of a bimetallic surface
of single-walled carbon nanotubes. J. Am. Chem. Soc. 127, 2533–2537 (2005). with 3 nm resolution. Nat. Nanotechnol. 12, 132–136 (2017).
12. Liao, M. et al. Tip-enhanced Raman spectroscopic imaging of individual carbon nanotubes 41. Shao, F. et al. In-situ nanospectroscopic imaging of plasmon-induced two-dimensional
with subnanometer resolution. Nano Lett. 16, 4040–4046 (2016). [4+4]-cycloaddition polymerization on Au(111). Nat. Commun. 12, 4557 (2021).
13. Yano, T.-A. et al. Tip-enhanced nano-Raman analytical imaging of locally induced strain 42. Mahapatra, S. et al. Localized surface plasmon controlled chemistry at and beyond the
distribution in carbon nanotubes. Nat. Commun. 4, 2592 (2013). nanoscale. Chem. Phys. Rev. 4, 021301 (2023).
14. Schultz, J. F. & Jiang, N. Characterizations of two-dimensional materials with cryogenic 43. Trautmann, S. et al. A classical description of subnanometer resolution by atomic features
ultrahigh vacuum near-field optical microscopy in the visible range. J. Vac. Sci. Technol. A in metallic structures. Nanoscale 9, 391–401 (2017).
40, 40801 (2022). 44. Jakob, L. A. et al. Giant optomechanical spring effect in plasmonic nano- and picocavities
This review article discusses the technical challenges and advantages of cryogenic probed by surface-enhanced Raman scattering. Nat. Commun. 14, 3291 (2023).
UHV TERS and STM-induced luminescence. 45. García de Abajo, F. J. & Howie, A. Retarded field calculation of electron energy loss in
15. Ren, B., Picardi, G., Pettinger, B., Schuster, R. & Ertl, G. Tip-enhanced Raman spectroscopy inhomogeneous dielectrics. Phys. Rev. B 65, 115418 (2002).
of benzenethiol adsorbed on Au and Pt single-crystal surfaces. Angew. Chem. Int. Ed. 44, 46. Hohenester, U. & Trügler, A. MNPBEM — a Matlab toolbox for the simulation of plasmonic
139–142 (2005). nanoparticles. Comput. Phys. Commun. 183, 370–381 (2012).
16. Wang, X. et al. Tip-enhanced Raman spectroscopy for investigating adsorbed species 47. Cvitkovic, A., Ocelic, N., Aizpurua, J., Guckenberger, R. & Hillenbrand, R. Infrared
on a single-crystal surface using electrochemically prepared Au tips. Appl. Phys. Lett. 91, imaging of single nanoparticles via strong field enhancement in a scanning nanogap.
101105 (2007). Phys. Rev. Lett. 97, 060801 (2006).
17. Chiang, N. et al. Conformational contrast of surface-mediated molecular switches 48. Barbry, M. et al. Atomistic near-field nanoplasmonics: reaching atomic-scale resolution
yields Ångstrom-scale spatial resolution in ultrahigh vacuum tip-enhanced Raman in nanooptics. Nano Lett. 15, 3410–3419 (2015).
spectroscopy. Nano Lett. 16, 7774–7778 (2016). 49. Schmidt, M. K., Esteban, R., González-Tudela, A., Giedke, G. & Aizpurua, J. Quantum
18. Braun, K. et al. Probing bias-induced electron density shifts in metal–molecule interfaces mechanical description of Raman scattering from molecules in plasmonic cavities.
via tip-enhanced Raman scattering. J. Am. Chem. Soc. 143, 1816–1821 (2021). ACS Nano 10, 6291–6298 (2016).
19. Zhang, D., Domke, K. F. & Pettinger, B. Tip-enhanced Raman spectroscopic studies of the 50. Baumberg, J. J. Picocavities: a primer. Nano Lett. 22, 5859–5865 (2022).
hydrogen bonding between adenine and thymine adsorbed on Au (111). ChemPhysChem 51. Benz, F. et al. Single-molecule optomechanics in “picocavities”. Science 354, 726–729
11, 1662–1665 (2010). (2016).
20. Wang, X. et al. Revealing intermolecular interaction and surface restructuring of an 52. Zhang, R. et al. Chemical mapping of a single molecule by plasmon-enhanced Raman
aromatic thiol assembling on Au(111) by tip-enhanced Raman spectroscopy. Anal. Chem. scattering. Nature 498, 82–86 (2013).
88, 915–921 (2016). 53. Lee, J., Crampton, K. T., Tallarida, N. & Apkarian, V. A. Visualizing vibrational normal
21. Pandey, Y., Kumar, N., Goubert, G. & Zenobi, R. Nanoscale chemical imaging of supported modes of a single molecule with atomically confined light. Nature 568, 78–82 (2019).
lipid monolayers using tip-enhanced Raman spectroscopy. Angew. Chem. Int. Ed. 60, 54. Jiang, S. et al. Subnanometer-resolved chemical imaging via multivariate analysis of
19041–19046 (2021). tip-enhanced Raman maps. Light Sci. Appl. 6, e17098 (2017).
22. Jiang, N. et al. Nanoscale chemical imaging of a dynamic molecular phase boundary 55. Kong, F.-F. et al. Probing intramolecular vibronic coupling through vibronic-state imaging.
with ultrahigh vacuum tip-enhanced Raman spectroscopy. Nano Lett. 16, 3898–3904 Nat. Commun. 12, 1280 (2021).
(2016). 56. Hao, E. & Schatz, G. C. Electromagnetic fields around silver nanoparticles and dimers.
23. Kurouski, D., Deckert-Gaudig, T., Deckert, V. & Lednev, I. K. Structural characterization J. Chem. Phys. 120, 357–366 (2003).
of insulin fibril surfaces using tip enhanced Raman spectroscopy (TERS). Biophys. J. 104, 57. Zou, S., Janel, N. & Schatz, G. C. Silver nanoparticle array structures that produce
49A (2014). remarkably narrow plasmon lineshapes. J. Chem. Phys. 120, 10871–10875 (2004).
24. Deckert-Gaudig, T. & Deckert, V. High resolution spectroscopy reveals fibrillation inhibition 58. Gieseking, R. L., Ratner, M. A. & Schatz, G. C. Semiempirical modeling of Ag nanoclusters:
pathways of insulin. Sci. Rep. 6, 39622 (2016). new parameters for optical property studies enable determination of double excitation
25. Krasnoslobodtsev, A., Deckert-Gaudig, T., Zhang, Y., Deckert, V. & Lyubchenko, Y. L. contributions to plasmonic excitation. J. Phys. Chem. A 120, 4542–4549 (2016).
Polymorphism of amyloid fibrils formed by a peptide from the yeast prion protein Sup35: 59. Ding, W., Hsu, L.-Y., Heaps, C. W. & Schatz, G. C. Plasmon-coupled resonance energy
AFM and tip-enhanced Raman scattering studies. Ultramicroscopy 165, 26–33 (2016). transfer II: exploring the peaks and dips in the electromagnetic coupling factor. J. Phys.
26. Paulite, M. et al. Full spectroscopic tip-enhanced Raman imaging of single nanotapes Chem. C 122, 22650–22659 (2018).
formed from β-amyloid(1-40) peptide fragments. ACS Nano 7, 911–920 (2013). 60. Payton, J. L., Morton, S. M., Moore, J. E. & Jensen, L. A discrete interaction model/quantum
27. Lipiec, E., Perez-Guaita, D., Kaderli, J., Wood, B. R. & Zenobi, R. Direct nanospectroscopic mechanical method for simulating surface-enhanced Raman spectroscopy. J. Chem. Phys.
verification of the amyloid aggregation pathway. Angew. Chem. Int. Ed. 57, 8519–8524 136, 214103 (2012).
(2018). 61. Payton, J. L., Morton, S. M., Moore, J. E. & Jensen, L. A hybrid atomistic electrodynamics —
28. Talaga, D. et al. Total internal reflection tip-enhanced Raman spectroscopy of tau fibrils. quantum mechanical approach for simulating surface-enhanced Raman scattering. Acc.
J. Phys. Chem. B 126, 5024–5032 (2022). Chem. Res. 47, 88–99 (2014).
29. Bonhommeau, S., Talaga, D., Hunel, J., Cullin, C. & Lecomte, S. Tip-enhanced Raman 62. Hu, Z., Chulhai, D. V. & Jensen, L. Simulating surface-enhanced hyper-Raman scattering
spectroscopy to distinguish toxic oligomers from Aβ1–42 fibrils at the nanometer scale. using atomistic electrodynamics-quantum mechanical models. J. Chem. Theory Comput.
Angew. Chem. Int. Ed. 56, 1771–1774 (2017). 12, 5968–5978 (2016).
30. D’Andrea, C. et al. Nanoscale discrimination between toxic and nontoxic protein misfolded 63. Liu, P., Chulhai, D. V. & Jensen, L. Single-molecule imaging using atomistic near-field
oligomers with tip-enhanced Raman spectroscopy. Small 14, 1800890 (2018). tip-enhanced Raman spectroscopy. ACS Nano 11, 5094–5102 (2017).
31. vandenAkker, C. et al. Nanoscale heterogeneity of the molecular structure of individual 64. Chen, X., Liu, P., Hu, Z. & Jensen, L. High-resolution tip-enhanced Raman scattering
hIAPP amyloid fibrils revealed with tip-enhanced Raman spectroscopy. Small 11, 4131–4139 probes sub-molecular density changes. Nat. Commun. 10, 2567 (2019).
(2015). This research article introduces a theory adopting the concept of distributed
32. Yeo, B.-S., Amstad, E., Schmid, T., Stadler, J. & Zenobi, R. Nanoscale probing of a polarizability density (namely, locally integrated Raman polarizability density (LIRPD))
polymer-blend thin film with tip-enhanced Raman spectroscopy. Small 5, 952–960 (2009). to show that single-molecule TERS images can be explained by local sub-molecular
33. Xue, L. et al. High-resolution chemical identification of polymer blend thin films using density changes induced by extremely confined near-field interaction, and that these
tip-enhanced Raman mapping. Macromolecules 44, 2852–2858 (2011). determine the obtainable TERS resolution and affect the Raman selection rules.
34. Agapov, R. L., Scherger, J. D., Sokolov, A. P. & Foster, M. D. Identification of individual 65. Schmidt, S. et al. Image formation properties and inverse imaging problem in aperture
isotopes in a polymer blend using tip enhanced Raman spectroscopy. J. Raman Spectrosc. based scanning near field optical microscopy. Opt. Express 24, 4128–4142 (2016).
46, 447–450 (2015). 66. Langer, J. et al. Present and future of surface-enhanced Raman scattering. ACS Nano 14,
35. Höppener, C., Elter, J. K., Schacher, F. H. & Deckert, V. Inside block copolymer micelles — 28–117 (2020).
tracing interfacial influences on crosslinking efficiency in nanoscale confined spaces. 67. Latorre, F. et al. Spatial resolution of tip-enhanced Raman spectroscopy — DFT assessment
Small 19, 2206451 (2023). of the chemical effect. Nanoscale 8, 10229–10239 (2016).
36. Höppener, C., Schacher, F. H. & Deckert, V. Multimodal characterization of resin 68. Rodriguez, R. D. et al. Chemical enhancement vs molecule–substrate geometry in
embedded and sliced polymer nanoparticles by means of tip-enhanced Raman plasmon-enhanced spectroscopy. ACS Photonics 8, 2243–2255 (2021).
spectroscopy and force-distance curve based atomic force microscopy. Small 112, 69. Fiederling, K., Kupfer, S. & Gräfe, S. Are charged tips driving TERS-resolution? A full
1907418 (2020). quantum chemical approach. J. Chem. Phys. 154, 034106 (2021).

Nature Reviews Methods Primers | (2024) 4:47 17


0123456789();:
Primer

70. Fiederling, K. et al. The chemical effect goes resonant — a full quantum mechanical 104. Pettinger, B., Picardi, G., Schuster, R. & Ertl, G. Surface enhanced Raman spectroscopy:
approach on TERS. Nanoscale 12, 6346–6359 (2020). towards single molecule spectroscopy. Electrochemistry 68, 942–949 (2000).
This research article presents a theoretical study of a tin(II) phthalocyanine molecule 105. Yang, B., Kazuma, E., Yokota, Y. & Kim, Y. Fabrication of sharp gold tips by three-electrode
in the presence of a single silver atom utilizing a full quantum mechanical description electrochemical etching with high controllability and reproducibility. J. Phys. Chem. C
to reveal unique non-resonant and resonant chemical tip–molecule interactions, and 122, 16950–16955 (2018).
the research also demonstrates that these lead to alter TERS spectra and contribute to 106. Taguchi, A., Yu, J., Verma, P. & Kawata, S. Optical antennas with multiple plasmonic
subnanometre TERS resolution. nanoparticles for tip-enhanced Raman microscopy. Nanoscale 7, 17424–17433 (2015).
71. Li, J., Li, X., Zhai, H.-J. & Wang, L.-S. Au20: a tetrahedral cluster. Science 299, 864–867 In this article, the authors theoretically and experimentally investigate the influence
(2003). of multiple metal grains on the electromagnetic field enhancement.
72. Zhao, Jensen, L. & Schatz, G. C. Pyridine–Ag20 cluster: a model system for studying 107. Vasconcelos, T. L. et al. Tuning localized surface plasmon resonance in scanning
surface-enhanced Raman scattering. J. Am. Chem. Soc. 128, 2911–2919 (2006). near-field optical microscopy probes. ACS Nano 9, 6297–6304 (2015).
73. Duan, S. et al. Theoretical modeling of plasmon-enhanced Raman images of a single 108. Vasconcelos, T. L. et al. Plasmon-tunable tip pyramids: monopole nanoantennas for
molecule with subnanometer resolution. J. Am. Chem. Soc. 137, 9515–9518 (2015). near-field scanning optical microscopy. Adv. Optical Mater. 6, 1800528 (2018).
74. Duan, S., Tian, G. & Luo, Y. Theory for modeling of high resolution resonant and 109. Carnegie, C. et al. Room-temperature optical picocavities below 1 nm3 accessing
nonresonant Raman images. J. Chem. Theory Comput. 12, 4986–4995 (2016). single-atom geometries. J. Phys. Chem. Lett. 9, 7146–7151 (2018).
75. Duan, S., Xie, Z., Tian, G. & Luo, Y. Effects of plasmon modes on resonant Raman images This research article demonstrates the chemistry and dynamics of a single gold
of a single molecule. J. Phys. Chem. Lett. 11, 407–411 (2020). adatom, distinguishing atom dynamics in real time, to provide insights into the
76. Mortensen, J. J., Hansen, L. B. & Jacobsen, K. W. Real-space grid implementation of the stability of picocavities under ambient conditions.
projector augmented wave method. Phys. Rev. B 71, 035109 (2005). 110. Huang, Y.-P. et al. Shell-isolated tip-enhanced Raman and fluorescence spectroscopy.
77. Enkovaara, J. et al. Electronic structure calculations with GPAW: a real-space implementation Angew. Chem. Int. Ed. 57, 7523–7527 (2018).
of the projector augmented-wave method. J. Phys. Condens. Matter 22, 253202 (2010). 111. Martín Sabanés, N., Driessen, L. M. A. & Domke, K. F. Versatile side-illumination geometry
78. Lin, Q. et al. Optical suppression of energy barriers in single molecule-metal binding. for tip-enhanced Raman spectroscopy at solid/liquid interfaces. Anal. Chem. 88, 7108–7114
Sci. Adv. 8, eabp9285 (2022). (2016).
79. Griffiths, J. et al. Resolving sub-Angstrom ambient motion through reconstruction from 112. Yokota, Y. et al. Systematic assessment of benzenethiol self-assembled monolayers on
vibrational spectra. Nat. Commun. 12, 6759 (2021). Au(111) as a standard sample for electrochemical tip-enhanced Raman spectroscopy.
80. Fiederling, K. et al. A full quantum mechanical approach assessing the chemical and J. Phys. Chem. C 123, 2953–2963 (2019).
electromagnetic effect in TERS. ACS Nano 17, 13137–13146 (2023). 113. Chen, X., Goubert, G., Jiang, S. & Van Duyne, R. P. Electrochemical STM tip-enhanced
81. Zhang, Y., Dong, Z.-C. & Aizpurua, J. Theoretical treatment of single-molecule scanning Raman spectroscopy study of electron transfer reactions of covalently tethered
Raman picoscopy in strongly inhomogeneous near fields. J. Raman Spectrosc. 52, chromophores on Au(111). J. Phys. Chem. C 122, 11586–11590 (2018).
296–309 (2021). 114. Kumar, N., Wondergem, C. S., Wain, A. J. & Weckhuysen, B. M. In situ nanoscale
This paper introduces a simplified calculation procedure to calculate inhomogeneous investigation of catalytic reactions in the liquid phase using zirconia-protected
field-enhanced Raman spectra from a single molecule. tip-enhanced Raman spectroscopy probes. J. Phys. Chem. Lett. 10, 1669–1675 (2019).
82. Giovannini, T. et al. Do we really need quantum mechanics to describe plasmonic 115. Zeng, Z.-C. et al. Electrochemical tip-enhanced Raman spectroscopy. J. Am. Chem. Soc.
properties of metal nanostructures? ACS Photonics 9, 3025–3034 (2022). 137, 11928–11931 (2015).
83. Bursi, L., Calzolari, A., Corni, S. & Molinari, E. Quantifying the plasmonic character 116. Nečas, D. & Klapetek, P. Gwyddion: an open-source software for SPM data analysis.
of optical excitations in nanostructures. ACS Photonics 3, 520–525 (2016). Open Phys. 10, 181–188 (2012).
84. Ropers, C. et al. Grating-coupling of surface plasmons onto metallic tips: a nanoconfined 117. Kurouski, D., Mattei, M. & Van Duyne, R. Probing redox reactions at the nanoscale with
light source. Nano Lett. 7, 2784–2788 (2007). electrochemical tip-enhanced Raman spectroscopy. Nano Lett. 15, 7956–7962 (2015).
85. Berweger, S., Atkin, J. M., Olmon, R. L. & Raschke, M. Adiabatic tip-plasmon focusing 118. Zhang, Z., Deckert-Gaudig, T., Singh, P. & Deckert, V. Single molecule level plasmonic
for nano-Raman spectroscopy. J. Phys. Chem. Lett. 1, 3427–3432 (2010). catalysis — a dilution study of p-nitrothiophenol on gold dimers. Chem. Commun. 51,
86. Umakoshi, T., Saito, Y. & Verma, P. Highly efficient plasmonic tip design for plasmon 3069–3072 (2015).
nanofocusing in near-field optical microscopy. Nanoscale 8, 5634–5640 (2016). 119. Zhang, Z., Richard-Lacroix, M. & Deckert, V. Plasmon induced polymerization using
87. Lee, D. Y. et al. Adaptive tip-enhanced nano-spectroscopy. Nat. Commun. 12, 3465 (2021). a TERS approach: a platform for nanostructured 2D/1D material production. Faraday
88. Novotny, L., Bian, R. X. & Xie, X. S. Theory of nanometric optical tweezers. Phys. Rev. Lett. Discuss. 205, 213–226 (2017).
79, 645–648 (1997). 120. Szczerbiński, J., Metternich, J. B., Goubert, G. & Zenobi, R. How peptides dissociate in
89. Kazemi-Zanjani, N., Vedraine, S. & Lagugne-Labarthet, F. Localized enhancement of plasmonic hot spots. Small 16, 1905197 (2020).
electric field in tip-enhanced Raman spectroscopy using radially and linearly polarized 121. Veres, M., Füle, M., Tóth, S., Koós, M. & Pócsik, I. Surface enhanced Raman scattering
light. Opt. Express 21, 25271–25276 (2013). (SERS) investigation of amorphous carbon. Diam. Relat. Mater. 13, 1412–1415 (2004).
90. Mueller, N. S., Juergensen, S., Höflich, K., Reich, S. & Kusch, P. Excitation-tunable 122. Yao, X. et al. Targeted suppression of peptide degradation in Ag-based surface-enhanced
tip-enhanced Raman spectroscopy. J. Phys. Chem. C 122, 28273–28279 (2018). Raman spectra by depletion of hot carriers. Small 18, 2205080 (2022).
91. Glebov, A. L. et al. Volume Bragg gratings as ultra-narrow and multiband optical filters. 123. Meng, L., Yang, Z., Chen, J. & Sun, M. Effect of electric field gradient on sub-nanometer
in Proc. SPIE. 8428, Micro-Optics 2012 84280C (2012). spatial resolution of tip-enhanced Raman spectroscopy. Sci. Rep. 5, 9240 (2015).
92. Rapaport, A. et al. Very low frequency Stokes and anti‐Stokes Raman spectra accessible 124. Sun, M., Zhang, Z., Chen, L., Sheng, S. & Xu, H. Plasmonic gradient effects on high
with a single multichannel spectrograph and volume Bragg grating optical filters. vacuum tip-enhanced Raman spectroscopy. Adv. Optical Mater. 2, 74–80 (2014).
AIP Conf. Proc. 1267, 808–809 (2010). 125. Cao, Y. et al. Plasmonic gradient and plexcitonic effects in single-molecule tip-enhanced
93. Yano, T.-A., Ichimura, T., Kuwahara, S., Verma, P. & Kawata, S. Subnanometric stabilization (resonance) Raman spectroscopy. J. Phys. Chem. C 127, 476–489 (2023).
of plasmon-enhanced optical microscopy. Nanotechnology 23, 205503 (2012). 126. Poliani, E. et al. Breakdown of far-field Raman selection rules by light–plasmon coupling
94. Yano, T.-A., Tsuchimoto, Y., Mochizuki, M., Hayashi, T. & Hara, M. Laser scanning-assisted demonstrated by tip-enhanced Raman scattering. J. Phys. Chem. Lett. 8, 5462–5471
tip-enhanced optical microscopy for robust optical nanospectroscopy. Appl. Spectrosc. (2017).
70, 1239–1243 (2016). 127. Deckert-Gaudig, T., Rauls, E. & Deckert, V. Aromatic amino acid monolayers sandwiched
95. Kato, R., Moriyama, T., Umakoshi, T., Yano, T.-A. & Verma, P. Ultrastable tip-enhanced between gold and silver: a combined tip-enhanced Raman and theoretical approach.
hyperspectral optical nanoimaging for defect analysis of large-sized WS2 layers. Sci. Adv. J. Phys. Chem. C 114, 7412–7420 (2010).
8, eabo4021 (2022). 128. Kurouski, D., Postiglione, T., Deckert-Gaudig, T., Deckert, V. & Lednev, I. K. Amide I
96. Hayazawa, N., Furusawa, K. & Kawata, S. Nanometric locking of the tight focus for optical vibrational mode suppression in surface (SERS) and tip (TERS) enhanced Raman spectra
microscopy and tip-enhanced microscopy. Nanotechnology 23, 465203 (2012). of protein specimens. Analyst 138, 1665–1673 (2013).
97. Binnig, G., Quate, C. F. & Gerber, C. Atomic force microscope. Phys. Rev. Lett. 56, 930–933 129. Liu, S., Hammud, A., Wolf, M. & Kumagai, T. Atomic point contact Raman spectroscopy
(1986). of a Si(111)-7 × 7 surface. Nano Lett. 21, 4057–4061 (2021).
98. Binnig, G., Rohrer, H., Gerber, C. & Weibel, E. Surface studies by scanning tunneling 130. Yang, B. et al. Chemical enhancement and quenching in single-molecule tip-enhanced
microscopy. Phys. Rev. Lett. 49, 57–61 (1982). Raman spectroscopy. Angew. Chem. Int. Ed. 62, e202218799 (2023).
99. Cappella, B. & Dietler, G. Force-distance curves by atomic force microscopy. Surf. Sci. Rep. 131. Guo, S., Popp, J. & Bocklitz, T. Chemometric analysis in Raman spectroscopy from
34, 1–104 (1999). experimental design to machine learning-based modeling. Nat. Protoc. 16, 5426–5459
100. Karrai, K. & Tiemann, I. Interfacial shear force microscopy. Phys. Rev. B 62, 13174–13181 (2021).
(2000). 132. Gautam, R., Vanga, S., Ariese, F. & Umapathy, S. Review of multidimensional data processing
101. Hansma, P. K. et al. Tapping mode atomic force microscopy in liquids. Appl. Phys. Lett. approaches for Raman and infrared spectroscopy. EPJ Tech. Instrum. 2, 8 (2015).
64, 1738–1740 (1994). 133. Su, W., Kumar, N., Krayev, A. & Chaigneau, M. In situ topographical chemical and
102. Dufrêne, Y. F. et al. Imaging modes of atomic force microscopy for application in molecular electrical imaging of carboxyl graphene oxide at the nanoscale. Nat. Commun. 9, 2891
and cell biology. Nat. Nanotechnol. 12, 295–307 (2017). (2018).
103. Xu, D., Liang, B., Xu, Y. & Liu, M. Recent advances in tip-enhanced Raman spectroscopy This work introduces multi-parameter microscopy to measure local electronic
probe designs. Nano Res. 16, 5555–5571 (2023). properties in situ by KPFM.

Nature Reviews Methods Primers | (2024) 4:47 18


0123456789();:
Primer

134. Deckert-Gaudig, T., Pichot, V., Spitzer, D. & Deckert, V. High-resolution Raman spectroscopy 164. Geim, A. K. & Novoselov, K. S. The rise of graphene. Nat. Mater. 6, 183–191 (2007).
for the nanostructural characterization of explosive nanodiamond precursors. 165. Geim, A. K. Graphene: status and prospects. Science 324, 1530–1534 (2009).
ChemPhysChem 18, 175–178 (2017). 166. Malard, L. M. et al. Studying 2D materials with advanced Raman spectroscopy: CARS, SRS
135. Dou, T., Li, Z., Zhang, J., Evilevitch, A. & Kurouski, D. Nanoscale structural characterization and TERS. Phys. Chem. Chem. Phys. 23, 23428–23444 (2021).
of individual viral particles using atomic force microscopy infrared spectroscopy (AFM-IR) 167. Rahaman, M. et al. Highly localized strain in a MoS2/Au heterostructure revealed by
and tip-enhanced Raman spectroscopy (TERS). Anal. Chem. 92, 11297–11304 (2020). tip-enhanced Raman spectroscopy. Nano Lett. 17, 6027–6033 (2017).
136. Hermelink, A. et al. Towards a correlative approach for characterising single virus 168. Vantasin, S. et al. Tip-enhanced Raman scattering of the local nanostructure of epitaxial
particles by transmission electron microscopy and nanoscale Raman spectroscopy. graphene grown on 4H-SiC (0001). J. Phys. Chem. C 118, 25809–25815 (2014).
Analyst 142, 1342–1349 (2017). 169. Su, W., Kumar, N., Mignuzzi, S., Crain, J. & Roy, D. Nanoscale mapping of excitonic
137. Huang, S.-C. et al. Electrochemical tip-enhanced Raman spectroscopy: an in situ processes in single-layer MoS2 using tip-enhanced photoluminescence microscopy.
nanospectroscopy for electrochemistry. Annu. Rev. Phys. Chem. 72, 213–234 (2021). Nanoscale 8, 10564–10569 (2016).
This research article provides a review on electrochemical TERS. 170. Kato, R., Umakoshi, T., Sam, R. T. & Verma, P. Probing nanoscale defects and wrinkles
138. Yokota, Y., Hong, M., Hayazawa, N. & Kim, Y. Electrochemical tip-enhanced Raman in MoS2 by tip-enhanced Raman spectroscopic imaging. Appl. Phys. Lett. 114, 073105
spectroscopy for microscopic studies of electrochemical interfaces. Surf. Sci. Rep. 77, (2019).
100576 (2022). 171. Huang, T.-X. et al. Probing the edge-related properties of atomically thin MoS2 at
139. Pfisterer, J. H. K. & Domke, K. F. Unfolding the versatile potential of EC-TERS for nanoscale. Nat. Commun. 10, 5544 (2019).
electrocatalysis. Curr. Opin. Electrochem. 8, 96–102 (2018). This research article demonstrates how TERS is used to probe the unique electronic
140. Martín Sabanés, N., Ohto, T., Andrienko, D., Nagata, Y. & Domke, K. F. Electrochemical TERS property of defects in MoS2.
elucidates potential-induced molecular reorientation of adenine/Au(111). Angew. Chem. 172. Beams, R., Cançado, L. G., Jorio, A., Vamivakas, A. N. & Novotny, L. Tip-enhanced Raman
Int. Ed. 56, 9796–9801 (2017). mapping of local strain in graphene. Nanotechnology 26, 175702 (2015).
141. Fiocco, A. et al. Electrochemical tip-enhanced Raman spectroscopy for the elucidation 173. Cançado, L. G., Beams, R., Jorio, A. & Novotny, L. Theory of spatial coherence in near-field
of complex electrochemical reactions. Anal. Chem. 96, 2791–2798 (2024). Raman scattering. Phys. Rev. X 4, 031054 (2014).
142. Smithe, K. K. H. et al. Nanoscale heterogeneities in monolayer MoSe2 revealed by 174. Publio, B. C. et al. Inclusion of the sample-tip interaction term in the theory of tip-enhanced
correlated scanning probe microscopy and tip-enhanced Raman spectroscopy. Raman spectroscopy. Phys. Rev. B 105, 235414 (2022).
ACS Appl. Nano Mater. 1, 572–579 (2018). 175. Beams, R., Cançado, L. G., Oh, S.-H., Jorio, A. & Novotny, L. Spatial coherence in near-field
143. Bonhommeau, S., Cooney, G. S. & Huang, Y. Nanoscale chemical characterization of Raman scattering. Phys. Rev. Lett. 113, 186101 (2014).
biomolecules using tip-enhanced Raman spectroscopy. Chem. Soc. Rev. 51, 2416–2430 176. Rabelo, C. et al. Linkage between micro- and nano-Raman spectroscopy of defects
(2022). in graphene. Phys. Rev. Appl. 14, 024056 (2020).
This review article focuses specifically on TERS applications related to biomatter, and 177. Alencar, R. S. et al. Probing spatial phonon correlation length in post-transition metal
it critically discusses challenges related to this field. monochalcogenide gas using tip-enhanced Raman spectroscopy. Nano Lett. 19, 7357–7364
144. Talaga, D. et al. PIP2 phospholipid-induced aggregation of tau filaments probed by (2019).
tip-enhanced Raman spectroscopy. Angew. Chem. Int. Ed. 57, 15738–15742 (2018). 178. Nadas, R. B. et al. Spatially coherent tip-enhanced Raman spectroscopy measurements
145. Lipiec, E. et al. Nanoscale hyperspectral imaging of amyloid secondary structures in of electron–phonon interaction in a graphene device. Nano Lett. 23, 8827–8832 (2023).
liquid. Angew. Chem. Int. Ed. 60, 4545–4550 (2021). 179. Piscanec, S., Lazzeri, M., Mauri, F., Ferrari, A. C. & Robertson, J. Kohn anomalies and
This recent TERS study comprises the successful integration of liquid TERS for probing electron-phonon interactions in graphite. Phys. Rev. Lett. 93, 185503 (2004).
the secondary structure of amyloid fibrils in situ. 180. Das, A. et al. Monitoring dopants by Raman scattering in an electrochemically top-gated
146. Wood, B. R. et al. Tip-enhanced Raman scattering (TERS) from hemozoin crystals within a graphene transistor. Nat. Nanotechnol. 3, 210–215 (2008).
sectioned erythrocyte. Nano Lett. 11, 1868–1873 (2011). 181. Gadelha, A. C. et al. Localization of lattice dynamics in low-angle twisted bilayer graphene.
147. Mrđenović, D., Ge, W., Kumar, N. & Zenobi, R. Nanoscale chemical imaging of human Nature 590, 405–409 (2021).
cell membranes using tip-enhanced Raman spectroscopy. Angew. Chem. Int. Ed. 61, 182. Gadelha, A. C., Vasconcelos, T. L., Cançado, L. G. & Jorio, A. Nano-optical imaging of
e202210288 (2022). in-plane homojunctions in graphene and MoS2 van der Waals heterostructures on talc
148. Tabatabaei, M., Caetano, F. A., Pashee, F., Ferguson, S. S. G. & Lagugné-Labarthet, F. Tip- and SiO2. J. Phys. Chem. Lett. 12, 7625–7631 (2021).
enhanced Raman spectroscopy of amyloid β at neuronal spines. Analyst 142, 4415–4421 183. Lee, K. S. et al. MicrobioRaman: an open-access web repository for microbiological
(2017). Raman spectroscopy data. Nat. Microbiol. 9, 1152–1156 (2024).
149. Stepanenko, T. et al. Surface-enhanced Raman scattering (SERS) and tip-enhanced 184. Baumberg, J. J., Aizpurua, J., Mikkelsen, M. H. & Smith, D. R. Extreme nanophotonics from
Raman scattering (TERS) in label-free characterization of erythrocyte membranes ultrathin metallic gaps. Nat. Mater. 18, 668–678 (2019).
and extracellular vesicles at the nano-scale and molecular level. Analyst 149, 778–788 185. Stanciu, C., Sackrow, M. & Meixner, A. J. High NA particle- and tip-enhanced nanoscale
(2024). Raman spectroscopy with a parabolic-mirror microscope. J. Microsc. 229, 247–253 (2008).
150. Alexander, K. D. & Schultz, Z. D. Tip-enhanced Raman detection of antibody conjugated 186. Stockman, M. I. Nanofocusing of optical energy in tapered plasmonic waveguides.
nanoparticles on cellular membranes. Anal. Chem. 84, 7408–7414 (2012). Phys. Rev. Lett. 93, 137404 (2004).
151. Xiao, L., Wang, H. & Schultz, Z. D. Selective detection of RGD-integrin binding in cancer 187. Gramotnev, D. K. & Bozhevolnyi, S. I. Nanofocusing of electromagnetic radiation.
cells using tip enhanced Raman scattering microscopy. Anal. Chem. 88, 6547–6553 (2016). Nat. Photonics 8, 13–22 (2014).
152. Domke, K., Zhang, D. & Pettinger, B. Tip-enhanced Raman spectra of picomole quantities This review article provides an overview on the physical principles, developments and
of DNA nucleobases at Au (111). J. Am. Chem. Soc. 129, 6708–6709 (2007). applications of nanofocusing in plasmonic nanostructures.
153. Watanabe, H., Ishida, Y., Hayazawa, N., Inouye, Y. & Kawata, S. Tip-enhanced near-field 188. Lindquist, N. C., Nagpal, P., Lesuffleur, A., Norris, D. J. & Oh, S.-H. Three-dimensional
Raman analysis of tip-pressurized adenine molecule. Phys. Rev. B 69, 155418 (2004). plasmonic nanofocusing. Nano Lett. 10, 1369–1373 (2010).
154. Bailo, E. & Deckert, V. Tip-enhanced Raman spectroscopy of single RNA strands: towards 189. Taguchi, K., Umakoshi, T., Inoue, S. & Verma, P. Broadband plasmon nanofocusing:
a novel direct-sequencing method. Angew. Chem. Int. Ed. 47, 1658–1661 (2008). comprehensive study of broadband nanoscale light source. J. Phys. Chem. C 125,
155. Lin, X. et al. Direct base-to-base transitions in ssDNA revealed by tip-enhanced Raman 6378–6386 (2021).
scattering. Preprint at [Link] (2016). 190. Hampson, K. M. et al. Adaptive optics for high-resolution imaging. Nat. Rev. Methods
156. Hennemann, L. E., Meixner, A. J. & Zhang, D. Surface- and tip-enhanced Raman spectroscopy Primers 1, 68 (2021).
of DNA. Spectroscopy 24, 119–124 (2010). 191. Umakoshi, T., Kawashima, K., Moriyama, T., Kato, R. & Verma, P. Tip-enhanced Raman
157. Treffer, R., Lin, X.-M., Bailo, E., Deckert-Gaudig, T. & Deckert, V. Distinction of spectroscopy with amplitude-controlled tapping-mode AFM. Sci. Rep. 12, 12776 (2022).
nucleobases — a tip-enhanced Raman spectroscopy approach. Beilstein J. Nanotechnol. 192. Bartolomeo, G. L., Zhang, Y., Kumar, N. & Zenobi, R. Molecular perturbation effects
2, 628–637 (2011). in AFM-based tip-enhanced Raman spectroscopy: contact versus tapping mode.
158. Najjar, S. et al. Tip-enhanced Raman spectroscopy of combed double-stranded DNA Anal. Chem. 93, 15358–15364 (2021).
bundles. J. Phys. Chem. C 118, 1174–1181 (2013).
159. Zhang, R. et al. Distinguishing individual DNA bases in a network by non-resonant Acknowledgements
tip-enhanced Raman scattering. Angew. Chem. Int. Ed. 56, 5561–5564 (2017). V.D. and C.H. acknowledge funding from the Deutsche Forschungsgemeinschaft (DFG,
160. He, Z. et al. Tip-enhanced Raman imaging of single-stranded DNA with single base German Research Foundation) — CRC 1278 PolyTarget, project number 316213987 (project
resolution. J. Am. Chem. Soc. 141, 753–757 (2019). B04) and SFB 1375 (39881677, project C2). S.G. gratefully acknowledges funding from
This TERS study proves subnanometre resolution under ambient conditions by direct the European Research Council (ERC) under the European’s Horizon 2020 research and
nucleic acid sequencing of a phage ssDNA at a step size of 0.5 nm. innovation programme — QUEM-CHEM (grant number 772676), ‘Time- and space-resolved
161. He, Z. et al. Resolving the sequence of RNA strands by tip-enhanced Raman spectroscopy. ultrafast dynamics in molecular plasmonic hybrid systems’ and by the DFG (German
ACS Photonics 8, 424–430 (2021). Research Foundation) — SFB 1375 (39881677, project A4). A.J. acknowledges support from
162. Deckert, V. et al. Laser spectroscopic technique for direct identification of a single virus I: FAPEMIG (APQ-01860-2229868, RED0008123) and CNPq (307619/2023-0, APQ-04852-23,
FASTER CARS. Proc. Natl Acad. Sci. USA 117, 27820–27824 (2020). 421469/2023-4), Brazil. J.A. acknowledges support from grant PID2022-139579NB-I00 of the
163. Olschewski, K. et al. A manual and an automatic TERS based virus discrimination. Spanish Ministry of Science and Innovation and grant number IT 1526-22 from the Department
Nanoscale 7, 4545–4552 (2015). of Education of the Basque Government. C.H. and Z.Z. acknowledge support from the

Nature Reviews Methods Primers | (2024) 4:47 19


0123456789();:
Primer

National Natural Science Foundation of China (numbers U22A6005 and 12304426) and the Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
Natural Science Foundation of Shaanxi Province (numbers 2024JC-JCQN-07 and 22JSZ010). published maps and institutional affiliations.

Author contributions Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this
Introduction (C.H., S.G., S.K., J.A. and V.D.); Experimentation (C.H., H.C., Z.Z. and V.D.); Results article under a publishing agreement with the author(s) or other rightsholder(s); author self-
(C.H. and V.D.); Applications (C.H., A.J., H.C., Z.Z. and V.D.); Reproducibility and data deposition archiving of the accepted manuscript version of this article is solely governed by the terms of
(C.H. and V.D.); Limitations and optimizations (C.H. and V.D.); Outlook (C.H., J.A., H.C., S.G., A.J., such publishing agreement and applicable law.
S.K., Z.Z. and V.D.); overview of the Primer (C.H., J.A., H.C., S.G., A.J., S.K., Z.Z. and V.D.).

Competing interests © Springer Nature Limited 2024


The authors declare no competing interests.

Additional information
Peer review information Nature Reviews Methods Primers thanks the anonymous reviewer(s)
for their contribution to the peer review of this work.

Nature Reviews Methods Primers | (2024) 4:47 20


0123456789();:

Common questions

Powered by AI

Chemical effects at close tip-sample distances (<1 nm) involve site-specific interactions forming hybrid systems between metal atoms of the plasmonic tip and the sample molecule. These effects include non-resonant, resonant interactions, and charge-transfer phenomena, which modify the electronic structure of the molecule and influence TERS signal enhancement. Charge-transfer contributions, in particular, play a significant role at these distances, affecting resolution and plasmon-induced catalysis by altering charge distribution .

Picocavities enable the confinement of light to single atoms due to atomic-scale protrusions at the tip. This confinement results in a threefold to fivefold signal enhancement, allowing for ultrahigh spatial resolution below 1 nm, which surpasses the capabilities of traditional plasmonic gaps. In TERS experiments, picocavities facilitate the resolution of intramolecular vibrational features by enhancing light localization and providing exceptional chemical specificity .

Mechanical and thermal drift in TERS can destabilize the tip-sample interaction and misalign the focus, adversely affecting signal quality and spatial resolution. To counter this, drift compensation techniques using in situ corrections have been integrated. Lateral drift compensation and axial focus drift correction systems rely on feedback-controlled piezoelectric actuation to adjust the tip's or focus's position, augmented by optical readouts to continuously correct drift. These solutions enable stable, long-term mapping and imaging .

Adaptive optics in TERS contribute to enhanced light coupling by achieving spatial coherence and momentum matching of the incident field to the tip. These optics allow for precise control over the light field's properties, maximizing the interaction strength at the tip apex and reducing background noise. This improvement in light coupling results in stronger, more localized field enhancements, leading to more pronounced Raman signals and finer resolution capabilities in TERS experiments .

Incorporating metal atoms into quantum chemistry simulations for STM-TERS studies is crucial for accurately describing charge-transfer states. These states are prominent at close tip-sample distances and play a significant role in enhancing resolution and signal intensity. Quantum-chemical methods like TDDFT consider these metal atoms to simulate resonant and non-resonant interactions accurately, accounting for the changes in electronic structure due to charge-transfer phenomena. This inclusion ensures the fidelity of models used to predict the behavior of plasmon-molecule hybrid systems .

Tunable excitation wavelengths in TERS allow for the adaptation to varying optical transitions of different molecular species, facilitating their distinction based on unique vibrational signatures. This flexibility aids in resolving spectral features and enhances signal detection across a wider range of molecular species compared to fixed excitation settings. The ability to selectively tune excitation wavelengths enhances the specificity and sensitivity of molecular detection and characterization in TERS experiments .

Enhancement in TERS arises from electromagnetic and chemical contributions. Electromagnetic enhancement results from localized intensified electric fields near metal interfaces, often through plasmonic modes that significantly increase Raman signal strength. Chemical enhancement involves site-specific interactions, including non-resonant, resonant, and charge-transfer phenomena between the plasmonic nanoparticle and sample molecule. Combined, these mechanisms greatly amplify Raman signals, enabling sub-molecular sensitivity .

Technological advancements in TERS include the use of single-point photodetectors to capture intensity maps of specific marker bands, which accelerates data acquisition times compared to capturing full spectroscopic information with CCD cameras. This approach allows mapping at smaller step sizes while maintaining acceptable acquisition durations. In addition, systems for lateral drift compensation and axial focus drift correction using feedback-controlled piezoelectric actuation have been developed to maintain stability over large areas during prolonged imaging sessions .

Charge-transfer processes in TERS represent site-specific molecular interactions that alter electronic structures by transferring charges between the plasmonic tip and the sample. These interactions influence the electronic properties of the molecule, which can lead to further signal enhancement and affect both resolution and chemical specificity of TERS. Implementing quantum-chemical methods, such as TDDFT, helps to simulate these charge-transfer states, highlighting their significance in enhancing Raman signals and facilitating precise molecular characterization at the nanoscale .

Picocavities enhance our understanding of atomic-scale plasmonic interactions by confining light to volumes as small as single atoms. This confinement occurs due to atomic-scale protrusions and significantly enhances the electromagnetic field's localization. By facilitating the resolution of intramolecular vibrational modes, picocavities allow for greater insight into the precise light-matter interactions at nanoscales, surpassing previous spatial resolution limits. They serve as critical tools for exploring localized plasmonic phenomena at atomic levels .

You might also like