Multiprotein Complexes
Multiprotein Complexes
Multiprotein
Complexes
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences,
University of Hertfordshire, Hatfield,
Hertfordshire, UK
Edited by
Arnaud Poterszman
Institut de Génétique et de Biologie Moléculaire et Cellulaire, Center for Integrated Biology, Integrated
Structural Biology Department, Equipe labellisée Ligue Contre le Cancer, CNRS UMR 7104 - Inserm U
1258, University of Strasbourg, Illkirch, France
Editor
Arnaud Poterszman
Institut de Génétique et de Biologie
Moléculaire et Cellulaire, Center for
Integrated Biology, Integrated
Structural Biology Department, Equipe
labellisée Ligue Contre le Cancer
CNRS UMR 7104 - Inserm U 1258
University of Strasbourg
Illkirch, France
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface
Molecular complexes of interacting proteins govern virtually all biological processes such as
metabolism, cell signaling, DNA repair, or gene expression. Macromolecular assemblies are
also of great biomedical relevance as factors that perturb biomolecular interaction networks
underlie a number of diseases, and deliberate inhibition of protein–protein interactions is an
increasingly common strategy in drug discovery initiatives. Unraveling their functions and
mechanisms of action is often only potentially accessible through a detailed structural
description and the integration of dynamic information. This volume of the Methods in
Molecular Biology series aims to provide the scientific community with strategies and detailed
protocols for the preparation of macromolecular complexes and their characterization in
view of structural analysis.
Protein engineering and production are essential tools for structural, biophysical, and
functional studies as well as for biotechnology and medical applications. Strategies to
prepare proteins and protein complexes have tremendously been improved in part thanks
to recent structural genomic programs. Yet, no universal solution has been implemented,
and the production and/or reconstitution of protein complexes remains a major bottleneck.
This is in particular the case for complexes composed of many subunits which are often
incompletely characterized. Additional difficulties result from their low natural abundance
or their versatile nature, in part because regulation often involves the formation of transient
complexes with low binding constants and in part because their composition varies with the
physiological context.
The first section of this book focuses on sample preparation. While Chapters 1 and
2 concentrate on strategies for recombinant expression of multiprotein complexes in pro-
karyotic and eukaryotic hosts, Chapter 3 illustrates how genome editing with the CRISPR-
Cas9 system can be used to precisely modify protein coding genes in mammalian cells; this
offers the possibility to replace any coding gene by a reshaped version fused to an affinity tag
protein or to a fluorescent reporter, enabling the characterization of endogenous macromo-
lecular complexes expressed under near physiological conditions. In the first section, the
production of recombinant antibodies and artificial binding proteins which emerge as key
reagents in multiprotein complex research, as inhibitors of protein–protein interactions to
modulate activity, as probes for cellular imaging or to facilitate structural determination is
also discussed. Chapter 4 details the production of recombinant antibodies in different
formats, Chapter 5 the intervening removable affinity tag (iRAT) system for the production
of recombinant antibody fragments, and Chapter 6 the isolation of artificial binding proteins
(Affimer reagents) based on a non-antibody scaffold.
The second section of the book details a set of biophysical methods that can provide
useful indicators for sample optimization and often complement structural information
obtained with core technologies for structure determination (X-ray crystallography, nuclear
magnetic resonance, and cryo-electron microscopy) by quantitative solution data, helping to
understand how biological systems function. Three chapters focus on techniques for the
biophysical characterization of biological macromolecules and their complexes. Chapter 7
details interaction measurements of protein–DNA complexes by isothermal titration calo-
rimetry (ITC) and microscale thermophoresis (MST), Chapter 8 the use of the switch-
SENSE technology for the analysis of enzyme kinetics, and Chapter 9 the sedimentation
v
vi Preface
velocity methods for the characterization of protein heterogeneity and protein affinity
interactions. Another set of articles describe mass spectrometry (MS)-based approaches
for macromolecular complex analysis. Chapter 10 focuses on the applications of native
mass spectrometry for the characterization of multiprotein complexes ranging from 16 to
801 kDa, Chapter 11 on hydrogen/deuterium exchange mass spectrometry for analyzing
protein–DNA interactions, and Chapter 12 on integrative mass spectrometry-based
approaches for modeling macromolecular assemblies.
Although high‐resolution structure determination using X-ray crystallography or single‐
particle cryo‐electron microscopy (cryo‐EM) is now producing a rapid stream of break-
throughs in structural biology, the preparation of suitable crystals or hydrated frozen
samples on EM grids is often quite challenging. Purified samples, intact and structurally
homogeneous in the test tube, may not crystallize or survive the standard methods of
preparing thin aqueous films on grids. In the case of cryo-EM, optimization of sample
stability and extensive screening of parameters for grid preparation are often required to
collect high-quality datasets. The two last chapters of this section address sample optimiza-
tion. Chapter 13 provides detailed protocols for preparing negatively stained and hydrated
frozen EM-grid while Chapter 14 addresses solubilization screening using membrane
proteins as model system.
Finally, the third section of this book addresses the characterization of multiprotein
complexes in a cellular environment using state-of-the-art imaging technologies and in vivo
approaches. Chapter 15 describes practical aspects of super-resolution imaging and
Chapter 16 multi-color FRET-FLIM microscopy in live cells. Chapters 17 and 18 present
applications of directed evolution systems and of context-specific and proximity-dependent
labeling using the BioID technology.
This book is expected to be used not only by structural/molecular biologists who need
to prepare multi-components complexes for their own applications but also by scientists
from other fields who are working on macromolecular assemblies from other standpoints
and need an overview of state-of-art approaches. I am especially thankful to all the authors
for their great contributions, devoting their valuable time to the preparation of the manu-
scripts. I am also indebted to the Series Editor John M. Walker, to the editorial staff
members of Springer and to Marie Christine Poterszman for their kind support in making
this book publishable. I hope that this volume provides a useful overview preparation and
structural analysis of macromolecular complexes and fills a need for well-described hands-on
protocols.
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 339
Contributors
ABDULLAH AHMED • Central Laser Facility, Science and Technology Facilities Council
(STFC) Rutherford Appleton Laboratory, Research Complex at Harwell, Oxford, UK;
Plant Cell Biology, Biological and Medical Sciences, Oxford Brookes University, Oxford, UK
LEONID ANDRONOV • Centre for Integrative Biology (CBI), Institut de Génétique et de
Biologie Moléculaire et Cellulaire (IGBMC), Centre National de la Recherche Scientifique
(CNRS), UMR 7104, Institut National de la Santé et de la Recherche Médicale
(INSERM), U1258, Université de Strasbourg, Illkirch, France
MAGALI AUMONT-NICAISE • Institute for Integrative Biology of the Cell (I2BC), Université
Paris-Saclay, CEA, CNRS, Gif-s-Yvette, France
GUILLAUME BEC • Institut de Biologie Moléculaire et Cellulaire, Centre National de la
Recherche Scientifique (CNRS), Université de Strasbourg, Strasbourg, France
JULIEN BÉTHUNE • Hamburg University of Applied Sciences, Hamburg, Germany; Cluster of
Excellence CellNetworks, Heidelberg University, Heidelberg, Germany; Heidelberg
University Biochemistry Center (BZH), Heidelberg, Germany
CATHERINE BIRCK • Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC),
Centre National de la Recherche Scientifique (CNRS), UMR 7104, Institut National de
la Santé et de la Recherche Médicale (INSERM), U1258, Université de Strasbourg, Illkirch,
France
STANLEY W. BOTCHWAY • Central Laser Facility, Science and Technology Facilities Council
(STFC) Rutherford Appleton Laboratory, Research Complex at Harwell, Oxford, UK;
Plant Cell Biology, Biological and Medical Sciences, Oxford Brookes University, Oxford, UK
ALICE BRION • Laboratoire Structure et Instabilité des Génomes, Muséum National
d’Histoire Naturelle (MNHN), Institut National de la Santé et de la Recherche Médicale
(INSERM), U1154, Centre National de la Recherche Scientifique (CNRS), UMR7196,
Paris, France
JEAN-BAPTISTE CHARBONNIER • Institute for Integrative Biology of the Cell (I2BC),
Université Paris-Saclay, CEA, CNRS, Gif-s-Yvette, France
SARAH CIANFÉRANI • Laboratoire de Spectrométrie de Masse BioOrganique, Institut
Pluridisciplinaire Hubbert Curien (IPHC), Centre National de la Recherche Scientifique
(CNRS), UMR 7178, Université de Strasbourg, Strasbourg, France
JEAN-PAUL CONCORDET • Laboratoire Structure et Instabilité des Génomes, Muséum
National d’Histoire Naturelle (MNHN), Institut National de la Santé et de la Recherche
Médicale (INSERM), U1154, Centre National de la Recherche Scientifique (CNRS),
UMR7196, Paris, France
EMILY COOKE • Central Laser Facility, Science and Technology Facilities Council (STFC)
Rutherford Appleton Laboratory, Research Complex at Harwell, Oxford, UK
VINCENT CORVEST • CALIXAR, Lyon, France
MICHEL DESMADRIL • Institute for Integrative Biology of the Cell (I2BC), Université Paris-
Saclay, CEA, CNRS, Gif-s-Yvette, France
CHRISTINE EBEL • Institut de Biologie Structurale (IBS), Univ Grenoble Alpes,
Commissariat à l’énergie atomique et aux énergies alternatives (CEA), Centre National de
la Recherche Scientifique (CNRS), Grenoble, France
ix
x Contributors
YUMI SATO • Department of Cell Biology, Graduate School of Medicine, Kyoto University,
Kyoto, Japan
CHRISTIANE SCHAFFITZEL • School of Biochemistry, University of Bristol, Bristol, UK
DAMIAN SCHILLER • Department of Structural Biochemistry, Max-Planck-Institute of
Molecular Physiology, Dortmund, Germany
JENNIFER SCHOBERER • Department of Applied Genetics and Cell Biology, University of
Natural Resources and Life Sciences, BOKU Vienna, Vienna, Austria
PATRICK SCHULTZ • Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC),
Integrated Structural Biology, Equipe labellisée Ligue Contre le Cancer, Centre National
de la Recherche Scientifique (CNRS), UMR 7104, Institut National de la Santé et de la
Recherche Médicale (INSERM), U1258, Université de Strasbourg, Illkirch, France
GRIGORY SHAROV • Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC),
Integrated Structural Biology, Equipe labellisée Ligue Contre le Cancer, Centre National
de la Recherche Scientifique (CNRS), UMR 7104, Institut National de la Santé et de la
Recherche Médicale (INSERM), U1258, Université de Strasbourg, Illkirch, France; EM
Facility, MRC Laboratory of Molecular Biology, Cambridge, UK
MARTIN SPINCK • Department of Structural Biochemistry, Max-Planck-Institute of
Molecular Physiology, Dortmund, Germany
ANNA A. S. TANG • Astbury Centre for Structural and Molecular Biology, School of Molecular
and Cellular Biology, University of Leeds, Leeds, UK
CHRISTIAN TIEDE • Astbury Centre for Structural and Molecular Biology, School of Molecular
and Cellular Biology, University of Leeds, Leeds, UK
DARREN C. TOMLINSON • Astbury Centre for Structural and Molecular Biology, School of
Molecular and Cellular Biology, University of Leeds, Leeds, UK
JOOP VAN DEN HEUVEL • Department of Structure and Function of Proteins, Helmholtz
Zentrum für Infektionsforschung GmbH, Braunschweig, Germany
PALOMA F. VARELA • Institute for Integrative Biology of the Cell (I2BC), Université Paris-
Saclay, CEA, CNRS, Gif-s-Yvette, France
JEAN-LUC VONESCH • Centre for Integrative Biology (CBI), Institut de Génétique et de
Biologie Moléculaire et Cellulaire (IGBMC), Centre National de la Recherche Scientifique
(CNRS), UMR 7104, Institut National de la Santé et de la Recherche Médicale
(INSERM), U1258, Université de Strasbourg, Illkirch, France
MAXIMILIEN WERDERER • Institut de Génétique et de Biologie Moléculaire et Cellulaire
(IGBMC), Integrated Structural Biology, Equipe labellisée Ligue Contre le Cancer, Centre
National de la Recherche Scientifique (CNRS), UMR 7104, Institut National de la Santé
et de la Recherche Médicale (INSERM), U1258, Université de Strasbourg, Illkirch, France
GALA RAMON ZAMORANO • Institut de Génétique et de Biologie Moléculaire et Cellulaire
(IGBMC), Département of Integrated Structural Biology, Equipe Labellisée Ligue, Centre
National de la Recherche Scientifique (CNRS), UMR 7104, Institut National de la Santé
et de la Recherche Médicale (INSERM), U1258, Université de Strasbourg, Illkirch, France;
Department of Life and Medical Sciences, University of Hertfordshire, Hatfield, UK
Part I
Abstract
Membrane proteins constitute an important class of proteins for medical, pharmaceutical, and biotechno-
logical reasons. Understanding the structure and function of membrane proteins and their complexes is of
key importance, but the progress in this area is slow because of the difficulties to produce them in sufficient
quality and quantity. Overexpression of membrane proteins is often restricted by the limited capability
of translocation systems to integrate proteins into the membrane and to fold them properly. Purification of
membrane proteins requires their isolation from the membrane, which is a further challenge. The choice of
expression system, detergents, and purification tags is therefore an important decision. Here, we present a
protocol for expression in bacteria and isolation of a seven-subunit membrane protein complex, the
bacterial holo-translocon, which can serve as a starting point for the production of other membrane protein
complexes for structural and functional studies.
Key words Membrane protein complex, Expression in bacteria, Endogenous host, Complex purifica-
tion, Translocon
1 Introduction
1.1 Aim of the Study Membrane proteins represent more than 25% of the proteome of all
cells. They mediate the cell’s interaction with its environment, i.e.,
transmission of signals, cell adhesion, and transport across mem-
branes. Membrane proteins are of prime pharmaceutical interest as
they constitute ~50% of known potential drug targets. In addition
to this, membrane proteins are the natural entry and/or anchoring
points for infectious agents. Dysfunctional membrane proteins are
the basis of many disorders such as cystic fibrosis and Alzheimer’s.
Understanding the function and molecular structure of this class of
proteins is of key interest.
As in the cytosol, the majority of proteins in the membrane
occur in and function in complexes. For instance in budding yeast,
membrane proteins were found to interact on average with two to
three interaction partners [1]. Due to their association with cellular
membranes, expression and purification of membrane proteins and
their complexes are often a challenging task. Progress is often
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
3
4 Burak V. Kabasakal et al.
1.2 Recombinant E. coli has traditionally been, and still is, the most popular expres-
Expression sion system for proteins. This is because of low costs, low expendi-
in Escherichia coli ture of time, and the fact that it is less labor-intense than other
expression systems.
1.2.1 Choice of Promoter When expressing membrane proteins, saturation of the E. coli
and Strain membrane protein translocation and folding machinery should be
avoided. This would lead to protein misfolding, aggregation, and
formation of inclusion bodies. Very strong promoters such as the
T7 promoter frequently lead to these problems. Weaker promoters
synthesize membrane proteins at more moderate levels. Examples
include T7/lac hybrid promoters or the tightly regulated arabinose
promoter, both of which are often used for membrane protein
expression [2].
Addressing the same issues, tailor-made strains have been
developed for membrane protein production in E. coli. The T7
RNA polymerase-based expression strain BL21λ(DE3) and its
mutant strains C41λ(DE3) and C43λ(DE3) [3] are the most pop-
ular strains for expressing membrane proteins in E. coli [2]. C41
and C43 contain mutations in the lacUV5 promoter region of the
gene encoding for T7 RNA polymerase leading to lower expression
of the T7 RNA polymerase [4] and consequently slower transcrip-
tion and translation rates of the proteins under the control of T7
promoter. The same principle applies to the E. coli BL21-AI strain
(Invitrogen) which expresses T7 RNA polymerase under the con-
trol of a tightly regulated arabinose promoter.
1.2.2 Other Auto-induction media are commonly used for improved membrane
Considerations protein production [5]. They can be used for all IPTG-inducible
expression systems. Protein production is induced in auto-
induction media at high cell density when the glucose in the
media is depleted, which is during the mid/late log phase of
growth. Lactose uptake then leads to the production of allolactose
which causes the release of the lac repressor and induction of T7
RNA polymerase from the lacUV5 promoter.
For membrane protein complexes, a common strategy is the
co-expression of the proteins from their natural or artificial operons
[6] (see example in Fig. 1a). Co-expression of all subunits of a
complex allows complex assembly in vivo in the cell. This is partic-
ularly important for membrane protein complexes, where
Fig. 1 The production of the holo-translocon complex, comprising seven membrane proteins. (a) The
expression vector for the holo-translocon was generated using the ACEMBL system [13]. It comprises two
artificial operons encoding for YidC, SecD, and SecF (operon 1) and for SecY, SecE, and SecG (operon 2), as
well as the gene encoding for YajC with a C-terminal CBP-tag. The hexa-histidine tags on SecD, YidC, and
SecE are indicated as red triangles. The position of the CBP-tag is indicated with a purple triangle. Origins of
replication of donor (oriR6Kγ) and acceptor (oriBR322) vectors are indicated in black. Arabinose (ara) and trc
promoters are shown as grey arrows and terminators as black rectangles. Antibiotic resistance genes are
colored blue (Ap ampicillin, Kn kanamycin, Cm chloramphenicol). (b) Scheme showing the general workflow
for holo-translocon production and parameters that require optimization when a new membrane protein
complex is produced. (c) Coomassie-stained SDS PAGE gel of holo-translocon, analyzing the membrane
fraction, the detergent-solubilized protein fraction (Ni-NTA input), the flow-through from Ni-NTA, wash
fractions, and the eluate peak fraction (HS high salt). The bands for holo-translocon subunits are marked.
(d) Size exclusion chromatogram of holo-translocon and SDS PAGE of the peak fractions. The blue and red
curves show the absorption at 280 nm and 260 nm, respectively. Upper inset: Coomassie-stained SDS PAGE
showing the peak fractions; below: Western blot using an antibody directed against the CBP-tag to detect
YajC-CBP
6 Burak V. Kabasakal et al.
1.4 Overexpression Isolation of membrane protein complexes from the natural host
in the Endogenous used to be restricted to membrane protein machines which are
Host highly abundant in the cell, such as complexes for photosynthesis,
respiration, and oxidative phosphorylation [23]. However, with the
advent of miniaturization and automatization of biochemical, bio-
physical, and structural analyses, less abundant membrane protein
complexes can now be studied.
Purification of endogenous complexes is significantly facilitated
if a purification tag is fused to one of the subunits, which is possible
if the source can be genetically modified. The tagged subunit is
ideally an integral subunit of the complex. The chosen affinity
purification tag should be compatible with the presence of deter-
gents in the buffer (frequent choices include His-tags, 3xFLAG-
tag, and CBP-tag).
The E. coli holo-translocon production described below uses
the endogenous host, thus providing the required chaperone rep-
ertoire and the physiological lipid composition. The purified com-
plex has been shown to be active in co- and post-translational
8 Burak V. Kabasakal et al.
2 Materials
2.7 Sample 1. Amicon Ultra centrifugal filter units, molecular weight cut-off
Concentration 100 kDa, Ultra-15 (Amicon).
2. Centrifuge, e.g., Heraeus Megafuge 16R.
3. Prepare 10 mL S6 buffer: 20 mM HEPES-KOH pH 8.0
(0.2 mL of 1 M stock solution), 130 mM NaCl (0.26 mL of
5 M stock solution), 5 mM MgOAc2 (50 μL of 1 M stock
solution), 0.03% DDM (30 μL of 10% stock solution).
3 Methods
3.1 Expression 1. Transform the pACEMBL HTL3 plasmid (Fig. 1a) into chem-
of HTL ically competent or electrocompetent E. coli BL21 Star (DE3)
(SecY-SecE-SecG + or E. coli C43λ(DE3) cells [3] and select for growth on LB agar
YidC-SecD-SecF plates with ampicillin, chloramphenicol, and kanamycin at
+ YajC) 37 C overnight.
2. Inoculate 100 mL preculture in LB medium supplemented
with 50 μg/mL ampicillin, 20 μg/mL chloramphenicol, and
30 μg/mL kanamycin with one colony from the LB agar plate
and grow at 37 C overnight by shaking at 180 rpm.
3. Inoculate 1 L of Terrific Broth with 50 μg/mL ampicillin,
20 μg/mL chloramphenicol, and 30 μg/mL kanamycin in a
5 L baffled Erlenmeyer flask with approximately 20 mL pre-
culture to reach an initial optical density (OD600nm) of 0.05 at
600 nm. Shake the E. coli cultures at 37 C and 150 rpm.
Typical culture volumes for holo-translocon preparations are
6–12 L.
4. When the cell cultures reach an OD600 of 1.2–1.5 (mid-log
phase), induce protein expression by the addition of 21 mL of
10% L-arabinose (0.2% final concentration) and 0.5 mL of
1 M IPTG.
5. After 3 h of protein expression (37 C, 150 rpm), the cells are
harvested by centrifugation for 20 min at 5000 g (4 C) (see
Note 1).
6. Discard the supernatant and determine the weight of the cell
pellet (see Note 2).
3.3 Detergent 1. Add DDM to a final concentration of 1.5% w/v to the mem-
Solubilization branes (see Note 5).
2. Gently agitate the sample at 4 C (in the cold room) for 2 h by
head-over-tail rotation.
3. Centrifuge solubilized membranes for 1 h in a Ti70 rotor at
45,000 rpm (149,000 g) at 4 C (see Note 6).
3.4 NiNTA Affinity 1. Equilibrate 5 mL Ni-NTA resin with ten column volumes of
Chromatography (All Ni-NTA buffer (see Note 7 for using a prepacked column).
Steps at 4 C) 2. Add the Ni-NTA resin to the solubilized membrane superna-
tant (from step 3 of Subheading 3.3).
3. Gently agitate for 1 h by head-over-tail rotation.
4. Transfer the sample and beads into a gravity flow column.
Collect the flow-through.
5. Wash with at least 20 column volumes of Ni-NTA buffer (see
Note 8, to change the detergent to LMNG at this step).
6. Wash with three to five column volumes of high salt buffer.
7. Wash with at least five column volumes of Ni-NTA buffer.
8. Wash with 20 column volumes of Ni-NTA wash buffer.
9. Verify that there is no A280nm signal in the wash fraction using a
NanoDrop spectrophotometer before proceeding.
10. Elute with Ni-NTA elution buffer and collect the eluate in
1.5–2 mL tubes.
11. Determine the protein concentration of each fraction by
A280nm measurements using a NanoDrop spectrophotometer
(see Note 9).
12. Add 0.1 mM PMSF and cOmplete protease inhibitor cocktail
to the protein-containing fractions.
Production of Multi-subunit Membrane Protein Complexes 13
3.8 Size Exclusion 1. Equilibrate a Superose 6 column with water and then with two
Chromatography column volumes of S6 Buffer (see Note 13).
(Optional) 2. Load 500 μL of sample from step 3 of Subheading 3.7 onto the
column.
3. Collect 0.5 mL fractions.
4. Analyze the protein-containing fractions on a 15% SDS
PAGE gel.
Pool the peak fractions (Fig. 1d), if required concentrate to
~1 mg/mL using a concentrator with 100 kDa molecular weight
cut-off. Freeze aliquots in liquid nitrogen and store the purified
holo-translocon at 80 C.
4 Notes
Acknowledgments
References
9. Drew D, Lerch M, Kunji E et al (2006) Opti- expression in insect and mammalian cells. Nat
mization of membrane protein overexpression Biotechnol 23:567–575
and purification using GFP fusions. Nat Meth- 19. Akermoun M, Koglin M, Zvalova-Iooss D et al
ods 3:303–313 (2005) Characterization of 16 human G
10. Kawate T, Gouaux E (2006) Fluorescence- protein-coupled receptors expressed in
detection size-exclusion chromatography for baculovirus-infected insect cells. Protein Expr
precrystallization screening of integral mem- Purif 44:65–74
brane proteins. Structure 14:673–681 20. Rasmussen SG, Choi HJ, Rosenbaum DM et al
11. Duong F, Wickner W (1997) Distinct catalytic (2007) Crystal structure of the human beta2
roles of the SecYE, SecG and SecDFyajC sub- adrenergic G-protein-coupled receptor. Nature
units of preprotein translocase holoenzyme. 450:383–387
EMBO J 16:2756–2768 21. Fitzgerald DJ, Berger P, Schaffitzel C et al
12. Scotti PA, Urbanus ML, Brunner J et al (2000) (2006) Protein complex expression by using
YidC, the Escherichia coli homologue of mito- multigene baculoviral vectors. Nat Methods
chondrial Oxa1p, is a component of the Sec 3:1021–1032
translocase. EMBO J 19:542–549 22. Khan I, Krishnaswamy S, Sabale M et al (2018)
13. Bieniossek C, Nie Y, Frey D et al (2009) Auto- Efficient production of a mature and functional
mated unrestricted multigene recombineering gamma secretase protease. Sci Rep 8:12834
for multiprotein complex production. Nat 23. Mesa P, Deniaud A, Montoya G et al (2013)
Methods 6:447–450 Directly from the source: endogenous prepara-
14. Komar J, Botte M, Collinson I et al (2015) tions of molecular machines. Curr Opin Struct
ACEMBLing a multiprotein transmembrane Biol 23:319–325
complex: the functional SecYEG-SecDF-YajC- 24. Inoue H, Nojima H, Okayama H (1990) High
YidC Holotranslocon protein secretase/inser- efficiency transformation of Escherichia coli
tase. Methods Enzymol 556:23–49 with plasmids. Gene 96:23–28
15. Schulze RJ, Komar J, Botte M et al (2014) 25. Dower WJ, Miller JF, Ragsdale CW (1988)
Membrane protein insertion and proton- High efficiency transformation of E. coli by
motive-force-dependent secretion through the high voltage electroporation. Nucleic Acids
bacterial holo-translocon SecYEG-SecDF- Res 16:6127–6145
YajC-YidC. Proc Natl Acad Sci U S A 26. Linke D (2014) Explanatory chapter: choosing
111:4844–4849 the right detergent. Methods Enzymol
16. Botte M, Zaccai NR, Lycklama JA et al (2016) 541:141–148
A central cavity within the holo-translocon sug- 27. Kubicek J, Block H, Maertens B et al (2014)
gests a mechanism for membrane protein inser- Expression and purification of membrane pro-
tion. Sci Rep 6:38399 teins. Methods Enzymol 541:117–140
17. Thomas JA, Tate CG (2014) Quality control in 28. Lantez V, Nikolaidis I, Rechenmann M et al
eukaryotic membrane protein overproduction. (2015) Rapid automated detergent screening
J Mol Biol 426:4139–4154 for the solubilization and purification of mem-
18. Kost TA, Condreay JP, Jarvis DL (2005) Bacu- brane proteins and complexes. Eng Life Sci
lovirus as versatile vectors for protein 15:39–50
Chapter 2
Abstract
Most cellular processes are mediated by multi-subunit protein complexes which have attracted major
interest in both academia and industry. Recombinant production of such entities in quantity and quality
sufficient for functional and structural investigations may be extremely challenging and necessitate specific
technologies. The baculovirus expression vector system is widely used for the production of eukaryotic
multiprotein complexes, and a variety of strategies are available to assemble transfer vectors for the
generation of recombinant baculoviruses. Here we detail applications of homology-based cloning techni-
ques for one-step construction of dual promoter baculovirus transfer plasmids and of restriction-free
(RF) cloning for the modification of existing constructs.
Key words Baculovirus insect cell expression, Multiprotein complex, Homology-based cloning,
Sequence and ligation–independent cloning (SLIC), restriction-free (RF) cloning
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
17
18 Paola Rossolillo et al.
Fig. 1 Construction of multigene transfer vectors for the expression of multiprotein complexes. (a) DNA
elements comprising genes of interest, promoters, and terminators are combined with plasmid backbone
modules into multigene expression transfer vectors (left). These plasmids are transferred into the viral genome
through Tn7 transposition in bacterial BH10Bac cells or by homologous recombination after co-transfection in
insect cells (right). Recombinant viruses produce proteins of interest (here under the control of the PH
promoter) together with a reporter gene (here mCherry under the P10 promoter). (b) To assemble multigene
constructs, individual or dual expression cassettes can be excised by digestion with a pair of restriction
endonucleases or amplified by PCR and inserted via compatible restriction sites or homology-based cloning
into the multiplication module of a progenitor plasmid. The top panel shows an example in which an
expression cassette containing genes C and D is cloned into a plasmid containing genes A and
B. Alternatively, multigene constructs can be assembled using Cre-mediated fusion via LoxP sites (green
circles). Acceptors have a regular replication origin (ori ColE1), whereas donors have a conditional origin
derived from phage (ori R6Kγ); the two plasmids also have different antibiotic resistance. The bottom panel
illustrates the Cre-mediated fusion of an acceptor plasmid containing a dual expression cassette bearing
genes A and B with a donor vector bearing gene E
20 Paola Rossolillo et al.
2 Materials
2.1 Working You need access to standard equipment for molecular biology
Environment including PCR machines, agarose gel electrophoresis apparatus,
and Instruments UV trans-illuminator, refrigerated benchtop centrifuge, nanodrop
for DNA quantification, fridge, and freezers (20 C and 80 C).
Prepare all solutions using ultrapure water (prepared by purify-
ing deionized water, to attain a sensitivity of 18 MΩ-cm at 25 C)
and analytical grade reagents. Unless indicated otherwise, prepare
and store all reagents at room temperature. Diligently follow all
waste disposal regulations when disposing waste materials.
2.2 Bacterial Strains 1. Luria–Bertani (LB) medium with antibiotics added at the fol-
and Plasmids lowing concentrations: ampicillin (100 μg/mL), kanamycin
(30 μg/mL), spectinomycin (90 μg/mL), and chlorampheni-
col (15 μg/mL).
2. E. coli DH5α, TOP10, XL-1 blue, or Pir1 (see Note 1) compe-
tent cells (chemically or electrocompetent cells).
3. Dual expression transfer vectors (see Table 1). These plasmids
are available from Addgene.
4. Templates for amplification of the target genes. When a starting
plasmid containing the cDNA of your gene of interest is not
present, chemical synthesis is often an advantageous option for
generating cDNAs. In any case, the removal of restriction sites
that might be used for the transfer of the expression cassettes is
Table 1
Dual promoter plasmids for baculovirus expression systems
Fig. 2 Dual expression plasmids. (a) Expression cassette from the transfer vector pFastBac Dual, where
promoters (p10 and PH), cloning sites to insert the genes of interest (A and B) and terminators (HSV Tk and
SV40 polyA) are indicated. (b) Representation of the transfer vectors pFastBac Dual, pKL, and pAC8_MF. The
expression cassettes of pKL and pAC8_MF are flanked by a pair of unique restriction sites (AvrII and PmeI) and
contain a multiplication module (M) composed of the BstZ17I, SpeI, or NruI recognition sequences. These can
be used to assemble constructs for the co-expression of three and more cDNAs. Plasmids pKL and pAC8_MF
also contain a LoxP site (blue circle). Elements for the transfer into the viral genome (Tn7-R and Tn7-L or
AcMNPV sequences), a replication unit (ColE1) and antibiotic resistance genes (AmpR and KmR) are also
indicated
2.3 Reagents 1. Plasmid containing the target cDNAs and dual expression
for the Preparation transfer vectors (see Subheading 2.2).
of the Linearized 2. Synthetic oligonucleotides for PCR amplification designed as
Vector and DNA detailed in Subheading 3.2 (see Table 2). Dry oligonucleotides
Fragments are usually resuspended at 100 μM and further diluted at
10 μM.
3. Phusion Polymerase (ThermoScientific™) with 5xHF or GC
buffer and DMSO or another high-fidelity polymerase.
4. dNTPs mix. Prepare and aliquot 10 mM dNTP stock solutions
in ultrapure water.
5. DpnI (10 u/μL) restriction enzyme and corresponding buffer.
6. If the plasmid backbone is prepared by digestion: BamHI,
XbaI, XhoI, NheI (10 u/μL) restriction enzymes, and the
corresponding buffers.
22
Table 2
Oligonucleotides for the amplification of the dual promoter region, the plasmid backbone, and the two target cDNAs and their cloning
3 Methods
Fig. 3 Homology-based assembly of dual expression vectors. The plasmid backbone, the promoter module
(comprising the PH and p10 promoters), and the cDNAs encoding the two target genes are amplified by PCR
using primers designed to generate end-terminal homology and combined in a single-step four-fragment
assembly reaction
3.1 Principles Several seamless cloning technologies are now available to assemble
of Homology-Based multiple DNA fragments into a destination plasmid without intro-
Technologies ducing undesired nucleotides or scar sequences between vector and
for Fragment insert. Homology-based techniques—Gibson Assembly [15],
Assembly In-Fusion Cloning (Clontech™, [16]), and SLIC [17]—rely on
PCR to add homologous sequence overhangs to the DNA frag-
ments to be assembled adjacently and on an exonuclease activity to
expose single-stranded overhangs that will anneal with complemen-
tary overlapping fragments.
The Gibson assembly technique [15] relies on an enzyme mix
composed of the T5 exonuclease, which chews back the 50 ends of
DNA fragments, generating long overhangs and allowing the
Production of Multiprotein Complexes Using the Baculovirus Expression. . . 25
3.2 Primer Selection The assembly of a dual expression transfer plasmid involves the
for Homology-Based combination of four DNA fragments with overlapping ends
Cloning which are in general obtained by PCR amplification: the vector
backbone, the dual promoter module, and the two cDNAs
(Fig. 3). Four pairs of oligonucleotides are required.
(a) The region of the plasmid including the divergent promoters
spanning from XhoI to BamHI sites is amplified with primers
named prom-F and prom-R, both including the restriction site
in their sequence and containing a Kozak consensus in their
50 end (see Table 2 for the primer sequences).
(b) The two genes are amplified by a PCR performed with the
primer pairs pH-gene-START-F/pH-gene-STOP-R and p10-
gene-START-F/p10-gene-STOP-R. They are composed of a
50 part corresponding to the cloning junction followed by 30
part complementary to the insert target (see step 4 below).
(c) Finally, the vector backbone, from XbaI to NheI sites, is
amplified with primers Backbone-F and Backbone-R. Note
that, alternatively to PCR amplification, the linearized vector
can be obtained by XbaI/NheI restriction digest followed by
gel purification (see Subheading 3.3).
Construct design and selection of primers for PCR amplifica-
tion are detailed using an example where a dual expression cassette
for the co-expression of eGFP and mCherry is assembled (Fig. 4
and Table 2). We strongly advise using a DNA cloning software
(i.e., Serial cloner, ApE, SnapGene) to define the desired con-
structs, select a set of specific primers, and carefully simulate the
cloning procedure in silico before starting any experiment.
1. Identify plasmids/cDNAs from which the sequences encoding
the proteins of interest will be amplified and carefully verify
their nucleotide sequence. Do not hesitate to re-sequence if
cDNAs were obtained from external sources.
26 Paola Rossolillo et al.
Fig. 4 Plasmid and primer sequences at junctions of a dual expression cassette for co-expression of eGFP and
mCherry. The eGFP and mCherry cDNAs were cloned into pKL (plasmid available from Addgene # Plasmid
#110741). PCR primers were designed to generate DNA fragments with 19- to 21-bp-long overhangs and
maintain the NheI, XhoI, BamHI, and XbaI restriction sites. The 30 region of the eGFP is detailed in panel (a), the
dual promoter region with the 50 region of the eGFP, the p10 and PH promoters, and the 50 region of the
mCherry cDNA in panel (b) and the 30 region of the mCherry cDNA in panel (c). The plasmid backbone is
amplified with the oligonucleotide pair Backbone-R/Backbone-F and the dual-promoter module with the
Production of Multiprotein Complexes Using the Baculovirus Expression. . . 27
Fig. 4 (continued) Prom-R/Prom-F pair. The eGFP and mCherry cDNAs are amplified with the p10-gene-
START-F/p10-gene-STOP-R and the pH-gene-START-F/pH-gene-STOP-R. Note that oligonucleotides for the
amplification of the “promoter” cassette and of the 50 end of the cDNAs are designed to contain a Kozak
consensus CCACCATGG sequence where ATG (in bold) encodes the initiator codon (see Table 2)
28 Paola Rossolillo et al.
3.3 Preparation The linearized vector and the DNA fragments to be assembled are
of the Linearized prepared by PCR, except when the expression cassette is to be
Vector and of the DNA cloned into large transfer vectors such as pAC8_pMF derivatives.
Fragments 1. Set up 50 μL PCR to amplify the promoter and backbone
regions of the plasmid and the two genes (Table 3). Use
1–50 ng of template DNA if you amplify your fragments
from a plasmid. Use 100–200 ng of template if you amplify
your genes from cDNA.
2. Run the PCR in a thermocycler by using the conditions sug-
gested by the polymerase manufacturer. We typically denature
the template DNA at 98 C for 30 s, perform 25 cycles of
amplification (denaturation at 98 C for 10 s, annealing at the
calculated Tm for 15 s, and elongation at 72 C for 30 s in the
case of a 1 kb gene) followed by a final incubation at 72 C for
5 min.
3. Load 1/10 of the PCR volume on a 1% agarose gel in parallel
with a molecular weight marker to verify that the PCR amplifi-
cation resulted in a single band of the expected size.
4. If the fragments are amplified from a plasmid, add ten units of
the DpnI restriction enzyme to the PCR mix and incubate at
37 C for 1 h. DpnI will digest the (methylated) plasmid
template.
5. Purify the PCR on PCR clean-up columns following the
instruction manual, elute bound DNA in 30 μL, and
determine the concentration of the extracted DNA
spectrophotometrically.
We usually prepare between 1 and 2 μg of each fragment. Do
not hesitate to optimize PCR conditions (polymerase buffer,
annealing temperature, addition of DMSO, ) or redesign PCR
primers if yield or PCR specificity are not sufficient (see Note 3).
If DNA fragments are to be cloned into large transfer vectors
such as pAC8_pMF derivatives, the backbone DNA is prepared by
XbaI/NheI restriction and gel purification:
1. Digest 3–5 μg of plasmid in a total volume of 30 μL for 3 h at
37 C with ten units of NheI-HF and XbaI in CutSmart Buffer
(New England Biolabs).
Fig. 5 Plasmid and primer sequences at junctions of a dual expression cassette for co-expression of eGFP and
mCherry fused to a C-terminal histidine tag. The eGFP and mCherry cDNAs were cloned into the pKL derivative
pKL-PH-3C-10His-Cter. PCR primers were designed to generate DNA fragments with 19- to 21-bp-long
overhangs and maintain the NheI, XhoI, BamHI, and XbaI restriction sites. The 30 region of the eGFP cDNA is
detailed in panel (a), the dual promoter region with the 50 region of the eGFP cDNA, the p10 and PH promoters,
and the 50 region of the mCherry cDNA in panel (b), and the 30 region of the mCherry cDNA in panel (c). The
plasmid backbone is amplified with the oligonucleotide pair Backbone-3C-R/Backbone-F and the dual-
promoter module with the Prom-R/Prom-F pair. The eGFP and mCherry cDNAs are amplified with the p10-
gene-START-F/p10-gene-STOP-R and the pH-gene-START-F/pH-gene-10His-3C-R. The amino acid sequence
recognized by the prescission protease (3C) is LEVLFQ!GP (see Table 2)
30 Paola Rossolillo et al.
Table 3
Composition of the PCR mixes for amplification of the plasmid backbone, of the dual-promoter
module, and of the two cDNAs
3.4 SLIC Reaction As mentioned above, different approaches can be used to assemble
DNA fragments into a linearized vector containing overlapping
ends. Sequence and ligation–independent cloning (SLIC), in con-
trast to most other homology-based cloning strategies, does not
necessitate specific kits and only requires T4 DNA polymerase to be
tested first.
1. Set up the T4 DNA polymerase treatment for the four PCR
products in separate tubes. In each tube, mix 1 μg of DNA,
3 μL of 10 NEB 2.1 buffer, and 0.5 U of T4 DNA Polymer-
ase in a final volume of 30 μL. Incubate the reaction for 30 min
at room temperature (see Note 4).
2. Stop the exonuclease reaction by adding 3 μL of a 10 mM
dCTP solution (1/10 of the reaction volume) and leave on
ice. In the absence of dNTPs, the T4 DNA polymerase has a 30
to 50 exonuclease activity and “chews” the DNA leaving a
single-stranded region. Addition of dCTP stops the exonucle-
ase activity and shifts it to a polymerase activity at the first
occurrence of this nucleotide.
3. Prepare an annealing mix containing the polymerase-treated
vector backbone, the dual promoter unit, and the two cDNAs
in a 1:2:2:2 ratio using 250 ng (0.15 pmoles) of a 3 kb vector
and appropriate amount of inserts (see Note 5), in a total
volume of 20 μL. Incubate the annealing mix at 37 C for
30 min and leave on ice until transformation or store at
20 C. A negative control where one of the insert is omitted
can be included to evaluate background.
4. Use 10 μL of the annealing reaction to transform 100 μL of
E. coli competent cells (do not forget to use Pir1 cells for
plasmids with an R6Kγ replication origin). Plate the transfor-
mation mixture on LB agar plates containing the appropriate
antibiotic and incubate overnight at 37 C. If a control experi-
ment lacking one of the fragments was included, significantly
more colonies should be obtained in the presence of all inserts
than in the negative control.
5. Purify plasmid DNA from 6 to 12 colonies for restriction
analysis and sequencing. We typically first digest 500 ng of
purified plasmid with BamHI/XbaI and XhoI/NheI (both in
CutSmart Buffer) to control the presence of the desired inserts
(see Note 6). In the second step, two positive clones are
selected, and their expression cassettes are sequenced (see
sequencing oligos in Table 4).
Table 4
List of primers for colony PCR analysis and sequencing
3.6 Restriction-Free Preparation of multiprotein complexes has its own challenges and
(RF) Cloning specificities. Typically, constructs might need to be modified by
for the Modification mutation, truncation, or deletion of low complexity regions and
of the Existing the position or nature of affinity tags might have to be modified. In
Constructs the example shown in Fig. 6, RF cloning is used to introduce a
cleavable affinity tag at the 30 extremity of a cDNA in a complex
expression construct.
Restriction-free (RF) cloning, developed for the introduction
of a foreign DNA into a plasmid at any predetermined position, is
based on the overlap extension site-directed mutagenesis and popu-
larized under the name QuickChange mutagenesis (Stratagene™)
[18–20]. The sequence of interest is PCR-amplified using two
hybrid primers designed with complementarity to the desired insert
and the destination plasmid (Fig. 7a). The double-stranded PCR
product is used as a mega-primer for the second amplification
reaction (Fig. 7b). In this step, each of the DNA strands anneals
to the destination vector at the predetermined position and is
extended in a linear amplification reaction that leads to the forma-
tion of a double-stranded nicked plasmid. The parental DNA is
then removed by DpnI treatment (Fig. 7c), and the newly synthe-
sized plasmid, containing the DNA insert, is then transformed into
E. coli cells, in which the nicked DNA is ligated by endogenous
enzymatic activity.
1. Collect the plasmid/cDNA required for the first PCR and the
construct that you wish to modify, carefully verify their
sequences, and design the desired construct.
2. Design a pair of hybrid primers with a 50 part complementary to
the destination plasmid followed by a 30 part complementary to
the insert and compatible melting temperatures (see Note 2).
Oligonucleotides typically have a 18–25 bp overlap (Tm#
50 C) with the destination vector and 18–25 bp overlap
(Tm# 50 C) with the insert of interest.
3. Set up the first PCR (50 μL) to amplify the fragment to be
introduced using high-fidelity polymerase according to the
manufacturer’s instructions (see Note 8). Use 1–50 ng of tem-
plate DNA containing the sequence of interest if you amplify
your fragment from a plasmid. Use 100–200 ng of template if
you amplify your fragment from cDNA.
34 Paola Rossolillo et al.
Fig. 6 Modification of an existing construct. In this example, RF cloning is used to introduce a cleavable affinity
tag (3C-twinstrep) at the 30 extremity of the MAT1 cDNA which is part of a multigene expression construct. The
sequence of the modified plasmid where the existing part (in blue) and the insert (in green) are shown. The
hybrid primers MAT1-TwinStrep-FW and MAT1-TwinStrep-RV used to amplify the insert (3C cleavage site and
Twin-Strep tag) and introduce 20–22 bp overhangs matching the MAT1 gene at the insertion point (immedi-
ately before the Stop codon) are also displayed
Fig. 7 Principle of site-directed insertion by RF cloning. (a) A first PCR amplifies the sequence to be inserted
(green, double-stranded) and introduces overhangs at each end (light blue strands), which overlap the
insertion site at the destination vector. The primers contain a target-specific sequence and an 18–25 bp
extension overlapping the desired insertion sites at the destination vector. The double-stranded PCR product is
then used as a megaprimer for the second amplification reaction. (b) In this step, each of the DNA strands
anneals to the destination vector and extends in a linear amplification reaction using the destination vector
(navy blue circumferences) as template, leading to a double-stranded nicked plasmid. (c) The parental DNA is
then removed by DpnI treatment, and newly synthesized plasmid, containing the DNA insert, is transformed
into Escherichia coli cells where the nicked DNA is sealed by endogenous repair activities. (d) Agarose gel
electrophoresis of the product from the first (left panel) and second (right panel) PCRs. The amplified insert
(lane 2, 132 bp) was used as a mega-primer to generate the desired vector (lane 4, 5800 bp). The Phusion
DNA polymerase was omitted in the negative control (lanes 1 and 3). Note that the 132-bp fragment, visible in
the negative control (lane 3), has been consumed in the presence of DNA polymerase (lane 4)
4 Notes
500
Insert ðngÞ ¼ 2 250 ¼ 83:3 ng of insert
3000
6. As an alternative to restriction digestion, the presence of the
correct inserts can be checked by PCR or colony-PCR and
amplification across two or more assembled fragments, for
example, by using one primer that hybridizes on the coding
sequence and another on the plasmid backbone.
7. When using the In-Fusion reaction, the step of DNA purifica-
tion may be avoided if the PCR products show one clean band
of the expected size after gel electrophoresis. These samples
may be treated with Cloning Enhancer in the same PCR tube
and used directly to set up the In-Fusion reaction. Add 2 μL of
Cloning Enhancer to 5 μL of the PCR product and incubate at
37 C for 15 min, followed by 80 C for 15 min. Use a
thermocycler for accurate temperature control.
8. It is important to have a sharp, specific PCR band as a mega-
primer. The eventual gel purification of the PCR should be
avoided since it can impact the efficiency of the following PCR
amplification reaction. It is crucial to optimize the PCR condi-
tions until a specific band is obtained.
9. Agarose gel electrophoresis after the second PCR is optional.
Even if the discrete band of the high molecular weight PCR
product is not clearly visible, there might be enough material to
obtain several colonies. You can proceed immediately to E. coli
transformation step after DpnI treatment.
Acknowledgments
References
1. Contreras-Gomez A, Sanchez-Miron A, using the baculovirus expression system. Meth-
Garcia-Camacho F, Molina-Grima E, Chisti Y ods Mol Biol 1261:91–114
(2014) Protein production using the 12. Abdulrahman W, Iltis I, Radu L, Braun C,
baculovirus-insect cell expression system. Bio- Maglott-Roth A, Giraudon C, Egly JM,
technol Prog 30(1):1–18 Poterszman A (2013) ARCH domain of
2. Martinez-Solis M, Herrero S, Targovnik AM XPD, an anchoring platform for CAK that con-
(2019) Engineering of the baculovirus expres- ditions TFIIH DNA repair and transcription
sion system for optimized protein production. activities. Proc Natl Acad Sci U S A 110(8):
Appl Microbiol Biotechnol 103(1):113–123 E633–E642
3. Berger I, Poterszman A (2015) Baculovirus 13. Kobbi L, Demey-Thomas E, Braye F, Proux F,
expression: old dog, new tricks. Bioengineered Kolesnikova O, Vinh J, Poterszman A, Ben-
6(6):316–322 saude O (2016) An evolutionary conserved
4. Gupta K, Tolzer C, Sari-Ak D, Fitzgerald DJ, Hexim1 peptide binds to the Cdk9 catalytic
Schaffitzel C, Berger I (2019) MultiBac: site to inhibit P-TEFb. Proc Natl Acad Sci U
baculovirus-mediated multigene DNA cargo S A 113(45):12721–12726
delivery in insect and mammalian cells. Viruses 14. Radu L, Schoenwetter E, Braun C, Marcoux J,
11(3):198 Koelmel W, Schmitt DR, Kuper J, Cianferani S,
5. Berger I, Fitzgerald DJ, Richmond TJ (2004) Egly JM, Poterszman A, Kisker C (2017) The
Baculovirus expression system for heterolo- intricate network between the p34 and p44
gous multiprotein complexes. Nat Biotechnol subunits is central to the activity of the tran-
22(12):1583–1587 scription/DNA repair factor TFIIH. Nucleic
6. Fitzgerald DJ, Berger P, Schaffitzel C, Acids Res 45(18):10872–10883
Yamada K, Richmond TJ, Berger I (2006) Pro- 15. Gibson DG, Young L, Chuang RY, Venter JC,
tein complex expression by using multigene Hutchison CA 3rd, Smith HO (2009) Enzy-
baculoviral vectors. Nat Methods 3 matic assembly of DNA molecules up to several
(12):1021–1032 hundred kilobases. Nat Methods 6
7. Trowitzsch S, Bieniossek C, Nie Y, Garzoni F, (5):343–345
Berger I (2010) New baculovirus expression 16. Irwin CR, Farmer A, Willer DO, Evans DH
tools for recombinant protein complex produc- (2012) In-fusion(R) cloning with vaccinia
tion. J Struct Biol 172(1):45–54 virus DNA polymerase. Methods Mol Biol
8. Weissmann F, Petzold G, VanderLinden R, 890:23–35
Huis In’t Veld PJ, Brown NG, Lampert F, 17. Li MZ, Elledge SJ (2007) Harnessing homol-
Westermann S, Stark H, Schulman BA, Peters ogous recombination in vitro to generate
JM (2016) biGBac enables rapid gene assembly recombinant DNA via SLIC. Nat Methods 4
for the expression of large multisubunit protein (3):251–256
complexes. Proc Natl Acad Sci U S A 113(19): 18. Bryksin AV, Matsumura I (2010) Overlap
E2564–E2569 extension PCR cloning: a simple and reliable
9. Zhang Z, Yang J, Barford D (2016) Recombi- way to create recombinant plasmids. Biotech-
nant expression and reconstitution of multi- niques 48(6):463–465
protein complexes by the USER cloning 19. Unger T, Jacobovitch Y, Dantes A,
method in the insect cell-baculovirus expres- Bernheim R, Peleg Y (2010) Applications of
sion system. Methods 95:13–25 the Restriction Free (RF) cloning procedure
10. Osz-Papai J, Radu L, Abdulrahman W, Kolb- for molecular manipulations and protein
Cheynel I, Troffer-Charlier N, Birck C, expression. J Struct Biol 172(1):34–44
Poterszman A (2015) Insect cells-baculovirus 20. van den Ent F, Lowe J (2006) RF cloning: a
system for the production of difficult to express restriction-free method for inserting target
proteins. Methods Mol Biol 1258:181–205 genes into plasmids. J Biochem Biophys Meth-
11. Abdulrahman W, Radu L, Garzoni F, ods 67(1):67–74
Kolesnikova O, Gupta K, Osz-Papai J, 21. Bustin SA, Mueller R, Nolan T (2020) Para-
Berger I, Poterszman A (2015) The produc- meters for successful PCR primer design.
tion of multiprotein complexes in insect cells Methods Mol Biol 2065:5–22
Chapter 3
Abstract
Macromolecular complexes govern the majority of biological processes and are of great biomedical
relevance as factors that perturb interaction networks underlie a number of diseases, and inhibition of
protein–protein interactions is a common strategy in drug discovery. Genome editing technologies enable
precise modifications in protein coding genes in mammalian cells, offering the possibility to introduce
affinity tags or fluorescent reporters for proteomic or imaging applications in the bona fide cellular context.
Here we describe a streamlined procedure which uses the CRISPR/Cas9 system and a double-stranded
donor plasmid for efficient generation of homozygous endogenously GFP-tagged human cell lines. Estab-
lishing cellular models that preserve native genomic regulation of the target protein is instrumental to
investigate protein localization and dynamics using fluorescence imaging but also to affinity purify asso-
ciated protein complexes using anti-GFP antibodies or nanobodies.
Key words CRISPR/Cas9, Genome editing, Double-stranded DNA donors, Fluorescent protein
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
39
40 Sylvain Geny et al.
2 Materials
1. T75 cell culture flasks (75 cm2) (Corning, cat. no. 431464 U).
2. McCoy’s 5a or DMEM medium supplemented with 10% fetal
bovine serum (FBS), 4 mM GlutaMAX™ (Gibco, cat.
no. 35050061) and 1% PenStrep (Gibco, cat. no. 15140-122).
3. Phosphate-buffered saline (PBS).
4. Trypsin–EDTA solution (0.025% w/v Trypsin, 0.05 mM
EDTA in 1 PBS) (Gibco, cat. no. R001100).
Table 1
XPB locus
U-2 OSXPB::GFP
Chromosome/gene Chr. 2/XPB
Homology arms 50 Chr.2: 127257599–127257872 (hg 38)
30 Chr.2: 127257596–127256813 (hg 38)
sgRNA 50 TAGGAAATGATGCTTAGGCAggg 30
Selection marker Puromycin
sgRNA-FW 50 ACACCG TAGGAAATGATGCTTAGGC G 30
sgRNA-RV 50 AAAAC TGCCTAAGCATCATTTCCTA CG
U6-seq 50 CAGGGTTATTGTCTCATGAGCGG-30
XPB-FW 50 AGACAGTAAGCGATCTGTAAACA 30
XPB-RV 50 ACCCCACTCCCCAAAAAGTT 30
XPB-FW2 50 TCCTCTTCTTTCAGGTGTGGA 30
GFP-RV 50 GAACTTCAGGGTCAGCTTGC 30
Puro-FW 50 GCAACCTCC CCTTCTACGAG 30
XPB-RV2 50 GCGAATATGCCTTATGTGTG 30
Target sequence for the sgRNA used for editing the C-terminus of the XPB gene. Online web applications such as
CRISPOR ([Link] aimed at optimizing CRISPR knock-in tag experimentation identify and rank
potential guide RNAs in an input sequence. Oligonucleotides for sense and antisense strands designed with CRISPOR
software for cloning into MLM3636 (sgRNA-FW and sgRNA-RV) as well as for genomic screening (XPB-FW, RV) are
detailed. Efficient transcription from the U6 promoter requires a 50 G (underlined)
42 Sylvain Geny et al.
2.2.2 Pool and Clone 1. QuickExtract DNA solution (Viagen, cat. no. 302C).
Analysis 2. Oligonucleotides for PCR amplification and sequencing (see
Table 1).
3. Phusion high-fidelity DNA polymerase with buffer and dNTPs
(New England BioLabs, cat. no. M053OS).
4. PCR isolation kit (Macherey-Nagel™ NucleoSpin™ Gel and
PCR Clean-up Kit).
2.3.2 FACS Sorting Sorting of GFP-fluorescent cells was carried out on a Melody FACS
(BD), and analysis of GFP-positive cells was carried on an Accuri
C6 analyzer (BD). You will need:
1. Cytometry Falcon tubes (Becton Dickinson).
2. Tissue culture plate, 96 wells (Eppendorf, cat.
no. EP0030730119).
2.4.2 Western Blot 1. 150-mm Petri dishes (Falcon® 150 mm TC-treated dishes,
Analysis Corning, cat. no. 353025).
2. Cell scrapers (Dominique Dutscher, cat. no. 353085).
3. PBS containing 30% w/v glycerol (Sigma Aldrich, cat.
no. G5516).
4. RIPA buffer: 20 mM Tris-HCl or HEPES, pH 7.5, 120 mM
KCl, 1% NP-40, 0.1% SDS, 1 mM EDTA, 0.5%
Na-deoxycholate, supplemented with protein inhibitor cocktail
(Roche™) and 0.5 mM 1,4-dithreothiol (DTT) (Sigma
Aldrich).
5. Lysis buffer: 20 mM Tris or HEPES, 250 mM KCl, NP-40
0.05% supplemented with protein inhibitor cocktail (Roche™)
and 0.5 mM DDT.
6. Protein assay dye reagent (Bio-Rad, cat. no. 5000006).
7. Laemmli buffer 4: 60 mM Tris-HCl, pH 6.8, 10% glycerol,
2% SDS, 0.0005% Bromophenol Blue, 355 mM
β-mercaptoethanol.
8. SDS PAGE gels, PVDF transfer membranes, 3MM Whatman
paper.
9. TBST: 20 mM Tris/HCl pH 7.4, 150 mM NaCl, 0.1% Tween-
20.
10. Non-fat dry milk or BSA powder.
11. Western blotting detection reagents (Amersham ECL Prime,
cat no. 3030-931).
12. Primary antibodies against the target protein or against the
GFP tag and corresponding secondary antibodies coupled to
horseradish peroxidase (HRP). For the detection of XPB pro-
tein, we used a mouse monoclonal anti-XPB antibody (1B3,
MABE1123, Sigma-Aldrich) and a donkey anti-mouse anti-
body coupled with HRP.
3 Methods
3.1 Design The design of the sgRNA and HDR donor depends on the nature
of the sgRNAs and position of the tag (see Note 2). As the efficiency of HDR
insertion varies with the distance from the DSB, the DSB (gener-
ated 3 bp upstream of the PAM sequence corresponding to the
sgRNA) should be as close as possible to the insertion site of tag.
For example, to tag a protein at its C-terminal end, the DSB should
be as close as possible to the stop codon of the gene of interest
(Fig. 3).
synthetic
Cas protein ssDNA Nucleofection
crRNA:tracRNA
in vitro
Cas mRNA PCR product
transcribed sgRNA
Fig. 1 Experimental workflow for CRISPR/Cas9-mediated genome editing. Several sources of Cas nuclease,
guide RNA and donor template can be used. We detailed a protocol that utilizes electroporation (nucleofection)
for the delivery of plasmidic reagents (donor, Cas9, sgRNA)
Tagging Proteins with Fluorescent Reporters Using the CRISPR/Cas9 System. . . 45
sgRNA
Chr.2
STOP
XPB exon Last exon
STOP
5’ HA GFP P2A Puro 3’ HA
STOP
XPB exon Last exon
Fig. 2 Schematic of the tagging strategy for the XPB locus. To introduce a GFP tag at the C-terminal end of the
XPB gene, we select an sgRNA to generate a CRISPR/Cas9-induced DSB in vicinity of the stop codon of the
XPB gene. The donor plasmid contains the eGFP-2A-Puro coding sequence flanked by respectively 300 and
800 bp homology arms (50 and 30 HA). The eGFP-2A-Puro coding sequence is inserted at the position of the
XPB STOP codon and in frame with the last exon of the target protein
A
Cas9
TAGGAAATGATGCTTAGGCA PAM
ATCCTTTACTACGAATCCGT
||||||||||||||||||||
UAGGAAAUGAUGCUUAGGCA
sgRNA
Fig. 3 Design of sgRNAs and HDR donor sequences. (a) Schematic representation of the Cas9 protein (gray)
bound to sgRNA (red) and targeted to genomic DNA (black). The PAM sequence (GGG with overbar), the Cas9
cleavage sites (black triangles), and the stop codon of the XPB gene (TGA, in cyan) are indicated. A ribbon
representation of the Cas9 nuclease from Streptococcus pyogenes bound to PAM-containing DNA target is
shown in the right panel (PDB code, 4UN3; [30]). (b) Repair donor designed to insert the eGFP-2A-Puro coding
sequence (all in frame with the last exon of the target protein) upstream of the XPB STOP codon (TGA).
Nucleotides targeted by the sgRNA are in bold. After integration of the tag, the sequence is significantly
modified (red line above the + strand), preventing cleavage of the repaired locus by Cas9
3.2.1 Nucleofection 1. Thaw and maintain U2-OS cells using your favorite protocol
(see Note 1). We usually split cells 1:5 every 3–4 days, verify
that the viability is always higher than 95% and limit the num-
ber of passages to 20.
2. Two or three days before nucleofection, seed two 75-cm2 flasks
and incubate at 37 C, 5% CO2.
3. When 50–70% confluence is reached, detach the cells with
trypsin, spin-down in a 15-mL tube at 90 g at room tempera-
ture for 10 min, remove the supernatant and re-suspend the
cells in PBS to a concentration of 1–3 106 cells/mL.
4. Aliquot 106 cells into 1.5-mL microcentrifuge tubes (one tube
per guide RNA to be tested plus an additional tube for a
negative control), pellet the cells, discard supernatant
completely, and resuspend cells in Nucleofector® solution
(100 μL per sample).
5. Prepare the DNA mixes containing 2 μg of guide sgRNA
plasmid (sgXPB) and 2 μg of plasmid expressing the SpCas9
protein (JDS246) in a total volume less than 10 μL.
6. Mix the DNA solution with 100 μL of cell suspension and
transfer to a cuvette. Process the samples quickly to avoid
storing the cells longer than 10 min in Nucleofector®
Solution V.
7. Insert the cuvette into the Nucleofector®, select the cell-type-
specific program X-001 and press the start button. Using the
provided pipette, immediately remove the sample from the
cuvette and transfer into the six-well plate containing 2 mL of
culture medium.
8. Incubate the six-well plates at 37 C, 5% CO2 and proceed to
analysis or collect the cells and store the cell pellet at 20 C.
Table 2
Composition of the PCR mix used to amplify the genomic site XPB
6. Upload the trace files and the guide RNA sequence (20 nt) into
the TIDE web tool (available at [Link] and https://
[Link]) and perform the analysis with default
parameters.
Use the TIDE assay to compare the efficiency of the different
guides and select the best experimental conditions for further
experiments. An example of TIDE analysis is provided on the
TIDE website.
ggtggtggcggttcaggcggaggtggctctggcggtggcggatcggccATGGTGAGCAAGGGCGAGGAGCTGTTCACCGG
GGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATG
CCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACC
CTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGA
AGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCG
ACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTAC
AACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAA
CATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCG
ACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTC
GTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGtacagcggtcgcgactctagagtcgacggttctGG
TAAGCAAACTTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCCGGGCCCgcatgcaagcttcagc
tgaagcttaccATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTC
GCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCA
AGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGA
CCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTG
GCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGT
CTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGC
CCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAG
GTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA
Fig. 4 eGFP-2A-Puro nucleotide sequence. cDNAs encoding gGFP and the puromycin resistance genes are in
green and blue, respectively, the P2A peptide in red and linker regions in black
target protein and that the guide RNA or PAM sequence has
been modified to prevent cleavage by Cas9. If that is not the
case, introduce point mutations to avoid unwanted mutations
being introduced after integration.
Having precisely defined the donor sequence, different options
can be considered to prepare the donor plasmid.
3. Purchasing the designed sequence from your preferred supplier
is the easiest approach. Alternatively, you can amplify the
eGFP-P2A-PURO coding sequence from an existing plasmid,
the homology arms from genomic DNA, and assemble the
three fragments into your preferred cloning vector using
restriction enzyme-free technologies (see Note 4).
Tagging Proteins with Fluorescent Reporters Using the CRISPR/Cas9 System. . . 51
3.4 Gene Targeting When the CRISPR/Cas9 reagents are ready, you can proceed to
and Isolation of Gene genome editing with CRISPR/Cas9 to generate cell lines that
Edited Cells by FACS express an endogenously tagged protein. The strategy detailed
Sorting below relies on antibiotic selection combined with fluorescence-
activated cell sorting (FACS) for enrichment in HDR during
genome editing. FACS is an efficient technology which allows to
simultaneously measure the knock-in efficiency by counting fluo-
rescently positive cells and sort isolated cells into 96-well plates. As
cell sorting relies on the expression levels of the fluorescent-tagged
proteins driven by endogenous promoters, isolation of positive
clones can be challenging for proteins expressed at low levels.
3.4.2 Isolation of Gene Proceed to FACS sorting 7 days after the beginning of the puro-
Edited Cells by FACS mycin treatment (or 3 days after nucleofection in absence of antibi-
Sorting otic selection). Use non-transfected cells as negative control for
gating.
1. Prepare 96-well plates containing 100 μL of growth medium in
each well.
2. Wash cells with PBS, add 1 mL of trypsin and transfer the
resuspended cells in a 1.5-mL microcentrifuge tube containing
0.5 mL of medium.
3. Centrifuge the cell suspension for 5 min at 90 g at room
temperature, remove the supernatant, resuspend the cells in
1 mL PBS containing 2% FBS, and filter the cells through a
50-μm cell strainer into a sterile flow cytometry tube.
4. Turn on the cytometer, run the cleaning/calibration proce-
dures and load settings to detect GFP. Refer to the user manual
of your instrument for detailed procedures.
5. Run the non-transfected cells to check the cell sorter para-
meters and establish gates to select single live cells (Fig. 5).
For single cells, plot forward scatter linear (FCS) on the y-axis
and the fluorescent channel (GFP-FL) on the x-axis. Ideally, set
a background threshold where less than 0.1% of the
non-transfected control cells are counted as GFP positive.
52 Sylvain Geny et al.
A B
105 105
104 104
FSC
FSC
103 103
102 102
Fig. 5 FACS analysis of wild-type and modified U2-OS cells. Non-transfected U2-OS cells (a) and CRISPR/Cas9
modified cells in which a GFP tag is fused to the C-terminus of XPB (b) were analyzed for the expression of a
green fluorescent protein (b). Both the plots show the green fluorescence intensity (GFP-FL) versus the forward
scatter (FSC). U2-OS wild-type cells served as a negative control (blue dots) and define background signal;
gates for the GFP-positive cells (green dots) were set accordingly. The GFP-positive cells were sorted into
96-well plates to obtain single clones expressing XPB-eGFP
6. Repeat with the cell population to be sorted and verify that the
CRISPR/Cas9-modified cells can be differentiated from
parental cells. Run the transfected cells to quantify the amount
of fluorescently labeled cells and define the collection gate. The
fluorescent signal depends on expression levels of the target
gene and can be relatively dim (Fig. 6b).
7. Sort the positive cells into the 96-well plates and incubate at
37 C, 5% CO2.
8. After ~5 days, identify 24 single-cell clones for validation and
keep them growing. Maintain the cells in 96-well plates until
you can proceed to validation. Split cells by trypsinization when
required.
3.5 Validation This section details: (1) genotyping of the knock-in cell clones by
of Selected Clones PCR to verify that the fluorescent marker was correctly inserted at
the target locus and to test for homozygosity, (2) Western blot
analysis to verify that the GFP fusion protein is effectively
expressed, and (3) fluorescence microscopy to validate expression
and localization of the tagged protein.
3.5.1 Validation 1. Split cells from each positive well into two 96-well plates. The
at the Genomic Level day after, spin down and wash the cells in one of the plates
with PBS.
Tagging Proteins with Fluorescent Reporters Using the CRISPR/Cas9 System. . . 53
A B
FP
-G
PB
:X
OS
OS
U2
U2
250
130 XPB-GFP
70 XPB
55
35
25
1 2
Fig. 6 Validation of engineered cell lines. (a) Western blot analysis of engineered
U2-OS cells in which wild-type XPB was replaced by C-terminal GFP-tagged
version (U2-OSXPB::GFP, lane 2). Unmodified U2-OS cells were used as control
(U2-OS, lane 1) (Adapted from Sandoz et al. 2019). (b) GFP fluorescence of living
U2-OSXPB::GFP cells observed using an inverted microscope equipped with a 63
immersion objective
3.5.2 Western Blot 1. Seed five 150-mm Petri dishes containing 25 mL of growth
Analysis medium and incubate at 37 C, 5% CO2 until a confluency of
80% is reached.
2. Wash the plate with PBS containing 30% w/v glycerol, detach
the cells with a scraper, and after centrifugation at 1000 g for
10 min at 4 C, snap freeze the pellet in liquid nitrogen and
store at 80 C. We usually prepare batches of 15 106 and
25 106 cells.
3. Resuspend 15 106 cells in 150 μL of RIPA buffer and
incubate for 10 min by pipetting up and down.
54 Sylvain Geny et al.
3.5.3 Fluorescence We typically select four positive clones and include the
Microscopy non-modified cell line as control. The target protein being fused
to GFP, expression of a fluorescent fusion protein can be checked
using an epifluorescence inverted microscope. Live or fixed cell
imaging can be performed.
1. Seed glass-bottom dishes/plates with clones that have been
tested positive until 70–80% confluency is reached.
2. For live cell imaging, change the medium to a phenol red-free
medium and observe cells using an inverted epifluorescence
microscope with adapted filters (i.e., an FITC filter for GFP
detection). Maintain cells at 37 C in the incubation chamber
of the microscope. Record images with a 63/1.4 NA
Tagging Proteins with Fluorescent Reporters Using the CRISPR/Cas9 System. . . 55
4 Notes
Acknowledgments
References
1. Villicana C, Cruz G, Zurita M (2014) The 6. Dalvai M, Loehr J, Jacquet K, Huard CC,
basal transcription machinery as a target for Roques C, Herst P, Cote J, Doyon Y (2015)
cancer therapy. Cancer Cell Int 14(1):18 A scalable genome-editing-based approach for
2. Scott DE, Bayly AR, Abell C, Skidmore J mapping multiprotein complexes in human
(2016) Small molecules, big targets: drug dis- cells. Cell Rep 13(3):621–633
covery faces the protein-protein interaction 7. Dewari PS, Southgate B, McCarten K,
challenge. Nat Rev Drug Discov 15 Monogarov G, O’Duibhir E, Quinn N,
(8):533–550 Tyrer A, Leitner MC, Plumb C,
3. Bushweller JH (2019) Targeting transcription Kalantzaki M, Blin C, Finch R, Bressan RB,
factors in cancer—from undruggable to reality. Morrison G, Jacobi AM, Behlke MA, von
Nat Rev Cancer 19(11):611–624 Kriegsheim A, Tomlinson S, Krijgsveld J, Pol-
4. Doudna JA, Charpentier E (2014) Genome lard SM (2018) An efficient and scalable pipe-
editing. The new frontier of genome engineer- line for epitope tagging in mammalian stem
ing with CRISPR-Cas9. Science 346 cells using Cas9 ribonucleoprotein. elife 7
(6213):1258096 8. Geny S, Pichard S, Poterszman A, Concordet J
5. Jinek M, Chylinski K, Fonfara I, Hauer M, (in press) Gene tagging with the CRISPR-Cas9
Doudna JA, Charpentier E (2012) A program- system to facilitate macromolecular complex
mable dual-RNA-guided DNA endonuclease purification. Methods Mol Biol
in adaptive bacterial immunity. Science 337
(6096):816–821
Tagging Proteins with Fluorescent Reporters Using the CRISPR/Cas9 System. . . 57
9. Compe E, Egly JM (2016) Nucleotide excision cells with zinc finger nucleases constructed via
repair and transcriptional regulation: TFIIH modular assembly. Genome Res 19
and beyond. Annu Rev Biochem 85:265–290 (7):1279–1288
10. Kolesnikova O, Radu L, Poterszman A (2019) 20. Guschin DY, Waite AJ, Katibah GE, Miller JC,
TFIIH: a multi-subunit complex at the cross- Holmes MC, Rebar EJ (2010) A rapid and
roads of transcription and DNA repair. Adv general assay for monitoring endogenous
Protein Chem Struct Biol 115:21–67 gene modification. Methods Mol Biol
11. Sandoz J, Nagy Z, Catez P, Caliskan G, Geny S, 649:247–256
Renaud JB, Concordet JP, Poterszman A, 21. Brinkman EK, Chen T, Amendola M, van
Tora L, Egly JM, Le May N, Coin F (2019) Steensel B (2014) Easy quantitative assessment
Functional interplay between TFIIH and of genome editing by sequence trace decompo-
KAT2A regulates higher-order chromatin sition. Nucleic Acids Res 42(22):e168
structure and class II gene expression. Nat 22. Paix A, Rasoloson D, Folkmann A, Seydoux G
Commun 10(1):1288 (2019) Rapid tagging of human proteins with
12. Yeh CD, Richardson CD, Corn JE (2019) fluorescent reporters by genome engineering
Advances in genome editing through control using double-stranded DNA donors. Curr Pro-
of DNA repair pathways. Nat Cell Biol 21 toc Mol Biol 129(1):e102
(12):1468–1478 23. Paix A, Schmidt H, Seydoux G (2016) Cas9-
13. Chu VT, Weber T, Wefers B, Wurst W, assisted recombineering in C. elegans: genome
Sander S, Rajewsky K, Kuhn R (2015) Increas- editing using in vivo assembly of linear DNAs.
ing the efficiency of homology-directed repair Nucleic Acids Res 44(15):e128
for CRISPR-Cas9-induced precise gene edit- 24. Auer TO, Del Bene F (2014) CRISPR/Cas9
ing in mammalian cells. Nat Biotechnol 33 and TALEN-mediated knock-in approaches in
(5):543–548 zebrafish. Methods 69(2):142–150
14. Sluch VM, Chamling X, Wenger C, Duan Y, 25. Liu Z, Chen O, Wall JBJ, Zheng M, Zhou Y,
Rice DS, Zack DJ (2018) Highly efficient scar- Wang L, Ruth Vaseghi H, Qian L, Liu J (2017)
less knock-in of reporter genes into human and Systematic comparison of 2A peptides for clon-
mouse pluripotent stem cells via transient anti- ing multi-genes in a polycistronic vector. Sci
biotic selection. PLoS One 13(11):e0201683 Rep 7(1):2193
15. Sentmanat MF, Peters ST, Florian CP, Con- 26. Chen X, Zaro JL, Shen WC (2013) Fusion
nelly JP, Pruett-Miller SM (2018) A survey of protein linkers: property, design and function-
validation strategies for CRISPR-Cas9 editing. ality. Adv Drug Deliv Rev 65(10):1357–1369
Sci Rep 8(1):888 27. Koch B, Nijmeijer B, Kueblbeck M, Cai Y,
16. Vouillot L, Thelie A, Pollet N (2015) Compar- Walther N, Ellenberg J (2018) Generation
ison of T7E1 and surveyor mismatch cleavage and validation of homozygous fluorescent
assays to detect mutations triggered by engi- knock-in cells using CRISPR-Cas9 genome
neered nucleases. G3 (Bethesda) 5 editing. Nat Protoc 13(6):1465–1487
(3):407–415 28. Kimple ME, Brill AL, Pasker RL (2013) Over-
17. Renaud JB, Boix C, Charpentier M, De Cian A, view of affinity tags for protein purification.
Cochennec J, Duvernois-Berthet E, Curr Protoc Protein Sci 73:19–23
Perrouault L, Tesson L, Edouard J, 29. Rossolillo P, Kolesnikova O, Essabri K, Ramon
Thinard R, Cherifi Y, Menoret S, Zamorano G, Poterszman A (in press) Produc-
Fontaniere S, de Croze N, Fraichard A, tion of multiprotein complexes using the Bacu-
Sohm F, Anegon I, Concordet JP, Giovannan- lovirus expression system: homology based and
geli C (2016) Improved genome editing effi- Restriction Free cloning strategies for con-
ciency and flexibility using modified struct design. Methods Mol Biol
oligonucleotides with TALEN and CRISPR-
Cas9 nucleases. Cell Rep 14(9):2263–2272 30. Anders C, Niewoehner O, Duerst A, Jinek M
(2014) Structural basis of PAM-dependent tar-
18. Shan Q, Wang Y, Li J, Gao C (2014) Genome get DNA recognition by the Cas9 endonucle-
editing in rice and wheat using the CRISPR/ ase. Nature 513(7519):569–573
Cas system. Nat Protoc 9(10):2395–2410
19. Kim HJ, Lee HJ, Kim H, Cho SW, Kim JS
(2009) Targeted genome editing in human
Chapter 4
Abstract
Mammalian cells are the most commonly used production system for therapeutic antibodies. Protocols for
the expression of recombinant antibodies in HEK293-6E cells in different antibody formats are described in
detail. As model, antibodies against Kallikrein-related peptidase 7 (KLK7) were used. KLK7 is a key player
in skin homeostasis and represents an emerging target for pharmacological interventions. Potent inhibitors
can not only help to elucidate physiological and pathophysiological functions but also serve as a new
archetype for the treatment of inflammatory skin disorders. Phage display-derived affinity-matured human
anti-KLK7 antibodies were converted to scFv-Fc, IgG, and Fab formats and transiently produced in the
mammalian HEK293-6E system. For the production of the corresponding antigen—KLK7—the baculo-
virus expression vector system (BEVS) and virus-free expression in Hi5 insect cells were used in a
comparative approach. The target proteins were isolated by various chromatographic methods in a one-
or multistep purification strategy. Ultimately, the interaction between anti-KLK7 and KLK7 was character-
ized using biolayer interferometry. Here, protocols for the expression of recombinant antibodies in
different formats are presented and compared for their specific features. Furthermore, biolayer interferom-
etry (BLI), a fast and high-throughput biophysical analytical technique to evaluate the kinetic binding
constant and affinity constant of the different anti-KLK7 antibody formats against Kallikrein-related
peptidase 7 is presented.
Key words Transient gene expression, Recombinant antibody formats, scFv, scFv-Fc, Fab, IgG,
Biolayer interferometry, Kallikrein-related protease 7
1 Introduction
1.1 Aim of the Study The functional and structural analyses of mammalian protein and
protein complexes require simple, robust, and efficient protein
production systems. Virus-free transient gene expression in insect
cell lines and mammalian cell lines as well as the baculoviral expres-
sion vector system allows the purification of ample amounts of
high-quality protein [1, 2]. Furthermore, adequate biochemical
and biophysical methods are essential for the kinetic analysis of
the binding affinity. Biolayer interferometry is a simple method
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
59
60 Jens König et al.
1.2 Expression Below, the set of expression vectors to generate different antibody
of Different formats and purification recombinant proteins expressed in
Recombinant Antibody HEK293-6E cells is described. The HEK293-6E cell line is espe-
Formats cially qualified for fast and simple protein production as this cell line
is compatible with the plasmid-based expression using polyethyle-
nimine (PEI) [1, 2, 16]. The VH and VL coding fragments are
cloned in specific vector pairs to be able to generate scFv, homo-
dimeric scFv-Fc, heterodimeric Fab, or tetrameric IgG antibodies
[9–11] (see Fig. 1)
Expression of Recombinant Antibodies in Different Formats 61
Fig. 1 Recombinant antibody formats compared to IgG. IgGs are large heterotetrameric molecules and depend
on homodimerization of the Fc region (fragment crystallizable) of two identical heavy chains (HCs) and the
subsequent assembly of two identical light chains (LCs) via disulfide linkages. The modular structure of
multiple immunoglobulin domains allows for recombinant antibody formats with preserved antigen binding in
a less complex dimeric (Fab, scFv-Fc) or single-chain structure (scFv). Red and grey: heavy chain; blue: light
chain; orange: artificial peptide linker
1.3 Analysis Binding affinities of antibodies to their target protein (antigen) can
of the Binding Kinetics be determined by the dip and read biosensor technology of the
of the Antibodies OctetRed System. This technology uses biolayer interferometry
and KLK7 Using (BLI) to measure protein–protein interactions [3]. The data are
Biolayer generated in real time, allowing kinetic analysis as well as quantita-
Interferometry (BLI) tive analysis of bound protein. Here, we describe the application to
determine the binding affinity KD of immobilized biotinylated-
KLK7 to streptavidin sensors to the different antibody formats.
After initial equilibration of the biosensor, the ligand (KLK7) is
tightly bound to the tip. Binding of protein results in a change of
the thickness of the biolayer at the tip of the biosensor. The increase
in thickness of the biolayer results in a change of the interference
between two reflected beams from the internal reference layer and
the surface of the tip used for specific binding to the protein
samples. The binding of protein is detected and reported as a
change in wavelength. In this way, the association and dissociation
of the antibody to the immobilized KLK7 can be followed in time
for a range of concentrations using parallel tips. The kinetic con-
stants can be calculated from these curves presuming a 1:1 interac-
tion stoichiometry, which allows proper fitting of the curves.
2 Materials
describe the necessary materials needed for fast and efficient protein
expression of the materials required for kinetic analysis of the
binding of the different antibody format to the KLK7 target pro-
tein by biolayer interferometry (BLI).
2.1 Expression All cloning steps were performed using standard restriction enzyme
Vectors digestion with subsequent ligation. Alternatively, the sequence-
and ligation-independent cloning (SLIC) technique according to
Li et al. [17] was used to generate the expression clones. DNA
preparation for transient gene expression was done using the Pure-
Yield Plasmid Midiprep kit (Promega) or the endotoxin-free Plas-
mid DNA Gigaprep kit (Qiagen). The construction of the cloning
vectors is described in detail in J€ager et al. [16].
1. pCSE2.6-hIgG1-Fc-LUP37-A10 (Expression vector for the
synthesis of the antibody LUP37-A10 in the scFv-Fc format).
2. pCSE2.6-hIgG1-Fc-LUP37-B10 (Expression vector for the syn-
thesis of the antibody LUP37-B10 in the scFv-Fc format).
3. pCSE2.6-hIgG1-Fc-LUP37-C11 (Expression vector for the syn-
thesis of the antibody LUP37-C11 in the scFv-Fc format).
4. pCSE2.6-hIgG1-Fc-LUP37-D11 (Expression vector for the
synthesis of the antibody LUP37-D11 in the scFv-Fc format).
5. pCSL3l (Expression vector for the synthesis of antibody light
chains. VL domains were cloned into this vector for production
of IgG and Fab antibodies).
6. pCSEH1c (Expression vector for the synthesis of antibody
heavy chains. VH domains were cloned into this vector for
production of IgG antibodies).
7. pCSE2.5-Fab-h-HIS-XP (Expression vector for the synthesis of
antibody heavy chains lacking the domains CH2 and CH3. VH
domains were cloned into this vector for the production of
antibodies in the Fab format).
8. pUC57-His8-proKLK-3C-hKLK7 (Cloning vector obtained
from GenScript carrying the synthetic codon optimized DNA
sequence His8-proKLK-3C-hKLK7).
9. pOpIE2- His8-proKLK-3C-hKLK7 (The sE2-dHVR1
sequence of pOpIE2-sE2-dHVR1 was exchanged with the
insert His8-proKLK-3C-hKLK7 to get a Hi5 expression vector
for human proKLK7).
10. pTTo/eGFPq (Control vector for the determination of trans-
fection efficiency in HEK293-6E cells via flow cytometry).
11. pOpiE2-eGFP-HA (Control vector for the determination of
transfection efficiency in Hi5 cells via flow cytometry).
Expression of Recombinant Antibodies in Different Formats 63
Fig. 2 Vector cloning for transient scFv-Fc, IgG, and Fab expression in HEK293-6E. (a). Schematic overview of
the cloning strategies for the generation of pCSL3l-LUP37-A10-VL, pCSL3l-LUP37-B10-VL, pCSL3l-LUP37-
C11-VL, pCSL3l-LUP37-D11-VL, pCSEH1c-LUP37-All-VH, and pCSE2.5-Fab-h-HIS-LUP37-All-VH (“All” in the
plasmid names means that all four different LUP isolates (A10, B10, C11 and D11) were cloned in the same
way) starting from the corresponding pCSE2.6-hIgG1-Fc-LUP37 vectors. Shown are the expression cassettes
consisting of signal peptide (green), Ig domains, and artificial peptide linker (orange), as well as the particular
restriction sites used for cloning. (b) Analysis of colony-PCR products via agarose gel electrophoresis. Black
arrows indicate the expected lengths of positive amplificates
2.2 Cell Lines 1. The HEK293-6E cell line was licensed from National Research
for Protein Production Council (NRC), Biotechnological Research Institute (BRI),
Montreal, Canada.
2. The Trichoplusia ni Hi5 insect cell line (BTI-Tn-5B1-4) was
isolated by the Boyce Thompson Institute for Plant Research,
Ithaca, USA.
3. The Spodoptera frugiperda Sf21 (DSMZ #ACC119) insect cell
line (IPLB-Sf21-AE) was used for amplification of the
baculovirus.
64 Jens König et al.
2.4 Transfection Prepare all solutions using ultrapure water and analytical grade
Reagents reagents. All reagents will be sterile filtered and stored at 4 C
and Additional (unless otherwise mentioned).
Chemicals for Protein 1. 1 mg/mL 25 kDa Polyethylenimine (PEI_25), linear (Poly-
Production sciences #23966): Dissolve 0.05 g of PEI in 50 mL of water
and heat until it is completely dissolved. Store aliquots at 70
C.
2. Use 15-mL polystyrene tubes for preparing DNA/PEI_25-
complexes.
3. 20% (w/v) Tryptone N1 (Organotechnie S.A.S., La Cour-
neuve, France): Weigh 100 g Tryptone N1. Make up to
500 mL with water.
4. 300 g/L Glucose: Weigh 150 g glucose and make up to
500 mL with water.
5. 75 mM Valproic acid (20). Dissolve 1.2 g of valproic acid
sodium salt (MW 155.19) and make up to 100 mL in F17
medium (supplemented).
6. Guava EasyCyte™ Mini (Merck, Millipore).
7. CASY Cell Counter (Innovatis).
2.5 Biolayer Prepare all solutions using ultrapure water and analytical grade
Interferometry reagents. All reagents are sterile filtered and stored at 4 C (unless
otherwise mentioned).
1. 1 mM EZ-Link Sulfo-NHS-LC-LC-Biotin solution (Thermo
Fisher).
2. Zeba spin desalting columns (Thermo Fisher).
3. OctetRed 96 System (Pall, Fortebio).
Expression of Recombinant Antibodies in Different Formats 65
3 Methods
3.1 Transient Protein The protocol is described in Karste et al. [1]. The employed vectors
Expression contain the OriP to ensure optimal long-term expression levels.
in HEK293-6E Cells Here the expression is described for 500 mL.
1. [Day 3, e.g., Friday] Prepare a 400 mL culture containing 0.3
106 HEK293-6E c/mL. Incubate the culture for 72 h at
37 C, 110 rpm, and 5% CO2.
2. [Day 0, e.g., Monday] Count the cells of the preparatory culture
and prepare a 250 mL culture containing 1.8 106 HEK293-
6E c/mL by centrifuging the required volume of the cell
suspension at 180 g for 4 min. Discard the supernatant
carefully and resolve the cell pellet in 250 mL fresh F17. Place
the cells back into the incubator (37 C, 90 rpm, and 5% CO2)
until use (see Note 1).
3. Prepare the DNA solution in 12.5 mL F17 in a 50-mL corning
flask (see Note 2). Hereto, mix 237 μg of the target plasmid
(s) containing your gene(s) of interest with 13 μg control
plasmid pTTo-GFPq coding, e.g., for eGFP. Mix by agitating
the tube briefly.
4. Prepare the PEI_25 solution in 12.5 mL F17 in a 50-mL
Corning flask (see Note 2). Hereto, pipette 625 μL PEI of
the 1 mg/mL PEI_25 stock solution into the. Mix by vortex-
ing briefly.
5. Mix the PEI_25 solution with the DNA solution directly (see
Note 3).
6. Incubate the PEI_25–DNA solution for 15 min at RT to
preform PEI–DNA complexes.
7. Pipette the PEI–DNA complexes (25 mL) to the cells and mix
gently. Incubate the cells until harvest at 37 C, 90 rpm, and 5%
CO2.
66 Jens König et al.
3.2 Transient Protein The protocol is described in Karste et al. MiMB [1]. Here, we show
Expression in Hi5 Cells the expression and purification of the secreted KLK7 in Hi5 cells in
500 mL scale. The employed vectors contain the optimal expres-
sion cassette with the strong OpIE2 promoter (see Note 4, [20]).
1. [Day 1, e.g., Friday] Prepare a 150 mL preculture starting at
0.3–0.4 106 Hi5 c/mL. Incubate the culture for 72 h at
27 C and 110 rpm (see Note 5).
2. [Day 0, e.g., Monday] Count the cells of the preparatory culture
and prepare a 100 mL culture containing 5 106 Hi5 c/mL by
centrifuging the required volume of the cell suspension at
180 g for 4 min. Discard the supernatant and resolve the
cell pellet in 100 mL fresh EX-CELL 405.
3. Incubate the culture at 27 C and 110 rpm for 1 h.
4. Mix 425 μg of the expression plasmid and 25 μg of the
control plasmid, e.g., pOpIE2-eGFP-HA, coding for eGFP
(see Note 6).
Expression of Recombinant Antibodies in Different Formats 67
Fig. 3 Transient antibody production in HEK293-6E cells. (a) Schematic vector map of the mammalian
HEK293-6E expression vector with exemplary expression cassette (found in pTT5 or pFlpBtMII [2]). (b)
Schematic illustration of corresponding gene expression cassettes used for the production of recombinant
antibodies in the scFv-Fc, Fab, and IgG format. (c/d) Monitoring of growth, viability, and transfection efficiency
(GFP-positive cells) over time. Volume doubling and supplementations at 48, 72, and 96 h post-transfection
are indicated by black arrows. Mean values are presented
5. Pipette the DNA mix directly to the prepared cells and mix
gently (see Note 7).
6. Immediately pipette 4 mL PEI of the 1 mg/mL PEI stock
solution to the cells and mix gently.
7. Incubate the culture at 27 C and 110 rpm for 3 up to 5 h.
8. Add 400 mL fresh EX-CELL 405 (see Note 8).
9. [Day 1–3, Tuesday to Thursday] Take samples daily, monitor
cell numbers and viability, and determine transfection efficiency
in the cytometer. If cells reach a density above 3 106 c/mL,
adjust the concentration back to 2 106 c/mL by adding fresh
culture medium.
10. [Day 3, Thursday] Harvest secreted target proteins by centrifu-
ging the cell suspension 15 min at 1000 g and store the
supernatant at 4 C after sterile filtration (0.45 μm) until
purification.
68 Jens König et al.
Fig. 4 Yields of antibody production in HEK293-6E cells. (a) Stained protein gel of purified scFv-Fc, IgG, and
Fab antibodies. Samples of 3.5 μg/lane were separated for 50 min on a 12% SDS-PAGE gel at 160 V and
analyzed via Coomassie staining. (b, c) Column charts of volumetric and specific cellular recombinant protein
yields with SEM error bars. Yield was calculated on the basis of the total amount of purified protein and final
production volume. For the calculation of the specific cellular yield, maximal cell number and cultivation time
were additionally considered
Expression of Recombinant Antibodies in Different Formats 69
3.3 Baculoviral The protocol describes the expression and purification of the
Expression of hKLK7 secreted KLK7 in Hi5 cells in 500 mL scale using the BEVS
in Hi5 Cells technology (see Note 9).
1. [Day 3, Friday] Prepare a 250 mL preculture starting with
0.3–0.4 106 Hi5 c/mL. Incubate the culture for 72 h at
27 C and 110 rpm (see Note 5).
2. [Day 0, e.g., Monday] Count the cells of the preparatory culture
and prepare a 500 mL culture containing 1.0–1.5 106 Hi5
c/mL by diluting the required volume of the cell suspension
into fresh EX-CELL 405 medium. Infect the cells at a MOI of
0.5–2.0 with the baculoviral stock solution (see Note 10). Mix
gently and incubate the culture at 27 C and 110 rpm for 72 h.
3. [Day 1–3, Tuesday to Thursday] Take samples daily, monitor
cell numbers, viability, and cell diameter in the CASY Cell
Counter to determine the progress of the baculoviral infection.
If cells reach a density above 3 106 c/mL, adjust the concen-
tration back to 1 106 c/mL by adding fresh EX-CELL
405 culture medium.
4. [Day 3, Thursday] Harvest secreted target proteins 48 h after
total proliferation stop by centrifuging the cell suspension for
15 min at 1000 g and store the supernatant at 4 C after
sterile filtration (0.45 μm) until purification. Prevent microbial
growth by adding 0.05% sodium azide.
3.4 Preparation 1. [Day 3, Friday] Prepare a 150 mL Sf21 preculture starting with
of the Baculoviral 0.3–0.4 106 c/mL in EX-CELL 420 medium. Incubate the
Stock Solution culture for 72 h at 27 C and 110 rpm (see Note 5).
2. [Day 0, e.g., Monday] Count the cells of the preparatory culture
and prepare a 500 mL culture containing 0.5 106 Hi5 c/mL
by diluting the required volume of the cell suspension into
fresh EX-CELL 420 medium. Infect the cells with a MOI of
0.2 with the baculoviral transfection supernatant or use 5% v/v
of a nontitered viral stock. Mix gently and incubate the culture
at 27 C and 110 rpm for 4 days.
3. [Day 1–4, Tuesday to Friday] Monitor the cell number, viabil-
ity, and the cell diameter (CASY cell counter). The cells should
be split to 1 106 c/mL by adding fresh EX-CELL
420 medium once they reach 2 106 c/mL.
4. [Day 4, e.g., Friday] The viral supernatant was harvested
48 hours after an increase in cell diameter of 3 μm was
observed.
Fig. 5 Affinity chromatography. The cell culture supernatants were filtrated (0.45 m) and loaded onto the
HisTrap Excel column. (a, b) Comparison of the chromatograms of KLK7 affinity purification of the production
via BEVS and virus-free expression in Hi5 cells (c, d, respectively). Peak fractions were detected by
SDS-PAGE. 20 μL samples of the collected 1 mL fractions were applied per lane of a 12% SDS-gel and
separated for 50 min at 160 V. Black arrows indicate the bands resembling pro-KLK7. The imidazole gradient
is shown on the right axis in % B (100% B corresponds to 500 mM Imidazole)
Expression of Recombinant Antibodies in Different Formats 71
3.6 Biolayer Protocols were set up using the Acquisition and Analysis User
Interferometry Guide for the OctetRed 96 (Fortebio, Pall) and according to the
methods described in detail in [19].
1. Purified pro-KLK7 samples were activated for 16 h at 4 C
using 0.02 U/g bovine Enterokinase (Sigma).
2. The activated KLK7 was biotinylated using 1 mM EZ-link
Sulfo-NHS-LC-LC-Biotin (Thermo Fisher). The protein was
cross-linked in at molar ratio of 3:1 (linker: KLK7) for 30 min
at room temperature.
3. Non-reacted biotinylating reagent was removed by gel filtra-
tion in a Zeba spin desalting column (Thermo Fisher) accord-
ing to the manufacturer’s protocol. The biotinylated KLK7 was
diluted to 12.5 μg/mL. Antibodies were diluted in a range of
concentration from 1 to 500 nM. The sample plate was
prepared as described in Fig 6. Each well was filled with
200 μL of buffer or sample.
4. Prepare a plate with eight streptavidin biosensors in row 1 and
preincubate the tips in 200 μL PBS for 10 min. Start the
acquisition software (8.2) of the OctetRed 96 and set up and
kinetic experiment with regeneration of the tips according to
the Octet Data Acquisition User Guide. Detailed protocols are
described by Kamaraswamy and Tobias [19].
5. The setup for the biolayer interferometric kinetic measure-
ments is described in detail in Table 1. Preincubated streptavi-
din biosensors were equilibrated for 60 s in PBS before the
biotine-KLK7 was immobilized on the sensor for
300 s. Baseline, association, and dissociation to the antibody
were monitored over time as shown in Table 1. The tips were
subsequently regenerated by a threefold cycle of regeneration
in 10 mM 1 glycine buffer, pH 1.5 followed by neutralization
in PBS. The tips were reused to measure the remaining
KLK7—anti-KLK7 antibody kinetics.
6. The data were processed using the Octet Data Analysis soft-
ware package (8.2). The association step was aligned to the
baseline. The relative signal of antibody binding to the immo-
bilized KLK7 is shown in Fig 7. Make sure that the antibody
does not show nonspecific binding to the tips by monitoring
the signal of a tip which is not charged with biotinylated KLK7.
72 Jens König et al.
Fig. 6 Plate map diagram and principle of KLK7—anti-KLK7 kinetic measurements. Plate map: column 1, 3,
5, 7, 9, 12 (gray ¼ PBS), column 2 (blue ¼ Biotin-KLK7 (12.5 μg/mL)), column 6, 8, 10 (red ¼ antibody dilution
series (1.1-500 nM)), well H4, H6, H8 (orange ¼ reference for subtraction of the background), column
11 (green ¼ glycine buffer for regeneration). Biolayer interferometry principle: Top-emitting light is reflected
at the internal reference layer and the outer reflection surface of the biosensor tip. Binding molecules increase
the optical thickness and cause a shift of the resultant wave due to changes in the wave interference pattern.
This shift in wavelength is measured in real-time
Table 1
Settings for the biolayer interferometric kinetic measurements
Step Step name Time [s] Flow [rpm] Run 1 Run 2 Run 3
1 Equilibration 60 1000 1 1 1
2 Loading 300 1000 2 2 2
3 Baseline 60 1000 3 3 3
4 Association 600 1000 4 6 8
5 Dissociation 600 1000 5 7 9
6 Regeneration 30 1000 11,12 11,12 11,12
The experiment was repeated after regeneration of the tips using the different antibody formats in column 4, 6, and
8 respectively
Expression of Recombinant Antibodies in Different Formats 73
Fig. 7 Biolayer interferometry-based affinity ranking for recombinant scFv-Fc, IgG, and Fab antibodies.
Streptavidin Dip and Read tips were loaded with biotinylated KLK7 and assayed for their response to various
anti-KLK7 antibody levels. (a) Nonlinear fit of grouped association and dissociation curves based on a 1:1
binding model for the three recombinant antibody formats of LUP37-C11. (b) Summary of apparent affinity and
rate constants in a grouped column chart with error bars representing the SEM. Antibodies with insufficient fits
(X2: > 3 and R2: < 0.95) are displayed in gray
Table 2
Summary of antibody yields and apparent affinity to KLK7
4 Notes
5. This step must ensure that the cells are still in the exponential
growth phase, and this will increase the transfection efficiency,
baculoviral infection, and protein expression vastly.
6. Using higher amounts of DNA (up to 3 μg per 1 106 cells)
leads to higher yields if the PEI amount is increased accord-
ingly and the PEI:DNA ratio of 4:1 is kept stable. Further
increasing the amount of DNA will decrease cell viability due
to the required higher PEI concentration, as PEI is known to
be cytotoxic in high concentrations. This will decrease the
overall productivity.
7. Direct transfection without preforming the DNA-PEI com-
plexes led to the highest transfection rates and protein levels
in our lab. In contrast, Shen et al. observed no differences
between direct transfection or transfection after preforming
the DNA-PEI complexes [21]. The difference might be caused
by different performance of other batches of Hi5 cells. How-
ever, a direct transfection is easier and faster. Thus, the
described direct transfection is the optimal method in our
hands.
8. Diluting with fresh media is important to keep the cells in the
exponential growth phase until the time of harvest.
9. Optimized protocols are validated and reviewed in the bench-
marking study by Stolt-Bergner et al. [22].
10. For optimal expression results, the titer of the viral stock solu-
tion should be determined by a plaque assay. Additionally, the
best MOI for expression should be determined in a small-scale
expression analysis prior to scaling up by varying the MOI from
0.2 to 2.0.
11. Avidity effects can be caused by a multivalent molecule, like an
antibody, when the antigen is immobilized. For accurate deter-
mination of the kinetic constants, the orientation of the assay
must also be reverted by using anti-human IgG Fc Capture
(AHC) biosensors for the immobilization of the IgG and
Fc-tagged antibody format using KLK7 as analyte. The Fab
format cannot be analyzed in this way and needs direct chemi-
cal cross-linking to suitable tips.
Acknowledgments
References
1. Karste K, Bleckmann M, van den Heuvel J 13. Wenzel EV, Bosnak M, Tierney R et al (2020)
(2017) Not limited to E. coli: versatile expres- Human antibodies neutralizing diphtheria
sion vectors for mammalian protein expression. toxin in vitro and in vivo. Sci Rep 10:571
Methods Mol Biol 1586:313–324 14. Li Z, Krippendorff B-F, Sharma S et al (2016)
2. Meyer S, Lorenz C, Baser B et al (2013) Multi- Influence of molecular size on tissue distribu-
host expression system for recombinant pro- tion of antibody fragments. mAbs 8:113–119
duction of challenging proteins. PLoS One 8 15. Khan KH (2013) Gene expression in mamma-
(7):e68674 lian cells and its applications. Adv Pharm Bull
3. Kamat V, Rafique A (2017) Designing binding 3:257–263
kinetic assay on the bio-layer interferometry 16. J€ager V, Büssow K, Wagner A et al (2013) High
(BLI) biosensor to characterize antibody- level transient production of recombinant anti-
antigen interactions. Anal Biochem 536:16–31 bodies and antibody fusion proteins in
4. Egawa G, Kabashima K (2018) Barrier dys- HEK293 cells. BMC Biotechnol 13:52
function in the skin allergy. Allergol Int 17. Li MZ, Elledge SJ (2012) SLIC: a method for
67:3–11 sequence- and ligation-independent cloning.
5. Sotiropoulou G, Pampalakis G (2012) Target- Methods Mol Biol 852:51–59
ing the kallikrein-related peptidases for drug 18. Fühner V, Heine PA, Helmsing S et al (2018)
development. Trends Pharmacol Sci Development of neutralizing and
33:623–634 non-neutralizing antibodies targeting known
6. Goettig P, Magdolen V, Brandstetter H (2010) and novel epitopes of TCDB of Clostridioides
Natural and synthetic inhibitors of kallikrein- difficile. Front Microbiol 9:2908
related peptidases (klks). Biochimie 19. Kumaraswamy S, Tobias R (2015) Label-Free
92:1546–1567 kinetic analysis of an antibody-antigen interac-
7. Russo G, Meier D, Helmsing S et al (2018) tion using biolayer interferometry. Methods
Parallelized antibody selection in microtiter Mol Biol 1278:165–182
plates. Methods Mol Biol 1701:273–284 20. Bleckmann M, Schürig M, Chen FF et al
8. Frenzel A, Hust M, Schirrmann T (2016) (2016) Identification of essential genetic bacu-
Phage display-derived antibodies in clinical loviral elements for recombinant protein
development and therapy. mAbs 8:1177–1194 expression by transactivation in Sf21 insect
9. Strohl WR (2018) Current progress in innova- cells. PloS One 11:e0149424
tive engineered antibodies. Prot Cell 9:86–120 21. Shen X, Pitol AK, Bachmann V et al (2015) A
10. Frenzel A, Hust M, Schirrmann T (2013) simple plasmid-based transient gene expression
Expression of recombinant antibodies. Front method using High Five cells. J Biotechnol
Immunol 4:217 216:67–75
11. Ha J-H, Kim J-E, Kim Y-S (2016) Immuno- 22. Stolt-Bergner P, Benda C, Bergbrede T et al
globulin Fc heterodimer platform technology: (2018) Baculovirus-driven protein expression
From design to applications in therapeutic anti- in insect cells: a benchmarking study. J Struct
bodies and proteins. Front Immunol 7:394 Biol 203:71–80
12. Thie H, Toleikis L, Li J et al (2011) Rise and
fall of an anti-MUC1 specific antibody. PLoS
One 6:e15921
Chapter 5
Abstract
Fv and Fab antibody fragments are versatile co-crystallization partners that aid in the structural determina-
tion of otherwise “uncrystallizable” proteins, including human/mammalian membrane proteins. Accessi-
ble methods for the rapid and reliable production of recombinant antibody fragments have been long
sought. In this chapter, we describe the concept and protocols of the intervening removable affinity tag
(iRAT) system for the efficient production of Fv and Fab fragments in milligram quantities, which are
sufficient for structural studies. As an extension of the iRAT system, we also provide a new method for the
creation of genetically encoded fluorescent Fab fragments, which are potentially useful as molecular devices
in various basic biomedical and clinical procedures, such as immunofluorescence cytometry, bioimaging,
and immunodiagnosis.
Key words Recombinant antibody, Polyprotein, Secretory expression, Fv fragment, Fab fragment,
Crystallography, Genetically encoded fluorescent antibody, Therapeutic antibody, Biosimilar,
Immunodiagnostics
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
77
78 Norimichi Nomura et al.
2 Materials
Fig. 2 (continued) polyprotein construct. (b) Universal PCR primers for the
construction of expression plasmid. (c) Sequence corresponding to the region
shown in (a). P5–35 and P5–10 represent the 35 and 10 box of the promoter
P5, respectively. SD1 and SD2 are Shine-Dalgarno sequences. The Sec secre-
tion signal, TEV recognition sequence, His6 tag, and MBP are shown in gray,
orange, yellow, and green, respectively. Gray arrowheads indicate the signal
cleavage site and TEV cleavage sites
Production of Recombinant Antibody Fragments via the iRAT system 83
3 Methods
3.1 Original iRAT Fv fragments (with a molecular weight of ~25 kDa) are heterodi-
System meric molecules consisting of two domains, VL and VH, that assem-
for the Production ble through hydrophobic interactions. Each of the VL and VH
of Recombinant Fv domains contains an intrachain disulfide bond for stabilization.
Fragments These structural properties require a sophisticated apparatus for
secretion, folding, and assembly, as well as an oxidizing environ-
ment for disulfide bond generation. The expression of Fv fragments
via the B. choshinensis Sec-dependent secretion pathway ensures the
formation of the intrachain disulfide bonds to stabilize the struc-
ture. A reason to include MBP in the iRAT segment is that the
distance between the N- and C-termini (43 Å) is similar to the
distance between the C-terminus of VL and the N-terminus of VH
(approximately 35–40 Å) for most Fv fragments.
3.1.2 Construction The pBIM2 vector (Fig. 2a) for the expression of Fv fragments is
of the Brevibacillus designed based on the backbone of the Brevibacillus plasmid
Expression Plasmid pNY326. The VL-insertion site, iRAT cassette, and VH-insertion
site are tandemly arranged in this order and are introduced down-
stream of the constitutively active P5 promoter and Sec secretion
signal sequence. The iRAT-MBP cassette encodes the N-terminal
TEV cleavage site, His6 tag, a 9-residue Gly/Ser-rich linker, the
MBP coding sequence (residues 27–392 from UniProt ID:
P0AEX9), a 25-residue Asn/Gly/Ser-rich linker, and a
C-terminal TEV cleavage site (Fig. 2c). Residues 1–107 (Kabat
numbering scheme) of the VL domain and 1–113 of the VH domain
derived from monoclonal antibodies are used for Fv fragment
expression.
Production of Recombinant Antibody Fragments via the iRAT system 85
Table 1
Preparation of PCR tubes
Table 2
PCR primer template combination
PCR product
Table 3
Gibson assembly reaction
Table 4
Colony PCR mix
3.1.3 Secretory 1. Day 1: (Pre-culture) Open the tube of the glycerol stock of
Expression Using Brevibacillus choshinensis harboring a positive pBIM2 expres-
Brevibacillus Cells sion plasmid and scrape some of the frozen bacteria off using a
sterile loop. Inoculate the bacteria into 50 mL of 2SY/neomy-
cin medium in a 125-mL baffled-bottom Erlenmeyer flask and
grow for 40–55 h at 30 C and 200 rpm.
2. Day 3: (Large-scale culture) Inoculate 1 L of 2SY/neomycin
medium into a 2.5-L Tunair baffled shaker flask with 10 mL of
saturated pre-culture.
3. Grow the cells for 48–60 h at 30 C and 200 rpm.
4. Day 5: Centrifuge the culture at 6000 g for 15 min at 4 C.
Recover the supernatant and discard the cell pellet.
Fig. 3 Certolizumab Fv produced via the Brevibacillus-iRAT system. (a) Typical profile in size exclusion
chromatography of the certolizumab Fv-TNFα complex in the presence of excess certolizumab Fv on a
Superdex200 Increase 10/300GL column (blue line). As a reference, TNFα alone was separated on the same
column (green line). Elution volumes of protein standards are indicated at the top. Peak Fv-T certolizumab
Fv-TNFα trimer complex, peak T free TNFα trimer, and peak Fv free certolizumab Fv. (b) SDS-PAGE analysis of
the corresponding peak fractions in (a). The theoretical molecular masses of the certolizumab Fv and TNFα
trimer are 24.6 kDa (VL: 11.6 kDa, VH: 13.0 kDa) and 51.9 kDa (17.3 kDa protomer 3), respectively
3.2 Extended iRAT Fab fragments (with a molecular weight of ~50 kDa) are hetero-
System dimeric molecules consisting of two chains, each of which has two
for the Production domains: the light chain variable domain (VL) linked to the light
of Recombinant Fab chain constant domain (CL) and the heavy chain variable domain
Fragments and Their (VH) linked to the heavy chain constant domain 1 (CH1). Fab
Fluorescent fragments contain five disulfide bonds (except IgA and IgE which
Derivatives have six disulfides) and need to be targeted to the Gram-negative
bacterial periplasm, the Gram-positive bacterial extracellular space,
or the eukaryotic endoplasmic reticulum. The linear distance
between the C-terminus of the Fab light chain (FabL) and
N-terminus of the Fab heavy chain (FabH) for most Fab fragments
is approximately 65 Å. Appropriate long flexible linkers are needed
for successful “molecular surgery” to anastomose the two termini
without violating the overall fold and biological function of the Fab
fragments. According to Koerber et al. a 70-residue Gly/Ser-rich
linker (sc70) is available to express functional single-chain Fab
[13]. Here we provide an example of which the mCherry red
fluorescent protein, instead of MBP, is installed into an intermedi-
ate point of the sc70 linker to create a new iRAT segment. This
construct yields a polyprotein that works as a genetically encoded
Production of Recombinant Antibody Fragments via the iRAT system 91
3.2.1 Construction The pFBgp67-iRATmC vector (Fig. 4a) for the expression of Fab
of the Baculovirus Strain fragments is designed based on the backbone of the pFastBac1, an
entry vector to produce Bac-to-Bac baculoviruses. The FabL inser-
tion site, iRATmC cassette, and FabH insertion site are tandemly
arranged in this order and are introduced downstream of the con-
stitutively active PPH promoter and gp67 secretion signal sequence.
The iRATmC cassette encodes the N-terminal TEV cleavage site,
His6 tag, a 35-residue Gly/Ser/Thr-rich linker, the mCherry cod-
ing sequence (residues 3–236 from UniProt ID: X5DSL3), a
35-residue Gly/Ser-rich linker, and a C-terminal TEV cleavage
site (Fig. 4c).
1. Day 1: Perform PCR amplifications of the FabL, iRATmC,
FabH, and pFastBac vector backbone containing the gp67
signal sequence (VEC-FB). Add the appropriate components
to four 0.2-mL PCR tubes as in Table 5. The PCR primer-
template combinations are listed in Table 6. The primers for
FabL and FabH domains include 50 overhangs (27 bp) comple-
menting the upstream and downstream sequences to the
pFBgp67-iRATmC vector junctions. Mix the contents gently,
and place the tubes in a thermal cycler.
2. Run the PCR according to the following parameters: (1) 2 min
at 95 C; (2) 30 cycles of a sequence composed of 10 s at
98 C/5 s at 56 C/5 s/kbp at 72 C; and (3) 10 min at 72 C.
3. Check the PCR products by loading an aliquot (5 μL) on a 1%
agarose gel with a DNA ladder in a separate lane. After ethi-
dium bromide staining, observe the gel by UV illumination.
4. Purify the PCR product (45 μL) using a Wizard SV gel and
PCR clean-up system, according to the manufacturer’s instruc-
tions. Use the PCR products directly for purification. DNA
extraction from the agarose gel slice is not necessary.
92 Norimichi Nomura et al.
Fig. 4 Structure of the Bac-to-Bac entry vector pFBgp67-iRATmC for the iRAT-based Fab expression. (a)
Schematic illustration of the region containing the promoter, secretion signal, and iRAT-polyprotein construct.
(b) Universal PCR primers for construction of expression plasmid. (c) Sequence corresponding to the region
shown in (a). The gp67 secretion signal, TEV recognition sequence, His6 tag, and mCherry are shown in gray,
orange, yellow, and purple, respectively. Gray arrowheads indicate the signal cleavage site and TEV cleavage
sites. The sc70-derived linker regions are shown in green
Production of Recombinant Antibody Fragments via the iRAT system 93
Table 5
PCR amplification
Table 6
PCR primer–template combinations
PCR product
Forward Reverse
Name Size primer primer Template
FabL 700 bp F1 R1 Native or synthetic cDNA encoding Fab light
chain
iRATmC 980 bp IRAT70-F IRAT70-R pFBgp67-iRATmC
FabH 700 bp F2 R2 Native or synthetic cDNA encoding Fab heavy
chain
VEC-FB 4800 bp FB-F1 gp67-R pFBgp67-iRATmC
Table 7
Gibson assembly reaction
Table 8
Colony PCR mix
21. Run the PCR according to the following parameters: (1) 2 min
at 94 C; (2) 25 cycles of a sequence composed of 30 s at
94 C/1 min at 55 C/1 min at 72 C; and (3) 5 min at 72 C.
22. Load 10 μL of each colony PCR product directly onto a 1%
agarose gel, alongside an appropriate DNA ladder. After ethi-
dium bromide staining, observe the gel by UV illumination.
The expected size of the colony PCR product is approximately
2500 bp.
23. Select several positive colonies, and use them to inoculate 6 mL
of LB/ampicillin medium. Shake the cultures overnight at
37 C and 250 rpm.
24. Day 3: Add 1 mL of each saturated overnight culture to 0.5 mL
of 50% glycerol in a 2-mL screw top tube or cryovial and gently
mix. Freeze the glycerol stock tube at 80 C. The stock is now
stable for years, as long as it is kept at 80 C.
25. Extract and purify the plasmid DNA from the remaining 5 mL
of each culture using a QIAquick spin miniprep kit, according
to the manufacturer’s instructions. Measure the DNA concen-
tration using a NanoDrop spectrophotometer.
26. Using the vector primers, SFseq-F and SFseq-R, perform
sequence analysis to confirm that the nucleotide sequence of
the plasmids is correct.
27. Day 4: Chill 1 μL of the positive pFBgp67-iRATmC-based
entry plasmid in a 1.5-mL centrifuge tube.
28. Thaw the E. coli DH10Bac competent cells (10 μL) on ice.
29. Add 10 μL of DH10Bac competent cells to the plasmid DNA.
Mix gently by pipetting up and down to mix the cells and
DNA. Do not vortex.
30. Place the mixture on ice for 30 min.
31. Heat shock at 42 C for 45 s.
32. Place the mixture on ice for 2 min.
33. Add 90 μL of pre-warmed SOC medium to the tube.
34. Incubate the tube at 37 C for 4 h with vigorous shaking
(250 rpm).
35. Dilute the transformation culture with SOC medium as appro-
priate, and then spread 100 μL of cells onto an LB/KTGIB
agar plate.
36. Incubate the plate for 2 days at 37 C.
37. Day 6: Pick several white colonies, and use them to inoculate
6 mL of LB/KTG medium. Shake the cultures overnight at
37 C and 250 rpm.
96 Norimichi Nomura et al.
Fig. 5 iRAT-based production and characterization of mCherry-engineered certolizumab Fab. (a) The con-
centrated final product from the Subheading 3.2.3 was analyzed by SEC on a Superdex200 Increase 10/300GL
column. (b) FSEC profile. The fractions collected in (a) were subjected to mCherry fluorescence measurement
(excitation: 587 nm, emission maximum: 610 nm). (c) SDS-PAGE analysis of the peak fraction (labeled by
Fab*) of SEC in (a). The existence of multiple extra bands could be attributed to DsRed-specific fragmentation
Production of Recombinant Antibody Fragments via the iRAT system 99
3.2.4 Purification 1. Day 1: (IMAC) After collecting the Sf9 culture supernatant,
of Tag-Free Fab Fragments perform the same procedures as steps 1–5 in Subheading
3.2.3.
2. (TEV cleavage and dialysis) Add an appropriate amount (typi-
cally at a protease to target protein ratio of 1:100 (w/w) or
3 mg) of TEV-His6 to the elution fraction.
3. Transfer the mixture into dialysis tubing, and dialyze overnight
at 4 C against 2 L of TBS.
4. Day 2: (Reverse IMAC) Equilibrate a 5-mL HisTrap HP col-
umn with 25 mL of buffer C.
5. Remove the dialysate from the tubing and inject it into the
column using a 10-mL syringe.
ä
Fig. 5 (continued) caused by boiling before SDS-PAGE as described in [18]. (d) SEC profile of the mCherry-
engineered certolizumab Fab-TNFα complex in the presence of excess engineered Fab on a Superdex200
10/300GL column (blue line). As a reference, TNFα alone was separated on the same column (green line).
Elution volumes of protein standards are indicated at the top. Peak Fab*-T engineered certolizumab Fab-TNFα
trimer complex, peak T free TNFα trimer, and peak Fab* free engineered certolizumab Fab. (e) FSEC profile.
The fractions collected in (d) were subjected to mCherry fluorescence measurement. Red line: mixture of the
engineered certolizumab Fab and TNFα trimer; pink line: TNFα trimer alone. (f) SDS-PAGE analysis of the
corresponding peak fractions in (d). (g) In gel fluorescence analysis of mCherry-engineered certolizumab Fab.
The same peak fractions as in (f) were added 1:1 with buffer containing 50 mM Tris-HCl (pH 7.6), 50 mM DTT,
5% glycerol, 5% SDS, 5 mM EDTA, and 0.02% bromophenol blue. Without boiling the sample, electrophoresis
was performed on a Novex WedgeWell 10% Tris-glycine gel (Thermo Fisher Scientific) at 100 V for 130 min.
For mCherry, protein bands were observed on a LED transilluminator. The theoretical molecular masses of the
red fluorescent certolizumab Fab and TNFα trimer are 81.2 kDa and 51.9 kDa (17.3 kDa protomer 3),
respectively
100 Norimichi Nomura et al.
4 Notes
Fig. 6 Certolizumab Fab produced via the Sf9-iRAT system. (a) Typical profile in SEC of the certolizumab
Fab-TNFα complex in the presence of excess certolizumab Fab on a Superdex200 10/300GL column (blue
line). As a reference, TNFα alone was separated on the same column (green line). Elution volumes of protein
standards are indicated at the top. Peak Fab-T certolizumab Fab-TNFα trimer complex, peak T free TNFα
trimer, and peak Fab free certolizumab Fab. (b) SDS-PAGE analysis of the corresponding peak fractions in (a).
The theoretical molecular masses of the certolizumab Fab and TNFα trimer are 47.6 kDa (Fab light chain:
23.1 kDa, Fab heavy chain: 24.5 kDa) and 51.9 kDa (17.3 kDa protomer 3), respectively. (c) Crystal of the
certolizumab Fab apo. (d) Crystal of the certolizumab Fab-TNFα complex
Acknowledgments
References
1. Griffin L, Lawson A (2011) Antibody frag- 8. Wu S, Avila-Sakar A, Kim J et al (2012) Fabs
ments as tools in crystallography. Clin Exp enable single particle cryoEM studies of small
Immunol 165:285–291 proteins. Structure 20:582–592
2. Lieberman RL, Culver JA, Entzminger KC 9. Koehl A, Hu H, Maeda S et al (2018) Structure
et al (2011) Crystallization chaperone strate- of the μ-opioid receptor-Gi protein complex.
gies for membrane proteins. Methods Nature 558:547–552
55:293–302 10. Nomura Y, Sato Y, Suno R et al (2016) The
3. Hino T, Arakawa T, Iwanari H et al (2012) G- intervening removable affinity tag (iRAT) pro-
protein-coupled receptor inactivation by an duction system facilitates Fv antibody
allosteric inverse-agonist antibody. Nature fragment-mediated crystallography. Protein
482:237–240 Sci 25:2268–2276
4. Nomura N, Verdon G, Kang HJ et al (2015) 11. Horita S, Nomura Y, Sato Y et al (2016) High-
Structure and mechanism of the mammalian resolution crystal structure of the therapeutic
fructose transporter GLUT5. Nature antibody pembrolizumab bound to the human
526:397–401 PD-1. Sci Rep 6:35297
5. Asada H, Horita S, Hirata K et al (2018) Crys- 12. Ono M, Horita S, Sato Y et al (2018) Structural
tal structure of the human angiotensin II type basis for tumor necrosis factor blockade with
2 receptor bound to an angiotensin II analog. the therapeutic antibody golimumab. Protein
Nat Struct Mol Biol 25:570–576 Sci 27:1038–1046
6. Nagarathinam K, Nakada-Nakura Y, Parthier C 13. Koerber JT, Hornsby MJ, Wells JA (2015) An
et al (2018) Outward open conformation of a improved single-chain Fab platform for effi-
Major Facilitator Superfamily multidrug/H+ cient display and recombinant expression. J
antiporter provides insights into switching Mol Biol 427:576–586
mechanism. Nat Commun 9:4005 14. Fields C, O’Connell D, Xiao S et al (2013)
7. Toyoda Y, Morimoto K, Suno R et al (2019) Creation of recombinant antigen-binding
Ligand binding to human prostaglandin E molecules derived from hybridomas secreting
receptor EP4 at the lipid-bilayer interface. Nat specific antibodies. Nat Protoc 8:1125–1148
Chem Biol 15:18–26
Production of Recombinant Antibody Fragments via the iRAT system 103
15. Lucast LJ, Batey RT, Doudna JA (2001) 17. Markiv A, Beatson R, Burchell J et al (2011)
Large-scale purification of a stable form of Expression of recombinant multi-coloured
recombinant tobacco etch virus protease. Bio- fluorescent antibodies in gor-/trxB- E. coli
techniques 30:544–546, 548, 550 passim cytoplasm. BMC Biotechnol 11:117
16. Abdulrahman W, Radu L, Garzoni F et al 18. Gross LA, Baird GS, Hoffman RC et al (2000)
(2015) The production of multiprotein com- The structure of the chromophore within
plexes in insect cells using the baculovirus DsRed, a red fluorescent protein from coral.
expression system. Methods Mol Biol Proc Natl Acad Sci U S A 97:11990–11995
1261:91–114
Chapter 6
Abstract
Artificial binding proteins have been validated as alternatives to antibodies in their use as research reagents
in molecular and cellular biology. For example, they have been used as inhibitors of protein–protein
interactions to modulate activity, to facilitate crystallization, and as probes for cellular imaging.
Phage display is a widely used approach for isolating target-specific binding reagents, and it has even been
used to isolate isoform-specific binding proteins and binders that can distinguish between highly homolo-
gous protein domains.
Here, we describe methods that have been employed in isolating highly specific artificial binding proteins
against a wide range of target proteins.
Key words Artificial binding protein, Affimer, Research reagents, Protein–protein interaction,
Inhibitor, Phage display, Panning, Phage ELISA
1 Introduction
Antibodies are the most widely used research reagents for protein
binding; however, they have numerous limitations and issues with
validation and reproducibility [1–3]. Consequently, artificial bind-
ing proteins such as DARPins [4], monobodies [5], and Affimer
reagents [6–9] have been developed as promising alternatives with
the added benefits of bacterial production for ease of manufactur-
ability and mammalian cell expression to study protein function.
Affimer reagents are based on two types of closely related scaf-
folds—a mammalian scaffold based on Stefin A [6, 7] and the
Adhiron scaffold based on a consensus sequence of phytocystatins
[8]. Both scaffolds were engineered to constrain two variable pep-
tide sequences for molecular recognition (Fig. 1) [8]. Affimer
reagents have been utilized as affinity reagents in various applica-
tions, for example, as detection reagents for diagnostics, as inhibi-
tors of protein–protein interactions to modulate activity, as
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
105
106 Anna A. S. Tang et al.
Interacon Interacon
Loop 2 Loop 1
1. Immobilisationof
biotinylated target
x4
Wash
Phage Wash Wash
library
x2
2. Incubation with
phage
Pre-pan Pre-pan Pre-pan Control
x3 (negative x4
Wash Wash Wash
selection)
3. Phage elution
Phage ELISA
Streptavidin NeutrAvidin Streptavidin coated Phage Target Deselection
coated well coated well magnetic beads protein target
Fig. 2 Affimer selection by phage display conducted over three panning rounds. In each panning round,
immobilized target (red spots) is incubated with a population of phage (green bars). After washing away any
unbound phage, bound phage is eluted and propagated for subsequent rounds of panning. The population of
phage can also be preincubated with a deselection target, to remove binders to the deselection target, and this
is shown from Pan 2 onwards in the example depicted. After the final round of panning, selected phage clones
are tested for binding to target by phage ELISA. (Figure adapted from Tang AA et al. (2017) [35])
2 Materials
2.2 Screening 1. 96-well V-bottom deep well plates (Greiner Bio-One, catalog
Selected Phage Clones no. 786201).
by Phage ELISA 2. 2YT medium: Dissolve 16 g of Bacto tryptone, 10 g of Bacto
yeast extract, and 5 g of NaCl (MW ¼ 58.44) in 900 ml of
dH2O. Adjust the pH to 7.0 with NaOH and add dH2O until a
total volume of 1 l. Autoclave to sterilize and store at room
temperature.
3. Carbenicillin (500 stock): Dissolve carbenicillin (50 mg/ml)
in ddH2O. Filter-sterilize and store at 20 C. Working con-
centration is 100 μg/ml.
4. M13KO7 helper phage (New England BioLabs).
5. Kanamycin (500 stock): Dissolve kanamycin (25 mg/ml) in
ddH2O. Filter-sterilize and store at 20 C. Working concen-
tration is 50 μg/ml.
6. Pierce Streptavidin-coated, clear, 96-well plates (ThermoFisher
Scientific, catalog no. 15126).
7. PBS: Prepare a 10 stock by dissolving 80.0 g of NaCl
(MW ¼ 58.44), 2.0 g of KCl (MW ¼ 74.55), 14.4 g of
Na2HPO4 (MW ¼ 141.96) and 2.4 g of KH2PO4
(MW ¼ 136.09) in 800 ml of dH2O. Adjust the pH to 7.4
with HCl and add dH2O until a total volume of 1 l. Autoclave
to sterilize and store at room temperature. For a 1 stock,
dilute the 10 stock with dH2O and adjust the pH to 7.4
with HCl.
8. PBST: Dilute the 10 PBS to 1 with dH2O and 0.1% (v/v)
Tween 20, and adjust to pH 7.4 with HCl.
9. 10 Casein Blocking Buffer (Sigma-Aldrich, catalog
no. B6429).
10. 2 Blocking Buffer: Dilute 10 Casein Blocking Buffer five-
fold in PBS.
11. Biotinylated target protein (recommended 0.5–1.0 μg
per well).
12. Biotinylated deselection target (optional) (recommended
0.5–1.0 μg per well).
13. Anti-Fd-Bacteriophage-HRP (Seramun Diagnostica GmbH,
catalog no. A-020-1-HRP).
14. TMB (SeramunBlau® fast TMB/substrate solution) (Seramun,
catalog no. S-001-TMB).
15. 0.2 M H2SO4 (optional).
Isolation of Artificial Binding Proteins 111
3 Methods
3.1 Affimer Selection Target proteins can be biotinylated using chemical conjugation
by Phage Display methods, such as EZ-Link NHS-Biotin (ThermoFisher Scientific,
catalog no. 20217), following the manufacturer’s instructions.
Chemical biotinylation may block the binding sites on target pro-
teins. Alternatively, target protein sequence can be tagged with a
biotin acceptor peptide (BAP) sequence (GLNDIFEAQ-
KIEWHE), which is enzymatically biotinylated when expressed in
E. coli in the presence of biotin ligase.
8. Selection. Remove the target from the selection well and wash
6 with 300 μl of PBST. Transfer the phage from pre-pan well
3 to the selection well. If required, add 1 μg of
non-biotinylated deselection target (see Note 3). Cover with
a plate seal and incubate for 2 h at room temperature on the
vibrating platform shaker.
9. Wash the selection well 27 with 300 μl of PBST, preferably
using an automated plate washer.
10. Elution 1. Add 100 μl of 0.2 M glycine, pH 2.2 to the selection
well and incubate for 10 min at room temperature. Neutralize
by adding 15 μl of 1 M Tris-HCl, pH 9.1, and transfer the
eluted phage to a microcentrifuge tube.
11. Elution 2. Dilute 14 μl of triethylamine with 986 μl of PBS.
Add 100 μl of the diluted triethylamine to the selection well
and incubate for 6 min at room temperature. Neutralize by
adding 50 μl of 1 M Tris-HCl, pH 7, and transfer the eluted
phage to the microcentrifuge tube containing elution 1.
12. Infection of ER2738 cells. Before eluting the phage, set up an
8 ml culture of ER2738 cells for each selection. Dilute the
overnight cultures of ER2738 cells in 2YT medium with
12 μg/ml tetracycline to an OD600 of ~0.2 and incubate at
37 C, 230 rpm for about 1 h until OD600 reaches ~0.6. Add
the eluted phage and incubate for 1 h at 37 C at up to 90 rpm.
Mix at least once during the incubation.
13. Plating the cells. Plate 1 μl of the phage-infected ER2738 cells
(diluted in 100 μl of 2YT media) onto LB agar plates with
100 μg/ml carbenicillin (the selection antibiotic for the phage
library). Centrifuge the remaining culture at 3000 g for
5 min. Pour off the supernatant and resuspend the cell pellet
in the residual supernatant. Plate the cells on LB agar with
100 μg/ml carbenicillin. Incubate the plates overnight at
37 C.
Day 3
14. To estimate the phage titer, count the colonies on the plate
containing 1 μl of phage-infected ER2738 cells. Multiply by
8000 to determine the total number per 8 ml of cells (usually
between 0.1 and 2 106).
15. Scrape the cells from the plate containing the remaining cul-
ture. To do this, add 5 ml of 2YT medium with 12 μg/ml
tetracycline and scrape using a disposable plastic spreader.
Transfer the scraped cells to a 50 ml centrifuge tube. Use an
additional 2 ml of medium to scrape off any remaining cells and
mix with the cells in the centrifuge tube. Measure the OD600
of a 1/10 dilution to determine the volume required for an
8 ml culture at OD600 0.2.
Isolation of Artificial Binding Proteins 113
3.1.2 Panning Round 2 Magnetic separation and handling using Dynabeads MyOne Strep-
tavidin T1 magnetic beads can easily be automated on a wide variety
of liquid handling platforms. Panning Round 2 has been automated
on a KingFisher Flex magnetic particle processor (ThermoFisher
Scientific, catalog no. 5400630) and is described by Tang et al.
[35]. However, this method describes how the panning can be
done manually using a magnetic separation rack.
Day 1
1. Block the streptavidin-coated magnetic beads. Resuspend the
Dynabeads MyOne Streptavidin T1 magnetic beads thor-
oughly by vortexing and transfer 20 μl per selection to an
Eppendorf LoBind microcentrifuge tube. Block in a minimum
of 300 μl 2 Blocking Buffer (or 100 μl 2 Blocking Buffer
per 20 μl of streptavidin beads). Incubate overnight at room
temperature on a tube rotator to keep the beads in suspension.
2. Set up an overnight culture of ER2738 E. coli cells. Pick a single
colony into 5 ml of 2YT medium with 12 μg/ml tetracycline
and incubate overnight in an orbital incubator at 37 C,
230 rpm. If performing competitive panning, set this up at
the end of day 2.
114 Anna A. S. Tang et al.
Day 2
3. Centrifuge the blocked streptavidin beads at 800 g for 1 min.
Place the tube on the magnetic separation rack to immobilize
the beads. Remove the blocking buffer and replace with fresh
2 Blocking Buffer, resuspending the beads in 100 μl per 20 μl
of streptavidin beads.
4. Immobilization of biotinylated target. In an Eppendorf
LoBind microcentrifuge tube, add 1 μg of biotinylated target
to 200 μl of 2 Blocking Buffer and 50 μl of the blocked
streptavidin beads. Incubate at room temperature on a tube
rotator to keep the beads in suspension.
5. Immobilization of biotinylated deselection target (if using) for
pre-panning phage (see Note 1). Add 1 μg of biotinylated
deselection target to 200 μl of 2 Blocking Buffer and 50 μl
of the blocked streptavidin beads. Incubate for 1 h at room
temperature on the tube rotator. Centrifuge the tube at
800 g for 1 min. Wash the beads 6 with 500 μl of 2 Block-
ing Buffer using the magnetic separation rack to immobilize
the beads. Resuspend the beads in 50 μl of 2 Blocking Buffer.
6. Pre-pan 1. In an Eppendorf LoBind microcentrifuge tube, add
125 μl of phage-containing supernatant from panning round
1 to 125 μl of 2 Blocking Buffer and 25 μl of the blocked
streptavidin beads (from step 3 or step 5, as appropriate).
Incubate for 1 h at room temperature on the tube rotator.
7. Pre-pan 2. Centrifuge the pre-pan 1 tube at 800 g for 1 min
and place the tube on the magnetic separation rack to immobi-
lize the beads. Transfer the phage-containing supernatant to
the tube containing the remaining 25 μl of blocked streptavidin
beads (from step 3 or step 5, as appropriate). Incubate for 1 h
at room temperature on the tube rotator.
8. Centrifuge the tube containing the immobilized target at
800 g for 1 min. Wash the beads 6 with 500 μl of 2 Block-
ing Buffer using the magnetic separation rack to immobilize
the beads.
9. Selection. Centrifuge the pre-pan 2 tube at 800 g for 1 min
and place the tube on the magnetic separation rack to immobi-
lize the beads. Transfer the phage-containing supernatant to
the tube containing the immobilized target. If desired, add
1 μg of non-biotinylated deselection target (see Note 3). Incu-
bate for 1 h at room temperature on the tube rotator.
10. Centrifuge the tube at 800 g for 1 min. Wash the beads 6
with 500 μl of 2 Blocking Buffer using the magnetic separa-
tion rack to immobilize the beads. For standard panning, elute
the phage immediately as described in steps 13 and 14 (see
Note 4). For competitive panning, continue with the following
step (see Note 5).
Isolation of Artificial Binding Proteins 115
10. Wash the selection well and negative control well 27 with
300 μl of PBST, preferably using an automated plate washer.
For standard panning, elute the phage immediately as
described in steps 13 and 14 (see Note 4). For competitive
panning, continue with the following step (see Note 5).
11. Add the following to the selection well and negative control
well: 80 μl of 2 Blocking Buffer, 20 μl of 80% glycerol and 1 μl
of Halt protease inhibitor cocktail (100). If desired, add 1 μg
of non-biotinylated deselection target (see Note 3). Cover with
a plate seal and incubate for 22–24 h at room temperature on
the vibrating platform shaker.
Day 2 or 3
12. Wash the selection well and negative control well 6 with
300 μl of PBST.
13. Elution 1. Add 100 μl of 0.2 M glycine, pH 2.2 to the selection
well and negative control well. Incubate for 10 min at room
temperature. Neutralize by adding 15 μl of 1 M Tris-HCl,
pH 9.1 and transfer the eluted phage to a
microcentrifuge tube.
14. Elution 2. Dilute 14 μl of triethylamine with 986 μl of PBS.
Add 100 μl of the diluted triethylamine to the selection well and
negative control well. Incubate for 6 min at room temperature.
Neutralize by adding 50 μl of 1 M Tris-HCl, pH 7 and transfer
the eluted phage to the microcentrifuge tube containing
elution 1.
15. Infection of ER2738 cells. Before eluting the phage, set up
5 ml cultures of ER2738 cells for each selection. Dilute the
overnight cultures of ER2738 cells in 2YT medium with
12 μg/ml tetracycline to an OD600 of ~0.2 and incubate at
37 C, 230 rpm for about 1 h until OD600 reaches ~0.6. Add
the eluted phage and incubate for 1 h at 37 C at up to 90 rpm.
Mix at least once during the incubation.
16. Plating the cells. Plate a range of volumes (e.g., 0.01 μl, 0.1 μl,
1 μl, 10 μl, and 100 μl) onto LB agar plates with 100 μg/ml
carbenicillin. Also, centrifuge and plate the remaining cells as
described for Panning Round 1 (see Subheading 3.1.1, step
13). For the negative control, select one volume to plate
(usually 10 μl). Incubate the plates overnight at 37 C.
Day 3 or 4
17. Compare the number of colonies on the negative control plate
with the selection plate containing the same volume of cells. A
successful screen shows enrichment of target-specific phage
with fewer colonies (less than half) on the negative control
plate. If background is still high on the negative control plate,
118 Anna A. S. Tang et al.
3.2 Screening 1. Aliquot 200 μl per well of 2YT medium with 100 μg/ml
Selected Phage Clones carbenicillin into a 96-well V-bottom deep well plate using a
by Phage ELISA multichannel pipette and sterile reservoir.
3.2.1 Expressing 2. Pick individual colonies from the final panning round of phage
Selected Phage Clones display to inoculate into the wells—pick 48 colonies or what-
in a 96-Well Culture Plate ever the amount you want to test.
3. Incubate overnight at 37 C, 1050 rpm in an incubating
microplate shaker (e.g., Heidolph Incubator 1000 and
Titramax 1000).
4. Aliquot 200 μl per well of 2YT medium with 100 μg/ml
carbenicillin into a new 96-well V-bottom deep well plate.
5. Transfer 25 μl per well of the overnight cultures into this new
plate and incubate for 1 h at 37 C, 1050 rpm in the incubating
microplate shaker. It is important to keep the remaining culture
plate overnight (store at 4 C for up to a week or use it to
prepare fresh cultures for glycerol stocks).
6. Dilute M13K07 helper phage (titer ~1014/ml) 1/1000 in 2YT
medium with 100 μg/ml carbenicillin and add 10 μl per well to
the freshly grown cultures using a multichannel pipette. Incu-
bate for 30 min at 37 C, 450 rpm in the incubating microplate
shaker.
7. Dilute the kanamycin stock (25 mg/ml) 1/20 in 2YT medium
with 100 μg/ml carbenicillin and add 10 μl per well to the
phage-infected cultures using a multichannel pipette. Incubate
overnight at 25 C, 750 rpm in the incubating microplate
shaker.
8. Centrifuge the phage-infected culture plate at 3500 g for
10 min.
9. The supernatant contains the phage and can be removed
directly into the ELISA plate to test for binding to target.
3.2.2 Phage ELISA A phage ELISA is performed to test binding of selected phage
clones to target protein. The phagemid DNA from specific phage
binders can then be extracted and identified by DNA sequencing.
1. Block the streptavidin-coated 96-well plate with 300 μl per well
of 2 Blocking Buffer. Cover the wells with an adhesive plate
seal and incubate overnight at 37 C.
2. Wash the blocked wells 3 with 300 μl of PBST, preferably
using a 96-well plate washer.
Isolation of Artificial Binding Proteins 119
4 Notes
Acknowledgments
References
1. Bradbury A, Pluckthun A (2015) Reproduc- 5. Koide A et al (1998) The fibronectin type III
ibility: standardize antibodies used in research. domain as a scaffold for novel binding proteins.
Nature 518(7537):27–29 J Mol Biol 284(4):1141–1151
2. Baker M (2015) Reproducibility crisis: blame it 6. Woodman R et al (2005) Design and validation
on the antibodies. Nature 521 of a neutral protein scaffold for the presenta-
(7552):274–276. [Link] tion of peptide aptamers. J Mol Biol 352
521274a (5):1118–1133
3. McLeod J, Ferrigno PK (2016) Antibody alter- 7. Stadler LKJ et al (2011) Structure-function
natives. Scientist 30:38–45 studies of an engineered scaffold protein
4. Binz HK et al (2003) Designing repeat pro- derived from Stefin A. II: development and
teins: well-expressed, soluble and stable pro- applications of the SQT variant. Protein Eng
teins from combinatorial libraries of consensus Des Sel 24:751–763
ankyrin repeat proteins. J Mol Biol 332 8. Tiede C et al (2014) Adhiron: a stable and
(2):489–503 versatile peptide display scaffold for molecular
Isolation of Artificial Binding Proteins 121
recognition applications. Protein Eng Des Sel 23. Gersch M et al (2017) Mechanism and regula-
27:145–155 tion of the Lys6-selective deubiquitinase
9. Tiede C et al (2017) Affimer proteins are ver- USP30. Nat Struct Mol Biol 24(11):920–930
satile and renewable affinity reagents. elife 27 24. Hughes DJ et al (2017) Generation of specific
(6):24903 inhibitors of SUMO-1- and SUMO-2/3-
10. Johnson A et al (2012) Sensitive affimer and mediated protein-protein interactions using
antibody based impedimetric label-free assays Affimer (Adhiron) technology. Sci Signal 10
for C-reactive protein. Anal Chem 84 (505):eaaj2005
(15):6553–6560 25. Robinson JI et al (2018) Affimer proteins
11. King R et al (2015) Inhibition of complement inhibit immune complex binding to Fcgam-
C3 and fibrinogen interaction: a potential maRIIIa with high specificity through compet-
novel therapeutic target to reduce cardiovascu- itive and allosteric modes of action. Proc Natl
lar disease in diabetes. Lancet 26 Acad Sci U S A 115(1):E72–E81
(385):60372–60375 26. Zhurauski P et al (2018) Sensitive and selective
12. Fisher MJ et al (2015) Trivalent Gd-DOTA Affimer-functionalised interdigitated
reagents for modification of proteins. RSC electrode-based capacitive biosensor for Her4
Adv 5(116):96194–96200 protein tumour biomarker detection. Biosens
13. Kyle HF et al (2015) Exploration of the Bioelectron 108:1–8
HIF-1alpha/p300 interface using peptide and 27. Heidelberger JB et al (2018) Proteomic
Adhiron phage display technologies. Mol Bio- profiling of VCP substrates links VCP to
Syst 11:2738–2749 K6-linked ubiquitylation and c-Myc function.
14. Rawlings AE et al (2015) Phage display EMBO Rep 19(4):21
selected magnetite interacting Adhirons for 28. Lopata A et al (2018) Affimer proteins for
shape controlled nanoparticle synthesis. Chem F-actin: novel affinity reagents that label
Sci 6:5586–5594 F-actin in live and fixed cells. Sci Rep 8
15. Stadler LK et al (2014) The use of a neutral (1):018–24953
peptide aptamer scaffold to anchor BH3 pep- 29. Schlichthaerle T et al (2018) Site-specific label-
tides constitutes a viable approach to studying ing of Affimers for DNA-PAINT microscopy.
their function. Cell Death Dis 30(5):564 Angew Chem Int Ed Engl 57
16. Sharma R et al (2016) Label-free electrochem- (34):11060–11063
ical impedance biosensor to detect human 30. Klont F et al (2018) Affimers as an alternative
interleukin-8 in serum with sub-pg/ml sensi- to antibodies in an affinity LC-MS assay for
tivity. Biosens Bioelectron 80:607–613 quantification of the soluble receptor of
17. Weckman NE et al (2016) Comparison of the advanced glycation end-products (sRAGE) in
specificity and affinity of surface immobilised human serum. J Proteome Res 17
Affimer binders using the quartz crystal micro- (8):2892–2899
balance. Analyst 141(22):6278–6286 31. Hanes J, Pluckthun A (1997) In vitro selection
18. Arrata I et al (2017) Interfacing native and and evolution of functional proteins by using
non-native peptides: using Affimers to recog- ribosome display. Proc Natl Acad Sci U S A 94
nise alpha-helix mimicking foldamers. Chem (10):4937–4942
Commun 53(19):2834–2837 32. Wilson DS, Keefe AD, Szostak JW (2001) The
19. Koutsoumpeli E et al (2017) Antibody use of mRNA display to select high-affinity
mimetics for the detection of small organic protein-binding peptides. Proc Natl Acad Sci
compounds using a quartz crystal microbal- U S A 98(7):3750–3755
ance. Anal Chem 89(5):3051–3058 33. Odegrip R et al (2004) CIS display: in vitro
20. Wang W et al (2017) Ultraefficient selection of peptides from libraries of protein-
cap-exchange protocol to compact biofunc- DNA complexes. Proc Natl Acad Sci U S A 101
tional quantum dots for sensitive ratiometric (9):2806–2810
biosensing and cell imaging. ACS Appl Mater 34. Smith GP (1985) Filamentous fusion phage:
Interfaces 9(18):15232–15244 novel expression vectors that display cloned
21. Xie C et al (2017) Development of an Affimer- antigens on the virion surface. Science 228
antibody combined immunological diagnosis (4705):1315–1317
kit for glypican-3. Sci Rep 7(1):017–10083 35. Tang AA et al (2017) Isolation of isoform-
22. Michel MA et al (2017) Ubiquitin linkage- specific binding proteins (Affimers) by phage
specific affimers reveal insights into K6-linked display using negative selection. Sci Signal 10
ubiquitin signaling. Mol Cell 68(1):233–246 (505):eaan0868
Part II
Abstract
Interactions between protein complexes and DNA are central regulators of the cell life. They control the
activation and inactivation of a large set of nuclear processes including transcription, replication, recombi-
nation, repair, and chromosome structures. In the literature, protein–DNA interactions are characterized by
highly complementary approaches including large-scale studies and analyses in cells. Biophysical approaches
with purified materials help to evaluate if these interactions are direct or not. They provide quantitative
information on the strength and specificity of the interactions between proteins or protein complexes and
their DNA substrates. Isothermal titration calorimetry (ITC) and microscale thermophoresis (MST) are
widely used and are complementary methods to characterize nucleo-protein complexes and quantitatively
measure protein–DNA interactions. We present here protocols to analyze the interactions between a DNA
repair complex, Ku70–Ku80 (Ku) (154 kDa), and DNA substrates. ITC is a label-free method performed
with both partners in solution. It serves to determine the dissociation constant (Kd), the enthalpy (ΔH ),
and the stoichiometry N of an interaction. MST is used to measure the Kd between the protein or the DNA
labeled with a fluorescent probe. We report the data obtained on Ku–DNA interactions with ITC and MST
and discuss advantages and drawbacks of both the methods.
1 Introduction
Amandine Gontier and Paloma Fernández Varela contributed equally with all other contributors.
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
125
126 Amandine Gontier et al.
A B Time (min)
0 20 40 60 80 100
0.00
-0.05
μcal/sec
Syringe
(V = 300 μL)
-0.10
Adiabac -0.15
shield
0.00
Measurement cell Ka
[Link]-1 of
-3.00
injectant
(V = 1,4 mL)
ΔT
Reference cell ΔH
-7.00
n
-10.00
0 0.5 1.0 1.5 2.0 2.5
Molar rao
Fig. 1 (a) Schematic representation of an isothermal titration calorimeter (ITC). The reference and measure-
ment cells are positioned in an adiabatic shield. A constant power is applied to the reference cell and a
variable power is applied to the measurement cell to maintain a small constant temperature difference
between the two cells thanks to a feedback circuit. Interactions are between a receptor deposited in the
measurement cell and a small volume of ligand injected by the syringe. Most interactions generate heat
(exothermic reaction). This triggers a decrease in the feedback power as represented in (b, top panel).
Some interactions can consume heat leading to an increase in the feedback power (endothermic reaction).
The integrals of the peaks from the top panel enable to calculate the enthalpy exchange at each injection.
These values are reported versus the ratio of receptor and ligand. The fit of this curve is called the isotherm of
titration. It gives access to the enthalpy ΔH, the association constant Ka (and thus the Kd, Kd ¼ 1/Ka), and the
stoichiometry N
Fig. 2 (a) Microscale thermophoresis optic system. MST is measured in capillaries with a small sample volume
(~4 μl). The fluorescence within the capillary is excited and detected through an objective. A focused IR laser
is used to locally heat a defined sample volume. Thermophoresis of fluorescent molecules through the
temperature gradient is detected by the objective. (b) Typical binding experiment. The thermophoretic
movement of a fluorescent receptor (blue trace; unbound) changes upon binding to a non-fluorescent ligand
(blue to red traces; bound), resulting in different traces. The change in thermophoresis is expressed as the
change in the normalized fluorescence (Fnorm), which is defined as F1(hot)/F0(cold) (F-values correspond to
average fluorescence values between defined areas marked by the red and blue cursors, respectively). (c)
Titration with a non-fluorescent ligand results in a gradual change in thermophoresis, which is plotted as Fnorm
versus ligand concentration. When relevant, the resulting binding curve can be fitted with a single binding site
model and enables to define the Kd
2 Materials
2.2 Samples for ITC As will be detailed below, suitable concentrations for a titration
depend on the expected Kd between the ligand and the receptor
and on the enthalpy associated with the formation of the complex.
Quantities listed below are required to characterize the interaction
between the Ku70–Ku80 (Ku) heterodimer and small DNA
Measurements of Protein–DNA Complexes Interactions by Isothermal. . . 131
2.4 Samples for MST MST is based on the detection of temperature-induced changes in
fluorescence of a target as a function of the concentration of a
non-fluorescent ligand. In typical experiments, 5–500 nM of the
fluorescently labeled molecule is used. The maximum ligand
132 Amandine Gontier et al.
3 Methods
3.1 Methods for ITC To get an accurate Kd measurement with ITC, the receptor con-
centration in the cell of the instrument and the ligand loaded in the
syringe should be well chosen. The receptor concentration appro-
priate for an ITC experiment can be estimated using the dimen-
sionless constant c, determined by the formula, c ¼ N Ka [Ro],
where N is the stoichiometry of the reaction (number of ligand
molecules bound by molecule of receptor), Ka is the association
constant (M1), and [Ro] the initial concentration of the receptor
in the sample cell (M). To obtain a well-defined S-shaped binding
isotherm with two plateau (Fig. 1b, bottom) and an accurate
measurement of the thermodynamic parameters of the equilibrium,
it is recommended to use an initial concentration of the receptor
[Ro] that results in a c value between 20 and 200 [22]. In the
absence of a priori information, typical starting concentrations are
1 μM for the receptor and 10 μM for the ligand. The ligand is
usually loaded in the syringe at a concentration ten times higher
than the receptor, so that at the end of the titration (typically
28 injections of 10 μl), the molar ratio of the ligand over the
receptor is 2.
3.1.3 ITC Measurements 1. The receptor (2.3 ml of Ku at 1 μM) and the ligand (0.6 ml
and Data Interpretation DNA at 10 μM) are degassed and equilibrated for 10 min at the
measurement temperature (here 20 C) using the
ThermoVac™.
2. The receptor is deposited in the measurement cell with a 2.5 ml
glass syringe. The sample is slowly loaded in the cell to avoid
bubbles. Injection is stopped when the liquid comes above a
visible level.
3. The ligand is loaded on the injection syringe (in open position)
using a 10-ml plastic syringe connected to the top of the ITC
syringe. The syringe is then purged and filled twice to remove
bubbles.
4. Start titration.
Measurements of Protein–DNA Complexes Interactions by Isothermal. . . 135
18bp
A +
+ 42bp
B n)
Time (min) C Time (min)
-6 12 30 48 66 84 -6 12 30 48 66 84
0.02 0.06
18bp
μcal/sec
μcal/sec
0.04
0.01
0.02 42bp
0.00 0.00
-0.02
6.00 22.0
[Link]-1 of inj
[Link]-1 of inj
4.00 16.0
2.00 8.0
0.00 0.0
0.0 0.5 1.0 1.5 2.0 2.5 3.0 0.0 0.5 1.0 1.5 2.0
Molar Ratio Molar Ratio
D
KD ΔH° -TΔS° ΔG°
DNA N
(nM) ([Link]-1) ([Link]-1) ([Link]-1)
18bp 0.97 ± 0.1 3.5 ± 0.8 5.1 ± 0.1 -16.6 ± 0.2 -11.5 ± 0.2
42bp 0.47 ± 0.1 2.4 ± 0.5 22.9 ± 0.3 -34.7 ± 0.5 -11.8 ± 0.1
Fig. 3 ITC measurements between Ku and DNA. (a) Crystal structure of Ku-DNA complex with a 14 bp DNA. Ku
has a ring shape structure. The DNA present in the crystal structure has an additional hairpin part that has
been removed for clarity (pdb code 1JEY). A schema is presented of the two interactions analyzed with Ku and
either a 18 bp DNA or 42 bp DNA. (b) ITC measurement between Ku and a 18 bp DNA. The interaction is
endothermic with positive peaks on the thermogram. The heat exchanges observed in this interaction are very
weak (<0.02 μcal/s) and underline the high sensitivity of the VP-ITC. The isotherm of titration enables to
define ΔH, Kd, and N of the reaction, reported in Table (d). One Ku molecule binds to an 18 bp DNA. (c) ITC
measurement between Ku and a 42 bp DNA hairpin. ΔH, Kd, and N of the reaction are reported in Table (d).
Two Ku molecules bind on the 42 bp DNA leading to a stoichiometry N close to 0.5
3.2 Methods for MST We describe here general guidelines to measure interactions using
MST and we illustrate two experimental setups with a labeled DNA
and non-labeled Ku or a labeled Ku and non-labeled DNA. We will
call receptor the fluorescently labeled molecules and ligand the
non-labeled one hereafter. The first step of an MST experiment is
to find a suitable combination of the receptor concentration
(10–100 nM are usually sufficient) and excitation LED power.
The LED can be adjusted to 1–100%. For the binding experiment
itself, you will need ~200 μl at twice the concentration you have
established at this step (for one replicate measurement). To get an
accurate, well-defined Kd, it is important to use a high enough
concentration of the ligand to reach saturation. Saturation is a
hallmark of ligand-specific molecular interaction: if the interaction
cannot be saturated, i.e., the signal does not change anymore by
increasing the ligand concentration, it is not a specific interaction,
but a nonspecific adsorption effect. To reach saturation, it is recom-
mended that the highest concentration of ligand is equal or higher
than 20-fold the expected Kd value.
In a preliminary assay, we compare the fluorescence intensity of
the receptor after switching on the IR laser LED (MST power) in
the absence and in the presence of a high enough concentration of
the ligand (respective to the expected Kd). We perform this experi-
ment with at least four capillaries with and without ligand. The
signal is defined as the response amplitude Fnorm. It is the ratio
between fluorescence intensity after turning on the IR laser LED
(usually measured at the 2-second or 5-second mark, called “MST
on time”) divided by the fluorescence intensity measured before
turning on the IR laser LED. It is expressed as ‰. The noise floor is
the error (standard deviation) between replicates without ligand. If
it is above 8‰, it may reflect some protein aggregation that needs
optimization. This also determines what should be considered
binding (or not) of the ligand: binding is only confirmed, if the
change observed upon ligand binding is threefold larger than your
noise level established at this step. For example, for a typical noise
Measurements of Protein–DNA Complexes Interactions by Isothermal. . . 137
3.2.2 Fluorescence Before starting binding assays, several pretests are required to opti-
Pretests mize. Check the optimal concentration of the fluorescence mole-
cules. Ideal fluorescent intensities are between 200 and 1500
counts.
Check the capillary type that is optimal for our study (stan-
dards, hydrophobic, and premium). The aim is to obtain narrow,
shoulder-free, regular, and symmetrical fluorescent peaks.
Check the optimal buffer composition. BSA and detergents can
be used to improve sample homogeneity. pH and/or ionic strength
are also parameters that can be adjusted if needed. Reducing agents
freshly prepared can also be used when needed.
3.2.3 Preliminary Binding In these preliminary assays, we compare the fluorescent signals of
Assays the receptor in the absence and in the presence of the higher
concentration used for the ligand. The DNA solution (10 μl of
[DNA-FAM5] at 10 nM) is mixed with 10 μl buffer or with 10 μl of
Ku at 266 nM concentration. We analyzed fluorescence intensity
and homogeneity, and the signal to noise ratio by repeating the
measurement four times. MST traces should be smooth, which will
indicate the absence of aggregation. The signal is defined as the
response amplitude (difference of fluorescence amplitude between
receptor alone and receptor–ligand complex) and the noise is the
standard deviation of errors between replicates. A signal-to-noise
ratio less than 5 suggests a signal too weak to measure a Kd, a ratio
of 5 or more indicates a quite favorable case for a Kd measurement
and a ratio higher than 12 reflects optimal conditions to measure a
Kd with MST.
138 Amandine Gontier et al.
3.2.5 Assays Ku is labeled with NT495 final concentration 20 nM. Titrant DNA
with Labeled Ku (and 18 bp is prepared at concentrations ranging from 123 nM to 3.9
Non-labeled DNA) pM by serial dilution. The buffer used is MST buffer and the
capillaries are premium capillaries. Measurements are performed
at 22 C, at 40% LED excitation and 40% or 60% MST power.
The signal to noise ratio is 3 in these conditions and does not enable
to measure a reliable Kd (Fig. 4a). The excitation power of 40% was
enough to have around 350 fluorescence counts. Increasing the
MST power increases the signal, but also the noise of the data.
10
5
0
-1 0
1.0E-12 1.0E-11 1.0E-10 1.0E-09 1.0E-08 1.0E-07 1.0E-06 1.0E-11 1.0E-10 1.0E-09 1.0E-08 1.0E-07 1.0E-06 1.0E-05 1.0E-04
Ligand Concentration Ligand Concentration
C DNA-FAM5 vs Ku D DNA-FAM5 vs Ku
MST trace LED power 100%
8
1.00
6
[Ku] ↗
Relative Fluorescence [-]
0.95
4
' FNorm [%]
0.90 2
0
0.85
0 5 10 15 20
MST experiment time [s] 1.0E-11 1.0E-10 1.0E-09 1.0E-08 1.0E-07 1.0E-06 1.0E-05 1.0E-04
Ligand Concentration
Fig. 4 MST measurements between Ku70–Ku80 and an 18 bp DNA. (a) Ku is labeled with NT-495 fluorescent
probe. The signal to noise ratio is too weak, and no Kd can be measured at 40% or 60% MST power. (b) The
18 bp DNA is labeled in 50 with a FAM fluorophore on one strand of the duplex. The measurements are
performed at 60%, 80%, and 100% excitation power. The signal to noise ratio and the fits are better defined at
100% excitation (d) than at 80% excitation. The MST traces observed at 100% excitation are shown in (c)
4 Additional Remarks
Acknowledgments
References
1. Gavin AC, Bosche M, Krause R et al (2002) 10. Nemoz C, Ropars V, Frit P et al (2018) XLF
Functional organization of the yeast proteome and APLF bind Ku80 at two remote sites to
by systematic analysis of protein complexes. ensure DNA repair by non-homologous end
Nature 415(6868):141–147 joining. Nat Struct Mol Biol 25(10):971–980
2. Uetz P, Giot L, Cagney G et al (2000) A com- 11. Ropars V, Drevet P, Legrand P et al (2011)
prehensive analysis of protein-protein interac- Structural characterization of filaments formed
tions in Saccharomyces cerevisiae. Nature 403 by human Xrcc4-Cernunnos/XLF complex
(6770):623–627 involved in nonhomologous DNA
3. Walker JR, Corpina RA, Goldberg J (2001) end-joining. Proc Natl Acad Sci U S A 108
Structure of the Ku heterodimer bound to (31):12663–12668
DNA and its implications for double-strand 12. Malivert L, Ropars V, Nunez M et al (2010)
break repair. Nature 412(6847):607–614 Delineation of the Xrcc4-interacting region in
4. Blier PR, Griffith AJ, Craft J, Hardin JA (1993) the globular head domain of cernunnos/XLF.
Binding of Ku protein to DNA. Measurement J Biol Chem 285(34):26475–26483
of affinity for ends and demonstration of bind- 13. Bacquin A, Pouvelle C, Siaud N et al (2013)
ing to nicks. J Biol Chem 268(10):7594–7601 The helicase FBH1 is tightly regulated by
5. Arosio D, Costantini S, Kong Y, Vindigni A PCNA via CRL4(Cdt2)-mediated proteolysis
(2004) Fluorescence anisotropy studies on the in human cells. Nucleic Acids Res 41
Ku-DNA interaction: anion and cation effects. (13):6501–6513
J Biol Chem 279(41):42826–42835 14. Dherin C, Gueneau E, Francin M et al (2009)
6. Tadi SK, Tellier-Lebegue C, Nemoz C et al Characterization of a highly conserved binding
(2016) PAXX is an accessory c-NHEJ factor site of Mlh1 required for exonuclease
that associates with Ku70 and has overlapping I-dependent mismatch repair. Mol Cell Biol
functions with XLF. Cell Rep 17(2):541–555 29(3):907–918
7. Britton S, Coates J, Jackson SP (2013) A new 15. Liberti SE, Andersen SD, Wang J et al (2011)
method for high-resolution imaging of Ku foci Bi-directional routing of DNA mismatch repair
to decipher mechanisms of DNA double- protein human exonuclease 1 to replication
strand break repair. J Cell Biol 202 foci and DNA double strand breaks. DNA
(3):579–595 Repair (Amst) 10(1):73–86
8. Chang HHY, Pannunzio NR, Adachi N, Lie- 16. Holdgate GA (2001) Making cool drugs hot:
ber MR (2017) Non-homologous DNA end isothermal titration calorimetry as a tool to
joining and alternative pathways to double- study binding energetics. BioTechniques 31
strand break repair. Nat Rev Mol Cell Biol 18 (1):164–170
(8):495–506 17. Krell T (2008) Microcalorimetry: a response to
9. Frit P, Ropars V, Modesti M, Charbonnier JB, challenges in modern biotechnology. Microb
Calsou P (2019) Plugged into the Ku-DNA Biotechnol 1(2):126–136
hub: the NHEJ network. Prog Biophys Mol 18. Velazquez-Campoy A, Freire E (2006) Isother-
Biol 147:62–76 mal titration calorimetry to determine
Measurements of Protein–DNA Complexes Interactions by Isothermal. . . 143
association constants for high-affinity ligands. 22. Myszka DG, Abdiche YN, Arisaka F et al
Nat Protoc 1(1):186–191 (2003) The ABRF-MIRG’02 study: assembly
19. Asmari M, Ratih R, Alhazmi HA, El Deeb S state, thermodynamic, and kinetic analysis of an
(2018) Thermophoresis for characterizing bio- enzyme/inhibitor interaction. J Biomol Tech
molecular interaction. Methods 146:107–119 14(4):247–269
20. Jerabek-Willemsen M, Wienken CJ, Braun D, 23. Czarny B, Stura EA, Devel L et al (2013)
Baaske P, Duhr S (2011) Molecular interaction Molecular determinants of a selective matrix
studies using microscale thermophoresis. Assay metalloprotease-12 inhibitor: insights from
Drug Dev Technol 9(4):342–353 crystallography and thermodynamic studies. J
21. Raynal B, Lenormand P, Baron B, Hoos S, Med Chem 56(3):1149–1159
England P (2014) Quality assessment and opti- 24. Dumas P, Ennifar E, Da Veiga C et al (2016)
mization of purified protein samples: why and Extending ITC to kinetics with kinITC. Meth-
how? Microb Cell Factories 13:180 ods Enzymol 567:157–180
Chapter 8
Abstract
The switchSENSE technology is a recent approach based on surface sensor chips for the analysis of
interactions of macromolecules. The technology relies on electro-switchable DNA nanolevers tethered at
one end on a gold surface via a sulfur linker and labeled with a Cy3 dye on the other end. The switchSENSE
approach is effective in the determination of a large panel of biophysical parameters such as binding kinetics,
dissociation constant, hydrodynamic radius, or melting temperature. In addition, it can also give access to
some enzymatic data such as nuclease or polymerase activity. Here we describe a DNA polymerase assay that
allows retrieving, in a single experimental set, association and dissociation rates, as well as the catalytic rate
of the enzyme.
Key words HIV reverse transcriptase, switchSENSE technology, Kinetics, Biosensor, DNA
polymerase
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
145
146 Guillaume Bec and Eric Ennifar
2 Materials
Fig. 1 Schematic representation of the HIV-1 DNA polymerase switchSENSE experiment. (a) Illustration
showing the building of the DNA nanolever following by regeneration of the biosensor chip. (b) Scheme of
the switchSENSE measurement described here, containing three main steps: association, polymerization, and
dissociation
2.2 Enzyme 1. Reverse transcriptase HIV-1, BH10 isolate (RT) was expressed
Preparation and purified as described previously [15] and stored as a sus-
pension in a 2 M (NH4)2SO4 solution.
148 Guillaume Bec and Eric Ennifar
3 Methods
3.3 Schematic 1. Building of the DNA nanolever is the first step of the experi-
Overview ment. This reaction is achieved by the hybridization of the
of the Experiment P36T80 oligonucleotide on the 80-mer DNA probe attached
to the chip (30 end), to generate a DNA duplex with a 44 bases
50 overhang (Fig. 1a, see Note 2).
Analysis of a DNA Polymerase Using switchSENSE Approach 149
Fig. 2 Example of DNA polymerization experiment using four HIV-1 RT concentrations. Fluorescence signal
observed upon addition of HIV-1 RT onto DNA nanolevers (a). on- (b) and off (c) rates obtained using the
switchANALYSIS software package. Determination of the kpol using switchANALYSIS
3.5 Consideration Polymerization rate is only fitted during the first 30 s of the reac-
About Obtained tion. As for classical studies in enzymology, this time window
Kinetics Parameters corresponds to the initial linear part allowing to measure initial
rate of the reaction, before the substrate becomes limiting.
In this experiment datasets, please note that the determined
kON value stands for the association of polymerase on a 50 protrud-
ing DNA strand and that the kOFF value stands for dissociation of
the polymerase from a fully extended blunt end DNA. Therefore,
no proper KD value (usually deduced from the ratio kkOFFON
) could be
calculated, because of the change in the nature of the substrate that
occurs during polymerization. KD of the polymerase for both forms
of the DNA could be calculated using a different experimental set
using the polymerase as an analyte and two complementary DNA
nanolevers of 36 or 80 nucleotides long as ligands.
4 Notes
References
1. Rich RL, Myszka DG (2011) Survey of the bioorthogonal labeling in vitro and in living
2009 commercial optical biosensor literature. cells. Chembiochem 19:1949–1953
J Mol Recognit 24:892–914 9. Rueda FO, Bista M, Newton MD et al (2017)
2. Knezevic J, Langer A, Hampel PA et al (2012) Mapping the sugar dependency for rational
Quantitation of affinity, avidity, and binding generation of a DNA-RNA hybrid-guided
kinetics of protein analytes with a dynamically Cas9 endonuclease. Nat Commun 8:1610
switchable biosurface. J Am Chem Soc 10. Webster MW, Chen YH, Stowell JAW et al
134:15225–15228 (2018) mRNA deadenylation is coupled to
3. Langer A, Hampel PA, Kaiser W et al (2013) translation rates by the differential activities of
Protein analysis by time-resolved measure- Ccr4-not nucleases. Mol Cell 70:1089–1100.
ments with an electro-switchable DNA chip. e8
Nat Commun 4:2099 11. Webster MW, Stowell JA, Passmore LA (2019)
4. Alt A, Dang HQ, Wells OS et al (2017) RNA-binding proteins distinguish between
Specialized interfaces of Smc5/6 control similar sequence motifs to promote targeted
hinge stability and DNA association. Nat Com- deadenylation by Ccr4-Not. elife 8:e40670
mun 8:14011 12. Kroener F, Heerwig A, Kaiser W et al (2017)
5. Blocquel D, Li S, Wei N et al (2017) Alterna- Electrical actuation of a DNA origami nanole-
tive stable conformation capable of protein ver on an electrode. J Am Chem Soc
misinteraction links tRNA synthetase to 139:16510–16513
peripheral neuropathy. Nucleic Acids Res 13. Clery A, Sohier TJM, Welte T et al (2017)
45:8091–8104 switchSENSE: a new technology to study
6. Denichenko P, Mogilevsky M, Clery A et al protein-RNA interactions. Methods
(2019) Specific inhibition of splicing factor 118-119:137–145
activity by decoy RNA oligonucleotides. Nat 14. Langer A, Schraml M, Strasser R et al (2015)
Commun 10:1590 Polymerase/DNA interactions and enzymatic
7. Nemoz C, Ropars V, Frit P et al (2018) XLF activity: multi-parameter analysis with electro-
and APLF bind Ku80 at two remote sites to switchable biosurfaces. Sci Rep 5:12066
ensure DNA repair by non-homologous end 15. Freisz S, Bec G, Radi M et al (2010) Crystal
joining. Nat Struct Mol Biol 25:971–980 structure of HIV-1 reverse transcriptase bound
8. Ploschik D, Ronicke F, Beike H et al (2018) to a non-nucleoside inhibitor with a novel
DNA primer extension with cyclopropenylated mechanism of action. Angew Chem Int Ed
7-Deaza-20 -deoxyadenosine and efficient Engl 49:1805–1808
Chapter 9
Abstract
Sedimentation velocity analytical ultracentrifugation is a powerful and versatile tool for the characterization
of proteins and macromolecular complexes in solution. The direct modeling of the sedimentation process
using modern computational strategies allows among others to assess the homogeneity/heterogeneity state
of protein samples and to characterize protein associations. In this chapter, we will provide theoretical
backgrounds and protocols to analyze the size distribution of protein samples and to determine the affinity
of protein–protein hetero-associations.
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
155
156 Christine Ebel and Catherine Birck
1.2 The c(s) Analysis During centrifugation, domination of the sedimentation term gives
rise to a migrating boundary that spreads with time because of an
opposing diffusional flow in response to the resulting concentra-
tion gradient [2, 13]. The time evolution of the radial concentra-
tion distribution during sedimentation is given by the Lamm
equation (Eq. 1). Numerical solutions to the Lamm equation are
used in many SV analysis programs to extract s and D from SV
experimental data.
The c(s) method implemented in the SV program SEDFIT
[14, 15] allows to obtain a high-resolution distribution of particle
according to their s-values. The c(s) analysis considers a large num-
ber of types of particles. It deconvolutes the effect of diffusion
broadening, assuming that all proteins have the same shape and
density (same v, f/fmin), which gives a relationship between s and D,
or, in an equivalent way, s and M, or s and RH (Eqs. 2–5). The
program simulates for each type of particle (each s-value), the set of
SV profiles, and allows to refine the value of f/fmin. It then deter-
mines the best combination of simulated SV profiles that fits the
experimental data. The resulting c(s) distribution shows peaks for
all sedimenting species in solution, assuming a constant shape.
Peaks of the c(s) plot can be easily integrated, providing their s-
value, their signal, and the percentage of each species.
1.3 Characterization It is noteworthy that SV data are highly sensitive to the presence of
of Protein trace aggregates, and a wide range of s-values can be covered in the c
Heterogeneity Using (s) distribution from a single experiment. The c(s) analysis allows to
SV determine if samples are heterogeneous. However, a c(s) plot with
only one peak does not mean that the sample is homogeneous. In
1.3.1 Non-interacting general, there are fewer peaks than species when particles are inter-
Versus Interacting System acting. For this reason, SV profiles should be acquired at different
concentrations. The nice superposition of the normalized c(s) plots
for protein samples at different concentrations indicates that the
protein does not self-associate. A shift in the peak position indicates
that the protein is in an equilibrium of association. When working
at high protein concentrations, above the mg/mL range, a slight
decrease of s-value is expected due to non-ideality effect (Eq. 8).
This is a complication in the analysis of weakly interacting
systems [12].
Heterogeneity and Affinity Interaction Analysis by Sedimentation Velocity 159
1.3.2 Non-interacting When s-values are invariant with concentration, the sample may be
System Analysis considered as composed of non-interacting species, a peak in the c
(s) representing a species. The non-interacting species analysis then
allows the determination of independent values for s and D, thus
M and RH, if the system consists of a limited number of species
(typically one or two).
1.4 Characterization SV offers two significant advantages for the study of interacting
of Protein macromolecules: a relatively high hydrodynamic size-dependent
Hetero-association resolution allowing the separation of free and bound species and
Using SV the fact that during the experiment, the complexes will remain in a
bath of the free species. Thereby, dissociating complexes can
re-associate during the sedimentation process in a way that will
reflect their equilibrium and kinetic properties [17]. The standard
methods of analyzing SV data to obtain association constants
between interacting macromolecules are Lamm equation fitting
and c(s)-based isotherm analysis. Practically, the determination of
equilibrium and kinetic binding constants requires to run multiple
experiments at concentrations that cover a range of about 1/10 to
10 Kd. It is advisable to make dilution or titration series to prepare
samples. In this way, these values can be refined with added con-
straints linking the concentrations of different experiments. In
dilution series of stock mixtures, the molar ratio is constant and
can be fixed or refined as a single global parameter. In titration
series, one protein is kept at low constant concentration in each
sample while the concentration of the binding partner varies in a
wide range.
1.4.1 Lamm Equation Current computational strategies allow for direct boundary model-
Fitting to Characterize ing of SV data for reacting systems with a set of coupled Lamm
Protein Hetero-association equations describing all the species participating in the interaction
combined with information on the equilibrium association con-
stant and reaction kinetics [18, 19]. It is noteworthy that only
this approach allows to estimate the kinetic off-rate constant koff
of interactions (see Note 2). This direct boundary fitting method
has been implemented in SEDPHAT with different binding models
available. Compared to the SV isotherm analysis, this analysis can be
conducted when only a few SV data sets are available (minimum
160 Christine Ebel and Catherine Birck
two) and yield more precise parameter estimates about Kd, koff, and
scomplex. This approach has been demonstrated to be efficient in a
number of cases but has several limitations including the fact that
individual species need to be reasonably described as discrete spe-
cies with the correct molecular weights. This is not always the case,
for example, when impurities contribute to boundary broadening
and thus preclude a good model fitting and accurate results. Fur-
thermore, as this method will take some time to converge, it is not
the first method of choice, but may be conducted using parameter
values obtained with the isotherm analysis.
1.4.2 Isotherm Analysis For the construction of an isotherm, the first step is the c(s) analysis
to Characterize Protein of all SV data corresponding to the concentration series. In fact, the
Hetero-association c(s) analysis can also be applied to slowly as well as rapidly interact-
ing systems. For slowly interacting systems, the boundary pattern
directly reflects the population of different species, which can often
be hydrodynamically resolved. In the case of a bimolecular interac-
tion of the type A + B forming an AB complex with s-values such
that sA < sB < sAB, three boundaries will be observed corresponding
to free A, free B, and complex AB. For rapidly interacting systems,
the association-dissociation events during sedimentation lead to at
most two boundaries, one always sedimenting at the s-value of
either free A or free B, termed undisturbed boundary, and the
other at a composition-dependent s-value between sB and sAB,
termed the reaction boundary. When the integration limits encom-
pass all sedimenting species, the result is termed signal-weighted
average sedimentation coefficient, sw, which is directly related to the
overall transport of the interacting system and independent of the
kinetics of the interactions. When the integration limits encompass
only the reaction boundary, the result is termed sfast referring to the
sedimentation coefficient of the fast-sedimenting species. The
resulting sw and sfast isotherms can be combined and fitted with
mass action law models implemented in program SEDPHAT to
determine the binding constants and species size [19]. In addition
to these two sw and sfast isotherms, a population isotherm can be
constructed by integrating each c(s) peak and tabulating the
reported amplitudes, in signal units, and combined in the analysis.
1.4.3 Example of Protein We will use the association between the BTG2 factor and the poly
Hetero-association (A)-binding protein PABP C1 as model system to illustrate protein
hetero-association. These proteins were shown to interact directly
and their association sufficient in vitro and necessary in cellulo for
BTG2 to stimulate mRNA deadenylation. The BTG2/PABP inter-
action is also required for BTG2 to exert its antiproliferative
function [20].
Heterogeneity and Affinity Interaction Analysis by Sedimentation Velocity 161
2 Materials
3 Methods
3.1 Data Acquisition 1. Prepare the analytical ultracentrifugation cells assemblies. Fill
the sample compartments with 400 μL (12 mm path length
centerpiece) or 100 μL (3 mm path length centerpiece) of
protein solutions and the solvent compartments with 420 or
162 Christine Ebel and Catherine Birck
110 μL of buffer (see Note 5). Close the cells and check that
cells that will be placed in opposite positions in the rotor have
the same weights (tolerance of 0.5 g). Place and align the cells
in the rotor holes.
2. Prepare the instrument: Put the rotor then the optical arm into
the analytical ultracentrifuge, and initiate vacuum and temper-
ature equilibration. Wait at least 2 h at the requested tempera-
ture before starting the SV experiment.
3. Check the absorbance signal in each cell. During temperature
equilibration, start the program ProteomeLab XL-I. Give a
title for each cell and a common folder for the collected data.
Start the AUC at 3000 rpm and acquire for each cell a radial
scan at 280 nm to check that the absorbance signal corresponds
to expectation.
4. Start the SV run: In the method window, enter 150 for the
number of scans. In the options window, enter 3 for the last
scans overlay and select stop XL after the last scan. Start the
centrifuge at the chosen speed (see Note 6) then start the
method scan. After the stop of the ultracentrifuge, cells are
disassembled, cleaned, and reassembled. Raw data are copied
for analysis. A detailed protocol can be found in [8].
3.2 Non-interacting We perform heterogeneity analysis of two BSA samples using both c
System Data Analysis (s) and non-interacting species models to illustrate the potential
with BSA Data Sets and limits of these approaches. The first sample, BSA1, which
contains aging aggregates is heterogeneous while the second,
BSA2, freshly prepared from size exclusion chromatography and
composed of monomeric BSA, is homogenous.
1. The c(s) analysis: Open the program SEDFIT and load a set of
SV scans corresponding to the whole sedimentation process
(Fig. 1). Set the meniscus with the red line (air-sample inter-
face) and the radial limits for the fit with the green lines.
Choose the continuous c(s) distribution model. In the parame-
ter window, enter the experimental values for partial specific
volume, density, and viscosity, change the confidence level to
0.68 (see Note 7) and mark the frictional ratio and meniscus
check boxes. Use the default values for all other parameters
(100 for resolution, 0–20 S for sedimentation coefficient
range, 1.2 for frictional ratio value) and press the run command
to perform a simulation of the sedimentation process using the
given parameters. The simulated data are displayed as lines with
the loaded scans, and a first c(s) distribution plot appears. Then
press the fit command to optimize the checked parameters
(frictional ratio and meniscus position). After convergence,
simulated data should fit very well to the experimental data
Heterogeneity and Affinity Interaction Analysis by Sedimentation Velocity 163
Fig. 1 SV data and c(s) analysis of BSA. Superposition of the experimental and fitted sedimentation velocity
profiles for BSA before (a) and after (b) size exclusion chromatography—samples BSA1 and BSA2, respec-
tively. Residuals of the fit are displayed in gray or absorbance scales. Corresponding c(s) distributions are
shown below each SV data. Sedimentation velocity profiles were obtained at 280 nm, at 20 C, and
130,000 g (42,000 rpm) using double-sector centerpieces with 12 mm optical path length. Analysis was
performed with the first 100 profiles, collected during 350 min. The c(s) analysis was obtained considering
200 particles with s-values in the 0–15 S range and a partial specific volume of 0.73 mL/g solvent density of
1.005 g/mL and a viscosity of 1.02 cp. A confidence level of 0.68 was used for the regularization procedure.
The rmsd were 0.006 and 0.009 for the BSA1 and BSA2 samples, respectively. The fitted frictional ratio were
1.25 and 1.33, respectively
(criteria for the quality of the fit are low rmsd value, less than
0.01 signal units under most cases, and randomly distributed
residuals around zero) to get the true best-fit distribution c(s).
Integration of the peaks in the c(s) distribution will give the
values of the different molecular parameters. Detailed steps of
the c(s) analysis can be found in SEDFIT help website (www.
[Link]/sedfit_help.htm). Figure 1,
panels A and B, shows a nice fit for the two BSA samples.
When BSA is diluted, the sample consist of a mixture of mono-
mers, dimers, trimers, and traces of higher oligomers which can
164 Christine Ebel and Catherine Birck
Fig. 2 SV data and analysis of BSA using a non-interacting species model. Superposition of the experimental
and fitted SV profiles for BSA, before (a) and after (b) size exclusion chromatography—samples BSA1 and
BSA2, respectively—using one non-interacting species model. Residuals of the fit are displayed in gray or
absorbance scales. Experimental conditions are detailed in the legend of Fig. 1. Sedimentation coefficients of
4.7 and 4.3 S with the corresponding molar masses of 27.4 and 65.9 kDa and rmsd on fits of 0.018 and 0.009
were obtained for BSA1 and BSA2 samples, respectively
Heterogeneity and Affinity Interaction Analysis by Sedimentation Velocity 165
3.3 Hetero- We illustrate here c(s) analysis in SEDFIT and integration of the
association Data sedimentation coefficient distributions in GUSSI to determine sw
Analysis and sfast values, reflecting the properties of the interacting system.
with BTG2-PABP Isotherm analysis in SEDPHAT.
Mixtures Data Sets 1. Perform a c(s) analysis in SEDFIT with SV data for each mix-
ture of the titration series and save the corresponding c(s)
distribution in GUSSI format. Open the program SEDFIT
and perform the c(s) analysis with SV data for the first mixture.
Excellent fit of the raw data is essential for the accuracy of
parameters determined in next steps. The c(s) distribution is
exported to GUSSI using Plot/Gussi c(s) plot, then accept the
GUSSI terms in the GUSSI window that appears, select File/
Save data only, choose the correct directory, give a name to the
file and save. A file *.gcofs is created. Then File/quit. Proceed
the same way for all SV data.
2. Superimpose all the c(s) distributions corresponding to the
titration series and transform experimental c(s) in corrected c
(s) distributions (Fig. 3). Open GUSSI, accept terms and press
OK in the GUSSI window with default c(s) selection. In the
GUSSI c(s) module window, select File/Add Distribution and
load the GUSSI file *.gcofs corresponding to the first c(s)
distribution (corresponding to the lowest concentration of
A). Repeat the loading procedure in ascending order of con-
centration for all the c(s) distributions. Select Axis/Standardi-
zation/Standardization, then Axis/Standardization/Modify
Standardization Parameters, and enter experimental conditions
in Standardization window for density, viscosity, partial specific
volume (values at experimental temperature and 20 C), and
temperature. Then press propagate to all distributions and
finally press commit. The experimental c(s) distributions are
transformed to corrected c(s) distributions. Then File/Save
GUSSI State to save the corrected c(s) superimposition file.
This *.gussi file can be recalled if needed.
3. Integrate all the superimposed corrected c(s) distributions to
generate the signal-weighted average sw isotherm file (Fig. 4).
In GUSSI, select Integration/Make Isotherm/Hetero/sw,
press no for the exclusion zone selection (see Note 8), and
166 Christine Ebel and Catherine Birck
Fig. 3 SV data and c(s) analysis of GST-BTG2: PABP mixtures. (a) Experimental SV data, fit, and residuals for a
mixture of 5 μM GST-BTG2 and 20 μM PABP. Individual data points are shown as circles and fits to
experimental data as lines. Residuals of the fit are displayed in absorbance scales. Sedimentation velocity
profiles were obtained at 280 nm, at 4 C, and 182,000 g (50,000 rpm) (b) Sedimentation coefficient
distributions c(s) derived from SV data of a titration series of 5 μM GST-BTG2 with 2.5, 5, 10, 20, 40, 80, and
160 μM PABP. The vertical dotted line indicates the s-value of GST-BTG2 determined in a separate experiment
(s ¼ 4.49 S). For better clarity of the reaction boundary, the y-axis was truncated at 2.1 value. To optimize
absorbance measurements, centerpieces with a 12 mm optical path length were used to analyze mixtures
with 2.5, 5, 10, 20, and 40 μM PABP, and centerpieces with a 3 mm optical path length for ones with 80 and
160 μM PABP. The sw isotherm was generated using integration of the c(s) overlays from 1 to 7 S and sfast
isotherm using integration from 3.2 to 7 S corresponding to the reaction boundary
4.5 5.8
5.6
4.0
5.4
sw fast (S)
sw (S)
3.5 5.2
5.0
3.0
4.8
2.5 4.6
residuals
residuals
0.04 0.03
0.01 –0.01
–0.03 –0.04
10-6 10-5 10-4 10-3 10-6 10-5 10-4 10-3
concentration (M) concentration (M)
Fig. 4 Binding isotherms of sedimentation coefficients sw and sfast. The two isotherms were extracted from the
sedimentation coefficient distributions shown in Fig. 3. Isotherm of sw is derived from the integration of all c(s)
peaks while sfast is from only the fast c(s) peak, corresponding to the reaction boundary. The global analysis of
both isotherms was performed in SEDPHAT using a hetero-association model with: M ¼ 80,860 Da,
s ¼ 4.48 S, and ε280nm ¼ 122,620 M1 cm1 for species A (GST-BTG2) and M ¼ 22,387 Da, s ¼ 2.20 S,
and ε280nm ¼ 15,930 M1 cm1 for species B (PABP). Starting values of logKa ¼ 5 and sAB ¼ 5.5 S yielded a
best-fit for Kd of 20 μM (95% confidence interval: 14–29 μM) with refined values for sA ¼ 4.49 S, sB ¼ 2.36 S,
and sAB ¼ 5.85 S. These values are in agreement with initial fitting values and observed peak positions in the c
(s) overlays (see Note 11)
Heterogeneity and Affinity Interaction Analysis by Sedimentation Velocity 167
4 Notes
Acknowledgments
References
1. Arthur KK, Kendrick BS, Gabrielson JP (2015) 15. Dam J, Schuck P (2004) Calculating sedimen-
Guidance to achieve accurate aggregate quan- tation coefficient distributions by direct mod-
titation in biopharmaceuticals by SV-AUC. eling of sedimentation velocity concentration
Methods Enzymol 562:477–500 profiles. Methods Enzymol 384:185–212
2. Correia JJ, Stafford WF (2015) Sedimentation 16. Zhao H, Ghirlando R, Alfonso C, Arisaka F,
velocity: a classical perspective. Methods Enzy- Attali I, Bain DL, Bakhtina MM, Becker DF,
mol 562:49–80 Bedwell GJ, Bekdemir A, Besong TMD,
3. Zhao H, Mayer ML, Schuck P (2014) Analysis Birck C, Brautigam CA, Brennerman W,
of protein interactions with picomolar binding Byron O, Bzowska A, Chaires JB, Chaton CT,
affinity by fluorescence-detected sedimentation Cölfen H, Connaghan KD, Crowley KA,
velocity. Anal Chem 86:3181–3187 Curth U, Daviter T, Dean WL, Dı́ez AI,
4. Kingsbury JS, Laue TM (2011) Fluorescence- Ebel C, Eckert DM, Eisele LE, Eisenstein E,
detected sedimentation in dilute and highly England P, Escalante C, Fagan JA, Fairman R,
concentrated solutions. Methods Enzymol Finn RM, Fischle W, de la Torre JG, Gor J,
492:283–304 Gustafsson H, Hall D, Harding SE, Cifre
JGH, Herr AB, Howell EE, Isaac RS, Jao
5. Schuck P (2013) Analytical ultracentrifugation S-C, Jose D, Kim S-J, Kokona B, Kornblatt
as a tool for studying protein interactions. Bio- JA, Kosek D, Krayukhina E, Krzizike D, Kusz-
phys Rev 5:159–171 nir EA, Kwon H, Larson A, Laue TM, Le
6. Le Roy A, Wang K, Schaack B, Schuck P, Roy A, Leech AP, Lilie H, Luger K, Luque-
Breyton C, Ebel C (2015) AUC and small- Ortega JR, Ma J, May CA, Maynard EL,
angle scattering for membrane proteins. Meth- Modrak-Wojcik A, Mok Y-F, Mücke N,
ods Enzymol 562:257–286 Nagel-Steger L, Narlikar GJ, Noda M,
7. Unzai S (2018) Analytical ultracentrifugation Nourse A, Obsil T, Park CK, Park J-K, Pawelek
in structural biology. Biophys Rev 10:229–233 PD, Perdue EE, Perkins SJ, Perugini MA,
8. Salvay AG, Communie G, Ebel C (2012) Sedi- Peterson CL, Peverelli MG, Piszczek G,
mentation velocity analytical ultracentrifuga- Prag G, Prevelige PE, Raynal BDE,
tion for intrinsically disordered proteins. Rezabkova L, Richter K, Ringel AE,
Methods Mol Biol 896:91–105 Rosenberg R, Rowe AJ, Rufer AC, Scott DJ,
9. Tabarani G, Reina JJ, Ebel C, Vivès C, Lortat- Seravalli JG, Solovyova AS, Song R,
Jacob H, Rojo J, Fieschi F (2006) Mannose Staunton D, Stoddard C, Stott K, Strauss
hyperbranched dendritic polymers interact HM, Streicher WW, Sumida JP, Swygert SG,
with clustered organization of DC-SIGN and Szczepanowski RH, Tessmer I, Toth RT,
inhibit gp120 binding. FEBS Lett Tripathy A, Uchiyama S, Uebel SFW,
580:2402–2408 Unzai S, Gruber AV, von Hippel PH,
Wandrey C, Wang S-H, Weitzel SE, Wielgus-
10. Dach I, Olesen C, Signor L, Nissen P, le Kutrowska B, Wolberger C, Wolff M, Wright E,
Maire M, Møller JV, Ebel C (2012) Active Wu Y-S, Wubben JM, Schuck P (2015) A mul-
detergent-solubilized H+,K+-ATPase is a tilaboratory comparison of calibration accuracy
monomer. J Biol Chem 287:41963–41978 and the performance of external references in
11. Rocco M, Byron O (2015) Computing trans- analytical ultracentrifugation. PLoS One 10:
lational diffusion and sedimentation coeffi- e0126420
cients: an evaluation of experimental data and 17. Zhao H, Balbo A, Brown PH, Schuck P (2011)
programs. Eur Biophys J 44:417–431 The boundary structure in the analysis of rever-
12. Chaturvedi SK, Ma J, Brown PH, Zhao H, sibly interacting systems by sedimentation
Schuck P (2018) Measuring macromolecular velocity. Methods 54:16–30
size distributions and interactions at high con- 18. Brautigam CA (2011) Using Lamm-equation
centrations by sedimentation velocity. Nat modeling of sedimentation velocity data to
Commun 9:4415 determine the kinetic and thermodynamic
13. Lebowitz J, Lewis MS, Schuck P (2002) Mod- properties of macromolecular interactions.
ern analytical ultracentrifugation in protein sci- Methods 54:4–15
ence: a tutorial review. Protein Sci 19. Zhao H, Brautigam CA, Ghirlando R, Schuck
11:2067–2079 P (2013) Overview of current methods in sedi-
14. Schuck P (2000) Size-distribution analysis of mentation velocity and sedimentation equilib-
macromolecules by sedimentation velocity rium analytical ultracentrifugation. Curr
ultracentrifugation and lamm equation model- Protoc Protein Sci. Chapter 20, Unit20.12
ing. Biophys J 78:1606–1619
Heterogeneity and Affinity Interaction Analysis by Sedimentation Velocity 171
20. Stupfler B, Birck C, Seraphin B, Mauxion F stoichiometry and affinity in SEDPHAT. Acta
(2016) BTG2 bridges PABPC1 RNA-binding Crystallogr D Biol Crystallogr 71:3–14
domains and CAF1 deadenylase to control cell 24. Brautigam CA (2015) Calculations and
proliferation. Nat Commun 7:10811 publication-quality illustrations for analytical
21. Balbo A, Minor KH, Velikovsky CA, Mariuzza ultracentrifugation data. Methods Enzymol
RA, Peterson CB, Schuck P (2005) Studying 562:109–133
multiprotein complexes by multisignal sedi- 25. Schuck P (2010) Sedimentation patterns of
mentation velocity analytical ultracentrifuga- rapidly reversible protein interactions. Biophys
tion. Proc Natl Acad Sci U S A 102:81–86 J 98:2005–2013
22. Zhao H, Piszczek G, Schuck P (2015) SED- 26. Demeler B (2010) Methods for the design and
PHAT--a platform for global ITC analysis and analysis of sedimentation velocity and sedimen-
global multi-method analysis of molecular tation equilibrium experiments with proteins.
interactions. Methods 76:137–148 Curr Protoc Protein Sci. Chapter 7, Unit 7.13
23. Zhao H, Schuck P (2015) Combining biophys-
ical methods for the analysis of protein complex
Chapter 10
Abstract
By maintaining intact multi-protein complexes in the gas-phase, native mass spectrometry provides their
molecular weight with very good accuracy compared to other methods (typically native PAGE or
SEC-MALS) (Marcoux and Robinson, Structure 21:1541–1550, 2013). Besides, heterogeneous samples,
in terms of both oligomeric states and ligand-bound species can be fully characterized. Here we thoroughly
describe the analysis of several oligomeric protein complexes ranging from a 16 ¼ kDa dimer to a 801-kDa
tetradecameric complex on different instrumental setups.
Key words Structural mass spectrometry, Noncovalent mass spectrometry, Oligomeric states, Stoi-
chiometry, Subcomplexes
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
173
174 Stéphane Erb et al.
2 Materials
2.1 Desalting Ammonium acetate: 200 mM solution in water (see Note 1). Weigh
1.54 g ammonium acetate (>98%) and transfer to a 100-mL cylin-
der. Add water to a volume of 95 mL. Mix and adjust pH to 7.4
with ammonium hydroxide (see Note 2). Make up to 100 mL with
water.
3 Methods
3.3 Direct Infusion of 1. In the interface setting panel, set the controller power On and
the Sample with the the temperature to 4 C (see Note 4).
TriVersa Nanomate™ 2. Load 10 μL of desalted protein sample to the 96- or 384-well
(Advion) plate.
3. In the Spray Optimization panel, set the Sample Volume to
5 μL, the gas pressure to 0.35 psi, the Voltage to apply to
1.60 kV and press “Deliver Sample” (see Note 5).
3.4 Calibration 1. Using the TriVersa Nanomate™ (see Subheading 3.3), deliver
5 μL of cesium iodide calibration mix (see Subheading 2.2).
3.4.1 TOF LCT (Upgraded
for High Mass Detection by 2. In MassLynx MS Tune window, manually set the following
MS Vision) parameters: Operate the instrument in positive mode with an
m/z range from 1,000 to 10,000. Apply 120 V and 5 V for the
sampling cone and extraction cone, respectively. The source
temperature is set at 90 C, but the capillary voltage and the gas
flows are not used in the TriVersa Nanomate™ interface setup.
3. Adjust the backing pressure to 6 mbar (see Note 6).
4. Start a 2-min acquisition with 4-s scans.
5. Average the signal over the 2 min in the Chromatogram panel
and in the Spectrum panel, select “Tools,” then “Make Cali-
bration,” and select “CsI_esi.ref” profile. Adjust calibration
points for the m/z range targeted and click on File\Save Spec-
trum, then click OK and finally accept the calibration after
closing the window.
6. Do not forget to load this calibration file (e.g., named CsI_-
date) before starting the first acquisition of the analyzed sam-
ple. To do so, click on “Acquire,” then select “calibration,” and
load the calibration file. Finally perform the acquisition.
Native Mass Spectrometry 177
3.4.2 Q-TOF Synapt G2 1. Using the TriVersa Nanomate™ (see Subheading 3.3), deliver
and G2Si 5 μL of cesium iodide calibration mix (see Subheading 2.2).
2. In MassLynx MS Tune windows, manually set the following
parameters: Operate the instrument in positive and sensitivity
modes with an m/z range from 1,000 to 8,000.
3. Nanoflow+ panel: Sampling Cone: 150 V. Source Offset: 30 V.
Source Temperature: 80 C. The Capillary Voltage and the gas
flows are not used in the TriVersa Nanomate™ interface setup.
4. Instrument: Trap and Transfer Collision Energy are turned off
(4 V and 2 V, respectively, by default).
5. Save these parameters as an .ipr file.
6. Press “acquire” to start a 2-min TOF-MS acquisition in the
1,000–8,000 m/z range.
7. Average the signal over the 2 min in the Chromatogram panel
and in the Spectrum panel, select Process\Automatic Peak
Detection with the “Set Peak Detection Parameters Automati-
cally” option activated.
8. Click on File\Save Spectrum and click OK.
9. In the Acquity UPLC Console, click on Intellistart, select
“Create Calibration,” and click Start.
10. In the calibration profile editor, select the right Mass Calibra-
tion Profile (here CsI in the 1,000–8,000 m/z range), right
click, and reset it.
11. Right Click and edit the Mass Calibration Profile. Below the
Positive Polarity chart, click on edit. Select the right Reference
Compound (here CsI_1,000–8,000 (positive) with reference
masses ranging from 1,172.1450 Da to 7,927.2031 Da) (see
Note 7).
12. Browse to select the previous acquisition file. Click on History
and select the last AccMass2 line.
13. Close the four windows by clicking OK and close the Mass
Calibration Profile Editor.
14. Click Next, Next, and Start to launch the calibration.
3.4.3 Q-TOF Maxis II 1. Using the HESI source and the 500 μL Hamilton™ syringe,
deliver cesium iodide calibration mix (see Subheading 2.2) with
a flow rate of 3 μL/min.
2. In the MS Tune window, manually set the following
parameters:
Operate the instrument in positive mode with an m/z
range from 1,000 to 8,000. Apply 20 eV and 5 eV for is CID
and CE parameters, respectively. Furthermore, native experi-
ments involve adapting transfer and prepulse storage times (see
Note 8): set to 320 μs and 15 μs, respectively. Concerning the
178 Stéphane Erb et al.
3.4.4 Exactive™ Plus 1. Using the HESI source and the 500 μL Hamilton™ syringe,
EMR Orbitrap deliver cesium iodide calibration mix (see Subheading 2.2) with
a flow rate of 10 μL/min.
2. In the MS Tune page, manually set the following parameters:
Operate the instrument in positive mode with an m/z
range from 1,000 to 20,000. Apply 25 eV and 100 eV for the
CID and CE parameters, respectively. The source temperature
is set at 250 C, the capillary voltage is set to 4 kV, and the gas
flow is set to 10 u.a. The trapping gas pressure is set to 7 u.a.
Set the ion optics (injection, inter, and bent flatapoles) at 4 V,
the nominal resolution at 17,500 and activate the EMR mode.
3. To perform the calibration, wait for a stable Total Ion Chro-
matogram (<12%), then select “Calibrate,” and check “EMR
MS Mass Calibration (pos)”.
3.4.5 Q-Exactive™ 1. Using the syringe pusher to deliver the ammonium hexafluor-
BioPharma Orbitrap ophosphate calibration mix at 5 μL/min.
2. In the Calibration Panel, select “HMR Mode calibration
(pos).”.
Fig. 1 Native MS analysis of the E. coli RNA polymerase complex. (a) Full MS spectrum of E. coli RNA
polymerase complex showing charged states 35+ to 41+ in the 9,000–12,000 m/z range corresponding to the
hetero-oligomer composed of five subunits (orange triangle) and 16+ to 33+ under m/z 2,500 corresponding
to the α-subunit (green circle). (b) Nondenaturing mass spectrum of E. coli RNA polymerase after deconvolu-
tion with UniDec highlights the presence of the hetero-oligomeric protein (390,315 Da) and the monomeric
α-subunit (36,509 Da)
180 Stéphane Erb et al.
Fig. 2 Native MS spectrum of the recombinant CDK-activating kinase complex desalted on a Micro
Bio-SpinTM 6 column. MS spectrum (a) before and (b) after data processing; and (c) after deconvolution
with UniDec
Native Mass Spectrometry 181
Fig. 3 Native MS analysis of the ERRα DBD-BE26PSIR3 complex. (a) Full MS spectrum of protein/DNA
complex. Two charge states distributions in the 2,000–4,000 m/z range are present, first corresponding to the
6+ and 7+ charge states of DNA alone in the 2,000–4,000 m/z range and second to the 9+ and 8+ charge
states of the protein/DNA complex in the 3,000–3,800 m/z range. (b) Zoom in the 3,000–3,600 m/z range
showing the protein/DNA complex 9+ and 8+ charge states revealing the presence of two truncated DNA
species. (c) The associated deconvolution of native mass spectrum with UniDec software highlights a 1:1
stoichiometry for the protein/DNA complex (27,892.5 Da) and confirms the presence of two truncated DNA
species which are also able to interact with the protein (27,740.6 Da and 27,586.3 Da)
Fig. 4 SEC-Native MS analysis of Saccharomyces cerevisiae ADH. (a) Total Ion Chromatogram (TIC)
corresponding to the SEC separation of the monomer and tetramer of the ADH. (b) Native MS spectrum of
the monomer (36.9 kDa) before (left) and after (right) deconvolution with UniDec. (c) Native MS spectrum of the
tetramer (147.5 kDa) before (left) and after (right) deconvolution with UniDec
184 Stéphane Erb et al.
3.10 High Molecular The use of an Exactive Plus platform is illustrated by the characteri-
Weight Homo- zation of the GroEL chaperone. This 57-kDa protein assembles as a
oligomeric Protein on a 14-mer to form a double toroidal complex, which together with
High-Resolution the GroES co-chaperonin facilitates protein folding in an
Exactive™ Plus EMR ATP-dependent manner [25].
Orbitrap 1. Use the freshly prepared and desalted GroEL protein (see Sub-
heading 2.4).
2. Connect the TriVersa Nanomate™ (see Subheading 3.3) to the
mass spectrometer. Infuse the sample concentrated at 5 μM of
oligomer.
3. In the Tune page, set the following parameters: Positive mode
with a 1,000–20,000 m/z range. Activate the EMR mode and
set the trapping gas pressure at 7 u.a., the ion optics at 4 V
(inter, injection, and bent flatapoles), the S-lens RF voltage at
200 V, the temperature at 250 C, the fragmentation para-
meters at 25 eV and 150 eV for CID and CE values, respec-
tively. Select a nominal resolution of 17,500.
4. Start a 2-min acquisition with a stable TIC and analyze the MS
spectrum.
The resulting averaged mass spectrum is presented in
Fig. 6a (full mass range) and Fig. 6b (zoom between 11,000
Native Mass Spectrometry 185
Fig. 5 Native MS analysis of Concanavalin A from Canavalia ensiformis protein. (a) Full MS spectrum of
Concanavalin A showing charged states 24+ to 20+ in the m/z range from 4,000 to 5,500 corresponding to
the homo-oligomeric protein (blue circle). (b) Non-denaturing mass spectrum of Concanavaline A after
deconvolution with UniDec highlights the tetrameric state of the protein complex (102,707 Da)
Fig. 6 Native MS analysis of Chaperonin 60 (GroEL) complex. (a) Full MS spectrum of GroEL complex showing
a unique charge states distribution around m/z 12,000. (b) Zoom in the 10,000–14,000 m/z range where
charge states 64+ to 71+ of the protein complex are detected. (c) Associated deconvolution obtained after
data processing using UniDec software in the 785–815 kDa mass range, showing one species corresponding
to the 14-mer homo-complex at 801.6 kDa
3.11 Protein The use of a Q-Exactive™ Biopharma Orbitrap platform for the
Oligomeric State determination of protein oligomeric states is exemplified by the
Determination on a analysis of the p8/TTD-A TFIIH subunit and yeast alcohol dehy-
High-Resolution Q- drogenase (ADH). p8 is a 72-amino acid protein shown to form
Exactive™ Biopharma stable homodimers in solution [26]. The ADH is an enzyme
Orbitrap required for the reduction of acetaldehyde to ethanol and is active
as a tetramer [27].
186 Stéphane Erb et al.
Fig. 7 Native MS analysis of the p8 subunit from the human TFIIH complex (a) Raw MS spectrum of p8
showing charged states 4+ to 9+ corresponding to the monomer (purple) and 6+ to 11+ corresponding to the
dimer (red). The inset shows a close-up view of the 2,069.01 peak, revealing an overlap of the monomeric 4+
and dimeric 8+ charged states. (b) Native MS spectrum of p8 after deconvolution with UniDec, showing the
presence of monomeric (8,272 Da) and dimeric (16,544 Da) species
Native Mass Spectrometry 187
3.11.2 The Yeast Alcohol 1. Weigh 1.6 mg of alcohol dehydrogenase from Saccharomyces
Dehydrogenase (ADH) Cerevisiae (Sigma-Aldrich). Resuspend in 280 μL of 200 mM
ammonium acetate to reach a tetrameric concentration of
40 μM.
2. Connect the TriVersa Nanomate™ to the Q-Exactive™ Bio-
pharma Orbitrap as explained in Subheading 3.4.
3. In Excalibur Tune window, manually set the following
parameters:
Operate the instrument in positive mode with an m/z
range from 2,500 to 8,000.
Intact protein mode: off; HRM mode: on; resolution:
15,000; Micro Scan Count: 10; Max. Ion Time: 200 ms;
AGC target: 3e6, S-Lens RF Level: 200, Capillary Tempera-
ture: 320 C, Capillary Voltage: 4.4 kV.
Save these parameters as an .mstune file.
4. Start a 2-min acquisition in the 2,500–8,000 m/z range and
analyze data.
The corresponding averaged raw data is represented in
Fig. 8a. Manual or software-driven (see Subheading 3.5, step
5) deconvolution of the data identifies different species
corresponding to the monomeric (MW ¼ 36,879 Da) and
tetrameric (MW ¼ 147,516 Da) ADH protein (Fig. 8b). The
effective resolution ranges from 2,000 (m/z 5,674) to 4,600
(m/z 2,844).
Fig. 8 Native MS analysis of Saccharomyces cerevisiae ADH. (a) Raw MS spectrum of ADH showing charged
states 10+ to 14+ corresponding to the monomer (purple) and 23+ to 28+ corresponding to the tetramer
(red). (b) Native MS spectrum of ADH after deconvolution with UniDec, showing the presence of monomeric
(36,879 Da) and tetrameric (147,516 Da) species
188 Stéphane Erb et al.
4 Notes
Acknowledgments
References
Khalid S, Stewart AG, Matthews SJ, 22. Kolesnikova O, Radu L, Poterszman A (2019)
Grünewald K, Robinson CV (2018) Protein TFIIH: a multi-subunit complex at the cross-
assemblies ejected directly from native mem- roads of transcription and DNA repair. Adv
branes yield complexes for mass spectrometry. Protein Chem Struct Biol 115:21–67
Science 362(6416):829–834 23. Fouillen L, Abdulrhaman W, Moras D, van
14. Marcoux J, Robinson CV (2013) Twenty years Dorsselaer A, Poterszman A, Sanglier-Cianfér-
of gas phase structural biology. Structure 21 ani S (2010) Analysis of recombinant phospho-
(9):1541–1550 protein complexes with complementary mass
15. Gan J, Ben-Nissan G, Arkind G, Tarnavsky M, spectrometry approaches. Anal Biochem 407
Trudeau D, Noda Garcia L, Tawfik DS, Sharon (1):34–43
M (2017) Native mass spectrometry of recom- 24. Mohideen-Abdul K, Tazibt K, Bourguet M,
binant proteins from crude cell lysates. Anal Hazemann I, Lebars I, Takacs M,
Chem 89(8):4398–4404 Cianférani S, Klaholz BP, Moras D, Billas
16. van de Waterbeemd M, Tamara S, Fort KL, IML (2017) Importance of the sequence-
Damoc E, Franc V, Bieri P, Itten M, directed DNA shape for specific binding site
Makarov A, Ban N, Heck AJR (2018) Dissect- recognition by the estrogen-related receptor.
ing ribosomal particles throughout the king- Front Endocrinol (Lausanne) 8:140
doms of life using advanced hybrid mass 25. Horwich AL, Fenton WA, Chapman E, Farr
spectrometry methods. Nat Commun 9 GW (2007) Two families of chaperonin: physi-
(1):2493 ology and mechanism. Annu Rev Cell Dev Biol
17. Opalka N, Brown J, Lane WJ, Twist KA, 23:115
Landick R, Asturias FJ, Darst SA (2010) Com- 26. Vitorino M, Coin F, Zlobinskaya O,
plete structural model of Escherichia coli RNA Atkinson A, Moras D, Egly JM,
polymerase from a hybrid approach. PLoS Biol Poterszman A, Kieffer B (2007) Solution struc-
8(9):e1000483 ture and self-association properties of the p8
18. Twist KA, Husnain SI, Franke JD, Jain D, TFIIH subunit responsible for Trichothiody-
Campbell EA, Nickels BE, Thomas MS, Darst strophy. J Mol Biol 368(2):473–480
SA, Westblade LF (2011) A novel method for 27. Raj SB, Ramaswamy S, Plapp BV (2014) Yeast
the production of in vivo-assembled, recombi- alcohol dehydrogenase structure and catalysis.
nant Escherichia coli RNA polymerase lacking Biochemistry 53(36):5791–5803
the α C-terminal domain. Protein Sci 20 28. Gervais V, Muller I, Mari PO, Mourcet A,
(6):986–995 Movellan K, Ramos P, Marcoux J, Guillet V,
19. Marty MT, Baldwin AJ, Marklund EG, Hoch- Javaid S, Burlet-Schiltz O, Czaplicki G,
berg GK, Benesch JL, Robinson CV (2015) Milon A, Giglia-Mari G (2018) Small
Bayesian deconvolution of mass and ion mobil- molecule-based targeting of TTD-A dimeriza-
ity spectra: from binary interactions to polydis- tion to control TFIIH transcriptional activity
perse ensembles. Anal Chem 87 represents a potential strategy for anticancer
(8):4370–4376 therapy. J Biol Chem 293(39):14974–14988
20. Reid DJ, Diesing JM, Miller MA, Perry SM, 29. Marcoux J, Wang S, Politis A, Reading E, Ma J,
Wales JA, Montfort WR, Marty MT (2019) Biggins P, Zhou M, Tao H, Zhang Q,
MetaUniDec: high-throughput deconvolution Chang G, Morgner N, Robinson CV (2013)
of native mass spectra. J Am Soc Mass Spec- Mass spectrometry reveals synergistic binding
trom 30(1):118–127 of nucleotides, lipids and drugs to a multidrug
21. Radu L, Schönwetter E, Braun C, Marcoux J, resistance efflux pump. Proc Natl Acad Sci 110
Kölmel W, Schmitt DR, Kuper J, Cianferani S, (24):9704–9709
Egly JM, Poterszman A, Kisker C (2017) The 30. Laganowsky A, Reading E, Hopper JT, Robin-
intricate network between the p34 and p44 son CV (2013) Mass spectrometry of intact
subunits is central to the activity of the tran- membrane protein complexes. Nat Protoc 8
scription/DNA repair factor TFIIH. Nucleic (4):639–651
Acids Res 45(18):10872–10883
Chapter 11
Abstract
Protein hydrogen/deuterium exchange (HDX) coupled to mass spectrometry (MS) can be used to study
interactions of proteins with various ligands, to describe the effects of mutations, or to reveal structural
responses of proteins to different experimental conditions. It is often described as a method with virtually
no limitations in terms of protein size or sample composition. While this is generally true, there are,
however, ligands or buffer components that can significantly complicate the analysis. One such compound,
that can make HDX-MS troublesome, is DNA. In this chapter, we will focus on the analysis of pro-
tein–DNA interactions, describe the detailed protocol, and point out ways to overcome the complications
arising from the presence of DNA.
Key words DNA, Hydrogen/deuterium exchange, Protein–DNA binding, Structural mass spec-
trometry, Transcription factor
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
193
194 Ruzena Filandrova et al.
2 Materials
3 Methods
Fig. 1 Gel shift assay. Two oligonucleotides (DNA1 and DNA2) with different
binding affinities are shown. Shifts in electrophoretic mobility in the third and
fifth lane from the left indicate duplex DNA and protein–DNA complex formation,
respectively. Protein control lane stayed empty since no DNA was present. In
both the complex lanes, a band of the same mobility as dsDNA can be observed,
though in the “higher KD complex” lane, this band is much thicker, indicating
lower bound fraction of the protein
HDX-MS of Protein-DNA Complexes 199
3.2 Optimizing Before starting the H/D exchange, it is crucial to verify how the
Digestion Conditions protein is digested under HDX-MS compatible conditions. Differ-
ent aspects to be considered are protein sequence coverage, peptide
length, and peptide redundancy but also whether the protein
remains soluble after quenching and freezing and how the presence
of DNA affects the whole procedure. The primary goal is to ideally
obtain full sequence coverage with peptides providing good spatial
resolution, i.e., not very short or long ones. Recommendations
regarding optimal length do vary slightly in the literature, but
fragments between 8 and 12 amino acids probably represent the
best standard. Besides the spatial resolution obtainable through the
generated peptides, one can also target nearly amino acid resolution
using suitable fragmentation techniques like electron transfer dis-
sociation [19] or UV photodissociation [20] (see Note 11). In
addition, emphasis should also be put on the generation of large
numbers of overlapping peptides as these can further increase the
spatial resolution [21, 22] and/or provide higher confidence in the
observed changes (see Note 12). To fulfill all these goals, different
proteases, ideally immobilized and packed into a column, should be
tested [17, 23–26]. The columns can be used individually or com-
bined in serial or parallel setting [27]. Column size as well as the
protease density on the POROS resin, which together dictate the
enzyme:protein ratio, can be varied. Other factors affecting the
digestion are flow, temperature, pressure, and the use of denaturing
agents. Time spent on the proteolytic column is primarily deter-
mined by the desalting LC flow. Therefore, higher flow leads to
faster digestion and produces longer fragments and higher redun-
dancy (number of overlapping peptides). Slower flow, on the other
hand, produces more complete digestion, which however may at
times be even detrimental, if the peptides produced are too short.
Typical digestion temperature should be close to 0 C to minimize
deuterium-loss (back-exchange), but it can be raised to 15 C or
even 20 C locally to increase the digestion efficiency. This is usually
achieved either in a dedicated separately temperature-controlled
chamber for the protease column or by placing the column out of
the ice/water bath. However, when tweaking these parameters, one
should always keep in mind that optimal balance between efficient
digestion and minimal H/D back-exchange conditions must be
maintained (hence running the analysis as fast as possible and at
the lowest possible temperature). For proteins not offering satisfac-
tory digestion under mild denaturing conditions provided by the
acidic environment of the quench buffer alone, addition of dena-
turing agents is suggested. Urea or guanidine can be used at quite
high concentrations with all the immobilized proteases; however,
besides rendering the target protein susceptible to digestion, these
agents also affect the protease itself as well as peptide binding to the
reversed phase resin in the trap column. While guanidine was
shown to have mainly a detrimental effect, urea can even enhance
200 Ruzena Filandrova et al.
Fig. 2 Schematic representation of HDX LC-MS setup. Dimensions of the columns and tubing are shown. The
setup is in position where digestion and desalting are running. Upon switch of the switching valve, the ports
are connected by the gray dashed lines and gradient elution of the desalted peptides from trap column onto an
analytical column is performed
HDX-MS of Protein-DNA Complexes 201
Fig. 3 Sequence coverages of the two studied DNA binding domains. In all instances, immobilized proteases
were used. Table at the right lower corner of each panel shows digestion metrics for the individual conditions
(coverage, number of peptides, average peptide length, and redundancy—how many peptides are on average
covering each residue). (a) DNA binding domain of FOXO4 where initial proteolysis by pepsin (blue bars) was
after optimization replaced by combined digestion with pepsin followed by nepenthesin-1 (red bars). This led
to better spatial resolution and higher redundancy. In case of FOXO4, the presence of oligonucleotides
(DAF-16) caused no problems, and thus, only tuning of the digestion itself was necessary. (b) Examples
from the tuning procedure with TEAD1 DNA binding domain. Pepsin (blue bars) provided full sequence
HDX-MS of Protein-DNA Complexes 203
Fig. 3 (continued) coverage but lower spatial resolution—on average it had longest peptides. Nepenthesin-
2 (red bars) led to over-digestion, which is indicated by gaps in the sequence, and the identified peptides are
mostly short ones. High activity of the protease resulted in the generation of short peptides and incomplete
sequence coverage. The green bars show the final conditions where aspergillopepsin (protease type XIII) was
utilized in the presence of urea. Addition of denaturing agent was necessary as the protein in the presence of
oligonucleotides precipitated. Addition of urea (optimized to final 2 M concentration) led to much better protein
recovery. In both examples shown here, the advantage of alternative proteases for the digestion of DNA
binding proteins (which are rich in basic residues) is demonstrated through their ability to cleave after the Lys
and Arg residues (highlighted by arrowheads above the sequence)
204 Ruzena Filandrova et al.
3.4 Mass 1. Use the LC system as in Subheading 3.2 and perform steps
Spectrometric 2–4. Start all LC pumps, calibrate the mass spectrometer,
Analysis of Deuterated pre-wash, and pre-condition the protease column. Then run
Samples the standard protein followed by two blank injections (see
Note 28).
2. Before the end of previous analysis, take one of the partially
deuterated samples from the freezer and start thawing
it. Depending on the quench buffer composition, it will melt
in 30 s to 1 min. As soon as it is thawed, inject it for analysis.
3. Repeat this for all collected samples (see Note 29).
4. Analyze fully deuterated control exactly as the partially deuter-
ated samples.
5. Finally run two blanks followed by non-deuterated samples for
each experimental condition.
6. Export and/or pre-process all LC-MS acquired data and pre-
pare them for final data processing.
3.5 Interpreting Data Nowadays, there are several different programs that are capable of
from H/D Exchange largely automatic HDX-MS data processing. Waters users rely on
their DynamX suite while others can use HDExaminer from Sierra
Analytics that supports all native file types as well as open source
ones. Another option for Waters and Thermo users is represented
by the HDX Workbench [31] from Omics Informatics. Alterna-
tively, there are software tools freely available from different
research groups [22, 32–35]. These and other programs and their
workflows were recently reviewed in detail by Claesen and Burzy-
kowski and also by Eggertson et al. which in addition offers another
view on HDX-MS data processing [36, 37].
The basic principle which is crucial to the understanding of the
workflow and its requirements is, however, the same. To make this
protocol widely applicable, we will show two possible scenarios.
One, relying on a manual interpretation which is nowadays out-
dated and extremely laborious. However, it demonstrates well the
basic principle which the available programs automate. It can also
be useful for validation purposes and in specific cases (extraction of
EX1/EX2 data). The other workflow presented here employs our
own software called DeutEx (see Note 30).
Data processing in the HDX-MS workflow consists of four
major steps. First is the identification of peptides generated during
the proteolysis step and their temporal localization within an LC
HDX-MS of Protein-DNA Complexes 207
3.5.1 Workflow A: 1. From an MS/MS search engine, e.g., MASCOT (here utilized
(Largely Automated) Data by Bruker’s ProteinScape), export the search result in the form
Interpretation Using DeutEx of a csv file (see Note 32).
2. Prepare a separate simple text file containing the sequence of
the studied protein in FASTA format.
3. Open DeutEx and go to Analysis>Compose digest file from MS.
New window will appear. In this window, upload your protein
sequence as a FASTA file, then csv file containing the list of
identified peptides from MASCOT and an LC-MS run of a
non-deuterated sample exported into simple text files (each MS
scan corresponding to one file) containing a list of m/z values
and their intensities (see Note 33).
4. Go to Digest, click Create from report and then Extract scan/
charge limits. Each peptide will have its retention limits auto-
matically identified, and extracted ion chromatograms will be
drawn for individual charge states (m/z values). User can man-
ually inspect the assignments and either manually correct or
completely reject them. Once finished, the result should be
exported into a text file that serves as a lookup file for an
automated assignment of HDX data for the deuterated sam-
ples. Close the “Compose digest from MS window.”
5. Go to Analysis>Open Analysis directory. It is advisable to
pre-compile data for each state into a separate folder (which
contains exported LC-MS data in a txt format, with appropriate
fasta sequence and digest file—the list of peptides created in
step 4). However, the data can also be compiled in DeutEx
using the “Compose analysis” function.
6. Once all data are opened, check the settings for mass accuracies
and filtering under the options menu and run the calculation.
Typically, it lasts from seconds to a few minutes, depending on
the number of conditions, number of peptides, and size of the
exported data on a common laptop/office computer. When
calculation is finished, run filtering, which tries to automatically
remove incorrect assignments. Then look through the assign-
ments manually, check the data, and correct any misassign-
ments, if needed.
208 Ruzena Filandrova et al.
7. The basic output from DeutEx is a set of uptake plots that are
displayed either as deuteration percentage or number of
exchanged deuterons as a function of time. The data can also
be exported in simple text form which allows their further
processing in Excel or MSTools ([Link]
MSTools/) [38].
3.5.2 Workflow B: 1. In any program that is used for viewing the LC-MS data, open
Manual Data Interpretation a non-deuterated LC-MS analysis.
2. For each peptide, trace an extracted ion chromatogram based
on its m/z (usually included in the search engine report).
Check also other charge states that are visible and enter this
information into an Excel sheet together with the retention
time limits for further use. Sum scans across the LC peak and
export the spectrum as a simple text file (typically two columns
including m/z values and intensity).
3. Open a partially deuterated LC-MS analysis and locate the
deuterated signal corresponding to the peptide information
gathered in the previous step. Repeat the step of summing up
the scans and exporting the spectra into text files. Repeat
iteratively for all peptides. For such a manual approach, it is
advisable to select a minimal set of peptides (preferably short
ones) covering the entire protein without many overlaps (see
Note 34).
4. Once the data are exported to *.txt files, run mMass program
[39] (see Note 35). Go to File>Open and open a file with
non-deuterated data. The spectrum is not by default labeled,
but it is not necessary at this point. Make sure that the correct
way of peak picking is selected. Go to tab Processing>Deisotop-
ing and set “Label envelope tool” to Envelope Centroid option.
Now locate the selected peak (m/z) and zoom to the mass
range covering the whole isotopic pattern of this peptide. Use
“Label envelope tool” (select from tab Tools). Using Shift +
mouse middle wheel scrolling, set the desired charge state—
black dots are changing distance as you scroll up and down. Fit
it to the desired isotopomer distance and now select the num-
ber of dots to cover all visible isotopic peaks from the particular
envelope. This is done by Ctrl + Shift + mouse middle button
scrolling. This tool helps you to localize all isotopes belonging
to the selected peak. Left click and the peak will be labeled.
Average m/z value is written into the spectrum, and the decon-
voluted value (average mass) appears in the right panel (Fig. 5).
Write this number down to an Excel file. Eventually, you can
now repeat this step also for other charge states of the same
peptide. One by one, all m/z values of each peptide from all
deuterated samples are processed using this approach (see
Note 36).
HDX-MS of Protein-DNA Complexes 209
Fig. 5 Screenshot of mMass window with zoom on the isotopic pattern. Black dots are labels showing which
isotopes will be used for Mavg calculation. The deconvoluted average mass is shown in the right panel
5. When all peptides are processed and the Excel file complete, the
percentage of deuteration or the number of deuterons can be
easily calculated [2] and used for visualization of the results.
3.6 Data There are no set guidelines on how to visualize HDX data, and
Visualization indeed, a multitude of different plots are used throughout the
literature. The first result that is usually obtained is a set of uptake
plots in which the percentage of deuteration or the number of
deuterons is plotted for each peptide as a function of time. How-
ever, from such a display, it is difficult to interpret the data in the
structural context and also to efficiently handle the information
from overlapping peptides. For a more comprehensive view, heat
maps or protection plots [38] are most often utilized. These sum-
marize the information into one picture and present it along the
protein sequence. However, their basic form does not allow one to
visualize information from the overlapping peptides as the data are
plotted using only a subset of selected (usually shortest) peptides
continuously covering the entire sequence. To also include the
redundancy information, peptide midpoints can be calculated
[29] for each peptide, which allows the distinction of closely related
ones (e.g., 14–25, 14–27, 16–25, 16–27). Upon this modification,
210 Ruzena Filandrova et al.
the data can also efficiently be used in mirror (or so-called butterfly)
plots or in bar graphs. The disadvantage of this data display is that
the proportions of the peptides versus the protein sequence are lost.
Probably one of the most attractive ways of data presentation is thus
mapping the observed changes onto an existing high-resolution
structure or protein model. In this case, differences between two
protein states are calculated (preferably for the number of deuter-
ons not for percentages), and the structure is colored according to
the observed changes. Visualization tools are usually included in
the HDX specific software (DynamX, HDExaminer, etc.,); how-
ever, our web-based MSTools suite makes many visualization tools
available for vendor-independent use [38].
Moreover, for structure coloring, PyMol with its scripting
capabilities is unparalleled. In this workflow, the b-factors of pdb
format’s fields in an existing protein structure are hijacked and
replaced with the numbers from an HDX experiment. To load the
data into PyMol, it is necessary to cut each peptide virtually into
individual amino acids and use this as an input for coloring.
1. Prepare a table which contains information about each pep-
tide’s start, end, time of deuteration (in seconds), and the
difference in deuteration between selected states:
Save this table as tab delimited simple text file into a new
folder.
2. Copy Python script [Link] (see Note 37) into
this folder and run it (see Note 38). Command window will
appear, and the script will ask for the name of the input file.
Then it requires information about the time to be parsed
(selected time or all the times in the file) and finally about the
conditions to be extracted (again selected one or all). The script
then creates a set of files depending on the number of condi-
tions and time points in the experiment. Names of the files are
HDX-MS of Protein-DNA Complexes 211
created using the name of the input file, time, and number of
the column in the input file (e.g., FOXO_20_2.txt means 20-s
time point and second column from the input file which was
named [Link]).
3. Open PyMol and load the pdb file with the structure. Using
“copy” ([Link] command,
get the desired number of copies corresponding to the number
of states and conditions prepared in the previous step. Also
name the objects so that the names correspond to the condi-
tions and times from the dataset.
4. Within the PyMol command line, activate script data2bfactor.
py (see Note 39) by the command “run path/[Link]”
(where “path” stands for the absolute path to the folder, where
the script is saved on your computer), e.g., run C:\Python27
\Scripts\[Link].
5. Reset the b factors to a number that is outside the dataset (e.g.,
99). This will later allow you to color the regions that are not
covered by the peptides in the dataset. Enter command “alter
object_name, b¼99” (where “object_name” stands for the
name of an individual object/structure chosen by the user).
6. Color the structure(s) to some neutral, uniform color using
command “color.” E.g., “color grey70.”
7. Apply your data onto the individual structures. Use command
“data2b_res object_name, path.” For example, data2b_res
FOXO_20_WT-MUT, C:\Data\FOXO_20_2.txt (i.e., second
column of the input file for [Link] script
contained difference between wild-type and mutant). Do this
for all structures/objects in PyMol and all input text files.
8. Now select residues with all negative and positive b values,
respectively. Enter commands “select negative, b<0.0” and
“select positive, b>0.0.”
9. Color these selections using commands “spectrum b, selec-
tion¼negative, minimum¼-X, maximum¼0.0, palet-
te¼blue_white” and “spectrum b, selection¼positive,
minimum¼0.0, maximum¼X, palette¼white_red,” where X is
the highest/lowest number in your dataset. Negative (white-
to-blue gradient) differences are regions where the exchange
was lowered, and positive (white-to-red gradient) are regions
with increased deuteration.
10. Finally, differentiate the regions that were not covered by pep-
tides in the dataset. Run command “color black, (b¼99).”
11. Optionally show a colorbar with the scale using command
“ramp_new colorbar, none, [-X, 0.0, X], [blue, white, red].”
212 Ruzena Filandrova et al.
4 Notes
the sample will reach the trap column and several volumes of
the trap column will pass through to achieve efficient desalting.
If guanidine or phosphates are used in sample preparation,
make the desalting slightly longer. This step usually lasts from
1 to 4 min, depending on the flow and volumes mentioned
above.
17. Duration of the gradient and its slope depend on the column
and the LC system used. In general, the gradient should be
fast, lasting just a few minutes. However, during this short
period, the most efficient elution should be achieved. There-
fore, gradient running from 5 or 10% acetonitrile (solvent B)
and ending at 25–35% acetonitrile should be used. In specific
cases, the upper acetonitrile percentage can be raised to 40 or
50% or even higher.
18. For example, here the data are processed in DataAnalysis using
Find>Compounds AutoMS(n) feature and exported into a
MASCOT generic file (*.mgf). Two different algorithms are
used for peak picking (FTMS and SNAP) and thus two *.mgf
files are created for each analysis. The whole procedure can be
automated using Visual Basic macros in Data Analysis. These
macros can be obtained from the authors.
19. If the coverage map shows many gaps and the covered parts are
represented by short peptides, the protein was probably over-
digested. Faster flow (even in hundreds of microliters per
minute) should be tested. One should, however, keep in
mind the trapping efficiency of the trap column at a given
flow rate. Alternatively, another protease may be used. These
steps are also advisable if higher redundancy is desired. In cases
where the peptides are too long, temperature should be
increased or addition of a denaturing agent considered. Use
of alternative aspartic proteases beside pepsin is advantageous
for DNA binding proteins since they tend to be rich in basic
residues. While pepsin exerts nearly no cleavage after Lys, His,
and Arg residues, the other proteases like nepenthesins, asper-
gillopepsin, and rhizopuspepsin cleave at these sites with high
frequency [17, 24, 26]. These proteases may thus yield good
spatial resolution of basic proteins or basic protein regions.
20. It is often stated that the use of robotics leads to higher
reproducibility; however, trained user and careful pipetting
can lead to very similar outcomes. The main advantage in
using automation is the ability to perform the analysis in an
unattended manner and thus using the instrument time more
efficiently. Most importantly, the manual way utilizes freezing
of samples and their subsequent thawing. These steps require
additional 0.5–2 min, during which the sample undergoes
back-exchange or (in the case of low D2O dilution by the
HDX-MS of Protein-DNA Complexes 215
Acknowledgments
References
1. Katta V, Chait BT, Carr S (1991) Conforma- of solution. Die Makromol Chemie
tional changes in proteins probed by hydrogen- 187:1053–1063
exchange electrospray-ionization mass spec- 7. Ma L, Fitzgerald MC (2003) A new H/D
trometry. Rapid Commun Mass Spectrom exchange- and mass spectrometry-based
5:214–217 method for thermodynamic analysis of
2. Zhang Z, Smith DL (1993) Determination of protein-DNA interactions. Chem Biol
amide hydrogen exchange by mass spectrome- 10:1205–1213
try: a new tool for protein structure elucida- 8. Sperry JB, Wilcox JM, Gross ML (2008)
tion. Protein Sci 2:522–531 Strong anion exchange for studying protein-
3. Bai YW, Milne JS, Mayne L et al (1993) Pri- DNA interactions by H/D exchange mass
mary structure effects on peptide group spectrometry. J Am Soc Mass Spectrom
hydrogen-exchange. Proteins 17:75–86 19:887–890
4. Engen JR, Wales TE (2015) Analytical aspects 9. Sperry JB, Shi X, Rempel DL et al (2008) A
of hydrogen exchange mass spectrometry. mass spectrometric approach to the study of
Annu Rev Anal Chem 8:127–148 DNA-binding proteins: interaction of human
5. Oganesyan I, Lento C, Wilson DJ (2018) Con- TRF2 with telomeric DNA. Biochemistry
temporary hydrogen deuterium exchange mass 47:1797–1807
spectrometry. Methods 144:27–42 10. Poliakov A, Jardine P, Prevelige PE (2008)
6. Sorokin VA, Gladchenko GO, Valeev VA Hydrogen/deuterium exchange on protein
(1986) DNA protonation at low ionic strength solutions containing nucleic acids: utility of
218 Ruzena Filandrova et al.
protamine sulfate. Rapid Commun Mass Spec- resolution by proteolytic fragmentation mass
trom 22:2423–2428 spectrometry analysis. Proc Natl Acad Sci U S
11. Roberts VA, Pique ME, Hsu S et al (2012) A 110:16438–16443
Combining HD exchange mass spectroscopy 23. Cravello L, Lascoux D, Forest E (2003) Use of
and computational docking reveals extended different proteases working in acidic conditions
DNA-binding surface on uracil-DNA glycosy- to improve sequence coverage and resolution
lase. Nucleic Acids Res 40:6070–6081 in hydrogen/deuterium exchange of large pro-
12. Graham BW, Tao Y, Dodge KL et al (2016) teins. Rapid Commun Mass Spectrom
DNA interactions probed by hydrogen- 17:2387–2393
deuterium exchange (HDX) Fourier transform 24. Rey M, Man P, Brandolin G et al (2009)
ion cyclotron resonance mass spectrometry Recombinant immobilized rhizopuspepsin as
confirm external binding sites on the minichro- a new tool for protein digestion in hydrogen/
mosomal maintenance (MCM) helicase. J Biol deuterium exchange mass spectrometry. Rapid
Chem 291:12467–12480 Commun Mass Spectrom 23:3431–3438
13. Boura E, Silhan J, Herman P et al (2007) Both 25. Kadek A, Tretyachenko V, Mrazek H et al
the N-terminal loop and wing W2 of the fork- (2014) Expression and characterization of
head domain of transcription factor Foxo4 are plant aspartic protease nepenthesin-1 from
important for DNA binding. J Biol Chem Nepenthes gracilis. Protein Expr Purif
282:8265–8275 95:121–128
14. Slavata L, Chmelik J, Kavan D et al (2019) 26. Yang M, Hoeppner M, Rey M et al (2015)
MS-based approaches enable the structural Recombinant Nepenthesin II for hydrogen/
characterization of transcription factor/DNA deuterium exchange mass spectrometry. Anal
response element complex. Biomol Ther 9: Chem 87:6681–6687
E535 27. Kadek A, Kavan D, Marcoux J et al (2017)
15. Anbanandam A, Albarado DC, Nguyen CT Interdomain electron transfer in cellobiose
et al (2006) Insights into transcription dehydrogenase is governed by surface electro-
enhancer factor 1 (TEF-1) activity from the statics. Biochim Biophys Acta Gen Subj
solution structure of the TEA domain. Proc 1861:157–167
Natl Acad Sci U S A 103:17225–17230 28. Moroco JA, Engen JR (2015) Replication in
16. Wang L, Pan H, Smith DL (2002) Hydrogen bioanalytical studies with HDX MS: aim as
exchange-mass spectrometry. Mol Cell Proteo- high as possible. Bioanalysis 7:1065–1067
mics 1:132–138 29. Houde D, Berkowitz SA, Engen JR (2011)
17. Kadek A, Mrazek H, Halada P et al (2014) The utility of hydrogen/deuterium exchange
Aspartic protease nepenthesin-1 as a tool for mass spectrometry in biopharmaceutical com-
digestion in hydrogen/deuterium exchange parability studies. J Pharm Sci 100:2071–2086
mass spectrometry. Anal Chem 86:4287–4294 30. Wales TE, Poe JA, Emert-Sedlak L et al (2016)
18. Kochert BA, Iacob RE, Wales TE et al (2018) Hydrogen exchange mass spectrometry of
Hydrogen-deuterium exchange mass spec- related proteins with divergent sequences: a
trometry to study protein complexes. In: comparative study of HIV-1 Nef allelic var-
Methods in molecular biology (Clifton, N.J.). iants. J Am Soc Mass Spectrom 27:1048–1061
Humana Press, New York, NY, pp 153–171 31. Pascal BD, Willis S, Lauer JL et al (2012)
19. Rand KD, Zehl M, Jensen ON et al (2009) HDXWorkbench: software for the analysis of
Protein hydrogen exchange measured at H/D exchange MS data. J Am Soc Mass Spec-
single-residue resolution by electron transfer trom 23:1512–1521
dissociation mass spectrometry. Anal Chem 32. Guttman M, Weis DD, Engen JR et al (2013)
81:5577–5584 Analysis of overlapped and noisy hydrogen/
20. Mistarz UH, Bellina B, Jensen PF et al (2018) deuterium exchange mass spectra. J Am Soc
UV Photodissociation mass spectrometry accu- Mass Spectrom 24:1906–1912
rately localize sites of backbone Deuteration in 33. Lindner R, Lou X, Reinstein J et al (2014)
peptides. Anal Chem 90:1077–1080 Hexicon 2: automated processing of
21. Mayne L, Kan ZY, Sevugan Chetty P et al hydrogen-deuterium exchange mass spectrom-
(2011) Many overlapping peptides for protein etry data with improved deuteration distribu-
hydrogen exchange experiments by the frag- tion estimation. J Am Soc Mass Spectrom
ment separation-mass spectrometry method. J 25:1018–1028
Am Soc Mass Spectrom 22:1898–1905 34. Rey M, Sarpe V, Burns KM et al (2014) Mass
22. Kan Z-Y, Walters BT, Mayne L et al (2013) spec studio for integrative structural biology.
Protein hydrogen exchange at residue Structure 22:1538–1548
HDX-MS of Protein-DNA Complexes 219
35. Kan ZY, Ye X, Skinner JJ et al (2019) ExMS2: 40. Majumdar R, Manikwar P, Hickey JM et al
an integrated solution for hydrogen-deuterium (2012) Minimizing carry-over in an online
exchange mass spectrometry data analysis. Anal pepsin digestion system used for the H/D
Chem 91:7474–7481 exchange mass spectrometric analysis of an
36. Claesen J, Burzykowski T (2017) Computa- IgG1 monoclonal antibody. J Am Soc Mass
tional methods and challenges in hydrogen/ Spectrom 23:2140–2148
deuterium exchange mass spectrometry. Mass 41. Rey M, Mrazek H, Pompach P et al (2010)
Spectrom Rev 36:649–667 Effective removal of nonionic detergents in
37. Eggertson MJ, Fadgen K, Engen JR et al protein mass spectrometry, hydrogen/deute-
(2020) Considerations in the analysis of hydro- rium exchange, and proteomics. Anal Chem
gen exchange mass spectrometry data. Meth- 82:5107–5116
ods Mol Biol 2051:407–435 42. Glasoe PK, Long FA (1960) Use of glass elec-
38. Kavan D, Man P (2011) MSTools - web based trodes to measure acidities in deuterium oxide
application for visualization and presentation 1,2. J Phys Chem 64:188–190
of HXMS data. Int J Mass Spectrom 43. Guttman M, Wales TE, Whittington D et al
302:53–58 (2016) Tuning a high transmission ion guide
39. Strohalm M, Kavan D, Novak P et al (2010) to prevent gas-phase proton exchange during
mMass 3: a cross-platform software environ- H/D exchange MS analysis. J Am Soc Mass
ment for precise analysis of mass spectrometric Spectrom 27:662–668
data. Anal Chem 82:4648–4651
Chapter 12
Abstract
Mass spectrometry (MS)–based strategies have emerged as key elements for structural modeling of proteins
and their assemblies. In particular, merging together complementary MS tools, through the so-called
hybrid approaches, has enabled structural characterization of proteins in their near-native states. Here,
we describe how different MS techniques, such as native MS, chemical cross-linking MS, and ion mobility
MS, are brought together using sophisticated computational algorithms and modeling restraints. We
demonstrate the applicability of the strategy by building accurate models of multimeric protein assemblies.
These strategies can practically be applied to any protein complex of interest and be readily integrated with
other structural approaches such as electron density maps from cryo-electron microscopy.
Key words Structural mass spectrometry, Computational modeling, Protein complexes, Hybrid
approaches, Modeling restraints
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
221
222 Andy M. Lau and Argyris Politis
Fig. 1 Integrative modeling with mass spectrometry. Integration of restraints derived from MS-based and cryo-
EM data sets lead to computational structural models that can be directly compared with available crystal
structures. Such comparisons allow for assessing the ability of the methods used to make accurate
predictions
1.2 Ion Mobility MS Native MS is often hyphenated with ion mobility (IM)-MS. IM-MS
provides information about protein topologies and dynamics in the
gas phase [17, 18]. It is expressed using the collisional cross section
(CCS) which reflects the orientationally average cross section of
proteins as they tumble through the IM cell in the mass spectrom-
eter [19]. CCS from IM-MS is obtained by measuring the arrival
time distributions (ATDs) of different ions [20] and can in turn be
used as shape restraints for interrogating structural models gener-
ated by computational methods [7, 21, 22]. Structural dynamics
and conformational heterogeneity can be inferred from the distri-
bution of mobilities measured by IM-MS [23–25]. Typically, ions
with multiple conformations will result in broad, Gaussian
ATDs [12].
1.4 Hydrogen– HDX-MS has recently gained interest for studying protein confor-
Deuterium mational dynamics and their associations with ligands [15, 34–
Exchange MS 36]. HDX-MS can report on change in the structure and dynamics
of proteins, through monitoring the exchange of protein backbone
amide hydrogens for deuterium in the surrounding labeling buffer.
The exchange rate is dependent on both hydrogen bonding and
solvent accessibility [37–39]. HDX-MS tolerates a broad range of
sample environments and can be used to capture conformational
changes of proteins at peptide-level resolution. Data from two
protein states (e.g., apo and holo) can be compared in a differential
manner, allowing relative changes in protein structure and dynam-
ics to be determined. The resulting significant differences (ΔHDX)
between the two states can in turn be mapped onto 3D models of
proteins to inform on conformational changes [37] (Fig. 1).
Recently HDX-MS has been applied to a range of membrane
proteins and their interactions with lipids [36, 40, 41]. Moreover,
attempts to model data derived from HDX-MS have utilized pro-
tection factors, which can be used as restraints to build model
structures directly from ΔHDX [42].
1.5 Integrating While MS-based approaches offer a wide range of techniques capa-
with Other Structural ble of generating diverse structural information, their integration
Approaches with other powerful structural methods is often desirable. The
most commonly used methods to integrate MS data are X-ray
crystallography and cryo-EM. Traditionally, crystallographic infor-
mation has been the gold standard to either validate the ability of a
computational strategy to build accurate models (benchmarking)
or be used in conjunction with other methods to refine its confor-
mation. The recent resolution revolution of cryo-EM has yield a
game-changing effect in structural biology through its ability to
provide atomic-level resolution of proteins previously thought to
be insuperable (such as dynamic and membrane proteins), thus
significantly expanding the potential number of biological
224 Andy M. Lau and Argyris Politis
2 Materials
3 Methods
All instructions below assume that tutorial files have been down-
loaded and that the required software packages have been installed
and tested for correct functionality.
3.1 Preparing Inputs 1. The IMP platform can be used to generate models of protein
for IMP complexes, informed by experimental techniques which each
contribute modeling restraints. To use stoichiometry, cross-
linking, and cryo-EM restraints, the following files are needed:
Files
initial_model.pdb—contains EM-map aligned model of the
protein complex.
[Link]—contains full sequences of each subunit.
[Link]—list of stoichiometric connectivities.
[Link]—list of experimental cross-links.
Mass Spectrometry-Based Protein Modelling 225
Fig. 2 Visualization of protein structures using PyMOL. (a) Ribbon representation of the PDB 1WBJ tryptophan
synthase. (b) Display of atomic bonds for a selected residue
3.3 Determining 1. The native MS spectra of the tryptophan synthase complex can
Complex be used to determine any subcomplexes that build up the full
Stoichiometry Using complex, and the mass of these subcomplexes (Fig. 4).
Native MS 2. A native MS spectra of the complex can be found at [33].
3. Use the subcomplexes to determine the known connections
between the constituent subunits (see Notes 7 and 8). The
228 Andy M. Lau and Argyris Politis
Fig. 3 Sequence analysis. (a) T-Coffee sequence alignment of canonical (AN: P0A2K1) and model sequence
(TS_A_A) of tryptophan synthase beta chain. The second and third residue of TS_A_A (PDB 1WBJ) has been
altered to demonstrate the conservation notation (cons). Asterisk (*) and colon (:) denote full and similar
property conservation, respectively. Only the first line of the sequence has been shown. (b) Alpha and beta
subunit sequence in fasta format
Mass Spectrometry-Based Protein Modelling 229
Fig. 4 Native MS of tryptophan synthase. (a) Native mass spectra showing four ion distributions of 144, 115,
86, and 29 kDa. (b) Annotated spectra of (a) with assigned subcomplexes
3.5 Preparation 1. Having determined the subunit connections of the complex via
of Stoichiometry List native MS, we will need to convert these into modelable
for IMP restraints.
2. In the same format as the “[Link]” file, we can include a
pseudo-cross-link between the alpha–beta and beta–beta sub-
units of the complex. As there are two alpha–beta pairs, we will
enforce a pseudo-cross-link between TS_alpha_A-TS_beta_B
and TS_alpha_C-TS_beta_D and the beta–beta connection as
230 Andy M. Lau and Argyris Politis
3.6 Preparing 1. Open the [Link] file which has already been filled
Modeling Script (Fig. 7a).
for IMP 2. The topology file contains a “topology_dictionary” for each
subunit. Table 1 explains the function of each heading.
3. In the previous directory, there will be a script called “model-
[Link]” which will call IMP and perform the modeling.
4. “[Link]” is a python script that will instruct IMP on how
to initialize each subunit and perform random sampling while
restraining their positions and orientations using the stoichi-
ometry, cross-link, and EM restraints.
5. Within “[Link],” lines 25–27 under the “Define Input
Files” section will link IMP to the necessary “[Link]” and
“initial_map.[Link]” files which are located in the “./
inputs/” directory (Fig. 7b).
6. The next lines “num_frames” and “num_mc_steps” will set the
number of iterations that the sampling will be performed for
and the number of Monte Carlo steps that are included in one
iteration.
7. “rb_max_trans” and “rb_max_rot” are variables for controlling
the step size of each translation and rotation of each rigid body,
i.e., each subunit.
232 Andy M. Lau and Argyris Politis
Fig. 7 Preparing the IMP modeling script. (a) Content of the topology file [Link]. (b) Definition of input
files. (c) Examples of rigid body groups
Table 1
Function of headings from the topology file
Heading Function
component_name Name of subunit
domain_name Subunit identifier for modelling
fasta_fn Fasta filename
fasta_id References the subunit sequence listed in specified file
pdb_fn References the PDB file containing all structures
Chain References the chain belonging to the subunit in the PDB specified
residue_range Obtains the atomic position of the residues within range from the PDB
pdb_offset Offsets the PDB by the number specified
bead_size Number of residues to represent using a single bead for coarse-graining
em_residues_per_gaussian Number of components for GMM model generation
Mass Spectrometry-Based Protein Modelling 233
3.7 Modeling 1. The first restraint is the excluded volume restraint—this pre-
Restraints vents unrealistic overlapping in space through calculating the
volume of each subunit per iteration and avoiding steps which
promote overlap.
2. The excluded volume restraint is computationally expensive to
calculate, and thus, the volume is approximated by bead reso-
lution (by default set to 20) on line 115.
3. Lines 117 and 118 add the restraint to the bead model.
4. Next, we will add two cross-link restraints to our tryptophan
synthase system, xl1 and xl2.
5. xl1 is the stoichiometry restraint which will enforce alpha–
beta–beta–alpha connectivity in our modeling. The xl1
restraint can be adjusted by variables listed in Table 2.
6. The “length” variable passed into xl1 is defined by the approxi-
mate distance between the alpha and beta subunits as measured
from their centers (approximately equal to the sum radius of
alpha and beta subunits). This distance is approximate and
serves to enforce the topology of the system by preventing
the subunits from moving too far away from their designated
binding partners.
7. The xl2 restraint includes cross-links determined for the tryp-
tophan synthase complex. Lines 146–158 are parametrized
identically to xl1; however, the distance threshold “length,”
“slope,” and “label” has been altered.
234 Andy M. Lau and Argyris Politis
Table 2
Key parameters that can be used for the adjustment of modeling restraints
Heading Function
Length Distance threshold to enforce per iteration, set to 38 Å
Slope Linear gradient for preventing the system from expanding too much
Columnmapping Designates the format of the [Link] file
Resolution Sets the bead resolution that the cross-link distance will be measured using
Label Label for modeling output
Csvfile Toggle for [Link] file format to be read as a comma separated values file
3.8 Calculating 1. The theoretical collision cross section (CCS) of atomic models
the CCS of Generated can be calculated using software such as IMPACT [43] (see
Models Notes 17–19).
2. This value can be compared to experimentally determined CCS
via IM-MS [44].
3. Alternatively, CCS values for complexes may be found in pub-
lished literature [7].
4. The CCS of the tryptophan synthase complex is approximately
7200 Å2.
5. We will use IMPACT to calculate the projection approximation
(PA) of each model.
6. Open a terminal window and direct to the “output_atomistic”
folder.
7. With IMPACT callable from your PATH variable, run “impact
*.pdb -o output_file_CCS.txt.” *.pdb will tell IMPACT to run
through file with the .pdb file extension.
8. When IMPACT has finished, output_file_CCS.txt will display a
list of each file, with the calculated PA and TJM values (see
Note 20).
9. Linear scaling of the calculated PA by an empirical factor of
1.14 has been shown to provide a good approximation of the
true model CCS [45].
10. “output_file_CCS.txt” can be opened using spreadsheet soft-
ware, and a scaling factor of 1.14 can be applied to each value
under “CCS_PA.”
236 Andy M. Lau and Argyris Politis
CCSmodel CCSexp
% error ¼ 100
CCSexp
12. The best-fit models will show the lowest % error. This confor-
mation will have been generated using stoichiometry, cross-
linking, and EM restraints and have been filtered using CCS.
13. Finally, evaluate the accuracy of your model against the crystal
structure of the full tetrameric tryptophan synthase complex.
Open PyMOL and use the “fetch 1WBJ, type¼pdb1, multi-
plex¼1” command to automatically download the “biological
assembly” of 1WBJ.
14. 1WBJ will download as two objects in PyMOL, 1WBJ_0001
and 1WBJ_0002 which will each be half of the complex. Both
alpha chains will be labeled as Chain A, and both beta as
Chain B.
15. To align our best-fit model to this complex, we will first need to
combine the two halves of 1WBJ into a single object, with the
same Chain ABCD arrangement.
16. Use the command “alter 1WBJ_0002 & chain A, chain¼‘C’”
and “alter 1WBJ_0002 & chain B, chain¼‘D’” to rename to
chains C and D.
17. Next, use “create 1WBJ_assembled, 1WBJ_*” to create a new
object with all chains of the tryptophan synthase biological
assembly.
18. Align your best fit model to this 1WBJ_assembled object using
either “align <best_model_name> 1WBJ_assembled” or by
clicking on screen in the PyMOL GUI.
19. In the External GUI, the root mean squared deviation
(RMSD) of the fitting will be displayed (Fig. 8). The RMSD
represents the similarity score between the two models. The
lower the RMSD, the more similar the models.
4 Notes
References
1. Alber F et al (2007) Determining the architec- spectrometry: application to the yeast eIF3:
tures of macromolecular assemblies. Nature eIF5 complex. Chem Biol 22:117–128.
450:683–694. [Link] [Link]
nature06404 11.010
2. Ahdash Z, Pyle E, Politis A (2016) Hybrid 10. Russel D et al (2012) Putting the pieces
mass spectrometry: towards characterization together: integrative modeling platform soft-
of protein conformational states. Trends Bio- ware for structure determination of macromo-
chem Sci 41:650–653. [Link] lecular assemblies. PLoS Biol 10:e1001244.
1016/[Link].2016.04.008 [Link]
3. Bullock JMA, Sen N, Thalassinos K, Topf M 1001244
(2018) Modeling protein complexes using 11. Faull SV et al (2019) Structural basis of Cullin
restraints from crosslinking mass spectrometry. 2 RING E3 ligase regulation by the COP9
Structure 26:1015–1024.e1012. [Link] signalosome. Nat Commun 10:3814. https://
org/10.1016/[Link].2018.04.016 [Link]/10.1038/s41467-019-11772-y
4. Degiacomi MT, Schmidt C, Baldwin AJ, Ben- 12. Zhou M et al (2014) ATP binding reduces
esch JLP (2017) Accommodating protein conformational flexibility in a rotary ATPase—
dynamics in the modeling of chemical cross- Evidence from ion mobility mass spectrometry.
links. Structure 25:1751–1757.e1755. Nat Chem 6(3):208–215
[Link] 13. Alber F et al (2007) The molecular architecture
5. Lasker K et al (2012) Molecular architecture of of the nuclear pore complex. Nature
the 26S proteasome holocomplex determined 450:695–701. [Link]
by an integrative approach. Proc Natl Acad Sci nature06405
U S A 109:1380–1387. [Link] 14. Bechara C et al (2015) A subset of annular
1073/pnas.1120559109 lipids is linked to the flippase activity of an
6. Politis A et al (2014) A mass spectrometry- ABC transporter. Nat Chem 7:255–262.
based hybrid method for structural modelling [Link]
of protein complexes. Nat Methods 15. Bechara C, Robinson CV (2015) Different
11:403–406 modes of lipid binding to membrane proteins
7. Hall Z, Politis A, Robinson CV (2012) Struc- probed by mass spectrometry. J Am Chem Soc
tural modeling of heteromeric protein com- 137:5240–5247. [Link]
plexes from disassembly pathways and ion jacs.5b00420
mobility-mass spectrometry. Structure 16. Ahdash Z et al (2017) Mechanistic insight into
20:1596–1609. [Link] the assembly of the HerA-NurA helicase-nucle-
str.2012.07.001 ase DNA end resection complex. Nucleic Acids
8. Hansen K et al (2018) A mass spectrometry- Res 45:12025–12038. [Link]
based modelling workflow for accurate predic- 1093/nar/gkx890
tion of IgG antibody conformations in the gas 17. Pagel K, Natan E, Hall Z, Fersht AR, Robinson
phase. Angew Chem Int Ed Engl 57 CV (2013) Intrinsically disordered p53 and its
(52):17194–17199 complexes populate compact conformations in
9. Politis A et al (2015) Topological models of the gas phase. Angew Chem Int Ed Engl
heteromeric protein assemblies from mass
240 Andy M. Lau and Argyris Politis
Abstract
Electron microscopy is a powerful tool for studying the homogeneity and structure of biomolecular
complexes. The small wavelength of electron and the availability of electron optics enable the direct
visualization of macromolecular assemblies in a large range of sizes between 5 and 100 nm. This informs
us about the degree of multimerization or aggregation and provides precise information about their general
shape and dimensions. When combined with sophisticated image analysis protocols, three-dimensional
(3D) information can be gained from 2D projections of the sample, leading to a structural description.
When intermediate steps of a reaction can be imaged, insights into the mode of action of macromolecules
can be gained, and structure–function relations can be established. However, the way the sample is prepared
for its observation within the vacuum of an electron microscope determines the information that can be
retrieved from the experiment. We will review two commonly used specimen preparation protocols for
subsequent single-particle electron microscopy observation, namely negative staining and vitrification.
Key words Single particle electron microscopy, Negative stain electron microscopy, Cryo-EM,
EM sample preparation
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
243
244 Alexandre Frechard et al.
1.1 Negative The most straightforward negative staining approach was first
Staining described by Brenner and Horne in 1959 [3]. This method brings
important preliminary information on sample quality and may be
used on a daily basis to follow and optimize a purification protocol.
Associated with single particle image analysis, it may provide impor-
tant information on homogeneity or oligomerization states. This
information may not be portable for cryo-EM sample preparation
but guaranties a firm starting point. Negative staining consists of
embedding the protein into a matrix of heavy atom salt to increase
the contrast of unstained biomolecules and prevent, to some
extent, their collapse during the drying process when exposed to
the vacuum of the microscope. Stains of heavy metal salts, such as
uranyl acetate, uranyl formate, phosphotungstic acid, and others,
are commonly used, since they strongly scatter electrons and pro-
duce high amplitude contrast. It is important to notice that nega-
tive staining reveals only the surface and the overall shape of protein
molecules and does not provide information about their inner
structure. The resolution that can be achieved after image analysis
of multiple images is limited to 15–20 Å, by the graininess of the
stain and particle distortions during the drying process. This
method is, however, very useful to check particle homogeneity
and to determine initial 3D models. Furthermore, the sample
preparation is easy to perform and to observe at room temperature
in a standard transmission electron microscope. The stained sam-
ple, or more specifically, its heavy metal cast, is more resistant to
radiation damage produced by the electron irradiation, and the
high image contrast favors image interpretation.
Specimen Optimization for Single Particle cryo-EM 245
1.2 Vitrification The major drawback of negative staining is that the sample is dried
during preparation and introduction into the microscope vacuum.
To overcome this limitation, several options have been explored to
keep the specimen hydrated including the construction of hydrated
chambers around the specimen holder. Attempts were made to
replace water with sugar polymers to functionally replace the shield-
ing properties of water, and remarkable results were obtained for
2D crystals of membrane proteins. Cryogenic methods were tried
early on and proved efficient to reduce radiation damage resulting
from the interaction of electrons with matter by a factor of 2 at
liquid nitrogen temperature. However, freezing water invariably
resulted in ice crystal formation which affects sample distribution
and image quality. Being able to obtain vitreous ice at atmospheric
pressure was a major breakthrough for studying biological macro-
molecules in a fully hydrated state in the electron microscope. The
method consists of flash freezing a thin layer of an aqueous suspen-
sion of the purified biomolecule to form a vitrified sample that can
be transferred and observed in a cryo electron microscope at liquid
nitrogen temperature. A layer of suspension thinner than 100 nm is
generally obtained by removing the excess of a drop of sample
applied onto the electron microscopy grid by blotting with a filter
paper. Alternatively, sample micro droplets can be sprayed onto the
grid or applied by a nanoliter dispensers [4]. Vitrification is gener-
ally performed by plunging the EM grid into liquid ethane cooled
by liquid nitrogen for better heat dissipation. High pressure freez-
ing devices have been developed for the vitrification of up to
300 nm thick sample [5]. This approach, which was rewarded the
Nobel Prize in chemistry in 2017, preserves the hydrated structure
of the molecules at atomic resolution. The vitrification process can
be performed once the sample is adsorbed on a carbon film, but
adsorption can be avoided by using holey carbon films. In this case,
observations are made on the thin layer of vitrified suspension
stretched over the carbon-free holes. However, the sample still
experiences the interaction with the air–water interface which can
be deleterious when the specimen is prone to denaturation or can
result in preferential orientations of the molecules [6].
2 Materials
2.1 Common 1. The EM grid, a universal, and versatile specimen support. The
Materials universal support to manipulate EM samples is a thin metallic
and Equipment grid 3 mm in diameter adapted for most electron microscope
holders. EM grids are made of copper, copper/rhodium, or
gold to be conductive and eliminate electron charge accumula-
tion. Square holes of different sizes are separated by grid bars
that absorb electrons. Copper mesh grids with 300 grid squares
per inch are commonly used because they are conductive, stable
under the electron beam, and inexpensive. The grid is generally
covered by a 5–20 nm thin carbon film onto which protein
complexes are adsorbed for subsequent negative staining. To
avoid sample adsorption in cryo-EM, the grids can also be
covered with a self-made carbon film perforated with holes of
various diameter ranging between 0.3 and 10 μm in diameter
[7]. More recently, perforated grids with calibrated circular
holes arranged into regular arrays were developed to serve
automated data acquisition [8]. Such perforated grids can be
covered by a continuous thin carbon film when adsorption
cannot be avoided. Holey carbon films can also be covered by
a single monolayer thick graphene or graphene oxide crystal-
line layer instead of amorphous carbon, thus leading to a less
grainy background [9] (Oxford Instruments, quantifoil micro
tools GMBH).
2. High precision tweezers. To properly manipulate the EM grids
without distortion and contamination, high precision and
sharp tweezers are recommended (Dumont style 5 tweezers,
Fine Science Tools GMBH ref.: 11252-30). Make sure to grab
the grids by the rim to not damage or distort the support.
Standard straight tweezers are sufficient to manipulate grids,
but other types of tweezers can be useful in electron micros-
copy: anti-capillarity tweezers have a wider angle at the tip
when closed, limiting the amount of liquid retained by capillar-
ity. Inverted tweezers are also found useful since they remain
closed until squeezed, limiting the risks of dropping grids when
handling the tweezers.
3. Glow discharge and plasma cleaner devices. These table top
instruments are used to produce a gas plasma to charge the
surface of the grids by an electrostatic potential in order to
produce a hydrophilic surface suitable for protein absorption.
The devices differ by the quality of the vacuum (between 10 2
and 10 6 Torr, or 1.3 and 1.3 10 4 Pa), the way the plasma is
produced, and the mixture of gases that can be used to form
the plasma (ELMO, Cordouan Technologies; Nanoclean
model 1070, Fischione).
4. Filter paper. Different steps of the protocol require blotting the
grids to remove excess of staining solution or water (Macherey-
Nagel, ref.: 202009).
Specimen Optimization for Single Particle cryo-EM 247
2.2 Negative 1. Heavy atom salt solution. Uranyl acetate (Agar Scientific, ref.:
Staining AGR1260A; Polysciences ref.: 21447-25) uranyl formate,
phosphotungstic acid (PTA), and other heavy metals are com-
monly used to embed the biological sample into a shell of
electron-dense material. The heavy atom salt is dissolved in
water at 2% (w/v). Most of the solutions are at low pH, and
only few of them, such as PTA, can be buffered to pH 7.0
without forming aggregates. In this respect, phosphate buffer
present in the sample solution may provoke uranyl acetate
precipitation observed as dark clusters under the microscope.
2. Handling heavy metal salts requires strict safety protections:
use gloves, mask and safety glasses and work under hood when
preparing solutions. Uranyl salts are slightly radioactive, and
specific safety precautions are necessary: store uranyl salts in a
lead protection box, identify the workbench used to work with
uranyl acetate, weigh powders in a secured work station, work
under a hood protected by a Plexiglas screen when handling
concentrated solutions, and finally, make sure to dispose any
contaminated waste according to your lab policy. Radiations
emitted from 2% solutions are shielded by water molecules and
the glass bottle. Depending on national policies, uranyl-based
reagent might be difficult or even illegal to buy. Please make
sure your experiments comply with your local regulations.
3. Note that there are now non-radioactive alternatives to uranyl
acetate: based on methylamine vanadate (NanoVan, Nanop-
robes), methylamine tungstate (Nano-W, Nanoprobes), Ura-
nyLess (TAAB), and UA-Zero (Agar Scientific).
4. Parafilm. The protocol includes several washing steps aiming at
solution replacement. Parafilm may be used to deposit small
solution drops on top of which the EM grid can be placed
(VWR international SAS, ref.: 97949).
2.3 Cryo-EM Preparing the sample for cryo-EM requires more material and
equipment than negative staining. Although automated spray sys-
tems and microfluidic-based devices are emerging, vitrification is
usually performed using a cryo-plunger. Make sure that all the
materials are at your disposal before you start since the protocol
cannot be interrupted.
248 Alexandre Frechard et al.
3 Methods
3.1 Negative Negative staining is a fast method to assess the quality of your
Staining sample by checking its stability, homogeneity, and propensity to
aggregate. Key steps of sample preparation are illustrated in Fig. 1
and detailed below.
Fig. 1 Negative staining. (a) The EM grid is glow-discharged in a plasma of ionized air to render the support
hydrophilic. (b) 3 μL of the purified biomolecules solubilized in buffer is allowed to adsorb on the EM grid
support for 1 min. (c) The excess of sample and detrimental buffer components are diluted away by several
passes on top of buffer drops. (d) Sample staining: the grid is deposited on the top of a drop of stain—here a
2% of uranyl acetate—for 30 s. (e) The staining solution is blotted away using filter paper. (f) Electron
micrograph of a well-stained sample, particles are well dispersed, show little aggregation and optimal
embedding in the stain layer
water using filter paper and transfer the grid to the last drop
containing the phosphotungstic acid and wait for 30 s
(Fig. 1d).
5. Grab the grid with tweezers, approach the filter paper from the
side of the grid, gently remove the excess of stain by capillarity,
let the grid dry completely for 1 min, and store it in a grid
storage box before observation in the transmission electron
microscope (Fig. 1e).
Specimen Optimization for Single Particle cryo-EM 251
3.1.2 Observation Ideally the sample should be evenly distributed with little interac-
and Trouble Shooting tions between individual particles (compare Figs. 1f and 3a). The
macromolecules should be included in a layer of stain of the same
thickness as the particle to sustain optimally the sample, to reveal all
parts and to obtain the best contrast. It is often necessary to screen
several places on the grids to find optimal staining. The following
indications may help to improve staining.
1. Poor staining. In a standard bright field transmission electron
microscope, your protein sample should appear as a lighter area
embedded in a darker background. If your sample is poorly
stained, you will only see fingerprints of your protein (Fig. 3b)
or worse, and your sample may be positively stained and appear
as dark spots on a lighter background. You may adjust the glow
discharge conditions to render the support more hydrophilic
and make sure that the staining solution is not removed too fast
by wetting the filter paper beforehand. Adding 0.5% glycerol
may help to reduce the drying speed and improve staining.
2. Excess staining. Your sample may be well embedded, but a
thick layer of stain may be superimposed to the particles, thus
reducing the contrast and obscuring fine details of your sample
(Fig. 3c). Sometimes wiping away the stain faster can help.
Check that your sample buffer does not contain large excess
of sucrose of glycerol which increases its viscosity. In this case,
an additional washing step can be added.
3. Presence of stain crystals. Uranyl salts precipitate at neutral pH
or in contact with phosphate buffer and form small crystals
visible in EM. Make sure that these reagents are absent or
sufficiently dilute in the last staining step and that the pH is
suitable.
4. Damaged/destroyed proteins. Some fragile protein complexes
may be altered during grid preparation and even fall apart
during the dilution, adsorption, or staining steps. Chemical
cross-linkers such as glutaraldehyde or BS3 may stabilize the
sample. As a standard procedure, glutaraldehyde is added at a
final concentration of 0.1–0.5% for 2 min, before adsorption on
the EM grid. Cross-linkers may lead to protein aggregation,
and therefore, cross-linking time and concentration need to be
adjusted. Adding 1% glycerol in the staining solution may help
sustaining fragile samples and prevent their collapse during the
drying step.
5. Small number of particles. When a smaller number of particles
than expected is observed, the sample may form aggregates.
Aggregates are not always detected because of their small inter-
action interface with the carbon support which can lead their
dissociation during the washing or staining steps. Alternatively,
252 Alexandre Frechard et al.
3.2 Vitrification The protocol presented here is adapted for a Vitrobot, but most of
the steps can be adjusted to a handmade plunger or a device from
3.2.1 Preparation
another manufacturer. Key steps are illustrated in Fig. 2 and
of the Vitrified Suspension
detailed below.
1. Prepare four EM grids coated with holey carbon
(non-adsorbed sample) or plain carbon (adsorbed sample)
and glow discharge them as described in Subheading 3.1.1.
2. Prepare the plunging device by adjusting the temperature and
humidity of the chamber.
Fig. 2 Sample vitrification. (a) Styrofoam holder filled with liquid nitrogen, showing the central ethane
container. The ethane gas was liquefied, holding the tube appearing on the left into the cold container. (b)
The grid is loaded on the tweezers attached to the plunger. (c) 3 μL of sample is deposited on the grid which
will be lifted up to the filter paper pads that will be automatically pressed against the grid to blot away the
excess of liquid. (d) The plunger quickly submerges the grid in the liquid ethane. (e, f) The vitrified sample is
transferred into a cryo-box for storage. (g) Electron micrograph of a frozen hydrated sample showing well-
dispersed particles, little aggregation, thin ice, and no ice contamination
Specimen Optimization for Single Particle cryo-EM 253
Fig. 3 Troubleshooting. Negative staining: (a) Electron micrograph showing aggregated particles. (b) Electron
micrograph showing a heavily stained sample in which the details of the particles are lost, and the overall
contrast is weak due to stain accumulation on top of the particle. (c) In this field, the particles are not well-
stained and embedded, and only a small rim of stain surrounds each particle whose structure is poorly
sustained. Sample vitrification: (d) Contaminant filaments arising from residues remaining after ethane
evaporation. (e) Transformed ice image due to warming up of the sample during transfer in the microscope.
(f) Partially molten hexagonal ice crystals (arrows) are spread over the grid surface and may have been
collected during the grid transfer or mounting steps and exposition to humid environment
Acknowledgments
References
1. Cheng Y (2018) Single-particle cryo-EM-how 6. Noble AJ et al (2018) Routine single particle
did it get here and where will it go. Science 361 CryoEM sample and grid characterization by
(6405):876–880 tomography. Elife 7:e34257
2. Dubochet J et al (1971) A new preparation 7. Fukami A, Adachi K (1965) A new method of
method for dark-field electron microscopy of preparation of a self-perforated micro plastic
biomacromolecules. J Ultrastruct Res 35 grid and its application. J Electron Microsc 14
(1):147–167 (2):112–118
3. Brenner S, Horne RW (1959) A negative stain- 8. Russo CJ, Passmore LA (2016) Progress
ing method for high resolution electron towards an optimal specimen support for elec-
microscopy of viruses. Biochim Biophys Acta tron cryomicroscopy. Curr Opin Struct Biol
34:103–110 37:81–89
4. Jain T et al (2012) Spotiton: a prototype for an 9. Palovcak E et al (2018) A simple and robust
integrated inkjet dispense and vitrification sys- procedure for preparing graphene-oxide cryo-
tem for cryo-TEM. J Struct Biol 179(1):68–75 EM grids. J Struct Biol 204(1):80–84
5. Dubochet J et al (1988) Cryo-electron micros- 10. Vos MR et al (2008) The development of a
copy of vitrified specimens. Q Rev Biophys 21 glove-box/Vitrobot combination: air-water
(2):129–228 interface events visualized by cryo-TEM.
Ultramicroscopy 108(11):1478–1483
Chapter 14
Abstract
Membrane proteins (MPs) are stable in their native lipid environment. To enable structural and functional
investigations, MPs need to be extracted from the membrane. This is a critical step that represents the main
obstacle for MP biochemistry and structural biology. Here we describe detergent solubilization screening of
MPs using dot-blot and Western-blot analyses. Good solubilization conditions are ranked for their best
capacity to stabilize MPs using thermal shift assay. The protein functionality is evaluated by radioligand
binding (for G-protein-coupled receptor) and ATPase activity (ABC Transporter) and finally the aggrega-
tion status as well as protein homogeneity are assessed by Native-polyacrylamide gel, chemical cross-linking,
and size exclusion chromatography.
Key words Membrane proteins, Solubilization, Stabilization, Detergent, Native-PAGE, Size exclu-
sion chromatography, Chemical-crosslinking, Function
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
257
258 Vincent Corvest and Anass Jawhari
Fig. 1 Screening of membrane proteins solubilization. (a) Large solubilization screening performed in 96-well
plate and monitored by dot-blot. (b) Confirmation of solubilization efficiency by Western blotting. Membrane
protein A and B correspond to typical easy and difficult to solubilize targets, respectively (Adapted from [7])
Fig. 2 Membrane protein stability assessment. (a) Western blot based thermostability assay (adapted from
[12]). (b) Functional investigation using radioligand binding and ATPase activity assays for a GPCR and a
Transporter target, respectively. Two examples were previously described [9, 11]
2 Materials
Fig. 3 Membrane protein behavior in solution. (a) Native-PAGE on purified Matrix 2 ion channel revealed by
western blot. (b) Chemical cross-linking assay using different amounts of glutaraldehyde, analyzed by
SDS-PAGE and revealed by Western blot. (c) Gel filtration (5-150GL) profile and corresponding Western blot
analysis. (Adapted from [13]). A similar approach was also previously reported for the characterization of the
human transcription factor TFIIE [14]
3 Methods
3.1.1 Cell Lysis and 1. Resuspend dry cell pellet at 2 mL/g with 1 PBS supplemen-
Membrane Fractionation ted with 1 PIC.
2. Lyse cells on ice using a Bead Beater homogenizer with
0.1 mm diameter glass beads (0.5 mm for yeast) with five cycles
of 30 s lysis followed by 2 min cool down (see Note 1).
3. Centrifuge at increasing speeds at 4 C to collect different
membrane fractions: 1000 g for 5 min (whole cell and cell
debris), 15,000 g for 30 min (internal membranes, ER,
mitochondria, etc.) and 100,000 g for 45 min (plasma
membrane).
262 Vincent Corvest and Anass Jawhari
3.2 Membrane The Western blot–based thermostability assay is adapted from [8].
Protein Stability
1. Solubilize the protein of interest in each detergent condition to
Assessment
be evaluated and in a final volume of 700 μL.
3.2.1 Western Blot– 2. Aliquot 50 μL of solubilisate into 14 PCR microtubes.
Based
3. Using a thermocycler, submit the PCR microtubes to a gradi-
Thermostability Assay
ent of temperature from 25 C to 80 C for 30 min.
4. Immediately transfer to fresh microtubes and centrifuge at
20,000 g for 40 min at 4 C.
5. Analyze the supernatants by SDS-PAGE and Western blot
using an antibody raised against the protein of interest.
6. Quantify the intensity of the immunodetection signal,
corresponding to the protein of interest, plot as function of
temperature, and fit to the Boltzmann equation to determine
the Tm.
3.2.2 Radioligand This protocol is developed for A2A receptor and is adapted from
Binding Assay [9]. A single protein concentration and a single radioligand con-
centration are used to compare the different protein preparations.
This assay is performed in triplicate for each protein sample.
264 Vincent Corvest and Anass Jawhari
3.2.3 ATPase This protocol is developed for BmrA transporter and is adapted
Activity Assay from [11].
1. Prepare a range of 20 μL Pi standards at 0 mM, 2 mM, 4 mM,
and 8 mM in 1 TBS from the Pi standard stock solution.
2. Prepare the membrane protein samples at 0.5 mg/mL in their
own buffer.
3. Using a 96-well microplate with a transparent flat-bottom,
prepare 2 series of 10 μL for each Pi standards and protein
samples (series #1 for total signal, series #2 for nonspecific
signal).
Solubilization and Stabilization of Membrane Proteins 265
4 Notes
1. As the cell lysate will warm up, due to the high energy mixing
with glass beads, make sure to use an ice-water cooling jacket
with the Bead Beater homogenizer to control the temperature
during the cell disruption. The 2 min cool down step between
two cell lysis cycles is critical to avoid protein denaturation.
2. 2 stock solutions of each detergent or combination of deter-
gents are prepared in 1 PBS, 1 PIC at 20-fold the Critical
Micelle Concentration (CMC) in order to reach a final concen-
tration of 10 CMC in the solubilization tests.
3. Keep one well with no membrane that will serve as negative
control and one well with 2% SDS that will serve as positive
control. An example of 96-well plate solubilization conditions
is described in [7].
4. The membrane should not extend beyond the edge of the
gasket after the Bio-Dot apparatus is assembled.
5. Use a diagonal crossing pattern when tightening the screws to
ensure uniform application of pressure on the membrane
surface.
6. Tightening the four screws while vacuum is applied ensures a
tight sealing, preventing leaking between the wells and con-
tamination between slots.
7. To stop the vacuum, set the flow valve to a position that does
not expose the apparatus to air. That will maintain a slight
depression in the Bio-Dot apparatus preventing leaking
between the wells, while the vacuum pump is off.
8. This step will drastically improve the membrane protein reten-
tion on the GF/B filter.
9. The orthovanadate inhibits ATPase activity, enabling to deter-
mine the nonspecific inorganic phosphate background.
Solubilization and Stabilization of Membrane Proteins 267
References
1. Almen MS et al (2009) Mapping the human western blotting. Protein Eng Des Sel 28
membrane proteome: a majority of the human (12):539–542
membrane proteins can be classified according 9. Igonet S et al (2018) Enabling STD-NMR
to function and evolutionary origin. BMC Biol fragment screening using stabilized native
7:50 GPCR: a case study of adenosine receptor. Sci
2. Overington JP, Al-Lazikani B, Hopkins AL Rep 8(1):8142
(2006) How many drug targets are there? Nat 10. Nguyen KA et al (2018) Glycosyl-substituted
Rev Drug Discov 5(12):993–996 Dicarboxylates as detergents for the extraction,
3. Seddon AM, Curnow P, Booth PJ (2004) overstabilization, and crystallization of mem-
Membrane proteins, lipids and detergents: brane proteins. Angew Chem Int Ed Engl 57
not just a soap opera. Biochim Biophys Acta (11):2948–2952
1666(1–2):105–117 11. Matar-Merheb R et al (2011) Structuring
4. Duquesne K, Sturgis JN (2010) Membrane detergents for extracting and stabilizing func-
protein solubilization. Methods Mol Biol tional membrane proteins. PLoS One 6(3):
601:205–217 e18036
5. Eshaghi S (2009) High-throughput expression 12. Hardy D et al (2018) The yin and yang of
and detergent screening of integral membrane solubilization and stabilization for wild-type
proteins. Methods Mol Biol 498:265–271 and full-length membrane protein. Methods
6. Agez M et al (2017) Molecular architecture of 147:118–125
potassium chloride co-transporter KCC2. Sci 13. Desuzinges Mandon E et al (2017) Expression
Rep 7(1):16452 and purification of native and functional influ-
7. Desuzinges Mandon E et al (2017) Novel sys- enza a virus matrix 2 proton selective ion chan-
tematic detergent screening method for mem- nel. Protein Expr Purif 131:42–50
brane proteins solubilization. Anal Biochem 14. Jawhari A et al (2006) Structure and oligo-
517:40–49 meric state of human transcription factor
8. Ashok Y, Nanekar R, Jaakola VP (2015) Defin- TFIIE. EMBO Rep 7(5):500–505
ing thermostability of membrane proteins by
Part III
Abstract
Super-resolution fluorescence microscopy allows imaging macromolecular complexes down to the nano-
scopic scale and thus is a great tool to combine and integrate cellular imaging in the native cellular
environment with structural analysis by X-ray crystallography or high-resolution cryo electron microscopy
or tomography. Here we describe practical aspects of SMLM imaging by dSTORM, from the initial sample
preparation using mounting media, antibodies and fluorescent markers, the experimental setup for data
acquisition including multi-color colocalization and 3D data acquisition, and finally tips and clues on
advanced data processing that includes image reconstruction and data segmentation using 2D or 3D
clustering methods. This approach opens the path toward multi-resolution integration in cellular structural
biology.
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
271
272 Leonid Andronov et al.
2 Materials
2.1 Cell Culture In addition to your favorite adherent cell line, you need:
and Immunolabeling
1. Glass-bottom petri dishes with a diameter of 35 mm for cell
culture (CELLView, Greiner Bio-One).
2. Phosphate-buffered saline (PBS), 1 and 10 times concentrated
(PBS 1 and 10).
3. Paraformaldehyde (PFA) 4% solution in PBS.
4. 0.1% Triton X-100 in PBS (PBS/Tx).
5. Primary antibody.
6. Secondary antibody coupled to compatible fluorophores
(if primary antibody was not directly labeled).
7. Bovine serum albumin (BSA).
8. Normal goat serum (NGS).
9. Fetal bovine serum (FBS).
Compatible fluorophores:
Alexa Fluor family (Thermo Fisher Scientific): Alexa
647 (the most commonly used fluorophore for SMLM),
Alexa 555, Alexa 532, Alexa 488; Atto 488 (ATTO-TEC
GmbH); Cy3B [13] and others [6].
Practical Aspects of Super-Resolution Imaging and Segmentation of. . . 273
2.2 Mounting Media: Gloxy [6]: Cysteamine hydrochloride 50 mM, glucose 10% w/v,
Composition glucose oxidase 0.5 mg/ml, catalase 40 μg/ml in TN buffer
and Choice (50 mM Tris (pH 8.0) and 10 mM NaCl).
We use the following stock solutions:
1. Cysteamine hydrochloride (Sigma-Aldrich M6500, 1 M in
H2O, stored at 20 C).
2. Glucose 400 g/l, stored at 20 C.
3. Glucose Oxidase (Sigma-Aldrich G2133, 5 mg/ml, stored at
4 C).
4. Catalase (Sigma-Aldrich C3515, 4 mg/ml, stored at 4 C).
Vectashield/TDE [14]: Vectashield 20% v/v, TDE 70% v/v in
PBS.
1. Vectashield® Antifade Mounting Medium (Vectorlabs
H-1000, stored at +4 C).
2. 2,20 -Thiodiethanol (TDE, Sigma-Aldrich 166782).
Mix 20% v/v Vectashield with 70% v/v TDE and 10% v/v
PBS 10. For mounting, incubate in solutions with increasing
concentrations of TDE in PBS: 10%, 25%, 50%, 10 min each.
Then replace with the final solution, Vectashield/TDE.
OxEA [15]: Cysteamine hydrochloride 50 mM, Oxy-
Fluor™ 3% v/v, sodium DL-lactate 20% v/v in PBS adjusted
to pH 8–8.5 with 1 M aqueous NaOH.
We use the following stock solutions:
1. Cysteamine hydrochloride (Sigma-Aldrich M6500, 1 M in
PBS, stored at 20 C).
2. OxyFluor™ (Sigma-Aldrich SAE0059, stored at 20 C) [16].
3. Sodium DL-lactate (Sigma-Aldrich L1375, 60% w/w syrup,
stored at +4 C).
3 Methods
Fig. 1 Example of a typical dSTORM data acquisition cycle (see methods). HeLa cells, β-tubulin marked by
Alexa Fluor-647-conjugated secondary antibodies and mounted in the “Vectashield/TDE” medium. (a) Preview
in HiLo mode. (b) One of the frames of the acquisition (exposure time is 50 ms/frame). (c) Circles indicate the
spots that are selected by the Leica LAS AF software as single-molecule localizations. (d) Final reconstructed
super-resolution image using 17,622 frames with 1,160,875 localization events (collected here over 15 min);
the image is in the histogram mode with 20 nm/pixel, corrected for drift and rendered in SharpViSu [29]. Scale
bars, 2 μm
3.4 3D SMLM One of the easiest and most common ways for 3D SMLM imaging
Experiment is realized by the modification of the point spread function (PSF) of
the microscope with an astigmatic aberration.
Calibration. The astigmatic PSF deformation as a function of
the axial position of fluorophores should be calibrated by imaging
fluorescent beads using several known axial positions of the
objective.
1. Install a sample with fluorescent beads with subdiffraction size
in the microscope. For example, multi-color TetraSpeck™
Microspheres, 0.1 or 0.2 μm, can be used.
2. Put in place the cylindrical lens or activate astigmatism in the
adaptive optics module.
3. Focus the microscope in a way that the images of the beads are
closest to circular symmetry.
4. Adjust the imaging parameters (excitation intensity, exposure
time, and electron-multiplying gain of the camera) to get good
SNR. It is preferable to increase first the excitation intensity in
order to keep the exposure time minimal.
5. Image the beads as a Z-stack with a step of 50 nm around
0.6–1 μm of the focus point determined in step 3.
6. Repeat the procedure (steps 1–5) for each spectral channel.
7. Focus the microscope on the beads in one of the spectral
channels. Image the beads through all the channels in this
Z-position. It is necessary to take into account axial chromatic
aberration.
8. Fit all the acquired images with a software for single-molecule
detection, which will be used for the following experiments.
Refer to the manual of the software.
Once the calibration is done, 3D SMLM experiments can
be performed with the conventional SMLM procedure, with
the difference that the maximal density of switched-on mole-
cules on a frame should be reduced to avoid overlap of
stretched PSF spots.
3.5 SMLM Data The first step in SMLM data processing is the determination of the
Processing localization of each individual fluorophore to provide a full event
list from which a super-resolution image can be reconstructed. The
Practical Aspects of Super-Resolution Imaging and Segmentation of. . . 279
Fig. 2 Typical histogram of the photon count of localizations of the Alexa Fluor-647 dye. The exposure time
was 50 ms/frame, the detection threshold is 60 photons/pixel, 17,622 frames were analyzed producing
1,160,875 events, the average photon count is 2675 photons/event. The analysis was done in the Leica LAS
AF software
282 Leonid Andronov et al.
Fig. 3 Typical histogram of the number of localizations per frame for the Alexa Fluor-647 dye. The curve is
built using blocks of 100 frames each for smoothing reasons. Note increases in the number of localizations
(middle part of the graph) due to an increase in the intensity of the “backpumping” with a 405-nm laser.
Exposure time is 50 ms/frame, detection threshold is 80 photons/pixel; 18,620 frames with 1,161,303 events
were analyzed. The analysis was done in the Leica LAS AF software
4 Notes
Acknowledgments
We thank Yves Lutz from the Imaging Centre for discussions on the
adaptation of a Leica protocol and his contribution during earlier
published work. This work was supported by CNRS, Association
pour la Recherche sur le Cancer (ARC), Institut National du Can-
cer (INCa), Ligue nationale contre le cancer (Ligue), Agence
National pour la Recherche (ANR), and the USIAS research fel-
lowship program of the University of Strasbourg. The super-
resolution microscope setup was supported by the Alsace Region
and by the French Infrastructure for Integrated Structural Biology
(FRISBI; ANR-10-INSB-05-01) and Instruct-ERIC.
References
1. Orlov I, Myasnikov AG, Andronov L et al performance in localization-based super-reso-
(2017) The integrative role of cryo electron lution imaging. Nat Methods 8:1027–1036
microscopy in molecular and cellular structural 7. Lippincott-Schwartz J, Patterson GH (2009)
biology. Biol Cell 109:81–93 Photoactivatable fluorescent proteins for
2. Rust MJ, Bates M, Zhuang X (2006) Stochastic diffraction-limited and super-resolution imag-
optical reconstruction microscopy (STORM) ing. Trends Cell Biol 19:555–565
provides sub-diffraction-limit image resolu- 8. Owen DM, Rentero C, Rossy J et al (2010)
tion. Nat Methods 3:793–795 PALM imaging and cluster analysis of protein
3. van de Linde S, Löschberger A, Klein T et al heterogeneity at the cell surface. J Biopho-
(2011) Direct stochastic optical reconstruction tonics 3:446–454
microscopy with standard fluorescent probes. 9. Andronov L, Orlov I, Lutz Y et al (2016) Clus-
Nat Protoc 6:991–1009 terViSu, a method for clustering of protein
4. Betzig E, Patterson GH, Sougrat R et al (2006) complexes by Voronoi tessellation in super-
Imaging intracellular fluorescent proteins at resolution microscopy. Sci Rep 6:24084
nanometer resolution. Science 10. Malkusch S, Endesfelder U, Mondry J et al
313:1642–1645 (2012) Coordinate-based colocalization analy-
5. Sharonov A, Hochstrasser RM (2006) Wide- sis of single-molecule localization microscopy
field subdiffraction imaging by accumulated data. Histochem Cell Biol 137:1–10
binding of diffusing probes. Proc Natl Acad 11. Lee S-H, Shin JY, Lee A et al (2012) Counting
Sci U S A 103:18911–18916 single photoactivatable fluorescent molecules
6. Dempsey GT, Vaughan JC, Chen KH et al by photoactivated localization microscopy
(2011) Evaluation of fluorophores for optimal
Practical Aspects of Super-Resolution Imaging and Segmentation of. . . 285
(PALM). Proc Natl Acad Sci U S A 26. Sage D, Kirshner H, Pengo T et al (2015)
109:17436–17441 Quantitative evaluation of software packages
12. Fricke F, Beaudouin J, Eils R et al (2015) One, for single-molecule localization microscopy.
two or three? Probing the stoichiometry of Nat Methods 12:717–724
membrane proteins by single-molecule locali- 27. Baddeley D, Cannell MB, Soeller C (2010)
zation microscopy. Sci Rep 5:14072 Visualization of localization microscopy data.
13. Cooper M, Ebner A, Briggs M et al (2004) Microsc Microanal 16:64–72
Cy3B™: improving the performance of cya- 28. Glushonkov O, Réal E, Boutant E et al (2018)
nine dyes. J Fluoresc 14:145–150 Optimized protocol for combined PALM-
14. Olivier N, Keller D, Rajan VS et al (2013) dSTORM imaging. Sci Rep 8:8749
Simple buffers for 3D STORM microscopy. 29. Andronov L, Lutz Y, Vonesch J-L et al (2016)
Biomed Opt Express 4:885–899 SharpViSu: integrated analysis and segmenta-
15. Nahidiazar L, Agronskaia AV, Broertjes J et al tion of super-resolution microscopy data. Bio-
(2016) Optimizing imaging conditions for informatics 32:2239–2241
demanding multi-color super resolution locali- 30. Erdelyi M, Rees E, Metcalf D et al (2013)
zation microscopy. PLoS One 11:e0158884 Correcting chromatic offset in multicolor
16. Adler H, Spady G (1997) The use of microbial super-resolution localization microscopy. Opt
membranes to achieve anaerobiosis. J Rapid Express 21:10978–10988
Methods Autom Microbiol 5:1–12 31. Annibale P, Vanni S, Scarselli M et al (2011)
17. Tokunaga M, Imamoto N, Sakata-Sogawa K Quantitative photo activated localization
(2008) Highly inclined thin illumination microscopy: unraveling the effects of Photo-
enables clear single-molecule imaging in cells. blinking. PLoS One 6:e22678
Nat Methods 5:159–161 32. Ripley BD (1976) The second-order analysis of
18. Staudt T, Lang MC, Medda R et al (2007) stationary point processes. J Appl Probab
2,20 -thiodiethanol: a new water soluble mount- 13:255–266
ing medium for high resolution optical micros- 33. Nicovich PR, Owen DM, Gaus K (2017) Turn-
copy. Microsc Res Tech 70:1–9 ing single-molecule localization microscopy
19. Thompson RE, Larson DR, Webb WW (2002) into a quantitative bioanalytical tool. Nat Pro-
Precise nanometer localization analysis for indi- toc 12:453–460
vidual fluorescent probes. Biophys J 34. Ester M, Kriegel H-P, Sander J, Xu X (1996) A
82:2775–2783 density-based algorithm for discovering clus-
20. Holden SJ, Uphoff S, Kapanidis AN (2011) ters in large spatial databases with noise.
DAOSTORM: an algorithm for high- density KDD-96 Proceedings 226–231 ([Link]
super-resolution microscopy. Nat Methods [Link])
8:279–280 35. Voronoi G (1908) Nouvelles applications des
21. Abraham AV, Ram S, Chao J et al (2009) paramètres continus à la théorie des formes
Quantitative study of single molecule location quadratiques. J Reine Angew Math
estimation techniques. Opt Express 1908:97–102
17:23352–23373 36. Levet F, Hosy E, Kechkar A et al (2015)
22. Quan T, Zhu H, Liu X et al (2011) High- SR-Tesseler: a method to segment and quantify
density localization of active molecules using localization-based super-resolution microscopy
structured sparse model and Bayesian informa- data. Nat Methods 12:1065–1071
tion criterion. Opt Express 19:16963–16974 37. Andronov L, Michalon J, Ouararhni K et al
23. Ovesný M, Křı́žek P, Borkovec J et al (2014) (2018) 3DClusterViSu: 3D clustering analysis
ThunderSTORM: a comprehensive ImageJ of super-resolution microscopy data by 3D
plug-in for PALM and STORM data analysis Voronoi tessellations. Bioinformatics 34
and super-resolution imaging. Bioinformatics (17):3004–3012
30:2389–2390 38. Beheiry ME, Dahan M (2013) ViSP: represent-
24. Rouault H (2013) Brecs: reconstruction of ing single-particle localizations in three dimen-
dense localization microscopy datasets sions. Nat Methods 10:689–690
[Link] 39. Malkusch S, Heilemann M (2016) Extracting
25. Köthe U, Herrmannsdörfer F, Kats I et al quantitative information from single-molecule
(2014) SimpleSTORM: a fast, self-calibrating super-resolution imaging data with LAMA—
reconstruction algorithm for localization LocAlization microscopy analyzer. Sci Rep
microscopy. Histochem Cell Biol 6:34486
141:613–627
286 Leonid Andronov et al.
40. Ankerst M, Breunig MM, Kriegel H-P et al resolution imaging enables the analysis of pro-
(1999) OPTICS: ordering points to identify tein interactions, dynamics and formation of
the clustering structure. In: Proceedings of multi-protein structures. PLoS Comput Biol
the 1999 ACM SIGMOD international confer- 11:e1004634
ence on Management of Data. ACM, 42. Pengo T, Holden SJ, Manley S (2015)
New York, NY, USA, pp 49–60 PALMsiever: a tool to turn raw data into results
41. Caetano FA, Dirk BS, Tam JHK et al (2015) for single-molecule localization microscopy.
MIiSR: molecular interactions in super- Bioinforma Oxf Engl 31:797–798
Chapter 16
Abstract
The need to describe and understand signaling pathways in live cell is seen as a primary route to identifying
and developing targeted medicines. Signaling cascade is also seen as a complex communication and involves
interactions between multiple interconnecting proteins. Where subcellularly and how different proteins
interact need to be preserved during investigation. Furthermore, these complex events occurring simulta-
neously may lead to a single or multiple end point or cell function such as protein synthesis, cell cytoskele-
ton formation, DNA damage repair, or autophagy. There is therefore a need of real-time noninvasive
methods for protein assays to enable direct visualization of the interactions in their natural environment and
hence overcome the limitations of methods that rely on invasive cell disruption techniques. Förster
resonance energy transfer (FRET) coupled with fluorescence lifetime imaging microscopy (FLIM) is an
advanced imaging method to observe protein–protein interactions at nanometer scale inside single living
cells in real-time. Here we describe the development and use of two-channel pulsed interleave excitation
(PIE) for multiple protein interactions in the mTORC1 pathway. The proteins were first tagged with
multiple color fluorescent protein derivatives. The FRET-FLIM combination means that the information
gained from using standard steady-state FRET between interacting proteins is considerably improved by
monitoring changes in the excited-state lifetime of the donor fluorophore where its quenching in the
presence of the acceptor is evidence for a direct physical interaction.
Key words mTOR, Enzymes, Protein complex, Fluorescence imaging, Confocal microscopy,
Excited-state lifetime, TCSPC, FRET, FLIM GFP-tag, DNA, Three-color
1 Introduction
All cellular processes are driven by the action of proteins, from ion
channels across phospholipid membranes to DNA synthesis and cell
growth. For example, the mechanistic or mammalian target of
rapamycin (mTOR) pathway functions in the coordination of
energy, nutrients, and growth factor availability to regulate key
biological processes including cellular growth, metabolism, and
protein synthesis through the phosphorylation of downstream sub-
strates, ribosomal protein, S6 Kinase 1 (S6K1), and 4E-binding
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
287
288 Abdullah Ahmed et al.
Fig. 1 Schematic representation of colocalization versus interaction of proteins in a confocal volume of a high
numerical aperture microscope objective
Fig. 2 Simplified types of Förster resonance energy transfer (FRET) multiplexing. (a) Standard dual channel
(1:1) FRET process. For example, small two molecular probes or intramolecular FRET sensors co-expressed in
a cell, each containing a donor (D) and acceptor (A) fluorophores that are spectrally separate but emission of
the D overlaps with excitation of A, shown in (c). Both fluorophore needs to be within <10 nm. (b) Sequential
two-step FRET between three fluorophores that form two consecutive FRET donor and acceptor pairs. The
acceptor of the first pair acts as the donor for the second acceptor. In (b1), the donor (D1) is able to transfer
energy to both A1 and A2, so that D interacts with both A1 and A2. But A1 does not interact with A2. (c) In this
triple-fluorophore FRET used to detect multiple interactions in a complex, the overlap between all three does
need to have some spectral overlap. FRET detection between the donors and acceptors can be determined
when they form a donor–acceptor triple complex. (c, d), and (e) are representative excitation and emission
spectra (donors and acceptors pairs) for the fluorescent probes described in the work. The double-headed
arrows indicate the spectral overlap between donor emission and acceptor excitation spectra. (Modified from
Ref 17)
kD!A1 þ kD!A2
E¼ ð3Þ
kD!A þ kD!A þ τ1D
where E is the efficiency, k is the transfer rate, D is the donor, and τ
is the lifetime.
The cumulative FRET efficiencies in a complex multiplexed
acceptor(s)–donor(s) (Fig. 2) further developed by FRET from
single to multiplexed signaling events [17] can be calculated using
the normalized transfer rates related as:
6
0 kT R0 k0
kT ¼ ¼ , E¼ 0 T ð4Þ
Γ þ knr R kT þ 1
where kT is the transferred rate, k0T is the normalized transferred
rate, knr is the non-radiative decay, R is the distance between donor
and acceptor, R0 is the Förster radius, and E is the efficiency.
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . . 291
Fig. 3 Schematics of two-channel pulsed interleave excitation fluorescence lifetime imaging microscopy
292 Abdullah Ahmed et al.
2 Materials
3 Methods
3.1 Amplification PCRs were set up on ice in 0.2 ml PCR tubes or in an eight-strip
of cDNA by PCR PCR tube (Star Lab) containing both forward (Fwd) and reverse
(Rev) primers at a 10 μM working concentration, Phusion Flash
Mix (Thermo Fisher Scientific), template plasmid DNA
(100–200 ng) containing cDNA gene to be amplified and sterile
water as shown in Table 1. Constituents were gently mixed by
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . . 293
Table 1
PCR volumes
Table 2
Parameters of thermal cycles used for PCR
pipetting up and down. The PCR tubes were placed into a Veriti™
96-well thermal cycler (Thermo Fisher Scientific) running a pro-
gram as listed in Table 2.
3.2 Agarose Gel Upon completion of the PCR, 10 μl of filtered DNA loading buffer
Electrophoresis of PCR (0.25% w/v bromophenol in 30% v/v glycerol) was added to each
Products PCR tube and mixed gently by pipetting up and down. A volume of
40 μl of the PCR–dye mix was then loaded onto a pre-cast 1.0%
agarose/Tris-borate-EDTA (TBE) gel, commonly used for DNA
gel electrophoresis, containing the SYBRSafe stain (Thermo Fisher)
as listed in Table 3. Adjacent to the samples, 5 μl of Hyperlad-
derTM 1 kb (BioLine) was loaded and run in a 10 8 gel tank
(MiniRapide) filled with TBE for 120 min at 70 V using a Power
Pac 300 (Bio-Rad) power supply until the markers were separated
sufficiently. After marker bands were separated, the gel was viewed
with a blue light illuminator (Jencons-PLS) to both visualize and
verify PCR bands at their respected correct base pair lengths.
3.3 DNA PCR Product PCR products were visualized using blue light illumination, excised
Extraction from from the gel with a sterile surgical scalpel and transferred to a 1.5-
Agarose and Clean Up ml tube. The PCR-amplified gene was purified from the gel using a
commercially supplied kit (i.e., Machinery-Nagel).
294 Abdullah Ahmed et al.
Table 3
Parameters of thermal cycles used for PCR
Composition Amount
Agarose (sigma-Aldrich) 0.5 g
TBE (1) (sigma-Aldrich) 50 ml
SYBRSafe (Thermo fisher scientific) 5 μl
Composition of 1.0% TBE agarose gel
Table 4
In-fusion reaction for a two-way fusion
3.4 In-Fusion Ligation of the PCR products with linearized pOPIN vectors were
Reaction with pOPIN performed according to the manufacturer’s recommendations
Vectors using a Quick-Fusion cloning kit (Biotool). A two-way fusion
cloning reaction involving one PCR DNA insert and vector was
set up as described in Table 4. For a three-way fusion cloning
reaction involving two PCR DNA inserts and vector, 2 μl of each
insert with 2 μl of vector was added and the final volume adjusted to
10 μl with sterile water.
1. Transform fusion products into competent E. coli (i.e., RecA
strain DH5α) by electroporation or heat shock.
2. Incubate bacteria at 37 C for 30–60 min.
3. Plate different volumes of the bacterial suspension on LB plates
supplemented with appropriate antibiotics for selection.
4. Incubate plates at 37 C overnight.
5. Pick single colonies and grow LB overnight cultures.
6. Purify the recombinant plasmid using a commercially supplied
kit, i.e., the QIAprep Spin Miniprep Kit.
7. Optionally, determine the DNA concentration and purity using
a spectrophotometer, i.e., NanoDrop Microvolume Spectro-
photometer (Thermo Fisher Scientific).
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . . 295
3.6 Cell Lines HEK293 cells were cultured in Minimum Essential Media (MEM)
supplemented with 10% (w/v) fetal bovine serum (FBS), 2 mM L-
glutamine, and 1% (w/v) penicillin–streptomycin. All culture
reagents were acquired from Life Technologies. Cells were incu-
bated at 37 C with 5% CO2 humidified air in T75 culture flasks
(Thermo Scientific).
3.8 Equipment Our two-channel confocal and two-channel FLIM setup was fitted
for Real-Time Imaging with time-correlated single-photon counting cards (TCSPC) from
of Protein–Protein Becker & Hickl (BH SPC 830 or SPC150), and data were analyzed
Interactions Using using the BH SPCImage analysis software v 5.1.
a Confocal 1. Although the two-photon microscopy technique has several
and FRET-FLIM Setup advantages over a one-photon system, it is best to use a
one-photon confocal microscope for the multicolor FRET-
FLIM technique. This is because the ultrafast femtosecond
pulsed laser is likely to excite both the donor(s) and acceptor
(s) at the same time. This needs to be avoided. For the PIE
operation which is essential for three protein interaction stud-
ies, two separate pulsed laser sources are required. It is more
convenient to use two lasers that (1) can vary their repetition
rates, (2) can be synchronized, and (3) can be triggered exter-
nally (Fig. 3).
296 Abdullah Ahmed et al.
Fig. 4 Live HEK293 cell localization and interaction between the mTORC1-expressed proteins observed by
three-channel confocal and PIE two-channel FLIM. A1: EGPF-S6K1 alone as control with observed lifetime. B1:
The distribution of all lifetime in the image pixel is given in D1. B1–3 Confocal image of cell expression of
mTurg2-S6K1, FYP-Rheb, and mCherry-raptor. B4 and B5 are the two-channel PIE FLIM images of
mTurg2–S6K1 and YFP-Rheb. D2 and D3 are the respective lifetime distributions, indicating a reduction in
lifetime of the mTurg2-S6K1 but not the YFP-Rheb. C1–3 Confocal image of cell expression of mTurg2-S6K1,
FYP-mTOR, and mCherry-raptor. C4 and C5 are the two-channel PIE FLIM images of mTurg2-S6K1 and
YFP-mTOR. D4 and D5 are the respective lifetime distributions, indicating a reduction in lifetime of the
mTurg2-S6K1 but not the YFP-mTOR. E1 and E2 are schematic representation of the physical interaction
between the different proteins within the complex. FLIM of the red channel is not measured but could be
performed in a three-channel PIE setup. Scale bar is 10 μm
298 Abdullah Ahmed et al.
Table 5
Standard solution lifetime calibration for three-colour FRET-FLIM
Excitation Energy
Standard dye % Lifetime (in nm) transfer
7-OH-CCA 100 3.7 0.1 ns 405 N/A
Fluorescein 100 4.0 0.1 ns 488 N/A
Rhodamine b 100 1.7 0.05 ns 543 or 561 N/A
7-OH-CCA + fluorescein 50/50 3.3 0.05 ns 405 Yes
Fluorescein + rhodamine b 50/50 3.1 0.05 ns 488 Yes
7-OH-CCA + 33/33/33 3.3 0.05 ns (Ch1), 404 Yes
fluorescein + rhodamine b 3.1 0.05 ns (Ch2)
3.9 Typical Results Typical multichannel FLIM results of multiple protein interactions
are shown in Fig. 4 and changes in lifetime values are given in
Table 6.
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . . 299
Table 6
Three-color FRET-FLIM results for multiple mTORC1 interactions
4 Notes
Acknowledgments
References
1. Beretta L, Gingras AC, Svitkin YV et al (1996) 2. Brunn GJ, Hudson CC, Sekulić A et al (1997)
Rapamycin blocks the phosphorylation of Phosphorylation of the translational repressor
4E-BP1 and inhibits cap-dependent initiation PHAS-I by the mammalian target of rapamy-
of translation. EMBO J 15(3):658–664 cin. Science 277(5322):99–101
300 Abdullah Ahmed et al.
3. Gingras AC, Kennedy SG, O’Leary MA et al measurements beyond 100 Å using common
(1998) 4E-BP1, a repressor of mRNA transla- organic fluorophores: enhanced transfer in the
tion, is phosphorylated and inactivated by the presence of multiple acceptors. J Biomed Opt
Akt(PKB) signaling pathway. Genes Dev 12 17:11006. [Link]
(4):502–513 17.1.011006
4. Holz MK, Ballif BA, Gygi SP et al (2005) 15. Walczewska-Szewc K, Bojarski P, d’Auria S
mTOR and S6K1 mediate assembly of the (2013) Extending the range of FRET—the
translation preinitiation complex through Monte Carlo study of the antenna effect. J
dynamic protein interchange and ordered Mol Model 19:4195–4201. [Link]
phosphorylation events. Cell 123(4):569–580 10.1007/s00894-013-1810-3
5. Arif A, Terenzi F, Potdar AA et al (2017) EPRS 16. Koushik SV, Blank PS, Vogel SS (2009) Anom-
is a critical mTORC1–S6K1 effector that influ- alous surplus energy transfer observed with
ences adiposity in mice. Nature 542:357–361 multiple FRET acceptors. PLoS One 4(11):
6. Caccamo A, Branca C, Talboom JS et al (2015) e8031. [Link]
Reducing ribosomal protein S6 kinase 1 expres- pone.0008031
sion improves spatial memory and synaptic 17. Bunt G, Wouters FS (2017) FRET from single
plasticity in a mouse model of Alzheimer ‘s to multiplexed signaling events. Biophys Rev
disease. J Neurosci 35:14042–14056 9:119–129. [Link]
7. Kim SY, Baik KH, Baek KH et al (2014) S6K1 s12551-017-0252-z
negatively regulates TAK1 activity in the toll- 18. Wolfgang B (2015) Advanced single photon
like receptor. Mol Cell Biol 34:510–521 counting applications. Springer, New York, pp
8. Marabita M, Baraldo M, Solagna F et al (2016) 1–624. [Link]
S6K1 is required for increasing skeletal muscle 14929-5
force during hypertrophy article S6K1 is 19. Botchway SW, Scherer KM, Hook S et al
required for increasing skeletal muscle force (2015) A series of flexible design adaptations
during hypertrophy. Cell Rep 17:501–513 to the Nikon E-C1 and E-C2 confocal micro-
9. Choo AY, Yoon SO, Kim SG et al (2008) scope systems for UV, multiphoton and FLIM
Rapamycin differentially inhibits S6Ks and imaging. J Microsc 258(1):68–78. [Link]
4E-BP1 to mediate cell-type-specific repression org/10.1111/jmi.12218
of mRNA translation. Proc Natl Acad Sci U S A 20. Scully AD, Macrobert AJ, Botchway S et al
105(45):17414–17419. [Link] (1996) Development of a laser-based fluores-
1073/pnas.0809136105 cence microscope with subnanosecond time
10. Choo AY, Blenis J (2009) Not all substrates are resolution. J Fluoresc 6(2):119–125. https://
treated equally implications for mTOR, [Link]/10.1007/BF00732051
rapamycin-resistance and cancer therapy. Cell 21. Suhling K, Siegel J, Phillips D et al (2002)
Cycle 8:567–572. [Link] Imaging the environment of green fluorescent
cc.8.4.7659 protein. Biophys J 83(3589–3595):2002
11. Förster T (1948) Zwischenmolekulare Ener- 22. Marcu L, French PMW, Elson DS (2014)
giewanderung und Fluoreszenz [Intermolecu- Fluorescence lifetime spectroscopy and imag-
lar energy migration and fluorescence]. ing—principles and applications in biomedical
Annalen der Physik (in German). 437: 55–75. diagnostics. CRC Press, Boca Raton, Florida,
B För s t e r T (1946) Energiewanderung und pp 1–570. SBN 9781439861677—CAT#
Fluoreszenz. Naturwissenschaften K12851
33:166–175? (Translation: by Klaus Suhling). 23. Estandarte AK, Botchway S, Lynch C et al
J Biomed Opt 17:011002 (2016) The use of DAPI fluorescence lifetime
12. Pawley JB (2006) Handbook of biological con- imaging for investigating chromatin condensa-
focal microscopy, 3rd edn. Springer, New York, tion in human chromosomes. Sci Rep 6:31417.
NY, pp 1–985. [Link] [Link]
978-0-387-45524-2_8. ISBN 978-0-387- 24. Yadav RB, Burgos P, Parker AW et al (2013)
25921-5 mTOR direct interactions with Rheb-GTPase
13. Fábián ÁI, Rente T, Szöllősi J et al (2010) and raptor: sub-cellular localization using fluo-
Strength in numbers: effects of acceptor abun- rescence lifetime imaging. BMC Cell Biol 14:3.
dance on FRET efficiency. ChemPhysChem [Link]
11:3713–3721. [Link] 25. Stubbs CD, Botchway SW, Slater SJ et al
cphc.201000568 (2005) The use of time-resolved fluorescence
14. Maliwal BP, Raut S, Fudala R et al (2012) imaging in the study of protein kinase C loca-
Extending Förster resonance energy transfer lisation in cells. BMC Cell Biol 6(1):22
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . . 301
26. Jeshtadi A, Burgos P, Stubbs CD et al (2010) interactions between Golgi tethering factors
Interaction of poxvirus intracellular mature and small GTPases in plants. Traffic 10
virion proteins with the TPR domain of kinesin (8):1034–1046. [Link]
light chain in live infected cells revealed by two- 1600-0854.2009.00930.x
photon-induced fluorescence resonance energy 28. Nettleship JE, Assenberg R, Diprose JM et al
transfer fluorescence lifetime imaging micros- (2010) Recent advances in the production of
copy. J Virol 84(24):12886–12894. https:// proteins in insect and mammalian cells for
[Link]/10.1128/JVI.01395-10 structural biology. J Struct Biol 172
27. Osterrieder A, Carvalho CM, Latijnhouwers M (1):55–65. [Link]
et al (2009) Fluorescence lifetime imaging of 2010.02.006
Chapter 17
Abstract
Proximity-dependent labeling techniques such as BioID and APEX2 allow the biotinylation of proteins
proximal to a protein of interest in living cells. Following streptavidin pulldown and mass spectrometry
analysis, this enables the identification of native protein–protein interactions. Here we describe split-BioID,
a protein-fragment complementation assay that increases the resolution of BioID. Using this technique,
context-specific protein complexes can be resolved.
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
303
304 Cinthia Amaya Ramirez et al.
Fig. 1 Principle of split-BioID. Protein A interacts with protein B within Complex I or with protein C within
Complex II. Fusing the BirA* fragments NBirA* and CBirA* to protein A and protein B, respectively, leads to the
reassembly of an active enzyme upon dimerization of these two proteins and the specific labeling of further
components of complex
2 Materials
3 Methods
3.1 Cloning of Two 1. Design primers to amplify the two genes to be tested, so that
Genes of Interests restriction sites are included that allow subcloning in split-
in Split-BioID Plasmid BioID plasmids (see Note 11).
2. Perform PCR to amplify both genes, run the reactions on a 1%
agarose-TAE gel and cut slices of agarose gel that encompass
the amplified DNA. Extract and purify the amplified DNA
using a standard DNA gel extraction kit.
3. Digest amplified DNA and acceptor plasmid(s) with the rele-
vant restriction enzymes. Typically 2 μg of plasmid is mixed
with 1 μL of each restriction enzyme in a total volume reaction
of 20 μL, whereas 25 μL of the purified PCR products is mixed
308 Cinthia Amaya Ramirez et al.
3.2 Small-Scale 1. Seed a six-well cell culture plate with the cells to transfect so
Testing of Proximity- that they reach 50–70% confluence on the following day. Incu-
Dependent bate overnight at 37 C, 5% CO2. For HeLa cells, typically
Biotinylation 80–150 103 cells are seeded per well in a volume of 2 mL (see
in Living Cell Note 14).
2. On the next day, remove the medium from the six-well plate
and replace with 2 mL of fresh medium per well.
3. Prepare the transfection mixes for all conditions to be tested,
usually the pair of proteins of interest and a negative control (see
Note 15). When using PEI as a transfection reagent for HeLa
cells, we typically use 6 μg PEI diluted in 100 μL DMEM
Context-Specific Proximity-Dependent Proteomics with Split-BioID 309
3.3 Large-Scale 1. For each condition to be tested, seed three to four 10-cm cell
Proximity-Dependent culture dishes with the cells to transfect, so that they reach
Biotinylation approximately 70% confluence on the following day. Incubate
for Proteomics Studies overnight at 37 C, 5% CO2. For HeLa cells, typically 8 105
cells are seeded per dish in a volume of 10 mL (see Note 14).
Context-Specific Proximity-Dependent Proteomics with Split-BioID 311
2. On the next day, remove the medium from the dishes and
replace with 10 mL of fresh medium.
3. Prepare the transfection mixes for all conditions to be tested,
usually the pair of proteins of interest and a negative control (see
Note 15). When using PEI as a transfection reagent for HeLa
cells, we typically use 12 μg PEI diluted in 150 μL DMEM
medium (without serum) mixed with 6 μg plasmid diluted in
150 μL DMEM medium (without serum) per plate. The trans-
fection mixes are incubated for 5–15 min at room temperature
(RT) and then dispatched drop wise to their corresponding
dishes (300 μL per 10 cm plate). The cells are then incubated
overnight at 37 C, 5% CO2.
4. On the next day, transfer the cells from each dish to 15 cm
plates. To do so, the cells are first washed with 7 mL PBS and
then incubated with 1.5 mL of a trypsin-EDTA solution for
5 min at RT. DMEM (3.5 mL) is then added and the cells
resuspended by pipetting and transferred to 15 cm plates filled
with 20 mL DMEM containing enough biotin to reach a final
concentration of 50 μM for a total volume of 25 mL, and
enough doxycycline for a concentration of 200 ng mL 1 doxy-
cycline if using inducible plasmids under the control of a
tet-responsive element (see Note 16). Incubate the cells for at
least 16 h at 37 C, 5% CO2.
5. On the following day, cells in each 15 cm dish are washed twice
with 20 mL PBS and then scrapped in 1.5 mL PBS using
disposable cell scrappers.
6. Scrapped cells are then transferred to 1.5 mL tubes and har-
vested by centrifugation at 1200 g for 5 min at 4 C.
7. Cell pellets can then be snap frozen in liquid nitrogen and if
desired stored at 80 C until further processing.
8. To prepare cell lysates, the frozen cell pellets are first resus-
pended in 1 mL lysis buffer II at room temperature and passed
ten times (five strokes) through 25G needle attached to a 1-mL
syringe (see Note 21).
9. The lysates are then sonicated in a cold ultrasonic bath for
4 cycles of 30 s at high intensity with 30 s pause time between
each cycle (see Note 22).
10. Add Triton X-100 to the sonicated lysates to a final concentra-
tion of 2% (Typically 100 μL of a 20% Triton X-100 solution is
added to 900 μL of lysate) and then enough volume of 50 mM
Tris–HCl, pH 7.4 solution, so that the final NaCl concentra-
tion is adjusted to 150 mM (typically 2.3 mL is added to 1 mL
of Triton X-100 adjusted lysates) (see Note 23).
312 Cinthia Amaya Ramirez et al.
3.5 SDS-PAGE 1. Prior to sample preparation for MS analysis, assess the success
and Sample of the split-BioID experiment by Western blot. To do so,
Preparation for MS prepare input and elution blot samples as follows: equal protein
Analysis amounts of input samples mixed with 5 SDS loading buffer in
a total volume of 28 μL (load 25 μL per lane), 5 μL of each
elution sample mixed with 1.25 μL of 5 SDS loading buffer
(load 6 μL per lane). Western blot analysis is performed as
described in Subheading 3.2, steps 10–18 (Fig. 4a).
2. To prepare sample for MS analysis, we recommend using com-
mercial precast gels and reagents (see Note 10). Prepare sam-
ples for SDS-PAGE as follows: 18.75 μL elution samples mixed
with 4 sample buffer. Load the samples on a 4–20%
SDS-polyacrylamide gel and run the electrophoresis until the
running front migrate 2–4 cm into the gel.
Fig. 4 Typical Western blot and protein gel for a split-BioID experiment. (a) Biotinylated proteins are shown for
input and eluted samples from a streptavidin pulldown experiment. GIGYF2 and 4EHP are direct binding
partners. Ago2 and 4EHP do not interact directly and serve as a negative control pair. (b) The elution sample of
a split-BioID experiment was run on a protein gel. The region to be excised and processed for MS analysis is
indicated. (Panel (b) is adapted from Fig. 6 of Schopp and Béthune 2018 [15] under a creative commons
license(CRC 3.0, by,nc,nd)). Asterisks indicate endogenous biotinylated proteins
314 Cinthia Amaya Ramirez et al.
4 Notes
Acknowledgments
References
1. Scott DE, Bayly AR, Abell C et al (2016) Small mammalian cells. J Cell Biol 196(6):801–810.
molecules, big targets: drug discovery faces the [Link]
protein-protein interaction challenge. Nat Rev 4. Kim DI, Birendra KC, Zhu W et al (2014)
Drug Discov 15(8):533–550. [Link] Probing nuclear pore complex architecture
org/10.1038/nrd.2016.29 with proximity-dependent biotinylation. Proc
2. Lam SS, Martell JD, Kamer KJ et al (2015) Natl Acad Sci U S A 111(24):E2453–E2461.
Directed evolution of APEX2 for electron [Link]
microscopy and proximity labeling. Nat Meth- 5. Lambert JP, Tucholska M, Go C et al (2015)
ods 12(1):51–54. [Link] Proximity biotinylation and affinity purification
nmeth.3179 are complementary approaches for the interac-
3. Roux KJ, Kim DI, Raida M et al (2012) A tome mapping of chromatin-associated protein
promiscuous biotin ligase fusion protein iden- complexes. J Proteome 118:81–94. https://
tifies proximal and interacting proteins in [Link]/10.1016/[Link].2014.09.011
318 Cinthia Amaya Ramirez et al.
Abstract
Lysine acetylation is a ubiquitous modification permeating the proteomes of organisms from all domains of
life. Lysine deacetylases (KDACs) reverse this modification by following two fundamentally different
enzymatic mechanisms, which differ mainly by the need for NAD+ as stoichiometric co-substrate.
KDACs are often found as catalytic subunit in protein complexes involved in cell cycle regulation,
chromatin organization and transcription. Their promiscuity with respect to sequence context and type
of lysine acylation convolutes the network of functional and physical connections.
Here we present an efficient selection method for KDACs in E. coli, which allows for the creation of acyl-
type specific KDAC variants, which greatly facilitate the investigation of their physiological function. The
selection system builds on the incorporation of acylated lysines by genetic code expansion in reporter
enzymes with essential lysine residues. We describe the creation of KDAC mutant libraries by saturation
mutagenesis of active site residues, the isolation of individual mutants from this library using the selection
system, and their biochemical characterization with acylated firefly luciferase.
Key words Genetic code expansion, Non-canonical amino acids, Lysine deacetylases, Directed
evolution
1 Introduction
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
319
320 Martin Spinck et al.
2 Materials
2.1 Strains
and Plasmids (Table 1)
2.2 Creation of KDAC 1. Expand High Fidelity Polymerase (11732650001, 3.5 U μL1,
Mutant Libraries by Sigma Aldrich).
Inverse PCR 2. 3 M NaOAc pH 5.2 (ITW Reagents).
Table 1
Strains and plasmids
3 Methods
The following three sections outline the necessary steps for the
creation, selection, and characterization of a KDAC mutant library.
We are using E. coli KDAC CobB as an example. CobB is a multi-
functional enzyme able to reverse various lysine modifications such
as acetylation, crotonylation, propionylation or butyrylation. In
this example, we decided to remove its decrotonylation activity by
directed evolution.
3.1 Creation of KDAC The active site residues of sirtuins were randomized by three rounds
Mutant Libraries by of enzymatic inverse PCR [27]. Positions in this example were
Inverse PCR chosen based on the crystal structure of CobB (pdb-file: 1S5P
[28]) close to the bound acetyl-lysine head group (~7 Å radius,
see Fig. 1).
3.1.1 Inverse PCR Primers contain randomized bases (NNK) at the sites of interest
and recognition sites for Bsa I-HF to allow scar less ligation for
plasmid circularization (Fig. 2).
1. Set up several PCRs in parallel as indicated in Table 2 (see Notes
2 and 3):
2. Run PCR according to the program detailed in Table 3.
3. Add 1 μL of Dpn I (20 U μL1, NEB) to each 50 μL PCR.
Incubate for 1 h, 37 C.
4. Purify PCR product by QIA Quick PCR Purification Kit or by
Gel purification kit (see Fig. 3).
5. Bsa I-HF digestion of the PCR products for 2 h at 37 C
(Table 4).
6. Purify PCR product by QIA Quick PCR Purification Kit and
elute in 50 μL.
A Directed Evolution System for Lysine Deacetylases 325
Fig. 1 Active site of the CobB crystal structure (1S5P [28]) with bound peptide.
The acetyl-lysine (AcK) and NAD+ (placed with chimera from 2H4F [29]) are
shown, the selected atom to place the sphere for the selection of the active site
residues is indicated (black circle). Five amino acids (orange) were chosen
because of their distance to the indicated atom and to the NAD+. The codons
of all five amino acids were replaced by NNK codons in three rounds of
mutagenesis
Ligation(scale to adjust
DNA concentration <10 ng/μl)
ddH2O 325 μL
Ligation buffer (10) 50 μL
Digested PCR product 100 μL
1
T4 ligase (5 U μL ) 25 μL
Total volume 500 μL
Table 2
Composition of the inverse PCR mix
ddH2O 41 μL
Buffer expand high fidelity (10) 5 μL
Volume of each primer (100 μM) 0.5 μL
dNTP mix (10 mM) 1 μL
1
Template (~400 ng μL ) 1 μL
1
Expand polymerase (3.5 U μL ) 1 μL
Total volume 50 μL
Table 3
Cycles for the inverse PCR
(b) Then slowly pull down the droplet with the pipette tip.
(c) When the round droplet touches the DNA pellet, it will
spread and run to the bottom of the tube slowly.
(d) Repeat this process several times until there is no DNA left
(droplet stays round).
(e) Transfer the solution to the next tube.
13. Determine DNA concentration by NanoDrop.
14. Test ligation efficiency by Hind III digest of 100 ng of DNA in
a 10-μL reaction (see Note 7 and Fig. 3).
Fig. 3 Examples for each step are from the creation of various libraries. (a) Example for a primer pair,
important sequence features are highlighted. (b) Examples for PCR products ranked from suitable to
unsuitable for subsequent steps. Troubleshooting recommendations are indicated. Start a library with the
least efficient PCR, because the required number of transformants increases while performance usually
declines in successive rounds of mutagenesis. (c) Efficiency of the ligation should be tested before
electroporation. A circular vector will give a single band (1) when digested with a single cutting restriction
enzyme, if the ligation is incomplete, it will result in two extra bands with different intensities depending on the
ligation efficiency (2, 3). No ligation results in just a double band (4). Reason for incomplete ligation can be the
presence of side products capping the linear DNA (compare PCRs labeled # and * in b). Transformation of 3 or
4 did not yield any or sufficient numbers of colonies, while transformation of 2 was still sufficient
A Directed Evolution System for Lysine Deacetylases 329
Table 4
Restriction digest of PCR product (scale to match volume of PCR product)
PCR product 30 μL
ddH2O 11 μL
Cut smart buffer (10) 5 μL
Bsa I-HF (20 U μL1) 4 μL
Total volume 50 μL
5. Dry the cuvette with a paper towel and place it in the electro-
poration system.
6. Electroporate using E. coli electroporation settings: 2500 V,
25 μF, 200 Ω.
7. Immediately add 1 mL recovery medium (RT).
8. Transfer the reaction into a 1.5 mL reaction tube.
9. Incubate at 37 C for 1 h.
10. Pool the transformations in a volume of 250 mL LB medium
containing 50 μg/mL kan and plate a dilution series (104 to
107) on LB-kan plates. Incubate both overnight at 37 C, the
flask shaking at 200 rpm.
11. Estimate transformation efficiency from the colony count of
the dilution series.
12. Isolate plasmid DNA from the pool and from at least 12 indi-
vidual clones and sequence the KDAC ORF.
13. If transformation efficiency exceeds three times the diversity of
the library and the majority of individual sequences are unique
and without frameshifts continue to the next step.
14. Use the plasmid preparation isolated from the pool as template
in the next round of mutagenesis.
3.2 Selection The mutant libraries generated above contain a large number of
of Lysine Deacetylases different mutants due to the numerous possible combinations of
randomized positions (205 different proteins coded for by 325
codon combinations if five positions are mutated). Most of the
mutations will be detrimental to protein function or folding, ren-
dering the mutants inactive. Hence, an efficient selection system is
required to identify the mutants of interest in a large background of
inactive ones. Therefore, we designed a bacterial selection system
that allows parallel screening of each mutant in a single step [24]. We
created an E. coli strain without deacetylase activity and impaired
uracil biosynthesis by inactivating the genes for CobB and PyrF
using CRISPR/Cas9 and Lambda Red Recombineering [30]. We
complemented the uracil auxotrophic strain with Ura3 (orotidine
50 -phosphate decarboxylase), which contains an amber codon in
330 Martin Spinck et al.
Fig. 4 Outline of the bacterial KDAC selection system. (a) Specific mutants can be enriched by transforming
E. coli expressing acylated Ura3 with the library. Each individual cell will then perform the demodification
reaction and only produce active Ura3 if the encoded KDAC mutant has activity for the attached modification.
The active Ura3 can then be used to either remove or enrich the active mutants depending on the selection
plate composition. (b) Phenotyping. DH10B ΔcobB ΔpyrF expressing Ura3 K93ac or K93boc and either CobB or
HDAC8 were grown on positive (–Ura) or negative (+5-FOA/Ura) selection conditions. Both KDACs are able to
cleave AcK and hence grow only under positive selection. The situation is inversed when BocK is incorporated
which neither KDAC can cleave. (c) Example for a positive selection of the CobB active site mutant library in
the presence or absence of AcK or CrK. Approximately 108 cells were plated in each case (library diversity
approximately 3.4 107). Number of colonies gives an estimate of surviving mutants and is used as a
reference for the required transformation efficiency in subsequent selection rounds
place of the codon for an essential lysine in its active site (K93)
[31]. Suppression of this codon with an acylated lysine by genetic
code expansion [26] produces an enzyme that can be activated by
co-expression of a KDAC. This allows for positive (in the absence of
uracil) and negative (in the presence of 5-fluoroorotic acid [32] and
uracil) selection of its activity (Fig. 4).
A Directed Evolution System for Lysine Deacetylases 331
the cells into aliquots of 500 μL and isolate the plasmid DNA
using a commercial kit. Pool plasmid DNA for the next round
of selection.
9. Repeat steps 1–8 until all selection rounds are completed.
10. Transform DH10B cells with the plasmid DNA obtained by
the selection via heat shock. Plate the cells on agar plates
containing 50 μg/mL kan and incubate them overnight at
37 C.
11. On the next day, prepare a 96 deep well block by filling each
well with 1 mL LB medium containing 50 μg/mL kan. Inocu-
late each well by picking single colonies of the transformed
DH10B cells. Incubate the block overnight at 37 C.
12. Harvest the cells by centrifuging the 96 well block for 10 min
at 2700 g and remove the media.
13. Isolate the plasmid DNA of each well and sequence the KDAC
ORF (see Note 11).
3.2.3 6-AU Assay This step is optional, but can help filter out the most active variants
(Optional) from a pool of mutants. Therefore, repeat the last selection step of
Subheading 3.2.2 with the addition of 6-azauridine (6-AU) to the
agar plates (0.01–2 mM, at least 10 different concentrations). This
can be done by plating the pool of mutants or by replicating single
colonies from a 96-well plate onto the selection plates. 6-AU is an
inhibitor of Ura3, which requires cells to produce more active
Ura3, increasing the stringency of the positive selection assay.
3.3 KDAC Assay Similar to Ura3, the firefly luciferase (FLuc) also contains an essen-
Based on Acylated tial lysine (K529) in its active site. When modified, the luciferase is
Firefly Luciferase completely inactive and therefore can be used to monitor the
activity of enzymes capable of reversing the modification [25]. We
use this to assay the activity and selectivity of the isolated mutants.
3.3.1 Preparation 1. Transform E. coli BL21 DE3 with plasmids pFluc and
of FLucmod pBK-AcKRS3opt or pBK-PylS depending on the desired
modification.
2. Grow the cells in LB medium (50 μg/mL spectinomycin and
50 μg/mL kan, 5 mM N(ε)-acetyl-lysine or 1 mM other AS
and 20 mM nicotinamide) at 37 C to and OD600 of 1.0.
3. Shift cells to 30 C and induce protein expression by the
addition of 1 mM IPTG.
4. After 4 h at 30 C harvest cells by centrifugation, wash with
PBS, and suspend in Ni-wash buffer.
5. Lyse cells by passing them three times through a microfluidizer.
6. Centrifuge lysate at 20,000 g for 20 min and transfer the
supernatant to a falcon tube.
A Directed Evolution System for Lysine Deacetylases 333
3.3.3 Characterization For testing a large number of mutants for a desired property,
of Isolated Mutants KDACs partially purified by Ni-NTA (Subheading 3.3.2, steps 1–
14) or even cell lysates can be used if mutants can be expressed in an
E. coli ΔcobB strain (e.g., DH10B ΔcobB ΔpyrF). The assay is
exceptionally sensitive, so that even small contaminations with
KDACs such as E. coli CobB will produce high background signals.
All isolated mutants are expressed, and activity for different mod-
ifications is assessed. Eventually, the desired KDACs should be
purified to homogeneity by Ni-NTA affinity and gel filtration chro-
matography for full characterization.
1. Prepare cell lysate (Subheading 3.3.2, steps 1–10), Ni-Eluate
(steps 1–14), or fully purified KDACs (steps 1–18) of all
mutants and a wild-type control.
2. Estimate protein concentration by SDS-PAGE or nano drop.
3. Set up reactions in 96-well PCR plates in triplicate for every
lysine modification as following: 0.2 mg/mL KDAC, 2 mM
NAD+, 10 μL Luciferase eluate (1:125 to 1:8000 dilution,
depending on the signal strength, at least 100-fold over back-
ground) in KDAC reaction buffer to a final volume of 50 μL.
4. Incubate at 30 C for 30 min with 50 C lid temperature in a
thermocycler.
5. Transfer 40 μL of the reaction mixture to a 96-well microtiter
plate.
6. Add 40 μL of 2 Luciferase Buffer.
7. Measure luminescence using a Microplate reader.
8. Normalize activity to the signal of the wild-type.
9. Mutants with enhanced selectivity and/or activity are selected
for further analysis.
10. Perform steps 1–8 with various concentrations of mutant and
wild-type enzyme (between 1 nM and 16 μM).
11. Activity can be compared in the linear region of the obtained
curve for each individual substrate.
4 Notes
Acknowledgments
References
1. Allfrey VG, Faulkner R, Mirsky AE (1964) regulatory enzyme CobB in Escherichia coli.
Acetylation and methylation of histones and Mol Cell Proteomics 12:3509–3520. https://
their possible role in the regulation of rna syn- [Link]/10.1074/mcp.M113.031567
thesis. Proc Natl Acad Sci U S A 51:786–794 13. Vaziri H et al (2001) hSIR2(SIRT1) functions
2. Riggs MG, Whittaker RG, Neumann JR, as an NAD-dependent p53 deacetylase. Cell
Ingram VM (1977) n-Butyrate causes histone 107:149–159
modification in HeLa and friend erythroleu- 14. Luo J, Su F, Chen D, Shiloh A, Gu W (2000)
kaemia cells. Nature 268:462. [Link] Deacetylation of p53 modulates its effect on
org/10.1038/268462a0 cell growth and apoptosis. Nature
3. Taunton J, Hassig CA, Schreiber SL (1996) A 408:377–381. [Link]
mammalian histone deacetylase related to the 35042612
yeast transcriptional regulator Rpd3p. Science 15. Hubbert C et al (2002) HDAC6 is a
272:408 microtubule-associated deacetylase. Nature
4. Yang WM, Inouye C, Zeng Y, Bearss D, Seto E 417:455–458. [Link]
(1996) Transcriptional repression by YY1 is 417455a
mediated by interaction with a mammalian 16. Andrews FH et al (2016) The Taf14 YEATS
homolog of the yeast global regulator RPD3. domain is a reader of histone crotonylation.
Proc Natl Acad Sci U S A 93:12845–12850 Nat Chem Biol 12:396–398. [Link]
5. Seto E, Yoshida M (2014) Erasers of histone org/10.1038/nchembio.2065
acetylation: the histone deacetylase enzymes. 17. Sabari BR et al (2015) Intracellular crotonyl-
Cold Spring Harb Perspect Biol 6:a018713. CoA stimulates transcription through p300-
[Link] catalyzed histone crotonylation. Mol Cell
a018713 58:203–215. [Link]
6. Sauve AA (2010) Sirtuin chemical mechan- molcel.2015.02.029
isms. Biochim Biophys Acta 18. Wei W et al (2017) Class I histone deacetylases
1804:1591–1603. [Link] are major histone decrotonylases: evidence for
[Link].2010.01.021 critical and broad function of histone crotony-
7. Lombardi PM, Cole KE, Dowling DP, Chris- lation in transcription. Cell Res 27:898–915.
tianson DW (2011) Structure, mechanism, and [Link]
inhibition of histone deacetylases and related 19. Meier K, Brehm A (2014) Chromatin regula-
metalloenzymes. Curr Opin Struct Biol tion: how complex does it get? Epigenetics
21:735–743. [Link] 9:1485–1495. [Link]
2011.08.004 15592294.2014.971580
8. Tan M et al (2011) Identification of 67 histone 20. Zhang Y, Iratni R, Erdjument-Bromage H,
marks and histone lysine crotonylation as a new Tempst P, Reinberg D (1997) Histone deace-
type of histone modification. Cell tylases and SAP18, a novel polypeptide, are
146:1016–1028. [Link] components of a human Sin3 complex. Cell
cell.2011.08.008 89:357–364. [Link]
9. Finkemeier I, Laxa M, Miguet L, Howden AJ, S0092-8674(00)80216-0
Sweetlove LJ (2011) Proteins of diverse func- 21. Xue Y et al (1998) NURD, a novel complex
tion and subcellular location are lysine acety- with both ATP-dependent chromatin-remo-
lated in Arabidopsis. Plant Physiol deling and histone deacetylase activities. Mol
155:1779–1790. [Link] Cell 2:851–861
pp.110.171595 22. Wen YD et al (2000) The histone deacetylase-3
10. Wu X et al (2011) Lysine acetylation is a wide- complex contains nuclear receptor corepres-
spread protein modification for diverse proteins sors. Proc Natl Acad Sci U S A 97:7202–7207
in Arabidopsis. Plant Physiol 155:1769–1778. 23. Simithy J et al (2017) Characterization of his-
[Link] tone acylations links chromatin modifications
11. Henriksen P et al (2012) Proteome-wide anal- with metabolism. Nat Commun 8:1141.
ysis of lysine acetylation suggests its broad reg- [Link]
ulatory scope in Saccharomyces cerevisiae. Mol 01384-9
Cell Proteomics 11:1510–1522. [Link] 24. Spinck M, Neumann-Staubitz P, Ecke M, Gas-
org/10.1074/mcp.M112.017251 per R, Neumann H (2020) Evolved, selective
12. Colak G et al (2013) Identification of lysine erasers of distinct lysine acylations. Angew
succinylation substrates and the succinylation
A Directed Evolution System for Lysine Deacetylases 337
Chem Int Ed Engl 59:11142–11149. https:// 29. Hoff KG, Avalos JL, Sens K, Wolberger C
[Link]/10.1002/anie.202002899 (2006) Insights into the Sirtuin mechanism
25. Spinck M, Ecke M, Sievers S, Neumann H from ternary complexes containing NAD+
(2018) Highly sensitive lysine deacetylase and acetylated peptide. Structure 14
assay based on acetylated firefly luciferase. Bio- (8):1231–1240
chemistry 57:3552–3555. [Link] 30. Pyne ME, Moo-Young M, Chung DA, Chou
10.1021/[Link].8b00483 CP (2015) Coupling the CRISPR/Cas9 sys-
26. Neumann H, Peak-Chew SY, Chin JW (2008) tem with lambda red Recombineering enables
Genetically encoding N(epsilon)-acetyllysine in simplified chromosomal gene replacement in
recombinant proteins. Nat Chem Biol Escherichia coli. Appl Environ Microbiol
4:232–234. [Link] 81:5103–5114. [Link]
nchembio.73 aem.01248-15
27. Stemmer WP, Morris SK (1992) Enzymatic 31. Appleby TC, Kinsland C, Begley TP, Ealick SE
inverse PCR: a restriction site independent, (2000) The crystal structure and mechanism of
single-fragment method for high-efficiency, orotidine 50 -monophosphate decarboxylase.
site-directed mutagenesis. BioTechniques Proc Natl Acad Sci U S A 97:2005–2010.
13:214–220 [Link]
28. Zhao K, Chai X, Marmorstein R (2004) Struc- 32. Boeke JD, Trueheart J, Natsoulis G, Fink GR
ture and substrate binding properties of cobB, (1987) 5-Fluoroorotic acid as a selective agent
a Sir2 homolog protein deacetylase from in yeast molecular genetics. Methods Enzymol
Escherichia coli. J Mol Biol 337:731–741. 154:164–175
[Link]
INDEX
Arnaud Poterszman (ed.), Multiprotein Complexes: Methods and Protocols, Methods in Molecular Biology, vol. 2247,
[Link] © Springer Science+Business Media, LLC, part of Springer Nature 2021
339
MULTIPROTEIN COMPLEXES: METHODS AND PROTOCOLS
340 Index
Hybrid approaches ........................................................ 126 Protein interactions...........................................18, 39, 61,
Hydrogen/deuterium exchange ......................... 193–217 105, 126, 155, 156, 195, 288, 289, 291, 295,
296, 303
I Protein-protein interaction (PPI) ....................... 303, 304
Proteomics...........................................190, 193, 303–317
IgG................................................ 60, 62, 70, 73, 75, 101
Immunodiagnostics ........................................................ 79
R
Immunofluorescence .................................................... 288
Inhibitor .............................................................. 9, 11, 12, Recombinant antibodies ........................... 60, 66, 77–102
43, 60, 66, 105, 109, 115, 117, 260, 306, 307, Recombinant antibody formats...................................... 70
323, 324, 332 Research reagents .......................................................... 105
Restriction free (RF) .........................................18, 24, 32,
K 34, 35, 184, 186, 187
Kallikrein-related protease 7 (KLK7)......................60–62,
S
66, 69, 70, 75
Kinetics .............................................................. 59–62, 65, ScFv-Fc ........................................................ 60, 62, 70, 73
70, 73, 75, 138, 140, 145–153, 159, 160, 168, Secretory expression........................................................ 78
217, 275 Sedimentation coefficients.................................. 156, 160,
162, 163, 169
L Sedimentation velocity (SV) ................................... 79, 85,
91, 155–164, 168
Lysine deacetylases ............................................... 319–335
Sequence and ligation independent cloning
M (SLIC) .................................................... 18, 23–25,
30, 32, 34, 55, 62
Mammalian target of rapamycin (mTOR).......... 287, 288 Single-chain variable fragment format
Membrane protein complexes ........................... 3–15, 190 (scFv).............................................. 60, 61, 63, 102
Membrane proteins................................................. 3, 4, 6, Single-molecule localization microscopy
7, 77, 78, 189, 223, 245, 257–267 (SMLM)................................................... 271, 272,
Microcalorimetry........................................................... 130 275, 277–279, 281, 283
Modelling restraints .................................... 221, 224, 235 Single particle electron microscopy ............................. 244
Multiprotein complexes ............................ 17–37, 39, 189 Size exclusion chromatography (SEC) .................. 10, 13,
15, 89, 93, 99, 127, 133, 156, 161, 162, 164,
N
181–183, 259, 266, 267
Native-PAGE................................................259–261, 265 Solubilization .............................................................9, 12,
Negative stain electron microscopy ............................. 245 257–259, 261–263, 266
Non-canonical amino acids .......................................... 319 Stabilization ....................................................84, 257–267
Non-covalent mass spectrometry ............... 173, 174, 181 Stoichiometries..................................................6, 61, 126,
Non-homologous endjoining (NHEJ)............... 126, 127 127, 133, 135, 136, 140, 141, 156, 173, 174,
Nucleo-protein complexes............................................ 125 181, 222, 224, 230, 233, 236, 272, 283
Structural mass spectrometry ............................. 174, 193,
O 194, 209, 221–223, 239
Subcomplexes .............................................. 226, 229, 238
Oligomeric states.................................184, 185, 247, 259
Super-resolution microscopy ............................... 126, 271
P SwitchSENSE technology ................................... 145, 146