0% found this document useful (0 votes)
55 views221 pages

Python For Biologists

Uploaded by

kkwaiheejini
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
55 views221 pages

Python For Biologists

Uploaded by

kkwaiheejini
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

i

Copyright © 2013 Dr. Martin Jones

This work is licensed under a Creative Commons Attribution-NonCommercial-


ShareAlike 3.0 Unported License.

For more information, visit [Link]


Set in PT Serif and Source Code Pro
ii

About the author


Martin started his programming career by learning Perl during the
course of his PhD in evolutionary biology, and started teaching
other people to program soon after. Since then he has taught
introductory programming to hundreds of biologists, from
undergraduates to PIs, and has maintained a philosophy that
programming courses must be friendly, approachable, and
practical.

Martin has taught introductory programming as part of the


Bioinformatics MSc course at Edinburgh University for the past five
years, and is currently Lecturer in Bioinformatics.
iii

Preface
Welcome to Python for Biologists.
Before you read any further, make sure that this is the most recent
version of the book. Python for Biologists is being continually
updated and improved to take into account corrections,
amendments and changes to Python itself, so it's important that
you are reading the most up-to-date version.
This file is revision number 205. The number of the most recent
revision can always be found at:
[Link]
If the revision number listed at the URL is higher than the one in
bold, then this is an out-of-date copy, and you need to download
the latest version from
[Link]
You'll notice from the copyright page that the contents of this book
are licensed under a Creative Commons Attribution ShareAlike
license. This means that you're free to do what you like with it –
copy it, email it to your friends, wallpaper your lab with it – as long
as you keep the attribution. You can also modify it, as long as you
license your modification under the same terms. The only thing that
the license doesn't allow is commercial use – if you'd like to use the
contents of this course for commercial purposes, get in touch with
me at
martin@[Link]

Happy programming!
iv

Table of Contents
About the author » ii
Preface » iii
1: Introduction and environment 1
Why have a programming book for biologists? » 1
Why Python? » 2
How to use this book » 5
Exercises and solutions » 7
Getting in touch » 8
Setting up your environment » 8
Text editors » 11
Reading the documentation » 12
2: Printing and manipulating text 13
Why are we so interested in working with text? » 13
Printing a message to the screen » 14
Quotes are important » 15
Use comments to annotate your code » 16
Error messages and debugging » 18
Printing special characters » 21
Storing strings in variables » 21
Tools for manipulating strings » 24
Recap » 34
Exercises » 36
Solutions » 39
3: Reading and writing files 52
Why are we so interested in working with files? » 52
Reading text from a file » 53
Files, contents and file names » 55
Dealing with newlines » 57
Missing files » 60
Writing text to files » 60
Closing files » 63
Paths and folders » 63
Recap » 64
Exercises » 65
v

Solutions » 67
4: Lists and loops 74
Why do we need lists and loops? » 74
Creating lists and retrieving elements » 76
Working with list elements » 77
Writing a loop » 79
Indentation errors » 82
Using a string as a list » 83
Splitting a string to make a list » 84
Iterating over lines in a file » 84
Looping with ranges » 85
Recap » 87
Exercises » 89
Solutions » 90
5: Writing our own functions 99
Why do we want to write our own functions? » 99
Defining a function » 100
Calling and improving our function » 103
Encapsulation with functions » 105
Functions don't always have to take an argument » 106
Functions don't always have to return a value » 108
Functions can be called with named arguments » 108
Function arguments can have defaults » 110
Testing functions » 111
Recap » 113
Exercises » 115
Solutions » 116
6: Conditional tests 121
Programs need to make decisions » 121
Conditions, True and False » 121
if statements » 124
else statements » 125
elif statements » 126
while loops » 128
Building up complex conditions » 128
Writing true/false functions » 130
Recap » 131
vi

Exercises » 133
Solutions » 135
7: Regular expressions 141
The importance of patterns in biology » 141
Modules in Python » 143
Raw strings » 144
Searching for a pattern in a string » 145
Extracting the part of the string that matched » 150
Getting the position of a match » 152
Splitting a string using a regular expression » 153
Finding multiple matches » 154
Recap » 155
Exercises » 157
Solutions » 158
8: Dictionaries 168
Storing paired data » 168
Creating a dictionary » 173
Iterating over a dictionary » 179
Recap » 182
Exercises » 183
Solutions » 184
9: Files, programs, and user input 195
File contents and manipulation » 195
Basic file manipulation » 196
Deleting files and folders » 198
Listing folder contents » 198
Running external programs » 199
Running a program » 200
Saving program output » 201
User input makes our programs more flexible » 201
Interactive user input » 203
Command line arguments » 204
Recap » 205
Exercises » 207
Solutions » 208
1 Chapter 1: Introduction and environment

1: Introduction and environment

Why have a programming book for biologists?


If you're reading this book, then you probably don't need to be convinced
that programming is becoming an increasingly essential part of the tool
kit for biologists of all types. You might, however, need to be convinced
that a book like this one, developed especially for biologists, can do a
better job of teaching you to program than a general-purpose
introductory programming book. Here are a few of the reasons why I
think that is the case.
A biology-specific programming book allows us to use examples and
exercises that use biological problems. This serves two important
purposes: firstly, it provides motivation and demonstrates the types of
problems that programming can help to solve. Experience has shown
that beginners make much better progress when they are motivated by
the thought of how the programs they write will make their life easier!
Secondly, by using biological examples, the code and exercises
throughout the book can form a library of useful code snippets, which we
can refer back to when we want to solve real-life problems. In biology, as
in all fields of programming, the same problems tend to recur time and
time again, so it's very useful to have this collection of examples to act
as a reference – something that's not possible with a general-purpose
programming book.
A biology-specific programming book can also concentrate on the
features of the language that are most useful to biologists. A language
like Python has many features and in the course of learning it we
inevitably have to concentrate on some and miss others out. The set of
features which are important to us in biology are slightly different to
those which are most useful for general-purpose programming – for
example, we are much more interested in manipulating text (including
things like DNA and protein sequences) than the average programmer.
2 Chapter 1: Introduction and environment

Also, there are several features of Python that would not normally be
discussed in an introductory programming book, but which are very
useful to biologists (for example, regular expressions and subprocesses).
Having a biology-specific textbook allows us to include these features,
along with explanations of why they are particularly useful to us.
A related point is that a textbook written just for biologists allows us to
introduce features in a way that allows us to start writing useful
programs right away. We can do this by taking into account the sorts of
problems that repeatedly crop up in biology, and prioritising the features
that are best at solving them. This book has been designed so that you
should be able to start writing small but useful programs using only the
tools in the first couple of chapters.

Why Python?
Let me start this section with the following statement: programming
languages are overrated. What I mean by that is that people who are
new to programming tend to worry far too much about what language to
learn. The choice of programming language does matter, of course, but it
matters far less than people think it does. To put it another way, choosing
the "wrong" programming language is very unlikely to mean the
difference between failure and success when learning. Other factors
(motivation, having time to devote to learning, helpful colleagues) are far
more important, yet receive less attention.
The reason that people place so much weight on the "what language
should I learn?" question is that it's a big, obvious question, and it's not
difficult to find people who will give you strong opinions on the subject.
It's also the first big question that beginners have to answer once they've
decided to learn programming, so it assumes a great deal of importance
in their minds.
There are three main reasons why choice of programming language is
not as important as most people think it is. Firstly, nearly everybody who
spends any significant amount of time programming as part of their job
3 Chapter 1: Introduction and environment

will eventually end up using multiple languages. Partly this is just down
to the simple constraints of various languages – if you want to write a
web application you'll probably do it in Javascript, if you want to write a
graphical user interface you'll probably use something like Java, and if
you want to write low-level algorithms you'll probably use C.
Secondly, learning a first programming language gets you 90% of the
way towards learning a second, third, and fourth one. Learning to think
like a programmer in the way that you break down complex tasks into
simple ones is a skill that cuts across all languages – so if you spend a
few months learning Python and then discover that you really need to
write in C, your time won't have been wasted as you'll be able to pick it
up much quicker.
Thirdly, the kinds of problems that we want to solve in biology are
generally amenable to being solved in any language, even though
different programming languages are good at different things. In other
words, as a beginner, your choice of language is vanishingly unlikely to
prevent you from solving the problems that you need to solve.
Having said all that, when learning to program we do need to pick a
language to work in, so we might as well pick one that's going to make
the job easier. Python is such a language for a number of reasons:
• It has a mostly-consistent syntax, so you can generally learn one
way of doing things and then apply it in multiple places
• It has a sensible set of built-in libraries for doing lots of common
tasks
• It is designed in such a way that there's an obvious way of doing
most things
• It's one of the most widely-used languages in the world, and there's
a lot of advice, documentation and tutorials available on the web
• It's designed in a way that lets you start to write useful programs
as soon as possible
4 Chapter 1: Introduction and environment

• Its use of indentation, while annoying to people who aren't used to


it, is great for beginners as it enforces a certain amount of
readability
Python also has a couple of points to recommend it to biologists and
scientists specifically:
• It's widely used in the scientific community
• It has a couple of very well-designed libraries for doing complex
scientific computing (although we won't encounter them in this
book)
• It lend itself well to being integrated with other, existing tools
• It has features which make it easy to manipulate strings of
characters (for example, strings of DNA bases and protein amino
acid residues, which we as biologists are particularly fond of)

Python vs. Perl


For biologists, the question "what language should I learn" often really
comes down to the question "should I learn Perl or Python?", so let's
answer it head on. Perl and Python are both perfectly good languages for
solving a wide variety of biological problems. However, after extensive
experience teaching both Perl and Python to biologists, I've come the
conclusion that Python is an easier language to learn by virtue of being
more consistent and more readable.
An important thing to understand about Perl and Python is that they are
incredibly similar (despite the fact that they look very different), so the
point above about learning a second language applies doubly. Many
Python and Perl features have a one-to-one correspondence, and so
learning Perl after learning Python will be relatively easy – much easier
than, for example, moving to Java or C.
5 Chapter 1: Introduction and environment

How to use this book


Programming books generally fall into two categories; reference-type
books, which are designed for looking up specific bits of information, and
tutorial-type books, which are designed to be read cover-to-cover. This
book is an example of the latter – code samples in later chapters often
use material from previous ones, so you need to make sure you read the
chapters in order. Exercises or examples from one chapter are sometimes
used to illustrate the need for features that are introduced in the next.
There are a number of fundamental programming concepts that are
relevant to material in multiple different chapters. In this book, rather
than introduce these concepts all in one go, I've tried to explain them as
they become necessary. This results in a tendency for earlier chapters to
be longer than later ones, as they involve the introduction of more new
concepts.
A certain amount of jargon is necessary if we want to talk about
programs and programming concepts. I've tried to define each new
technical term at the point where it's introduced, and then use it
thereafter with occasional reminders of the meaning.
Chapters tend to follow a predictable structure. They generally start with
a few paragraphs outlining the motivation behind the features that it will
cover – why do they exist, what problems do they allow us to solve, and
why are they useful in biology specifically? These are followed by the
main body of the chapter in which we discuss the relevant features and
how to use them. The length of the chapters varies quite a lot –
sometimes we want to cover a topic briefly, other times we need more
depth. This section ends with a brief recap outlining what we have
learned, followed by exercises and solutions (more on that topic below).
6 Chapter 1: Introduction and environment

Further reading
I've deliberately limited the scope of this book to introductory material, in
order to keep the size manageable. As a result, there are lots of useful
techniques and tools that I've had to leave out. The good stuff that I
couldn't fit into this book forms the basis of my second book, Advanced
Python for Biologists. You can read more about Advanced Python for
Biologists at this URL:

[Link]

There are several tools and techniques that are discussed only briefly in
this book, but in much more depth in Advanced Python for Biologists.
Rather than repeating the URL each time, I have just mentioned the
relevant chapters in the text or in footnotes. Hopefully this should allow
you to easily find the corresponding bit in the advanced book when you
want to read about a particular topic in more depth.

Formatting
A couple of notes on typography: bold type is used to emphasize
important points and italics for technical terms and file names. Where
code is mixed in with normal text it's written in a mono-spaced font
like this. Occasionally there are footnotes1 to provide additional
information that is interesting to know but not crucial to understanding,
or to give links to web pages.
Example code is highlighted with a solid border:

Some example code goes here

1 Like this.
7 Chapter 1: Introduction and environment

and example output (i.e. what we see on the screen when we run the
code) is highlighted with a dotted border:

Some output goes here

Often we want to look at the code and the output it produces together. In
these situations, you'll see a solid-bordered code block followed
immediately by a dotted-bordered output block.
Sometimes it's necessary to refer in the text to individual lines of code or
output, in which case I've used line numberings on the left:

1 first line
2 second line
3 third line

Other blocks of text (usually file contents or typed command lines) don't
have any kind of border and look like this:

contents of a file

Exercises and solutions


The final part of each chapter is a set of exercises and solutions. The
number and complexity of exercises differ greatly between chapters
depending on the nature of the material. As a rule, early chapters have a
large number of simple exercises, while later chapters have a small
number of more complex ones. Many of the exercise problems are
written in a deliberately vague manner and the exact details of how the
solutions work is up to you (very much like real-life programming!) You
can always look at the solutions to see one possible way of tackling the
problem, but there are often multiple valid approaches.
I strongly recommend that you try tackling the exercises yourself before
reading the solutions; there really is no substitute for practical
8 Chapter 1: Introduction and environment

experience when learning to program. I also encourage you to adopt an


attitude of curious experimentation when working on the exercises – if
you find yourself wondering if a particular variation on a problem is
solvable, or if you recognize a closely-related problem from your own
work, try solving it! Continuous experimentation is a key part of
developing as a programmer, and the quickest way to find out what a
particular function or feature will do is to try it.
The example solutions to exercises are written in a different way to most
programming textbooks: rather than simply present the finished solution,
I have outlined the thought processes involved in solving the exercises
and shown how the solution is built up step-by-step. Hopefully this
approach will give you an insight into the problem-solving mindset that
programming requires. It's probably a good idea to read through the
solutions even if you successfully solve the exercise problems yourself,
as they sometimes suggest an approach that is not immediately obvious.

Getting in touch
One of the most convincing arguments for presenting a course like this
one in the form of an ebook is that it can be continually updated and
tweaked based on reader feedback. So, if you find anything that is hard
to understand, or you think may contain an error, please get in touch –
just drop me an email at martin@[Link] and I promise
to get back to you.

Setting up your environment


All that you need in order to follow the examples and exercises in this
book is a standard Python installation and a text editor. All the code in
this book will run on either Linux, Mac or Windows machines. The slight
differences between operating systems are explained in the text (mostly
in chapter 9). If you have a choice of operating systems on which to learn
Python, I recommend Linux, Mac OSX and Windows in that order, simply
9 Chapter 1: Introduction and environment

because the UNIX-based operating systems (Linux and OSX) are more
amenable to programming in general.

Installing Python
The process of installing Python depends on the type of computer you're
running on. If you're running a mainstream Linux distribution like Ubuntu,
Python is probably already installed. To find out, open a terminal and type

python

If you see some output along these lines:

Python 2.7.3 (default, Apr 10 2013, 05:13:16)


[GCC 4.7.2] on linux2
Type "help", "copyright", "credits" or "license" for more information.
>>>

Then you are ready to go. If your Linux installation doesn't already have
Python installed, try installing it with your package manager (the
command will probably be either sudo apt-get install python or
sudo yum install python). If this doesn't work, then download the
package from the Python download page1.
The official Python website has installation instructions for Mac2 and
Windows3 computers as well; these are likely to be the most up-to-date
instructions, so follow them closely.

Running Python programs


A Python program is just a normal text file that contains Python code. To
run it we must first open up a command line. On Linux and Mac

1 [Link]
2 [Link]
3 [Link]
10 Chapter 1: Introduction and environment

computers, the application to do this will be called something along the


lines of "terminal". On Windows, it is known as "command prompt".
To run a Python program, we just type the path to the Python executable
followed by the name of the file that contains the code we want to run1.
On a Linux or Mac machine, the path will be something like:

/usr/local/bin/python

On Windows, it will be something like:

c:\Python27\python

To run a Python program, it's generally easiest to be in the same folder


as it. By convention, Python programs are given the extension .py, so to
run a program called [Link], we just type:

/usr/local/bin/python [Link]

There are a couple of tricks that can be useful when experimenting with
programs2. Firstly, you can run Python in an interactive (or "shell") mode
by running it without the name of a program file. This allows you to type
individual statements and see the result straight away.
Secondly, you can run Python with the -i option, which will cause it to
run your program and then enter interactive mode. This can be handy if
you want to examine the state of variables after your code has run.

Python 2 vs. Python 3


As will quickly become clear if you spend any amount of time on the
official Python website, there are two versions of Python currently
available. The Python world is, at the time of writing, in the middle of a

1 When we refer to "a Python program" in this book, we are usually talking about the text file
that holds the code.
2 Don't worry if these two options make no sense to you right now – they will do so later on in
the book, once you've learned what statements and variables actually are.
11 Chapter 1: Introduction and environment

transition from version 2 to version 3. A discussion of the pros and cons


of each version is well beyond the scope of this book1, but here's what
you need to know: install Python 3 if possible, but if you end up with
Python 2, don't worry – all the code examples in the book will work with
both versions.
If you're going to use Python 2, there is just one thing that you have to
do in order to make some of the code examples work: include this line at
the start of all your programs:

from __future__ import division

We won't go into the explanation behind this line, except to say that it's
necessary in order to correct a small quirk with the way that Python 2
handles division of numbers.
Depending on what version you use, you might see slight differences
between the output in this book and the output you get when you run the
code on your computer. I've tried to note these differences in the text
where possible.

Text editors
Since a Python program is just a text file, you can create and edit it with
any text editor of your choice. Note that by a text editor I don't mean a
word processor – do not try to edit Python programs with Microsoft Word,
LibreOffice Writer, or similar tools, as they tend to insert special
formatting marks that Python cannot read.
When choosing a text editor, there is one feature that is essential2 to
have, and one which is nice to have. The essential feature is something
that's usually called tab emulation. The effect of this feature at first

1 You might encounter writing online that makes the 2 to 3 changeover seem like a big deal,
and it is – but only for existing, large projects. When writing code from scratch, as you'll be
doing when learning, you're unlikely to run into any problems.
2 OK, so it's not strictly essential, but you will find life much easer if you have it.
12 Chapter 1: Introduction and environment

seems quite odd; when enabled, it replaces any tab characters that you
type with an equivalent number of space characters (usually set to four).
The reason why this is useful is discussed at length in chapter 4, but
here's a brief explanation: Python is very fussy about your use of tabs
and spaces, and unless you are very disciplined when typing, it's easy to
end up with a mixture of tabs and spaces in your programs. This causes
very infuriating problems, because they look the same to you, but not to
Python! Tab emulation fixes the problem by making it effectively
impossible for you to type a tab character.
The feature that is nice to have is syntax highlighting. This will apply
different colours to different parts of your Python code, and can help you
spot errors more easily.
Recommended text editors are Notepad++ for Windows1,
TextWrangler for Mac OSX2, and gedit for Linux3, all of which are freely
available.
On the web and elsewhere you may see references to Python IDEs. IDE
stands for Integrated Development Environment, and they typically
combine a text editor with a collection of other useful programming tools.
While they can speed up development for experienced programmers,
they're not a good idea for beginners as they complicate things, so I
don't recommend you use them.

Reading the documentation


Part of the teaching philosophy that I've used in writing this book is that
it's better to introduce a few useful features and functions rather than
overwhelm you with a comprehensive list. The best place to go when you
do want a complete list of the options available in Python is the official
documentation4 which, compared to many languages, is very readable.

1 [Link]
2 [Link]
3 [Link]
4 [Link]
13 Chapter 1: Introduction and environment
14 Chapter 2: Printing and manipulating text

2: Printing and manipulating text

Why are we so interested in working with text?


Open the first page of a book about learning Python1, and the chances
are that the first examples of code you'll see involve numbers. There's a
good reason for that: numbers are generally simpler to work with than
text – there are not too many things you can do with them (once you've
got basic arithmetic out of the way) and so they lend themselves well to
examples that are easy to understand. It's also a pretty safe bet that the
average person reading a programming book is doing so because they
need to do some number-crunching.
So what makes this book different – why is this first chapter about text
rather than numbers? The answer is that, as biologists, we have a
particular interest in dealing with text rather than numbers (though of
course, we'll need to learn how to manipulate numbers too). Specifically,
we're interested in particular types of text that we call sequences – the
DNA and protein sequences that constitute the data that we deal with in
biology.
There are other reasons that we have a greater interest in working with
text than the average novice programmer. As scientists, the programs
that we write often need to work as part of a pipeline, alongside other
programs that have been written by other people. To do this, we'll often
need to write code that can understand the output from some other
program (we call this parsing) or produce output in a format that
another program can operate on. Both of these tasks require
manipulating text.
I've hinted above that computers consider numbers and text to be
different in some way. That's an important idea, and one that we'll return
to in more detail later. For now, I want to introduce an important piece of
jargon – the word string. String is the word we use to refer to a bit of text
1 Or indeed, any other programming language
15 Chapter 2: Printing and manipulating text

in a computer program (it just means a string of characters). From this


point on we'll use the word string when we're talking about computer
code, and we'll reserve the word sequence for when we're discussing
biological sequences like DNA and protein.

Printing a message to the screen


The first thing we're going to learn is how to print1 a message to the
screen. Here's a line of Python code that will cause a friendly message to
be printed. Quick reminder: solid lines indicate Python code, dotted lines
indicate output.

print("Hello world")

Let's take a look at the various bits of this line of code, and give some of
them names:
The whole line is called a statement.
print is the name of a function. The function tells Python, in vague
terms, what we want to do – in this case, we want to print some text. The
function name is always2 followed by parentheses3.
The bits of text inside the parentheses are called the arguments to the
function. In this case, we just have one argument (later on we'll see
examples of functions that take more than one argument, in which case
the arguments are separated by commas).
The arguments tell Python what we want to do more specifically – in this
case, the argument tells Python exactly what it is we want to print: a
friendly greeting.

1 When we talk about printing text inside a computer program, we are not talking about
producing a document on a printer. The word "print" is used for any occasion when our
program outputs some text – in this case, the output is displayed in your terminal.
2 This is not strictly true, but it's easier to just follow this rule than worry about the exceptions.
3 There are several different types of brackets in Python, so for clarity we will always refer to
parentheses when we mean these: (), square brackets when we mean these: [] and curly
brackets when we mean these: {}
16 Chapter 2: Printing and manipulating text

Assuming you've followed the instructions in chapter 1 and set up your


Python environment, type the line of code above into your favourite text
editor, save it, and run it. You should see a single line of output like this:

Hello world

Quotes are important


In normal writing, we only surround a bit of text in quotes when we want
to show that they are being said by somebody. In Python, however,
strings are always surrounded by quotes. That is how Python is able to
tell the difference between the instructions (like the function name) and
the data (the thing we want to print). We can use either single or double
quotes for strings – Python will happily accept either. The following two
statements behave exactly the same:

print("Hello world")
print('Hello world')

Let's take a look at the output to prove it1:

Hello world
Hello world

You'll notice that the output above doesn't contain quotes – they are part
of the code, not part of the string itself. If we do want to include quotes
in the output, the easiest thing to do2 is use the other type of quotes for
surrounding the string:

1 From this point on, I won't tell you to create a new file, enter the text, and run the program for
each example – I will simply show you the output – but I encourage you to try the examples
yourself.
2 The alternative is to place a backslash character (\) before the quote – this is called escaping
the quote and will prevent Python from trying to interpret it.
17 Chapter 2: Printing and manipulating text

print("She said, 'Hello world'")


print('He said, "Hello world"')

The above code will give the following output:

She said, 'Hello world'


He said, "Hello world"

Be careful when writing and reading code that involves quotes – you
have to make sure that the quotes at the beginning and end of the string
match up.

Use comments to annotate your code


Occasionally, we want to write some text in a program that is for humans
to read, rather than for the computer to execute. We call this type of line
a comment. To include a comment in your source code, start the line with
a hash symbol1:

# this is a comment, it will be ignored by the computer


print("Comments are very useful!")

You're going to see a lot of comments in the source code examples in this
book, and also in the solutions to the exercises. Comments are a very
useful way to document your code, for a number of reasons:
• You can put the explanation of what a particular bit of code does
right next to the code itself. This makes it much easier to find the
documentation for a line of code that is in the middle of a large
program, without having to search through a separate document.
• Because the comments are part of the source code, they can never
get mixed up or separated. In other words, if you are looking at the

1 This symbol has many names – you might know it as number sign, pound sign, octothorpe,
sharp (from musical notation), cross, or pig-pen.
18 Chapter 2: Printing and manipulating text

source code for a particular program, then you automatically have


the documentation as well. In contrast, if you keep the
documentation in a separate file, it can easily become separated
from the code.
• Having the comments right next to the code acts as a reminder to
update the documentation whenever you change the code. The
only thing worse than undocumented code is code with old
documentation that is no longer accurate!
Don't make the mistake, by the way, of thinking that comments are only
useful if you are planning on showing your code to somebody else. When
you start writing your own code, you will be amazed at how quickly you
forget the purpose of a particular section or statement. If you are working
on a solution to one of the exercises in this book on Friday afternoon,
then come back to it on Monday morning, it will probably take you quite a
while to pick up where you left off.
Comments can help with this problem by giving you hints about the
purpose of code, meaning that you spend less time trying to understand
your old code, thus speeding up your progress. A side benefit is that
writing a comment for a bit of code reinforces your understanding at the
time you are doing it. A good habit to get into is writing a quick one-line
comment above any line of code that does something interesting:

# print a friendly greeting


print("Hello world")

You'll see this technique used a lot in the code examples in this book, and
I encourage you to use it for your own code as well. There are other ways
to use comments which work with Python's built-in help system – take a
look at the chapter on modules and testing in Advanced Python for
Biologists.
19 Chapter 2: Printing and manipulating text

Error messages and debugging


It may seem depressing early in the book to be talking about errors!
However, it's worth pointing out at this early stage that computer
programs almost never work correctly the first time. Programming
languages are not like natural languages – they have a very strict set of
rules, and if you break any of them, the computer will not attempt to
guess what you intended, but instead will stop running and present you
with an error message. You're going to be seeing a lot of these error
messages in your programming career, so let's get used to them as soon
as possible.

Forgetting quotes
Here's one possible error we can make when printing a line of output –
we can forget to include the quotes:

print(Hello world)

This is easily done, so let's take a look at the output we'll get if we try to
run the above code1:

1 $ python [Link]
2 File "[Link]", line 1
3 print(Hello world)
4 ^
5 SyntaxError: invalid syntax

1 The output that you see might be very slightly different from this, depending on a bunch of
factors like your operating system and the exact version of Python you are using.
20 Chapter 2: Printing and manipulating text

Referring to the line numbers on the left we can see that the name of the
Python file is [Link] (line 1) and that the error occurs on the first line
of the file (line 2). Python's best guess at the location of the error is just
before the close parentheses (line 3). Depending on the type of error, this
can be wrong by quite a bit, so don't rely on it too much!
The type of error is a SyntaxError (line 5), which mean that Python can't
understand the code – it breaks the rules in some way (in this case, the
rule that strings must be surrounded by quotation marks). We'll see
different types of errors later in this book. For a discussion of how these
errors are actually generated, and how we can deal with them, see the
chapter on exceptions in Advanced Python for Biologists.

Spelling mistakes
What happens if we miss-spell the name of the function?:

prin("Hello world")

We get a different type of error – a NameError – and the error message


is a bit more helpful:

1 $ python [Link]
2 Traceback (most recent call last):
3 File "[Link]", line 1, in <module>
4 prin("Hello world")
5 NameError: name 'prin' is not defined
21 Chapter 2: Printing and manipulating text

This time, Python doesn't try to show us where on the line the error
occurred, it just shows us the whole line (line 4). The error message tells
us which word Python doesn't understand (line 5), so in this case, it's
quite easy to fix.

Splitting a statement over two lines


What if we want to print some output that spans multiple lines? For
example, we want to print the word "Hello" on one line and then the word
"World" on the next line – like this:

Hello
World

We might try putting a new line in the middle of our string like this:

print("Hello
World")

but that won't work and we'll get the following error message:

1 $ python [Link]
2 File "[Link]", line 1
3 print("Hello
4 ^
5 SyntaxError: EOL while scanning string literal

Python finds the error when it gets to the end of the first line of code (line
2 in the output). The error message (line 5) is a bit more cryptic than the
others. EOL stands for End Of Line, and string literal means a string in
quotes. So to put this error message in plain English: "I started reading a
string in quotes, and I got to the end of the line before I came to the
closing quotation mark"
If splitting the line up doesn't work, then how do we get the output we
want.....?
22 Chapter 2: Printing and manipulating text

Printing special characters


The reason that the code above didn't work is that Python got confused
about whether the new line was part of the string (which is what we
wanted) or part of the source code (which is how it was actually
interpreted). What we need is a way to include a new line as part of a
string, and luckily for us, Python has just such a tool built in. To include a
new line, we write a backslash followed by the letter n – Python knows
that this is a special character and will interpret it accordingly. Here's the
code which prints "Hello world" across two lines:

# how to include a new line in the middle of a string


print("Hello\nworld")

Notice that there's no need for a space before or after the new line.
There are a few other useful special characters as well, all of which
consist of a backslash followed by a letter. The only ones which you are
likely to need for the exercises in this book are the tab character (\t) and
the carriage return character (\r). The tab character can sometimes be
useful when writing a program that will produce a lot of output. The
carriage return character works a bit like a new line in that it puts the
cursor back to the start of the line, but doesn't actually start a new line,
so you can use it to overwrite output – this is sometimes useful for long-
running programs.

Storing strings in variables


OK, we've been playing around with the print function for a while; let's
introduce something new. We can take a string and assign a name to it
using an equals sign – we call this a variable:

# store a short DNA sequence in the variable my_dna


my_dna = "ATGCGTA"
23 Chapter 2: Printing and manipulating text

The variable my_dna now points to the string "ATGCGTA". We call this
assigning a variable, and once we've done it, we can use the variable
name instead of the string itself – for example, we can use it in a print
statement1:

# store a short DNA sequence in the variable my_dna


my_dna = "ATGCGTA"
# now print the DNA sequence
print(my_dna)

Notice that when we use the variable in a print statement, we don't


need any quotation marks – the quotes are part of the string, so they are
already "built in" to the variable my_dna.
We can change the value of a variable as many times as we like once
we've created it:

my_dna = "ATGCGTA"
print(my_dna)
# change the value of my_dna
my_dna = "TGGTCCA"

Here's a very important point that trips many beginners up: variable
names are arbitrary – that means that we can pick whatever we like
to be the name of a variable. So our code above would work in exactly
the same way if we picked a different variable name:

# store a short DNA sequence in the variable banana


banana = "ATGCGTA"
# now print the DNA sequence
print(banana)

What makes a good variable name? Generally, it's a good idea to use a
variable name that gives us a clue as to what the variable refers to. In

1 If it's not clear why this is useful, don't worry – it will become much more apparent when we
look at some longer examples.
24 Chapter 2: Printing and manipulating text

this example, my_dna is a good variable name, because it tells us that the
content of the variable is a DNA sequence. Conversely, banana is a bad
variable name, because it doesn't really tell us anything about the value
that's stored. As you read through the code examples in this book, you'll
get a better idea of what constitutes good and bad variable names.
This idea – that names for things are arbitrary, and can be anything we
like – is a theme that will occur many times in this book, so it's important
to keep it in mind. Occasionally you will see a variable name that looks
like it has some sort of relationship with the value it points to:

my_file = "my_file.txt"

but don't be fooled! Variable names and strings are separate things.
I said above that variable names can be anything we want, but it's
actually not quite that simple – there are some rules we have to follow.
We are only allowed to use letters, numbers, and underscores, so we
can't have variable names that contain odd characters like £, ^ or %. We
are not allowed to start a name with a number (though we can use
numbers in the middle or at the end of a name). Finally, we can't use a
word that's already built in to the Python language like "print".
It's also important to remember that variable names are case-sensitive,
so my_dna, MY_DNA, My_DNA and My_Dna are all separate variables.
Technically this means that you could use all four of those names in a
Python program to store different values, but please don't do this – it is
very easy to become confused when you use very similar variable
names.

Tools for manipulating strings


Now we know how to store and print strings, we can take a look at a few
of the facilities that Python has for manipulating them. It's actually
possible to explore the tools for manipulating particular types of data
from within Python itself – see the chapter on modules and testing in
25 Chapter 2: Printing and manipulating text

Advanced Python for Biologists for a discussion – but for now we'll just
take a look at some of the most useful ones. In the exercises at the end
of this chapter, we'll look at how we can use multiple different tools
together in order to carry out more complex operations.

Concatenation
We can concatenate (stick together) two strings using the + symbol1.
This symbol will join together the string on the left with the string on the
right:

my_dna = "AATT" + "GGCC"


print(my_dna)

Let's take a look at the output:

AATTGGCC

In the above example, the things being concatenated were strings, but
we can also use variables that point to strings:

upstream = "AAA"
my_dna = upstream + "ATGC"
# my_dna is now "AAAATGC"

We can even join multiple strings together in one go:

upstream = "AAA"
downstream = "GGG"
my_dna = upstream + "ATGC" + downstream
# my_dna is now "AAAATGCGGG"

1 We call this the concatenation operator.


26 Chapter 2: Printing and manipulating text

It's important to realize that the result of concatenating two strings


together is itself a string. So it's perfectly OK to use a concatenation
inside a print statement:

print("Hello" + " " + "world")

As we'll see in the rest of the book, using one tool inside another is quite
a common thing to do in Python.

Finding the length of a string


Another useful built-in tool in Python is the len function (len is short for
length). Just like the print function, the len function takes a single
argument (take a quick look back at when we were discussing the print
function for a reminder about what arguments are) which is a string.
However, the behaviour of the len function is quite different. Instead of
outputting text to the screen, len outputs a value that can be stored –
we call this the return value. In other words, if we write a program that
uses len to calculate the length of a string, the program will run but we
won't see any output:

# this line doesn't produce any output


len("ATGC")

If we want to actually use the return value, we need to store it in a


variable, and then do something useful with it (like printing it):

dna_length = len("AGTC")
print(dna_length)

There's another interesting thing about the len function: the result (or
return value) is not a string, it's a number. This is a very important idea
so I'm going to write it out in bold: Python treats strings and
numbers differently.
27 Chapter 2: Printing and manipulating text

We can see that this is the case if we try to concatenate together a


number and a string. Consider this short program which calculates the
length of a DNA sequence and then prints a message telling us the
length:

# store the DNA sequence in a variable


my_dna = "ATGCGAGT"
# calculate the length of the sequence and store it in a variable
dna_length = len(my_dna)
# print a message telling us the DNA sequence lenth
print("The length of the DNA sequence is " + dna_length)

When we try to run this program, we get the following error:

1 $ python [Link]
2 Traceback (most recent call last):
3 File "[Link]", line 6, in <module>
4 print("The length of the DNA sequence is " + dna_length)
5 TypeError: cannot concatenate 'str' and 'int' objects

The error message (line 5) is short but informative: "cannot


concatenate 'str' and 'int' objects". Python is complaining that it
doesn't know how to concatenate a string (which it calls str for short)
and a number (which it calls int – short for integer). Strings and
numbers are examples of types – different kinds of information that can
exist inside a program. If you want to read more, there's a full
explanation of how types work in the chapter on object-oriented
programming in Advanced Python for Biologists.
Happily, Python has a built-in solution to this type mismatch problem – a
function called str which turns a number1 into a string so that we can
print it. Here's how we can modify our program to use it – I've removed
the comments from this version to make it a bit more compact:

1 Or a value of any non-string type, but we'll come to that later


28 Chapter 2: Printing and manipulating text

my_dna = "ATGCGAGT"
dna_length = len(my_dna)
print("The length of the DNA sequence is " + str(dna_length))

The only thing we have changed is that we've replace dna_length with
str(dna_length) inside the print statement1. Notice that because
we're using one function (str) inside another function (print), our
statement now ends with two closing parentheses.
To finish our discussion of the str function, here's a formal description of
it, with all the technical terms in italics:
str is a function which takes one argument (whose type is number), and
returns a value (whose type is string) representing that number.
If you're unsure about the meanings of any of the words in italics, skip
back to the earlier parts of this chapter where we discussed them.
Understanding how types work is key to avoiding many of the
frustrations which new programmers typically encounter, so make sure
the idea is clear in your mind before moving on with the rest of this book.

Changing case
We can convert a string to lower case by using a new type of syntax – a
method that belongs to strings. A method is like a function, but instead of
being built in to the Python language, it belongs to a particular type. The
method we are talking about here is called lower, and we say that it
belongs to the string type. Here's how we use it:

my_dna = "ATGC"
# print my_dna in lower case
print(my_dna.lower())

1 If you experiment with some of the code here, you might discover that you can also print a
number directly without using str – but only if you don't try to concatenate it.
29 Chapter 2: Printing and manipulating text

Notice how using a method looks different to using a function. When we


use a function like print or len, we write the function name first and the
arguments go in parentheses:

print("ATGC")
len(my_dna)

When we use a method, we write the name of the variable first, followed
by a period, then the name of the method, then the method arguments
in parentheses. For the example we're looking at here, lower, there is no
argument, so the opening and closing parentheses are right next to each
other.
It's important to notice that the lower method does not actually change
the variable; instead it returns a copy of the variable in lower case. We
can prove that it works this way by printing the variable before and after
running lower. Here's the code to do so:

my_dna = "ATGC"
# print the variable
print("before: " + my_dna)
# run the lower method and store the result
lowercase_dna = my_dna.lower()
# print the variable again
print("after: " + my_dna)

and here's the output we get:

before: ATGC
after: ATGC

Just like the len function, in order to actually do anything useful with the
lower method, we need to store the result (or print it right away).
Because the lower method belongs to the string type, we can only use it
on variables that are strings. If we try to use it on a number:
30 Chapter 2: Printing and manipulating text

my_number = len("AGTC")
# my_number is 4
print(my_number.lower())

we will get an error that looks like this:

AttributeError: 'int' object has no attribute 'lower'

The error message is a bit cryptic, but hopefully you can grasp the
meaning: something that is a number (an int, or integer) does not have
a lower method. This is a good example of the importance of types in
Python code: we can only use methods on the type that they
belong to.
Before we move on, let's just mention that there is another method that
belongs to the string type called upper – you can probably guess what it
does!

Replacement
Here's another example of a useful method that belongs to the string
type: replace. replace is slightly different from anything we've seen
before – it takes two arguments (both strings) and returns a copy of the
variable where all occurrences of the first string are replaced by the
second string. That's quite a long-winded description, so here are a few
examples to make things clearer:

protein = "vlspadktnv"
# replace valine with tyrosine
print([Link]("v", "y"))
# we can replace more than one character
print([Link]("vls", "ymt"))
# the original variable is not affected
print(protein)

And this is the output we get:


31 Chapter 2: Printing and manipulating text

ylspadktny
ymtpadktnv
vlspadktnv

We'll take a look at more tools for carrying out string replacement in
chapter 7.

Extracting part of a string


What do we do if we have a long string, but we only want a short portion
of it? This is known as taking a substring, and it has its own notation in
Python. To get a substring, we follow the variable name with a pair of
square brackets which enclose a start and stop position, separated by a
colon. Again, this is probably easier to visualize with a couple of
examples – let's reuse our protein sequence from before:

protein = "vlspadktnv"
# print positions three to five
print(protein[3:5])
# positions start at zero, not one
print(protein[0:6])
# if we use a stop position beyond the end, it's the same as using the
end
print(protein[0:60])

and here's the output:

pa
vlspad
vlspadktnv

There are two important things to notice here. Firstly, we actually start
counting from position zero, rather than one – in other words, position 3
is actually the fourth character1. This explains why the first character of
the first line of output is p and not s as you might think. Secondly, the

1 This seems very annoying when you first encounter it, but we'll see later why it's necessary.
32 Chapter 2: Printing and manipulating text

positions are inclusive at the start, but exclusive at the stop. In other
words, the expression protein[3:5] gives us everything starting at the
fourth character, and stopping just before the sixth character (i.e.
characters four and five).
If we just give a single number in the square brackets, we'll just get a
single character:

protein = "vlspadktnv"
first_residue = protein[0]

We'll learn a lot more about this type of notation, and what we can do
with it, in chapter 4.

Counting and finding substrings


A very common job in biology is to count the number of times some
pattern occurs in a DNA or protein sequence. In computer programming
terms, what that translates to is counting the number of times a
substring occurs in a string. The method that does the job is called
count. It takes a single argument whose type is string, and returns the
number of times that the argument is found in the variable. The return
type is a number, so be careful about how you use it!
Let's use our protein sequence one last time as an example. Remember
that we have to use our old friend str to turn the counts into strings so
that we can print them. Also, notice that here I have used a blank line to
separate out the two bits of the program (calculating the counts, and
printing them). Python is perfectly happy with this – it just ignores blank
lines, so it's fine to put them in in order to make your programs more
readable for humans.
33 Chapter 2: Printing and manipulating text

protein = "vlspadktnv"
# count amino acid residues
valine_count = [Link]('v')
lsp_count = [Link]('lsp')
tryptophan_count = [Link]('w')

# now print the counts


print("valines: " + str(valine_count))
print("lsp: " + str(lsp_count))
print("tryptophans: " + str(tryptophan_count))

The output shows how the count method behaves:

valines: 2
leucines: 1
tryptophans: 0

A closely-related problem to counting substrings is finding their location.


What if instead of counting the number of proline residues in our protein
sequence we want to know where they are? The find method will give us
the answer, at least for simple cases. find takes a single string
argument, just like count, and returns a number which is the position at
which that substring first appears in the string (in computing, we call that
the index of the substring).
Remember that in Python we start counting from zero rather than one, so
position 0 is the first character, position 4 is the fifth character, etc. A
couple of examples:

protein = "vlspadktnv"
print(str([Link]('p')))
print(str([Link]('kt')))
print(str([Link]('w')))

And the output:


34 Chapter 2: Printing and manipulating text

3
6
-1

Notice the behaviour of find when we ask it to locate a substring that


doesn't exist – we get back the answer -1.
Both count and find have a pretty serious limitation: you can only
search for exact substrings. If you need to count the number of
occurrences of a variable protein motif, or find the position of a variable
transcription factor binding site, they will not help you. The whole of
chapter 7 is devoted to tools that can do those kinds of jobs.
Of the tools we've discussed in this section, three – replace, count and
find – require at least two strings to work, so be careful that you don't
get confused about the order – remember that:

my_dna.count(my_motif)

is not the same as:

my_motif.count(my_dna)

Splitting up a string into multiple bits


An obvious question which biologists often ask when learning to program
is "how do we split a string (e.g. a DNA sequence) into multiple pieces?"
That's a common job in biology, but unfortunately we can't do it yet
using the tools from this chapter. We'll talk about various different ways
of splitting strings in chapter 4. I mention it here just to reassure you that
we will learn how to do it eventually!
35 Chapter 2: Printing and manipulating text

Recap
We started this chapter talking about strings and how to work with them,
but along the way we had to take a lot of diversions, all of which were
necessary to understand how the different string tools work. Thankfully,
that means that we've covered most of the nuts and bolts of the Python
language, which will make future chapters go much more smoothly.
We've learned about some general features of the Python programming
language like
• the difference between functions, statements and arguments
• the importance of comments and how to use them
• how to use Python's error messages to fix bugs in our programs
• how to store values in variables
• the way that types work, and the importance of understanding
them
• the difference between functions and methods, and how to use
them both
And we've encountered some tools that are specifically for working with
strings:
• concatenation
• different types of quotes and how to use them
• special characters
• changing the case of a string
• finding and counting substrings
• replacing bits of a string with something new
• extracting bits of a string to make a new string
36 Chapter 2: Printing and manipulating text

Many of the above topics will crop up again in future chapters, and will be
discussed in more detail, but you can always return to this chapter if you
want to brush up on the basics. The exercises for this chapter will allow
you to practice using the string manipulation tools and to become
familiar with them. They'll also give you the chance to practice builder
bigger programs by using the individual tools as building blocks.
37 Chapter 2: Printing and manipulating text

Exercises
Reminder: the descriptions of the exercises are deliberately terse and
may be somewhat ambiguous (just like requirements for programs you
will write in real life). See the solutions for in-depth discussions of the
exercises.

Calculating AT content
Here's a short DNA sequence:

ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT

Write a program that will print out the AT content of this DNA sequence.
Hint: you can use normal mathematical symbols like add (+), subtract (-),
multiply (*), divide (/) and parentheses to carry out calculations on
numbers in Python.
Reminder: if you're using Python 2 rather than Python 3, include this
line at the top of your program:

from __future__ import division

Complementing DNA
Here's a short DNA sequence:

ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT

Write a program that will print the complement of this sequence.


38 Chapter 2: Printing and manipulating text

Restriction fragment lengths


Here's a short DNA sequence:

ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT

The sequence contains a recognition site for the EcoRI restriction


enzyme, which cuts at the motif G*AATTC (the position of the cut is
indicated by an asterisk). Write a program which will calculate the size of
the two fragments that will be produced when the DNA sequence is
digested with EcoRI.

Splicing out introns, part one


Here's a short section of genomic DNA:
ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGAT
CGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCAT
CGACTACTAT
It comprises two exons and an intron. The first exon runs from the start of
the sequence to the sixty-third character, and the second exon runs from
the ninety-first character to the end of the sequence. Write a program
that will print just the coding regions of the DNA sequence.

Splicing out introns, part two


Using the data from part one, write a program that will calculate what
percentage of the DNA sequence is coding.
Reminder: if you're using Python 2 rather than Python 3, include this
line at the top of your program:

from __future__ import division


39 Chapter 2: Printing and manipulating text

Splicing out introns, part three


Using the data from part one, write a program that will print out the
original genomic DNA sequence with coding bases in uppercase and non-
coding bases in lowercase.
40 Chapter 2: Printing and manipulating text

Solutions

Calculating AT content
This exercise is going to involve a mixture of strings and numbers. Let's
remind ourselves of the formula for calculating AT content:
A+T
AT content=
length

There are three numbers we need to figure out: the number of As, the
number of Ts, and the length of the sequence. We know that we can get
the length of the sequence using the len function, and we can count the
number of As and Ts using the count method. Here are a few lines of
code that we think will calculate the numbers we need:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')

At this point, it seems sensible to check these lines before we go any


further. So rather than diving straight in and doing some calculations,
let's print out these numbers so that we can eyeball them and see if they
look approximately right. We'll have to remember to turn the numbers
into strings using str so that we can print them:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')

print("length: " + str(length))


print("A count: " + str(a_count))
print("T count: " + str(t_count))
41 Chapter 2: Printing and manipulating text

Let's take a look at the output from this program:

length: 54
A count: 16
T count: 21

That looks about right, but how do we know if it's exactly right? We could
go through the sequence manually base by base, and verify that there
are sixteen As and eighteen Ts, but that doesn't seem like a great use of
our time: also, what would we do if the sequence were 51 kilobases
rather than 51 bases? A better idea is to run the exact same code with a
much shorter test sequence, to verify that it works before going ahead
and running it on the larger sequence.
Here's a version that uses a very short test sequence with one of each of
the four bases:

test_dna = "ATGC"
length = len(test_dna)
a_count = test_dna.count('A')
t_count = test_dna.count('T')

print("length: " + str(length))


print("A count: " + str(a_count))
print("T count: " + str(t_count))

and here's the output:

length: 4
A count: 1
T count: 1

Everything looks OK – we can probably go ahead and run the code on the
long sequence. But wait; we know that the next step is going to involve
doing some calculations using the numbers. If we switch back to the long
sequence now, then we'll be in the same position as we were before –
42 Chapter 2: Printing and manipulating text

we'll end up with an answer for the AT content, but we won't know if it's
the right one.
A better plan is to stick with the short test sequence until we've written
the whole program, and check that we get the right answer for the AT
content (we can easily see by glancing at the test sequence that the AT
content is 0.5). Here goes – we'll use the add and divide symbols from
the exercise hint:

test_dna = "ATGC"
length = len(test_dna)
a_count = test_dna.count('A')
t_count = test_dna.count('T')

at_content = a_count + t_count / length


print("AT content is " + str(at_content))

The output from this program looks like this:

AT content is 1.25

That doesn't look right. Looking back at the code we can see what has
gone wrong – in the calculation, the division has taken precedence over
the addition, so what we have actually calculated is:
T
A+
length

To fix it, all we need to do is add some parentheses around the addition,
so that the line becomes:

at_content = (a_count + t_count) / length

Now we get the correct output for the test sequence:

AT content is 0.5
43 Chapter 2: Printing and manipulating text

and we can go ahead and run the program using the longer sequence,
confident that the code is working and that the calculations are correct.
Here's the final version:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')

at_content = (a_count + t_count) / length


print("AT content is " + str(at_content))

and the final output:

AT content is 0.6851851851851852

Complementing DNA
This one seems pretty straightforward – we need to take our sequence
and replace A with T, T with A, C with G, and G with C. We'll have to make
four separate calls to replace, and use the return value for each on as
the input for the next tone. Let's try it:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
# replace A with T
replacement1 = my_dna.replace('A', 'T')
# replace T with A
replacement2 = [Link]('T', 'A')
# replace C with G
replacement3 = [Link]('C', 'G')
# replace G with C
replacement4 = [Link]('G', 'C')
# print the result of the final replacement
print(replacement4)

When we take a look at the output, however, something seems wrong:


44 Chapter 2: Printing and manipulating text

ACACAACCAAAACCAAAACAAAAACCAAACAAACAAAAAAAACCAACCCAACAA

We can see just by looking at the original sequence that the first letter is
A, so the first letter of the printed sequence should be its complement, T.
But instead the first letter is A. In fact, all of the bases in the printed
sequence are either A or T. This is definitely not what we want!
Let's try and track the problem down by printing out all the intermediate
steps as well:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
replacement1 = my_dna.replace('A', 'T')
print(replacement1)
replacement2 = [Link]('T', 'A')
print(replacement2)
replacement3 = [Link]('C', 'G')
print(replacement3)
replacement4 = [Link]('G', 'C')
print(replacement4)

The output from this program makes it clear what the problem is:

TCTGTTCGTTTTCGTTTTGTTTTTGCTTTCTTTCTTTTTTTTCGTTGCGTTCTT
ACAGAACGAAAACGAAAAGAAAAAGCAAACAAACAAAAAAAACGAAGCGAACAA
AGAGAAGGAAAAGGAAAAGAAAAAGGAAAGAAAGAAAAAAAAGGAAGGGAAGAA
ACACAACCAAAACCAAAACAAAAACCAAACAAACAAAAAAAACCAACCCAACAA

The first replacement (the result of which is shown in the first line of the
output) works fine – all the As have been replaced with Ts (for example,
look at the first character – it's A in the original sequence and T in the
first line of the output).
The second replacement is where it starts to go wrong: all the Ts are
replaced by As, including those that were there as a result of the
first replacement. So during the first two replacements, the first
character is changed from A to T and then straight back to A again.
45 Chapter 2: Printing and manipulating text

How are we going to get round this problem? One option is to pick a
temporary alphabet of four letters and do each replacement twice:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
replacement1 = my_dna.replace('A', 'H')
replacement2 = [Link]('T', 'J')
replacement3 = [Link]('C', 'K')
replacement4 = [Link]('G', 'L')
replacement5 = [Link]('H', 'T')
replacement6 = [Link]('J', 'A')
replacement7 = [Link]('K', 'G')
replacement8 = [Link]('L', 'C')
print(replacement8)

This gets us the result we are looking for. It avoids the problem with the
previous program by using another letter to stand in for each base while
the replacements are being done. For example, A is first converted to H
and then later on H is converted to T.
Here's a slightly more elegant way of doing it. We can take advantage of
the fact that the replace method is case-sensitive, and make all the
replaced bases lower case. Then, once all the replacements have been
carried out, we can simply call upper and change the whole sequence
back to upper case. Let's take a look at how this works:

my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
replacement1 = my_dna.replace('A', 't')
print(replacement1)
replacement2 = [Link]('T', 'a')
print(replacement2)
replacement3 = [Link]('C', 'g')
print(replacement3)
replacement4 = [Link]('G', 'c')
print(replacement4)
print([Link]())

The output lets us see exactly what's happening – notice that in this
version of the program we print the final string twice, once as it is and
then once converted to upper case:
46 Chapter 2: Printing and manipulating text

tCTGtTCGtTTtCGTtTtGTtTTTGCTtTCtTtCtTtTtTtTCGtTGCGTTCtT
tCaGtaCGtaatCGatatGataaaGCataCtatCtatatataCGtaGCGaaCta
tgaGtagGtaatgGatatGataaaGgatagtatgtatatatagGtaGgGaagta
tgactagctaatgcatatcataaacgatagtatgtatatatagctacgcaagta
TGACTAGCTAATGCATATCATAAACGATAGTATGTATATATAGCTACGCAAGTA

We can see that as the program runs, each base in turn is replaced by its
complement in lower case. Since the next replacement is only looking for
upper case characters, bases don't get changed back as they did in the
first version of our program.

Restriction fragment lengths


Let's start this exercise by solving the problem manually. If we look
through the DNA sequence we can spot the EcoRI site at position 21.
Here's the sequence with the base positions labelled above and the EcoRI
motif in bold:

1 2 3 4 5
0123456789012345678901234567890123456789012345678901234
ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT

Since the EcoRI enzyme cuts the DNA between the G and first A, we can
figure out that the first fragment will run from position 0 to position 21,
and the second fragment from position 22 to the last position, 54.
Therefore the lengths of the two fragments are 22 and 33.
Writing a program to figure out the lengths is just a question of applying
the same logic. We'll use the find method to figure out the position of
the start of the EcoRI motif, then add one to account for the fact that the
positions start counting from zero – this will give us the length of the first
fragment. From there we can get the length of the second fragment by
finding the length of the input sequence and subtracting the length of
the first fragment:
47 Chapter 2: Printing and manipulating text

my_dna = "ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT"
frag1_length = my_dna.find("GAATTC") + 1
frag2_length = len(my_dna) - frag1_length
print("length of fragment one is " + str(frag1_length))
print("length of fragment two is " + str(frag2_length))

The output from this program confirms that it agrees with the answer we
got manually:

length of fragment one is 22


length of fragment two is 33

If we wanted to run the same program using a different restriction


enzyme, we'd have to change both the string that we used in the find
method call, and the number that we add in order to take account of the
cut site.
It's worth noting that this program assumes that the DNA sequence
definitely does contain the restriction site we're looking for. If we try the
same program using a DNA sequence which doesn't contain the site, it
will report a fragment of length 0 and a fragment whose length is equal
to the total length of the DNA sequence. While this is not strictly wrong,
it's a little misleading – if we were going to use this program for real-life
work, we'd probably prefer to have slightly different behaviour depending
on whether or not the DNA sequence contained the motif we're looking
for. We'll talk about how to implement that type of behaviour in chapter
6.

Splicing out introns, part one


In this exercise, we're being asked to produce a program that does the
job of a spliceosome – splits a DNA sequence at two specified locations to
make three pieces, then join the outer two pieces together1.

1 We know that that's not really how a splicosome works, but it's fine as a conceptual model.
48 Chapter 2: Printing and manipulating text

Let's start by splitting the sequence up into three bits. We'll have to use
the substring notation from earlier in the chapter, and we'll need to take
care with the numbers. We know that if we give a stop position for a
substring then it will go on to the end of the input string, so rather than
figure out the position of the end of the sequence, we'll just be lazy and
use a big number. Here's the code (the first line, where we store the DNA
sequence in the variable my_dna, is too long to fit on one line on the
page, so it looks like it's spread out over multiple lines):

my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[1:63]
exon2 = my_dna[91:10000]
print(exon1 + exon2)

The output from this code looks vaguely right:

TCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCATCGATCGA
TATCGATGCATCGACTACTAT

but when we look more closely we can see that something is not right.
The printed coding sequence is supposed to start at the very first
character of the input sequence, but it's starting at the second. We have
forgotten to take into account the fact that Python starts counting from
zero, so our numbers are all too high by one. Let's try again:

my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:63]
exon2 = my_dna[90:10000]
print(exon1 + exon2)

Now the output looks correct – the coding sequence starts at the very
beginning of the input sequence:
49 Chapter 2: Printing and manipulating text

ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCATCGATCG
ATATCGATGCATCGACTACTAT

Splicing out introns, part two


This is a straightforward piece of number-crunching. There are a couple
of ways to go about it. We could use the exon start-stop coordinates to
calculate the length of the coding portion of the sequence. However,
since we've already written the code to generate the coding sequence,
we can simply calculate the length of it, and then divide by the length of
the input sequence:

my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:63]
exon2 = my_dna[90:10000]
coding_length = len(exon1 + exon2)
total_length = len(my_dna)
print(coding_length / total_length)

The output shows that we're nearly right:

0.780487804878

We have calculated the coding proportion as a fraction, but the exercise


called for a percentage. We can easily fix this by multiplying by 100.
Notice that the symbol for multiplication is not x, as you might think, but
*. The final code:
50 Chapter 2: Printing and manipulating text

my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:63]
exon2 = my_dna[90:10000]
coding_length = len(exon1 + exon2)
total_length = len(my_dna)
print(100 * coding_length / total_length)

gives the correct output:

78.0487804878

although we probably don't really require that number of significant


figures. In chapter 5 we will learn how to format the output nicely.

Splicing out introns, part three


This sounds quite tricky, but we have already done the hard bit in part
one. All we need to do is extract the intron sequence as well as the
exons, convert it to lower case, then concatenate the three sequences to
recreate the original genomic sequence:

my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:63]
intron = my_dna[63:90]
exon2 = my_dna[90:10000]
print(exon1 + [Link]() + exon2)

Looking at the output, we see an upper case DNA sequence with a lower
case section in the middle, as expected:

ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGAtcgatcgatc
gatcgatcgatcatgctATCATCGATCGATATCGATGCATCGACTACTAT
51 Chapter 2: Printing and manipulating text

When we are applying several transformations to text, as in this exercise,


there are usually a number of different ways we can write the program.
For example, we could store the lower case version of the intron, rather
than converting it to lower case when printing:

intron = my_dna[63:90].lower()

Or we could avoid using variables for the introns and exons all together,
and do everything in one big print statement:

print(my_dna[0:63] + my_dna[63:90].lower() + my_dna[90:10000])

This last option is very concise, but a bit harder to read than the more
verbose way.
As the exercises in this book get longer, you'll notice that there are more
and more different ways to write the code – you may end up with
solutions that look very different to the example solutions. When trying
to choose between different ways to write a program, always favour the
solution that is clearest in intent and easiest to read.
52 Chapter 3: Reading and writing files

3: Reading and writing files

Why are we so interested in working with files?


As we start this chapter, we find ourselves once again doing things in a
slightly different order to most programming books. The majority of
introductory programming books won't consider working with external
files until much further along, so why are we introducing it now?
The answer, as was the case in the last chapter, lies in the particular jobs
that we want to use Python for. The data that we as biologists work with
is stored in files, so if we're going to write useful programs we need a
way to get the data out of files and into our programs (and vice versa).
As you were going through the exercises in the previous chapter, it may
have occurred to you that copying and pasting a DNA sequence directly
into a program each time we want to use it is not a very good approach
to take, and you'd be right. The sequences we were working with in the
exercises were very short; obviously real-life data will be much longer.
Also, it seems inelegant to have the data we want to work on mixed up
with the code that manipulates it. In this chapter we'll see a better way
to do it.
We're lucky in biology that many of the types of data that we work with
are stored in text1 files which are relatively simple to process using
Python. Chief among these, of course, are DNA and protein sequence
data, which can be stored in a variety of formats.2 But there are many
other types of data – sequencing reads, quality scores, SNPs,
phylogenetic trees, read maps, geographical sample data, genetic
distance matrices – which we can access from within our Python
programs.

1 i.e. files which you can open in a text editor and read, as opposed to binary files which cannot
be read directly.
2 In this book we'll mostly be talking about FASTA format as it's the simplest and most common
format, but there are many more.
53 Chapter 3: Reading and writing files

Another reason for our interest in file input/output is the need for our
Python programs to work as part of a pipeline or work flow involving
other, existing tools. When it comes to using Python in the real world, we
often want Python to either accept data from, or provide data to, another
program. Often the easiest way to do this is to have Python read, or
write, files in a format that the other program already understands.

Reading text from a file


Firstly, a quick note about what we mean by text. In programming, when
we talk about text files, we are not necessarily talking about something
that is human-readable. Rather, we are talking about a file that contains
characters and lines – something that you could open up and view in a
text editor, regardless of whether you could actually make sense of the
file or not. Examples of text files which you might have encountered
include:
• FASTA files of DNA or protein sequences
• files containing output from command-line programs (e.g. BLAST)
• FASTQ files containing DNA sequencing reads
• HTML files
• word processing documents
• and of course, Python code
In contrast, most files that you encounter day-to-day will be binary files –
ones which are not made up of characters and lines, but of bytes.
Examples include:
• image files (JPEGs and PNGs)
• audio files
• video files
• compressed files (e.g. ZIP files)
54 Chapter 3: Reading and writing files

If you're not sure whether a particular file is text or binary, there's a very
simple way to tell – just open it up in a text editor. If the file displays
without any problem, then it's text (regardless of whether you can make
sense of it or not). If you get an error or a warning from your text editor,
or the file displays as a collection of indecipherable characters, then it's
binary.
The examples and exercises in this chapter are a little different from
those in the previous one, because they rely on the existence of the files
that we are going to manipulate. If you want to try running the examples
in this chapter, you'll need to make sure that there is a file in your
working directory called [Link] which has a single line containing a DNA
sequence. The easiest way to do this is to run the examples while in the
chapter_3 folder inside the exercises download1.

Using open to read a file


In Python, as in the physical world, we have to open a file before we can
read what's inside it. The Python function that carries out the job of
opening a file is very sensibly called open. It takes one argument – a
string which contains the name of the file – and returns a file object:

my_file = open("[Link]")

A file object is a new type which we haven't encountered before, and it's
a little more complicated than the string and number types that we saw
in the previous chapter. With strings and numbers it was easy to
understand what they represented – a single bit of text, or a single
number. A file object, in contrast, represents something a bit less
tangible – it represents a file on your computer's hard drive.
The way that we use file objects is a bit different to strings and numbers
as well. If you glance back at the examples from the previous chapter

1 If you haven't downloaded the example files yet, you'll find the link in the email that came
with your purchase of this book.
55 Chapter 3: Reading and writing files

you'll see that most of the time when we want to use a variable
containing a string or number we just use the variable name:

my_string = 'abcdefg'
print(my_string)
my_number = 42
print(my_number + 1)

In contrast, when we're working with file objects most of our interaction
will be through methods. This style of programming will seem unusual at
first, but as we'll see in this chapter, the file type has a well thought-out
set of methods which let us do lots of useful things.
The first thing we need to be able to do is to read the contents of the file.
The file type has a read method which does this. It doesn't take any
arguments, and the return value is a string, which we can store in a
variable. Once we've read the file contents into a variable, we can treat
them just like any other string – for example, we can print them:

my_file = open("[Link]")
file_contents = my_file.read()
print(file_contents)

Files, contents and file names


When learning to work with files it's very easy to get confused between a
file object, a file name, and the contents of a file. Take a look at the
following bit of code:

1 my_file_name = "[Link]"
2 my_file = open(my_file_name)
3 my_file_contents = my_file.read()

What's going on here? On line 1, we store the string [Link] in the


variable my_file_name. On line 2, we use the variable my_file_name as
the argument to the open function, and store the resulting file object in
56 Chapter 3: Reading and writing files

the variable my_file. On line 3, we call the read method on the variable
my_file, and store the resulting string in the variable
my_file_contents.
The important thing to understand about this code is that there are three
separate variables which have different types and which are storing three
very different things. my_file_name is a string, and it stores the name of
a file on disk. my_file is a file object, and it represents the file itself.
my_file_contents is a string, and it stores the text that is in the file.
Remember that variable names are arbitrary – the computer doesn't care
what you call your variables. So this piece of code is exactly the same as
the previous example:

apple = "[Link]"
banana = open(apple)
grape = [Link]()

except it is harder to read! In contrast, the file name ([Link]) is not


arbitrary – it must correspond to the name of a file on the hard drive of
your computer.
A common error is to try to use the read method on the wrong thing.
Recall that read is a method that only works on file objects. If we try to
use the read method on the file name:

my_file_name = "[Link]"
my_contents = my_file_name.read()

we'll get an AttributeError – Python will complain that strings don't


have a read method1:

AttributeError: 'str' object has no attribute 'read'

1 From now on, I'll just show the relevant bits of output when discussing error message.
57 Chapter 3: Reading and writing files

Another common error is to use the file object when we meant to use the
file contents. If we try to print the file object:

my_file_name = "[Link]"
my_file = open(my_file_name)
print(my_file)

we won't get an error, but we'll get an odd-looking line of output:

<open file '[Link]', mode 'r' at 0x7fc5ff7784b0>

We won't discuss the meaning of this line now: just remember that if you
try to print the contents of a file but instead you get some output that
looks like the above, you have almost definitely printed the file object
rather than the file contents.

Dealing with newlines


Let's take a look at the output we get when we try to print some
information from a file. We'll use the [Link] file from the chapter_3
exercises folder. This file contains a single line with a short DNA
sequence. Open the file up in a text editor and take a look at it.
We're going to write a simple program to read the DNA sequence from
the file and print it out along with its length. Putting together the file
functions and methods from this chapter, and the material we saw in the
previous chapter, we get the following code:

# open the file


my_file = open("[Link]")
# read the contents
my_dna = my_file.read()
# calculate the length
dna_length = len(my_dna)
# print the output
print("sequence is " + my_dna + " and length is " + str(dna_length))
58 Chapter 3: Reading and writing files

When we look at the output, we can see that the program is working
almost perfectly – but there is something strange: the output has been
split over two lines:

sequence is ACTGTACGTGCACTGATC
and length is 19

The explanation is simple once you know it: Python has included the new
line character at the end of the [Link] file as part of the contents. In
other words, the variable my_dna has a new line character at the end of
it. If we could view the my_dna variable directly1, we would see that it
looks like this:

'ACTGTACGTGCACTGATC\n'

The solution is also simple. Because this is such a common problem,


strings have a method for removing new lines from the end of them. The
method is called rstrip, and it takes one string argument which is the
character that you want to remove. In this case, we want to remove the
newline character (\n). Here's a modified version of the code – note that
the argument to rstrip is itself a string so needs to be enclosed in
quotes:

my_file = open("[Link]")
my_file_contents = my_file.read()
# remove the newline from the end of the file contents
my_dna = my_file_contents.rstrip("\n")
dna_length = len(my_dna)
print("sequence is " + my_dna + " and length is " + str(dna_length))

and now the output looks just as we expected:

sequence is ACTGTACGTGCACTGATC and length is 18

1 In fact, we can do this – there's a function called repr that returns a representation of a
variable.
59 Chapter 3: Reading and writing files

In the code above, we first read the file contents and then removed the
newline, in two separate steps:

my_file_contents = my_file.read()
my_dna = my_file_contents.rstrip("\n")

but it's more common to read the contents and remove the newline all in
one go, like this:

my_dna = my_file.read().rstrip("\n")

This is a bit tricky to read at first as we are using two different methods
(read and rstrip) in the same statement. The key is to read it from left
to right – we take the my_file variable and use the read method on it,
then we take the output of that method (which we know is a string) and
use the rstrip method on it. The result of the rstrip method is then
stored in the my_dna variable.
If you find it difficult write the whole thing as one statement like this, just
break it up and do the two things separately – your programs will run just
as well.

Missing files
What happens if we try to read a file that doesn't exist?

my_file = open("[Link]")

We get a new type of error that we've not seen before:

IOError: [Errno 2] No such file or directory: '[Link]'

Ideally, we'd like to be able to check if a file exists before we try to open
it – we'll see how to do that in chapter 9. Alternatively, we can deal with
60 Chapter 3: Reading and writing files

missing file errors when they occur: there are many examples in the
chapter on exceptions in Advanced Python for Biologists.

Writing text to files


All the example programs that we've seen so far in this book have
produced output straight to the screen. That's great for exploring new
features and when working on programs, because it allows you to see the
effect of changes to the code right away. It has a few drawbacks,
however, when writing code that we might want to use in real life.
Printing output to the screen only really works well when there isn't very
much of it1. It's great for short programs and status messages, but
quickly becomes cumbersome for large amounts of output. Some
terminals struggle with large amounts of text, or worse, have a limited
scrollback capability which can cause the first bit of your output to
disappear. It's not easy to search in output that's being displayed at the
terminal, and long lines tend to get wrapped. Also, for many programs
we want to send different bits of output to different files, rather than
having it all dumped in the same place.
Most importantly, terminal output vanishes when you close your terminal
program. For small programs like the examples in this book, that's not a
problem – if you want to see the output again you can just re-run the
program. If you have a program that requires a few hours to run, that's
not such a great option.

Opening files for writing


In the previous section, we saw how to open a file and read its contents.
We can also open a file and write some data to it, but we have to use the
open function in a slightly different way. To open a file for writing, we use
a two-argument version of the open function, where the second
argument is a specially-formatted string describing what we want to do

1 Linux users may be aware that we can redirect terminal output to a file using shell redirection,
which can get around some of these problems.
61 Chapter 3: Reading and writing files

to the file1. This second argument can be "r" for reading, "w" for writing,
or "a" for appending2. If we leave out the second argument (like we did
for all the examples above), Python uses the default, which is "r" for
reading.
The difference between "w" and "a" is subtle, but important. If we open a
file that already exists using the mode "w", then we will overwrite the
current contents with whatever data we write to it. If we open an existing
file with the mode "a", it will add new data onto the end of the file, but
will not remove any existing content. If there doesn't already exist a file
with the specified name, then "w" and "a" behave identically – they will
both create a new file to hold the output.
Quite a lot of Python functions and methods have these optional
arguments. For the purposes of this book, we will only mention them
when they are directly relevant to what we're doing. If you want to see all
the optional arguments for a particular method or function, the best
place to look is the official Python documentation – see chapter 1 for
details.
Once we've opened a file for writing, we can use the file write method to
write some text to it. write works a lot like print – it takes a single
string argument - but instead of printing the string to the screen it writes
it to the file.
Here's how we use open with a second argument to open a file and write
a single line of text to it:

my_file = open("[Link]", "w")


my_file.write("Hello world")

Because the output is being written to the file in this example, you won't
see any output on the screen if you run it. To check that the code has

1 We call this the mode of the file.


2 These are the most commonly-used options – there are a few others.
62 Chapter 3: Reading and writing files

worked, you'll have to run it, then open up the file [Link] in your text
editor and check that its contents are what you expect1.
Remember that with write, just like with print, we can use any string
as the argument. This also means that we can use any method or
function that returns a string. The following are all perfectly OK:

# write "abcdef"
my_file.write("abc" + "def")
# write "8"
my_file.write(str(len('AGTGCTAG')))
# write "TTGC"
my_file.write("ATGC".replace('A', 'T'))
# write "atgc"
my_file.write("ATGC".lower())
# write contents of my_variable
my_file.write(my_variable)

Closing files
There's one more important file method to look at before we finish this
chapter – close. Unsurprisingly, this is the opposite of open (but note
that it's a method, whereas open is a function). We should call close
after we're done reading or writing to a file – we won't go into the details
here, but it's a good habit to get into as it avoids some types of bugs that
can be tricky to track down2. close is an unusual method as it takes no
arguments (so it's called with an empty pair of parentheses) and doesn't
return any useful value:

my_file = open("[Link]", "w")


my_file.write("Hello world")
# remember to close the file
my_file.close()

1 .txt is the standard file name extension for a plain text file. Later in this book, when we
generate output files with a particular format, we'll use different file name extensions.
2 Specifically, it helps to ensure that output to a file is flushed, which is necessary when we
want to make a file available to another program as part of our work flow.
63 Chapter 3: Reading and writing files

There's also way of using a tool called a context manager to take care of
closing files automatically: see the exceptions chapter in Advanced
Python for Biologists for more details.

Paths and folders


So far, we have only dealt with opening files in the same folder that we
are running our program. What if we want to open a file from a different
part of the file system?
The open function is quite happy to deal with files from anywhere on your
computer, as long as you give the full path (i.e. the sequence of folder
names that tells you the location of the file). Just give a file path as the
argument rather than a file name. The format of the file path looks
different depending on your operating system. If you're on Linux, it will
look like this:

my_file = open("/home/martin/myfolder/[Link]")

if you're on Windows, like this1:

my_file = open(r"c:\windows\Desktop\myfolder\[Link]")

and if you're on a Mac, like this:

my_file = open("/Users/martin/Desktop/myfolder/[Link]")

Recap
We've taken a whole chapter to introduce the various ways of reading
and writing to files, because it's such an important part of building
programs that are useful in biology. We've seen how working with file

1 The extra r character before the string is necessary to prevent Python from trying to interpret
the backslash in the file path; see chapter 7 for an explanation.
64 Chapter 3: Reading and writing files

contents is always a two-step process – we must open a file before


reading or writing – and looked at several common pitfalls. We'll return to
the theme of file manipulation in later chapters where we'll address some
of the shortcomings of the techniques we learned in this chapter:
• All the examples in this chapter than involve reading files do so by
reading all the content into a single variable. Often, this is not what
we want – a much more common requirement is to process a file
line-by-line. In chapter 4 we'll learn about lists and loops, which will
allow us to do exactly that.
• There are, of course, many things we want to do to files besides
simply reading their contents. We would also like our programs to
be able to move and copy files, to create and delete files and
directories, and to list files and their properties. We'll cover the
tools required to do these things in chapter 9.
• Finally, another feature common to all our examples is that the
names of files are written as part of the code. We will generally
want our real-life programs to be more flexible, and capable of
reading files that are specified by the user. Chapter 9 also deals
with the various forms of user input and in it we'll learn how to
make our programs accept file names flexibly.
65 Chapter 3: Reading and writing files

Exercises

Splitting genomic DNA


Look in the chapter_3 folder for a file called genomic_dna.txt – it contains
the same piece of genomic DNA that we were using in the final exercise
from chapter 2. Write a program that will split the genomic DNA into
coding and non-coding parts, and write these sequences to two separate
files.
Hint: use your solution to the last exercise from chapter 2 as a starting
point.

Writing a FASTA file


FASTA file format is a commonly-used DNA and protein sequence file
format. A single sequence in FASTA format looks like this:

>sequence_name
ATCGACTGATCGATCGTACGAT

Where sequence_name is a header that describes the sequence (the


greater-than symbol indicates the start of the header line). Often, the
header contains an accession number that relates to the record for the
sequence in a public sequence database. A single FASTA file can contain
multiple sequences, like this:

>sequence_one
ATCGATCGATCGATCGAT
>sequence_two
ACTAGCTAGCTAGCATCG
>sequence_three
ACTGCATCGATCGTACCT
66 Chapter 3: Reading and writing files

Write a program that will create a FASTA file for the following three
sequences – make sure that all sequences are in upper case and only
contain the bases A, T, G and C.

Sequence header DNA sequence


ABC123 ATCGTACGATCGATCGATCGCTAGACGTATCG
DEF456 actgatcgacgatcgatcgatcacgact
HIJ789 ACTGAC-ACTGT--ACTGTA----CATGTG

Writing multiple FASTA files


Use the data from the previous exercise, but instead of creating a single
FASTA file, create three new FASTA files – one per sequence. The names
of the FASTA files should be the same as the sequence header names,
with the extension .fasta.
67 Chapter 3: Reading and writing files

Solutions

Splitting genomic DNA


We have a head-start on this problem, because we have already tackled
a similar problem in the previous chapter. Let's remind ourselves of the
solution we ended up with for that exercise:

my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:62]
intron = my_dna[62:90]
exon2 = my_dna[90:10000]
print(exon1 + [Link]() + exon2)

What changes do we need to make? Firstly, we need to read the DNA


sequence from a file instead of writing it in the code:

dna_file = open("genomic_dna.txt")
my_dna = dna_file.read()

Secondly, we need to create two new file objects to hold the output:

coding_file = open("coding_dna.txt", "w")


noncoding_file = open("noncoding_dna.txt", "w")

Finally, we need to concatenate the two exon sequences and write them
to the coding DNA file, and write the intron sequence to the non-coding
DNA file:

coding_file.write(exon1 + exon2)
noncoding_file.write(intron)
68 Chapter 3: Reading and writing files

Let's put it all together, with some blank lines to separate out the
different parts of the program:

# open the file and read its contents


dna_file = open("genomic_dna.txt")
my_dna = dna_file.read()

# extract the different bits of DNA sequence


exon1 = my_dna[0:62]
intron = my_dna[62:90]
exon2 = my_dna[90:10000]

# open the two output files


coding_file = open("coding_dna.txt", "w")
noncoding_file = open("noncoding_dna.txt", "w")

# write the sequences to the output files


coding_file.write(exon1 + exon2)
noncoding_file.write(intron)

Writing a FASTA file


Let's start this problem by thinking about the variables we're going to
need. We have three DNA sequences in total, so we'll need three
variables to hold the sequence headers, and three more to hold the
sequences themselves:

header_1 = "ABC123"
header_2 = "DEF456"
header_3 = "HIJ789"
seq_1 = "ATCGTACGATCGATCGATCGCTAGACGTATCG"
seq_2 = "actgatcgacgatcgatcgatcacgact"
seq_3 = "ACTGAC-ACTGT--ACTGTA----CATGTG"

FASTA format has alternating lines of header and sequence, so before we


try any sequence manipulation, let's try to write a program that produces
the lines in the right order. Rather than writing to a file, we'll print the
output to the screen for now – that will make it easier to see the output
69 Chapter 3: Reading and writing files

right away. Once we've got it working, we'll switch over to file output.
Here's a few lines which will print data to the screen:

print(header_1)
print(seq_1)
print(header_2)
print(seq_2)
print(header_3)
print(seq_3)

and here's what the output looks like:

ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG
DEF456
actgatcgacgatcgatcgatcacgact
HIJ789
ACTGAC-ACTGT--ACTGTA----CATGTG

Not far off – the lines are in the right order, but we forgot to include the
greater-than symbol at the start of the header. Also, we don't really need
to print the header and the sequence separately for each sequence – we
can include a newline character in the print string in order to get them on
separate lines. Here's an improved version of the code:

print('>' + header_1 + '\n' + seq_1)


print('>' + header_2 + '\n' + seq_2)
print('>' + header_3 + '\n' + seq_3)

and the output looks better too:

>ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG
>DEF456
actgatcgacgatcgatcgatcacgact
>HIJ789
ACTGAC-ACTGT--ACTGTA----CATGTG
70 Chapter 3: Reading and writing files

Next, let's tackle the problems with the sequences. The second sequence
is in lower case, and it needs to be in upper case – we can fix that using
the upper string method. The third sequence has a bunch of gaps that
we need to remove. We haven't come across a remove method.... but we
do know how to replace one character with another. If we replace all the
gap characters with an empty string, it will be the same as removing
them1. Here's a version that fixes both sequences:

print('>' + header_1 + '\n' + seq_1)


print('>' + header_2 + '\n' + seq_2.upper())
print('>' + header_3 + '\n' + seq_3.replace('-', ''))

Now the printed output is perfect:

>ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG
>DEF456
ACTGATCGACGATCGATCGATCACGACT
>HIJ789
ACTGACACTGTACTGTACATGTG

The final step is to switch from printed output to writing to a file. We'll
open a new file, and change the three print lines to write:

output = open("[Link]", "w")


[Link]('>' + header_1 + '\n' + seq_1)
[Link]('>' + header_2 + '\n' + seq_2.upper())
[Link]('>' + header_3 + '\n' + seq_3.replace('-', ''))

After making these changes the code doesn't produce any output on the
screen, so to see what's happened we'll need to take a look at the
[Link] file:

1 An empty string is just a pair of open and close quotation marks with nothing in between
them.
71 Chapter 3: Reading and writing files

>ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG>DEF456
ACTGATCGACGATCGATCGATCACGACT>HIJ789
ACTGACACTGTACTGTACATGTG

This doesn't look right – the second and third lines have been joined
together, as have the fourth and fifth. What has happened?
It looks like we've uncovered a difference between the print function
and the write method. print automatically puts a new line at the end of
the string, whereas write doesn't. This means we've got to be careful
when switching between them! The fix is quite simple, we'll just add a
newline onto the end of each string that gets written to the file:

output = open("[Link]", "w")


[Link]('>' + header_1 + '\n' + seq_1 + '\n')
[Link]('>' + header_2 + '\n' + seq_2.upper() + '\n')
[Link]('>' + header_3 + '\n' + seq_3.replace('-', '') + '\n')

The arguments for the write statements are getting quite complicated,
but they are all made up of simple building blocks. For example the last
one, if we translated it into English, would read "a greater-than symbol,
followed by the variable header_3, followed by a newline, followed by the
variable seq_3 with all hyphens replaced with nothing, followed by
another newline".
Here's the final code, including the variable definition at the beginning,
with blank lines and comments:
72 Chapter 3: Reading and writing files

# set the values of all the header variables


header_1 = "ABC123"
header_2 = "DEF456"
header_3 = "HIJ789"

# set the values of all the sequence variables


seq_1 = "ATCGTACGATCGATCGATCGCTAGACGTATCG"
seq_2 = "actgatcgacgatcgatcgatcacgact"
seq_3 = "ACTGAC-ACTGT—ACTGTA----CATGTG"

# make a new file to hold the output


output = open("[Link]", "w")

# write the header and sequence for seq1


[Link]('>' + header_1 + '\n' + seq_1 + '\n')

# write the header and uppercase sequences for seq2


[Link]('>' + header_2 + '\n' + seq_2.upper() + '\n')

# write the header and sequence for seq3 with hyphens removed
[Link]('>' + header_3 + '\n' + seq_3.replace('-', '') + '\n')

There's an exercise that uses different techniques to solve a very similar


problem at the end of the chapter on functional programming in
Advanced Python for Biologists – if you find yourself carrying out this
type of process in real life code, then it's probably worth a look.

Writing multiple FASTA files


We can solve this problem with a slight modification of our solution to the
previous exercise. We'll need to create three new files to hold the output,
and we'll construct the name of each file by using string concatenation:

output_1 = open(header_1 + ".fasta", "w")


output_2 = open(header_2 + ".fasta", "w")
output_3 = open(header_3 + ".fasta", "w")
73 Chapter 3: Reading and writing files

Remember, the first argument to open is a string, so it's fine to use a


concatenation because we know that the result of concatenating two
strings is also a string.
We'll also change the write statements so that we have one for each of
the output files. We need to be careful with the number here in order to
make sure that we get the right sequence in each file. Here's the final
code, with comments.

# set the values of all the header variables


header_1 = "ABC123"
header_2 = "DEF456"
header_3 = "HIJ789"

# set the values of all the sequence variables


seq_1 = "ATCGTACGATCGATCGATCGCTAGACGTATCG"
seq_2 = "actgatcgacgatcgatcgatcacgact"
seq_3 = "ACTGAC-ACTGT—ACTGTA----CATGTG"

# make three files to hold the output


output_1 = open(header_1 + ".fasta", "w")
output_2 = open(header_2 + ".fasta", "w")
output_3 = open(header_3 + ".fasta", "w")

# write one sequence to each output file


output_1.write('>' + header_1 + '\n' + seq_1 + '\n')
output_2.write('>' + header_2 + '\n' + seq_2.upper() + '\n')
output_3.write('>' + header_3 + '\n' + seq_3.replace('-', '') + '\n')

Looking at the code above, it seems like there's a lot of redundancy


there. Each of the four sections of code – setting the header values,
setting the sequence values, creating the output files, and writing data to
the output files – consists of three nearly-identical statements. Although
the solution works, it seems to involve a lot of unnecessary typing! Also,
having so much nearly-identical code seems likely to cause errors if we
need to change something. In the next chapter, we'll examine some
tools which will allow us to start removing some of that redundancy.
74 Chapter 4: Lists and loops

4: Lists and loops

Why do we need lists and loops?


Think back over the exercises that we've seen in the previous two
chapters – they've all involved dealing with one bit of information at a
time. In chapter 2, we used string manipulation tools to process single
sequences, and in chapter 3, we practised reading and writing files one
at a time. The closest we got to using multiple pieces of data was during
the final exercise in chapter 3, where we were dealing with three DNA
sequences.
If that's all that Python allowed us to do, it wouldn't be a very helpful tool
for biology. In fact, there's a good chance that you're reading this book
because you want to be able to write programs to help you deal with
large datasets. A very common situation in biological research is to have
a large collection of data (DNA sequences, SNP positions, gene
expression measurements) that all need to be processed in the same
way. In this chapter, we'll learn about the fundamental programming
tools that will allow our programs to do this.
So far we have learned about several different data types (strings,
numbers, and file objects), all of which store a single bit of information 1.
When we've needed to store multiple bits of information (for example,
the three DNA sequences in the chapter 3 exercises) we have simply
created more variables to hold them:

# set the values of all the sequence variables


seq_1 = "ATCGTACGATCGATCGATCGCTAGACGTATCG"
seq_2 = "actgatcgacgatcgatcgatcacgact"
seq_3 = "ACTGAC-ACTGT—ACTGTA----CATGTG"

1 We know that files are slightly different to strings and numbers because they can store a lot of
information, but each file object still only refers to a single file.
75 Chapter 4: Lists and loops

The limitations of this approach became clear quite quickly as we looked


at the solution code – it only worked because the number of sequences
were small, and we knew the number in advance. If we were to repeat
the exercise with three hundred or three thousand sequences, the vast
majority of the code would be given over to storing variables and it would
become completely unmanageable. And if we were to try and write a
program that could process an unknown number of input sequences (for
instance, by reading them from a file), we wouldn't be able to do it. To
make our programs able to process multiple pieces of data, we need an
entirely new type of structure which can hold many pieces of information
at the same time – a list.
We've also dealt exclusively with programs whose statements are
executed from top to bottom in a very straightforward way. This has
great advantages when first starting to think about programming – it
makes it very easy to follow the flow of a program. The downside of this
sequential style of programming, however, is that it leads to very
redundant code like we saw at the end of the previous chapter:

# make three files to hold the output


output_1 = open(header_1 + ".fasta", "w")
output_2 = open(header_2 + ".fasta", "w")
output_3 = open(header_3 + ".fasta", "w")

Again; it was only possible to solve the exercise in this manner because
we knew in advance the number of output files we were going to need.
Looking at the code, it's clear that these three lines consist of essentially
the same statement being executed multiple times, with some slight
variations. This idea of repetition-with-variation is incredibly common in
programming problems, and Python has built in tools for expressing it –
loops.
76 Chapter 4: Lists and loops

Creating lists and retrieving elements


To make a new list, we put several strings or numbers1 inside square
brackets, separated by commas:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


conserved_sites = [24, 56, 132]

Each individual item in a list is called an element. To get a single element


from the list, write the variable name followed by the index of the
element you want in square brackets:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


conserved_sites = [24, 56, 132]
print(apes[0])
first_site = conserved_sites[2]

If we want to go in the other direction – i.e. we know which element we


want but we don't know the index – we can use the index method:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


chimp_index = [Link]("Pan troglodytes")
# chimp_index is now 1

Remember that in Python we start counting from zero rather than one, so
the first element of a list is always at index zero. If we give a negative
number, Python starts counting from the end of the list rather than the
beginning – so it's easy to get the last element from a list:

last_ape = apes[-1]

What if we want to get more than one element from a list? We can give a
start and stop position, separated by a colon, to specify a range of
elements:

1 Or in fact, any other type of value or variable


77 Chapter 4: Lists and loops

ranks = ["kingdom","phylum", "class", "order", "family"]


lower_ranks = ranks[2:5]
# lower ranks are class, order and family

Does this look familiar? It's the exact same notation that we used to get
substrings back in chapter 2, and it works in exactly the same way –
numbers are inclusive at the start and exclusive at the end. The fact
that we use the same notation for strings and lists hints at a deeper
relationship between the two types. In fact, what we were doing when
extracting substrings in chapter 2 was treating a string as though it
were a list of characters. This idea – that we can treat a variable as
though it were a list when it's not – is a powerful one in Python and we'll
come back to it later in this chapter (and also in the chapter on iterators
in Advanced Python for Biologists).

Working with list elements


To add another element onto the end of an existing list, we can use the
append method:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


[Link]("Pan paniscus")

append is an interesting method because it actually changes the variable


on which it's used – in the above example, the apes list goes from having
three elements to having four. We can get the length of a list by using
the len function, just like we did for strings:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


print("There are " + str(len(apes)) + " apes")
[Link]("Pan paniscus")
print("Now there are " + str(len(apes)) + " apes")

The output shows that the number of elements in apes really has
changed:
78 Chapter 4: Lists and loops

There are 3 apes


Now there are 4 apes

We can concatenate two lists just as we did with strings, by using the
plus symbol:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


monkeys = ["Papio ursinus", "Macaca mulatta"]
primates = apes + monkeys

print(str(len(apes)) + " apes")


print(str(len(monkeys)) + " monkeys")
print(str(len(primates)) + " primates")

As we can see from the output, this doesn't change either of the two
original lists – it makes a brand new list which contains elements from
both:

3 apes
2 monkeys
5 primates

If we want to add elements from a list onto the end of an existing list,
changing it in the process, we can use the extend method. extend
behaves like append but takes a list as its argument rather than a single
element.
Here are two more list methods that change the variable they're used on:
reverse and sort. Both reverse and sort work by changing the order of
the elements in the list. If we want to print out a list to see how this
works, we need to used str (just as we did when printing out numbers):
79 Chapter 4: Lists and loops

ranks = ["kingdom","phylum", "class", "order", "family"]


print("at the start : " + str(ranks))
[Link]()
print("after reversing : " + str(ranks))
[Link]()
print("after sorting : " + str(ranks))

If we take a look at the output, we can see how the order of the elements
in the list is changed by these two methods:

at the start : ['kingdom', 'phylum', 'class', 'order', 'family']


after reversing : ['family', 'order', 'class', 'phylum', 'kingdom']
after sorting : ['class', 'family', 'kingdom', 'order', 'phylum']

By default, Python sorts strings in alphabetical order and numbers in


ascending numerical order1.

Writing a loop
Imagine we wanted to take our list of apes:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]

and print out each element on a separate line, like this:

Homo sapiens is an ape


Pan troglodytes is an ape
Gorilla gorilla is an ape

One way to do it would be to just print each element separately:

print(apes[0] + " is an ape")


print(apes[1] + " is an ape")
print(apes[2] + " is an ape")

1 We can sort in other ways too, but that's beyond the scope of this book
80 Chapter 4: Lists and loops

but this is very repetitive and relies on us knowing the number of


elements in the list. What we need is a way to say something along the
lines of "for each element in the list of apes, print out the element,
followed by the words ' is an ape'". Python's loop syntax allows us to
express those instructions like this:

for ape in apes:


print(ape + " is an ape")

Let's take a moment to look at the different parts of this loop. We start by
writing for x in y, where y is the name of the list we want to process
and x is the name we want to use for the current element each time
round the loop.
x is just a variable name (so it follows all the rules that we've already
learned about variable names), but it behaves slightly differently to all
the other variables we've seen so far. In all previous examples, we create
a variable and store something in it, and then the value of that variable
doesn't change unless we change it ourselves. In contrast, when we
create a variable to be used in a loop, we don't set its value – the value
of the variable will be automatically set to each element of the list in
turn, and it will be different each time round the loop.
Importantly, the loop variable x only exists inside the loop – it gets
created at the start of each loop iteration, and disappears at the end.
This means that once the loop has finished running for the last time, that
variable is gone forever. When a variable is restricted to a block of code
like this, we call it the variable's scope – we will see several more
examples later in the book.
This first line of the loop ends with a colon, and all the subsequent lines
(just one, in this case) are indented. Indented lines can start with any
number of tab or space characters, but they must all be indented in the
same way. This pattern – a line which ends with a colon, followed by
some indented lines – is very common in Python, and we'll see it in
81 Chapter 4: Lists and loops

several more places throughout this book. A group of indented lines is


often called a block of code1.
In this case, we refer to the indented bock as the body of the loop, and
the lines inside it will be executed once for each element in the list. To
refer to the current element, we use the variable name that we wrote in
the first line. The body of the loop can contain as many lines as we like,
and can include all the functions and methods that we've learned about,
with one important exception: we're not allowed to change the list while
inside the body of the loop2.
Here's an example of a loop with a more complicated body:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


for ape in apes:
name_length = len(ape)
first_letter = ape[0]
print(ape + " is an ape. Its name starts with " + first_letter)
print("Its name has " + str(name_length) + " letters")

The body of the loop in the code above has four statements, two of which
are print statements, so each time round the loop we'll get two lines of
output. If we look at the output we can see all six lines:

Homo sapiens is an ape. Its name starts with H


Its name has 12 letters
Pan troglodytes is an ape. Its name starts with P
Its name has 15 letters
Gorilla gorilla is an ape. Its name starts with G
Its name has 15 letters

Why is the above approach better than printing out these six lines in six
separate statements? Well, for one thing, there's much less redundancy –
here we only needed to write two print statements. This also means that

1 If you're familiar with any other programming languages, you might know code blocks as
things that are surrounded with curly brackets – the indentation does the same job in Python
2 Changing the list while looping can cause Python to become confused about which elements
have already been processed and which are yet to come.
82 Chapter 4: Lists and loops

if we need to make a change to the code, we only have to make it once


rather than three separate times. Another benefit of using a loop here is
that if we want to add some elements to the list, we don't have to touch
the loop code at all. Consequently, it doesn't matter how many elements
are in the list, and it's not a problem if we don't know how many are
going to be in it at the time when we write the code.
Many problems that can be solved with loops can also be solved using a
tool called list comprehensions – see the chapter on comprehensions in
Advanced Python for Biologists.

Indentation errors
Unfortunately, introducing tools like loops that require an indented block
of code also introduces the possibility of a new type of error – an
IndentationError. Notice what happens when the indentation of one of
the lines in the block does not match the others:

apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]


for ape in apes:
name_length = len(ape)
first_letter = ape[0]
print(ape + " is an ape. Its name starts with " + first_letter)
print("Its name has " + str(name_length) + " letters")

When we run this code, we get an error message before the program
even starts to run:

IndentationError: unindent does not match any outer indentation level

When you encounter an IndentationError, go back to your code and


double-check that all the lines in the block match up. Also double-check
that you are using either tabs or spaces for indentation, not both. The
easiest way to do this, as mentioned in chapter 1, is to enable tab
emulation in your text editor.
83 Chapter 4: Lists and loops

Using a string as a list


We've already seen how a string can pretend to be a list – we can use list
index notation to get individual characters or substrings from inside a
string. Can we also use loop notation to process a string as though it
were a list? Yes – if we write a loop statement with a string in the position
where we'd normally find a list, Python treats each character in the
string as a separate element. This allows us to very easily process a
string one character at a time:

name = "martin"
for character in name:
print("one character is " + character)

In this case, we're just printing each individual character:

one character is m
one character is a
one character is r
one character is t
one character is i
one character is n

The process of repeating a set of instructions for each element of a list


(or character in a string) is called iteration, and we often talk about
iterating over a list or string.

Splitting a string to make a list


So far in this chapter, all our lists have been written manually. However,
there are plenty of functions and methods in Python that produce lists as
their output. One such method that is particularly interesting to biologists
is the split method which works on strings. split takes a single
argument, called the delimiter, and splits the original string wherever it
sees the delimiter, producing a list. Here's an example:
84 Chapter 4: Lists and loops

names = "melanogaster,simulans,yakuba,ananassae"
species = [Link](",")
print(str(species))

We can see from the output that the string has been split wherever there
was a comma leaving us with a list of strings:

['melanogaster', 'simulans', 'yakuba', 'ananassae']

Of course, once we've created a list in this way we can iterate over it
using a loop, just like any other list.

Iterating over lines in a file


Another very useful thing that we can iterate over is a file. Just as a string
can pretend to be a list for the purposes of looping, a file object can do
the same trick1. When we treat a string as a list, each character becomes
an individual element, but when we treat a file as a list, each line
becomes an individual element. This makes processing a file line-by-line
very easy:

file = open("some_input.txt")
for line in file:
# do something with the line

A quick warning: when you're writing a program that reads data from a
file, it's best to use either the read method (to store the entire contents
in a variable) or the loop method (to deal with each line separately). If
you try to mix them, you might get unexpected behaviour. The reason for
this is that Python keeps track of its position in each file, so if you read
the contents of a file object using the read method, and then later try to
process it one line at a time with a loop, you won't get any input because
Python thinks it's already at the end of the file. If you absolutely have to
1 If you're interested in how this "pretending" actually works, look up the Python documentation
for iterators – but be prepared to do quite a bit of reading!
85 Chapter 4: Lists and loops

use one method and then the other, you can get round this problem by
closing and then re-opening the file.

Looping with ranges


Sometimes we want to loop over a list of numbers. Imagine we have a
protein sequence:

protein = "vlspadktnv"

and we want to print out the first three residues, then the first four
residues, etc. etc.:

vls
vlsp
vlspa
vlspad
...etc...

One way to tackle the problem would be to use a loop – we could extract
a substring from the protein sequence and print it in the body of the loop,
and the only thing that would need to change is the stop position in the
substring. But what are we going to iterate over? We can't just iterate
over the protein string, because that will give us individual residues,
which is not what we want. We can manually assemble a list of stop
positions, and loop over that:

stop_positions = [3,4,5,6,7,8,9,10]
for stop in stop_positions:
substring = protein[0:stop]
print(substring)

but this seems cumbersome, and only works if we know the length of the
protein sequence in advance.
86 Chapter 4: Lists and loops

A better solution is to use the range function. range is a built-in Python


function that generates lists of numbers for us to loop over. The
behaviour of the range function depends on how many arguments we
give it. Below are a few examples, with the output following directly after
the code.
With a single argument, range will count up from zero to that number,
excluding the number itself:

for number in range(6):


print(number)

0
1
2
3
4
5

With two numbers, range will count up from the first number (inclusive1)
to the second (exclusive):

for number in range(3, 8):


print(number)

3
4
5
6
7

With three numbers, range will count up from the first to the second with
the step size given by the third:

1 The rules for ranges are the same as for array notation – inclusive on the low end, exclusive
on the high end – so you only have to memorize them once!
87 Chapter 4: Lists and loops

for number in range(2, 14, 4):


print(number)

2
6
10

Recap
In this chapter we've seen several tools that work together to allow our
programs to deal elegantly with multiple pieces of data. Lists let us store
many elements in a single variable, and loops let us process those
elements one by one. In learning about loops, we've also been introduced
to the block syntax and the importance of indentation in Python.
We've also seen several useful ways in which we can use the notation
we've learned for working with lists with other types of data. Depending
on the circumstances, we can use strings, files, and ranges as if they
were lists. This is a very helpful feature of Python, because once we've
become familiar with the syntax for working with lists, we can use it in
many different place. Learning about these tools has also helped us make
sense of some interesting behaviour that we observed in earlier
chapters.
Lists are the first example we've encountered of structures that can hold
multiple pieces of data. We'll encounter another such structure – the dict
– in chapter 8. In fact, Python has several more such data types – you'll
find a full survey of them in the chapter on complex data structures in
Advanced Python for Biologists.
88 Chapter 4: Lists and loops

Exercises
Note: all the files mentioned in these exercises can be found in the
chapter_4 folder of the exercises download.

Processing DNA in a file


The file [Link] contains a number of DNA sequences, one per line.
Each sequence starts with the same 14 base pair fragment – a
sequencing adapter that should have been removed. Write a program
that will (a) trim this adapter and write the cleaned sequences to a new
file and (b) print the length of each sequence to the screen.

Multiple exons from genomic DNA


The file genomic_dna.txt contains a section of genomic DNA, and the file
[Link] contains a list of start/stop positions of exons. Each exon is on a
separate line and the start and stop positions are separated by a comma.
Write a program that will extract the exon segments, concatenate them,
and write them to a new file.
89 Chapter 4: Lists and loops

Solutions

Processing DNA in a file


This seems a bit more complicated than previous exercises – we are
being asked to write a program that does two things at once! – so lets
tackle it one step at a time. First, we'll write a program that simply reads
each sequence from the file and prints it to the screen:

file = open("[Link]")
for dna in file:
print(dna)

We can see from the output that we've forgotten to remove the newlines
from the ends of the DNA sequences – there is a blank line between
each:

ATTCGATTATAAGCTCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

ATTCGATTATAAGCACTGATCGATCGATCGATCGATCGATGCTATCGTCGT

ATTCGATTATAAGCATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC

ATTCGATTATAAGCACTATCGATGATCTAGCTACGATCGTAGCTGTA

ATTCGATTATAAGCACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA

but we'll ignore that for now. The next step is to remove the first 14
bases of each sequence. We know that we want to take a substring from
each sequence, starting at the fifteenth character, and continuing to the
end. Unfortunately, the sequences are all different lengths, so the stop
position is going to be different for all of them. We'll have to calculate the
position of the last character for each sequence, by using the len
function to calculate the length.
Here's what the code looks like with the substring part added:
90 Chapter 4: Lists and loops

file = open("[Link]")
for dna in file:
last_character_position = len(dna)
trimmed_dna = dna[14:last_character_position]
print(trimmed_dna)

As before, we are simply printing the trimmed DNA sequence to the


screen, and from the output we can confirm that the first 14 bases have
been removed from each sequence:

TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

ACTGATCGATCGATCGATCGATCGATGCTATCGTCGT

ATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC

ACTATCGATGATCTAGCTACGATCGTAGCTGTA

ACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA

Now that we know our code is working, we'll switch from printing to the
screen to writing to a file. We'll have to open the file before the loop,
then write the trimmed sequences to the file inside the loop:

file = open("[Link]")
output = open("[Link]", "w")
for dna in file:
last_character_position = len(dna)
trimmed_dna = dna[14:last_character_position]
[Link](trimmed_dna)

Opening up the [Link] file, we can see that the result looks good. It
didn't matter that we never removed the newlines, because they appear
in the correct place in the output file anyway:
91 Chapter 4: Lists and loops

TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
ACTGATCGATCGATCGATCGATCGATGCTATCGTCGT
ATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC
ACTATCGATGATCTAGCTACGATCGTAGCTGTA
ACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA

Now the final step – printing the lengths to the screen – requires just one
more line of code. Here's the final program in full, with comments:

# open the input file


file = open("[Link]")

# open the output file


output = open("[Link]", "w")

# go through the input file one line at a time


for dna in file:

# calculate the position of the last character


last_character_position = len(dna)

# get the substring from the 15th character to the end


trimmed_dna = dna[14:last_character_position]

# print out the trimmed sequence


[Link](trimmed_dna)

# print out the length to the screen


print("processed sequence with length " + str(len(trimmed_dna)))

Multiple exons from genomic DNA


This is very similar to the exercises from the previous two chapters, and
so our solution to it is going to look very similar. Let's concentrate on the
new bit of the problem first – reading the file of exon locations. As before,
we can start by opening up the file and printing each line to the screen:
92 Chapter 4: Lists and loops

exon_locations = open("[Link]")
for line in exon_locations:
print(line)

This gives us a loop in which we are dealing with a different exon each
time round. If we look at the output, we can see that we still have a
newline at the end of each line, but we'll not worry about that for now:

5,58

72,133

190,276

340,398

Now we have to split up each line into a start and stop position. The
split method is probably a good choice for this job – let's see what
happens when we split each line using a comma as the delimiter:

exon_locations = open("[Link]")
for line in exon_locations:
positions = [Link](',')
print(positions)

The output shows that each line, when split, turns into a list of two
elements:

['5', '58\n']
['72', '133\n']
['190', '276\n']
['340', '398\n']

The second element of each list has a newline on the end, because we
haven't removed them. Let's try assigning the start and stop position to
sensible variable names, and printing them out individually:
93 Chapter 4: Lists and loops

exon_locations = open("[Link]")
for line in exon_locations:
positions = [Link](',')
start = positions[0]
stop = positions[1]
print("start is " + start + ", stop is " + stop)

The output shows that this approach works – the start and stop variables
take different values each time round the loop:

start is 5, stop is 58

start is 72, stop is 133

start is 190, stop is 276

start is 340, stop is 398

Now let's try putting these variables to use. We'll read the genomic
sequence from the file all in one go using read – there's no need to
process each line separately, as we just want the entire contents. Then
we'll use the exon coordinates to extract one exon each time round the
loop, and print it to the screen:

1 genomic_dna = open("genomic_dna.txt").read()
2 exon_locations = open("[Link]")
3 for line in exon_locations:
4 positions = [Link](',')
5 start = positions[0]
6 stop = positions[1]
7 exon = genomic_dna[start:stop]
8 print("exon is: " + exon)

Unfortunately, when we run this code we get an error at line 7:


94 Chapter 4: Lists and loops

File "multiple_exons_from_genomic_dna.py", line 7, in <module>


exon = genomic_dna[start:stop]
TypeError: slice indices must be integers or None or have an __index__
method

What has gone wrong? Recall that the result of using split on a string is
a list of strings – this means that the start and stop variables in our
program are also strings (because they're just individual elements of the
positions list). The problem comes when we try to use them as
numbers in line 7. Fortunately, it's easily fixed – we just have to use the
int function to turn our strings into numbers:

start = int(positions[0])
stop = int(positions[1])

and the program works as intended.


Next step: doing something useful with the exons, rather than just
printing them to the screen. The exercise description says that we have
to concatenate the exon sequences to make a long coding sequence. If
we had all the exons in separate variables, then this would be easy;

coding_seq = exon1 + exon2 + exon3 + exon4

but instead we have a single exon variable that stores one exon at a
time. Here's one way to get the complete coding sequence: before the
loop starts we'll create a new variable called coding_sequence and
assign it to an empty string. Then, each time round the loop, we'll add
the current exon on to the end, and store the result back in the same
variable. When the loop has finished, the variable will contain all the
exons. This is what the code looks like (with line numbers as the program
is getting quite long):
95 Chapter 4: Lists and loops

1 genomic_dna = open("genomic_dna.txt").read()
2 exon_locations = open("[Link]")
3 coding_sequence = ""
4 for line in exon_locations:
5 positions = [Link](',')
6 start = int(positions[0])
7 stop = int(positions[1])
8 exon = genomic_dna[start:stop]
9 coding_sequence = coding_sequence + exon
10 print("coding sequence is : " + coding_sequence)

On line 3 we create the coding_sequence variable, and on line 9, inside


the loop, we add the current exon on to the end. This is an unusual type
of variable assignment, because the coding_sequence variable is on
both the left and right side of the equals sign. The trick to understanding
line 9 is to read the right-hand side of the statement first i.e.
"concatenate the current coding_sequence and the current exon, then
store the result of that concatenation in coding_sequence".
On line 10, instead of printing the exon, we're printing the coding
sequence, and we can see from the output how the coding sequence is
gradually built up as we go round the loop:

coding sequence is :
CGTACCGTCGACGATGCTACGATCGTCGATCGTAGTCGATCATCGATCGATCG
coding sequence is :
CGTACCGTCGACGATGCTACGATCGTCGATCGTAGTCGATCATCGATCGATCGCGATCGATCGATATCGATCG
ATATCATCGATGCATCGATCATCGATCGATCGATCGATCGA
coding sequence is :
CGTACCGTCGACGATGCTACGATCGTCGATCGTAGTCGATCATCGATCGATCGCGATCGATCGATATCGATCG
ATATCATCGATGCATCGATCATCGATCGATCGATCGATCGACGATCGATCGATCGTAGCTAGCTAGCTAGATC
GATCATCATCGTAGCTAGCTCGACTAGCTACGTACGATCGATGCATCGATCGTA
coding sequence is :
CGTACCGTCGACGATGCTACGATCGTCGATCGTAGTCGATCATCGATCGATCGCGATCGATCGATATCGATCG
ATATCATCGATGCATCGATCATCGATCGATCGATCGATCGACGATCGATCGATCGTAGCTAGCTAGCTAGATC
GATCATCATCGTAGCTAGCTCGACTAGCTACGTACGATCGATGCATCGATCGTACGATCGATCGATCGATCGA
TCGATCGATCGATCGATCGATCGTAGCTAGCTACGATCG
96 Chapter 4: Lists and loops

The final step is to save the coding sequence to a file. We can do this at
the end of the program with three lines of code. Here's the final code
with comments:

# open the genomic dna file and read the contents


genomic_dna = open("genomic_dna.txt").read()

# open the exons locations file


exon_locations = open("[Link]")

# create a variable to hold the coding sequence


coding_sequence = ""

# go through each line in the exon locations file


for line in exon_locations:

# split the line using a comma


positions = [Link](',')

# get the start and stop positions


start = int(positions[0])
stop = int(positions[1])

# extract the exon from the genomic dna


exon = genomic_dna[start:stop]

# append the exon to the end of the current coding sequence


coding_sequence = coding_sequence + exon

# write the coding sequence to an output file


output = open("coding_sequence.txt", "w")
[Link](coding_sequence)
[Link]()
97 Chapter 5: Writing our own functions

5: Writing our own functions

Why do we want to write our own functions?


Take a look back at the very first exercise in this book – the one in
chapter 2 where we had to write a program to calculate the AT content of
a DNA sequence. Let's remind ourselves of the code:

1 my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
2 length = len(my_dna)
3 a_count = my_dna.count('A')
4 t_count = my_dna.count('T')
5 at_content = (a_count + t_count) / length
6 print("AT content is " + str(at_content))

If we discount the first line (whose job is to store the input sequence) and
the last line (whose job is to print the result), we can see that it takes
four lines of code to calculate the AT content1. This means that every
place in our code where we want to calculate the AT content of a
sequence, we need these same four lines – and we have to make sure we
copy them exactly, without any mistakes.
It would be much simpler if Python had a built-in function (let's call it
get_at_content) for calculating AT content. If that were the case, then
we could just run get_at_content in the same way we run print, or
len, or open. Although, sadly, Python does not have such a built-in
function, it does have the next best thing – a way for us to create our
own functions.
Creating our own function to carry out a particular job has many benefits.
It allows us to re-use the same code many times within a program
without having to copy it out each time. Additionally, if we find that we
have to make a change to the code, we only have to do it in one place.

1 We could, of course, compress this down to a single line:


at_content = (my_dna.count('A') + my_dna.count('T')) / len(my_dna)
but it would be much less readable.
98 Chapter 5: Writing our own functions

Splitting our code into functions also allows us to tackle larger problems,
as we can work on different bits of the code independently. We can also
re-use code across multiple programs.

Defining a function
Let's go ahead and create our get_at_content function. Before we start
typing, we need to figure out what the inputs (the number and types of
the function arguments) and outputs (the type of the return value) are
going to be. For this function, that seems pretty obvious – the input is
going to be a single DNA sequence, and the output is going to be a
decimal number. To translate these into Python terms: the function will
take a single argument of type string, and will return a value of type
number1. Here's the code:

def get_at_content(dna):
length = len(dna)
a_count = [Link]('A')
t_count = [Link]('T')
at_content = (a_count + t_count) / length
return at_content

Reminder: if you're using Python 2 rather than Python 3, include this


line at the top of your program:

from __future__ import division

The first line of the function definition contains a several different


elements. We start with the word def, which is short for define (writing a
function is called defining it). Following that we write the name of the
function, followed by the names of the argument variables in
parentheses. Just like we saw before with normal variables, the function

1 In fact, we can be a little bit more specific: we can say that the return value will be of type
float – a floating point number (i.e. one with a decimal point).
99 Chapter 5: Writing our own functions

name and the argument names are arbitrary – we can use whatever we
like.
The first line ends with a colon, just like the first line of the loops that we
were looking at in the previous chapter. And just like loops, this line is
followed by a block of indented lines – the function body. The function
body can have as many lines of code as we like, as long as they all have
the same indentation. Within the function body, we can refer to the
arguments by using the variable names from the first line. In this case,
the variable dna refers to the sequence that was passed in as the
argument to the function.
The last line of the function causes it to return the AT content that was
calculated in the function body. To return from a function, we simply
write return followed by the value that the function should output.
There are a couple of important things to be aware of when writing
functions. Firstly, we need to make a clear distinction between defining a
function, and running it (we refer to running a function as calling it). The
code we've written above will not cause anything to happen when we run
it, because we've not actually asked Python to execute the
get_at_content function – we have simply defined what it is. The code
in the function will not be executed until we call the function like this:

get_at_content("ATGACTGGACCA")

If we simply call the function like that, however, then the AT content will
vanish once it's been calculated. In order to use the function to do
something useful, we must either store the result in a variable:

at_content = get_at_content("ATGACTGGACCA")

Or use it directly:

print("AT content is " + str(get_at_content("ATGACTGGACCA")))


100 Chapter 5: Writing our own functions

Secondly, it's important to understand that the argument variable dna


does not hold any particular value when the function is defined1. Instead,
its job is to hold whatever value is given as the argument when the
function is called. In this way it's analogous to the loop variables we saw
in the previous chapter: loop variables hold a different value each time
round the loop, and function argument variables hold a different value
each time the function is called.
Finally, be aware that the same scoping rules that applied to loops also
apply to functions – any variables that we create as part of the function
only exist inside the function, and cannot be accessed outside. If we try
to use a variable that's created inside the function from outside:

def get_at_content(dna):
length = len(dna)
a_count = [Link]('A')
t_count = [Link]('T')
at_content = (a_count + t_count) / length
return at_content

print(a_count)

We'll get an error:

NameError: name 'a_count' is not defined

Calling and improving our function


Let's write a small program that uses our new function, to see how it
works. We'll try both storing the result in a variable before printing it
(lines 8 and 9) and printing it directly (lines 10 and 11):

1 Indeed, it doesn't actually exist when it's defined, only when it runs.
101 Chapter 5: Writing our own functions

1 def get_at_content(dna):
2 length = len(dna)
3 a_count = [Link]('A')
4 t_count = [Link]('T')
5 at_content = (a_count + t_count) / length
6 return at_content
7
8 my_at_content = get_at_content("ATGCGCGATCGATCGAATCG")
9 print(str(my_at_content))
10 print(get_at_content("ATGCATGCAACTGTAGC"))
11 print(get_at_content("aactgtagctagctagcagcgta"))

Looking at the output, we can see that the first function call works fine –
the AT content is calculated to be 0.45, is stored in the variable
my_at_content, then printed. However, the output for the next two calls
is not so great. The call at line 10 produces a number with way too many
figures after the decimal point, and the call at line 11, with the input
sequence in lower case, gives a result of 0.0, which is definitely not
correct:

0.45
0.5294117647058824
0.0

We'll fix these problems by making a couple of changes to the


get_at_content function. We can add a rounding step in order to limit
the number of significant figures in the result. Python has a built-in round
function that takes two arguments – the number we want to round, and
the number of significant figures. We'll call the round function on the
result before we return it. And we can fix the lower case problem by
converting the input sequence to upper case before starting the
calculation. Here's the new version of the function, with the same three
function calls:
102 Chapter 5: Writing our own functions

def get_at_content(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, 2)

my_at_content = get_at_content("ATGCGCGATCGATCGAATCG")
print(str(my_at_content))
print(get_at_content("ATGCATGCAACTGTAGC"))
print(get_at_content("aactgtagctagctagcagcgta"))

and now the output is just as we want:

0.45
0.53
0.52

We can make the function even better though: why not allow it to be
called with the number of significant figures as an argument1? In the
above code, we've picked two significant figures, but there might be
situations where we want to see more. Adding the second argument is
easy; we just add it to the argument variable list on the first line of the
function definition, and then use the new argument variable in the call to
round. We'll throw in a few calls to the new version of the function with
different arguments to check that it works:

1 An even better solution would be to specify the number of significant figures in the string
representation of the number when it's printed.
103 Chapter 5: Writing our own functions

def get_at_content(dna, sig_figs):


length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, sig_figs)

test_dna = "ATGCATGCAACTGTAGC"
print(get_at_content(test_dna, 1))
print(get_at_content(test_dna, 2))
print(get_at_content(test_dna, 3))

The output confirms that the rounding works as intended:

0.5
0.53
0.529

Encapsulation with functions


Let's pause for a moment and consider what happened in the previous
section. We wrote a function, and then wrote some code that used that
function. In the process of writing the code that used the function, we
discovered a couple of problems with our original function definition. We
were then able to go back and change the function definition,
without having to make any changes to the code that used the
function.
I've written that last sentence in bold, because it's incredibly important.
It's no exaggeration to say that understanding the implications of that
sentence is the key to being able to write larger, useful programs. The
reason it's so important is that it describes a programming phenomenon
that we call encapsulation. Encapsulation just means dividing up a
complex program into little bits which we can work on independently. In
the example above, the code is divided into two parts – the part where
we define the function, and the part where we use it – and we can make
changes to one part without worrying about the effects on the other part.
104 Chapter 5: Writing our own functions

This is a very powerful idea, because without it, the size of programs we
can write is limited to the number of lines of code we can hold in our
head at one time. Some of the example code in the solutions to exercises
in the previous chapter were starting to push at this limit already, even
for relatively simple problems. By contrast, using functions allows us to
build up a complex program from small building blocks, each of which
individually is small enough to understand in its entirety.
Because using functions is so important, future solutions to exercises will
use them when appropriate, even when it's not explicitly mentioned in
the problem text. I encourage you to get into the habit of using functions
in your solutions too.

Functions don't always have to take an argument


There's nothing in the rules of Python to say that your function must
take an argument. It's perfectly possible to define a function with no
arguments:

def get_a_number():
return 42

but such functions tend not to be very useful. For example, we can write
a version of get_at_content that doesn't require any arguments by
setting the value of the dna variable inside the function:

def get_at_content():
dna = "ACTGATGCTAGCTA"
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, 2)

but that's obviously not very useful. Occasionally you may be tempted to
write a no-argument function that works like this:
105 Chapter 5: Writing our own functions

1 def get_at_content():
2 length = len(dna)
3 a_count = [Link]().count('A')
4 t_count = [Link]().count('T')
5 at_content = (a_count + t_count) / length
6 return round(at_content, 2)
7
8 dna = "ACTGATCGATCG"
9 print(get_at_content())

At first this seems like a good idea – it works because the function gets
the value of the dna variable that is set on line 81. However, this breaks
the encapsulation that we worked so hard to achieve. The function now
only works if there is a variable called dna set in the bit of the code
where the function is called, so the two pieces of code are no longer
independent.
If you find yourself writing code like this, it's usually a good idea to
identify which variables from outside the function are being used inside
it, and turn them into arguments.

Functions don't always have to return a value


Consider this variation of our function – instead of returning the AT
content, this function prints it to the screen:

def print_at_content(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
print(str(round(at_content, 2)))

When you first start writing functions, it's very tempting to do this kind of
thing. You think "OK, I need to calculate and print the AT content – I'll

1 It doesn't matter that the variable is set after the function is defined – all that matters it that
it's set before the function is called on line 9.
106 Chapter 5: Writing our own functions

write a function that does both". The trouble with this approach is that it
results in a function that is less flexible. Right now you want to print the
AT content to the screen, but what if you later discover that you want to
write it to a file, or use it as part of some other calculation? You'll have to
write more functions to carry out these tasks.
The key to designing flexible functions is to recognize that the job
calculate and print the AT content is actually two separate jobs –
calculating the AT content, and printing it. Try to write your functions in
such a way that they just do one job. You can then easily write code to
carry out more complicated jobs by using your simple functions as
building blocks.

Functions can be called with named arguments


What do we need to know about a function in order to be able to use it?
We need to know what the return value and type is, and we need to know
the number and type of the arguments. For the examples we've seen so
far in this book, we also need to know the order of the arguments. For
instance, to use the open function we need to know that the name of the
file comes first, followed by the mode of the file. And to use our two-
argument version of get_at_content as described above, we need to
know that the DNA sequence comes first, followed by the number of
significant figures.
There's a feature in Python called keyword arguments which allows us to
call functions in a slightly different way. Instead of giving a list of
arguments in parentheses:

get_at_content("ATCGTGACTCG", 2)

we can supply a list of argument variable names and values joined by


equals signs:

get_at_content(dna="ATCGTGACTCG", sig_figs=2)
107 Chapter 5: Writing our own functions

This style of calling functions1 has several advantages. It doesn't rely on


the order of arguments, so we can use whichever order we prefer. These
two statements behave identically:

get_at_content(dna="ATCGTGACTCG", sig_figs=2)
get_at_content(sig_figs=2, dna="ATCGTGACTCG")

It's also clearer to read what's happening when the argument names are
given explicitly.
We can even mix and match the two styles of calling – the following are
all identical:

get_at_content("ATCGTGACTCG", 2)
get_at_content(dna="ATCGTGACTCG", sig_figs=2)
get_at_content("ATCGTGACTCG", sig_figs=2)

Although we're not allowed to start off with keyword arguments then
switch back to normal – this will cause an error:

get_at_content(dna="ATCGTGACTCG", 2)

Keyword arguments can be particularly useful for functions and methods


that have a lot of arguments, and we'll use them where appropriate in
the examples and exercise solutions in the rest of this book.

Function arguments can have defaults


We've encountered function arguments with defaults before, when we
were discussing opening files in chapter 3. Recall that the open function
takes two arguments – a file name and a mode string – but that if we call
it with just a file name it uses a default value for the mode string. We
can easily take advantage of this feature in our own functions – we
simply specify the default value in the first line of the function definition.

1 It works with methods too, including all the ones we've seen so far.
108 Chapter 5: Writing our own functions

Here's a version of our get_at_content function where the default


number of significant figures is two:

def get_at_content(dna, sig_figs=2):


length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, sig_figs)

Now we have the best of both worlds. If the function is called with two
arguments, it will use the number of significant figures specified; if it's
called with one argument, it will use the default value of two significant
figures. Let's see some examples:

get_at_content("ATCGTGACTCG")
get_at_content("ATCGTGACTCG", 3)
get_at_content("ATCGTGACTCG", sig_figs=4)

The function takes care of filling in the default value for sig_figs for the
first function call where none is supplied:

0.45
0.455
0.4545

Function argument defaults allow us to write very flexible functions which


can have varying numbers of arguments. It only makes sense to use
them for arguments where a sensible default can be chosen – there's no
point specifying a default for the dna argument in our example. They are
particularly useful for functions where some of the options are only going
to be used infrequently.
109 Chapter 5: Writing our own functions

Testing functions
When writing code of any type, it's important to periodically check that
your code does what you intend it to do. If you look back over the
solutions to exercises from the first few chapters, you can see that we
generally test our code at each step by printing some output to the
screen and checking that it looks OK. For example, in chapter 2 when we
were first calculating AT content, we used a very short test sequence to
verify that our code worked before running it on the real input.
The reason we used a test sequence was that, because it was so short,
we could easily work out the answer by eye and compare it to the answer
given by our code. This idea – running code on a test input and
comparing the result to an answer that we know to be correct1 – is
such a useful one that Python has a built-in tool for expressing it: assert.
An assertion consists of the word assert, followed by a call to our
function, then two equals signs, then the result that we expect2.
For example, we know that if we run our get_at_content function on the
DNA sequence "ATGC" we should get an answer of 0.5. This assertion will
test whether that's the case:

assert get_at_content("ATGC") == 0.5

Notice the two equals signs – we'll learn the reason behind that in the
next chapter. The way that assertion statements work is very simple; if
an assertion turns out to be false (i.e. if Python executes our function on
the input "ATGC" and the answer isn't 0.5) then the program will stop and
we will get an AssertionError.
Assertions are useful in a number of ways. They provide a means for us
to check whether our functions are working as intended and therefore
help us track down errors in our programs. If we get some unexpected

1 Think of it as similar to running a positive control in a wet-lab experiment.


2 In fact, assertions can include any conditional statement; we'll learn about those in the next
chapter.
110 Chapter 5: Writing our own functions

output from a program that uses a particular function, and the assertion
tests for that function all pass, then we can be confident that the error
doesn't lie in the function but in the code that calls it.
They also let us modify a function and check that we haven't introduced
any errors. If we have a function that passes a series of assertion tests,
and we make some changes to it, we can re-run the assertion tests and,
assuming they all pass, be confident that we haven't broken the
function1.
Assertions are also useful as a form of documentation. By including a
collection of assertion tests alongside a function, we can show exactly
what output is expected from a given input.
Finally, we can use assertions to test the behaviour of our function for
unusual inputs. For example, what is the expected behaviour of
get_at_content when given a DNA sequence that includes unknown
bases (usually represented as N)? A sensible way to handle unknown
bases would be to exclude them from the AT content calculation – in
other words, the AT content for a given sequence shouldn't be affected
by adding a bunch of unknown bases. We can write an assertion that
expresses this:

assert get_at_content("ATGCNNNNNNNNNN") == 0.5

This assertions fails for the current version of get_at_content. However,


we can easily modify the function to remove all N characters before
carrying out the calculation:

1 This idea is very similar to a process in software development called regression testing.
111 Chapter 5: Writing our own functions

def get_at_content(dna, sig_figs=2):


dna = [Link]('N', '')
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, sig_figs)

and now the assertion passes.


It's common to group a collection of assertions for a particular function
together to test for the correct behaviour on different types of input.
Here's an example for get_at_content which shows a range of different
types of behaviour:

assert get_at_content("A") == 1
assert get_at_content("G") == 0
assert get_at_content("ATGC") == 0.5
assert get_at_content("AGG") == 0.33
assert get_at_content("AGG", 1) == 0.3
assert get_at_content("AGG", 5) == 0.33333

In fact, this idea of grouping sets of tests together is such a good one
that we have special words for it (test suites and unit testing) and
there's a built-in Python tool for carrying out such tests. Take a look at
the chapter on modules and testing in Advanced Python for Biologists for
more info.

Recap
In this chapter, we've seen how packaging up code into functions helps
us to manage the complexity of large programs and promote code reuse.
We learned how to define and call our own functions along with various
new ways to supply arguments to functions. We also looked at a couple
of things that are possible in Python, but rarely advisable – writing
functions without arguments or return values. Finally, we explored the
112 Chapter 5: Writing our own functions

use of assertions to test our functions, and discussed how we can use
them to catch errors before they become a problem.
This chapter has covered the basics of writing and using functions, but
there's much more we can do with them – in fact, there's a whole style of
programming (functional programming) which revolves around the
manipulation of functions. You'll find a discussion of this in the chapter in
Advanced Python for Biologists called, unsurprisingly, functional
programming.
The remaining chapters in this book will make use of functions in both
the examples and the exercise solutions, so make sure you are
comfortable with the new ideas from this chapter before moving on.
113 Chapter 5: Writing our own functions

Exercises

Percentage of amino acid residues, part one


Write a function that takes two arguments – a protein sequence and an
amino acid residue code – and returns the percentage of the protein that
the amino acid makes up. Use the following assertions to test your
function:

assert my_function("MSRSLLLRFLLFLLLLPPLP", "M") == 5


assert my_function("MSRSLLLRFLLFLLLLPPLP", "r") == 10
assert my_function("MSRSLLLRFLLFLLLLPPLP", "L") == 50
assert my_function("MSRSLLLRFLLFLLLLPPLP", "Y") == 0

Reminder: if you're using Python 2 rather than Python 3, include this


line at the top of your program:

from __future__ import division

Percentage of amino acid residues, part two


Modify the function from part one so that it accepts a list of amino acid
residues rather than a single one. If no list is given, the function should
return the percentage of hydrophobic amino acid residues (A, I, L, M, F,
W, Y and V). Your function should pass the following assertions:

assert my_function("MSRSLLLRFLLFLLLLPPLP", ["M"]) == 5


assert my_function("MSRSLLLRFLLFLLLLPPLP", ['M', 'L']) == 55
assert my_function("MSRSLLLRFLLFLLLLPPLP", ['F', 'S', 'L']) == 70
assert my_function("MSRSLLLRFLLFLLLLPPLP") == 65
114 Chapter 5: Writing our own functions

Solutions

Percentage of amino acid residues, part one


This is a similar problem to ones that we've tackled before, but we'll have
to pay attention to the details. Let's start with a piece of code that does
the calculation for a specific protein sequence and amino acid code, and
then turn it into a function. Calculating the percentage is very similar to
calculating the AT content, but we will need to multiple the result by 100
to get a percentage rather than a fraction:

protein = "MSRSLLLRFLLFLLLLPPLP"
aa = "R"
aa_count = [Link](aa)
protein_length = len(protein)
percentage = aa_count * 100 / protein_length
print(percentage)

Now we'll make this code into a function by turning the two variables
protein and aa into arguments, and returning the percentage rather
than printing it. We'll add in the assertions at the end of the program to
test if the function is doing its job:

def get_aa_percentage(protein, aa):


aa_count = [Link](aa)
protein_length = len(protein)
percentage = aa_count * 100 / protein_length
return percentage

# test the function with assertions


assert get_aa_percentage("MSRSLLLRFLLFLLLLPPLP", "M") == 5
assert get_aa_percentage("MSRSLLLRFLLFLLLLPPLP", "r") == 10
assert get_aa_percentage("msrslllrfllfllllpplp", "L") == 50
assert get_aa_percentage("MSRSLLLRFLLFLLLLPPLP", "Y") == 0

Running the code shows that one of the assertions is failing – the error
message tells us which assertion is the failed one:
115 Chapter 5: Writing our own functions

assert get_aa_percentage("MSRSLLLRFLLFLLLLPPLP", "r") == 10


AssertionError

Our function fails to work when the protein sequence is in upper case,
but the amino acid residue code is in lower case. Looking at the
assertions, we can make an educated guess that the next one (with the
protein in lower case and the amino acid in upper case) is probably going
to fail as well. Let's try to fix both of these problems by converting both
the protein and the amino acid string to upper case at the start of the
function. We'll use the same trick as we did before of converting a string
to upper case and then storing the result back in the same variable:

def get_aa_percentage(protein, aa):

# convert both inputs to upper case


protein = [Link]()
aa = [Link]()

aa_count = [Link](aa)
protein_length = len(protein)
percentage = aa_count * 100 / protein_length
return percentage

Now all the assertions pass without error.

Percentage of amino acid residues, part two


This exercise involves something that we've not seen before: a function
that takes a list as one of its arguments. As in the previous exercise, we'll
pick one of the assertion cases and write the code to solve it first, then
turn the code into a function.
There are actually two ways to approach this problem. We can use a loop
to go through each of the given amino acid residues in turn, counting up
the number of times they occur in the protein sequence, to get a total
count. Or, we can treat the protein sequence string as a list (as described
in the previous chapter) and ask, for each position, whether the
116 Chapter 5: Writing our own functions

character at that position is a member of the list of amino acid residues.


We'll use the first method here; in the next chapter we'll learn about the
tools necessary to implement the second.
We'll need some way to keep a running total of matching amino acids as
we go round the loop, so we'll create a new variable outside the loop and
update it each time round. The code inside the loop will be quite similar
to that from the previous exercise. Here's the code with some print
statements so we can see exactly what is happening:

protein = "MSRSLLLRFLLFLLLLPPLP"
aa_list = ['M', 'L', 'F']

# the total variable will hold the total number of matching residues
total = 0
for aa in aa_list:
print("counting number of " + aa)
aa = [Link]()
aa_count = [Link](aa)

# add the number for this residue to the total count


total = total + aa_count
print("running total is " + str(total))

percentage = total * 100 / len(protein)


print("final percentage is " + str(percentage))

When we run the code, we can see how the running total increases each
time round the loop:

counting number of M
running total is 1
counting number of L
running total is 11
counting number of F
running total is 13
final percentage is 65.0
117 Chapter 5: Writing our own functions

Now let's take the code and, just like before, turn the protein string and
the amino acid list into arguments to create a function:

def get_aa_percentage(protein, aa_list):


protein = [Link]()
protein_length = len(protein)
total = 0
for aa in aa_list:
aa = [Link]()
aa_count = [Link](aa)
total = total + aa_count
percentage = total * 100 / protein_length
return percentage

This function passes all the assertion tests except the last one, which
tests the behaviour when run with only one argument. In fact, Python
never even gets as far as testing the result from running the function, as
we get an error indicating that the function didn't complete:

TypeError: get_aa_percentage() takes exactly 2 arguments (1 given)

Fixing the error takes only one change: we add a default value for
aa_list in the first line of the function definition:

def get_aa_percentage(protein,
aa_list=['A','I','L','M','F','W','Y','V']):
protein = [Link]()
protein_length = len(protein)
total = 0
for aa in aa_list:
aa = [Link]()
aa_count = [Link](aa)
total = total + aa_count
percentage = total * 100 / protein_length
return percentage

and now all the assertions pass.


118 Chapter 6: Conditional tests

6: Conditional tests

Programs need to make decisions


If we look back at the examples and exercises in previous chapters,
something that stands out is the lack of decision-making. We've gone
from doing simple calculations on individual bits of data to carrying out
more complicated procedures on collections of data, but the way that
each bit of data (a sequence, a base, a species name, an exon) has been
treated identically.
Real-life problems, however, often require our programs to act as
decision-makers; to examine a property of some bit of data and decide
what to do with it. In this chapter, we'll see how to do that using
conditional statements. Conditional statements are features of Python
that allow us to build decision points in our code. They allow our
programs to decide which out of a number of possible courses of action
to take – instructions like "print the name of the sequence if it's longer
than 300 bases" or "group two samples together if they were collected
less than 10 metres apart".
Before we can start using conditional statements, however, we need to
understand conditions.

Conditions, True and False


A condition is simply a bit of code that can produce a true or false
answer. The easiest way to understand how conditions work in Python is
try out a few examples. The following example prints out the result of
testing (or evaluating) a bunch of different conditions – some
mathematical examples, some using string methods, and one for testing
if a value is included in a list:
119 Chapter 6: Conditional tests

1 print(3 == 5)
2 print(3 > 5)
3 print(3 <=5)
4 print(len("ATGC") > 5)
5 print("GAATTC".count("T") > 1)
6 print("ATGCTT".startswith("ATG"))
7 print("ATGCTT".endswith("TTT"))
8 print("ATGCTT".isupper())
9 print("ATGCTT".islower())
10 print("V" in ["V", "W", "L"])

If we look at the output, we can see use the line numbers to match up
each condition with its result:

1 False
2 False
3 True
4 False
5 True
6 True
7 False
8 True
9 False
10 True

But what's actually being printed here? At first glance, it looks like we're
printing the strings "True" and "False", but those strings don't appear
anywhere in our code. What is actually being printed is the special built-
in values that Python uses to represent true and false – they are
capitalized so that we know they're these special values.
We can show that these values are special by trying to print them. The
following code runs without errors (note the absence of quotation marks):

print(True)
print(False)

whereas trying to print arbitrary unquoted words:


120 Chapter 6: Conditional tests

print(Hello)

causes a NameError.
There's a wide range of things that we can include in conditions, and it
would be impossible to give an exhaustive list here. The basic building
blocks are:
• equals (represented by ==)
• greater and less than (represented by > and <)
• greater and less than or equal to (represented by >= and <=)
• not equal (represented by!=)
• is a value in a list (represented by in)
• are two objects the same1 (represented by is)
Many data types also provide methods that return True or False values,
which are often a lot more convenient to use than the building blocks
above. We've already seen a few in the code sample above: for example,
strings have a startswith method that returns true if the string starts
with the string given as an argument. We'll mention these true/false
methods when they come up.
Notice that the test for equality is two equals signs, not one. Forgetting
the second equals sign will cause an error.
Now that we know how to express tests as conditions, let's see what we
can do with them.

if statements
The simplest kind of conditional statement is an if statement. Hopefully
the syntax is fairly simple to understand:

1 A discussion of what this actually means in Python is beyond the scope of this book, so we'll
avoid using this comparison for the chapter.
121 Chapter 6: Conditional tests

expression_level = 125
if expression_level > 100:
print("gene is highly expressed")

We write the word if, followed by a condition, and end the first line with
a colon. There follows a block of indented lines of code (the body of the if
statement), which will only be executed if the condition is true. This
colon-plus-block pattern should be familiar to you from the chapters on
loops and functions.
Most of the time, we want to use an if statement to test a property of
some variable whose value we don't know at the time when we are
writing the program. The example above is obviously useless, as the
value of the expression_level variable is not going to change!
Here's a slightly more interesting example: we'll define a list of gene
accession names and print out just the ones that start with "a":

accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']


for accession in accs:
if [Link]('a'):
print(accession)

Looking at the output allows us to check that this works as intended:

ab56
ay93
ap97

If you take a close look at the code above, you'll see something
interesting – the lines of code inside the loop are indented (just as we've
seen before), but the line of code inside the if statement is indented
twice – once for the loop, and once for the if. This is the first time
we've seen multiple levels of indentation, but it's very common once we
start working with larger programs – whenever we have one loop or if
statement nested inside another, we'll have this type of indentation.
122 Chapter 6: Conditional tests

Python is quite happy to have as many levels of indentation as needed,


but you'll need to keep careful track of which lines of code belong at
which level. If you find yourself writing a piece of code that requires more
than three levels of indentation, it's generally an indication that that
piece of code should be turned into a function.

else statements
Closely related to the if statement is the else statement. The examples
above use a yes/no type of decision-making: should we print the gene
accession number or not? Often we need an either/or type of decision,
where we have two possible actions to take. To do this, we can add on an
else clause after the end of the body of an if statement:

expression_level = 125
if expression_level > 100:
print("gene is highly expressed")
else:
print("gene is lowly expressed")

The else statement doesn't have any condition of its own – rather, the
else statement body is execute when the if statement to which it's
attached is not executed.
Here's an example which uses if and else to split up a list of accession
names into two different files – accessions that start with "a" go into the
first file, and all other accessions go into the second file:

file1 = open("[Link]", "w")


file2 = open("[Link]", "w")
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a'):
[Link](accession + "\n")
else:
[Link](accession + "\n")
123 Chapter 6: Conditional tests

Notice how there are multiple indentation levels as before, but that the
if and else statements are at the same level.

elif statements
What if we have more than two possible branches? For example, say we
want three files of accession names: ones that start with "a", ones that
start with "b", and all others. We could have a second if statement
nested inside the else clause of the first if statement:

file1 = open("[Link]", "w")


file2 = open("[Link]", "w")
file3 = open("[Link]", "w")
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a'):
[Link](accession + "\n")
else:
if [Link]('b'):
[Link](accession + "\n")
else:
[Link](accession + "\n")

This works, but is difficult to read – we can quickly see that we need an
extra level of indentation for every additional choice we want to include.
To get round this, Python has an elif statement, which merges together
else and if and allows us to rewrite the above example in a much more
elegant way:
124 Chapter 6: Conditional tests

file1 = open("[Link]", "w")


file2 = open("[Link]", "w")
file3 = open("[Link]", "w")
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a'):
[Link](accession + "\n")
elif [Link]('b'):
[Link](accession + "\n")
else:
[Link](accession + "\n")

Notice how this version of the code only needs two levels of indention. In
fact, using elif we can have any number of branches and still only
require a single extra level of indentation:

for accession in accs:


if [Link]('a'):
[Link](accession + "\n")
elif [Link]('b'):
[Link](accession + "\n")
elif [Link]('c'):
[Link](accession + "\n")
elif [Link]('d'):
[Link](accession + "\n")
elif [Link]('e'):
[Link](accession + "\n")
else:
[Link](accession + "\n")

while loops
Here's one final thing we can do with conditions: use them to determine
when to exit a loop. In chapter 4 we learned about loops that iterate over
a collection of items (like a list, a string or a file). Python has another
type of loop called a while loop. Rather than running a set number of
times, a while loop runs until some condition is met. For example, here's
125 Chapter 6: Conditional tests

a bit of code that increments a count variable by one each time round
the loop, stopping when the count variable reaches ten:

count = 0
while count<10:
print(count)
count = count + 1

Because normal loops in Python are so powerful1, while loops are used
much less frequently than in other languages, so we won't discuss them
further.

Building up complex conditions


What if we wanted to express a condition that was made up of several
parts? Imagine we want to go through our list of accessions and print out
only the ones that start with "a" and end with "3". We could use two
nested if statements:

accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']


for accession in accs:
if [Link]('a'):
if [Link]('3'):
print(accession)

but this brings in an extra, unneeded level of indention. A better way is


to join up the two condition with and to make a complex expression:

accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']


for accession in accs:
if [Link]('a') and [Link]('3'):
print(accession)

This version is nicer in two ways: it doesn't require the extra level of
indentation, and the condition reads in a very natural way. We can also

1 E.g. the example code here could be better accomplished with a range.
126 Chapter 6: Conditional tests

use or to join up two conditions, to produce a complex condition that will


be true if either of the two simple conditions are true:

accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']


for accession in accs:
if [Link]('a') or [Link]('b'):
print(accession)

We can even join up complex conditions to make more complex


conditions – here's an example which prints accessions if they start with
either "a" or "b" and end with "4":

accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']


for acc in accs:
if ([Link]('a') or [Link]('b')) and [Link]('4'):
print(acc)

Notice how we have to include parentheses in the above example to


avoid ambiguity. Finally, we can negate any type of condition by prefixing
it with the word not. This example will print out accessions that start with
"a" and don't end with 6:

accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']


for acc in accs:
if [Link]('a') and not [Link]('6'):
print(acc)

By using a combination of and, or and not (along with parentheses


where necessary) we can build up arbitrarily complex conditions. This
kind of use for conditions – identifying elements in a list – can often be
done better using either the filter function, or a list comprehension. You'll
find examples of each in the chapters on functional programming and
comprehensions respectively in Advanced Python for Biologists.
These three words are collectively known as boolean operators and crop
up in a lot of places. For example, if you wanted to search for information
127 Chapter 6: Conditional tests

on using Python in biology, but didn't want to see pages that talked
about biology of snakes, you might do a search for "biology python
-snake". This is actually a complex condition just like the ones above –
Google automatically adds and between words, and uses the hyphen to
mean not. So you're asking for pages that mention python and biology
but not snakes.

Writing true/false functions


Sometimes we want to write a function that can be used in a condition.
This is very easy to do – we just make sure that our function always
returns either True or False. Remember that True and False are built-in
values in Python, so they can be passed around, stored in variables, and
returned, just like numbers or strings.
Here's a function that determines whether or not a DNA sequence is AT-
rich (we'll say that a sequence is AT-rich if it has an AT content of more
than 0.65):

def is_at_rich(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
if at_content > 0.65:
return True
else:
return False

We'll test this function on a few sequences to see if it works:

print(is_at_rich("ATTATCTACTA"))
print(is_at_rich("CGGCAGCGCT"))

The output shows that the function returns True or False just like the
other conditions we've been looking at:
128 Chapter 6: Conditional tests

True
False

Therefore we can use our function in an if statement:

if is_at_rich(my_dna):
# do something with the sequence

Because the last four lines of our function are devoted to evaluating a
condition and returning True or False, we can write a slightly more
compact version. In this example we evaluate the condition, and then
return the result right away:

def is_at_rich(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return at_content > 0.65

This is a little more concise, and also easier to read once you're familiar
with the idiom.

Recap
In this short chapter, we've dealt with two things: conditions, and the
statements that use them.
We've seen how simple conditions can be joined together to make more
complex ones, and how the concepts of truth and falsehood are built in
to Python on a fundamental level. We've also seen how we can
incorporate True and False in our own functions in a way that allows them
to be used as part of conditions.
We've been introduced to four different tools that use conditions – if,
else, elif, and while – in approximate order of usefulness. You'll
probably find, in the programs that you write and in your solutions to the
129 Chapter 6: Conditional tests

exercises in this book, that you use if and else very frequently, elif
occasionally, and while almost never.
130 Chapter 6: Conditional tests

Exercises
In the chapter_6 folder in the exercises download, you'll find a text file
called [Link], containing some made-up data for a number of genes.
Each line contains the following fields for a single gene in this order:
species name, sequence, gene name, expression level. The fields are
separated by commas (hence the name of the file – csv stands for
Comma Separated Values). Think of it as a representation of a table in a
spreadsheet – each line is a row, and each field in a line is a column. All
the exercises for this chapter use the data read from this file.
Reminder: if you're using Python 2 rather than Python 3, include this
line at the top of your programs:

from __future__ import division

Several species
Print out the gene names for all genes belonging to Drosophila
melanogaster or Drosophila simulans.

Length range
Print out the gene names for all genes between 90 and 110 bases long.

AT content
Print out the gene names for all genes whose AT content is less than 0.5
and whose expression level is greater than 200.

Complex condition
Print out the gene names for all genes whose name begins with "k" or "h"
except those belonging to Drosophila melanogaster.
131 Chapter 6: Conditional tests

High low medium


For each gene, print out a message giving the gene name and saying
whether its AT content is high (greater than 0.65), low (less than 0.45) or
medium (between 0.45 and 0.65 inclusive).
132 Chapter 6: Conditional tests

Solutions

Several species
These exercises are somewhat more complicated than previous ones,
and they're going to require material from multiple different chapters to
solve. The first problem is to deal with the format of the data file. Open it
up in a text editor and take a look before continuing.
We know that we're going to have to open the file (chapter 3) and
process the contents line-by-line (chapter 4). To deal with each line, we'll
have to split it to make a list of columns (chapter 4), then apply the
condition (this chapter) in order to figure out whether or not we should
print it. Here's a program that will read each line from the file, split it
using commas as the delimiter, then assign each of the four columns to a
variable and print the gene name:

data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
print(name)

Notice that we use rstrip to remove the newline from the end of the
current line before splitting it. We know the order of the fields in the line
because they were mentioned in the exercise description, so we can
easily assign them to the four variables. This program doesn't do
anything useful, but we can check the output to confirm that it gets the
names right:
133 Chapter 6: Conditional tests

kdy647
jdg766
kdy533
hdt739
hdu045
teg436

Now we can add in the condition. We want to print the name if the
species is either Drosophila melanogaster or Drosophila simulans. If the
species name is neither of those two, then we don't want to do
anything. This is a yes/no type decision, so we need an if statement:

data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if species == "Drosophila melanogaster" or species == "Drosophila
simulans":
print(name)

The line containing the if statement is quite long, so it wraps around onto
the next line on this page, but it's still just a single line in the program
file. We can check the output we get:

kdy647
jdg766
kdy533

against the contents of the file, and confirm that the program is working.

Length range
We can re-use a large part of the code from the previous exercise to help
solve this one. We have another complex condition: we only want to print
names for genes whose length is between 90 and 110 bases – in other
134 Chapter 6: Conditional tests

words, genes whose length is greater than 90 and less than 110. We'll
have to calculate the length using the len function. Once we've done
that the rest of the program is quite straightforward:

data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if len(sequence) > 90 and len(sequence) < 110:
print(name)

AT content
This exercise has a complex condition like the others, but it also requires
us to do a bit more calculation – we need to be able to calculate the AT
content of each sequence. Rather than starting from scratch, we'll simply
use the function that we wrote in the previous chapter and include it at
the start of the program. Once we've done that, it's just a case of using
the output from get_at_content as part of the condition. We must be
careful to convert the fourth column – the expression level – into an
integer so that it can be properly compared:
135 Chapter 6: Conditional tests

# our function to get AT content


def get_at_content(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return at_content

data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = int(columns[3])
if get_at_content(sequence) < 0.5 and expression > 200:
print(name)

Complex condition
There are no calculations to carry out for this exercise – the complexity
comes from the fact that there are three components to the condition,
and they have to be joined together in the right way:

data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if ([Link]('k') or [Link]('h')) and species !=
"Drosophila melanogaster":
print(name)

The line containing the if statement is quite long, so it wraps around onto
the next line on this page, but it's still just a single line in the program
file. There are two different ways to express the requirement that the
name is not Drosophila melanogaster. In the above example we've used
136 Chapter 6: Conditional tests

the not-equals sign (!=) but we could also have used the not boolean
operator:

if ([Link]('k') or [Link]('h')) and not species ==


"Drosophila melanogaster":

High low medium


Now we come to an exercise that requires the use of multiple branches.
We have three different printing options for each gene – high, low and
medium – so we'll need an if..elif..else section to handle the
conditions. We'll use the get_at_content function as before:

# our function to get AT content


def get_at_content(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return at_content

data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if get_at_content(sequence) > 0.65:
print(name + " has high AT content")
elif get_at_content(sequence) < 0.45:
print(name + " has low AT content")
else:
print(name + " has medium AT content")

Checking the output confirms that the conditions are working:


137 Chapter 6: Conditional tests

kdy647 has high AT content


jdg766 has medium AT content
kdy533 has medium AT content
hdt739 has low AT content
hdu045 has medium AT content
teg436 has medium AT content

This general type of problem is very common in programming. There's a


similar exercise at the end of the chapter on functional programming in
Advanced Python for Biologists which illustrates a different approach to
solving them.
138 Chapter 7: Regular expressions

7: Regular expressions

The importance of patterns in biology


A lot of what we do when writing programs for biology can be described
as searching for patterns in strings. The obvious examples come from the
analysis of biological sequence data – remember that DNA, RNA and
protein sequences are just strings. Many of the things we want to look for
in biological sequences can be described in terms of patterns:
• protein domains
• DNA transcription factor binding motifs
• restriction enzyme cut sites
• degenerate PCR primer sites
• runs of mononucleotides
However, it's not just sequence data that can have interesting patterns.
As we discussed in chapter 3, most of the other types of data we have to
deal with in biology comes in the form of strings1 inside text files – things
like:
• read mapping locations
• geographical sample coordinates
• taxonomic names
• gene names
• gene accession numbers
• BLAST searches

1 Note that although many of the things in this list are numerical data, they're still read in to
Python programs as strings and need to be manipulated as such.
139 Chapter 7: Regular expressions

In previous chapters, we've looked at some programming tasks that


involve pattern recognition in strings. We've seen how to count individual
amino acid residues (and even groups of amino acid residues) in protein
sequences (chapter 5), and how to identify restriction enzyme cut sites in
DNA sequences (chapter 2). We've also seen how to examine parts of
gene names and match them against individual characters (chapter 6).
The common theme among all these problems is that they involve
searching for a fixed set of characters. But there are many problems that
we want to solve that require more flexible patterns. For example:
• Given a DNA sequence, what's the length of the poly-A tail?
• Given a gene accession name, extract the part between the third
character and the underscore
• Given a protein sequence, determine if it contains this highly-
redundant domain motif
Because these types of problems crop up in so many different fields,
there's a standard set of tools in Python1 for dealing with them: regular
expressions. Regular expressions2 are a topic that might not be covered
in a general-purpose programming book, but because they're so useful in
biology, we're going to devote the whole of this chapter to looking at
them.
Although the tools for dealing with regular expressions are built in to
Python, they are not made automatically available when you write a
program. In order to use them we must first talk about modules.

Modules in Python
The functions and data types that we've discussed so far in this book
have been ones that are likely to be needed in pretty much every
program – tools for dealing with strings and numbers, for reading and
writing files, and for manipulating lists of data. As such, they are
1 And in many other languages and utilities.
2 The name is often abbreviated to regex.
140 Chapter 7: Regular expressions

automatically made available when we start to create a Python program.


If we want to open a file, we simply write a statement that uses the open
function.
However, there's another category of tools in Python which are more
specialized. Regular expressions are one example, but there is a large list
of specialized tools which are very useful when you need them1, but are
not likely to be needed for the majority of programs. Examples include
tools for doing advanced mathematical calculations, for downloading
data from the web, for running external programs, and for manipulating
date/time information. Each collection of specialized tools – really just a
collection of specialized functions and data types – is called a module.
For reasons of efficiency, Python doesn't automatically make these
modules available in each new program, as it does with the more basic
tools. Instead, we have to explicitly load each module of specialized tools
that we want to use inside our program. To load a module we use the
import statement2. For example, the module that deals with regular
expressions is called re, so if we want to write a program that uses the
regular expression tools we must include the line:

import re

at the top of our program. When we then want to use one of the tools
from a module, we have to prefix it with the module name3. For example,
to use the regular expression search function (which we'll discuss later in
this chapter) we have to write:

[Link](pattern, string)

rather than simply:

1 Indeed, this is one of the great strengths of the Python language.


2 This is the reason for the from __future__ import division statement that we have to
include if we're using Python 2.
3 There are ways round this, but we won't consider them in this book.
141 Chapter 7: Regular expressions

search(pattern, string)

If we forget to import the module which we want to use, or forget to


include the module name as part of the function call, we will get a
NameError.
We'll encounter various other module in the rest of this book. For the rest
of this chapter specifically, all code examples will require the import re
statement in order to work. For clarity, we won't include it, so if you want
try running any of the code in this chapter, you'll need to add it at the
top.
For lots more on modules, including how to create your own, take a look
at the modules chapter in Advanced Python for Biologists.

Raw strings
Writing regular expression patterns, as we'll see in the very next section
of this chapter, requires us to type a lot of special characters. Recall from
chapter 2 that certain combinations of characters are interpreted by
Python to have special meaning. For example, \n means start a new line,
and \t means insert a tab character.
Unfortunately, there are a limited number of special characters to go
round, so some of the characters that have a special meaning in regular
expressions clash with the characters that already have a special
meaning. Python's way round this problem is to have a special rule for
strings: if we put the letter r immediately before the opening quotation
mark, then any special characters inside the string are ignored:

print(r"\t\n")

The r stands for raw, which is Python's description for a string where
special characters are ignored. Notice that the r goes outside the
quotation marks – it is not part of the string itself. We can see from the
output that the above code prints out the string just as we've written it:
142 Chapter 7: Regular expressions

\t\n

without any tabs or new lines. You'll see this special raw notation used in
all the regular expression code examples in this chapter.

Searching for a pattern in a string


We'll start off with the simplest regular expression tool. [Link] is a
true/false function that determines whether or not a pattern appears
somewhere in a string. It takes two arguments, both strings. The first
argument is the pattern that you want to search for, and the second
argument is the string that you want to search in. For example, here's
how we test if a DNA sequence contains an EcoRI restriction site:

dna = "ATCGCGAATTCAC"
if [Link](r"GAATTC", dna):
print("restriction site found!")

Notice that we've used the raw notation for the pattern, even though it's
not strictly necessary as it doesn't contain any special characters.

Alternation
The above example isn't particularly interesting, as the restriction motif
has no variation. Let's try it with the AvaII motif, which cuts at two
different motifs: GGACC and GGTCC. We can use the techniques we
learned in the previous chapter to make a complex condition using or:

dna = "ATCGCGAATTCAC"
if [Link](r"GGACC", dna) or [Link](r"GGTCC", dna):
print("restriction site found!")

But a better way is to capture the variation in the AvaII site using a
regular expression:
143 Chapter 7: Regular expressions

dna = "ATCGCGAATTCAC"
if [Link](r"GG(A|T)CC", dna):
print("restriction site found!")

Here we're using the alternation feature of regular expressions. Inside


parentheses, we write the alternatives separated by a pipe character, so
(A|T) means either A or T. This lets us write a single pattern – GG(A|T)CC
– which captures the variation in the motif.

Character groups
The BisI restriction enzyme cuts at an even wider range of motifs – the
pattern is GCNGC, where N represents any base. We can use the same
alternation technique to search for this pattern:

dna = "ATCGCGAATTCAC"
if [Link](r"GC(A|T|G|C)GC", dna):
print("restriction site found!")

However, there's another regular expression feature that lets us write the
pattern more concisely. A pair of square brackets with a list of characters
inside them can represent any one of these characters. So the pattern
GC[ATGC]GC will match GCAGC, GCTGC, GCGGC and GCCGC. Here's the same
program using character groups:

dna = "ATCGCGAATTCAC"
if [Link](r"GC[ATGC]GC", dna):
print("restriction site found!")

If we want a character in a pattern to match any character in the input,


we can use a period – the pattern [Link] would match all four
possibilities. However, the period would also match any character which
is not a DNA base, or even a letter. Therefore, the whole pattern would
also match GCFGC, GC&GC and GC9GC, which may not be what we want.
144 Chapter 7: Regular expressions

Sometimes it's easier, rather than listing all the acceptable characters, to
specify the characters that we don't want to match. Putting a caret ^ at
the start of a character group like this [^XYZ] will negate it, and match
any character that isn't in the group.

Quantifiers
The regular expression features discussed above let us describe variation
in the individual characters of patterns. Another group of features,
quantifiers, let us describe variation in the number of times a section of a
pattern is repeated.
A question mark immediately following a character means that that
character is optional – it can match either zero or one times. So in the
pattern GAT?C the T is optional, and the pattern will match either GATC or
GAC. If we want to apply a question mark to more than one character, we
can group the characters in parentheses. For example, in the pattern
GGG(AAA)?TTT the group of three As is optional, so the pattern will match
either GGGAAATTT or GGGTTT.
A plus sign immediately following a character or group means that the
character or group must be present but can be repeated any number of
times – in other words, it will match one or more times. For example,
the pattern GGGA+TTT will match three Gs, followed by one or more As,
followed by three Ts. So it will match GGGATTT, GGGAATT, GGGAAATT, etc.
but not GGGTTT.
An asterisk immediately following a character or group means that the
character or group is optional, but can also be repeated. In other words,
it will match zero or more times. For example, the pattern GGGA*TTT
will match three Gs, followed by zero or more As, followed by three Ts. So
it will match GGGTTT, GGGATTT, GGGAATTT, etc.
If we want to specify a specific number of repeats, we can use curly
brackets. Following a character or group with a single number inside
curly brackets will match exactly that number of repeats. For example,
the pattern GA{5}T will match GAAAAAT but not GAAAAT or GAAAAAAT.
145 Chapter 7: Regular expressions

Following a character or group with a pair of numbers inside curly


brackets separated with a comma allows us to specify an acceptable
range of number of repeats. For example, the pattern GA{2,4}T will
match GAAT, GAAAT and GAAAAT but not GAT or GAAAAAT.

Positions
The final set of regular expression tools we're going to look at don't
represent characters at all, but rather positions in the input string. The
caret symbol ^ matches the start of a string, and the dollar symbol $
matches the end of a string. The pattern ^AAA will match AAATTT but not
GGGAAATTT. The pattern GGG$ will match AAAGGG but not AAAGGGCCC.

Combining
The real power of regular expressions comes from combining these tools.
We can use quantifiers together with alternations and character groups
to specify very flexible patterns. For example, here's a complex pattern
to identify full-length eukaryotic messenger RNA sequences:

^ATG[ATGC]{30,1000}A{5,10}$

Reading the pattern from left to right, it will match:


• an ATG start codon at the beginning of the sequence
• followed by between 30 and 1000 bases which can be A, T, G or C
• followed by a poly-A tail of between 5 and 10 bases at the end of
the sequence
As you can see, regular expressions can be quite tricky to read until
you're familiar with them! However, it's well worth investing a bit of time
learning to use them, as the same notation is used across multiple
different tools. The regular expression skills that you learn in Python are
transferable to other programming languages, command line tools, and
text editors.
146 Chapter 7: Regular expressions

The features we've discussed above are the ones most useful in biology,
and are sufficient to tackle all the exercises at the end of the chapter.
However, there are many more regular expression features available in
Python. If you want to become a regular expression master, it's worth
reading up on greedy vs. minimal quantifiers, back-references,
lookahead and lookbehind assertions, and built-in character classes.
Before we move on to look at some more sophisticated uses of regular
expressions, it's worth noting that there's a method similar to [Link]
called [Link]. The difference is that [Link] will identify a pattern
occurring anywhere in the string, whereas [Link] will only identify a
pattern if it matches the entire string. Most of the time we want the
former behaviour.

Extracting the part of the string that matched


In the section above we used [Link] as the condition in an if
statement to decide whether or not a string contained a pattern. Often in
our programs, we want to find out not only if a pattern matched, but
what part of the string was matched. To do this, we need to store the
result of using [Link], then use the group method on the resulting
object.
When introducing the [Link] function above I wrote that it was a
true/false function. That's not exactly correct though – if it finds a match,
it doesn't return True, but rather an object that is evaluated as true in a
conditional context1 (if the distinction doesn't seem important to you,
then you can safely ignore it). The value that's actually returned is a
match object – a new data type that we've not encountered before. Like
a file object (see chapter 3), a match object doesn't represent a simple
thing, like a number or string. Instead, it represents the results of a
regular expression search. And again, just like a file object, a match
object has a number of useful methods for getting data out of it.

1 If a match isn't found, then the same thing applies; the function doesn't return False, but a
different built-in value – None – that evaluates as false. If this doesn't make sense, don't worry.
147 Chapter 7: Regular expressions

One such method is the group method. If we call this method on the
result of a regular expression search, we get the portion of the input
string that matched the pattern:

dna = "ATGACGTACGTACGACTG"

# store the match object in the variable m


m = [Link](r"GA[ATGC]{3}AC", dna)
print([Link]())

In the above code, we're searching inside a DNA sequence for GA,
followed by three bases, followed by AC. By calling the group method on
the resulting match object, we can see the part of the DNA sequence that
matched, and figure out what the middle three bases were:

GACGTAC

What if we want to extract more than one bit of the pattern? Say we want
to match this pattern:

GA[ATGC]{3}AC[ATGC]{2}AC

That's GA, followed by three bases, followed by AC, followed by two


bases, followed by AC again. We can surround the bits of the pattern that
we want to extract with parentheses – this is called capturing it:

GA([ATGC]{3})AC([ATGC]{2})AC

We can now refer to the captured bits of the pattern by supplying an


argument to the group method. group(1) will return the bit of the string
matched by the section of the pattern in the first set of parentheses,
group(2) will return the bit matched by the second, etc.:
148 Chapter 7: Regular expressions

dna = "ATGACGTACGTACGACTG"

# store the match object in the variable m


m = [Link](r"GA([ATGC]{3})AC([ATGC]{2})AC", dna)
print("entire match: " + [Link]())
print("first bit: " + [Link](1))
print("second bit: " + [Link](2))

The output shows that the three bases in the first variable section were
CGT, and the two bases in the second variable section were GT:

entire match: GACGTACGTAC


first bit: CGT
second bit: GT

Getting the position of a match


As well as containing information about the contents of a match, the
match object also holds information about the position of the match.
The start and end methods get the positions of the start and end of the
pattern on the sequence:

dna = "ATGACGTACGTACGACTG"
m = [Link](r"GA([ATGC]{3})AC([ATGC]{2})AC", dna)
print("start: " + str([Link]()))
print("end: " + str([Link]()))

Remember that we start counting from zero, so in this case, the match
starting at the third base has a start position of two:

start: 2
end: 13

We can get the start and end positions of individual groups by supplying
a number as the argument to start and end:
149 Chapter 7: Regular expressions

dna = "ATGACGTACGTACGACTG"
m = [Link](r"GA([ATGC]{3})AC([ATGC]{2})AC", dna)
print("start: " + str([Link]()))
print("end: " + str([Link]()))
print("group one start: " + str([Link](1)))
print("group one end: " + str([Link](1)))
print("group two start: " + str([Link](2)))
print("group two end: " + str([Link](2)))

In this particular case, we could figure out the start and end positions of
the individual groups from the start and end positions of the whole
pattern:

start: 2
end: 13
group one start: 4
group one end: 7
group two start: 9
group two end: 11

but that might not always be possible for patterns that have variable
length repeats.

Splitting a string using a regular expression


Occasionally it can be useful to split a string using a regular expression
pattern as the delimiter. The normal string split method doesn't allow
this, but the re module has a split function of its own that takes a
regular expression pattern as an argument. The first argument is the
pattern, the second argument is the string to be split.
Imagine we have a consensus DNA sequence that contains ambiguity
codes, and we want to extract all runs of contiguous unambiguous bases.
We need to split the DNA string wherever we see a base that isn't A, T, G
or C:
150 Chapter 7: Regular expressions

dna = "ACTNGCATRGCTACGTYACGATSCGAWTCG"
runs = [Link](r"[^ATGC]", dna)
print(runs)

Recall that putting a caret ^ at the start of a character group negates it.
The output shows how the function works – the return value is a list of
strings:

['ACT', 'GCAT', 'GCTACGT', 'ACGAT', 'CGA', 'TCG']

Finding multiple matches


The examples we've seen so far deal with cases where we're only
interested in a single occurrence of a pattern in a string. If instead we
want to find every place where a pattern occurs in a string, there are two
functions in the re module to help us.
[Link] returns a list of all matches of a pattern in a string. The first
argument is the pattern, and the second argument is the string. Say we
want to find all runs of A and T in a DNA sequence longer than five bases:

dna = "ACTGCATTATATCGTACGAAATTATACGCGCG"
runs = [Link](r"[AT]{4,100}", dna)
print(runs)

Notice that the return value of the findall method is not a match object
– it is a straightforward list of strings:

['ATTATAT', 'AAATTATA']

so we have no way to extract the positions. If we want to do anything


more complicated than simply extracting the text of the matches, we
need to use the [Link] method. finditer returns a sequence of
match objects, so to do anything useful with it, we need to use the return
value in a loop:
151 Chapter 7: Regular expressions

dna = "ACTGCATTATATCGTACGAAATTATACGCGCG"
runs = [Link](r"[AT]{3,100}", dna)
for match in runs:
run_start = [Link]()
run_end = [Link]()
print("AT rich region from " + str(run_start) + " to " + str(run_end))

As we can see from the output:

AT rich region from 5 to 12


AT rich region from 18 to 26

finditer gives us considerably more flexibility that findall.

Recap
Just as in the previous chapter, we learned about two distinct concepts
(conditions, and the statements that use them) in this chapter we
learned about regular expressions, and the functions that use them.
We started with a brief introduction to two concepts that, while not part
of the regular expression tools, are necessary in order to use them –
libraries and raw strings. We got a far-from-complete overview of
features that can be used in regular expression patterns, and a quick look
at the range of different things we can do with them. Just as regular
expressions themselves can range from simple to complex, so can their
uses. We can use regular expressions for simple tasks like determining
whether or not a sequence contains a particular motif, or for complicated
ones like identifying messenger RNA sequences by using complex
patterns.
Before we move on to the exercises, it's important to recognize that for
any given pattern, there are probably multiple ways to describe it using a
regular expression. Near the start of the chapter, we came up with the
pattern GG(A|T)CC to describe the AvaII restriction enzyme recognition
site, but it could also be written as
152 Chapter 7: Regular expressions

• GG[AT]CC,
• (GGACC|GGTCC)
• (GGA|GGT)CC
• G{2}[AT]C{2}
As with other situations where there are multiple different ways to write
the same thing, it's best to be guided by what is clearest to read.
153 Chapter 7: Regular expressions

Exercises

Accession names
Here's a list of made-up gene accession names:
xkn59438, yhdck2, eihd39d9, chdsye847, hedle3455, xjhd53e, 45da,
de37dp
Write a program that will print only the accession names that satisfy the
following criteria – treat each criterion separately:
• contain the number 5
• contain the letter d or e
• contain the letters d and e in that order
• contain the letters d and e in that order with a single letter
between them
• contain both the letters d and e in any order
• start with x or y
• start with x or y and end with e
• contain three or more numbers in a row
• end with d followed by either a, r or p

Double digest
In the chapter_7 file inside the exercises download, there's a file called
[Link] which contains a made-up DNA sequence. Predict the fragment
lengths that we will get if we digest the sequence with two made-up
restriction enzymes – AbcI, whose recognition site is ANT*AAT, and AbcII,
whose recognition site is GCRW*TG (asterisks indicate the position of the
cut site).
154 Chapter 7: Regular expressions

Solutions

Accession names
Obviously, the bulk of the work here is going to be coming up with the
regular expression patterns to select each subset of the accession
names. Here's the easy bit – storing the accession names in a list and
then processing them in a loop (the first line wraps round because it's too
long to fit on the page):

accs = ["xkn59438", "yhdck2", "eihd39d9", "chdsye847", "hedle3455",


"xjhd53e", "45da", "de37dp"]
for acc in accs:
# print if it passes the test

Now we can tackle the different criteria one by one. For each example,
the code (bordered by solid lines) is followed immediately by the output
(bordered by dotted lines).
The first criterion is straightforward – accessions that contain the
number 5. We don't even have to use any fancy regular expression
features:

for acc in accs:


if [Link](r"5", acc):
print("\t" + acc)

xkn59438
hedle3455
xjhd53e
45da

Now for accessions that contain the letters d or e. We can use either
alternation or a character group. Here's a solution using alternation:
155 Chapter 7: Regular expressions

for acc in accs:


if [Link](r"(d|e)", acc):
print("\t" + acc)

yhdck2
eihd39d9
chdsye847
hedle3455
xjhd53e
45da
de37dp

The next one – accessions that contain both the letters d and e, in that
order – is a bit more tricky. We can't just use a simple alternation or a
character group, because they match any of their constituent parts, and
we need both d and e. One way to think of the pattern is d, followed by
some other letters and numbers, followed by e. We have to be careful
with our quantifiers, however – at first glance the pattern
d.+e looks good, but it will fail to match the accession where e follows d
directly. To allow for the fact that d might be immediately followed by e,
we need to use the asterisk:

for acc in accs:


if [Link](r"d.*e", acc):
print("\t" + acc)

chdsye847
hedle3455
xjhd53e
de37dp

The next requirement – d, followed by a single letter, followed by e – is


actually easier to write a pattern for, even though it sounds more
complicated. We simply remove the asterisk, and the period will now
match any single character:
156 Chapter 7: Regular expressions

for acc in accs:


if [Link](r"(d.e)", acc):
print("\t" + acc)

hedle3455

The next requirement – d and e in any order – is more difficult. We could


do it with an alternation using the pattern (d.*e|e.*d), which translates
as d then e, or e then d. In this case, I think it's clearer to carry out two
separate regular expression searches and combine them into a complex
condition:

for acc in accs:


if [Link](r"d.*e", acc) or [Link](r"e.*d", acc):
print("\t" + acc)

hedle3455
de37dp

To find accessions that start with either x or y, we need to combine an


alternation with a start-of-string anchor:

for acc in accs:


if [Link](r"^(x|y)", acc):
print("\t" + acc)

xkn59438
yhdck2
xjhd53e

We can modify this quite easily to add the requirement that the
accession ends with e. As before, we need to use .* in the middle to
match any number of any character, resulting in quite a complex pattern:
157 Chapter 7: Regular expressions

for acc in accs:


if [Link](r"^(x|y).*e$", acc):
print("\t" + acc)

xjhd53e

To match three or more numbers in a row, we need a more specific


quantifier – the curly brackets – and a character group which contains all
the numbers:

for acc in accs:


if [Link](r"[0123456789]{3,100}", acc):
print("\t" + acc)

xkn59438
chdsye847
hedle3455

We can actually make this a bit more concise. The character group of all
digits is such a common one that there's a built-in shorthand for it: \d.
We can also take advantage of a shorthand in the curly bracket quantifier
– if we leave off the upper bound, then it matches with no upper limit.
The more concise version:

for acc in accs:


if [Link](r"\d{3,}", acc):
print("\t" + acc)

xkn59438
chdsye847
hedle3455
158 Chapter 7: Regular expressions

The final requirement is quite simple and only requires a character group
and an end-of-string anchor to solve:

for acc in accs:


if [Link](r"d[arp]$", acc):
print("\t" + acc)

45da
de37dp

Double digest
This is a hard problem, and there are several ways to approach it. Let's
simplify it by first figuring out what the fragment lengths would be if we
digested the sequence with just a single restriction enzyme1. We'll open
and read the file all in one go (there's no need to process it line-by-line as
it's just a single sequence), then we'll use [Link] to figure out the
positions of all the cut sites.
The patterns themselves are relatively simple: N means any base, so the
pattern for the AbcI site is A[ATGC]TAAT. The ambiguity code R means A
or G and the code W means A or T, so the pattern for AbcII is GC[AG]
[AT]TG. Here's the code to calculate the start positions of the matches
for AbcI:

import re
dna = open("[Link]").read().rstrip("\n")
print("AbcI cuts at:")
for match in [Link](r"A[ATGC]TAAT", dna):
print([Link]())

The output from this looks good:

1 For the purposes of this exercise, we are of course ignoring all the interesting chemical
kinetics of restriction enzymes and assuming that all enzymes cut with complete specificity
and efficiency.
159 Chapter 7: Regular expressions

AbcI cuts at:


1140
1625

but it's not quite right – it's telling us the positions of the start of each
match, but the enzyme actually cuts 3 base pairs upstream of the start.
To get the position of the cut site, we need to add three to the start of
each match:

import re
dna = open("[Link]").read().rstrip("\n")
print("AbcI cuts at:")
for match in [Link](r"A[ATGC]TAAT", dna):
print([Link]() + 3)

AbcI cuts at:


1143
1628

Now we've got the cut positions, how are we going to work out the
fragment sizes? One way is to go through each cut site in order and
measure the distance between it and the previous one – that will give us
the length of a single fragment. To make this work we'll have to add
"imaginary" cut sites at the very start and end of the sequence:

1 import re
2 dna = open("[Link]").read().rstrip("\n")
3 all_cuts = [0]
4 for match in [Link](r"A[ATGC]TAAT", dna):
5 all_cuts.append([Link]() + 3)
6 all_cuts.append(len(dna))
7 print(all_cuts)

Let's take a moment to examine what's going on in this program. We


start by creating a new list variable called all_cuts to hold the cut
positions (line 3). At this point, the all_cuts variable only has one
160 Chapter 7: Regular expressions

element: zero, the position of the start of the sequence. Next, for each
match to the pattern (line 4), we take the start position, add three to it to
get the cut position, and append that number to the all_cuts list (line
5). Finally, we append the position of the last character in the DNA string
to the all_cuts list (line 6). When we print the all_cuts list, we can see
that it contains the position of the start and end of the string, and the
internal positions of the cut sites:

[0, 1143, 1628, 2012]

Now we can write a second loop to go through the all_cuts list and, for
each cut position, work out the size of the fragment that will be created
by figuring out the distance to the previous cut site (i.e. the previous
element in the list). To make this work, however, we can't just use a
normal loop – we have to start at the second element of the list (because
the first element has no previous element) and we have to work with the
index of each element, rather than the element itself. We'll use the range
function to generate the list of indexes that we want to process – we
need to go from index 1 (i.e. the second element of the list) to the last
index (which is the length of the list):

1 for i in range(1,len(all_cuts)):
2 this_cut_position = all_cuts[i]
3 previous_cut_position = all_cuts[i-1]
4 fragment_size = this_cut_position - previous_cut_position
5 print("one fragment size is " + str(fragment_size))

The loop variable i is used to store each value that is generated by the
range function (line 1). For each value of i we get the cut position at that
index (line 2) and the cut position at the previous index (line 3) and then
figure out the distance between them (line 4). The output shows how, for
two cuts, we get three fragments:
161 Chapter 7: Regular expressions

one fragment size is 1143


one fragment size is 485
one fragment size is 384

Now for the final part of the solution: how do we do the same thing for
two different enzymes? We can add in the second enzyme pattern with
the appropriate cut site offset and append the cut positions to the
all_cuts variable:

import re
dna = open("[Link]").read().rstrip("\n")
all_cuts = [0]

# add cut positions for AbcI


for match in [Link](r"A[ATGC]TAAT", dna):
all_cuts.append([Link]() + 3)

# add cut positions for AbcII


for match in [Link](r"GC[AG][AT]TG", dna):
all_cuts.append([Link]() + 4)

# add the final position


all_cuts.append(len(dna))
print(all_cuts)

but look what happens when we print the elements of all_cuts:

[0, 1143, 1628, 488, 1577, 2012]

We get zero, then the two cut positions for the first enzyme in ascending
order, then the two cut positions for the second enzyme in ascending
order, then the position of the end of the sequence. The method for
turning a list of cut positions into fragment sizes that we developed
above isn't going to work with this list, because it relies on the list of
positions being in ascending order. If we try it with the list of cut positions
produced by the above code, we'll end up with obviously incorrect
fragment sizes:
162 Chapter 7: Regular expressions

one fragment size is 1143


one fragment size is 485
one fragment size is -1140
one fragment size is 1089
one fragment size is 434

Happily, Python's built-in sort function can come to the rescue. All we
need to do is sort the list of cut positions before processing it, and we get
the right answers. Here's the complete, final code:

import re
dna = open("[Link]").read().rstrip("\n")
print(str(len(dna)))
all_cuts = [0]

# add cut positions for AbcI


for match in [Link](r"A[ATGC]TAAT", dna):
all_cuts.append([Link]() + 3)

# add cut positions for AbcII


for match in [Link](r"GC[AG][AT]TG", dna):
all_cuts.append([Link]() + 4)

# add the final position


all_cuts.append(len(dna))
sorted_cuts = sorted(all_cuts)
print(sorted_cuts)

for i in range(1,len(sorted_cuts)):
this_cut_position = sorted_cuts[i]
previous_cut_position = sorted_cuts[i-1]
fragment_size = this_cut_position - previous_cut_position
print("one fragment size is " + str(fragment_size))
163 Chapter 8: Dictionaries

8: Dictionaries

Storing paired data


Suppose we want to count the number of As in a DNA sequence. Carrying
out the calculation is quite straightforward – in fact it's one of the first
things we did in chapter 2:

dna = "ATCGATCGATCGTACGCTGA"
a_count = [Link]("A")

How will our code change if we want to generate a complete list of base
counts for the sequence? We'll add a new variable for each base:

dna = "ATCGATCGATCGTACGCTGA"
a_count = [Link]("A")
t_count = [Link]("T")
g_count = [Link]("G")
c_count = [Link]("C")

and now our code is starting to look rather repetitive. It's not too bad for
the four individual bases, but what if we want to generate counts for the
16 dinucleotides:

dna = "ATCGATCGATCGTACGCTGA"
aa_count = [Link]("AA")
at_count = [Link]("AT")
ag_count = [Link]("AG")
...etc. etc.

or the 64 trinucleotides:
164 Chapter 8: Dictionaries

dna = "ATCGATCGATCGTACGCTGA"
aaa_count = [Link]("AAA")
aat_count = [Link]("AAT")
aag_count = [Link]("AAG")
...etc. etc.

For trinucleotides and longer, the situation is particularly bad. The DNA
sequence is 20 bases long, so it only contains 18 overlapping
trinucleotides in total. This means that we'll end up with 64 different
variables, at least 46 of which will hold the value zero.
One possible way round this is to store the values in a list. If we use three
nested loops, we can generate all possible trinucleotides, calculate the
count for each one, and store all the counts in a list:

dna = "AATGATCGATCGTACGCTGA"
all_counts = []
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
print("count is " + str(count) + " for " + trinucleotide)
all_counts.append(count)
print(all_counts)
165 Chapter 8: Dictionaries

Although the code is above is quite compact, and doesn't require huge
numbers of variables, the output shows two problems with this approach:

count is 0 for AAA


count is 1 for AAT
count is 0 for AAG
count is 0 for AAC
count is 0 for ATA
count is 0 for ATT
count is 1 for ATG
count is 2 for ATC
… many lines removed …
[0, 1, 0, 0, 0, 0, 1, 2, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0,
2, 0, 0, 0, 0, 0, 2, 0, 0, 2, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0,
0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0]

Firstly, the data are still incredibly sparse – the vast majority of the
counts are zero. Secondly, the counts themselves are now disconnected
from the trinucleotides. If we want to look up the count for a single
trinucleotide – for example, TGA – we first have to figure out that TGA
was the 25th trinucleotide generated by our loops. Only then can we get
the element at the correct index:

print("count for TGA is " + str(all_counts[24]))


166 Chapter 8: Dictionaries

We can try various tricks to get round this problem. What if we generated
two lists – one of counts, and one of the trinucleotides themselves?

dna = "AATGATCGATCGTACGCTGA"
all_trinucleotides = []
all_counts = []
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
all_trinucleotides.append(trinucleotide)
all_counts.append(count)
print(all_counts)
print(all_trinucleotides)

Now we have two lists of the same length, with a one-to-one


correspondence between the elements:

[0, 1, 0, 0, 0, 0, 1, 2, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0,
2, 0, 0, 0, 0, 0, 2, 0, 0, 2, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0,
0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0]

['AAA', 'AAT', 'AAG', 'AAC', 'ATA', 'ATT', 'ATG', 'ATC', 'AGA', 'AGT',
'AGG', 'AGC', 'ACA', 'ACT', 'ACG', 'ACC', 'TAA', 'TAT', 'TAG', 'TAC',
'TTA', 'TTT', 'TTG', 'TTC', 'TGA', 'TGT', 'TGG', 'TGC', 'TCA', 'TCT',
'TCG', 'TCC', 'GAA', 'GAT', 'GAG', 'GAC', 'GTA', 'GTT', 'GTG', 'GTC',
'GGA', 'GGT', 'GGG', 'GGC', 'GCA', 'GCT', 'GCG', 'GCC', 'CAA', 'CAT',
'CAG', 'CAC', 'CTA', 'CTT', 'CTG', 'CTC', 'CGA', 'CGT', 'CGG', 'CGC',
'CCA', 'CCT', 'CCG', 'CCC']

This allows us to look up the count for a given trinucleotide in a slightly


more appealing way – we can look up the index of the trinucleotide in the
all_trinucleotides list, then get the count at the same index in the
all_counts list:

i = all_trinucleotides.index('TGA')
c = all_counts[i]
print('count for TGA is ' + str(c))
167 Chapter 8: Dictionaries

This is a little bit nicer, but still has major drawbacks. We're still storing
all those zeros, and now we have two lists to keep track of. We need to
be incredibly careful when manipulating either of the two lists to make
sure that they stay perfectly synchronized – if we make any change to
one list but not the other, then there will no longer be a one-to-one
correspondence between elements and we'll get the wrong answer when
we try to look up a count.
This approach is also slow1. To find the index of a given trinucleotide in
the all_trinucleotides list, Python has to look at each element one at
a time until it finds the one we're looking for. This means that as the size
of the list grows2, the time taken to look up the count for a given element
will grow alongside it.
If we take a step back and think about the problem in more general
terms, what we need is a way of storing pairs of data (in this case,
trinucleotides and their counts) in a way that allows us to efficiently look
up the count for any given trinucleotide. This problem of storing paired
data is incredibly common in programming. We might want to store:
• protein sequence names and their sequences
• DNA restriction enzyme names and their motifs
• codons and their associated amino acid residues
• colleagues' names and their email addresses
• sample names and their co-ordinates
• words and their definitions

1 As a rule, we've avoided talking about performance in this book, but we'll break the rule in
this case.
2 For instance, imagine carrying out the same exercise with the approximately one million
unique 10-mers.
168 Chapter 8: Dictionaries

All these are examples of what we call key-value pairs. In each case we
have pairs of keys and values:
Key Value
trinucleotide count
name protein sequence
name restriction enzyme motif
codon amino acid residue
name email address
sample coordinates
word definition
The last example in this table – words and their definitions – is an
interesting one because we have a tool in the physical world for storing
this type of data – a dictionary. Python's tool for solving this type of
problem is also called a dictionary (usually abbreviated to dict) and in
this chapter we'll see how to create and use them.

Creating a dictionary
The syntax for creating a dictionary is similar to that for creating a list,
but we use curly brackets rather than square ones. Each pair of data,
consisting of a key and a value, is called an item. When storing items in a
dictionary, we separate them with commas. Within an individual item, we
separate the key and the value with a colon. Here's a bit of code that
creates a dictionary of restriction enzymes (using data from the previous
chapter) with three items:

enzymes = { 'EcoRI':r'GAATTC', 'AvaII':r'GG(A|T)CC',


'BisI':'GC[ATGC]GC' }

In this case, the keys and values are both strings1. Splitting the dictionary
definition over several lines makes it easier to read:

1 The values are actually raw strings, but that's not important.
169 Chapter 8: Dictionaries

enzymes = {
'EcoRI' : r'GAATTC',
'AvaII' : r'GG(A|T)CC',
'BisI' : r'GC[ATGC]GC'
}

but doesn't affect the code at all. To retrieve a bit of data from the
dictionary – i.e. to look up the motif for a particular enzyme – we write
the name of the dictionary, followed by the key in square brackets:

print(enzymes['BisI'])

The code looks very similar to using a list, but instead of giving the index
of the element we want, we're giving the key for the value that we want
to retrieve.
Dictionaries are a very useful way to store data, but they come with
some restrictions. The only types of data we are allowed to use as keys
are strings and numbers1, so we can't, for example, create a dictionary
where the keys are file objects. Values can be whatever type of data we
like. Also, keys must be unique – we can't store multiple values for the
same key. You might think that this makes dicts less useful, but there are
ways round the problem of storing multiple values – we won't need them
for the examples in this chapter, but the chapter on complex data
structures in Advanced Python for Biologists gives details.
In real-life programs, it's relatively rare that we'll want to create a
dictionary all in one go like in the example above. More often, we'll want
to create an empty dictionary, then add key/value pairs to it (just as we
often create an empty list and then add elements to it).
To create an empty dictionary we simply write a pair of curly brackets on
their own, and to add elements, we use the square-brackets notation on
the left-hand side of an assignment. Here's a bit of code that stores the
restriction enzyme data one item at a time:

1 Not strictly true; we can use any immutable type, but that is beyond the scope of this book.
170 Chapter 8: Dictionaries

enzymes = {}
enzymes['EcoRI'] = r'GAATTC'
enzymes['AvaII] = r'GG(A|T)CC'
enzymes['BisI'] = r'GC[ATGC]GC'

We can delete a key from a dictionary using the pop method. pop actually
returns the value and deletes the key at the same time:

enzymes = {
'EcoRI' : r'GAATTC',
'AvaII' : r'GG(A|T)CC',
'BisI' : r'GC[ATGC]GC'
}
# remove the EcoRI enzyme from the dict
[Link]('EcoRI')

Let's take another look at the trinucleotide count example from the start
of the chapter. Here's how we store the trinucleotides and their counts in
a dictionary:

dna = "AATGATCGATCGTACGCTGA"
counts = {}
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
counts[trinucleotide] = count

print(counts)

We can see from the output that the trinucleotides and their counts are
stored together in one variable:
171 Chapter 8: Dictionaries

{'ACC': 0, 'ATG': 1, 'AAG': 0, 'AAA': 0, 'ATC': 2, 'AAC': 0, 'ATA': 0,


'AGG': 0, 'CCT': 0, 'CTC': 0, 'AGC': 0, 'ACA': 0, 'AGA': 0, 'CAT': 0,
'AAT': 1, 'ATT': 0, 'CTG': 1, 'CTA': 0, 'ACT': 0, 'CAC': 0, 'ACG': 1,
'CAA': 0, 'AGT': 0, 'CAG': 0, 'CCG': 0, 'CCC': 0, 'CTT': 0, 'TAT': 0,
'GGT': 0, 'TGT': 0, 'CGA': 1, 'CCA': 0, 'TCT': 0, 'GAT': 2, 'CGG': 0,
'TTT': 0, 'TGC': 0, 'GGG': 0, 'TAG': 0, 'GGA': 0, 'TAA': 0, 'GGC': 0,
'TAC': 1, 'TTC': 0, 'TCG': 2, 'TTA': 0, 'TTG': 0, 'TCC': 0, 'GAA': 0,
'TGG': 0, 'GCA': 0, 'GTA': 1, 'GCC': 0, 'GTC': 0, 'GCG': 0, 'GTG': 0,
'GAG': 0, 'GTT': 0, 'GCT': 1, 'TGA': 2, 'GAC': 0, 'CGT': 1, 'TCA': 0,
'CGC': 1}

We still have a lot of repetitive counts of zero, but looking up the count
for a particular trinucleotide is now very straightforward:

print(counts['TGA'])

We no longer have to worry about either "memorizing" the order of the


counts or maintaining two separate lists.
Let's now see if we can find a way of avoiding storing all those zero
counts. We can add an if statement that ensures that we only store a
count if it's greater than zero:

dna = "AATGATCGATCGTACGCTGA"
counts = {}
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
if count > 0:
counts[trinucleotide] = count

print(counts)

When we look at the output from the above code, we can see that the
amount of data we're storing is much smaller – just the counts for the
trinucleotides that are greater than zero:
172 Chapter 8: Dictionaries

{'ATG': 1, 'ACG': 1, 'ATC': 2, 'GTA': 1, 'CTG': 1, 'CGC': 1, 'GAT': 2,


'CGA': 1, 'AAT': 1, 'TGA': 2, 'GCT': 1, 'TAC': 1, 'TCG': 2, 'CGT': 1}

Now we have a new problem to deal with. Looking up the count for a
given trinucleotide works fine when the count is positive:

print(counts['TGA'])

But when the count is zero, the trinucleotide doesn't appear as a key in
the dictionary:

print(counts['AAA'])

so we will get a KeyError when we try to look it up:

KeyError: 'AAA'

There are two possible ways to fix this. We can check for the existence of
a key in a dictionary (just like we can check for the existence of an
element in a list), and only try to retrieve it once we know it exists:

if 'AAA' in counts:
print(counts('AAA'))

Alternatively, we can use the dictionary's get method. get usually works
just like using square brackets: the following two lines do exactly the
same thing:

print(counts['TGA'])
print([Link]('TGA'))

The thing that makes get really useful, however, is that it can take an
optional second argument, which is the default value to be returned if the
key isn't present in the dictionary. In this case, we know that if a given
173 Chapter 8: Dictionaries

trinucleotide doesn't appear in the dictionary then its count is zero, so we


can give zero as the default value and use get to print out the count for
any trinucleotide:

print("count for TGA is " + str([Link]('TGA', 0)))


print("count for AAA is " + str([Link]('AAA', 0)))
print("count for GTA is " + str([Link]('GTA', 0)))
print("count for TTT is " + str([Link]('TTT', 0)))

As we can see from the output, we now don't have to worry about
whether or not each trinucleotide appears in the dictionary – get takes
care of everything and returns zero when appropriate:

count for TGA is 2


count for AAA is 0
count for GTA is 1
count for TTT is 0

Iterating over a dictionary


What if, instead of looking up a single item from a dictionary, we want to
do something for all items? For example, imagine that we wanted to take
our counts dictionary variable from the code above and print out all
trinucleotides where the count was 2. One way to do it would be to use
our three nested loops again to generate all possible trinucleotides, then
look up the count for each one and decide whether or not to print it:

for base1 in ['A', 'T', 'G', 'C']:


for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
if [Link](trinucleotide, 0) == 2:
print(trinucleotide)
174 Chapter 8: Dictionaries

As we can see from the output, this works perfectly well:

ATC
TGA
TCG
GAT

But it seems inefficient to go through the whole process of generating all


possible trinucleotides again, when the information we want – the list of
trinucleotides – is already in the dictionary. A better approach would be to
read the list of keys directly from the dictionary, which is what the keys
method does.

Iterating over keys


When used on a dictionary, the keys method returns a list of all the keys
in the dictionary:

print([Link]())

Looking at the output1 confirms that this is the list of trinucleotides we


want to consider (remember that we're looking for trinucleotides with a
count of two, so we don't need to consider ones that aren't in the
dictionary as we already know that they have a count of zero):

['ATG', 'ACG', 'ATC', 'GTA', 'CTG', 'CGC', 'GAT', 'CGA', 'AAT', 'TGA',
'GCT', 'TAC', 'TCG', 'CGT']

Using keys, our code for printing out all the trinucleotides that appear
twice in the DNA sequence becomes a lot more concise:

1 If you're using Python 3 you might see slightly different output here, but all the code
examples will work just the same
175 Chapter 8: Dictionaries

for trinucleotide in [Link]():


if [Link](trinucleotide) == 2:
print(trinucleotide)

This version prints exactly the same set of trinucleotides as the more
verbose method:

ATC
GAT
TGA
TCG

Before we move on, take a moment to compare the output immediately


above this paragraph with the output from the three-loop version from
earlier in this section. You'll notice that while the set of trinucleotides
is the same, the order in which they appear is different. This
illustrates an important point about dictionaries – they are inherently
unordered. That means that when we use the keys method to iterate
over a dictionary, we can't rely on processing the items in the same order
that we added them. This is in contrast to lists, which always maintain
the same order when looping. If we want to control the order in which
keys are printed we can use the sorted method to sort the list before
processing it:

for trinucleotide in sorted([Link]()):


if [Link](trinucleotide) == 2:
print(trinucleotide)

Iterating over items


In the example code above, the first thing we need to do inside the loop
is to look up the value for the current key. This is a very common pattern
when iterating over dictionaries – so common, in fact, that Python has a
special shorthand for it. Instead of doing this:
176 Chapter 8: Dictionaries

for key in my_dict.keys():


value = my_dict.get(key)
# do something with key and value

We can use the items method to iterate over pairs of data, rather than
just keys:

for key, value in my_dict.items():


# do something with key and value

The items method does something slightly different from all the other
methods we've seen so far in this book; rather than returning a single
value, or a list of values, it returns a list of pairs of values. That's
why we have to give two variable names at the start of the loop. Here's
how we can use the items method to process our dictionary of
trinucleotide counts just like before:

for trinucleotide, count in [Link]():


if count == 2:
print(trinucleotide)

This method is generally preferred for iterating over items in a dictionary,


as it makes the intention of the code very clear.

Recap
We started this chapter by examining the problem of storing paired data
in Python. After looking at a couple of unsatisfactory ways to do it using
tools that we've already learned about, we introduced a new type of data
structure – the dictionary – which offers a much nicer solution to the
problem of storing paired data.
Later in the chapter, we saw that the real benefit of using dictionaries is
the efficient lookup they provide. We saw how to create dictionaries and
manipulate the items in them, and several different ways to look up
177 Chapter 8: Dictionaries

values for known keys. We also saw how to iterate over all the items in
dictionary.
In the process, we uncovered a few restrictions on what dictionaries are
capable of – we're only allowed to use a couple of different data types for
keys, they must be unique, and we can't rely on their order. Just as a
physical dictionary allows us to rapidly look up the definition for a word
but not the other way round, Python dictionaries allow us to rapidly look
up the value associated with a key, but not the reverse.
Because of their ability to look up a given value very rapidly given a key,
dicts are extremely useful when storing complex data. Take a look at the
last few sections of the chapter on complex data structures in Advanced
Python for Biologists for a set of examples of this technique.
178 Chapter 8: Dictionaries

Exercises

DNA translation
Write a program that will translate a DNA sequence into protein. Your
program should use the standard genetic code which can be found at this
URL1.

1 [Link]
chapter=tgencodes#SG1
179 Chapter 8: Dictionaries

Solutions

DNA translation
The description of this exercise is very short, but it hides quite a bit of
complexity! To translate a DNA sequence we need to carry out a number
of different steps. First, we have to split up the sequence into codons.
Then, we need to go through each codon and translate it into the
corresponding amino acid residue. Finally, we need to create a protein
sequence by adding all the amino acid residues together.
We'll start off by figuring out how to split a DNA sequence into codons.
Because this exercise is quite tricky, we'll pick a very short test DNA
sequence to work on – just three codons:

dna = "ATGTTCGGT"

How are we going to split up the DNA sequence into groups of three
bases? It's tempting to try to use the split method, but remember that
the split method only works if the things you want to split are
separated by a delimiter. In our case, there's nothing separating the
codons, so split will not help us.
Something that might be able to help us is substring notation. We know
that this allows us to extract part of a string, so we can do something like
this:

dna = "ATGTTCGGT"
codon1 = dna[0:3]
codon2 = dna[3:6]
codon3 = dna[6:9]
print(codon1, codon2, codon3)

As we can see from the output, this works:


180 Chapter 8: Dictionaries

('ATG', 'TTC', 'GGT')

but it's not a great solution, as we have to fill in the numbers manually.
Since the numbers follow a very predictable pattern, it should be possible
to generate them automatically. The start position for each substring is
initially zero, then goes up by three for each successive codon. The stop
position is just the start position plus three.
Recall that the job of the range function is to generate sequences of
numbers. In order to generate the sequence of substring start positions,
we need to use the three-argument version of range, where the first
argument is the number to start at, the second argument is the number
to finish at, and the third argument is the step size. For our DNA
sequence above, the number to start at is zero, and the step size is
three. The number to finish at it not six but seven, because ranges are
exclusive at the finish. This bit of code shows how we can use the range
function to generate the list of start positions:

for start in range(0,7,3):


print(start)

0
3
6

To find the stop position for a given start position we just add three, so
we can easily split our DNA into codons using a loop:

dna = "ATGTTCGGT"
for start in range(0,7,3):
codon = dna[start:start+3]
print("one codon is" + codon)
181 Chapter 8: Dictionaries

one codon is ATG


one codon is TTC
one codon is GGT

This works fine for our test DNA sequence, but if we give it a shorter
sequence we will get incomplete and empty codons:

dna = "ATGTT"
for start in range(0,7,3):
codon = dna[start:start+3]
print(codon)

one codon is ATG


one codon is TT
one codon is

and if we give it a longer sequence, we will miss out the fourth and
subsequent codons:

dna = "ATGTTCGGTGAAGCGGGCTAGAT"
for start in range(0,7,3):
codon = dna[start:start+3]
print("one codon is " + codon)

one codon is ATG


one codon is TTC
one codon is GGT

Clearly we need to modify the second argument to range – the position


to finish the sequence of numbers – in order to take into account the
length of the DNA sequence. At this point, we have to confront the
problem of what to do if we're given a DNA sequence whose length is not
an exact multiple of three. Clearly, we cannot translate an incomplete
codon, so we want the start position of the final codon to equal to the
length of the DNA sequence minus two. This guarantees that there will
182 Chapter 8: Dictionaries

always be two more characters following the position of the final codon
start – i.e. enough for a complete codon.
Here's the modified code:

dna = "ATGTTCGGT"

# calculate the start position for the final codon


last_codon_start = len(dna) – 2

# process the dna sequence in three base chunks


for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
print("one codon is " + codon)

Now that we know how to split a DNA sequence up into codons, let's turn
our attention to the problem of translating those codons. If we pull up the
URL from the exercise description in a web browser, we can see the
standard codon translation table in various formats. Storing this
translation table seems like a perfect job for a dictionary: we have codons
(keys) and amino acid residues (values) and we want to be able to look
up the amino acid for a given codon.
183 Chapter 8: Dictionaries

Here's a bit of code – it's actually a single statement, spread out over
multiple lines – which creates a dictionary to hold the translation table:

gencode = {
'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M',
'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T',
'AAC':'N', 'AAT':'N', 'AAA':'K', 'AAG':'K',
'AGC':'S', 'AGT':'S', 'AGA':'R', 'AGG':'R',
'CTA':'L', 'CTC':'L', 'CTG':'L', 'CTT':'L',
'CCA':'P', 'CCC':'P', 'CCG':'P', 'CCT':'P',
'CAC':'H', 'CAT':'H', 'CAA':'Q', 'CAG':'Q',
'CGA':'R', 'CGC':'R', 'CGG':'R', 'CGT':'R',
'GTA':'V', 'GTC':'V', 'GTG':'V', 'GTT':'V',
'GCA':'A', 'GCC':'A', 'GCG':'A', 'GCT':'A',
'GAC':'D', 'GAT':'D', 'GAA':'E', 'GAG':'E',
'GGA':'G', 'GGC':'G', 'GGG':'G', 'GGT':'G',
'TCA':'S', 'TCC':'S', 'TCG':'S', 'TCT':'S',
'TTC':'F', 'TTT':'F', 'TTA':'L', 'TTG':'L',
'TAC':'Y', 'TAT':'Y', 'TAA':'_', 'TAG':'_',
'TGC':'C', 'TGT':'C', 'TGA':'_', 'TGG':'W'}

We can look up the amino acid for a given codon using either of the two
methods that we learned about:

print(gencode['CAT'])
print([Link]('GTC'))

H
V
184 Chapter 8: Dictionaries

If we look up the amino acid for each codon inside the loop of our original
code, we can print both the codon and the amino acid translation1:

dna = "ATGTTCGGT"
last_codon_start = len(dna) - 2
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link](codon)
print("one codon is " + codon)
print("the amino acid is " + aa)

one codon is ATG


the amino acid is M
one codon is TTC
the amino acid is F
one codon is GGT
the amino acid is G

This is starting to look promising. The final step is to actually do


something with the amino acid residues rather than just printing them. A
nice idea is to take our cue from the way that a ribosome behaves and
add each new amino acid residue onto the end of a protein to create a
gradually-growing string:

1 dna = "ATGTTCGGT"
2 last_codon_start = len(dna) - 2
3 protein = ""
4 for start in range(0,last_codon_start,3):
5 codon = dna[start:start+3]
6 aa = [Link](codon)
7 protein = protein + aa
8 print("protein sequence is " + protein)

In the above code, we create a new variable to hold the protein sequence
immediately before we start the loop (line 3), then add a single character

1 From now on, we won't include the statement which creates the dictionary in our code
samples as it takes up too much room, so if you want to try running these yourself you'll need
to add it back at the top.
185 Chapter 8: Dictionaries

onto the end of that variable each time round the loop (line 7). By the
time we exit the loop, we have built up the complete protein sequence
and we can print it out (line 8):

protein sequence is MFG

This looks like a very useful bit of code, so let's turn it into a function. Our
function will take one argument – the DNA sequence as a string – and will
return a string containing the protein sequence1:

def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link](codon)
protein = protein + aa
return protein

We can now test our function by printing out the protein translation for a
few more test sequences:

print(translate_dna("ATGTTCGGT"))
print(translate_dna("ATCGATCGATCGTTGCTTATCGATCAG"))
print(translate_dna("actgatcgtagctagctgacgtatcgtat"))
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))

The output from this code shows that we run into a problem with the
third sequence:

1 You'll notice that this function relies on the gencode variable which is defined outside the
function – something that I told you not to do in chapter 5. This is an exception to the rule:
defining the gencode variable inside the function means that it would have to be created
anew each time we wanted to translate a DNA sequence.
186 Chapter 8: Dictionaries

MFG
IDRSLLIDQ
Traceback (most recent call last):
File "dna_translation.py", line 30, in <module>
print(translate_dna("actgatcgtagctagctgacgtatcgtat"))
File "dna_translation.py", line 25, in translate_dna
protein = protein + aa
TypeError: cannot concatenate 'str' and 'NoneType' objects

The problem occurs when we try to look up the amino acid for the first
codon of the third sequence – "act". Because the third sequence is in
lower case but the translation table dictionary is in upper case, the key
isn't found, the get method returns None, and we get an error. Fixing it is
straightforward – we just need to convert the codon to upper case before
looking up the amino acid:

def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link]([Link]())
protein = protein + aa
return protein

Now the output shows that the first three sequences are fine, but that
our function has a problem translating the fourth sequence:

MFG
IDRSLLIDQ
TDRSLLTYR
Traceback (most recent call last):
File "dna_translation.py", line 31, in <module>
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))
File "dna_translation.py", line 25, in translate_dna
protein = protein + aa
TypeError: cannot concatenate 'str' and 'NoneType' objects
187 Chapter 8: Dictionaries

Glancing at the input sequences, it's not clear what the problem is. Let's
try printing the codons as they're translated in order to identify the one
that's causing the error:

def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
print("about to translate codon: " + codon)
aa = [Link]([Link]())
protein = protein + aa
return protein

print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))

The output shows where the problem lies:

about to translate codon: ACG


about to translate codon: ATC
about to translate codon: GAT
about to translate codon: CGT
about to translate codon: NAC
Traceback (most recent call last):
File "dna_translation.py", line 32, in <module>
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))
File "dna_translation.py", line 26, in translate_dna
protein = protein + aa
TypeError: cannot concatenate 'str' and 'NoneType' objects

There is an unknown base in the middle of the DNA sequence, which


causes our function to try to look up the amino acid for the codon NAC,
which causes an error because that codon isn't in the dictionary. How
should we fix this? We could add an if statement to the function which
only translates the DNA sequence if it doesn't contain any unambiguous
bases, but that seems a little too conservative – there are plenty of
situations in which we might want to generate a protein sequence for a
DNA sequence that has unknown bases. We could add an if statement
inside the loop which only translates a given codon if it doesn't contain
188 Chapter 8: Dictionaries

any unambiguous bases, but that would lead to protein translations of an


incorrect length – we know that the codon NAC will translate to an amino
acid, we just don't know which one it will be.
The most sensible solution seems to be to translate any codon with an
unknown base into the symbol for an unknown amino acid residue, which
is X. The optional second argument to the get function makes it very
easy to do just that:

def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link]([Link](), 'X')
protein = protein + aa
return protein

and now we can translate all four of our test sequences correctly:

print(translate_dna("ATGTTCGGT"))
print(translate_dna("ATCGATCGATCGTTGCTTATCGATCAG"))
print(translate_dna("actgatcgtagcttgcttacgtatcgtat"))
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))

MFG
IDRSLLIDQ
TDRSLLTYR
TIDRXVRSYS

At this point, it's a good idea to turn these test sequences into assert
statements – that way, we can easily re-test the function if we make
some changes to it in the future:
189 Chapter 8: Dictionaries

assert(translate_dna("ATGTTCGGT")) == "MFG"
assert(translate_dna("ATCGATCGATCGTTGCTTATCGATCAG")) == "IDRSLLIDQ"
assert(translate_dna("actgatcgtagcttgcttacgtatcgtat")) == "TDRSLLTYR"
assert(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG")) == "TIDRXVRSYS"
190 Chapter 9: Files, programs, and user input

9: Files, programs, and user input

File contents and manipulation


Reading from and writing to files was one of the first things we looked at
in this book, back in chapter 3. For some programs, however, we're not
just concerned with the contents of files, but with files and folders
themselves. This is especially likely to be the case for programs that
have to operate as part of a work flow involving other tools and software.
For example, we may need to copy, move, rename and delete files, or we
may need to process all files in a certain folder.
Although it seems like a simple task (after all, the file manager tools that
come with your operating system can carry most of them out), file
manipulation in a language like Python is actually quite tricky. That's
because the code that we write has to function identically on different
operating systems – including Windows, Linux and Mac machines – which
may handle files quite differently. A discussion of the differences between
operating systems is way beyond the scope of this book, but to give one
example, UNIX-based systems like Linux and OSX have the concept of file
permissions which is lacking in Windows.
Thankfully, Python includes a couple of modules1 that take care of these
differences for us and provide us with a set of useful functions for
manipulating files. The modules' names are os (short for Operating
System) and shutil (short for SHell UTILities). In the next section we'll
see how they can be used to carry out various common (but important)
tasks.

A note on the code examples


Since the code examples in this chapter unavoidably involve interaction
with the operating system, some of the details will be operating-system

1 Take a look back at chapter 7 for a reminder of how modules work.


191 Chapter 9: Files, programs, and user input

specific. In particular, many of the file manipulation functions take paths


as arguments, which differ considerably between operating systems. A
path is the short bit of text that tells you the location of a file in the file
system. On Linux and OSX machines, the path to a file or folder typically
looks like this:

/path/to/my/[Link]

whereas on Windows machines, they look like this:

c:\path\to\my\[Link]

Moreover, the success of the code examples for many functions relies on
the files and folders actually being present on the computer on which the
examples are run. The code examples in this chapter will use Linux-style
paths, and will refer to folders and files on my computer, so if you want
to try running them, you'll probably need to change the paths to refer to
files on your own computer.

Basic file manipulation


To rename an existing file, we simply import the os module, then use the
[Link] function. The [Link] function takes two arguments, both
strings. The first is the current name of the file, the second is the new
name:

import os
[Link]("[Link]", "[Link]")

The above code assumes that the file [Link] is in the folder where we are
running our Python program. If it's elsewhere in the filesystem, then we
have to give the complete path:

[Link]("/home/martin/biology/[Link]", "/home/martin/biolgy/[Link]")
192 Chapter 9: Files, programs, and user input

If we specify a different folder, but the same file name, in the second
argument, then the function will move the file from one folder to another:

[Link]("/home/martin/biology/[Link]", "/home/martin/python/[Link]")

Of course, we can move and rename a file in one step if you like:

[Link]("/home/martin/biology/[Link]", "/home/martin/python/[Link]")

[Link] works on folders as well as files:

[Link]("/home/martin/old_folder", "/home/martin/new_folder")

If we try to move a file to a folder that doesn't exist we'll get an error. We
need to create the new folder first with the [Link] function:

[Link]("/home/martin/python")

If we need to create a bunch of directories all in one go, we can use the
[Link] function (note the s on the end of the name):

[Link]("/a/long/path/with/lots/of/folders")

To copy a file or folder we use the shutil module. We can copy a single
file with [Link]:

[Link]("/home/martin/[Link]", "/home/martin/[Link]")

or a folder with [Link]:

[Link]("/home/martin/original_folder",
"/home/martin/copy_folder")

To test whether a file or folder exists, use [Link]:


193 Chapter 9: Files, programs, and user input

if [Link]("/home/martin/[Link]"):
print("You have mail!")

Deleting files and folders


There are different functions for deleting files, empty folders, and non-
empty folders. To delete a single file, use [Link]:

[Link]("/home/martin/unwanted_file.txt")

To delete an empty folder, use [Link]:

[Link]("/home/martin/emtpy")

To delete a folder and all the files in it, use [Link]

[Link]("home/martin/full")

Listing folder contents


The [Link] function returns a list of files and folders. It takes a
single argument which is a string containing the path of the folder whose
contents you want to search. To get a list of the contents of the current
working directory, use the string "." for the path:

for file_name in [Link]("."):


print("one file name is " + file_name)

To list the contents of a different folder, we just give the path as an


argument:

for file_name in [Link]("/home/martin"):


print("one file name is " + file_name)
194 Chapter 9: Files, programs, and user input

Running external programs


Another feature of Python that involves interaction with the operating
system is the ability to run external programs. Just like file and folder
manipulation, the ability to run other programs is very useful when using
Python as part of a work flow. It allows us to use existing tools that would
be very time-consuming to recreate in Python, or that would run very
slowly.
Running external programs from within your Python code can be a tricky
business, and this feature wouldn't normally be covered in an
introductory programming course. However, it's so useful for biology
(and science in general) that we're going to cover it here, albeit in a
simplified form.
As with the above section on file operations, the exact details of how
external programs are run will vary with your operating system and the
way your computer is set up. On UNIX-based systems, the program that
you want to run might already be in your path, in which case you can
simply use the name of the executable as the string to be executed. For
the example code below, I'll give the full path to executables on my
computer, which look something like this:

/home/martin/software/myprogram

If you're on Windows, your paths will probably look like this:

c:\windows\Program files\myprogram\[Link]

And on OSX, they will look like this:

/Applications/myprogram

As before, if you want to try running any of these examples, make sure
that you change the paths to point to real executables on your computer.
195 Chapter 9: Files, programs, and user input

Running a program
The functions for running external program reside in the subprocess
module. The reasoning behind the name is slightly convoluted: when
talking about operating systems, a running program is called a process,
and a program that is started by another program is called a subprocess.
To run an external program, use the [Link] function. This
function takes a single string argument containing the path to the
executable you want to run:

import subprocess
[Link]("/bin/date")

Any output that is produced by the external program is printed straight to


the screen – in this case, the output from the Linux date program:

Fri Jul 26 15:15:26 BST 2013

If we want to supply command-line options to the external program then


we just include them in the string, and set the optional shell argument
to True. Here we call the Linux date program with the options which
cause it to just print the month:

[Link]("/bin/date +%B", shell=True)

July

Saving program output


Often, we want to run some external program and then store the output
in a variable so that we can do something useful with it. For this, we use
subprocess.check_output, which takes exactly the same arguments as
[Link]:
196 Chapter 9: Files, programs, and user input

current_month = subprocess.check_output("/bin/date +%B", shell=True)

Just like when reading file contents, the output from an external program
can run over multiples lines that end with new line characters, so you
probably need to use rstrip to remove them before carrying out any
processing.

User input makes our programs more flexible


The exercises and examples that we've seen so far in this book have
used two different ways of getting date into a program. For small bits of
data, like short DNA sequences, restriction enzyme motifs, and gene
accession names, we've simply stored the data directly in a variable like
this:

dna = "ATCGATCGTGACTAGCTACG"

When data is mixed in with the code in this manner, it is said to be hard-
coded.
For larger pieces of data, like longer DNA sequences and spreadsheet-like
data, we've typically read the information from an external text file. For
many purposes, this is a better solution than hard-coding the data, as it
allows the separation of data and code, making our programs easier to
read. However, in all the examples we've seen so far, the names of the
files from which the data are read are still hard-coded.
Both of these approaches to getting data in to our program have the
same shortcomings – if we want to change the input data, we have to
open up the code and edit it. In the case of hard-coded variables, we
have to edit the statement where the variables are created. In the case
of files, we have two choices – we can either edit the contents of the file,
or edit the hard-coded file name.
Real-life useful programs don't generally work that way. Instead, they
generally allow us to specify input files and options at the time when we
197 Chapter 9: Files, programs, and user input

run the program, rather than when we're writing it. This allows programs
to be much more flexible and easier to use, especially for a person who
didn't write the code in the first place.
In the next couple of sections we're going to see a couple of tools for
getting user input, but more importantly we're going to talk about the
transition from writing a program that's only useful to you, to writing one
that can be used by other people. This involves starting to think about
the experience of using a program from the perspective of a user.
There are many reasons why you might need your programs to be usable
by somebody who's not familiar with the code. If you write a program
that solves a problem for you, chances are that it could solve a problem
for your colleagues and collaborators as well. If you write a program that
forms a significant part of a piece of work which you later want to
publish, you many have to make sure that whoever is peer-reviewing
your paper can get your program working as well. Of course, making
your program easier to use for other people means that it will also be
easier to use for you, a few months after you have written it when you
have completely forgotten how the code works!

Interactive user input


To get interactive input from the user in our programs, we can use the
input function (in Python 2, this function is known as input_raw). input
takes a single string argument, which is the prompt to be displayed to
the user, and returns the value typed in as a string:

accession = input("Enter the accession name")


# do something with the accession variable

The input function behaves a little differently to other functions and


methods we've seen, because it has to wait for something to happen
before it can return a value – the user has to type in a string and press
enter. The user input will be returned as a string (so if we need to use is
as something else – e.g. a number – we'll have to do the conversion
198 Chapter 9: Files, programs, and user input

manually) and will end with a new line (so we might want to use rstrip
to remove it).
Capturing user input in this way requires us to think quite carefully about
how our program behaves. Programs that we write to carry out analysis
of large datasets will often take a considerable amount of time to run, so
it's important that we minimize the chances of the user having to re-run
them. When using the input function, there are two situations in
particular that we want to avoid.
One is the situation where we have a long-running program that requires
some user input, but doesn't make this fact clear to the user. What can
happen in this scenario is that the user starts the program running and
then switches their attention to something else, assuming that the
program will continue to make progress in the background. If the user
doesn't notice (or is not at their computer) when the program reaches
the point where it requires input and halts, the program may be stuck
waiting for input for a long time.
The other scenario to avoid is that where a program runs for some time
before asking the user for input, then fails to work due to an incorrect
input or typo, requiring the user to re-start the program from scratch.
A good way to avoid both of these problems is to design our programs
such that they collect all necessary user input at the start, before any
long-running tasks are carried out. We can also reduce the chances of
incorrect input on the part of the user by offering clear instructions and
documentation.
An important part of user input is input validation – checking that the
input supplied by the user makes sense. For example, you might require
that a particular input is a number between some minimum and
maximum values, or that it's a DNA sequence without ambiguous bases,
or that it's the name of a file that must exist. A good strategy for input
validation is to check the input as soon as it's received, and give the user
a second chance to enter their input if it's found to be invalid. We can
handle validation of user input using tools that we've already covered –
199 Chapter 9: Files, programs, and user input

loops and conditions – but a better way to do it is using exceptions. See


the chapter on exceptions in Advanced Python for Biologists for
examples.
One big drawback of getting user input interactively is that it makes it
harder to run a program unsupervised as part of a work flow. For most
biological analyses, specifying program options when it's run using
command line arguments is a better approach.

Command line arguments


If you're used to using existing programs that have a command-line user
interface (as opposed to a graphical one) then you're probably familiar
with command line arguments1. These are the strings that you type on
the command line after the name of a program you want to run:

myprogram one two three

In the above code, one two and three are the command line options. To
use command line arguments in our Python scripts, we import the sys
module. We can then access the command line arguments by using the
special list [Link]. Running the following code:

import sys
print([Link])

with the command line:

python [Link] one two three

shows how the elements of [Link] are made up of the arguments


given on the command line:

1 Not to be confused with the arguments that we give to functions, although they do a similar
job.
200 Chapter 9: Files, programs, and user input

['[Link]', 'one', 'two', 'three']

Note that the first element of [Link] is always the name of the
program itself, so the first command line argument is at index one, the
second at index two, etc.
Just like with input, options and filenames given on the command line
are stored as strings, so if, for example, we want to use a command line
argument as a number, we'll have to convert it with int.
Command line arguments are a good way of getting input for your
Python programs for a number of reasons. All the data your program
needs will be present at the start of your program, so you can do any
necessary input validation (like checking that files are present) before
starting any processing. Also, your program will be able to be run as part
of a shell script, and the options will appear in the user's shell history.

Recap
We started this chapter by examining two features of Python that allow
your programs to interact with the operating system – file manipulation
and external processes. We learned which functions to use for common
file system operations, and which modules they belong to. We also ssaw
two ways to call external programs from within your Python program.
When using these techniques to solve real life problems, or when working
on the exercises, remember that you may encounter errors that are
nothing to do with your program. For instance, when trying to manipulate
files you may get an error if a specified file doesn't exist or you don't
have the necessary permissions to rename it. Similarly, if you get
unexpected output when running an external program the problem may
lie with the external program or with the way that you're calling it, rather
than with your Python program. This is in contrast to the rest of the
exercises in this book, which are mostly self-contained. If you run into
difficulties when using the tools in this chapter, check the external
factors as well as checking your program code.
201 Chapter 9: Files, programs, and user input

In the last portion of the chapter, we saw two different ways to get user
input when your program runs. Using command line arguments is
generally better for the type of programming that forms part of scientific
research.
202 Chapter 9: Files, programs, and user input

Exercises
In the chapter_9 folder in the exercises download there is a collection of
files with the extension .dna which contain DNA sequences of varying
length, one per line. Use this set of files for both exercises.

Binning DNA sequences


Write a program which creates nine new folders – one for sequences
between 100 and 199 bases long, one for sequences between 200 and
299 bases long, etc. Write out each DNA sequence in the input files to a
separate file in the appropriate folder.

Kmer counting
Write a program that will calculate the number of all kmers of a given
length across all DNA sequences in the input files and display just the
ones that occur more than a given number of times. You program should
take two command line arguments – the kmer length, and the cutoff
number.
203 Chapter 9: Files, programs, and user input

Solutions

Binning DNA sequences


The first job is to figure out how to read all the DNA sequences. We can
get a list of all the files in the folder by using [Link], but we'll have
to be careful to only read DNA sequences from files that have the right
file name extension. Here's a bit of code to start off with:

import os

for file_name in [Link]("."):


if file_name.endswith(".dna"):
print("reading sequences from " + file_name)

We can check the output to make sure that we're only going to process
the correct files:

reading sequences from [Link]


reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]
reading sequences from [Link]

The next step is to read the DNA sequences from each file. For each file
that passes the name test, we'll open it, then process it one line at a time
and calculate the length of the DNA sequence:
204 Chapter 9: Files, programs, and user input

# look at each file


for file_name in [Link]("."):
if file_name.endswith(".dna"):
print("reading sequences from " + file_name)
dna_file = open(file_name)

# look at each line


for line in dna_file:
dna = [Link]("\n")
length = len(dna)
print("found a dna sequence with length " + str(length))

Notice how we've used rstrip to remove the new line character – we don't
want to include it in the count of the sequence length, since it's not a
base. With ten files, and ten DNA sequences per file, this program
generates over a hundred lines of output – here's the first few:

reading sequences from [Link]


found a dna sequence with length 432
found a dna sequence with length 818
found a dna sequence with length 604
found a dna sequence with length 879
found a dna sequence with length 619
found a dna sequence with length 500
found a dna sequence with length 119
found a dna sequence with length 341
found a dna sequence with length 303
found a dna sequence with length 469
reading sequences from [Link]
found a dna sequence with length 121
found a dna sequence with length 442
found a dna sequence with length 520

This looks good – we're getting a range of different sizes. Next we have
to figure out which bin each of the sequences should go in. Because the
limits of the bins follow a regular pattern, we can use the range function
to generate them. We can generate a list of the lower limits for each bin
by taking a range of numbers from 100 to 1000 with a step size of 100,
205 Chapter 9: Files, programs, and user input

then adding 99 to get the upper limit of the bin. We'll go through this
process for each sequence, checking if it belongs in each bin in turn:

# go through each file in the folder


for file_name in [Link]("."):

# check if it ends with .dna


if file_name.endswith(".dna"):
print("reading sequences from " + file_name)

# open the file and process each line


dna_file = open(file_name)
for line in dna_file:

# calculate the sequence length


dna = [Link]("\n")
length = len(dna)
print("sequence length is " + str(length))

# go through each bin and check if the sequence belongs in it


for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
if length >= bin_lower and length < bin_upper:
print("bin is " + str(bin_lower) + " to " + str(bin_upper))

There are quite a few levels of indentation in the above code, so you
might have to read it through a few times. We have
• the loop for each file name
• the if statement that checks the file name
• the loop for each sequence in a file
• the loop for each bin
• the if statement that checks if the sequence belongs in the bin
206 Chapter 9: Files, programs, and user input

The first few lines of the output show that this approach works:

reading sequences from [Link]


sequence length is 432
bin is 400 to 499
sequence length is 818
bin is 800 to 899
sequence length is 604
bin is 600 to 699
sequence length is 879
bin is 800 to 899
sequence length is 619
bin is 600 to 699
sequence length is 500
bin is 500 to 599
sequence length is 119

The final step is to create the new folders, and write each DNA sequence
to the appropriate one. We can re-use our range idea to generate the
folder names and create them. The name of the folder for a given bin is
the lower limit, followed by an underscore, followed by the upper limit:

for bin_lower in range(100,1000,100):


bin_upper = bin_lower + 99
bin_folder_name = str(bin_lower) + "_" + str(bin_upper)
[Link](bin_folder_name)

When we want to write out DNA sequence to a file in a particular folder,


we can use the same naming scheme to work out the name of the folder.
Of course, we also have to figure out what to call the individual files of
DNA sequences. The exercise description didn't specify any kind of
naming scheme, so we'll keep things simple and store the first DNA
sequence in a file called [Link], the second in a file called [Link], etc. We'll
need to create an extra variable to hold the number of DNA sequences
we've seen, and to increment it after writing each DNA sequence. Here's
the whole script – it's by far the largest program that we've written so far:
207 Chapter 9: Files, programs, and user input

import os

# create a new folder for each bin


for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
bin_folder_name = str(bin_lower) + "_" + str(bin_upper)
[Link](bin_folder_name)

# create a variable to hold the sequence number


seq_number = 1

# process all files that end in .dna


for file_name in [Link]("."):
if file_name.endswith(".dna"):
print("reading sequences from " + file_name)
dna_file = open(file_name)

# for each line, calculate the sequence length


for line in dna_file:
dna = [Link]("\n")
length = len(dna)
print("sequence length is " + str(length))

# figure out which bin the sequence belongs in


for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
if length >= bin_lower and length < bin_upper:

# once we know the correct bin, write out the sequence


print("bin is " + str(bin_lower) + " to " + str(bin_upper))
bin_folder_name = str(bin_lower) + "_" + str(bin_upper)
output_path = bin_folder_name + '/' + str(seq_number) + '.dna'
output = open(output_path, "w")
[Link](dna)
[Link]()

# increment the sequence number


seq_number = seq_number+1
208 Chapter 9: Files, programs, and user input

Kmer counting
To come up with a plan of attack for this exercise, we must first think
about the order in which we process the data. Can we simply read a
single DNA sequence, count the k-mers, and print the counts like we did
for the trinucleotide example in chapter 8? No, because we only want to
print the k-mers which occur more than a given number of times across
all sequences. In other words, we don't know which k-mers we want to
print the counts for until we have finished processing all sequences.
So, we will have to tackle this problem in two stages. First, we will go
through each sequence one-by-one and gradually build up a list of k-mer
counts. Second, we will go through the list of counts and print only the
ones whose count is above the cutoff.
How will we generate the k-mer counts? A good first step would be to
figure out how to split a DNA sequence into overlapping k-mers of any
given length. We can use a similar approach to the one taken in the DNA
translation exercise in chapter 8: use the range function to generate a list
of the start positions of each k-mer, then use substring notation to
extract the k-mer from the sequence. Here's a bit of code that prints all
k-mers of a given size. We'll use a short test DNA sequence for now:

test_dna = "ACTGTAGCTGTACGTAGC"
print(test_dna)
kmer_size = 4
for start in range(0,len(test_dna)-(kmer_size-1),1):
kmer = test_dna[start:start+kmer_size]
print(kmer)

The tricky bit is figuring out the arguments to the range function. We
know that we want to start at zero and increase by one each time. The
finish position is the length of the sequence, minus the k-mer size (to
make sure there is one k-mer's worth of bases after it) minus one (to
allow for the fact that the finish position is exclusive). The range function
generates the start positions for each k-mer, and to get the end positions
209 Chapter 9: Files, programs, and user input

we just add the k-mer size. We can examine the output from this code
and check that it agrees with out intuition:

ACTGTAGCTGTACGTAGC
ACTG
CTGT
TGTA
GTAG
TAGC
AGCT
GCTG
CTGT
TGTA
GTAC
TACG
ACGT
CGTA
GTAG
TAGC

To make it easier to test this bit of code, we'll turn it into a function. The
function will take two arguments. The first argument will be the DNA
sequence as a string, and the second argument will be the k-mer size as
a number. Instead of printing the list of k-mers, it will return a list of
them. Here's the code for the function and three statements to test it:

def split_dna(dna, kmer_size):


kmers = []
for start in range(0,len(dna)-(kmer_size-1),1):
kmer = dna[start:start+kmer_size]
[Link](kmer)
return kmers

print(split_dna("AATGCTGCAT", 4))
print(split_dna("AATGCTGCAT", 5))
print(split_dna("AATGCTGCAT", 6))
210 Chapter 9: Files, programs, and user input

As we can see from the output, running the function multiple times with
the same DNA sequence but different k-mer lengths gives different
results, as expected:

['AATG', 'ATGC', 'TGCT', 'GCTG', 'CTGC', 'TGCA', 'GCAT']


['AATGC', 'ATGCT', 'TGCTG', 'GCTGC', 'CTGCA', 'TGCAT']
['AATGCT', 'ATGCTG', 'TGCTGC', 'GCTGCA', 'CTGCAT']

Now we can put this function together with the code we developed for
looping through files from the previous exercise. To count up the k-mers,
we will create an empty dictionary at the start of the program (line 11),
then for each k-mer we find, we will look up the current count for it in the
dictionary (line 19). If the k-mer is not found in the dictionary (i.e. this is
the first time we've seen that particular k-mer) then we will say that the
current count is zero. We'll then add one to the current count (line 20)
and store the result back in the dictionary (line 21).
211 Chapter 9: Files, programs, and user input

1 import os
2 kmer_size = 6
3
4 def split_dna(dna, kmer_size):
5 kmers = []
6 for start in range(0,len(dna)-(kmer_size-1),1):
7 kmer = dna[start:start+kmer_size]
8 [Link](kmer)
9 return kmers
10
11 kmer_counts = {}
12 for file_name in [Link]("."):
13 if file_name.endswith(".dna"):
14 print("reading sequences from " + file_name)
15 dna_file = open(file_name)
16 for line in dna_file:
17 dna = [Link]("\n")
18 for kmer in split_dna(dna, kmer_size):
19 current_count = kmer_counts.get(kmer, 0)
20 new_count = current_count + 1
21 kmer_counts[kmer] = new_count
22
23 print(kmer_counts)

This program generates a lot of output! Here are the first few lines so we
can see that it's working:

{'gcagag': 11, 'aaataa': 13, 'ctttag': 11, 'gcagac': 14, 'ctttaa': 12,
'gcagaa': 15 etc. etc.

As planned, we end up with a big dictionary where the keys are kmers
and the values are their counts.
Next, we have to process the kmer_counts dictionary. We'll go through
the items in a loop, and if the count is greater than some cutoff, we'll
print the count. For testing, we'll fix the cutoff at 23 (later on we'll make
this a command-line option). Here's the code to process the dictionary:
212 Chapter 9: Files, programs, and user input

count_cutoff = 23
for kmer, count in kmer_counts.items():
if count > count_cutoff:
print(kmer + " : " + str(count))

And here's the output we get:

agagat : 26
agcggg : 26
atcgga : 25
aaggag : 25
cccagc : 24
aggttc : 25
agatta : 24
tctagg : 24
gagtgg : 28
ccggtt : 26
gagcag : 24
ttctga : 26
agatgg : 24
tctgaa : 24
gcgggt : 25
ttcaaa : 25
gattaa : 25
ccagcg : 25
ggacgt : 27
atggct : 24

Nearly done. The final step is to replace the hard-coded values for the k-
mer size and the count cutoff with values read from the command line.
We just have to import the sys module, and convert the arguments to
numbers using the int function. As specified in the exercise description,
the first command line argument is the k-mer size and the second is the
cutoff. Here's the final code with comments:
213 Chapter 9: Files, programs, and user input

import os
import sys

# convert command line arguments to variables


kmer_size = int([Link][1])
count_cutoff = int([Link][2])

# define the function to split dna


def split_dna(dna, kmer_size):
kmers = []
for start in range(0,len(dna)-(kmer_size-1),1):
kmer = dna[start:start+kmer_size]
[Link](kmer)
return kmers

# create an empty dictionary to hold the counts


kmer_counts = {}

# process each file with the right name


for file_name in [Link]("."):
if file_name.endswith(".dna"):
dna_file = open(file_name)

# process each DNA sequence in a file


for line in dna_file:
dna = [Link]("\n")

# increase the count for each k-mer that we find


for kmer in split_dna(dna, kmer_size):
current_count = kmer_counts.get(kmer, 0)
new_count = current_count + 1
kmer_counts[kmer] = new_count

# print k-mers whose counts are above the cutoff


for kmer, count in kmer_counts.items():
if count > count_cutoff:
print(kmer + " : " + str(count))
214 Chapter 9: Files, programs, and user input

Now we can specify the k-mer length on the command line when we run
the program. With a k-mer length of 6 and a cutoff of 25:

python kmer_counting.py 6 25

we get the output


agagat : 26
agcggg : 26
gagtgg : 28
ccggtt : 26
ttctga : 26
ggacgt : 27

With a k-mer length of 3 and a cutoff of 900:

python kmer_counting.py 3 900

tct : 908
ttc : 924
gtt : 905
gat : 904
gga : 910
atc : 905

You might also like