HKDSE Biology Mock Exam Paper 1A
HKDSE Biology Mock Exam Paper 1A
BIOLOGY PAPER 1
HKDSE MOCK EXAM XIII
GENERAL INSTRUCTIONS
1 There are TWO sections, A and B, in this Paper. You are advised to finish Section A in about 35 minutes.
2 Section A consists of multiple-choice questions in this question paper. Section B contains conventional
questions printed separately in Question-Answer Book B.
3 Answers to Section A should be marked on the Multiple-choice Answer Sheet while answers to Section B
should be written in the spaces provided in Question-Answer Book B. The Answer Sheet for Section A and
the Question-Answer Book B for Section B will be collected separately at the end of the examination.
1 Read carefully the instructions on the Answer Sheet. After the announcement of the start of the examination,
you should first stick a barcode label and insert the information required in the spaces provided. No extra time
will be given for sticking on the barcode label after the ‘Time is up’ announcement.
2 When told to open this book, you should check that all the questions are there. Look for the words ‘END OF
SECTION A’ after the last question.
4 ANSWER ALL QUESTIONS. You are advised to use an HB pencil to mark all the answers on the Answer
Sheet, so that wrong marks can be completely erased with a clean rubber. You must mark the answers clearly;
otherwise you will lose marks if the answers cannot be captured.
5 You should mark only ONE answer for each question. If you mark more than one answer, you will receive
NO MARKS for that question.
1 After trying to observe a specimen under high-power magnification of a light microscope, George
decided to switch back to low-power. Which of the following are the probable reasons behind?
2 George took a photomicrograph at high-power magnification and measured the distance between
two cells, X and Y, to find out the actual distance between the two cells in the specimen. The results
are as follows.
George also took a photomicrograph of the same specimen at 100× magnification. What would the
distance between cell X and cell Y be in the photomicrograph?
(Hint: 1 cm = 10,000 µm)
A 0.045 cm
B 0.18 cm
C 0.45 cm
D 1.8 cm
3 Which of the following processes will usually be very active in a cell immediately upon completion
of mitotic cell division?
(1) DNA replication
(2) oxidative phosphorylation
(3) protein synthesis
thick epidermal
layer
cut
thick epidermal
layer
She then put one strip into each of the three solutions, P, Q and R, of unknown sugar
concentrations. After 30 minutes, she observed the appearance of the strips. The results are
shown below.
Based on the above results, arrange the solutions in ascending order of their water potential.
A P, Q, R
B Q, P, R
C R, P, Q
D R, Q, P
5 Sarah is provided with four unlabelled liquid food samples. She is asked to identify the sample by
performing food tests on them. The components of the four samples are as follows.
I starch + vitamin C
II starch + maltose
What would be the minimum number of tests required to identify the four samples?
A 1
B 2
C 3
D 4
atmospheric
pressure
time (s)
6 With reference to the graph above, which of the following statements about the deep breathing
technique that James practised is/are correct?
(1) There should be no pause at the end of each inhalation.
(2) Make exhalation twice as long as inhalation.
(3) Breathe in air through the nose and breathe out through the mouth.
A (1) only
B (1) and (2) only
C (2) and (3) only
D (1), (2) and (3)
7 What is the rate of breathing of James when he was practising the deep breathing technique?
A 6 breaths per minute
B 7.5 breaths per minute
C 8 breaths per minute
D 10 breaths per minute
8 Under which combinations of environmental conditions would the stomata of a terrestrial dicot leaf
open the widest?
Light condition Wind speed
A dark 35 km/h
B dark 55 km/h
C light 45 km/h
D light 75 km/h
recommended daily
energy intake (kJ)
individual
The table below shows the basic information about Margaret, Elaine, Judy and Peter.
Gender F F F M
Age 75 41 29 9
P Q
Which of the following combinations correctly shows the first body parts likely to be found in
directions P and Q?
Direction P Direction Q
A foot brain
B heart kidney
C small intestine liver
D hand heart
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section A - 5 -
ã Oxford University Press 2021
11 The diagram shows the structure of Mary’s ear.
P Q R
Mary played the merry-go-round in a theme park. When she was stepping off the merry-go-round,
she could still feel the spinning movement in her head. Which of the following is the most probable
explanation for this?
A Structure P bulged outwards and could not vibrate freely.
B Structure S became blocked.
C The endolymph in structure Q was still moving.
D The perilymph in structure R was still moving.
12 Which of the following correctly shows the route of transport of amino acids from the mother’s
small intestine to the foetus in her uterus?
A hepatic portal vein → liver → hepatic vein → vena cava → heart → placenta →
umbilical vein
B hepatic vein → liver → vena cava → heart → lung → heart → placenta →
umbilical artery
C hepatic portal vein → liver → hepatic vein → vena cava → heart → lung → heart →
placenta → umbilical artery
D hepatic portal vein → liver → hepatic vein → vena cava → heart → lung → heart →
placenta → umbilical vein
The time taken for the mass of the gelatin cubes to decrease by 30% is measured. The results
are shown in the table below.
pH 2 4 6 8 10
13 Which of the following graphs correctly shows the activity of papain in the pH range investigated?
A B
activity of papain (min )
activity of papain (min-1)
-1
pH pH
C D
activity of papain (min )
-1
pH pH
15 Microorganism F is a salt-tolerant protozoan living in the sea. The table below shows the ratios of
two ions, sodium ion and potassium ion, in the cytoplasm of microorganism F to the sea water.
Which of the following correctly shows the net movement of ions across the cell membrane of
microorganism F and the mechanism behind?
Movement of ions Mechanism
A sodium ions out of the cell diffusion
B potassium ions into the cell active transport
C sodium ions into the cell active transport
D potassium ions out of the cell active transport
Directions: Questions 16 and 17 refer to the diagram below, which shows part of the structure of a
flower of plant U.
Q R
17 Which of the following is not a correct match of a pair of structures and their functions?
Female reproductive parts of Function
the flower and humans
A P and oviduct To receive the male gametes.
B R and ovary To produce ova.
C R and uterus To provide proection to the embryos.
D S and oviduct To serve as the site of fertilization.
18 The graph below shows the changes in a certain growth parameter of a bean seedling, the
cotyledons and the radicle of the same seedling during the first 12 days of germination.
X
growth parameter
p q r
0 5 10 15 20 25 30 35
time (min)
The oxygen debt of the person can be obtained by measuring the area of
A m.
B o.
C n + o.
D o + r.
20 A scientist extracted some mitochondria from a mouse liver tissue and transferred the extracted
mitochondria to a solution containing ADP and inorganic phosphate (Pi). He then added two
chemicals, succinate and cyanide, one by one into the solution mixture. The amount of oxygen
consumed and the amount of ATP synthesized by the mitochondria were measured. The graph
below shows the results of the experiment.
succinate cyanide
added added
amount of oxygen consumed or
ATP synthesized
synthesis of ATP
oxygen consumption
time
A (2) only
B (1) and (2) only
C (1) and (3) only
D (2) and (3) only
21 The diagram below shows the regions with reported cases of dengue fever during the periods 1943–
1952 and 1993–2012.
Regions with reported cases Regions with reported cases
of dengue fever in 1943–1952 of dengue fever in 1993–2012
Which of the following factors may contribute to the global spread of dengue fever starting from
1943?
(1) rapid growth in human population
(2) increase in the reproduction rate of the vectors
(3) growth in global traffic
L R L R
RL RL
X
optic nerve
left right
hemisphere hemisphere
Which of the following correctly identifies the vision in the left and right eyes if the optic nerve is
damaged and severed at site X?
A left eye right eye
normal vision
loss of vision
Trophic level P Q R
Which of the following correctly shows the pyramid of numbers of this food chain?
A B
P Q
Q P
R R
C D
Q P
R R
P Q
24 Which of the following is most likely the major factor that limits the number of trophic levels on a
piece of grassland?
A biomass of the producer
B efficiency of energy transfer between trophic levels
C population of the predator
D sunshine duration
100 generations
Based on the pie charts above, which of the following statements is/are correct?
(1) Allele X must be a dominant allele.
(2) Allele X can cause disease in heterozygous condition.
(3) Individuals possessing two copies of allele X are more likely to survive and reproduce.
A (3) only
B (1) and (2) only
C (1) and (3) only
D (2) and (3) only
26 The graph below shows the change in the level of three nitrogenous compounds X, Y and Z, in an
aquarium over a period of time. The aquarium contains nitrifying bacteria that help remove
ammonium compounds produced by the fish.
concentration (arbitrary unit)
time
Species P Q R S T
P -
Q 12 -
R 11 1 -
S 10 3 2 -
T 11 6 5 3 -
Which of the following evolutionary trees best illustrates the phylogenetic relationships of the five
mammalian species?
A B
Q R S T P T R S P Q
ancestor ancestor
C D
T S R Q P T R Q S P
ancestor ancestor
28 A blood sample was collected from a blood donor and was tested with anti-A antibody and anti-B
antibody respectively. The table below shows the results of the test.
Result
Based on the test results, the donor can donate blood to people of blood group
(1) A.
(2) B.
(3) AB.
Which of the following is the best explanation for the level of radioactivity detected in the
non-green part of leaf X?
A Some of the photosynthetic products are transported from the green part to non-green part of
the leaf.
B The plant had not been destarched before the experiment.
C Photosynthesis also occurs in the non-green part of the leaf but at a slower rate.
D Radioactive carbon dioxide diffuses into the non-green part of the leaf.
30 Which of the following statements about Darwin’s theory of evolution is/are correct?
(1) Organisms will evolve into a new species when there are changes in environmental
conditions.
(2) All individuals in a population have equal chance to reproduce.
(3) Intraspecific competition is the driving force behind natural selection.
A (1) only
B (3) only
C (1) and (3) only
D (2) and (3) only
rate of photosynthesis
0 10 20 30 40
temperature (°C)
Glycogen storage disease is a rare genetic disease in which the liver cells lose their
ability to convert stored glycogen into glucose. The pedigree below shows the
inheritance of glycogen storage disease in a family.
6 7
32 With reference from the pedigree above, what is the mode of inheritance of glycogen storage
disease?
A autosomal dominant B autosomal recessive
C X-linked dominant D X-linked recessive
A (1) only
B (1) and (2) only
C (1) and (3) only
D (2) and (3) only
34 In a certain species of primrose, the colour of the flowers is controlled by two genes, I and II. The
dominate allele (B) of gene I controls the production of a blue pigment and the dominant allele (Y)
of gene II controls the production of a yellow pigment. The table below shows the possible
genotypes and phenotypes of the primrose species.
Genotype Phenotype
If two primrose plants with green flowers of identical genotype are crossed, the ratio of offspring
having green flowers to blue flowers is 3:1. Which of the following can be deduced based on the
result of the cross?
(1) The parents must be homozygous dominant for gene I.
(2) The parents must be heterozygous for gene II.
(3) Gene I and gene II are located on different pairs of chromosomes.
15N
With reference to the results, which of the following statements are correct?
(1) In the first generation, one strand of each DNA molecule contains 15N while the other strand
contains 14N.
(2) In the second generation, half of the DNA molecules contain only 14N, and the remaining half
contain both 14N and 15N.
(3) After the third generation, all the DNA molecules contain only 14N.
36 The table below shows some information about the genomes of five organisms.
– END OF SECTION A –
PAPER 1B
BIOLOGY PAPER 1
HKDSE MOCK EXAM XIII
1 For each of the structures of the human eye listed in column 1, select from column 2 one
phrase that matches it. Put the appropriate letter in the space provided. (3 marks)
Column 1 Column 2
Y
Answers written in the margins will not be marked.
b Explain how the leaf is adapted for gas exchange with reference to one feature of tissue
Y observable in the photomicrograph. (2 marks)
there are air spaces in between the structure Y, Structure Y is spongy mesophyll
they are closely packed, this provides a larger surface area for the water to drain
out of the leaf during transpiration and prevents excessive water loss
100
80
concentration 60
of sugar
(arbitrary unit) 40
20
0
Answers written in the margins will not be marked.
a What is the main kind of sugar found at the exit of the stomach? (1 mark)
glucose
4 The diagram below shows a process in the synthesis of a polypeptide in a human cell.
amino
amino acid U amin
o
acid T acid
V
G A
U G
C A U
G C
peptide bond
Answers written in the margins will not be marked.
ribosome
tRNA
A U A G C U
U G C G C A U A U C G A A C U
… …
mRNA
movement of ribosome
a Where does this process take place in the human cell? (1 mark)
b Which amino acid will be added to the polypeptide chain next? (1 mark)
Using the information from the table above, state what amino acids P and V are.
(2 marks)
5 The diagram below shows the locations where two fish species (P and Q) are found in Central
America at present.
Fish Q
North America
Atlantic
Ocean
Isthmus of
Panama
Answers written in the margins will not be marked.
Pacific
Ocean
Fish P
Scientists believe that the two fish species evolved from a common ancestor after the
formation of the Isthmus of Panama, a narrow strip of land that connects North America and
South America, around 2.8 million years ago.
a Suggest how the two fish species might have evolved from the common ancestor.
(4 marks)
Fish R Fish S
Answers written in the margins will not be marked.
2 a ……………... Fish P
2 b ……………... Fish Q
6 Andy wanted to grow tomato plants at home. He wondered if using tomato juice can promote
the growth of tomato plants from seeds. The diagram below shows how he used tomato juice
to grow tomatoes. To his surprise, no seed germinated after three days.
seed
fruit wall
small piece
of tomato
no seed
germination
a Explain why it is important to wash the seeds thoroughly (step 2) before placing them
on cotton wool. (1 mark)
b Describe two conditions that should be provided to the seeds in step 5 and their
significance to seed germination. (2 marks)
c Andy forgot to include a control. If you were Andy, how would you set up a suitable
control for this experiment? Explain your answer. (3 marks)
Answers written in the margins will not be marked.
oxygen sensor
aquatic plant
dilute sodium
hydrogencarbonate
table lamp solution
a Explain why placing a water tank between the table lamp and the conical flask is
important for making the investigation a fair test. (2 marks)
c Each time Jason had manipulated the independent variable, he waited for five minutes
before starting to record the readings of the oxygen sensor. Explain why. (1 mark)
10
8
rate of 6
photosynthesis
(arbitrary unit) 4
2
0
0 0.1 0.2 0.3 0.4 0.5
carbon dioxide concentration (%)
Answers written in the margins will not be marked.
tubercle
(a structure
containing air sac
bacteria and
white blood
cells)
(×30)
b With reference to the photomicrograph, explain why TB patients usually experience
shortness of breath. (2 marks)
ii What reminders should be given to patients who are undergoing the antibiotic
treatment of TB so that the antibiotics currently in use can remain effective in
treating TB for a longer time? Give two examples. (2 marks)
Answers written in the margins will not be marked.
ii Government (1 mark)
species X species Y
With reference to the photographs above, explain why the abundance of the two
Answers written in the margins will not be marked.
b Using the graph paper on the next page, plot a graph to show the results of this study.
(5 marks)
c City P is undergoing rapid urbanization and large areas of the woodlands will be
destroyed to create lands for building houses and infrastructure. Deduce, with reasons,
which plant species (X or Y) would be more abundant in the city in the future.
(2 marks)
10 The diagram below shows part of the metabolic pathways involving two amino acids, X and
Y, in the human body. Amino acid Y is important for the synthesis of pigments in the skin
and hair.
proteases
People suffering from a certain genetic disease cannot produce functional enzyme P. It is
known that the inheritance of this disease is controlled by a pair of alleles. The disease can be
diagnosed by measuring the levels of amino acids X and Y in blood. The table below shows
the normal range of the ratio between the two amino acids and the typical range in patients
with this genetic disease.
c The pedigree below shows the inheritance of the genetic disease in a family. It is known
that the disease is caused by a recessive allele.
Key:
normal male
Mr Wong Mrs Wong
female with the disease
ii Mrs Wong has just given birth to Elaine. The couple thinks that the probability of
Elaine being normal is 50% as one out of two of their children is normal. Do you
agree with them? Explain your answer. (2 marks)
11 Water is essential for the survival of all living forms on earth. Describe how water is
transported in humans and in terrestrial plants. Illustrate, with examples, the role of water as a
transport medium for materials in humans and in terrestrial plants. (12 marks)
Answers written in the margins will not be marked.
BIOLOGY PAPER 2
HKDSE MOCK EXAM XIII
INSTRUCTIONS
1 There are FOUR sections, A, B, C and D in this Paper. Attempt ALL questions in any TWO sections.
2 Write your answers in the Answer Book. Start each question (not part of a question) on a new page.
1 a A kidney transplant is often the treatment of choice for kidney failure. However, there are
problems associated with kidney transplants. Scientists are now trying to develop a
bioartificial kidney as a better solution to kidney failure. Ideally, it would be a small,
implantable device that performs the functions of the natural kidney. An early design of
bioartificial kidney is shown below.
blood from patient
membrane
ultrafiltrate
hemofilter
ultrafiltrate
bioartificial
blood reservoir
kidney
ultrafiltrate
bioreactor
urine
The hemofilter consists of membranes, which rely on the body’s blood pressure to form
ultrafiltrate. The blood and ultrafiltrate then enter the bioreactor, which contains renal tubule
cells derived from stem cells of the patient to perform functions of the first coiled tubule.
The processed blood will return to the patient’s body and the urine produced will be passed
to the urinary bladder for removal.
i Name the part(s) of the nephron that perform(s) the same function as the hemofilter.
(1 mark)
ii One of the functions of the bioreactor is to concentrate the ultrafiltrate into urine with a
relatively high urea concentration. Based on your biological knowledge, suggest how
this can be achieved by the bioreactor. (5 marks)
iii Give two advantages of using a bioartificial kidney over a kidney transplant.
(2 marks)
iv Some of the predicted side effects of using a bioartificial kidney include frequent thirst
and production of large volumes of urine. It is caused by the fact that the bioartificial
kidney does not have the ability to respond to the hormone ADH. Suggest how this
causes the predicted side effects. (2 marks)
In the investigation, 12 young and healthy women were tested twice throughout one
menstrual cycle, once during the middle follicular phase (day 6 to 9) and once during the
luteal phase of their menstrual cycle. They were asked to sit quietly inside a room set at a
temperature of 41 °C and a relative humidity of 21% for 30 minutes. Their body temperature,
skin blood flow rate at the forehead and sweating rate at the forehead were measured at
regular intervals. The results are shown below.
Graph I
body temperature (oC)
average
follicular
luteal
time (minute)
Graph II Graph III
at forehead (arbitrary unit)
average blood flow rate
follicular follicular
luteal luteal
i Briefly explain why the body temperature of the subjects increases during the
investigation. (2 marks)
ii Explain why there is an increase in blood flow to the skin of the forehead during the
investigation. (3 marks)
iii Do the results support the hypothesis of the investigation? Explain your answer.
(3 marks)
iv Apart from maintaining the thickness of the uterine lining, suggest another importance
of the high level of progesterone during the luteal phase to the survival of the foetus.
(2 marks)
4 a Huntington’s disease is an autosomal dominant genetic disorder that leads to a loss in brain
functions and eventually death. It is caused by mutations in the HTT gene. Patients with
Huntington’s disease usually have large numbers of repeats of the base sequence CAG in the
gene.
Since the early 1990s, a genetic test has been available to predict whether a person will
develop Huntington’s disease or not and when the disease onset will be. It involves finding
out the number of CAG repeats in the HTT gene by DNA fingerprinting. The table below
shows the relationship between the number of CAG repeats, the predicted risk and possible
onset time of Huntington’s disease.
i Before the genetic test, polymerase chain reaction (PCR) is often performed on the
DNA samples. The diagram below shows part of the DNA sequence of a normal HTT
gene.
…CCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCG…
(1) How many CAG repeats are there in the gene? (1 mark)
(2) The base sequence below belongs to one of the primers used in PCR:
CGGCGGTGGCGGCTGTTG
State the region on the HTT gene that the primer would anneal to. (1 mark)
individual
1 2 3 4 5
A
B
number of
CAG repeats 33/39 24/51
iii Explain why there is only one band in the DNA fingerprint of individual 3. (1 mark)
(2) Should individual 4 disclose the test result to his wife and his daughter? Give a
reason to support your answer. (2 marks)
Scientists use Agrobacterium to transfer the Bt gene into the cells of maize plants.
The bacterium contains a plasmid with the gene for resistance against a chemical called
kanamycin. The flow chart below shows the main steps involved in the production of
Bt maize.
Insert the Bt gene into the plasmid and join them using DNA ligase.
After 1 day
Transfer the discs to agar plate B which contains kanamycin and allow the
maize tissues to grow into plantlets.
i The maize tissues used are obtained from meristematic tissues of the maize plants.
State one property of the cells in meristematic tissues that allows them to be suitable
for use in producing GM maize plants. (1 mark)
ii (1) Kanamycin is present in agar plate B. Suggest how it can be used to screen for
transformed maize cells. (2 marks)
(2) Other than kanamycin, suggest, with reasons, two ingredients that should be
present in agar plate B. (4 marks)
iii Scientists carried out an experiment to investigate the effect of growing Bt maize plants
in a piece of farmland on the population of non-target insect species (e.g. caddisflies)
in a nearby river. In the laboratory, they fed caddisfly larvae with maize leaves
containing certain concentrations of Bt toxins for 15 weeks and measured the death
rate of the caddisfly larvae. The results are shown in the graph on the next page.
20 ng/mg
30
10
0 5 10 15
time (weeks)
(1) Briefly describe the effect of feeding caddisfly larvae with Bt maize leaves.
(1 mark)
(2) Based on the results, some environmentalists warn that Bt crops can lead to a
decrease in the populations of other non-target species (e.g. caddisflies) and thus
have long-term negative effects on the nearby freshwater communities. However,
some scientists argue that the design of the investigation fails to reflect the reality
and the ecological effects of planting Bt crops are inconclusive. Suggest the
reasons behind the scientists’ claim. (2 marks)
– END OF PAPER –
The results show higher radioactivity in the green parts of leaves exposed to light, suggesting photosynthesis occurred primarily there. The detected radioactivity in the non-green part of Leaf X implies transport of photosynthesized products from the green parts, not independent photosynthesis in the non-green areas .
Individuals can prevent the spread of tuberculosis by practicing respiratory hygiene and seeking prompt treatment if symptoms arise. Governments can implement public health initiatives like vaccination programs and provide resources for education and access to healthcare to control outbreaks .
The correlation between photosynthesis and respiration rates at different temperatures can be understood through a balance between these processes. At higher temperatures, respiration rates may increase relative to photosynthesis, leading to no net food production if the rate of respiration exceeds photosynthesis, as indicated at temperatures above 36°C .
The effectiveness of tuberculosis treatment with antibiotics is impacted by the necessity to use multiple antibiotics to prevent resistance development. Compliance with treatment regimens is crucial to ensure effectiveness and delay resistance emergence, highlighting the importance of completing prescribed courses .
Gene interaction explains the phenotypic outcomes as two genes, each with two alleles, influence flower color. The dominant alleles in combination (B for blue pigment and Y for yellow pigment) result in green flowers, showing epistasis where presence of another dominant pigment gene changes the phenotypic outcome to green despite blue and yellow pigment precursors .
The appearance of plant strips in different sugar solutions relates to water potential, as water moves from higher to lower potential. Strips in hypertonic solutions (lower water potential) will shrink, while those in hypotonic solutions (higher water potential) will swell. This correlates with the arrangement of solutions in ascending order of their water potential .
Studying gene density helps understand genome evolution as it varies significantly among organisms, revealing how genes are organized and utilized. For example, higher gene density in simpler organisms like bacteria compared to complex organisms like humans indicates differing evolutionary strategies and regulatory mechanisms .
Investigating enzyme deficiencies, such as lack of functional enzyme P, helps diagnose metabolic diseases by revealing abnormal amino acid levels. This approach allows identification of blockages in metabolic pathways, aiding in diagnosis of diseases like those affecting pigment synthesis due to amino acid Y deficiency .
To obtain a clear image at high-power magnification, adjustments such as refocusing the objective lens are necessary, as indicated by the need to refocus after failing to obtain a clear image initially .
Glycogen storage disease exhibits an autosomal recessive inheritance pattern. This is inferred from the pedigree analysis where the disease appears to be inherited only when both parents contribute a recessive allele, indicating it is autosomal recessive .