100% found this document useful (1 vote)
72 views23 pages

MCQs for M.Sc. Microbiology Exam

This document contains 55 multiple choice questions about molecular biology and genetics concepts. The questions cover topics like the structure of DNA, DNA replication, transcription, translation, and genetic mutations. They assess understanding of foundational ideas in molecular biology including the base pairing rules, components of DNA/RNA, DNA replication enzymes, and the genetic code.
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
100% found this document useful (1 vote)
72 views23 pages

MCQs for M.Sc. Microbiology Exam

This document contains 55 multiple choice questions about molecular biology and genetics concepts. The questions cover topics like the structure of DNA, DNA replication, transcription, translation, and genetic mutations. They assess understanding of foundational ideas in molecular biology including the base pairing rules, components of DNA/RNA, DNA replication enzymes, and the genetic code.
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

 HO ME

 ABOUT
 C O NT A C T
 P U B LI C A T IO NS
 D O WNLO A D S
 SIGN IN

 C O MME NT S FE E D
 FU LL R S S FE E D

Saturday, July 7, 2012


MCQ-Molecular Biology and Genetics

MULTIPLE CHOICE QUESTIONS FOR [Link]. MICROBIOLOGY ENTRANCE EXAM PREPARATION,


TU, 2012
(SUBJECT: MOLECULAR BIOLOGY/GENETICS)

1. The scientists who proposed 3D model of DNA


a. Rosaline Frankline
b. James Watson
c. Francis crick
d. Frederick Sanger
2. Who first discovered Nucleic acid?
a. Friedrich Miescher
b. P. A. Levene
c. Erwin Chargaff
d. Tatum
3. One complete turn of DNA molecules have ………………..base pairing with
…………………diameter.
a. 10 base pairing and 10 nm
b. 12 base pairing and 6 nm
c. 10 base pairing and 34 nm
d. One base pairing and 3.4 nm
4. Which of the following forces stabilize the DNA double helix structure?
a. Hydrogen bonds between complementary bases
b. Stacking interactions between bases
c. Super-coiling structure
d. All
5. Which of the following best describes the arrangement of the sides of the DNA molecule?
a. twisted
b. antiparallel
c. super coiling
d. alternating
6. If a DNA molecule is found to be composed of 40% thymine, what percentage of guanine would
be expected.
a. 10%
b. 20%
c. 40%
d. 80%
7. The enzymes that break hydrogen bonds and unwind DNA are:
a. primers
b. forks
c. helicases
d. polymerases
8. Okasaki fragments occur during……………… on ………………………strand.
a. Transformation and ss RNA
b. Replication and lagging
c. polymerase reaction and amplifying DNA
d. Synthesis and leading
9. Which of the following must happen first in order for DNA replication to occur?
a. DNA polymerase binds to the leading strand
b. DNA is unwound
c. Hydrogen bonds form between bases
d. chromosomes condense
10. Which of the following is required for DNA replication to occur?
a. DNA helicase
b. DNA ligase
c. DNA polymerase
d. all of these
11. DNA replication results in:
a. 2 completely new DNA molecules
b. 2 DNA molecules that each contain a strand of the original
c. 1 new DNA molecule, 1 old molecule is conserved
d. 1 new molecule of RNA
12. During replication, what enzyme adds complimentary bases?
a. helicase
b. synthesase
c. replicase
d. polymerase
13. Which one polymerase synthesize DNA molecule in Replication?
a. Polymerase I
b. Polymerase II
c. Polymerase III
d. All
14. Which one of the following choices best completes about the histones:
a. Are basic proteins rich in lysine and or arginine
b. Are bound covalently attached to DNA
c. Are found in high concentration in ribosomes
d. Are identical to protamines
15. One class of RNA characteristically contains unusual purines and pyridines is
a. tRNA
b. mRNA
c. rRNA
d. 16S RNA
16. Which of the following statements about mRNA is, are correct?
a. mRNA exists as single stranded molecule.
b. mRNA has a 7’-methylguanosine “cap” at its 5’ end.
c. mRNA has a 3’-poly-A sequence.
d. All of the above
17. Which one of the following choices best completes about tRNA?
a. Is the largest of the RNA species
b. Has little or no secondary structure
c. Must exist in at least 20 different forms, one for each amino acid
d. Exists in cytosol associated with histones
18. Which one of the following molecule is not a component of the 30S initiation complex?
a. GTP
b. Initiation factor 2 (IF2)
c. mRNA
d. ATP
19. The genetic code
a. Is degenerate in that many triplets code for more than one amino acid
b. Is read in the direction 3’-5’
c. Triplet CCA is found at the beginning of nearly all mRNA coding
d. Is generally referred to as universal
20. Which one of the following plasmid codes for the production of bacteriocins ?
a. F plasmid
b. R plasmid
c. Col-plasmid
d. Virulence plasmid
21. The plaque forming lamda virus is
a. A lytic virus
b. A lysogenic virus
c. A template virus
d. None
22. The mechanism of tetracycline is to inhibit translation process by
a. Blocking the binding of aminoacyl tRNA to A-site of ribosome
b. Blocking initiation of RNA chains by binding to RNA polymerase
c. Binding DNA to block the movement of RNA polymerase
d. Preventing the transition from initiation complex to chain elongating ribosome/miscoding
23. One of the following statement best describes about the Hfr positive cell in conjugation.
a. It is a recipient cell
b. It is a fertile as a chromosomal segment of it is transferred to F- cell
c. It has high frequency of recombination
d. All
24. Short RNA primers required for DNA replication is synthesized by
a. DNA primase
b. DNA ligase
c. DNA helicase
d. DNA gyrase
25. Transcription results in:
a. an amino acid chain
b. messenger RNA
c. complementary DNA
d. okazaki fragments
26. A stretch of chromosome that codes for a trait can be called a(n):
a. chromatid
b. replication fork
c. gene
d. base-pair
27. In RNA, _____ codon(s) translate to ______ amino acid(s)
a. 1, 1
b. 3, 1
c. 3, 3
d. 1, 20
28. Translation begins:
a. at the replication fork
b. on the lagging strand
c. at the start codon
d. in the nucleus
29. A nucleotide consists of:
a. a phosphate and a base
b. a phosphate, and a sugar
c. a base and an amino acid
d. a phosphate, a sugar, and a base
30. The sugar in RNA is _____, the sugar in DNA is _______.
a. deoxyribose, ribose
b. ribose, deoxyribose
c. ribose, phosphate
d. ribose, uracil

31. The diploid cells of an animal have 44 chromosomes. How many chromosomes would you expect
to find in the animal’s sperm cells?
a. 22
b. 44
c. 88
d. 2
32. Down’s Syndome occurs when an invidual has:
a. an extra chromosome 21
b. a missing chromosome
c. an extra set of homologs
d. haploid cells
33. After examining a karyotype of an animal, a researcher counts 50 individual chromosomes of
varying sizes. How many homologs are in the karyotype?
a. 25
b. 50
c. 100
d. 200
34. Chromosomes are paired together based on their:
a. size
b. banding pattern
c. centromere location
d. all of these
35. Chromosomes line up on the equator during:
a. anaphase
b. telophase
c. metaphase
d. interphase
36. The purpose of mitosis is to:
a. create new cells
b. copy DNA
c. cellular repair
d. reproduction
37. What did Frederick Griffith’s discover?
a. DNA carried genetic information
b. bacteria could transform
c. mice died when exposed to viruses
d. viruses were encapsulated
38. What was the overall conclusion of the hershey-chase experiment?
a. DNA was responsible for heredity
b. proteins and DNA were responsible for heredity
c. the ratio of Adenine to thymine was always the same
d. phage DNA was similar to bacterial DNA
39. The 5′ and 3′ numbers are related to the:
a. length of the DNA strand
b. carbon rings in sugar
c. the number of phosphates
d. the base pair rule
40. A nucleoside consists of:
a. a nitrogen base
b. a nitrogen base and a sugar
c. a nitrogen base, sugar, and phosphate
d. two nitrogen bases, a sugar, and a phosphate
41. The element that transformed the bacteria in Griffith’s experiments was:
a. protein
b. capsules
c. DNA
d. Heat
42. The “rungs” of the DNA ladder are made of:
a. phosphates & bases
b. sugars
c. sugars & phosphates
d. bases
43. In order to transform to a virulent form of bacteria, non encapsulated bacteria must:
a. Divide
b. be exposed to killed capsulated bacteria
c. be exposed to radioactive phosphorous
d. infect a host
44. A DNA strand has the following bases: A A G C C A. What are the bases on its complimentary
strand?
a. AAGCCA
b. ACCGAA
c. TTCGGT
d. CCATTC
45. RNA is synthesized on a DNA template in a process called ______, which utilizes the enzyme
_______.
a. translation, RNA polymerase
b. transcription, DNA polymerase
c. transcription, RNA polymerase
d. replication, DNA polymerase
47. Which of the following is NOT a necessary component of translation?
a. Anticodon
b. mRNA
c. Ligase
d. amino acid
48. Given the following DNA strand, which of the following is its complementary mRNA?
GGACTGATT
a. CCTGACTAA
b. CCUGACUAA
c. GGACTGATT
d. TTAGTCAGG
49. Amino acids are joined together into a protein chain by which of the following?
a. transfer RNA
b. DNA polymerase
c. hydrogen bonds
d. messenger RNA
50. Proteins contain ____ different amino acids, whereas DNA and RNA are composed of ___
different nucleotides.
a. 20, 64
b. 3, 20
c. 4, 20
d. 20, 4
51. The base pair rules states that:
a. Replication is semiconservative
b. A pairs with T, G pairs with C
c. DNA is a double helix held together by hydrogen bonds
d. A pairs with G, T pairs with C
52. Once transcription has been completed, which of the following is NOT necessary for protein
synthesis to occur?
a. tRNA
b. ribosomes
c. mRNA
d. DNA
53. Which site of the tRNA molecule binds to the mRNA molecule?
a. Anticodon
b. Codon
c. amino acid
d. 5 prime end
54. Okazaki fragments occur on the ___ and are bonded together by ______.
a. leading strand, polymerase
b. mRNA, anticodons
c. lagging strand, ligase
d. tRNA, polymerase
55. How many different codons are possible?
a. 3
b. 20
c. 64
d. an infinite number
56. The prokaryotic ribosome is of 70S type which is composed of subunits:
a. 50S and 30S
b. 40S and 60S
c. 5S, 23S, and 33 polypeptides, 16S and 21 polypeptides
d. All
57. The role of RNA polymerase I is to transcribe genes of:
a. 5.8S, 18S and 28S rRNA genes
b. All protein-coding genes plu s coRNA genes and some snRNA genes
c. tRNA genes, 5S rRNA genes, some snRNA genes and genes for other small RNAs
d. none of the above
58. Recognition and attachment of correct amino acids in tRNA during translation depends on the
enzyme:
a. Reverse transcriptase
b. Aminoacyl tRNA synthetases
c. RNA polymerase
d. Spliceosome
59. The RNA message is decoded on
a. Ribosomes
b. tRNAs
c. mRNAs
d. small RNAs
60. The chain termination codons in translation is/are
a. AUG
b. UAA
c. UAG
d. UGA
61. AUG, an intiation codon in translation codes for an amino acid
a. Methionine
b. Arginine
c. Tyrosine
d. Glycine
62. The mutation caused due to long time exposure on UV light is
a. Spontaneous mutation
b. Induced mutation
c. Both
d. None
62. Which scientists established that EcoRI could generate staggered or “sticky” ends?
a. Berg and Jackson

b. Mertz and Davis


c. Cohen and Boyer
d. Helling and Chang

63. pBR322 is a plasmid vector

a. commoly used in molecular cloning


b. capable of conjugal transfer
c. with tet gene
d. all of the above
64. pUC18 plasmid has marker gene

a. ampicillin resistant gene


b. tetracycline resistant gene
c. F factor
d. All of the above
65. T4 DNA ligase used in molecular cloning is

a. Encoded by gene 30 of bacteriophage T4


b. A monomeric protein of 487 amino acids
c. For joining inserted DNA into vector DNA
d. All
66. Fertility plasmid (F plasmid) is a circular DNA molecule of

a. 100 Kb
b. 200 Kb
c. 300 Kb
d. 400 Kb
67. The lamda virus has genomic DNA of molecular size

a. 48.5 Kb
b. 60 Kb
c. 80 Kb
d. 100 Kb
68. The following compound is used to precipitate DNA

a. SDS
b. Salt
c. Proteinase K
d. Ethanol
69. Competent cells for transformation are prepared by treating cells with

a. High concentrations of Lysozyme


b. High concentration of calcium chloride
c. High concentration of SDS
d. High concentration of sodium hydroxide
70. Mutagenic agent hydroxylamine reacts with

a. Adenine
b. Guanine
c. Cytocine
d. Thymine
71. Mutation resulting from replacement of purine from one strand of DNA with the other purine and
vice versa (Pyrimidine) is………………………mutation.

a. Transversion M
b. Transition M
c. Frameshift M
d. Deletion M
72. Which one of the following is/are point mutation?

a. Transversion M
b. Transition M
c. Frameshift M
d. All
73. RNA polymerase is composed of two  subunits, one  subunit, one  subunit and one
sigma  subunit. Which one subunit (factor) is involved in initiation of transcription?

a.  subunit
b.  subunit
c.  subunit
d.  subunit
74. The termination factor of transcription is

a. Rho factor
b. G:C riched region followed by six or more A:T base pairs
c. Sigma factor
d. All of the above
75. The excision of introns sequences from primary transcripts is required before translation. It is
done by

a. Restriction endonucleases
b. DNA gyrase
c. RNA polymerase
d. RNA splicing
76. Gene expression in prokaryotes is regulated at …………levels.

a. Transcription
b. mRNA processing
c. mRNA turnover/translation/post-translation
d. All of the above
77. The operon model, a negative control mechanism was developed in 1961 by

a. Griffith
b. Jacob and Monod
c. Zinder and Lederberg
d. Lederberg and Tatum
78. The three structural genes in lac operon, lacZ, lacy and lacA encoding the enzymes

a.  galactoside permease,  galactosidase and  galactoside tranacetylase


b.  galactoside tranacetylase,  galactoside permease and galactosidase
c.  galactosidase,  galactoside permease and  galactoside tranacetylase
d. Only  galactosidase
79. Which one of the following is /are catalytic ribozymes?

a. Messenger RNA
b. tRNA
c. Ribosomes
d. Spliceosomes
80. An example of a restriction enzyme that gives a blunt end cut is:
a. SmaI
b. BamHI
c. TaqI
d. EcoRI
81. Which active enzyme is present in bacteria that give blue colony in the presence of X-gal?
a. Ampicillin resistance
b. Tetracycline resistance
c. Permease
d. β-galactosidase
82. A multiple cloning site
ortant for chromosomal DNA
ns many restriction enzyme and recognition sites
called alpha-complementation
as a probe in Southern blots
83. Choramphenicol reisistant gene of bacterial plasmid is responsible for
a. inhibition of bacterial cell wall synthesis
b. binding to 30S subunit of ribosome
c. binding to 50S subunit of ribosome
d. inhibition of glycolysis pathway
84. What is the function of tra genes in bacteria?
a. production of bacteriocins
b. resist to antibiotics
c. helps in conjugation
d. cause pathogenecity in bacteria
85. pUC19 plasmid vector contains one of the following selectable marker gene
a. kanR
b. ampR
c. tetR
d. tra genes
86. In the lysogenic pathway the bacteriophage genome
a. Is not integrated into the host genome
b. Is integrated into the host genome
c. Results in bacterial lysis
d. Contain cohesive termini
87. Arrange the following vectors in ascending order in terms of size of possible inserts:
a. BACs, cosmids, plasmids, bacteriophage
b. Cosmids, bacteriophage, plasmids, BACs
c. Plasmids, bacteriophage, cosmids, BACs
d. Bacteriophage, BACs, plasmids, cosmids
88. The first eukaryote-infecting virus used for cloning was:
a. HIV
b. SV40
c. Adenovirus
d. Lambda phage
89. A cDNA library:
a. Contains information related to gene regulation
b. Is of the same size as genomic library
c. Represents those genes expressed in a particular tissue at a particular time
d. Represents the entire genome of the organism
90. A nylon membrane is used for Southern blots because
a. Agarose gels are fragile
b. Probes cannot be visualized in agarose
c. DNA cannot be denatured in agarose
d. Agarose gels do not efficiently separate DNA fragments
91. Dideoxyribonucleotides differ from deoxyribonucleotides because an additional hydroxyl group is
missing from position
a. 5’
b. 1’
c. 2’
d. 3’
92. What is the annealing temperature for the following 21 mer primer?
AAGCTTGTCCAGAATTTCGAT
a. 58C
b. 62C
c. 54C
d. 50C
93. Which one of following is the recognization site for HindIII enzyme
a. 5'GGCC
3'CCGG
b. 5'GAATTA
3'CTTAAT
c. 5'GGATCC
3'CCTAGG
d. 5'AAGCTT
3'TTCGAA
94. Which one of following is the recognization site for EcoRI enzyme
a. 5'GGCC
3'CCGG
b. 5'GAATTC
3'CTTAAG
c. 5'GGATCC
3'CCTAGG
d. 5'AAGCTT
3'TTCGAA
95. How many bands would you obtain when DNA is cut by EcoRI and HindIII ?
a. 6
b. 8
c. 10
d. 12
96. Cancer, a type of genetic disorder is due to mutation in
a. Single gene
b. Multi gene
c. Mitochondrial DNA
d. Chromosome
97. The genetic disorder Huntington’s disease is caused due to defect in:-
a. Chromosome 16
b. Chromosome 20
c. Y chromosome
d. Chromosome
98. Which one of the following statement about randomly amplification of polymorphic DNA is not
true?
a. RAPD sequences are used to detect Variability in the PCR priming site.
b. Banding patterns of amplified product is not same for every individual in a pop
c. RAPQ methods do not distinguish between homozygous & heterozygous allele states
d. RAPD method is useful to distinguish between homozygous & heterozygous allele states.
99. Methodology for southern blot hybridization include:-
a. Gel electrophoresis of DNA fragments
b. Restriction Digestion
c. Hybridization
d. all of the above
100. Which one of the following histones most strongly binds to DNA?
a. H1
b. H5
c. H3B
d. ALL

***Good Luck***

Posted by Upendra THAPA SHRESTHA at 10:44 PM


Labels: Based on TU syllabus ([Link]. Microbiology)
1 comments:

Scitech Central said...

Journal of Genetics and Molecular Biology Research is an international peer reviewed journal strives to publish high

quality articles on emerging developments and supports current research in the field of genetics and molecular

[Link] - Journal of Genetics and Molecular Biology Research

October 25, 2016 at 4:44 AM

Post a Comment

Newer PostOlder PostHome

Bacteria in Photos

Search this Blog

Blog Archive

 ► 2017 (14)

 ► 2016 (26)

 ► 2015 (21)

 ► 2014 (23)
 ► 2013 (28)

 ▼ 2012 (27)

o ► December (5)

o ► November (2)

o ► October (2)

o ► September (2)

o ► August (2)

o ▼ July (4)

 GEL-DOC SYSTEM

 General Microbiology Multiple Choice Questions

 MCQ-Molecular Biology and Genetics

 MULTIPLE CHOICE QUESTIONS FOR [Link]. MICROBIOLOGY E...

o ► June (2)

o ► May (1)

o ► April (2)

o ► March (2)

o ► February (2)

o ► January (1)

 ► 2011 (16)

 ► 2010 (35)

 ► 2009 (19)

 ► 2008 (6)

 ► 2007 (9)

My Web Visitors

Staphylococcus aureus in Nutrient Agar


Secondary screening for Antibiosis

Zone of inhibition from different extracts

Coagulase Test

Novel Actinomycetes from Khumbu Region

Primary Screening for Antibiosis


Test organisms inhibited by Actinomycetes

3D STRUCTURE OF DELTA ENDOTOXIN

Delta Endotoxin - The Crystal Protein

Methanogens Isolation

Starting of my research with Bacillus thuringiensis endotoxin

Delta Endotoxin-The Insecticidal Crystal Protein


Vibrio parahaemolyticus on TCBS agar

Chryseobacterium indologenes on Mueller-Hinton agar

Staph. aureus in Mc conkey Agar

Staph. aureus in Blood Agar


Antibiosis

Staph. aureus in Chocolate Agar

About Me

UPENDRA THAPA SHRESTHA

Life member: Nepalese Society of Microbiology, Global Outreach Member: American Society of Microbiology, TIRI-

Scholar: USAID

VIEW MY COMPLETE PROFILE

Loading...

B. S. - 2070
HAPPY NEWYEAR ----- 2013 -----

MICROBES

MANUAL

Environmental Practical Manual

IMPORTANT WEBSITES

 RESEARCH GATE
 CRSP-TIRI

 ASM

 Revised GRE

 MOLECULAR BIOLOGY

 NCBI-Bioinformatics

 HIV-AIDS

 BACTERIOLOGY

 BIOSTATISTICS

 MICROBIOLOGY

 MEDICAL VIROLOGY

 MEDICAL-BIOCHEMISTRY

 MICROBIOLOGY & IMMUNOLOGY

 BIOLOGY OF MICROORGANISMS

 MICROSCOPY

 USC Biochemistry

 RLABB

 MISAN

 MICROBIAL WORLD

2009 All Rights Reserved My Scientific Blog - Research and Articles.

You might also like