0% found this document useful (0 votes)
70 views166 pages

Protocol

Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
70 views166 pages

Protocol

Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

PREFACE

DNA Lab protocols is a book designed for young


scientists and research scholar in order to acquaint them
with the basic techniques involved in DNA and Genetic
including: DNA isolation, DNA Finger printing, PCR
and do It your self-techniques. The purpose of this book
is to serve a guide for student young scientists and
research scholar aiming to adopt a research as a career.
Each chapter intend to describe the protocol of DNA lab
work. This book will allow the readers to have a better
understanding of Genetic protocols with a comparative
point of view.
This book would not have been possible without hard work,
efforts and contributions of my dearest sister Rida Zainab
How to Micropipette
Micropipette:
A pipette is a laboratory instrument. Used in chemistry, biology to take a
measured volume of liquid.

How to Use a Micropipette:


 Press a micropipette and clasp the plunger down
 Adjust the volume
 Position a tip on micropipette

 Push thumb plunger down to Desired Measurement and immerse tip far
enough into product for the betterment
 Throwaway the tip

References:
1. "Biotechnology Outreach". Retrieved 3 March [Link], M (2005). "When a
common problem meets an ingenious mind". EMBO Rep. 6 (9): 797–800.
doi:10.1038/[Link].7400520. PMC 1369176. PMID 16138087.
2. Zinnen, Tom (June 2004), The Micropipette Story, retrieved November 12, 2011
3. Shohl, Alfred T. (February 1928). "A Pipet for Micro-Analyses". Journal of the American
Chemical Society. 50 (2): 417. doi:10.1021/ja01389a502.
4. Ainla, Alar; Jansson, Erik T.; Stepanyants, Natalia; Orwar, Owe; Jesorka, Aldo (June
2010). "A Microfluidic Pipette for Single-Cell Pharmacology". Analytical Chemistry. 82
(11): 4529–4536. doi:10.1021/ac100480f. PMID 20443547.
5. Motorized Pipette Controllers | Motorized Controller | [Link]".
[Link].
6. Aimee Cunningham (2007-04-18). "A New Low: Lilliputian pipette releases tiniest
drops". Science News. Vol. 171. pp. 244–245
7. "Pipette Confidently with PipetteRite – Control the Immersion Depth, Steady Your
Hand, and Improve Ergonomics". hands-free use of pipettes, August 2012, retr
8. "Micro Pipette Calibration – Accumaximum". Archived from the original on 30 June
2013. Retrieved 3 March 2016.
9. Ovation Ergonomic Pipettes generate ideal pipetting posture". Archived from the
original on 3 March 2016. Retrieved 3 March 2016
10. electronic pipette made smart through connectivity, April 2019, retrieved April 11,
2019
[DNA Extraction]
DNA Extraction protocol:
Reagents:
 lysis buffer: 1% SDS, 0.5 M NaCl
 isopropanol

 70% (v/v) ethanol

 Collect the cells for DNA extraction into 2 ml tubes.

STEP OF DNA EXTRACTION:


 Put-on 1ml of cell suspension into 2 ml tubes
 Put-on 100 mg of 0.5 mm glass beads and the vortex throughout 15 min
 Rotate the cell suspension at high speed for 1 min using a centrifuge
 Throwaway supernatant and in 1000 μl of the lysis buffer
 Rotate at high speed for 1 min and shift the supernatant into a new 2ml
tube
 Put-on 500 μl of isopropanol and mix softly
 Place the blend on ice for 5 min.
 Rotate at high speed 1min
 Throwaway the supernatant and wash the DNA pellet with 500 μl 70%
(v/v) ethanol.
 Rotate again at high speed during 1 min.
 Throwaway the supernatant.
 Let the pellet air-dry, placing the 2 ml tubes upturn in a paper-towel.
 liquefy the DNA in 50 μl ultrapure DEPC H2
 Use the Nano drop apparatus to entrance DNA concentration and quality

References:
1. Gupta, Nalini (2019). "DNA extraction and polymerase chain reaction". Journal of
Cytology. 36 (2): 116. doi:10.4103/JOC.JOC_110_18. ISSN 0970-9371. PMC 6425773.
PMID 30992648.
2. DNA Extraction - an overview | ScienceDirect Topics". [Link]. Retrieved
2023-01-27.
3. Dehasque, Marianne; Pečnerová, Patrícia; Kempe Lagerholm, Vendela; Ersmark, Erik;
Danilov, Gleb K.; Mortensen, Peter; Vartanyan, Sergey; Dalén, Love (2022-04-13).
"Development and Optimization of a Silica Column-Based Extraction Protocol for Ancient
DNA". Genes. 13 (4): 687. doi:10.3390/genes13040687. ISSN 2073-4425. PMC 9032354.
PMID 35456493.
4. Yoshikawa H, Dogruman-Al F, Dogruman-Ai F, Turk S, Kustimur S, Balaban N, Sultan N
(October 2011). "Evaluation of DNA extraction kits for molecular diagnosis of human
Blastocystis subtypes from fecal samples". Parasitology Research. 109 (4): 1045–50.
doi:10.1007/s00436-011-2342-3. PMID 21499752. S2CID 37191780
5. Fahle, Gary A.; Fischer, Steven H. (October 2000). "Comparison of Six Commercial DNA
Extraction Kits for Recovery of Cytomegalovirus DNA from Spiked Human Specimens".
Journal of Clinical Microbiology. 38 (10): 3860–3863. doi:10.1128/JCM.38.10.3860-
3863.2000. ISSN 0095-1137
6. Elkins KM (2013). "DNA Extraction". Forensic DNA Biology. pp. 39–52.
doi:10.1016/B978-0-12-394585-3.00004-3. ISBN 9780123945853.

7. Marmur, J. (1961). "A procedure for the isolation of deoxyribonucleic acid from micro-
organisms". Journal of Molecular Biology. 3 (2): 208–IN1. doi:10.1016/S0022-
2836(61)80047-8.
8. Li, Richard (11 March 2015). Forensic biology (2nd ed.). Boca Raton. ISBN 978-
1439889725. OCLC 907517669.
9. "Fluorescence In Situ Hybridization (FISH)". [Link]. Retrieved 2022-10-23
10. Butler JM (2005). Forensic DNA typing : biology, technology, and genetics of STR markers
(2nd ed.). Amsterdam: Elsevier Academic Press. ISBN 9780080470610. OCLC 123448124.

[DNA isolation by saline mouthwash]


DNA isolation by saline mouthwash:
Procedure:
 Stream 10 ml of the saline solution (0.9% NaCl) into the mouth and
strongly swish for 30s
 Remove saline solution into a paper cup
 Whirl to mix cells in the cup and use a micropipette to shift 1 ml of the
liquid to 1.5-ml tube.
 Centrifuge for 1m
 Carefully stream off supernatant into the paper cup
 Use a micropipette to remove 30 µl of cell suspension
 Add to a tube containing 100 µl of Chelex.
 Boil sample for 10 minutes
 Centrifuge for 1m
 Utilize a micropipette to shift 30 µl of supernatant to clean 1.5-ml tube

References:
1. Pääbo S (March 1989). "Ancient DNA: extraction, characterization, molecular cloning, and
enzymatic amplification". Proceedings of the National Academy of Sciences of the United
States of America. 86 (6): 1939–43. Bibcode:1989PNAS...86.1939P.

2. Li, Zhigang; Parris, Stephen; Saski, Christopher A. (2020). "A simple plant high-molecular-
weight DNA extraction method suitable for single-molecule technologies". Plant Methods. 16:
38. doi:10.1186/s13007-020-00579-4. ISSN 1746-4811. PMC 7071634. PMID 32190102. CC BY
[Link] Text was copied from this source, which is available under a Creative Commons
Attribution 4.0 International License.
3. Coudy, Delphine; Colotte, Marthe; Luis, Aurélie; Tuffet, Sophie; Bonnet, Jacques (2021-11-11).
Xu, Jian (ed.). "Long term conservation of DNA at ambient temperature. Implications for DNA
data storage". PLOS ONE. 16 (11): e0259868. doi:10.1371/[Link].0259868. ISSN 1932-
6203. PMC 8585539. PMID 34763344.
4. Appendix S2: DNA extraction method and DNA quality". [Link]. Retrieved 2023-01-27.
5. Fuchs, Florence (2002-11-01). "Quality control of biotechnology-derived vaccines: technical
and regulatory considerations". Biochimie. 84 (11): 1173–1179. doi:10.1016/S0300-
9084(02)00028-7. ISSN 0300-9084.

[Isolation of highly degraded DNA


from ancient bones and teeth]
Isolation of highly degraded DNA from ancient bones
and teeth:
Buffer Preparation:
 Isolation Buffer(10ml):

H2O 745 μL
EDTA (0.5M) 9 mL
Proteinase K (10mg\mL) 250 μL
Tween-20 5 μL

Restricting Buffer:
 Restricting Buffer(50mL):

GuHCl (5 M) 23.88 g
Water 30 mL.
isopropanol 20 mL
Tween-20. 25 μL

Sample Preparation:
 Gather 10–150 mg powdered (grind) sample in a 2 mL tube.
 Put-on 1 mL of extraction buffer and Mix gently by vertexing
 Incubate at 37°C for 16-24h

DNA RESTRICTION:
 For each sample along control, shift approximately 10 mL of
restriction buffer to a tagged 15 mL tube, put-on (400 μL 3M) sodium
acetate.
 Centrifuge samples for 2 min
 Shift supernatant to the 15 mL tube carrying a restriction buffer. Mix
well by shaking.
 Stream the restriction buffer mixture into the reservoir of the spin-
column assembly, cover the 50 mL tube with a screw cap
 Centrifuge at 400g for 4min
 Spin tubes 90°
 Centrifuge again at 400g for 2min
 Discard the screw cap from the 50 mL tube, and shift the spin-column
assembly to a clean 2 mL tube and discard the extension reservoir.
 Close and tagged the spin-column cap
 Complete a dry spin at 3000g for 1min using benchtop centrifuge
 Remove any flow-through.
 Put-on 750 μL PE buffer to each column. centrifuge at 3000 for 30s
and Remove any flow-through
 Repeat step 13
 Complete a dry spin at 16,000 g for 1min
 Shift the column to a new 1.5 mL tube
 Put-on 50 μL TET buffer immediately on to the silica membrane.
keep sit for 5 min
 Centrifuge at maximum speed for 1 min
 Repeat steps 16 and 17 by shifting the eluate back on to the silica
membrane
 Shift the (final DNA extract) to a new 1.5 mL tube and stored at -
20°C

References:
1. Danielewski M, Żuraszek J, Zielińska A, Herzig KH, Słomski R, Walkowiak J, Wielgus
[Link] (Basel). 2023 Jan 16;14(1):234. doi: 10.3390/[Link]:
36672975
2. Šuligoj A, Mesesnel S, Leskovar T, Podovšovnik E, Zupanič Pajnič [Link] J Legal Med. 2022
Nov;136(6):1521-1539. doi: 10.1007/s00414-022-02881-3. Epub 2022 Sep [Link]:
36048257
3. Hyun JY, Kim TW, Pandey P, Kim KS, Jeong SJ, Kang JK, Kong DY, Jung SH, Jeong HK,
Han SH, Han SH, Lee [Link] Cells Syst (Seoul). 2022 Sep 20;26(5):214-222. doi:
10.1080/19768354.2022.2112755. eCollection [Link]: 36275447
4. Paszkiewicz, Konrad H.; Farbos, Audrey; O'Neill, Paul; Moore, Karen (2014). "Quality
control on the frontier". Frontiers in Genetics. 5. doi:10.3389/fgene.2014.00157. ISSN
1664-8021. PMC 4033843. PMID 24904650.
5. Coudy, Delphine; Colotte, Marthe; Luis, Aurélie; Tuffet, Sophie; Bonnet, Jacques (2021-11-
11). Xu, Jian (ed.). "Long term conservation of DNA at ambient temperature. Implications for
DNA data storage". PLOS ONE. 16 (11): e0259868. doi:10.1371/[Link].0259868. ISSN
1932-6203. PMC 8585539. PMID 34763344.
[Mitochondrial DNA isolation
protocol]
Mitochondrial DNA isolation protocol:
 Gather the cells 5 x 10^6 along with centrifugation at 600 x g for 5 min at
4ºC
 Clean cells with 5-10 ml of ice-cold Phosphate-buffered saline
 Centrifuge at 600 x g for 5 min at 4ºC
 Discard the supernatant
 Re-suspend cells in (1.0ml of 1X) cytosol isolation buffer
 Incubate for 10min within ice
 Homogenize cells in an ice-cold Dounce tissue blender. Process the task
with the blender on ice, 50 - 100 passes with the blender.
 Shift homogenate to a clean 1.5 ml micro centrifuge tube, centrifuge at
1200 x g for 10 min at 4ºC
 Shift supernatant to a clean 1.5 ml tube, centrifuge at 10,000 x g for 30 min
at 4ºC.
 Discard supernatant
 Re-suspend the pellet in 1ml 1X cystosol isolation buffer
 centrifuge at 10000 x g for 30min at 4ºC
 Discard the supernatant
 Lyse the mitochondria in 30µl of the mitochondria lysis buffer, remain on
ice for 10 min
 Put-on 5 µl lyophilized, Incubate at 50ºC water bath for 60min
 Put-on 100 µl entire ethanol next mix and remain at -20ºC for 10 min
 Micro centrifuge at maximum speed for 5min at room temperature
 Discard the supernatant.
 Wash the DNA pellet more than one time with 1 ml of 70 % ethanol.
 Discard the trace amount ethanol using a pipet tip.
 Air dry approximately for 5 min.
 Re-suspend the DNA using 20 µl TE buffer
 Store the DNA at -20ºC

References:
1. Graham [Link] Protoc Cell Biol. 2001 May;Chapter 3:Unit 3.3. doi:
10.1002/[Link]: 18228355

2. Wettmarshausen J, Perocchi [Link] Mol Biol. 2017;1567:15-32. doi: 10.1007/978-1-4939-


6824-4_2.PMID: 28276010

3. Franko A, Baris OR, Bergschneider E, von Toerne C, Hauck SM, Aichler M, Walch AK, Wurst W,
Wiesner RJ, Johnston IC, de Angelis [Link] One. 2013 Dec 12;8(12):e82392. doi:
10.1371/[Link].0082392. eCollection [Link]: 2434927

4. Boldogh IR, Pon [Link] Cell Biol. 2007;80:45-64. doi: 10.1016/S0091-679X(06)80002-


[Link]: 17445688

5. Islinger M, Wildgruber R, Völkl [Link]. 2018 Sep;39(18):2288-2299. doi:


10.1002/elps.201800187. Epub 2018 Jun [Link]: 29761848 Review.

[Isolation of genomic DNA from


mouse tails]
Isolation of genomic DNA from mouse tails protocol:
 Put a 0.5-1.5 cm mouse tail in a 1.5 ml Eppendorf tube and store frozen
until digestion
 To each tube, add 500 ml of tail prep solution in the following sequence:
 50 mM Tris-HCl (pH8.0)
 100 mM EDTA
 100 mM NaCl
 1% SDS
 0.5 mg Proteinase K/ml
 Digest at 55 °C overnight
 Cool sample on the ice
 Add 0.5 ml phenol, mix, and rotate12,000 rpm x 10m at room temperature
 shift the aqueous phase to a new Eppendorf tube
 Add 0.5 ml phenol: chloroform isoamyl alcohol mix, and rotate 12,000
rpm x 10m
 Repeat Step with 0.5 ml chloroform
 Shift the aqueous phase to a new Eppendorf tube, add equal volume 95%
ethanol. Lightly. Turnaround the tube several times to precipitate DNA.
 Centrifuge 10-15m at 12,000 rpm.
 Remove the supernatant
 wash a pellet with 70% ethanol
 Dry the pellet
 Re-suspend pellet in 200-400 ml TE.

References:

1. Zangala T. Isolation of genomic DNA from mouse tails. J Vis Exp. 2007;(6):246. doi:
10.3791/246. Epub 2007 Jul 29. PMID: 18997894; PMCID: PMC2557115.

2. Marmur, J. (1961). "A procedure for the isolation of deoxyribonucleic acid from micro-
organisms". Journal of Molecular Biology. 3 (2): 208–IN1. doi:10.1016/S0022-2836(61)80047-
8.

3. Appendix S2: DNA extraction method and DNA quality". [Link]. Retrieved 2023-01-27.

[ISOLATION OF DROSOPHILA
GENOMIC DNA PROTOCOL]
Isolation of Drosophila Genomic DNA protocol:
 Acquire 30 healthy, freshly flies freeze them at −80°C for 5 min.
 put-on 200 μL Buffer A and crush with tissue grinder round about 5min
 Put-on 200 μL Buffer A and continue to crush until only pieces of cuticle
remain. incubate at 65°C for 30min
 put-on 800 μL 1:2.5 [5 M]KOAc:[6 M] LiCl precipitate along the ice for
10 min. centrifuge at 14,000 rpm for 15 min
 Shift supernatant to 2 Eppendorf tubes observe volume in each tube
 Put-on 700 μL Isopropanol per mL supernatant. centrifuge at 14,000 rmp
for 15min, discard supernatant
 Washed with 1 mL cold ethanol
 centrifuge at 14,000 rpm for 5 min
 Discard the supernatant and resuspend in 100 μL TE.

References:
1. Identification of methylated sequences in genomic DNA of adult Drosophila
[Link] A, Fisher O, Siman-Tov R, Ankri [Link] Biophys Res Commun. 2004
Sep 17;322(2):465-9. doi: 10.1016/[Link]: 15325253
2. Brzobohatý B, Karlovská L, Vyskot B, Bezdĕk [Link] Biol (Praha). 1988;34(1):[Link]:
[Link] AV, Churikov [Link]. 1991 Sep;27(9):[Link]: 1778465
Russian.
3. Ashburner M, Bergman [Link] Res. 2005 Dec;15(12):1661-7. doi:
10.1101/[Link]: 16339363
4. Gibson [Link] Biol. 2003 Oct;1(1):E15. doi: 10.1371/[Link].0000015. Epub 2003 Oct
PMID: 14551912

[Chromosomal DNA isolation from


E. coli]
Chromosomal DNA isolation from E. coli: Materials:
 10% SDS
 Isopropanol
 Ethanol
 3 M NaOAc
 TE(1x)
Volume reagent final concentration
10 ml 1M Tris-HCl pH 7.5 or 8.0 10 mM
2 ml 0.5M EDTA pH 8.0 1 mM
988 ml ddH2O
 Killing Buffer
for 1 liter
2 ml 1M Tris-HCl pH 7.5
0.5 ml 1M MgCl2
1.3 g NaN3
997.5 ml ddH2O

Procedure:
 Develop a culture
 Mix specimen directly with ice cold Killing Buffer (ratio 1:1) and add on
ice
 Spin down cells 3 min
 Re-suspend in 300 μL TE
 Put-on 40 μL 10% SDS and 3 μL 0.5 M EDTA
 Incubate 5m at 65°C
 Put-on 750 μL isopropanol
 Spin at max speed 5 min and reject supernatant
 Re-suspend pellet in 500 μL TE and put-on 2 μL RNase A
 incubate for 30m at 65°C
 Put-on 2 μL proteinase K and incubate at 37°C for 15m
 Remove phenol
 precipitate whole night with 1 ml ethanol and 40 μL 3M Na-Acetate
 Turn down DNA at 4°C for a 15m, wash in 70% ethanol and re-suspend
pellet in 50 μLdH2

References

1. Blattner F R, et al. The complete genome sequence of Escherichia coli K-12. Science.
1997;277:1453–1474. [PubMed] [Google Scholar]

2. Carnevale S, Velasquez J N, Labbe J H, Chertcoff A, Cabrera M G, Rodriguez M I. Diagnosis of


Enterocytozoon bieneusi by PCR in stool samples eluted from filter paper disks. Clin Diagn Lab
Immunol. 2000;7:504–506. [PMC free article] [PubMed] [Google Scholar]
3. Fayer R, Lewis E J, Trout J M, Graczyk T K, Jenkins M C, Higgins J, Xiao L, Lal A A.
Cryptosporidium parvum detection in oysters from commercial harvesting sites in the
Chesapeake Bay. Emerg Infect Dis. 1999;5:706–710. [PMC free article] [PubMed] [Google
Scholar]

4. Fayer R, Trout J M, Graczyk T K, Lewis E J. Prevalence of Cryptosporidium, Giardia and Eimeria


infections in post-weaned and adult cattle on three Maryland farms. Vet Parasitol.
2000;93:103–112. [PubMed] [Google Scholar]

5. Hallier-Soulier S, Guillot E. Detection of cryptosporidia and Cryptosporidium parvum oocysts


in environmental water samples by immunomagnetic separation-polymerase chain reaction.
J Appl Microbiol. 2000;89:5–10. [PubMed] [Google Scholar]
6. Jenkins M C, Trout J M, Murphy C, Harp J A, Higgins J, Wergin W, Fayer R. Cloning and
expression of a DNA sequence encoding a 41-kilodalton Cryptosporidium parvum oocyst wall
protein. Clin Diagn Lab Immunol. 1999;6:912–920. [PMC free article] [PubMed] [Google
Scholar]

7. Kozwich D, Johansen K A, Landau K, Roehl C A, Woronoff S, Roehl P A. Development of a


novel, rapid integrated Cryptosporidium parvum detection assay. Appl Environ Microbiol.
2000;66:2711–2717. [PMC free article] [PubMed] [Google Scholar]

8. Sturbaum G D, Reed C, Hoover P J, Jost B H, Marshall M M, Sterling C R. Species-specific,


nested PCR-restriction fragment length polymorphism detection of single Cryptosporidium
parvum oocysts. Appl Environ Microbiol. 2001;67:2665–2668. [PMC free article] [PubMed]
[Google Scholar]

9. Orlandi P A, Lampel K A. Extraction-free, filter-based template preparation for rapid and


sensitive PCR detection of pathogenic parasitic protozoa. J Clin Microbiol. 2000;38:2271–
2277. [PMC free article] [PubMed] [Google Scholar]

[Plasmid DNA extraction protocol]


Plasmid DNA extraction protocol:
Regents:
 Re-suspension buffer (50 mM Tris HCl, pH 8, 10 mM EDTA, 100 µg/ml
RNase A)
 Lysis buffer (0.2 N NaOH, 1% SDS)
 Neutralization buffer (3/5 M Potassium acetate, pH 6)
 Isopropanol
 Wash buffer (70% Ethanol)
 Elution buffer (water or TE buffer- 10 mM Tris, pH 8, 1 mM EDTA)

Procedure:
 Culture E. coli with plasmid in LB media with anti-infection separating
pressure, entire near on a shaker at 37°C
 Pellet 1.5 ml of bacterial culture in a microfuge tube by centrifuging for 2
minutes justly. 10,000 rpm.
 Decant the supernatant and put-on 200 µl of the resuspension buffer. In
organization to resuspend the pellet you may have to vortex.
 Put-on 250 µl of the lysis buffer, upturn the tube 10 times to mix
rigorously. The solution should become clear and viscous.
 Put-on 350 µl of the neutralization buffer, upturn the tube 10 times or till a
precipitate form. The precipitate is a mixture of protein and chromosomal
DNA.
 Centrifuge the tube for 10 minutes at 10,000 rpm. Shift the supernatant to a
microfuge tube and add 0.7 isopropanol. Incubate justly -20°C for 15
minutes
 Shift the solution to a spin column.
 Centrifuge the spin column for 1 minute at 7,000 rpm. throwaway the flow
through
 Put-on 400 µl of the wash buffer and centrifuge for 1 minute at 7,000 rpm.
Throw away the flow through. Repeat this step.
 Centrifuge for an added 2 minutes at 10,000 rpm to remove the remaining
wash buffer.
 Shift the column to a clean microfuge tube. Put-on 50 µl of elution buffer
and centrifuge for 1 minute at 10,000 rpm.

References
1. Halary, S., Leigh, J. W., Cheaib, B., Lopez, P., and Bapteste, E. (2010). Network analyses
structure genetic diversity in independent genetic worlds. Proc. Natl. Acad. Sci. U.S.A. 107,
127–132. doi: 10.1073/pnas.0908978107

2. Dib, J. R., Wagenknecht, M., Farías, M. E., and Meinhardt, F. (2015). Strategies and approaches
in plasmidome studies—uncovering plasmid diversity disregarding of linear elements? Front.
Microbiol. 6:463. doi: 10.3389/fmicb.2015.00463
3. De Toro, M., Garcillán-Barcia, M. P., and De La Cruz, F. (2014). Plasmid diversity and
adaptation analyzed by massive sequencing of Escherichia coli plasmids. Microb. Spectr. 2,
219–235. doi: 10.1128/[Link]-0031-2014

4. Birnboim, H. C., and Doly, J. (1979). A rapid alkaline extraction procedure for screening
recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523.

5. Bennett, P. M. (2008). Plasmid encoded antibiotic resistance: acquisition and transfer of


antibiotic resistance genes in bacteria. Br. J. Pharmacol. 153, S347–S357. doi:
10.1038/[Link].0707607

6. Arredondo-Alonso, S., Willems, R. J., Van Schaik, W., and Schürch, A. C. (2017). On the (im)
possibility of reconstructing plasmids from whole genome short-read sequencing data.
Microb. Genom. 3:e000128. doi: 10.1099/mgen.0.000128

Isolation of Yeast Plasmid DNA


protocol:
 Gather cells along centrifugation for 5 min at 13,000 rpm
 Re-Suspend cells in 0.5 mL purify water.
 Shift cells to a 1.5 mL micro centrifuge tube and set them by a 5sec
centrifugation.
 Discharge the supernatant and vortex the tube for a short time to re-
suspend the pellet in residual liquid
 Put-on 0.2 mL lysis solution, and 0.2 mL phenol, chloroform,
isoamyl alcohol
 put-on 0.3 g acid-washed glass beads
 Vortex for 3,4 min to damage cells. Put-on 0.2 mL TE.
 Micro centrifuge for 5 min shift the aqueous layer to a new tube.
 put-on 1.0 mL 100% ethanol to precipitate the put-on 1.0 mL 100%
ethanol to precipitate the DNA. Invert the tube to blend.
 Micro centrifuge for 2 min Re-suspend the pellet along 0.4 mL TE
plus 30 μg RNase A incubate for 5,3 min at 37°C.
 Put-on 10 μL 4 M ammonium acetate plus 1.0 mL 100% ethanol.
Invert tube to blend and Set on ice for 10 min.
 Micro centrifuge for 2 min, air dry pellet and re-suspended in 50 μL
TE

References:
1. Orr-Weaver TL, Szostak JW, Rothstein [Link] Enzymol. 1983;101:228-45. doi:
10.1016/0076-6879(83)[Link]: 6310326

2. Gunn L, Nickoloff [Link] Biotechnol. 1995 Apr;3(2):79-84. doi: 10.1007/[Link]:


7620979

3. Gnügge R, Rudolf [Link]. 2017 May;34(5):205-221. doi: 10.1002/yea.3228. Epub 2017 Feb
[Link]: 28072905

[ENDO-FREE PLASMID MINI


KIT]
ENDO-FREE PLASMID MINI KIT:
 Inoculate 5 ml lb/ampicillin medium set in a 10-20 ml culture tube
with e. coli contain the desired plasmid and grow at 37 °c for 12-16
h.
 Pellet 1.5-5 ml bacteria in suitable vessels centrifugation at 10,000 x
g for 1 min
 Decant or aspirate medium and remove it. To the bacterial pellet put-
on 250 µL solution I/rnase A.
 Put-on 250 µL solution ii and mix softly to acquire a cleared lysate
 Put-on 125 µL ice-cold buffer n3 and mix softly by inverting tube
one is more than one time till a flocculent white precipitate form.
 Carefully aspirate and shift the supernatant to a new 1.5 ml centrifuge
tube.
 Put-on 0.1 volume of etr solution to the cleared lysate
 Incubate the lysate 42 °c for 5 min centrifuge 12,000xg for 3 min at
25 °c. The etr solution contains a blue layer at the surface of the tube
 Shift a cleared lysate into a new 1.5 ml tube and put- on 0.5 volume
of a total ethanol and softly mix by inverting tube 6-7 times.
 Shift 700 µL of the mixture into a clean hibindtm dna mini column
assembled in a 2 ml collection tube
 Remove the flow-through and load the remaining of the mixture
along the column, centrifuge as above. Remove the flow-through and
re-use the collection tube.
 Wash column using 500 µL buffer hb and centrifuge as above.
 Remove the flow-through liquid and wash the column by put-on 700
µL dna wash buffer diluted along with ethanol.
 Centrifuge As Above And Remove Flow-Through
 Repeat wash step along with another 700 µL DNA wash buffer
diluted with ethanol.
 Remove the flow-through liquid
 Set a column into a new 1.5 ml micro-centrifuge tube. put-on 30-50
µL endotoxin-free elution buffer, immediately onto the column
matrix and centrifuge 13,000 x g for 1 min to elute DNA.

References

1. Cheng L, Sun X, Yi X, Zhang [Link] Lett. 2011 Aug;33(8):1559-64. doi: 10.1007/s10529-


011-0612-x. Epub 2011 Apr [Link]: 21476094

2. O'Mahony K, Freitag R, Hilbrig F, Müller P, Schumacher I.J Biotechnol. 2005 Sep 23;119(2):118-
32. doi: 10.1016/[Link]: 15993505
3. Stadler J, Lemmens R, Nyhammar T.J Gene Med. 2004 Feb;6 Suppl 1:S54-66. doi:
10.1002/[Link]: 14978751

[Isolation of phage and


purification of phage DNA]
Isolation of phage protocol:

 Add RNase A and DNase to a standard concentration of 1 mg/ml and


incubate for 30m at room temperature.
 Include 2.9 g NaCl for each 50 ml of phage solution. Precipitate on ice for
30m.
 Centrifuge down the bacterial waste for 10 minutes.
 shift the supernatant to a tube and add PEG 8000 to the standard
concentration of 10%
 Precipitate phages on ice for 2h or 4 °C overnight.
 rotate down phage/PEG precipitates for 10 minutes
 Pour the supernatant and drain the remaining supernatant by turnaround the
tube on a paper towel.

Purification of phage DNA:

 Re-suspend the pellet in 10 ml SM and 10 ml chloroform


 Centrifuge to isolate phases
 shift the supernatant to a fresh tube
 Extract once over with phenol/chloroform.
 Precipitate phage DNA by adding 1 volume of standard isopropanol
 Pellet phage DNA by centrifugation
 Wash the pellet with 70% ethanol
 Re-suspend the pellet in 100 ml TE with RNase A (20 mg/ml).

References:
1. Rhoads DD, Wolcott RD, Kuskowski MA, Wolcott BM, Ward LS, Sulakvelidze A (June
2009). "Bacteriophage therapy of venous leg ulcers in humans: results of a phase I
safety trial". Journal of Wound Care. 18 (6): 237–8, 240–3.
doi:10.12968/jowc.2009.18.6.42801. PMID 19661847
2. Twort FW (1915). "An Investigation on the Nature of Ultra-Microscopic Viruses". The Lancet.
186 (4814): 1241–43. doi:10.1016/S0140-6736(01)20383-3.

3. Callanan J, Stockdale SR, Adriaenssens EM, Kuhn JH (January 2021). "Rename one class
(Leviviricetes - formerly Allassoviricetes), rename one order (Norzivirales - formerly
Levivirales), create one new order (Timlovirales), and expand the class to a total of six
families, 420 genera and 883 species". ResearchGate. doi:10.13140/RG.2.2.25363.40481

4. Keen EC (2012). "Phage therapy: concept to cure". Frontiers in Microbiology. 3: 238.


doi:10.3389/fmicb.2012.00238. PMC 3400130. PMID 22833738
5. Altamirano, Fernando L. Gordillo; Barr, Jeremy J. (16 January 2019). "Phage Therapy in the
Postantibiotic Era". Clinical Microbiology Reviews. 32 (2). doi:10.1128/CMR.00066-18. PMC
6431132. PMID 30651225. Retrieved 6 January 2022.

6. Borrell B, Fishchetti V (August 2012). "Science talk: Phage factor". Scientific American.
pp. 80–83. JSTOR 26016042
7. Bunting J (1997). "The Virus that Cures". BBC Horizon. BBC Worldwide Ltd. OCLC
224991186. – Documentary about the history of phage medicine in Russia and the
West
8. Wommack KE, Colwell RR (March 2000). "Virioplankton: viruses in aquatic
ecosystems". Microbiology and Molecular Biology Reviews. 64 (1): 69–114.
doi:10.1128/MMBR.64.1.69-114.2000. PMC 98987. PMID 10704475.
9. Suttle CA (September 2005). "Viruses in the sea". Nature. 437 (7057): 356–61.
Bibcode:2005Natur.437..356S. doi:10.1038/nature04160. PMID 16163346. S2CID
4370363
10. McGrath S, van Sinderen D, eds. (2007). Bacteriophage: Genetics and Molecular
Biology (1st ed.). Caister Academic Press. ISBN 978-1-904455-14-1.

[Gel electrophoresis protocol]


Gel Electrophoresis Protocol:
Gel electrophoresis is a technique used to split-up DNA pieces. According to
theirsize, DNA samples are fill into wells. And an electric current is applied to
drag themthrough the gel. DNA pieces are negatively charged, so they progress
towards the positive electrode.

Apparatus:
 Casting tray

 Well combs

 Voltage source

 Gel box

 UV light source

 Microwave

Reagents:
 TAE
 Agarose

 Ethidum bromide (stock concentration of 10 mg/mL

Procedure:
 Standard 1 g of agarose.
 Associate agarose powder with 100 mL 1xTAE in a microwavable flask.
 Microwave for 1-3 min till the agarose is totally dissolved.
 Let agarose solution cool down to about 50 °C regarding 5 mins.
 Add ethidium bromide (EtBr) to a concluding concentration of round about
0.2- 0.5 μg/mL
 Stream the agarose into a gel tray with the well comb in location
 Place newly stream gel at 4 °C for 10-15 mins OR let settle down at room
temperature for 20-30 mins, until it has totally solidified.

Loading Samples and Running an Agarose Gel:


 Put-on loading buffer to each of your DNA samples
 Once harden, place the agarose gel into the gel box
 Fill-up gel box with 1xTAE (or TBE) till the gel is covered.
 Slowly load a molecular weight ladder into the first pathway of the gel
 Slowly load your samples into the extra wells of the gel.
 Run the gel at 80-150 V

References:
1. Kastenholz, Bernd (2004). "Preparative Native Continuous Polyacrylamide Gel Electrophoresis
(PNC‐PAGE): An Efficient Method for Isolating Cadmium Cofactors in Biological Systems".
Analytical Letters. Informa UK Limited. 37 (4): 657–665. doi:10.1081/al-120029742. ISSN
0003-2719. S2CID 97636537

2. Smithies O (1955). "Zone electrophoresis in starch gels: group variations in the serum proteins
of normal human adults". Biochem J. 61 (4): 629–41. doi:10.1042/bj0610629. PMC 1215845.
PMID 13276348
3. Gordon, A.H. (1969). Electrophoresis of Proteins in Polyacrylamide and Starch Gels:
Laboratory Techniques in Biochemistry and Molecular Biology. Amsterdam: North-Holland
Pub. Co. ISBN 978-0-7204-4202-1. OCLC 21766.

4. Smisek, David L.; Hoagland, David A. (1989). "Agarose gel electrophoresis of high molecular
weight, synthetic polyelectrolytes". Macromolecules. American Chemical Society (ACS). 22 (5):
2270–2277. Bibcode:1989MaMol..22.2270S. doi:10.1021/ma00195a048. ISSN 0024-9297.

5. Tom Maniatis; E. F. Fritsch; Joseph Sambrook (1982). "Chapter 5, protocol 1". Molecular
Cloning - A Laboratory Manual. Vol. 1 (3rd ed.). p. 5.2–5.3. ISBN 978-0879691363

6. Lee PY, Costumbrado J, Hsu CY, Kim YH (2012). "Agarose gel electrophoresis for the separation
of DNA fragments". J Vis Exp (62). doi:10.3791/3923. PMC 4846332. PMID 22546956.

7. Robyt, John (1990). Biochemical techniques : theory and practice. Prospect Heights, Ill:
Waveland Press. ISBN 978-0-88133-556-9. OCLC 22549624

8. Boyer, Rodney (2000). Modern experimental biochemistry (in Estonian). San Francisco:
Benjamin Cummings. ISBN 978-0-8053-3111-0. OCLC 44493241

9. Sambrook, Joseph (2001). Molecular cloning : a laboratory manual (in Spanish). Cold Spring
Harbor, N.Y: Cold Spring Harbor Laboratory Press. ISBN 978-0-87969-576-7. OCLC 45015638.
10. Kryndushkin DS, Alexandrov IM, Ter-Avanesyan MD, Kushnirov VV (2003). "Yeast [PSI+] prion
aggregates are formed by small Sup35 polymers fragmented by Hsp104". J Biol Chem. 278
(49): 49636–43. doi:10.1074/jbc.M307996200. PMID 14507919.

[DETERMINATION OF
NUCLEOTIDE SEQUENCE OF
DNA BY DIDEOXY CHAIN
TERMINATION METHOD]
Determination of Nucleotide Sequence of DNA by
Dideoxy Chain Termination Method:
 put-on the following to an Eppendorf tube to assemble a template
primer mixture:(U1)
 Template DNA (700 ng) 7.0 μL
 Primer DNA (5 ng) 2.0 μL
 10×polymerase reaction buffer
 pH 7.5 1.0 μL
 Paraffin fluid 15.0 μL
 Stay in boiling water bath for 5 min
 put-on the components to another Eppendorf tube:
 [35S] dATP 1.0 μL
 0.1 M DTT 1.0 μL
 Klenow enzyme 2–3 units
 SDW 1.0 μL
 Template primer mix 10.0 μL
 Prepared in step U1
 Mix the given contents and tag it as enzyme and template, primer mix
 Set out the sequencing reaction in four different Eppendorf tubes
tagged as G, A, T, C
 Incubate the tubes at room temperature as 20 min
 Put-on 1 mL 0.5 μM dATP to all tube and permit the tubes to stand
for another 20 min at room temperature.
 Put-on 10 μL formamide dye mix
 Perform gel electrophoresis protocol.

References:
1. Shendure J, Ji H (October 2008). "Next-generation DNA sequencing". Nature Biotechnology.
26 (10): 1135–1145. doi:10.1038/nbt1486. PMID 18846087. S2CID 6384349.

2. Sanger F, Nicklen S, Coulson AR (December 1977). "DNA sequencing with chain-terminating


inhibitors". Proceedings of the National Academy of Sciences of the United States of America.
74 (12): 5463–5467. Bibcode:1977PNAS...74.5463S.

3. Murphy KM, Berg KD, Eshleman JR (January 2005). "Sequencing of genomic DNA by combined
amplification and cycle sequencing reaction". Clinical Chemistry. 51 (1): 35–39

4. Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Connell CR, et al. (1986). "Fluorescence
detection in automated DNA sequence analysis". Nature. 321 (6071): 674–679.
Bibcode:1986Natur.321..674S.

5. Sanger F, Nicklen S, Coulson AR (December 1977). "DNA sequencing with chain-terminating


inhibitors". Proceedings of the National Academy of Sciences of the United States of America.
74 (12): 5463–5467. Bibcode:1977PNAS...74.5463S

6. Kan CW, Fredlake CP, Doherty EA, Barron AE (November 2004). "DNA sequencing and
genotyping in miniaturized electrophoresis systems". Electrophoresis. 25 (21–22): 3564–3588.

7. Morozova O, Marra MA (November 2008). "Applications of next-generation sequencing


technologies in functional genomics". Genomics. 92 (5): 255–264.
doi:10.1016/[Link].2008.07.001. PMID [Link] Biologies Inc

[DNA fingerprinting protocol]


DNA fingerprinting protocol:
DNA fingerprinting is a laboratory method used to initiate a link between
biological evidence and a suspect in a criminal investigation. A DNA sample
taken from a crime scene is contrast with a DNA sample from a suspect. If the
two DNA profiles are a match, then the evidence came from that suspect.
DNA fingerprinting protocol:

MATERIALS:
 20µl Victim DNA
 20µl Suspect 1 DNA
 20µl Suspect 2 DNA
 20µl Crime Scene 1 DNA
 20µl Crime Scene 2 DNA
 120µl restriction enzyme Mix
 55µl DNA Loading Buffer

PRE EXPERIMENT SET UP:


Prepare the running buffer:
In a clean two-liter container, put-on the total contents of the TAE
Buffer (50X) and make up to two liters with ultra-pure water to make a
1X TAE Buffer solution. Stir until thoroughly mix
Prepare 1% agarose:

 In a clean, glass 500ml container put-on 1gm Agarose for each and every
100ml of the TAE Buffer. The pack has 5gm Agarose.
 Heat the solution in a microwave on high power, using 10-second bursts.
Examine to realize if all the agarose has dissolved. Repeat until agarose
has dissolved.
 Once the agarose has cooled to the end it can be held comfortably in your
hand, Nucleic Acid Stain to the agarose and whirl to mix
 You will need 25 wells that each holds 30µl for each group, use a suitable
size comb.
 Once the gels have set, remove the comb, shift to the running equipment
and cover with the running buffer until ready to use.

Procedure:
 Label 6 sets of 5 tubes with “Crime Scene 1”, “Crime Scene 2”, “Victim”,
“Suspect 1” and “Suspect 2”. Shift 20µl of each DNA sample into the
suitably labeled tube and provide each group with one of each sample
tube.
 Shift 20µl Cleaving Enzyme blend into the five tubes of DNA. Use a clean
tip for each and every DNA sample
 Setting each tube in a water bath or incubator at 37°C for one hour.
 Following incubation, put-on 10µl DNA Loading Buffer to each tube
 The agarose gels should have been prepared by you.
 Once the samples are all loaded, supply a current at 12-15V/cm. For an
8cm long gel run at 96-120 volts
 Once the blue dye front has roam ¾ the length of the gel, turn off the power
and gently shift the gel to a UV Light box
References:
1. Ravikumar D, Gurunathan D, Gayathri R, Priya VV, Geetha RV (1 January 2018). "DNA profiling
of Streptococcus mutans in children with and without black tooth stains: A polymerase chain
reaction analysis". Dental Research Journal. 15 (5): 334–339. doi:10.4103/1735-3327.240472.
PMC 6134728. PMID 30233653

2. Curtis C, Hereward J (29 August 2017). "From the crime scene to the courtroom: the journey
of a DNA sample". The Conversastion.

3. Evans C (2007) [1998]. The Casebook of Forensic Detection: How Science Solved 100 of the
World's Most Baffling Crimes (2nd ed.). New York: Berkeley Books. p. 86–89. ISBN 978-
1440620539.
4. Jeffreys AJ (November 2013). "The man behind the DNA fingerprints: an interview with
Professor Sir Alec Jeffreys". Investigative Genetics. 4 (1): 21. doi:10.1186/2041-2223-4-21.
PMC 3831583. PMID 24245655.

5. US 5766847, Jäckle, Herbert & Tautz, Diethard, "Process for analyzing length polymorphisms
in DNA regions", published 1998-06-16, assigned to Max-Planck-Gesellschaft zur Forderung
der Wissenschaften

6. Tautz D (1989). "Hypervariability of simple sequences as a general source for polymorphic


DNA markers". Nucleic Acids Research. 17 (16): 6463–6471. doi:10.1093/nar/17.16.6463.
PMC 318341. PMID 2780284.

7. Chambers GK, Curtis C, Millar CD, Huynen L, Lambert DM (February 2014). "DNA fingerprinting
in zoology: past, present, future". Investigative Genetics. 5 (1): 3. doi:10.1186/2041-2223-5-3.
PMC 3909909. PMID 24490906.

8. DNA pioneer's 'eureka' momen". BBC. 9 September 2009. Archived from the original on 22
August 2017. Retrieved 14 October 2011.

9. Petersen, K., J.. Handbook of Surveillance Technologies. 3rd ed. Boca Raton, FL. CRC Press,
2012. p815

10. Eureka moment that led to the discovery of DNA fingerprinting". The Guardian. 24 May 2009.
Archived from the original on 26 April 2021. Retrieved 11 December 2016
[Purifying DNA from an agarose
gel]
Purifying DNA from an Agarose Gel Protocol:
 Slash the required DNA bands out of the gel with as small excess agarose
as possible
 Place the gel slice(s) in a water bath at 65C till the agarose has completely
melted vortex frequently to help the process
 Put-on a uniform volume of Phenol.
 Vortex to an emulsion.
 Rotator for 10min RT 13,000rpm
 Pipette off and remain the top (aqueous layer) avoiding picking and
precipitated protein or phenol.
 put-on and uniform volume of phenol chloroform
 Vortex to an emulsion.
 Rotator for 10min RT 13,000rpm.
 Put-on 1/10 volume sodium acetate pH 5.5.
 Put-on 2 volumes of 100% ethanol.
 Vortex or upturn to mix well for a few seconds
 Rotate for 15min RT 13,000rpm.
 gently remove the ethanol
 Put-on 70% ethanol – generally 500µl in 1.5ml micro tube.
 rotate 2min max speed to re-pellet the DNA
 Evacuate ALL the ethanol
 Air dry for 5-10 minutes to make sure ALL ethanol has gone.
 Re-suspend in dH2O or TE as suitable
References:
1. Cuatrecasas P, Wilchek M (2004). Lennarz WJ, Lane MD (eds.). Encyclopedia of Biological
Chemistry. Vol. 1. Academic Press. p. 52. ISBN 9780124437104.

2. Caldwell GA, Williams SN, Caldwell KA (2006). Integrated Genomics: A Discovery-Based


Laboratory Course. Wiley. pp. 94–95. ISBN 978-0470095027.

3. Keren D (26 September 2003). Protein Electrophoresis in Clinical Diagnosis. CRC Press. pp. 7–
8. ISBN 978-0340812136.

4. Park H, Park K, Shalaby WS (1993). Biodegradable Hydrogels for Drug Delivery. CRC Press. p.
102. ISBN 978-1566760041

5. Stephen AM, Phillips GO, eds. (2006). Food Polysaccharides and Their Applications. CRC Press.
p. 226. ISBN 978-0824759223. Workshop on Marine Algae Biotechnology: Summary Report.
National Academy Press. 1986. p. 25.

6. Agar". Food and Agricultural Organization of the United [Link] R, Galatas F.


"Chapter 1 - Production, Properties and Uses of Agar". [Link].

7. Jeppsson JO, Laurell CB, Franzén B (April 1979). "Agarose gel electrophoresis". Clinical
Chemistry. 25 (4): 629–38. doi:10.1093/clinchem/25.4.629. PMID 313856. Agar Archived
October 16, 2007, at the Way back Machine at [Link] Water Structure and [Link]".
Food and Agricultural Organization of the United Nations

[Southern blotting protocol]


Southern Blotting Protocol:

In southern blotting multi-locus examination of your DNA by shifting DNA from


the gel prepared in an experiment to the nylon membrane. This technique is called
southern blotting.

PROTOCOL OF SOUTHERN BLOTTING:

 Shift the gel to a glass Pyrex dish and cut away from any unexploited areas
of the gel with a scalpel, Remove the gel beneath the bromophenol blue
dye.
 This portion of the gel does not carry DNA fragments. Cut the lower side
of the gel at the bottom of the lane with size standards.
 Shifting the gel to a UV Trans illuminator. Put an acetate sheet on top of
the gel and draw an outline of the gel with a marker pen, Mark the positions
of the wells and the position of the cutting side. Set on the Trans
illuminator, label the site of standard DNA bands on the acetate sheet.
 Shift the gel back to the Pyrex dish and put-on sufficient 0.25N HCl to
permit the gel to move freely in the solution (150–200ml of solution
standardized gel size).
 Set the dish on an orbital shaker, incubate for 10min. Revolving
 At 10–20r.p.m.
 Wash the gel for 10–20 seconds in 200ml of distilled water. Discard the
water and begin straight away to the next step
 Put-on 200ml of denaturation solution to the dish and disconcert it for
20min on a rotary shaker. (A)
 Drain the denaturation solution and repeat step A
 Put-on 200ml of water and wash the gel for 10–20 seconds in order to
remove the denaturation solution confine on the surface of the gel. Drain
the water, holding the gel with the palm of your hand.
 Put-on 100–200ml of neutralization solution to the dish and tend the gel
for 20 min with gentle disconcertment (B)
 Dispose the neutralization solution and repeat step B
 The gel is being tended, prepare the nylon membrane for shifting, cut the
nylon membrane to the length of the gel.
 Set the membrane in a separate Pyrex dish fill-up with distilled water.
 Leave the membrane inside water for 1–2 min. Drain the water and
submerge the membrane in ten times SSC (saline-sodium citrate). Cut 3
sheets of Whitman 3MM paper to the length of the nylon membrane.
 Produce a long strip of Whitman 3MM paper to utilize as a wick. The wick
should be about 30cm long and 10cm wide
 Build the blot sandwich. Put-on 400–600ml of ten times SSC to a large
Pyrex dish. Place a glass platform over the center of the dish and cover it
with the wick. Both ends of the wick are submerged in the SSC solution.
Wet the wick with 10–20ml of ten times SSC solution, remove confine air
bubbles by rolling a 10ml glass pipette over it
 Carefully hold the gel from the Pyrex dish and place it in
 Cover the complete dish, plus the surface of the gel, with saran wrap, the
razor blade removes the saran wrap covering the gel itself and discard it.
 Set the nylon membrane on top of the gel. Put-on 5ml of ten times SSC to
the top of the membrane and remove air bubbles by spinning a pipette over
it.
 Cut the left bottom corner side of the membrane to occur at the same time
with the cut made in the gel
 Set three sheets of dry Whitman 3MM paper, prepared on the top of the
membrane. Place respective inches of paper towels on top of the 3MM
paper. Place a glass plate on top of the paper towel stack and weigh it
down with a 1 flask filled (500ml water).
 Permit a minimum of 17 hours for the shifting.

References:
1. Sapkota, Anupama (2021-06-03). "Southern Blot- Definition, Principle, Steps, Results,
Applications". Microbe Notes. Retrieved 2023-01-04
2. Green, Michael R.; Sambrook, Joseph (July 2021). "Analysis of DNA by Southern
Blotting". Cold Spring Harbor Protocols. 2021 (7): pdb.top100396.
doi:10.1101/pdb.top100396. ISSN 1940-3402. PMID 34210774. S2CID
[Link] 3rd Edition, Matthews, Van Holde et al, Addison Wesley
Publishing, pg 977
3. Glenn, Gary; Andreou, Lefkothea-Vasiliki (2013-01-01), Lorsch, Jon (ed.), "Chapter Five
- Analysis of DNA by Southern Blotting", Methods in Enzymology, Laboratory Methods
in Enzymology: DNA, Academic Press, 529: 47–63, doi:10.1016/b978-0-12-418687-
3.00005-7, PMID 24011036, retrieved 2023-01-04
4. Burnette, W. Neal (April 1981). "Western Blotting: Electrophoretic Transfer of Proteins from
Sodium Dodecyl Sulfate-Polyacrylamide Gels to Unmodified Nitrocellulose and Radiographic
Detection with Antibody and Radioiodinated Protein A". Analytical Biochemistry. 112 (2):
195–203. doi:10.1016/0003-2697(81)90281-5. ISSN 0003-2697. PMID 6266278.

5. Southern, Edwin Mellor (5 November 1975). "Detection of specific sequences among


DNA fragments separated by gel electrophoresis". Journal of Molecular Biology. 98
(3): 503–517. doi:10.1016/S0022-2836(75)80083-0. ISSN 0022-2836. PMID 1195397.
6. Talking Glossary of Genetic Terms | NHGRI". [Link]. National Institutes of
Health. Retrieved 24 January 2023. Public Domain This article incorporates text from
this source, which is in the public domain.

[Protein gel electrophoresis


protocol]

Protein gel electrophoresis:


Gel electrophoresis is a laboratory technique used to contrasting proteins
according to molecular size.

Protein gel electrophoresis protocol:


Materials and Reagents:
 Pre-stain Protein
 TEMED
 ammonium per sulfate
 SDS
 30% Acrylamide stock
 Bromophenol Blue
 Tris Base
 Glycine
 EDTA
 Glycerol
 Isopropanol
 Tris-HCl (pH 6.8)
 β-mercaptoethanol
 2x SDS protein sample buffer
 10x running buffer

Apparatus:
Protein mini gel cassettes
 Heating block module
 Centrifuge
 Power supply
 Gloves
 Filter paper

10xrunning buffer Recipes:


 10x running buffer
 30.3 g Tris-base
 144.0 g glycine
 10.0 g SDS
 Completely dissolve in about 800 ml ddH2O and afterward more ddH2O
up to 1 liter.

2x SDS protein sample buffer:


 1.25 ml 1 M Tris-HCl (pH 6.8)
 4.0 ml 10% (w/v) SDS
 2.0 ml glycerol
 0.5 ml 0.5 M EDTA
 4 mg bromophenol blue
 0.2 ml b-mercaptoethanol (14.3 M)
 Bring the volume to 10 ml with ddH2O.

Sample preparation:
Prepare a similar amount of protein samples according to BCA assay
result, see bicinchoninic acid protein assay
 Put-on the similar volume of 2x protein sample buffer to each protein
sample, blend and boil the samples at 95 °C heating block module for 10
min.
 Rotate the samples at the high speed for 1 min

Procedure:
 Manufacture the SDS-PAGE gel
 Clean and totally dry glass plates, combs, and spacers are required.
 construct gel cassette
 Prepare 10% lower gel by adding the following solutions
 2 ml ddH2O
 1.67 ml 30% acrylamide/Bis
 1.25 ml 1.5 M Tris (pH 8.8)
 25 μl 20% SDS
 25 μl 10% ammonium per sulfate
 2.5 μl TEMED
 To keep away polymerization, after adding TEMED, mix well and quickly
shift the gel solution by using 1 ml pipette to the casting chamber in the
middle of the glass plates and fill up to about 0.7 cm below the bottom of
comb when the comb is in place.
 Put-on a little layer of isopropanol to the top of the gel early to
polymerization to straighten the level of the gel.
 once the gel has polymerized, produce stacking gel (5%) by adding the
following solutions
 2.088 ml dH2O
 0.506 ml 30% acrylamide/Bis
 0.375 ml 1 M Tris (pH 6.8)
 15 μl 20% (w/v) SDS
 15 μl 10% ammonium per sulfate
 1.5 μl TEMED
 Remove the isopropanol layer by using filter paper. Wash the top layer of
the gel with ddH2O and dry off as much of the water as possible by utilize
filter paper.
 Put-on TEMED and mix the stacking gel solution well. Rapidly shift the
gel solution by utilize a 1 ml pipette till the space is full, and then insert
the suitable comb.
 Permit the top part to solidify and then carefully remove the comb.

References:
1. Song D, Ma S, Khor SP (2002). "Gel electrophoresis-autoradiographic image analysis
of radiolabeled protein drug concentration in serum for pharmacokinetic studies".
Journal of Pharmacological and Toxicological Methods. 47 (1): 59–66.
doi:10.1016/s1056-8719(02)00203-4. PMID 12387940.

2. Schägger H, von Jagow G (1987). "Tricine-sodium dodecyl sulfate-polyacrylamide gel


electrophoresis for the separation of proteins in the range from 1 to 100 kDa". Anal.
Biochem. 166 (2): 368–379. doi:10.1016/0003-2697(87)90587-2. PMID 2449095.
3.

4. Ancrews D (2007). "SDS-PAGE". Andrews Lab. Archived from the original on 2 July
2017. Retrieved 27 September 2009.
5. Quandt N, Stindl A, Keller U (1993). "Sodium Dodecyl Sulfate-Polyacrylamide Gel
Electrophoresis for Mr Estimations of High-Molecular-Weight Polypeptides". Anal.
Biochem. 214 (2): 490–494. doi:10.1006/abio.1993.1527. PMID 8109738.

6. Davis BJ, Ornstein L (1959). "A new high resolution electrophoresis method".
Delivered at the Society for the Study of Blood at the New York Academy of Medicine

[PROTEIN FINGERPRINTING
PROTOCOL]
Protein fingerprinting protocol:
Protein Fingerprinting is a technique for protein identification.
Before the experiment:
 Put-on 50µl Sample Loading Buffer and 50µl distilled water to each vial
of proteins. Immerse the protein samples for 5 minutes with periodical
overtaxing to dissolve them completely.
Materials:
 50ml Lab Safe Gel Blue
 15μl Brain Protein
 15μl Heart Protein
 15μl Liver Protein
 15μl Lung Protein
 1X Electrophoresis running buffer
 1 8‐12% Polyacrylamide gel
 1 pin

PROCEDURE:
 Utilize the pin punch a little opening into the caps of the four protein
samples and then place in a boiling water bath for 5m
 Vortex the tubes in short and centrifuge for 1m
 For running the samples, construct the gel
 Load the samples in separate wells.
 Run the gel at 30mA/gel until the blue color front is 0.5‐2cm from the gel
base
 Add 50ml Lab Safe Gel Blue to cover the gel. Lightly tremble the gel for
60 minutes at room temperature.
 Think about the protein fingerprints and discuss the differences and
similarities between the samples

References:
1. Yates JR, Speicher S, Griffin PR, Hunkapiller T (1993). "Peptide mass maps: a highly
informative approach to protein identification". Anal. Biochem. 214 (2): 397–408.
doi:10.1006/abio.1993.1514. PMID 8109726.
2. LoPachin R (2004). "The changing view of acrylamide neurotoxicity".
Neurotoxicology. 25 (4): 617–30. doi:10.1016/[Link].2004.01.004. PMID 15183015.

3. Kerenyi L, Gallyas F (1973). "Über Probleme der quantitiven Auswertung der mit
physikalischer Entwicklung versilberten

4. "SDS-PAGE". Archived from the original on 20 February 2014. Retrieved 12


September 2009

5. Hempelmann E, Schulze M, Götze O (1984). "Free SH-groups are important for the
polychromatic staining of proteins with silver nitrat". In Neuhof V (ed.).
Electrophoresis '84. Weinheim: Verlag Chemie. pp. 328–3

6. Grant G (2007). "How the 1906 Nobel Prize in Physiology or Medicine was shared
between Golgi and Cajal". Brain Res Rev. 55 (2): 490–8.
doi:10.1016/[Link].2006.11.004. PMID 17306375. S2CID 24331507.

[PCR protocol]
Polymerase chain reaction:
Pcr is a method broadly used in molecular biology to manufacture several copies
of a specific DNA segment.

Material require:
Protocol:
 Deoxyribonucleoside triphosphates
 A polymerase enzyme including taq polymerase
 Buffer
 Primers
 Nuclease-free distilled water

Procedure:
 Thaw all reagents on ice.
 Construct reaction mix into 50 µL volume in a slim walled 0.2 mL PCR
tubes.
 Add reagents in following sequence: water, buffer, dNTPs, Mg CL2,
template primers, Taq polymerase.
 Lightly mix by tapping tube. in short centrifuge to settle tube contents.
 Produce negative control reaction without template DNA.
 Produce positive control reaction with template of known size and suitable
primers.

Component Final Concentration/


Water to 50 µL
Buffer 1x
Taq polymerase 0.05 units/µL
dNTP mix 200 µM
MgCl2 0.1-0.5 mM
Forward primer 0.1-0.5 µM
Reverse primer 0.1-0.5 µM
template 200 pg/µL
DMSO (optional) 1 to 10% w/v

References:
1. Schwartz JJ, Lee C, Shendure J (September 2012). "Accurate gene synthesis with tag-directed
retrieval of sequence-verified DNA molecules". Nature Methods. 9 (9): 913–15.
doi:10.1038/nmeth.2137. PMC 3433648. PMID 22886093.

2. Vincent M, Xu Y, Kong H (August 2004). "Helicase-dependent isothermal DNA amplification".


EMBO Reports. 5 (8): 795–800. doi:10.1038/[Link].7400200. PMC 1249482. PMID
15247927.

3. Kellogg DE, Rybalkin I, Chen S, Mukhamedova N, Vlasik T, Siebert PD, Chenchik A (June
1994). "TaqStart Antibody: "hot start" PCR facilitated by a neutralizing monoclonal antibody
directed against Taq DNA polymerase". BioTechniques. 16 (6): 1134–37. PMID 8074881

4. Zietkiewicz E, Rafalski A, Labuda D (March 1994). "Genome fingerprinting by simple


sequence repeat (SSR)-anchored polymerase chain reaction amplification". Genomics. 20 (2):
176–83. doi:10.1006/geno.1994.1151. PMID 8020964

5. Chien A, Edgar DB, Trela JM (September 1976). "Deoxyribonucleic acid polymerase from the
extreme thermophile Thermus aquaticus". Journal of Bacteriology. 127 (3): 1550–57.
doi:10.1128/jb.127.3.1550-1557.1976. PMC 232952. PMID 8432.
6. Pavlov AR, Pavlova NV, Kozyavkin SA, Slesarev AI (May 2004). "Recent developments in the
optimization of thermostable DNA polymerases for efficient applications". Trends in
Biotechnology. 22 (5): 253–60. doi:10.1016/[Link].2004.02.011. PMID 15109812

[PCR Amplification of Desired


gene protocol]
PCR Amplification of Desired gene protocol:
 PCR components in the following sequence:

Reaction microliter
water 32.5
Green hf buffer 10.0
DNTPs(10mM) 1.0
F primer (10 μM) 2.5
R primer (10 μM) 2.5

Template DNA ((10 ng/µL) 1.0


Phusion DNA Polymerase 0.5
Total 50.0
Thermocycler reaction Round
1.98°C for 0:30 min
2.98°C for 0:10 min 5x
3.X°C for 0:20 min
4.72°C for X min
5.98°C for 0:10 min 30x
6.72°C for X min
7.72°C for 5:00 min
8. 4°C until use
 Run 2-3 µl DNA ladder total PCR sample into gel electrophoresis
 Observe gel after 30-60min of gel electrophoresis and run until
marker hit the desire height
 Thermo cycler step 3-5 cycle with annealing temperature to the
forward or reverse primer with minimum Tm Has to adjust for every
gene
 Thermo cycler step4: setup the elongation time with 30 sec for each
kb
 Thermo cycler step 6: 30 cycles along with 72°C for elongation and
setup extension time. Change time with 30-sec per kb

References:
1. Joseph Sambrook & David W. Russel (2001). Molecular Cloning: A Laboratory
Manual (third ed.). Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.
ISBN 978-0-879-69576-7. Chapter 8: In vitro Amplification of DNA by the Polymerase
Chain Reaction

2. Carr AC, Moore SD (2012). Lucia A (ed.). "Robust quantification of polymerase chain
reactions using global fitting". PLOS ONE. 7 (5): e37640.
Bibcode:2012PLoSO...737640C.
3. Cheng S, Fockler C, Barnes WM, Higuchi R (June 1994). "Effective amplification of
long targets from cloned inserts and human genomic

4. Enners, Edward; Porta, Angela R. (2012). "Determining Annealing Temperatures for


Polymerase Chain Reaction". The American Biology Teacher. 74 (4): 256–60.
doi:10.1525/abt.2012.74.4.9. S2CID [Link], Ale

5. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. (January 1988).
"Primer-directed enzymatic amplification of DNA with a thermostable DNA
polymerase". Science. 239 (4839): 487–91. Bibcode:1988Sci...239..487S.
doi:10.1126/science.239.4839.487. PMID 2448875.

6. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N (December
1985). "Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia". Science. 230 (4732): 1350–54.
[DESIGNING PRIMER]
Broad guideline Designing primer.
 Avoid overflow three nucleotide (AAA)
 Long extend of G, in particular condition:
 18-30bp long nucleotides'
 Primer should differ in length under 3bp.
 3’ end must be G or C
 Primer melting temperature must be 50-60°C
 GC content between 40% to 60%
 Keep away palindromes and inverted repeat sequences.
 examine dimer binding and hairpins in Vector
 Long primers maximum >50 bp
 Fraction of synthesized oligo(0.99n-1)
 confirm that your primers are designed in the right direction

References:
1. Adenosine added on the primer 50 end improved TA cloning efficiency of polymerase chain
reaction products, Ri-He Peng, Ai-Sheng Xiong, Jin-ge Liu, Fang Xu, Cai Bin, Hong Zhu, Quan-
Hong Ya

2. "Electronic PCR". NCBI - National Center for Biotechnology Information. Retrieved 13 March
2012.

3. Doudna; Cox; O'Donnell, Jennifer; Michael M.; Michael (December 21, 2016). Molecular
Biology: Principles and practice. W. H. Freeman. ISBN 9781319116378.

4. Henneke, Ghislaine (2012-09-26). "In vitro reconstitution of RNA primer removal in Archaea
reveals the existence of two pathways". Biochemical Journal. 447 (2): 271–280.
doi:10.1042/BJ20120959. ISSN 0264-6021. PMID 22849643.

5. Cox, Michael M. (2015). Molecular Biology: Principles and Practice. New York: W. H. Freeman
and Company. pp. 221–238, 369–376, 592–593. ISBN 9781464126147.

[Gene cloning]
Gene cloning:
DNA cloning is a molecular biology technique that assemble many identical
copies of apiece of DNA. In a representative cloning experiment, a target gene is
load into a circular piece of DNA called a plasmid.

Steps of DNA cloning:


 Cutting and pasting DNA
 Bacterial transformation
 Protein manufacture

Protocol:
Steps of the gene cloning protocol:
 Rna isolation
 Cdna synthesis.
 Restriction digestion and ligation
 Transformation

RNA ISOLATION:
 Assemble the cells into 2 ml tubes.
 rotate the cell suspension at high speed for 1 min using a centrifuge,
 reject the supernatant and resuspend in 1 ml of lysis buffer prewarmed at
65 ºC
 put-on 900 μl of acid phenol: chloroform and vortex for 10 sec
 Permit the 2 ml tube in the bench for 10 min at room temperature.
 rotate at high speed for 10 min at 4 °C
 shift the supernatant to new 2 ml tube
 put-on 0.3 volume of 5 M sodium acetate and 0.7 capacity of acid
phenol:chloroform
 Blend slowly the tube and incubate on ice for 10 min.
 Top rotation for 10 min at 4 °C
 Shift the supernatant to fresh 2 ml tubes.
 Put-on 0.1 volume of 3 M sodium acetate and the identical volume of
isopropanol
 Incubate the tubes at -20 °C for 1 hour
 Rotation at high speed for 10 min at 4 °C and throwaway the supernatant.
 Clean the pellet with 500 μl ethanol (70 %)
 Centrifuge at 7,500 g for 5 min at 4 °C.
 Air dry the pellet for 5–10 min
 Diffuse in 25 μl RNase free water.
 Put into a 1ml tube 10ug of RNA
 put-on 5 μl of DNase buffer,
 Put-on 1 μl of DNase and totally the capacity up to 50 μl with RNase free
water.
 Incubate at 37 ºC for 30 m
 Put-on 500 μl ethanol (70 %)
 Centrifuge at 7,500 g for 5m at 4 °C.
 Air dry the pellet for 5–10 min
 utilize the nano-drop equipment to approach RNA concentration and
standard

References:
1. Gil, Gideon (17 January 2008). "California biotech says it cloned a human embryo, but no stem
cells produced". Boston Globe.

2. McFarland, Douglas (2000). "Preparation of pure cell cultures by cloning". Methods in Cell
Science. 22 (1): 63–66. doi:10.1023/A:1009838416621. PMID 10650336

3. Peter J. Russel (2005). iGenetics: A Molecular Approach. San Francisco, California, United
States of America: Pearson Education. ISBN 978-0-8053-4665-7.

4. Mock, K.E.; Rowe, C.A.; Hooten, M.B.; Dewoody, J.; Hipkins, V.D. (2008). "Blackwell Publishing
Ltd Clonal dynamics in western North American aspen (Populus tremuloides)". U.S.
Department of Agriculture, Oxford, UK : Blackwell Publishing Ltd. p. 17. Archived from the
original on 11 August 2014. Retrieved 5 December 2013.

5. DeWoody, J.; Rowe, C.A.; Hipkins, V.D.; Mock, K.E. (2008). ""Pando" Lives: Molecular Genetic
Evidence of a Giant Aspen Clone in Central Utah". Western North American Naturalist. 68 (4):
493–497. doi:10.3398/1527-0904-68.4.493. S2CID 59135424.
6. "Ibiza's Monster Marine Plant". Ibiza Spotlight. Archived from the original on 26 December
2007. Retrieved 7 May 2008.

7. Tasmanian bush could be oldest living organism". Discovery Channel. Archived from the
original on 23 July 2006. Retrieved 7 May 2008.

8. American Association for the Advancement of Science (1903). Science. Moses King. pp. 502–.
Retrieved 8 October 2010.
9. "Torrey Botanical Club: Volumes 42–45". Torreya. 42–45: 133. 1942.

10. de Candolle, A. (1868). Laws of Botanical Nomenclature adopted by the International


Botanical Congress held at Paris in August 1867; together with an Historical Introduction and
Commentary by Alphonse de Candolle, Translated from the French. translated by H.A.
Weddell. London: L. Reeve and Co.: 21, 43 

CDNA synthesis protocol:


 Blend RNA sample and primer d(T)23VN in two sterile RNase-free
microfuge tubes

Total RNA 1–6 μl


d(T)23VN (50 μM) 2 μl
nuclease-free H20 variable
Total Volume 8 μl
 Denature RNA for 5m at 70°C
 Put-on the following ingredient to one tube

M-MuLV Reaction Mix 10 μl


M-MuLV Enzyme Mix 2 μl
 Incubate the 20 μl Cdna synthesis reaction at 42°C for 1h
 Deactivate the enzyme at 80°C for 5m. diluted reaction to 50 μl with 30 μl
H2O for PCR

Restriction digestion and ligation:


Restriction digestion protocol:
 Defrost all reagents on ice.
 collect reaction mix into 50 µL volume in a microfuge tube
 Put-on reagents in following sequence: water, buffer, BSA, DNA
template, restriction enzyme
 Slowly mix by tapping the tube. In a short centrifuge to settle tube
contents.
 Produce negative control reaction without template DNA.
 Produce positive control reaction with template of known cutting site
corresponding to the restriction enzyme of option
 representative Incubation time and temperature is 37°C for 1h
 Incubation time temperature is 65°C for 20m,
 Examine the results of your PCR reaction via gel electrophoresis.

ingredient Final Concentration/amount


Water to 50 µL
Buffer 1X
BSA 0.05 units/µL
DNA template 1 µg
Restriction enzyme 5-10 U per µg of DNA template (should
not be over
10% of reaction capacity)

ligation protocol:
 Defrost all reagents on ice
 Collect reaction blend into 10 µL volume in a microfuge tube
 Put-on reagents in following sequence: water, buffer, insert, vector, T4
ligase.
 Slowly blend by stirring gently with pipette tip
 Representative Incubation time and temperature is 15°C for at a minimum
 (4h)

Component Final concentration/amount


water to 10 µL
Ligase buffer (with ATP) 1X
Vector 25 ng
Insert 75 ng
T4 DNA ligase 0.1 to 1 Weiss unit

References:
1. Ying, Shao-Yao (2004). "Complementary DNA Libraries: An Overview".
Molecular Biotechnology. 27 (3): 245–252. doi:10.1385/MB:27:3:245.
ISSN 1073-6085. PMID 15247497. S2CID 25600775.
2. P., Clark, David (2009). Biotechnology : applying the genetic revolution. Pazdernik, Nanette
Jean. Amsterdam: Academic Press/Elsevier. ISBN 9780121755522. OCLC 226038060.

DNA transformation protocol:


 Defrost all reagents completely on ice
 Put-on 1 µL of ligation reaction to defrost competent cells.
 Slowly blend by tapping tube of competent cells.
 Incubate reaction on ice for 30m
 Heat shock the capable cell fusion by incubation for 30 to 60s in a 42°C
water bath.
 Incubate tubes on ice for 2m
 Put-on 250 to 500 µL, SOC or LB media.
 Incubate at 37°C and spinning at 250 rpm
 Hot selection plates to 37°C.
 layout 10, 50, and 100 µL of transformed cells on selection plates
 Incubate plates at 30°C whole night.

Component Final concentration/amount


Competent cells to 50 µL
Ligation reaction 1-5 µL
SOC or LB media 950 ml

References:
1. Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME, Rosenfeld MG, Birnberg NC, Evans RM
(December 1982). "Dramatic growth of mice that develop from eggs microinjected with
metallothionein-growth hormone fusion genes". Nature. 300 (5893): 611–5.

2. Wirth R, Friesenegger A, Fiedler S (March 1989). "Transformation of various species of gram-


negative bacteria belonging to 11 different genera by electroporation". Molecular & General
Genetics. 216 (1): 175–7. doi:10.1007/BF00332248. PMID 2659971. S2CID 25214157.

3. Hanahan D (June 1983). "Studies on transformation of Escherichia coli with plasmids".


Journal of Molecular Biology. 166 (4): 557–80. CiteSeerX [Link].2021.
doi:10.1016/S0022-2836(83)80284-8. PMID 6345791.

4. Cohen SN, Chang AC, Hsu L (August 1972). "Nonchromosomal antibiotic resistance in
bacteria: genetic transformation of Escherichia coli by R-factor DNA". Proceedings of the
National Academy of Sciences of the United States of America. 69 (8): 2110–4.
Bibcode:1972PNAS...69.2110C. doi:10.1073/pnas.69.8.2110. PMC 426879. PMID 4559594.

5. Mandel M, Higa A (October 1970). "Calcium-dependent bacteriophage DNA infection".


Journal of Molecular Biology. 53 (1): 159–62. doi:10.1016/0022-2836(70)90051-3. PMID
4922220.
6. Lederberg, Joshua (1994). "The Transformation of Genetics by DNA: An Anniversary
Celebration of AVERY, MACLEOD and MCCARTY(1944) in Anecdotal, Historical and Critical
Commentaries on Genetics". Genetics. 136 (2): 423–6. doi:10.1093/genetics/136.2.423. PMC
1205797. PMID 8150273.

7. ohnston C, Martin B, Fichant G, Polard P, Claverys JP (March 2014). "Bacterial


transformation: distribution, shared mechanisms and divergent control". Nature Reviews.
Microbiology. 12 (3): 181–96. doi:10.1038/nrmicro3199. PMID 24509783. S2CID 23559881.

[GOLDEN GATE ASSEMBLY]


Golden Gate Assembly:
Golden Gate Assembly (GGA) is utilized for cloning one or more than one inserts
into a vector by building overlapping ends.

Procedure:
 Along PCR tube:

T4 DNA Ligase 0.5 µL


10X T4 DNA Ligase Buffer 2 µL
Type IIS restriction enzyme 0.5 µL
100 ng of vector 100 ng of vector
Complete with water QS 20 µL.
 Mix delicately

Cycle:
 15-120 cycles

Steps Temperature Time


Activation of the 37°C 5 min
restriction enzyme
Activation of the Ligase 16°C 5 min

Inactivation of the 55°C 15 min


enzyme
Inactivation of the ligase 85°C 20 min
Hold 4°C

References:
1. Pryor, John M.; Potapov, Vladimir; Kucera, Rebecca B.; Bilotti, Katharina; Cantor, Eric J.;
Lohman, Gregory J. S. (2020-09-02). "Enabling one-pot Golden Gate assemblies of
unprecedented complexity using data-optimized assembly design". PLOS ONE. 15 (9):
e0238592. Bibcode:2020PLoSO..1538592P. doi:10.1371/[Link].0238592. ISSN 1932-
6203. PMC 7467295. PMID 32877448

2. Sands, Bryan; Brent, Roger (2016-01-01). "Overview of post Cohen-Boyer methods for single
segment cloning and for multisegment DNA assembly". Current Protocols in Molecular
Biology. 113 (1): 3.26.1–3.26.20. doi:10.1002/0471142727.mb0326s113. ISSN 1934-3647.
PMC 4853029. PMID 27152131.

3. Engler, Carola; Marillonnet, Sylvestre (2014-01-01). "Golden Gate cloning". Methods in


Molecular Biology. 1116: 119–131. doi:10.1007/978-1-62703-764-8_9. ISBN 978-1-62703-
763-1. ISSN 1940-6029. PMID 24395361.

4. Engler, Carola; Gruetzner, Ramona; Kandzia, Romy; Marillonnet, Sylvestre (2009-05-14).


"Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction
Enzymes". PLOS ONE. 4 (5): e5553. Bibcode:2009PLoSO...4.5553E.
doi:10.1371/[Link].0005553. ISSN 1932-6203. PMC 2677662. PMID 19436741.

5. Weber, Ernst; Engler, Carola; Gruetzner, Ramona; Werner, Stefan; Marillonnet, Sylvestre
(2011-02-18). "A Modular Cloning System for Standardized Assembly of Multigene
Constructs". PLOS ONE. 6 (2): e16765. Bibcode:2011PLoSO...616765W.
doi:10.1371/[Link].0016765. ISSN 1932-6203. PMC 3041749. PMID 21364738.

6. Engler, Carola; Kandzia, Romy; Marillonnet, Sylvestre (2008-11-05). "A One Pot, One Step,
Precision Cloning Method with High Throughput Capability". PLOS ONE. 3 (11): e3647.
Bibcode:2008PLoSO...3.3647E. doi:10.1371/[Link].0003647. ISSN 1932-6203. PMC
2574415. PMID 18985154.

[DNA labeling by nick translation


(32P) protocol]
DNA labeling by nick a translation (32P) protocol:
 Cool a micro centrifuge tube on ice and mix reagents in following
sequence on ice
 10X dNTP mix (- dCTP) 1 microliter

(0.2 mM each dATP, dGTP, dTTP, 500 mM


Tris-HCl (pH 7.8)
2 microliter

50 mM MgCl2, 100 mM beta-
mercaptoethanol, 100 mg/ml
nuclease-
 free BSA)
DNA (plasmid, BAC, YAC,) 0.1-0.5 microgram
 10X Enzyme Mix: 2 microliter

(0.5 U/ml DNA Polymerase I,

0.07 U/ml DNase I

50 mM Tris-HCl (pH 7.5),

5 mM magnesium chloride

0.1 mM phenylmethylsulfonyl fluoride


50% (v/v) glycerol, 100 mg/ml nuclease-
free BSA)

-32P-dCTP 5 microliter
ddH20 Up to 20 microliter
 Mix and centrifuge in short Incubate at 15 °C for 2 hours

 Stop the reaction by putting the tubes in -20 °C (2 ml 0.5M EDTA pH8.0)
 Chill on ice.

References:
1. Tytgat, Olivier (2021). "STRide probes: Single-labeled short tandem repeat
identification probes". Biosensors and Bioelectronics. 180: 113135.
doi:10.1016/[Link].2021.113135. PMID 33690100.
2. Amann R, Ludwig W (2000). "Ribosomal RNA-targeted nucleic acid probes for studies
in microbial ecology". FEMS Microbiology Reviews. 24 (5): 555–565.
doi:10.1111/j.1574-6976.2000.tb00557.x. PMID 11077149.

3. Olsen, G.J.; Lane, D.J.; Giovannoni, S.J.; Pace, N.R.; Stahl, D.A. (1986). "Microbial
ecology and evolution: a ribosomal RNA approach". Annu. Rev. Microbiol. 40: 337–
365. doi:10.1146/[Link].40.100186.002005. PMID 2430518.
4. Fox, G.E.; Wisotzkey, J.D.; Jurtshuk Jr., P. (1992). "How close is close: 16S rRNA
sequence identity may not be sufficient to guarantee species identity". Int. J. Syst.
Bacteriol. 42 (1): 166–170. doi:10.1099/00207713-42-1-166. PMID 1371061.

5. Glöckner, F.O.; Babenzien H.D.; Amann R. (1999). "Phylogeny and diversity of


Achromatium oxaliferum". Syst. Appl. Microbiol. 22 (1): 28–38. doi:10.1016/s0723-
2020(99)80025-3. PMID 10188276.

6. Amann, R.; Ludwig, W.; Schleifer, K.-H. (1995). "Phylogenetic identification and in situ
detection of individual microbial cells without cultivation". Microbiological Reviews.
59 (1): 143–169. doi:10.1128/MMBR.59.1.143-169.1995. PMC 239358. PMID
7535888.
7. Amann R, Ludwig W (2000). "Ribosomal RNA-targeted nucleic acid probes for studies
in microbial ecology". FEMS Microbiology Reviews. 24 (5): 555–565.
doi:10.1111/j.1574-6976.2000.tb00557.x. PMID 11077149.

8. Nucleic Acid Hybridizations". [Link]. Retrieved 2017-05-26.

[35s labelling of the protein


Protocol]
35s labelling of the protein protocol:
 Wash cells once over with methionine-free tissue culture medium
 Incubate cells in methionine-free medium + 35S-methionine
(approximately 50 mCi per sample)
 incubate for 1-18h
 Expel medium
 Wash once over with PBS
 Solubilize cells with solubilizing agent (buffers containing 2% SDS or 4%
NP-40)
 Centrifuge at the high speed to pellet cell waste
 Examine using SDS-PAGE or 2D-gel

References:
1. Halevy, Revital; Sofiya Kolusheval; Robert E.W. Hancock; Raz Jelinek (2002). "Colorimetric
Biosensor Vesicles for Biotechnological

2. Chen X, Smith LM, Bradbury EM (March 2000). "Site-specific mass tagging with stable isotopes
in proteins for accurate and efficient protein identification". Analytical Chemistry. 72 (6):
1134–43. doi:10.1021/ac9911600. PMID 10740850.

3. Jing C, Cornish VW (September 2011). "Chemical tags for labeling proteins inside living cells".
Accounts of Chemical Research. 44 (9): 784–92. doi:10.1021/ar200099f. PMC 3232020. PMID
21879706.
4. Kricka LJ, Fortina P (April 2009). "Analytical ancestry: "firsts" in fluorescent labeling of
nucleosides, nucleotides, and nucleic acids". Clinical Chemistry. 55 (4): 670–83.
doi:10.1373/clinchem.2008.116152. PMID 19233914.

5. Gwynne and Page, Peter and Guy. "Laboratory Technology Trends: Fluorescence + Labeling".
Science. Retrieved 10 March 2013.

6. Sahoo, Harekrushna (1 January 2012). "Fluorescent labeling techniques in biomolecules: a


flashback". RSC Advances. 2 (18): 7017–7029. Bibcode:2012RSCAd...2.7017S.
doi:10.1039/C2RA20389H
7. Green Fluorescent Protein - GFP History - Osamu Shimomura".Shimomura, Osamu. "The
Nobel Prize in Chemistry". Retrieved 5 April 2013.

[Karyotype Analysis protocol]


Karyotype Analysis protocol:
Material and reagents:
 Cell lines (FaDu)
 Trypsine
 10% fetal bovine serum
 Colcemid (10 μg/ml)
 Hypotonic solution
 Glacial acetic acid
 Fixative (Methanol and glacial acetic acid 3:1)
 Growth medium (10% fetal bovine serum, 1% Penicillin Streptomycin)

Procedure:
 Put-on 0.1 ml colcemid, which can cave in mitotic spindles and prevent
the completion of mitosis, to each dish and mix lightly.
 Incubated at 37 °C, 5 % CO2 for 2 h.
 Shift medium to centrifuge tubes from the cell culture dishes. utilize PBS
to washthe dishes, and remove PBS.
 Put-on 1 ml 0.1% Trypsine into the dishes at 37 °C, 5% CO2 for 2m.
 Also, shift the mixture (Trypsine and cells) into the centrifuge tubes and
mix with the medium which is shifted to centrifuge tubes before we use
PBS to wash the dishes.
 centrifuge at 100 RCF for 10m
 Reject the supernatant and leave 0.5 ml medium to mix the pellet lightly
 Resuspend the pellet in 5-7 ml 37 °C hypotonic solution and mix
completely
 incubate at 37 °C for 10 min.
 centrifuge at 100 RCF for 10m
 Rejected the supernatant and leave 0.5 ml solution to mix the pellet lightly
 Resuspend the pellet in 5 ml cold fixative
 Set the centrifuge tube on ice minimum 20 min
 Centrifuge at 100 RCF for 10m ................ (a)
 Rejected the supernatant and put-on 3-5 ml cold fixative . (b)
 Repeat step a and b
 After the final centrifugation, suspend the cells in a few drops of cold
fixative to give a slightly non-transparent suspension.
 1-2 drops of cold fixative
 Dry the slides at 37°C temperature
 Notice the chromosomes with the microscope.

References:
1. Stebbins, G.L. (1971). Chromosomal evolution in higher plants. London: Arnold. pp.
85–86. ISBN 9780713122879.

2. Gustashaw K.M. 1991. Chromosome stains. In The ACT Cytogenetics Laboratory


Manual 2nd ed, ed. M.J. Barch. The Association of Cytogenetic Technologists, Raven
Press, New York.

3. Lee M. Silver (1995). Mouse Genetics, Concepts and Applications. Chapter 5.2:
KARYOTYPES, CHROMOSOMES, AND TRANSLOCATIONS. Oxford University Press.
Revised August 2004, January 2008

4. A preparation which includes the dyes Methylene Blue, Eosin Y and Azure-A,B,C

5. Stebbins, G.L. (1950). "Chapter XII: The Karyotype". Variation and evolution in plants.
Columbia University Press. ISBN 9780231017336.

6. King, R.C.; Stansfield, W.D.; Mulligan, P.K. (2006). A dictionary of genetics (7th ed.).
Oxford University Press. p. 242.
7. Judd, Walter S.; Campbell, Christopher S.; Kellogg, Elizabeth A.; Stevens, Peter F.;
Donoghue, Michael J. (2002). Plant systematics, a phylogenetic approach (2 ed.).
Sunderland MA, USA: Sinauer Associates Inc. p. 544. ISBN 0-87893-403-0.

8. "Karyotype, definition". Collins English Dictionary. Retrieved 23 December 2022.

[Phosphatase treatment of
linearized vector]
Phosphatase treatment of the linearized vector:
To limit the self-ligated vector in your transformation.

Materials:
 Linear DNA from the restriction digest
 Antarctic Phosphatase
 10X Antarctic Phosphatase buffer

Procedure:
 Put-on Antarctic Phosphatase buffer to a standard concentration of 1X
 put-on 1μL Antarctic Phosphatase
 Incubate 60m at 37°C
 Heat-deactivation for 5 mins at 65°C.
 Begin directly to ligation step.

References:
1. del Solar, Gloria; Giraldo, Rafael; Ruiz-Echevarría, María Jesús; Espinosa, Manuel; Díaz-
Orejas, Ramón (June 1998). "Replication and Control of Circular Bacterial Plasmids".
Microbiology and Molecular Biology Reviews. 62 (2): 434–464. doi:10.1128/MMBR.62.2.434-
464.1998. ISSN 1092-2172. PMC 98921. PMID 9618448.

2. Hartl DL, Jones EW (1998). Genetics: principles and analysis (4th ed.). Sudbury, Mass.: Jones
and Bartlett Publishers. ISBN 978-0-7637-0489-6. OCLC 45730915.

3. Johnston C, Martin B, Fichant G, Polard P, Claverys JP (March 2014). "Bacterial transformation:


distribution, shared mechanisms and divergent control". Nature Reviews. Microbiology. 12
(3): 181–96. doi:10.1038/nrmicro3199. PMID 24509783. S2CID 23559881.

4. Acquaah G (16 August 2012). Principles of Plant Genetics and Breeding. John Wiley & Sons Inc.
ISBN 978-1-118-31369-5.

5. Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell J (2000). "DNA Cloning with
Plasmid Vectors". Molecular Cell Biology (4th ed.). New York: W. H. Freeman.

[Dnase Protocol]
DNase that catalyzes the hydrolytic cleavage of phosphodiester linkages in the
DNA backbone.

Procedure:
 In order to DNase 20ug of RNA in a 100ul reaction, add reagents in the
following sequence:
 10μL 10X DNase buffer
 78μL dH20
 2μL DNase
 10μL RNA
 incubate at 37° C for 20m
 put-on 0.1 volume resuspended DNase deactivation Reagent
 Incubate 2m
 RT mixing each30s.
 Centrifuge(axis) at 10,000xg for 1m
 move solution to a new tube

References:
1. Bowen RA, Austgen L, Rouge M (20 February 2000). "Restriction Endonucleases and
DNA Modifying Enzymes". Nucleases: DNase and RNase. Biotechnology and Genetic
Engineering. Archived from the original on 5 August 2004. Retrieved 8 January 2017.

2. Varela-Ramirez, Armando; Abendroth, Jan; Mejia, Adrian A.; Phan, Isabelle Q.;
Lorimer, Donald D.; Edwards, Thomas E.; Aguilera, Renato J. (2017-06-02). "Structure
of acid deoxyribonuclease". Nucleic Acids Research. 45 (10): 6217–6227.
doi:10.1093/nar/gkx222. ISSN 0305-1048. PMC 5449587. PMID 28369538.

3. Jones, S. J.; Worrall, A. F.; Connolly, B. A. (1996-12-20). "Site-directed mutagenesis of


the catalytic residues of bovine pancreatic deoxyribonuclease I". Journal of Molecular
Biology. 264 (5): 1154–1163. doi:10.1006/jmbi.1996.0703. ISSN 0022-2836. PMID
9000637.

4. Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden,


Marc (2010-11-18). Levitt, Michael (ed.). "How Cations Can Assist DNase I in DNA
Binding and Hydrolysis". PLOS Computational Biology. 6 (11): e1001000.
Bibcode:2010PLSCB...6E1000G. doi:10.1371/[Link].1001000. ISSN 1553-7358.
PMC 2987838. PMID 21124947.

5. Suck, D.; Oefner, C.; Kabsch, W. (1984). "Three-dimensional structure of bovine


pancreatic DNase I at 2.5 A resolution". The EMBO Journal. 3 (10): 2423–2430.
doi:10.1002/j.1460-2075.1984.tb02149.x. PMC 557703. PMID 6499835
6. Junowicz, E. (1973). "Studies on bovine pancreatic deoxyribonuclease A. II. The
effect of different bivalent metals on the specificity of degradation of DNA".
Biochim. Biophys. Acta. 312 (1): 85–102. doi:10.1016/0005-2787(73)90054-3. PMID
4353710.

[DNA restriction digestion analysis


Protocol]
MATERIALS:
 40µl Plasmid 1
 40µl Plasmid 2
 40µl 4X R.E. Buffer 2
 15µl HindII
 15µl EcoRI
 25µl Sterile Water
 4 Centrifuge Tubes
 1 DNA Loading buffer

PROCEDURE:
 Label four tubes
 Plasmid 1 uncut
 Plasmid 1 digested with HindIII and EcoRI
 Plasmid 2 uncut
 Plasmid 2 digested with HindIII and EcoRI
 Spot the tubes in the ice bucket
 Utilize a clean pipette tip for every reagent, add reagents in following
sequence on ice to avoid cross contamination:
Tube 1 Tube 2 Tube 3 Tube 4
Plasmid 1 20µl 20µl none none
Plasmid 2 none none 20µl 20µl
HindIII none 5µl none 5µl
EcoRI none 5 none 5µl
4x buffer 10µl 10µl 10µl 10µl
Sterile Water 10µl none 10µl none
 Mix the contents of each tube by lightly pipetting 4-5 times

 After the one-hour incubation the DNA is envision by agarose


electrophoresis on a 1% agarose gel
 put-on 10µl DNA loading buffer (6X to 30µl of each sample)
 The agarose gels should have been prepared by yourself

References:
1. Micklos DA, Bloom MV, Freyer GA (1996). Laboratory DNA science: an introduction to
recombinant DNA techniques and methods of genome analysis. Menlo Park, Calif:
Benjamin/Cummings Pub. Co. ISBN 0-8053-3040-2.

2. Primrose SB, Old RW (1994). Principles of gene manipulation: an introduction to


genetic engineering. Oxford: Blackwell Scientific. ISBN 0-632-03712-1.

3. Roberts RJ, Vincze T, Posfai J, Macelis D (January 2007). "REBASE--enzymes and genes
for DNA restriction and modification". Nucleic Acids Research. 35 (Database issue):
D269-70. doi:10.1093/nar/gkl891. PMC 1899104. PMID 17202163.

4. Roberts RJ (April 2005). "How restriction enzymes became the workhorses of


molecular biology". Proceedings of the National Academy of Sciences of the United
States of America. 102 (17): 5905–8. Bibcode:2005PNAS..102.5905R.
doi:10.1073/pnas.0500923102. PMC 1087929. PMID 15840723.

5. Kobayashi I (September 2001). "Behavior of restriction-modification systems as selfish


mobile elements and their impact on genome evolution". Nucleic Acids Research. 29
(18): 3742–56. doi:10.1093/nar/29.18.3742. PMC 55917. PMID 11557807.

6. Krüger DH, Bickle TA (September 1983). "Bacteriophage survival: multiple


mechanisms for avoiding the deoxyribonucleic acid restriction systems of their hosts".
Microbiological Reviews. 47 (3): 345–60. doi:10.1128/MMBR.47.3.345-360.1983.
PMC 281580. PMID 6314109.

7. Arber W, Linn S (1969). "DNA modification and restriction". Annual Review of


Biochemistry. 38: 467–500. doi:10.1146/[Link].38.070169.002343. PMID
4897066

8. Pingoud A, Alves J, Geiger R (1993). "Chapter 8: Restriction Enzymes". In Burrell M


(ed.). Enzymes of Molecular Biology. Methods of Molecular Biology. Vol. 16. Totowa,
NJ: Humana Press. pp. 107–200. ISBN 0-89603-234-5.

9. Kessler C, Manta V (August 1990). "Specificity of restriction endonucleases and DNA


modification methyltransferases a review (Edition 3)". Gene. 92 (1–2): 1–248.
doi:10.1016/0378-1119(90)90486-B. PMID 2172084.

10. Roberts RJ (November 1976). "Restriction endonucleases". CRC Critical Reviews in


Biochemistry. 4 (2): 123–64. doi:10.3109/10409237609105456. PMID 795607.

[REPAIR OF THE END OF THE


ROUGH DNAPROTOCOL]
 Repair of the end of the rough DNA protocol:
 Set a 1.5ml microfuge tube on ice and tag it RE. Take two additional tubes,
one carry ten times dNTP solution, another with 10 times polynucleotide
kinase buffer. The entire reaction volume is [Link] the reaction
mixture in the RE tube

Ingredients Add to Final concentration


reaction(microliter)
Ten times the 5.0 one times
polynucleotide kinase
buffer
Ten times the dNTP 5.0 200.0 μM
solution
Nebulized DNA fragments 30.0 0.06–0.3 μg
(2–10 ngml -1)
ATP 10mM 5.0 1.0mM
T4 polynucleotide kinase 1.0 10.0 units
(10 uml -1)
T4 DNA polymerase (3 uml 1.0 3.0 units
Water Up to 50

 Put-on the required amount of water, Add buffer, 10 times dNTP solution,
DNA mix by micropipette up and down
 Set the reaction by the addition of the couple enzymes, mix by pipetting.
 Incubate for 25min
 Put an end to reactions by the incorporation of 1ml 0.5M EDTA and 50ml
of TE
 Buffer. Mix by pipetting.
 Put-on 100ml of the PCI solution and mix by put upside down the tube
respective times
 to form an emulsion .......... (A)
 shifting 100ml of the repair reaction mixture develop in step A into the
PLG tube
 Centrifuge the PLG tube at 10,000 r.p.m. for 30sec
 Remove the tube from the centrifuge and put-on 100ml of dihydrogen
hexachloroiridate(CIA) solution to the aqueous phase
 Centrifuge the PLG tube at 10,000 r.p.m. for 30sec
 Shifting the aqueous phase, collected from the above the gel, to a new
1.5ml microfuge tube. (aqueous stage 100ml)
 Put-on 50ml of 7.5M ammonium acetate to the tube. Precipitate nucleic
acids by the incorporation (320ml of 95 percent ethanol). mix well
 Centrifuge at high speed for 10min
 Remove the tube from the centrifuge. Drain all the ethanol.
 Clean the pellet with 700ml of cold 70 percent ethanol. Transfer the ethanol
to the side ofthe tube.
 Later the last clean, set the tube into the centrifuge (2-3sec). And Remove
totally ethanol.
 Resuspend the DNA pellet (unable to be seen). in the 4ml of water
 Repeat this process many times. utilize 4ml for ligation, the concluding
concentration ofthe DNA solution will (12ngml –1 see in table)
 Tag the tube U- DNA. Store in a -20°C freezer

References:
1. Wayengera M (2003). "HIV and Gene Therapy: The proposed [R-M enzymatic] model for a
gene therapy against HIV". Makerere Med J. 38: 28–30.

2. Wolff JN, Gemmell NJ (February 2008). "Combining allele-specific fluorescent probes and
restriction assay in real-time PCR to achieve SNP scoring beyond allele ratios of 1:1000".
BioTechniques. 44 (2): 193–4, 196, 199. doi:10.2144/000112719. PMID 18330346.

3. Zhang R, Zhu Z, Zhu H, Nguyen T, Yao F, Xia K, et al. (July 2005). "SNP Cutter: a
comprehensive tool for SNP PCR-RFLP assay design". Nucleic Acids Research. 33 (Web Server
issue): W489-92. doi:10.1093/nar/gki358. PMC 1160119. PMID 15980518.

4. Tebas P, Stein D, Tang WW, Frank I, Wang SQ, Lee G, et al. (March 2014). "Gene editing of
CCR5 in autologous CD4 T cells of persons infected with HIV". The New England Journal of
Medicine. 370 (10): 901–10. doi:10.1056/NEJMoa1300662. PMC 4084652. PMID 24597865.

5. Russell DW, Sambrook J (2001). Molecular cloning: a laboratory manual. Cold Spring Harbor,
N.Y: Cold Spring Harbor Laboratory. ISBN 0-87969-576-5.

6. Revolutionizing Biotechnology with Artificial Restriction Enzymes". Genetic Engineering and


Biotechnology News. 10 February 2017. Retrieved 27 May 2021. (reporting on
Programmable DNA-Guided Artificial Restriction Enzymes)

[Recombinant Protein Purification


Protocol]
MATERIALS:
 50μl GB Lysate
 1 Hydrophobic Column
 8ml 1X HP Loading Buffer
 5ml HP Elution Buffer
 10ml RED660 Protein Assay reagent
 20 Centrifuge Tubes.

PROCEDURE:
 clamp the Hydrophobic Column in an upstanding situation on to a stand
 Open the top cap first and then the bottom cap of the column to stop air
bubbles entering the column. Buffer move out of the column under gravity
to a waste container.
 Balanced the column: put in 2 bed volumes (4ml) of 1X HP Loading
Buffer. Put-on 0.5ml 1X HP Loading Buffer and let the buffer move out
freely in to a waste container. Repeat until all 4ml has been applied.
 Cautiously load 50µl GB Lysate to the column.
 Wash the column 3 times with 0.5ml 1X HP Loading Buffer: put in 0.5ml
1X HP loading Buffer to the column and let the buffer move out into a
waste container
 transport the proteins with 10x0.5ml elution steps: put in 0.5ml HP Elution
Buffer to the column and let the buffer move out a 1.5ml tube
 Gather all 10 fractions separately.
 Observe under the UV light.

RED660 PROTEIN TEST:


 Tag 10 tubes and a 100μl from all elute fraction to the tubes.
 Add the RED660 Protein Assay Reagent lightly by inverting the bottle
several times.
 Mix 1ml RED660 Protein Assay Reagent to each tube and mix by
inverting 5-6 times.
 Observe under the UV light.
References:
1. Brondyk, W. H. (2009). "Chapter 11 Selecting an Appropriate Method for Expressing
a Recombinant Protein". Guide to Protein Purification, 2nd Edition. Methods in
Enzymology. Vol. 463. pp. 131–147. doi:10.1016/S0076-6879(09)63011-1. ISBN
9780123745361. PMID 19892171.
2. Mahmoudi Gomari, Mohammad; Saraygord-Afshari, Neda; Farsimadan, Marziye;
Rostami, Neda; Aghamiri, Shahin; Farajollahia, Mohammad M. (1 December 2020).
"Opportunities and challenges of the tag-assisted protein purification techniques:
Applications in the pharmaceutical industry". Biotechnology Advances. 45: 107653.
doi:10.1016/[Link].2020.107653. ISSN 0734-9750. PMID 33157154. S2CID
226276355.
3. Hannig, G.; Makrides, S. (1998). "Strategies for optimizing heterologous protein
expression in Escherichia coli". Trends in Biotechnology. 16 (2): 54–60.
doi:10.1016/S0167-7799(97)01155-4. PMID 9487731.
4. Russell, David W.; Sambrook, Joseph (2001). Molecular cloning: a laboratory manual.
Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory. ISBN 978-0-87969-576-7
5. Watson, James D. (2007). Recombinant DNA: Genes and Genomes: A Short Course.
San Francisco: W.H. Freeman. ISBN 978-0-7167-2866-5.
6. Berg, Jeremy Mark; Tymoczko, John L.; Stryer, Lubert (2010). Biochemistry, 7th ed.
(Biochemistry (Berg)). W.H. Freeman & Company. ISBN 978-1-4292-2936-4. Fifth edition
available online through the NCBI Bookshelf: link

7. Peter Walter; Alberts, Bruce; Johnson, Alexander S.; Lewis, Julian; Raff, Martin C.;
Roberts, Keith (2008). Molecular Biology of the Cell (5th edition, Extended version).
New York: Garland Science. ISBN 978-0-8153-4111-6.. Fourth edition is available
online through the NCBI Bookshelf: link
8. Rosano, Germán L.; Ceccarelli, Eduardo A. (2014-04-17). "Recombinant protein
expression in Escherichia coli: advances and challenges". Frontiers in Microbiology. 5:
172. doi:10.3389/fmicb.2014.00172. ISSN 1664-302X. PMC 4029002. PMID
24860555.

[Making Competent Bacterial and


Yeast Cells for Transformation]
 Add reagents in the following sequence:
Regents volume
Polyethylene Glycol 10%
Dimethyl Sulfoxide 5%
25mM Calcium Chloride 25mM

 Pipette 100uL of Competent Bacterial Cells mix to a new micro


centrifuge tube.

Single Stranded:
 SS Carrier DNA is known to help or guidance DNA enter into yeast. It is
thought to stop nucleases from digesting the plasmid and also bind to the
yeast cell membrane and plasmid DNA enter to the cell.

References:
1. Gietz RD, Woods RA (2002). "Transformation of yeast by lithium acetate/single-stranded
carrier DNA/polyethylene glycol method". Guide to Yeast Genetics and Molecular and Cell
Biology - Part B. Methods in Enzymology. Vol. 350. pp. 87–96. doi:10.1016/S0076-
6879(02)50957-5. ISBN 9780121822538. PMID 12073338.

2. Kawai S, Hashimoto W, Murata K (1 November 2010). "Transformation of Saccharomyces


cerevisiae and other fungi: methods and possible underlying mechanism". Bioengineered
Bugs. 1 (6): 395–403. doi:10.4161/bbug.1.6.13257. PMC 3056089. PMID 21468206.

3. Srivastava S (2013). Genetics of Bacteria (PDF). India: Springer-Verlag. doi:10.1007/978-81-


322-1090-0. ISBN 978-81-322-1089-4. S2CID 35917467.

4. Donahue RA, Bloom FR (July 1998). "Large-volume transformation with high-throughput


efficiency chemically competent cells" (PDF). Focus. Vol. 20, no. 2. pp. 54–56. OCLC 12352630.
Archived from the original (PDF) on 2013-03-06 – via Invitrogen.[unreliable source?]

5. Albertini S, Chételat AA, Miller B, Muster W, Pujadas E, Strobel R, Gocke E (July 1995).
"Genotoxicity of 17 gyrase- and four mammalian topoisomerase II-poisons in prokaryotic and
eukaryotic test systems". Mutagenesis. 10 (4): 343–51. doi:10.1093/mutage/10.4.343. PMID
7476271.

[ISOLATION OF
BACTERIOPHAGE FROM
SEWAGE PROTOCOL]
 Gather the raw sewage from sewage treatment
 Mix the sewage (100 ml) along 10 ml of 10× nutrient phage broth,10
ml of e. coli suspension
 Incubate the mixture on 37°c for 24h
 Centrifuge the sewage at 2500 rpm round about 10 min
 Repeat the process more than once to acquire the filter
 Filter the supernatant utilizing the membrane filter (0.45 μm)
 Shift aseptically the final filtrate so acquire into a pre-sterilized flask
 Incubate both of them cultures at 37°c, shaking for 24 h.
 Obtain four tubes of soft nutrient agar of jelly-like substance, remain
on a water bath at 50°c. tag them as 1, 2, 3, , 4
 Pour 1 ml filtrate in tube 1, 2 ml filtrate in a tube 2, and 4 ml in a
tube 3 and remain tube 4 as blank having no filtrate
 Inoculate all the given tubes with 0.5 ml in e. coli, pour into petri
dishes formerly carry hard agar and tag them 1, 2, 3, 4.
 After the medium is solidified, an incubator for several hours and
observe for plaque formation

References:
1. Takahashi I, Marmur J (February 1963). "Replacement of thymidylic acid by deoxyuridylic acid
in the deoxyribonucleic acid of a transducing phage for Bacillus subtilis". Nature. 197 (4869):
794–5. Bibcode:1963Natur.197..794T. doi:10.1038/197794a0. PMID 13980287. S2CID
4166988

2. Häuser R, Blasche S, Dokland T, Haggård-Ljungquist E, von Brunn A, Salas M, et al. (2012).


"Bacteriophage protein-protein interactions". Advances in Virus Research. 83: 219–98.
doi:10.1016/B978-0-12-394438-2.00006-2. ISBN 9780123944382. PMC 3461333. PMID
22748812.

3. Morris P, Marinelli LJ, Jacobs-Sera D, Hendrix RW, Hatfull GF (March 2008). "Genomic
characterization of mycobacteriophage Giles: evidence for phage acquisition of host DNA by
illegitimate recombination". Journal of Bacteriology. 190 (6): 2172–82. doi:10.1128/JB.01657-
07. PMC 2258872. PMID 18178732.

4. Al-Shayeb B, Sachdeva R, Chen LX, Ward F, Munk P, Devoto A, et al. (February 2020). "Clades
of huge phages from across Earth's ecosystems". Nature. 578 (7795): 425–431.
Bibcode:2020Natur.578..425A. doi:10.1038/s41586-020-2007-4. PMC 7162821. PMID
32051592.

5. Petrov AS, Harvey SC (July 2008). "Packaging double-helical DNA into viral capsids: structures,
forces, and energetics". Biophysical Journal. 95 (2): 497–502. Bibcode:2008BpJ....95..497P.
doi:10.1529/biophysj.108.131797. PMC 2440449. PMID 18487310.

[EXTRACTION PROTEINS FROM E.


COLI]
 Inoculate one colony of E. coli along with 10 ml LB and aerate
overnight. at 100 rpm at 37°C for round about 8- 12 hours
 Shift 1m l of the overnight grown culture to a micro centrifuge tube,
harvesting at 12000 rpm at 4°C
 Discard the supernatant by aspiration goes away from the bacterial
pellet as dry as viable.
 Re-suspend the pellet, vertexing in 25µl of germ-free water
 Put-on 25µl of 2X SDS gel loading buffer
 vortex for 20, 30 seconds
 Set the tube in a boiling water bath for 5min.
 Centrifuge at 12,000rpm
 Diffuse the pellet in 25µl f 2X SDS loading buffer, store at 4°C

References:
1. Darnton NC, Turner L, Rojevsky S, Berg HC (March 2007). "On torque and tumbling in
swimming Escherichia coli". Journal of Bacteriology. 189 (5): 1756–64. doi:10.1128/JB.01501-
06. PMC 1855780. PMID 17189361.

2. Kubitschek HE (January 1990). "Cell volume increase in Escherichia coli after shifts to richer
media". Journal of Bacteriology. 172 (1): 94–101. doi:10.1128/jb.172.1.94-101.1990. PMC
208405. PMID 2403552

3. Yu AC, Loo JF, Yu S, Kong SK, Chan TF (January 2014). "Monitoring bacterial growth using
tunable resistive pulse sensing with a pore-based technique". Applied Microbiology and
Biotechnology. 98 (2): 855–62. doi:10.1007/s00253-013-5377-9. PMID 24287933. S2CID
2956197.

4. Bacteria". Microbiologyonline. Archived from the original on 27 February 2014. Retrieved 27


February 2014.

5. Montealegre MC, Roy S, Böni F, Hossain MI, Navab-Daneshmand T, Caduff L, et al. (December
2018). "Risk Factors for Detection, Survival, and Growth of Antibiotic-Resistant and Pathogenic
Escherichia coli in Household Soils in Rural Bangladesh". Applied and Environmental
Microbiology. 84 (24): e01978–18. Bibcode:2018ApEnM..84E1978M.
doi:10.1128/AEM.01978-18. PMC 6275341. PMID 30315075.

6. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, et al. (June 2005).
"Diversity of the human intestinal microbial flora". Science. 308 (5728): 1635–38.
Bibcode:2005Sci...308.1635E. doi:10.1126/science.1110591. PMC 1395357. PMID 15831718.

7. Tenaillon O, Skurnik D, Picard B, Denamur E (March 2010). "The population genetics of


commensal Escherichia coli". Nature Reviews. Microbiology. 8 (3): 207–17.
doi:10.1038/nrmicro2298. PMID 20157339. S2CID 5490303.
[Exon trapping protocol]
Exon Trapping protocol (Gibco-BRL):
 Digest 200 ng of the refine YAC DNA with one of the given endonuclease
restriction enzymes :( EcoRI, XhoI, NotI, XmaIII, PstI, and BamHI).
 Incubate at 37°C (3 h)
 Extract the DNA
 Clean the DNA pellet with 200 µL of 70% ethanol.
 Dissolve up the DNA in 10 µL of TE buffer
 Digest 100 ng of pSPLs vector DNAs (DNA digestive enzyme)
 Serve the digestive pSPLs DNA with phosphatase for dephosphorylation
 Refine the DNA by using agarose gel electrophoresis.
 Pool 100 ng of the digestive YAC
 100 ng of the digested vector DNAs for ligation
YAC 100 ng
Vector 100 ng
10 X ligation buffer 2 µL
ligase (4 units) 1 µL
Water 20 µL

 Incubate at 16°C (overnight)


 Shift the YAC/pSPL3 plasmid to DH10B
 Amplify and refine the YAC/pSPL3 plasmid DNAs by using miniprep
 Shift 1 µg of the YAC/pSPL3 plasmid DNAs into COS-7 cells (cell line
acceptable for transfection) utilize the Lipofectace
 Isolate the RNA
 Utilize 2–4 µg of the RNA for first-strand cDNA synthesis
 Perform PCR amplification.
References:
1. Guo Lei, Liu Chun-Ming (2015). "A single-nucleotide exon found in Arabidopsis". Scientific
Reports. 5: 18087. Bibcode:2015NatSR...518087G. doi:10.1038/srep18087. PMC 4674806.
PMID 26657562.

2. Sakharkar M, Passetti F, de Souza JE, Long M, de Souza SJ (2002). "ExInt: an Exon Intron
Database". Nucleic Acids Res. 30 (1): 191–4. doi:10.1093/nar/30.1.191. PMC 99089. PMID
11752290.

3. Liu AY, Van der Ploeg LH, Rijsewijk FA, Borst P (June 1983). "The transposition unit of variant
surface glycoprotein gene 118 of Trypanosoma brucei. Presence of repeated elements at its
border and absence of promoter-associated sequences". Journal of Molecular Biology. 167
(1): 57–75. doi:10.1016/S0022-2836(83)80034-5. PMID 6306255.

4. Gilbert W (February 1978). "Why genes in pieces?". Nature. 271 (5645): 501.
Bibcode:1978Natur.271..501G. doi:10.1038/271501a0. PMID 622185.
5. Valenzuela P, Venegas A, Weinberg F, Bishop R, Rutter WJ (January 1978). "Structure of
yeast phenylalanine-tRNA genes: an intervening DNA segment within the region coding for
the tRNA". Proceedings of the National Academy of Sciences of the United States of
America. 75 (1): 190–4. Bibcode:1978PNAS...75..190V. doi:10.1073/pnas.75.1.190. PMC
411211. PMID 343104.

6. Kister KP, Eckert WA (March 1987). "Characterization of an authentic intermediate in the self-
splicing process of ribosomal precursor RNA in macronuclei of Tetrahymena thermophila".
Nucleic Acids Research. 15 (5): 1905–20. doi:10.1093/nar/15.5.1905. PMC 340607. PMID
3645543.

[Cas9 nuclease functional testing


protocol]
Cas9 nuclease functional testing protocol:
 Position a 30 µl reaction along micro centrifuge tube on ice with the
following sequence:
Component 20 µl Reaction
Target DNA x µl (~100 ng)
sgRNA x µl (~4000 ng)
10X Cas9 Reaction Buffer 3.0 µl
Cas9 Nuclease 1.0 µl
H2O 30.0 µl
 Softly mix the reaction mixture and centrifuge it

 Incubate at 37°C for 60 min.


 Put-on 1 µl RNase (4 mg/ml)
 Incubate at 37°C for 20min
 Running an Agarose Gel.

References:
1. Zhang F, Wen Y, Guo X (2014). "CRISPR/Cas9 for genome editing: progress, implications and
challenges". Human Molecular Genetics. 23 (R1): R40–6. doi:10.1093/hmg/ddu125. PMID
24651067.
2. Bak RO, Gomez-Ospina N, Porteus MH (August 2018). "Gene Editing on Center Stage".
Trends in Genetics. 34 (8): 600–611. doi:10.1016/[Link].2018.05.004. PMID 29908711. S2CID
49269023.

3. Horvath P, Barrangou R (January 2010). "CRISPR/Cas, the immune system of bacteria and
archaea". Science. 327 (5962): 167–170. Bibcode:2010Sci...327..167H.
doi:10.1126/science.1179555. PMID 20056882. S2CID 17960960.

4. Hille F, Richter H, Wong SP, Bratovič M, Ressel S, Charpentier E (March 2018). "The Biology
of CRISPR-Cas: Backward and Forward". Cell. 172 (6): 1239–1259.
doi:10.1016/[Link].2017.11.032. hdl:21.11116/0000-0003-FC0D-4. PMID 29522745. S2CID
3777503.

5. Marraffini LA, Sontheimer EJ (December 2008). "CRISPR interference limits horizontal gene
transfer in staphylococci by targeting DNA". Science. 322 (5909): 1843–1845.
Bibcode:2008Sci...322.1843M. doi:10.1126/science.1165771. PMC 2695655. PMID
19095942.

6. doi:10.1136/archdischild-2016-310459. PMC 4975809. PMID 27059283.


7. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, et al. (March 2007).
"CRISPR provides acquired resistance against viruses in prokaryotes". Science. 315 (5819):
1709–1712. Bibcode:2007Sci...315.1709B. doi:10.1126/science.1138140.
hdl:20.500.11794/38902. PMID 17379808. S2CID 3888761. (registration required)

[CRISPR-BACTERIAL
PROTOCOL]
Making plates:
 Take an Agar media, such as “LB Agar Media”, “LB Strep/Kan Agar
Media” and discard its contents into the 250mL glass bottle
 utilize the 50mL conical tube add 150mL of water to the glass bottle
 Heat the agar to dissolve it, then it will harden when it cools
 pour the seven plates
 store in your fridge at 4ºC

Making competent bacteria:


 Add reagents in the following sequence:

Polyethylene Glycol 10%


Dimethyl Sulfoxide 5%
25mM Calcium Chloride 25mM

 Streak out a new plate of bacteria using an inoculation loop and let it
grow overnight
 100uL of Transformation mix to a new micro centrifuge tube
 Utilize an inoculation loop, soothing scrape some bacteria off of your
fresh plate and mix it into the transformation mix. Mix until any big
cluster have disappeared.
DNA Transformation & CRISPR:
 Find the DNA tube tag “Cas9 and tracrRNA” and, utilize your
pipette, put-on 10uL to your competent cell mixture
 Find the DNA tube tag “crRNA” and, utilize your pipette, add 10uL
to the same competent cell mixture
 Find the DNA tube tag “Template DNA” and, utilize your pipette,
add 10uL to the same competent cell mixture
 Incubate tube in the fridge for 30 minutes
 Incubate the tube for 30 seconds in 42ºC water
 Put-on 1mL water to one of the LB media microcentrifuge tubes and
waggle to dissolve the LB.
 utilize the pipette, put-on 100uL of LB media to your competent cell
mixture containing your DNA
 Incubate the tube at 37C for 1 hour
 utilize the pipette, put-on100uL of your CRISPR transformation
mixture on top of an LB Strep/Kan Agar plate
 utilize an inoculation loop, softly spread the bacteria around the plate
and let dry for 10 minutes
 Incubate the plate at 37ºC for 16-24 hours

CRISPRCas9 mutation detection with miss cleavage:


CRISPRCas9 is utilizing for selected mutagenesis. The investigation of mutants
obtained utilize CRISPRCas9 requires particular methods for mutation detection
and the enzyme mismatch cleavage technique is used for this purpose. T7
Endonuclease (cleaves non-perfectly matched DNA) to detect on-selected
CRISPRCas9 editing events in cells. The PCR by-product is denatured and
annealed to construct hetero-duplex mismatches where double-strand breaks have
to happen, resulting in insertion, deletion.

Procedure:
 Delicately aspirate the media from the cells and clean once with 100 μl
1X PBS
 collect the cells and extract genomic DNA using the method of choice
 Govern DNA concentration

Amplification reactions:
 Set up and run the PCR utilize a template, primers, and element of the
MethylTaq polymerase
 50 μl reaction:

Components Amount
MethylTaq 10x buffer 5 µl
--------------------------------------------------
dNTPs (5 mM stock solution): 2 µl

Genomic DNA template 100 ng

Primers 0.1 nmol

MgCl2 (25 mM stock solution) 4 µl

MethylTaq DNA polymerase (5U/µl) 1 to 2.5 units

 Nuclease-free H2O (50 µl)

Cycling condition:
steps condition cycles
MethylTaqDNA 10 min at 95°C 1

polymerase activation 30 sec at 95°C 35


Denaturation
Annealing 1 min, temperature depends on 35
Primers Tm
Elongation 1 min at 72°C 35
Final extension 5 min at 72°C 1

Heteroduplex development:
 200 ng of the amplified DNA
 T7 Endonuclease use 10 µ

Components Amount
PCR 10 µl or 200 ng
10X NEBuffer 2* 2 µl
Nuclease free H2O Up To 19 µl

 supply with T7 Endonuclease I from NEB


 Denature and anneal the products
Cycle step Temperature Ramp rate Time
Initial 95°C 5min
denaturation
Annealing 95-85°C -2°C/ second
85-25°C 0.1°C/second
Hold 4°C

Hetero duplex digestion:


 10 µl of the unrefined PCR
 250 ng of amplified DNA
Components Amount
Annealed PCR product 19 µl
T7 Endonuclease I (5 units/µl) 1 µl

 Mix ably and briefly spin


 incubate each and every reaction at 37°C for 15min
 Stop the reaction by adding 1 µl of EDTA 0.5 M
 finish the reaction by adding 1 µl of EDTA 0.5 M
 Proceed fragment in gel electrophoresis

Hetero duplex:
A hetero duplex is a double-stranded molecule of nucleic acid arise through the
genetic recombination of single complementary strands obtain from the different
origin such as from different homologous chromosomes or even from a different
organism

References:
1. Gesner EM, Schellenberg MJ, Garside EL, George MM, Macmillan AM (June 2011).
"Recognition and maturation of effector RNAs in a CRISPR interference pathway". Nature
Structural & Molecular Biology. 18 (6): 688–692. doi:10.1038/nsmb.2042. PMID 21572444.
S2CID 677704.
2. Datsenko KA, Pougach K, Tikhonov A, Wanner BL, Severinov K, Semenova E (July 2012).
"Molecular memory of prior infections activates the CRISPR/Cas adaptive bacterial immunity
system". Nature Communications. 3: 945. Bibcode:2012NatCo...3..945D.
doi:10.1038/ncomms1937. PMID 22781758.
3. Goren MG, Yosef I, Auster O, Qimron U (October 2012). "Experimental definition of a clustered
regularly interspaced short palindromic duplicon in Escherichia coli". Journal of Molecular
Biology. 423 (1): 14–16. doi:10.1016/[Link].2012.06.037. PMID 22771574.
4. Pride DT, Sun CL, Salzman J, Rao N, Loomer P, Armitage GC, et al. (January 2011). "Analysis of
streptococcal CRISPRs from human saliva reveals substantial sequence diversity within and
between subjects over time". Genome Research. 21 (1): 126–136.
doi:10.1101/gr.111732.110. PMC 3012920. PMID 21149389.
5. Andersson AF, Banfield JF (May 2008). "Virus population dynamics and acquired virus
resistance in natural microbial communities". Science. 320 (5879): 1047–1050.
Bibcode:2008Sci...320.1047A. doi:10.1126/science.1157358. PMID 18497291. S2CID
26209623.
6. Shah SA, Erdmann S, Mojica FJ, Garrett RA (May 2013). "Protospacer recognition motifs: mixed
identities and functional diversity". RNA Biology. 10 (5): 891–899. doi:10.4161/rna.23764.
PMC 3737346. PMID 23403393.
7. Erdmann S, Garrett RA (September 2012). "Selective and hyperactive uptake of foreign DNA
by adaptive immune systems of an archaeon via two distinct mechanisms". Molecular
Microbiology. 85 (6): 1044–1056. doi:10.1111/j.1365-2958.2012.08171.x. PMC 3468723.
PMID 22834906.
8. Díez-Villaseñor C, Guzmán NM, Almendros C, García-Martínez J, Mojica FJ (May 2013).
"CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities
among CRISPR-Cas I-E variants of Escherichia coli". RNA Biology. 10 (5): 792–802.
doi:10.4161/rna.24023. PMC 3737337. PMID 23445770.
9. Shah SA, Hansen NR, Garrett RA (February 2009). "Distribution of CRISPR spacer matches in
viruses and plasmids of crenarchaeal acidothermophiles and implications for their inhibitory
mechanism". Biochemical Society Transactions. 37 (Pt 1): 23–28. doi:10.1042/BST0370023.
PMID 19143596. S2CID 19093261
10. Lillestøl RK, Shah SA, Brügger K, Redder P, Phan H, Christiansen J, Garrett RA (April 2009).
"CRISPR families of the crenarchaeal genus Sulfolobus: bidirectional transcription and dynamic
properties". Molecular Microbiology. 72 (1): 259–272. doi:10.1111/j.1365-
2958.2009.06641.x. PMID 19239620. S2CID 36258923.
11. Mojica FJ, Díez-Villaseñor C, García-Martínez J, Almendros C (March 2009). "Short motif
sequences determine the targets of the prokaryotic CRISPR defence system". Microbiology.
155 (Pt 3): 733–740. doi:10.1099/mic.0.023960-0. PMID 19246744.

12. Deveau H, Barrangou R, Garneau JE, Labonté J, Fremaux C, Boyaval P, Romero DA, Horvath
P, Moineau S (February 2008). "Phage response to CRISPR-encoded resistance in
Streptococcus thermophilus". Journal of Bacteriology. 190 (4): 1390–1400.
doi:10.1128/JB.01412-07. PMC 2238228. PMID 18065545.

13. Horvath P, Romero DA, Coûté-Monvoisin AC, Richards M, Deveau H, Moineau S, et al.
(February 2008). "Diversity, activity, and evolution of CRISPR loci in Streptococcus
thermophilus". Journal of Bacteriology. 190 (4): 1401–1412. doi:10.1128/JB.01415-07. PMC
2238196. PMID 18065539.

14. Nuñez JK, Harrington LB, Kranzusch PJ, Engelman AN, Doudna JA (November 2015). "Foreign
DNA capture during CRISPR-Cas adaptive immunity". Nature. 527 (7579): 535–538.
Bibcode:2015Natur.527..535N. doi:10.1038/nature15760. PMC 4662619. PMID 26503043

15. Sorek R, Lawrence CM, Wiedenheft B (2013). "CRISPR-mediated adaptive immune systems in
bacteria and archaea". Annual Review of Biochemistry. 82 (1): 237–266.
doi:10.1146/annurev-biochem-072911-172315. PMID 23495939.

16. Fagerlund RD, Wilkinson ME, Klykov O, Barendregt A, Pearce FG, Kieper SN, Maxwell HW,
Capolupo A, Heck AJ, Krause KL, Bostina M, Scheltema RA, Staals RH, Fineran PC (June 2017).
"Spacer capture and integration by a type I-F Cas1-Cas2–3 CRISPR adaptation complex".
Proceedings of the National Academy of Sciences of the United States of America. 114 (26):
E5122–E5128. doi:10.1073/pnas.1618421114. PMC 5495228. PMID 28611213
[Cloning gRNA into lent virus
vector protocol]
Annealing:

ddH2O 23μL
100uM top oligo 1μL
100uM bottom oligo 1μL
2X Annealing Buffer 25μL
total reaction volume 50μL
 Incubate for 5min at 95°C

 Prepare a 1:40 dilution of annealing oligos in ddH2O


 2X annealing buffer:

Potassium acetate 200mM


HEPES-KOH (PH 7.4) 60mM
Magnesium acetate 4mM

Ligation:
digested vector(BstXI and BlpI) 10ng
1:40 diluted annealed oligo 1μL
10X T4 ligase buffer 1μL
T4 ligase 1μL
ddH2O --------------------------
total reaction volume 10μL
 Incubate for 2-4hr at RT
 Shift into 2.5μL DH5α bacteria
References:
1. Rollie C, Graham S, Rouillon C, White MF (February 2018). "Prespacer processing and specific
integration in a Type I-A CRISPR system". Nucleic Acids Research. 46 (3): 1007–1020.
doi:10.1093/nar/gkx1232. PMC 5815122. PMID 29228332.

2. Nuñez JK, Bai L, Harrington LB, Hinder TL, Doudna JA (June 2016). "CRISPR Immunological
Memory Requires a Host Factor for Specificity". Molecular Cell. 62 (6): 824–833.
doi:10.1016/[Link].2016.04.027. PMID 27211867.

3. Wang J, Li J, Zhao H, Sheng G, Wang M, Yin M, Wang Y (November 2015). "Structural and
Mechanistic Basis of PAM-Dependent Spacer Acquisition in CRISPR-Cas Systems". Cell. 163
(4): 840–853. doi:10.1016/[Link].2015.10.008. PMID 26478180.

4. Nuñez JK, Kranzusch PJ, Noeske J, Wright AV, Davies CW, Doudna JA (June 2014). "Cas1-Cas2
complex formation mediates spacer acquisition during CRISPR-Cas adaptive immunity".
Nature Structural & Molecular Biology. 21 (6): 528–534. doi:10.1038/nsmb.2820. PMC
4075942. PMID 24793649.

5. Samai P, Smith P, Shuman S (December 2010). "Structure of a CRISPR-associated protein


Cas2 from Desulfovibrio vulgaris". Acta Crystallographica Section F. 66 (Pt 12): 1552–1556.
doi:10.1107/S1744309110039801. PMC 2998353. PMID 21139194.

6. Wiedenheft B, Zhou K, Jinek M, Coyle SM, Ma W, Doudna JA (June 2009). "Structural basis
for DNase activity of a conserved protein implicated in CRISPR-mediated genome defense".
Structure. 17 (6): 904–912. doi:10.1016/[Link].2009.03.019. PMID 19523907

[DIY ANTIBIOTIC PROTOCOL]


(Research Natural Antibiotic)
 Plates
 Mortar and Pestle
 Cell Spreader
 Filter Paper
 15mL Culture Tubes with LB Media, 15ml Tubes with LB AGAR
 Empty 15mL Culture Tubes
 50mL tube with Tris Buffer
 Tweezer
 Plastic Pipettes

Procedure:
 Take a tube marked Agar media, such as “LB Agar Media” and Throw
away its contents into the 250mL glass bottle.
 Utilizing the 50mL conical tube add 150mL of water to the glass bottle
 Making agar, Heat the bottle in the microwave for 30 seconds
 When the liquid looks yellow. This must take about 2 -3 minutes
 Take the bottle out and let it cool
 pour the seven plates
 Place your sample in the mortar, put-on buffer using the plastic pipette
and then crush
 Take a new pipette and put-on a some drops of bacteria from culture you
started in a previous day and spread over the whole plate using the plate
spreader
 Allow the bacteria dry on the plate before you continue
 Tag the back of the plate in 8 different sections one section for your
antibacterial control and one section for your buffer control
 Using tweezers take a paper disc and permit it to take up a drop of each
sample.
 Control sections add a drop from your buffer tube and antibiotic control
tube (Kan) on paper discs and put them in their sections on the plate
 Observe after 12 hours and 18 hours, Bacterial growth able to be seen on
the plate. A clear ring should form around your antibiotic control and your
buffer control should have no effect

References:
1. Gould, Kate (1 March 2016). "Antibiotics: from prehistory to the present day". Journal
of Antimicrobial Chemotherapy. 71 (3): 572–575. doi:10.1093/jac/dkv484. ISSN 0305-
7453. PMID 26851273.
2. Laxminarayan R, Duse A, Wattal C, Zaidi AK, Wertheim HF, Sumpradit N, et al.
(December 2013). "Antibiotic resistance-the need for global solutions". The Lancet.
Infectious Diseases. 13 (12): 1057–98. doi:10.1016/S1473-3099(13)70318-9.
hdl:10161/8996. PMID 24252483.
3. Antimicrobial resistance: global report on surveillance (PDF). The World Health Organization.
April 2014. ISBN 978-92-4-156474-8. Retrieved 13 June 2016.

4. Murray, Christopher JL; Ikuta, Kevin Shunji; Sharara, Fablina; Swetschinski, Lucien;
Aguilar, Gisela Robles; Gray, Authia; Han, Chieh; Bisignano, Catherine; Rao, Puja;
Wool, Eve; Johnson, Sarah C. (12 February 2022). "Global burden of bacterial
antimicrobial resistance in 2019: a systematic analysis". The Lancet. 399 (10325): 629–
655. doi:10.1016/S0140-6736(21)02724-0. ISSN 0140-6736. PMC 8841637. PMID
35065702.
5. General Background: Antibiotic Agents". Alliance for the Prudent Use of Antibiotics.
Archived from the original on 14 December 2014. Retrieved 21 December 2014.
6. Foster W, Raoult A (December 1974). "Early descriptions of antibiosis". The Journal of
the Royal College of General Practitioners. 24 (149): 889–94. PMC 2157443. PMID
4618289.

[ELECTROPORATION
PROTOCOL]
Electroporation is a technique in which an electrical field is provided to cells to
increase the permeability of the cell membrane.

Procedure:
 Assemble 3*106 cells and spin cells at 800 rpm for 5 minutes
 Drain supernatant and clean cells with PBS. Spin cells once more
 Re-suspend cells, 65 μl electroporation buffer. (C)
 Mix 16 μl Cas9 nuclease ............ (A)
 4 μl annealed crRNA : tracRNA .........(A)
 sgRNA 1.5 ml EP tube ............ (A)
 put-on electroporation buffer in the tube of volume 65 μl and mix
lightly, Incubate(10min) at room temperature
 Mix the solution of step A and the resuspended cells of step C lightly
incubate at 10 min. (U)
 shifting the mixture of step U to the electroporation tube
 Electroporate suitable voltage: 700V
 Gather the cells about 48-72 hours after transfection

References:
1. Al-Sakere B, André F, Bernat C, Connault E, Opolon P, Davalos RV, Rubinsky B, Mir LM
(November 2007). "Tumor ablation with irreversible electroporation". PLO
2. Vilquin JT, Kennel PF, Paturneau-Jouas M, Chapdelaine P, Boissel N, Delaère P,
Tremblay JP, Scherman D, Fiszman MY, Schwartz K (July 2001). "Electrotransfer of
naked DNA in the skeletal muscles of animal models of muscular dystrophies". Gene
Therapy. 8 (14): 1097–107. doi:10.1038/[Link].3301484. PMID 11526457. S2CID
1081582.
3. Chuang IC, Jhao CM, Yang CH, Chang HC, Wang CW, Lu CY, Chang YJ, Lin SH, Huang PL,
Yang LC (2004). "Intramuscular electroporation with the pro-opiomelanocortin gene
in rat adjuvant arthritis". Arthritis Research & Therapy. 6 (1): R7–R14.
doi:10.1186/ar1014. PMC 400409. PMID 14979933.
4. Heller LC, Coppola D (October 2002). "Electrically mediated delivery of vector plasmid
DNA elicits an antitumor effect". Gene Therapy. 9 (19): 1321–5.
doi:10.1038/[Link].3301802. PMID 12224015.
5. Titomirov AV, Sukharev S, Kistanova E (January 1991). "In vivo electroporation and
stable transformation of skin cells of newborn mice by plasmid DNA". Biochimica et
Biophysica Acta (BBA) - Gene Structure and Expression. 1088 (1): 131–4.
doi:10.1016/0167-4781(91)90162-F. PMID 1703441.
6. Saito, Tetsuichiro (2010), Embryonic In Vivo Electroporation in the Mouse, Methods in
Enzymology, vol. 477, Elsevier, pp. 37–50, doi:10.1016/s0076-6879(10)77003-8, ISBN 978-0-
12-384880-2, PMID 20699135, retrieved 2022-09-19
[DNA library preparation]
DNA library:
A DNA library is a group of DNA piece that have been cloned into vectors. There
are basically two types of libraries:
 genomic DNA
 CDNA libraries

DNA library preparation:


Once the cDNA is acquired, the use of restriction enzymes is necessitating to
create complementary ends in the vector and in the DNA fragments.

Steps of DNA library preparation


 Restriction digestion
 plasmid restriction digestion
 Cloning

Restriction digestion:
 200 μl tube add 2 μl of cDNA or genomic DNA
 Put-on 15 μl of DEPC-treated water
 Put-on 2 μl of restriction enzyme buffer (10x)
 Put-on 1μlof restriction enzyme
 Incubate for 2h at actual temperature correspondingly the restriction
enzyme selected
 deactivate the restriction enzyme at high temperature: normally 20 min at
65 ºC

Plasmid restriction digestion:


 200 μl tube add 2 μl of vector (100 ng/μl)
 Put-on15 μl of DEPC-treated water
 Put-on 2 μl of restriction enzyme buffer (10x)
 Put-on 1 μl of restriction enzyme
 Incubate for 2h at actual temperature correspondingly the restriction
enzyme selected
 Inactivate the restriction enzyme at high temperature : normally 20 min at
65 ºC

Cloning:
 200μl tube add 5 μl of digested cDNA
 Put-on 3 μl of digested vector
 Put-on 1 μl of ligase buffer (10x)
 Put-on 1 μl of ligase enzyme
 Incubate at 4ºC whole night
 Use 5μl of the ligation solution to transform host capable cells

References:
1. Wang, Tian-Wen; Zhu, Hu; Ma, Xing-Yuan; Zhang, Ting; Ma, Yu-Shu; Wei, Dong-Zhi (2006-09-
01). "Mutant library construction in directed molecular evolution". Molecular Biotechnology.
34 (1): 55–68. doi:10.1385/MB:34:1:55. ISSN 1559-0305. PMID 16943572. S2CID 44393645.

2. Jones DD (May 2005). "Triplet nucleotide removal at random positions in a target gene: the
tolerance of TEM-1 beta-lactamase to an amino acid deletion". Nucleic Acids Research. 33 (9):
e80. doi:10.1093/nar/gni077. PMC 1129029. PMID 15897323.

3. Crameri A, Raillard SA, Bermudez E, Stemmer WP (January 1998). "DNA shuffling of a family
of genes from diverse species accelerates directed evolution". Nature. 391 (6664): 288–91.
Bibcode:1998Natur.391..288C. doi:10.1038/34663. PMID 9440693. S2CID 4352696

4. McCullum, Elizabeth O.; Williams, Berea A. R.; Zhang, Jinglei; Chaput, John C. (2010), Braman,
Jeff (ed.), "Random Mutagenesis by Error-Prone PCR", In Vitro Mutagenesis Protocols: Third
Edition, Methods in Molecular Biology, Humana Press, vol. 634, pp. 103–109,
doi:10.1007/978-1-60761-652-8_7, ISBN 9781607616528, PMID 20676978

5. Wajapeyee, Narendra; Liu, Alex Y.; Forloni, Matteo (2018-03-01). "Random Mutagenesis Using
Error-Prone DNA Polymerases". Cold Spring Harbor Protocols. 2018 (3): pdb.prot097741.
doi:10.1101/pdb.prot097741. ISSN 1940-3402. PMID 29496818.

[DNA Synthesis from Oligos


protocol]
DNA Synthesis from Oligos protocol: LCR Synthesis Procedure:
 Design oligos for your desire gene
 Dilute the oligos up to 100uM
 Kinase(catalyzes the shifting of phosphate group) the oligos.
 For Thermostable Taq Ligase(10-25 cycles)
 For T4 ligase(5-10 cycles)
 95°C denature, 15 sec
 45-55°C anneal, 30 sec
 20°C ligate
 Gel extract
 Cloning

References:
1. Hoshika, Shuichi (2020). "Hachimoji DNA and RNA. A Genetic System with Eight Building
Blocks". Science. 363 (6429): 884–887. doi:10.1126/science.aat0971. PMC 6413494. PMID
30792304.

2. Tabatabaei, S. Kasra (2020). "DNA punch cards for storing data on native DNA sequences via
enzymatic nicking". Nature Communications. 11 (1): 1742. doi:10.1038/s41467-020-15588-z.
PMC 7142088. PMID 32269230.

3. Perkel, Jeffrey M. (2019). "The race for enzymatic DNA synthesis heats up". Nature. 566
(7745): 565. doi:10.1038/d41586-019-00682-0. PMID 30804572.
4. Palluk, Sebastian; Arlow, Daniel H; et al. (2018). "De novo DNA synthesis using polymerase-
nucleotide conjugates". Nature Biotechnology. 36 (7): 645–650. doi:10.1038/nbt.4173. OSTI
1461176. PMID 29912208. S2CID 49271982.

5. Fikes, Bradley J. (May 8, 2014). "Life engineered with expanded genetic code". San Diego
Union Tribune. Archived from the original on 9 May 2014. Retrieved 8 May 2014.

6. Forloni, M (2018). "Random Mutagenesis Using Error-prone DNA Polymerases". Cold Spring
Harbor Protocols. 2018 (3): pdb.prot097741. doi:10.1101/pdb.prot097741. PMID 29496818.

7. Bachman, Julia (2013). "Chapter Two - Reverse-Transcription PCR (RT-PCR)". Methods in


Enzymology. 530: 67–74. doi:10.1016/B978-0-12-420037-1.00002-6. PMID 24034314.

[Engineer any bacteria to


Fluoresce]
Materials:
 Two microtubes
 6 disposable pipets
 6 disposable inoculating loops
 bacterial waste container
 2 LB + AMP plates

 water bath
 streak plates of E. coli
 pGREEN plasmid
 distilled water
 37 C incubator

Procedure:
Label one sterile microtube “A”. Mark another “B”.
 Utilize a micropipette, add 250 μl of CaCl2 solution (50 mM) to each tube
 Utilize a sterile plastic loop to shift one or more than one 3 mm bacterial
colonies from the streak plate to the “A” tube.
 Close the tube lid and place the tube on ice
 Utilize a new sterile loop to shift a mass of bacteria to the “B“ tube
 Add 10ul of pGREEN directly into your “A”
 Come back the “A and B” tube to the ice. Incubate both tubes on ice for
15 minutes
 Add 250 μl of Luria broth to the “A” tube
 Add 250 μl of Luria broth to the “B” tube
 Label 1 LB plate “+ PLASMID” and 1 LB/AMP plate “+ PLASMID”
 Label 1 LB plate “– PLASMID” and 1 LB/AMP plate “‐ PLASMID”
 Put-on 100μl of cell suspension from the “B” tube to the “LB ‐ PLASMID
 Put-on 100 μl of cell suspension from the “A” tube to the “LB +
PLASMID
 Utilize a new sterile loop for each plate, spread the suspensions evenly
around the surface
 Muffle Parafilm around your four plates
 Place the four plates upside down in a 37 C incubator. Incubate for 24
hours.
 Remove plates from incubator and observe the growth
 Observe plates with handheld UV light

References:
1. Mahaffee, W. F.; Bauske, E. M.; van Vuurde, J. W.; van der Wolf, J. M.; van den Brink,
M.; Kloepper, J. W. (1997-04-01). "Comparative analysis of antibiotic resistance,
immunofluorescent colony staining, and a transgenic marker (bioluminescence) for
monitoring the enviro

2. Ptitsyn, L. R.; Horneck, G.; Komova, O.; Kozubek, S.; Krasavin, E. A.; Bonev, M.;
Rettberg, P. (1997-11-01). "A biosensor for environmental genotoxin screening based
on an SOS lux assay in recombinant Escherichia coli cells". Applied and Environmental
Microbiology. 63 (11): 4377–4384. Bibcode:1997ApEnM..63.4377P.
doi:10.1128/AEM.63.11.4377-4384.1997. ISSN 0099-2240. PMC 168758. PMID
9361425

3. O'Kane, Dennis J.; Prasher, Douglas C. (1992-02-01). "Evolutionary origins of bacterial


bioluminescence". Molecular Microbiology. 6 (4): 443–449. doi:10.1111/j.1365-
2958.1992.tb01488.x. ISSN 1365-2958. PMID 1560772. S2CID 42286135.
4. Widder, E. A. (2010-05-07). "Bioluminescence in the Ocean: Origins of Biological,
Chemical, and Ecological Diversity". Science. 328 (5979): 704–708.
Bibcode:2010Sci...328..704W. doi:10.1126/science.1174269. ISSN 0036-8075. PMID
20448176. S2CID 2375135.

5. Fisher, Andrew J.; Thompson, Thomas B.; Thoden, James B.; Baldwin, Thomas O.;
Rayment, Ivan (1996-09-06). "The 1.5-Å Resolution Crystal Structure of Bacterial
Luciferase in Low Salt Conditions". Journal of Biological Chemistry. 271 (36): 21956–
21968. doi:10.1074/jbc.271.36.21956. ISSN 0021-9258. PMID 8703001.

6. Wiles, Siouxsie; Ferguson, Kathryn; Stefanidou, Martha; Young, Douglas B.;


Robertson, Brian D. (2005-07-01). "Alternative Luciferase for Monitoring Bacterial
Cells under Adverse Conditions". Applied and Environmental Microbiology. 71 (7):
3427–3432. Bibcode:2005ApEnM..71.3427W. doi:10.1128/AEM.71.7.3427-
3432.2005. ISSN 0099-2240. PMC 1169068. PMID 16000745.
7. Kaskova, Zinaida M.; Tsarkova, Aleksandra S.; Yampolsky, Ilia V. (2016-10-24). "1001
lights: luciferins, luciferases, their mechanisms of action and applications in chemical
analysis, biology and medicine". Chem. Soc. Rev. 45 (21): 6048–6077.
doi:10.1039/c6cs00296j. ISSN 1460-4744. PMID 27711774.

8. Pérez-Velázquez, Judith; Gölgeli, Meltem; García-Contreras, Rodolfo (2016-08-25).


"Mathematical Modelling of Bacterial Quorum Sensing: A Review" (PDF). Bulletin of
Mathematical Biology. 78 (8): 1585–1639. doi:10.1007/s11538-016-0160-6.
hdl:11693/36891. ISSN 0092-8240. PMID 27561265. S2CID 3940300.

9. Eberhard, A.; Burlingame, A. L.; Eberhard, C.; Kenyon, G. L.; Nealson, K. H.;
Oppenheimer, N. J. (1981-04-01). "Structural identification of autoinducer of
Photobacterium fischeri luciferase". Biochemistry. 20 (9): 2444–2449.
doi:10.1021/bi00512a013. ISSN 0006-2960. PMID 7236614.

10. Ruby, E. G.; Morin, J. G. (1979-09-01). "Luminous enteric bacteria of marine fishes: a
study of their distribution, densities, and dispersion". Applied and Environmental
Microbiology. 38 (3): 406–411. Bibcode:1979ApEnM..38..406R.
doi:10.1128/AEM.38.3.406-411.1979. ISSN 0099-2240. PMC 243508. PMID
16345429.
1. Mini PCR (polymerase chain reaction):
PCR is a method broadly used in molecular biology to manufacture several copies
of a specific DNA segment.

Mini PCR machine components:


 Lid adjustment knob
 Heat lid
 Sample holding blocker
 Cooling block
 Running indicator lights

Mini PCR Protocol:


Material and reagents:
 Deoxyribonucleoside triphosphates
 A polymerase enzyme including TAQ polymerase
 Buffer
 Primers
 Nuclease-free distilled water
 Micropipette
 Laptop or android
 Mini PCR machine

Procedure:
 Construct reaction mix into 50 μL volume in a slim walled 0.2 mL PCR
tubes.
 Add reagents in following sequence: water, buffer, dNTPs, Mg CL2,
template primers, Taq polymerase.
 Produce negative control reaction without template DNA.
 Produce positive control reaction with template of known size and suitable
primers.
water to 50 μL
Buffer 1x
Taq polymerase 0.05 units/μL
dNTP mix 200 μM
MgCl2 0.1-0.5 mM
Forward primer 0.1-0.5 mM

Reverse primer 0.1-0.5 mM

Template 200 pg/μL

Operation mini PCR software via window or Mac system:


 Download the minipcr software
 Open a minipcr software and click new protocol
 Select a protocol type that is PCR, Heat block, Linear Ramp

 Enter a protocol name for example u-DNA

 Set a protocol parameter such as time, temperature and number of


cycles
 Click on run button

2. Blue Gel-Electrophoresis:
Gel electrophoresis is a technique used to split-up DNA pieces. According to their
size, DNA samples are fill into wells., And an electric current is applied to drag
them through the gel. DNA pieces are negatively charged, so they progress
towards the positive electrode.

Blue Gel-Electrophoresis instrument components:


 Casting tray
 Gel tray
 Cover lid
 Gel-Electrophoresis comb
 Gel-runner or power source

Blue-Gel-Electrophoresis protocol:
Material and reagents:
 Agarose gel powder
 Micro wave Heating oven
 1XTBE-Buffer
 Flask
 DNA sample and DNA-Dyes
 Blue-Gel-Electrophoresis instrument
 Micropipette
Procedure:
 Prepare a gel utilizing 1XTBE-Buffer

Agarose 0.2g
1XTBE-Buffer 25ml

 Mix the regents in the flask


 Heat the mixture using microwave oven usually 40sec
 Cool the agarose solution round about 2-3min
 Slowly pour the agarose into the casting tray with gel-
electrophoresis comb
 Allow gel to completely solidify than remove the comb
 Place your gel in to the Gel-runner along with gel tray
 Load 10 μl sample of each dye into the wells in the given sequence
 Lane 1: Bromophenol Blue (BB)
 Lane 2: Methylene Blue (MB)
 Lane 3: Orange G (OG)
 Lane 4: Bromocresol Purple (BP)
 Lane 5: Allura Red AC (AR)
 Lane 6: Unknown A
 Lane 7: Unknown B
 ane 8: Unknown C
 Place the cover lid on the gel runner box
 Apply the power supply
 Then press the run button
 For visualization the band press illumination Uv-light button

3. Check Gene expression at Home:


The central dogma of molecular biology consists of two steps: translation and
transcription. Transcription is a process of synthesis an RNA copy of a gene

 Tube1 will be your negative control

 Tube 2 will be references

 Tube 3 will be your experiment reaction

 Tube 4 will be your experiment reaction


sequence using DNA that encode a color marker you will able to check the
production of RNA.
P51™ Molecular Fluorescence Viewer:
 Sample holder
 Cover lid
 Uv-light source

Gene-expression protocol:
Material and reagents:
 Nuclease free water
 DNA A
 DNA B
 Kanamycin
 Heat source 37°C
 Micropipette

Procedure:
 Label a tube 1 to 4
 Add a DNA to each pellet in the strip
Tube 2 and 3 Add DNA(A) 5 μL
Tube 4 Add DNA(B) 5 μL

 Do not add a liquid to tube 1

 Adding a regent to each tube

Water tube 1 7 μL
Kanamycin tube 3 2 μL

Water tube 2 and 4 2 μL

 Incubate the sample at 37°C


 After 15min observe the tubes under P51™ Molecular Fluorescence
Viewer

4. Pocket PCR:
PCR is a method broadly used in molecular biology to manufacture several
copies of a specific DNA segment

Pocket PCR machine components:


 Power cable
 Sample holder
 Pcr reaction display screen
 Sample holder
 Tightening screw
Pocket Pcr protocol:
 Prepare your Pcr reaction
 Connect your pcr to a power cable
 The main menu choose setup by rotating knob and then press it
 The pcr protocol can be setup through a graphical representation

 After scrolling through all the given parameter set cancel menu is show
choose set to store the setting in the memory
 Back in the main menu choose run pcr to the pcr reaction

 The pcr run can be end by rotating the knob press to stop will appear in the
display

5. Engineer any bacteria to fluoresce using amino lab


instrument (DIY EXPERIMENT):
Amino lab or DNA playground appealing science station that enable you to
genetically engineer bacteria.

Amino lab instrument components:


 cold station
 Hot station
 Incubator
 Power-cable

 Controlling screen

Controlling screen
 The left Colum control the incubator (30°C,37°C,40°C)
 The central Colum control the hot station (30°C,37°C,40°C)
 The right Colum control the cold station which can be set to 4°C to replace
ice and 16°C

Engineer any bacteria to fluoresce


using amino lab protocol:
 Two micro tubes
 Muffle para film
 6 disposable pipets
 6 disposable inoculating loops
 bacterial waste container
 2 LB + AMP plates
 streak plates of E. coli
 37°C incubator
 PGreen plasmid

Procedure:
 Label one sterile microtube “A”. Mark another “B”
 Utilize a micropipette, add 250 μl of CaCl2 solution (50 mM) to each tube
 Utilize a sterile plastic loop to shift one or more than one 3 mm bacterial
colonies from the streak plate to the “A” tube
 Close the tube lid and place the tube on ice
 Utilize a new sterile loop to shift a mass of bacteria to the “B“tube
 Add 10ul of pGREEN directly into your “A”
 Come back the “A and B” tube to the ice. Incubate both tubes on ice for 15
minutes
 Add 250 μl of Luria broth to the “A” tube
 Add 250 μl of Luria broth to the “B” tube
 Label 1 LB plate “+ PLASMID” and 1 LB/AMP plate “+ PLASMID”
 Label 1 LB plate “– PLASMID” and 1 LB/AMP plate “‐ PLASMID”
 Put-on 100μl of cell suspension from the “B” tube to the “LB ‐ PLASMID
 Put-on 100 μl of cell suspension from the “A” tube to the “LB + PLASMID
 Utilize a new sterile loop for each plate, spread the suspensions evenly
around the surface
 muffle Parafilm around your four plates
 Place the four plates upside down in a 37 C incubator. Incubate for 24 hours
 Observe plates with handheld UV light

6. DIY-Gene cloning protocol:


DNA cloning is a molecular biology technique that assemble many identical
copies of a piece of DNA. In a representative cloning experiment, a target gene
is load into a circular piece of DNA called a plasmid.

Steps for DIY-Gene cloning:


 Isolation of DNA
 Isolation of desire gene
 Restriction digestion
 Ligation
 Transformation
 centrifuge for 1m
 Utilize a micropipette to shift 30 µl of supernatant to clean 1.5-ml tube

PCR Amplification of Desired


gene protocol:
Material:
 Deoxyribonucleoside triphosphates
 A polymerase enzyme including TAQ polymerase
 Buffer
 Primers
 Nuclease-free distilled water
 Micropipette 7. Mini-pcr machine
Procedure:
 Pcr components in the following sequence:
Reaction Microliter
[Link] 32.5
[Link] hf buffer 10.0
[Link](10mM) 1.0
4.F primer (10 μM) 2.5
5.R primer (10 μM) 2.5
[Link] DNA ((10 ng/µL) 1.0
[Link] DNA Polymerase 0.5
Thermocycler and round cycles
1.98°C for 0:30 min
2.98°C for 0:10 min 5x
3.X°C for 0:20 min
4.72°C for X min
5.98°C for 0:10 min 30x
6.72°C for X min
7.72°C for 5:00 min
8. 4°C until use

 Thermo cycler step 3-5 cycle with annealing temperature to the forward or
reverse primer with minimum [Link] to adjust for every gene
 Thermo cycler step4: setup the elongation time with 30 sec for each kb
 Thermo cycler step 6: 30 cycles along with 72°C for elongation and setup
extension time. Change time with 30-sec per kb

Restriction digestion protocol:


Material:
 Centrifuge
 Incubator
 Water
 Buffer
 BSA
 DNA template
 Restriction enzyme
 Incubator

Procedure:
 Defrost all reagents on ice.
 collect reaction mix into 50 µL volume in a microfuge tube
 Put-on reagents in following sequence: water, buffer, BSA, DNA template,
restriction enzyme
 Slowly mix by tapping the tube. in a short centrifuge to settle tube contents.
 Produce negative control reaction without template DNA
 Produce positive control reaction with template of known cutting site
corresponding to the restriction enzyme of option
 representative Incubation time and temperature is 37°C for 1h
 Incubation time temperature is 65°C for 20m

water to 50 µL

Buffer 1X

BSA 0.05 units/µL

DNA template 1 µg

Restriction enzyme 5-10 U per µg of DNA template (should


not be over 10% of reaction capacity)
------------------------------------------------------------------------------------------------

Ligation protocol:
Material:
 Water
 Ligase buffer
 Vector
 Insert
 T4 DNA ligase
 Centrifuge
 incubator

Procedure:
 Defrost all reagents on ice
 collect reaction mix into 10 µL volume in a microfuge tube
 Put-on reagents in following sequence: water, buffer, insert, vector, T4
ligase.
 Slowly mixed by stirring gently with pipette tip
 Representative Incubation time and temperature is 15°C for at a minimum
4h

water to 10 µL

Ligase buffer (with ATP) 1X

Vector 25 ng
Insert 75 ng 75 ng
T4 DNA ligase 0.1 to 1 Weiss unit

DNA transformation protocol:


Material:
 Incubator
 Heat shock
 Competent cell
 Ligation reaction
 Lb media

Procedure:
 Defrost all reagents completely on ice
 Put-on 1 µL of ligation reaction to defrost competent cells.
 Slowly mix by tapping tube of competent cells.
 Incubate reaction on ice for 30m
 Heat shock the capable cell fusion by incubation for 30 to 60s in a 42°C
water bath
 Incubate tubes on ice for 2m
 Put-on 250 to 500 µL, SOC or LB media
 Incubate at 37°C
 Warm selection plates to 37°C.
 Layout 10, 50, and 100 µL of transformed cells on selection plates
 Incubate plates at 30°C whole night.

Competent cells to 50 µL
Ligation reaction 1-5 µL

LB media 950 ml

DIY Golden Gate Assembly


protocol:
Golden Gate Assembly (GGA) is utilized for cloning one or more than one inserts
into a vector by building overlapping ends

Material:
 Mini PCR
 T4-DNA ligase
 Restriction enzyme
 Vector

Procedure:
 Along with PCR tube:
T4 DNA Ligase 0.5 µL
10X T4 DNA Ligase Buffer 2 µL
Type IIS restriction enzyme 0.5 µL
vector 100ng
Complete with water QS 20 µL
 Mix gently
 15-120 cycles
Activation of the 37°C 5 min
restriction enzyme
Activation of the Ligase 16°C 5 min
Inactivation of the 55°C 15 min
enzyme
Inactivation of the ligase 85°C 20 min
Hold 4°C

------------------------------------------------------------------------------------------------

DIY- DNA fingerprinting protocol:


DNA fingerprinting is a laboratory method used to initiate a link between
biological evidence and a suspect in a criminal investigation. A DNA sample
taken from a crime scene is contrast with a DNA sample from a suspect. If the
two DNA profiles are a match, then the evidence came from that suspect.

Material:
 Agarose gel powder
 Micro wave Heating oven
 1XTBE-Buffer
 Blue-Gel-Electrophoresis instrument
 20µl Victim DNA
 20µl Suspect 1 DNA
 20µl Suspect 2 DNA
 20µl Crime Scene 1 DNA
 20µl Crime Scene 2 DNA
 120µl restriction enzyme Mix

Pre experiment setup:


 Prepare a gel utilizing 1XTBE-Buffer
Agarose 0.2g
1XTBE-Buffer 25ml
 Mix the regents in the flask
 Heat the mixture using microwave oven usually 40sec
 Cool the agarose solution round about 2-3min
 Slowly pour the agarose into the casting tray with gel-
electrophoresis comb
 Allow gel to completely solidify than remove the comb
 Place your gel in to the Gel-runner along with gel tray

Procedure:
 Label 6 sets of 5 tubes with “Crime Scene 1”, “Crime Scene 2”, “Victim”,
“Suspect 1” and “Suspect 2”. shift 20µl of each DNA sample into the
suitably labeled tube and provide each group with one of each sample tube
 Shift 20µl Cleaving Enzyme blend into the five tubes of DNA. Use a clean
tip for each and every DNA sample
 Setting each tube in a water bath or incubator at 37°C for one hour •
Following incubation, put-on 10µl DNA Loading Buffer to each tube
 Load 10 μl sample of each dye into the wells in the given sequence
 Once the samples are all loaded, supply a current at 12-15V/cm. For an
8cm long gel run at 96-120 volts
 Once the blue dye front has roam ¾ the length of the gel, turn off the power
and gently shift the gel to a UV Light box

DIY-CRISPRCas9 mutation
detection System with miss
cleavage protocol:
CRISPRCas9 is utilizing for selected mutagenesis. The investigation of mutants
obtained utilize CRISPRCas9 requires particular methods for mutation detection
and the enzyme mismatch cleavage technique is used for this purpose. T7
Endonuclease (cleaves non-perfectly matched DNA) to detect on-selected
CRISPRCas9 editing events in cells. The PCR by-product is denatured and
annealed to construct hetero duplex mismatches where double-strand breaks have
to happen, resulting in insertion, deletion.

Material requirement:
 Mini-PCR machine
 MethylTaq 10x buffer
 DNTPs
 MethylTaq DNA polymerase
 Nuclease-free water
 T7 Endonuclease

Procedure:
 Delicately aspirate the media from the cells and clean once with 100 μl 1X
PBS
 collect the cells and extract genomic DNA using the method of choice
Amplification reactions:
 Set up and run the PCR utilize a template, primers, and element of the
MethylTaq
 Polymerase
 50 μl reaction:

 Nuclease-free water (50 μl)

Cycling condition:

Hetero duplex development:


 200 ng of the amplified DNA
 . T7 Endonuclease use 10 μ
 supply with T7 Endonuclease I from NEB
 Denature and anneal the products

Hetero duplexes digestion:


 10 μl of the unrefined PCR
 250 ng of amplified DNA

 Mix ably and briefly spin


 Incubate each and every reaction at 37°C for 15min
 Stop the reaction by adding 1 μl of EDTA 0.5 M
 Finish the reaction by adding 1 μl of EDTA 0.5 M
 Proceed fragment in blue-gel electrophoresis

DIY-DNA Labeling protocol:


DNA labeling is a technique in which DNA label with tags that facilitates the
detection of
Hybridization of DNA and genes. Fragment of DNA or RNA of variable length
100-1000 base pair. P51™ Molecular Fluorescence Viewer hand-on investigation
for student explored the building block of life like base pairing, hybridization,
energy capture, gene expression etc.
Material required for DNA labeling:
Reagents Amount need Storage Equipment's
in group

DNA dye 70 μl. 4°C PCR tubes


Buffer 1 275 μl 4°C Microcentrifuge
tube
Buffer 2 255 μl 4°C
AT rich DNA 400 μl 4°C Mini pcr
machine
GC rich DNA 400 μl 4°C micropipette
50:50 AT and 500 μl 4°C Micropipette tip
GC
100mM 650 μl 4°C Eye wear
NAOH

Procedure:
 Label the tubes 1,2,3 and 4
 Add 10 μl buffer to each tube
 Add 10 μl dye to each tube
 Add 5 μl of DNA sample to tube 1,2 and 3
 Do not add an any DNA to tube 4 because tube 4 is serve as negative control
 Mix the regent by pipetting up and down 3-4 time

Mini PCR protocol:


 Open a mini PCR software
 Select the heat block
 Enter a name of your experiment
 Enter the heat block parameter such as 95°C for 2 min
 Position a tube in mini-PCR
 Run a PCR
 Carefully open a mini PCR lid and remove a tube and observe under P51™
Molecular Fluorescence Viewer

DNA fingerprinting and CRISPR cas9 system:


Abstract:
Leicester university geneticist Alec Jeffrey’s develops a technique called DNA
finger printing in 1985 it allows the DNA sample from different people to be
compared look for similarities and differences. It used the solving crime and can
confirm if the people are related to each other like paternity testing. There is
section of chromosomes where an instead of gene consisting of a long sequence
of bases, they are usually 15-100 base pairs long that are repeated in many times
these repeated sequences called Variable Number of Tandem Repeat. If we can
know the VNTR sequence of any person than we can design a gRNA. CRISPR
to scan through DNA or find specific VNTR sequence of another person. If the
CRISPR does not find targeted VNTR sequence it does not bind to it its means
that no fluorescence color appears under UV-light but its scan and find its target
and this binding create a fluorescence signal its means that VNTR can be occur
in given DNA and both persons are related to each other with respect to any point
that is father or son or suspect or victim. The DNA we can check is must be
labeled with fluorescence color.
DNA finger printing system parts:
CAS9-Protein:
 Cas9 protein is also called destructive protein Its main function is to cut
DNA and thereby alter a cell's genome

Guide-RNA (VNTR)
The main part of our technique is gRNA or VNTR the guide RNA is a specific
that recognizes the target DNA area of interest and directs the Cas nuclease there
for editing

Template DNA:
The template DNA is our target DNA that we want to check either Specific STR
are present or not.

DNA fingerprinting and CRISPR


cas9 protocol:
The protocol contains two steps:
 Labeling of Template DNA
 CRISPR cas9 working protocol
Labeling of Template DNA:
Reagent requires:
 DNA dye 70 μl.
 Buffer 1: 275 μl
 Buffer 2: 255 μl
 AT rich DNA 400 μl
 GC rich DNA 400 μl
 50:50 AT and GC 500 μl
 100mM NAOH 650 μl
Procedure:
 Label the tubes 1,2,3 and 4
 Add 10 μl buffer to each tube
 Add 10 μl dye to each tube
 Add 5 μl of DNA sample to tube 1,2 and 3
 Do not add an any DNA to tube 4 because tube 4 is serve as negative
control
 Mix the regent by pipetting up and down 3-4 time
 Enter the heat block parameter such as 95°C for 2 min
 Run a PCR
 View under UV-light

CRISPR cas9 working protocol:


Procedure:
 Position a 30 µl reaction along micro centrifuge tube on ice with the
following sequence:

Component 20 µl Reaction
Template DNA x µl (~100 ng)
Guide RNA x µl (~4000 ng)
10X Cas9 Reaction Buffer 3.0 µl
Cas9 Nuclease 1.0 µl
water 30.0 µl

 softly mix the reaction mixture and centrifuge it


 Incubate at 37°C for 20min
 View under UV-light
Cell-free E. coli Protein Synthesis
System Protocol:

A living cell could be genetically modified to perform a function such as the


production of a protein. However, these genetic modifications often conflict
with normal cellular function and result in a mutation. Defects can be overcome
through removing the bacterial membrane which leaves the lysate that is
performing both transcription and translation. The cell free-protein synthesis is
also known as in vitro protein synthesis and is the production of a protein
without using a living cell. The gene is acting as instructions to make the
protein.
Cell free protocol:

 Thaw all components on ice


 Gently mix with vortex the NEB-Express S30 Synthesis
 Extract and Protein Synthesis Buffer to mix
 Merge reagents in a 1.5 ml micro centrifuge tube on ice as follows:

Components Negative control (no Positive control Sample


DNA)
NEB-Express S30 12 µl 12 µl 12 µl
Protein Synthesis 25 µl 25 µl 25 µl
Buffer (2X)
T7 RNA Polymerase 1 µl 1 µl 1 µl
RNase Inhibitor, 1 µl 1 µl 1 µl
Murine
NEBExpress 2 µl
Control DHFR-His
Plasmid (125 ng/ µl)
Plasmid template (> 250 ng
100 ng/µl)
Water 11 µl 9 µl to 50 µl
 Incubate total reactions at 37°C, with vigorous shaking, for up to 2–4 hours.
 Analyze by method of choice or analyze by protein gel electrophoresis method.

[How to make a DIY Micro-pipette]

A pipette is a laboratory tool commonly used in chemistry, biology and


medicine to transport a measured volume of liquid, often as a media dispenser.
Pipettes and micropipettes are used to measure and deliver accurate volumes
of liquid.
Material requirement:
• Insulin syringe (Rs: 25)
• Micropipette tip (Rs:1)

Procedure:
 Take a syringe and tip
 Place a tip on the syringe
 Note that micropipette tip is with printed scale of microliter

 Take a volume by using syringe

--------------------------------------------------------------------------------------------------------------

[DNA Quantification by
using Spectrophotometer]
DNA quantification mean to determine the average concentration of DNA in a
sample prior to downstream experiments.

DNA Quantification Protocol:


 Earlier than measuring any samples, make sure to
‘blank’ the spectrophotometer the use of the solution
the DNA is re-suspended in, however with no DNA
added. 'Blanking' measures the background inherent to
the machine system and you’re solvent.
 If using a Nano Drop pore system to measure your
samples, place 1-2µL of mini-prepped DNA onto the
pedestal.
 Close the lid and click on measure degree, make sure to
record the concentration and purity.
 Repeat for each sample in each time
------------------------------------------------------------------------------------------

[Sequence Analysis of a Plasmid]

A small circular DNA molecule found in bacteria and some other organism with
particular function called plasmid.

Sequence Analysis of a Plasmid Protocol:

 Make sure the primer only anneals once in the whole assemble or construct.
 Primer should be a minimum of 50 nucleotides and a maximum of 300
nucleotides from your Plasmid
 A standard sequencing reaction between 300-900 base pairs of useable
sequence. You should receive your sequencing results as a trace file. Which
graphically depicts the sequence as a series of colored peaks corresponding
to one of the four nucleotide bases. This is an example of a trace file from
a high-quality portion of a sequencing reaction:
 Sequence near the beginning or end of a sequencing reaction is frequently
unreliable. Despite the fact that your sequencing outcomes can also suggest
bases at unique locations, by means of looking at the trace file, you may
see that those base calls are unreliable. That is an instance of a trace record
from a portion of a sequencing response with high background

[RNA Extraction without a Kit Protocol]


RNA contains genetic information this is translated by means of ribosomes into
numerous proteins essential for cellular function.
Procedure:
 Lyse tissues or cells in Solution D.
 For tissues: used 1 mL of Solution D per 100 mg of cells.
 For cultured cells: used 1 mL of Solution D per 1 X 107 cells.
 Permit sample(s) to take a sit at room temperature for 5 minutes to permit
for dissociation of the nucleoprotein complexes.
 Transfer tissue/cell lysate to a 4 mL tube.
 Add the following sequentially to 1 mL of lysate:
 Add 0.1 mL of 2 M sodium acetate (pH 4.0), blend or mix very well by
inversion.
 Add 1 mL water-saturated phenol, mix thoroughly via [Link] should
be 4.0
 Add o.2 mL of Chloroform/Isoamyl alcohol (forty nine: 1) and then shake
vigorously by means of hand for 10 seconds.
 Incubate sample for 15 minutes on ice and centrifuge the sample for 15
minutes at 12,000 × g at 4°C in order to separate RNA from the rest of the
tissue/cell lysate.
 By Using a pipettor, transfer the top, aqueous phase to a new RNAse-free
tube
 Precipitate your sample you can use either Isopropanol or Lithium Chloride
for this step.
 Centrifuge for minimum 20 minutes at 10,000 x g at 4°C and discard the
supernatant.
 There should be a gel-like white pellet of total RNA in the bottom of the
tube.
 Wash the RNA by re-suspending the pellet in 0.5–1 ml of 75% Ethanol and
vortex for a minimum few seconds.
 Centrifuge for 5 minutes at 10,000 x g at 4 °C and remove the supernatant
 Try to Remove as much of the ethanol wash as possible without disturbing
the pellet.
 Air-dry the pellet for less than 10 minutes.
 Re-suspend RNA pellet in RNase-free water

[PTC Genotyping]
This kit consists of everything you need to genotype samples for the bitter taste
receptor.
Procedure:
 Clean your mouth with water and then swab inside of cheek.
 Grasp cheek swab place in 300uL 50mM NaOH in 1.5mL micro centrifuge
tube
 Stir swab in tube for about 1 minute until solution is cloudy
 Heat tube in boiling water for 10 minutes 95 °C
 Add 300uL of 50mM Tris
 For a 50uL PCR reaction:
 1-microliter of cheek cell solution for PCR reaction template
 1-microliter of PTC primer
 10-microliter of 5x Master Mix(or 25uL of 2x Master Mix)
 38-microliter water with 5x Master Mix(or 23uL with 2x Master Mix)
 PCR Reaction:
 1x 95C 10 Minutes
 35 x 95C 30s
 55C 1 minute
 72C 1 minute
 1x 72C 10 minutes

 Forward PTC Primer

 AACTGGCAGATTAAAGATCTCAATTTAT

 Reverse PTC Primer

 AACACAAACCATCACCCCTATTTT

 After run your PCR reaction remove 20uL from each reaction and place
them in separate tubes.

 Add a 1uL Fnu4H1 or HaeIII restriction enzyme to each reaction in each


of these extra tubes and let sit for 30-45 minutes.

 HaeIII restriction enzyme only cuts the DNA of the taster allele at the
sequence GGCC and creates two bands in Gel electrophoresis
[How to create your own guide RNA for
Bacterial CRISPR cas9 experiment]
A manual RNA is a bit or piece of RNA that functions as a manual for RNA- or
DNA-targeting enzymes, with which it forms complexes. Very often these
enzymes will delete, insert or otherwise adjust the targeted RNA or DNA

Procedure:
 Go to [Link]

 For In chose E. coli str. K12/MG1655


 For Target chose rpsL the gene modified in this experiment
 What you'll see is a ranking of gRNAs based on how precise or unique
they may be
 You can use these same methods to design a gRNA for any other
organisms. Instead of E. coli just enter the organism's name and choose a
gene. For instance, myostatin knock-outs in animals make them very
muscular. You can find a gRNA that would target the MSTN or myostatin
gene in humans.

[DRD4 Genotyping]
Dopamine receptor D4 (DRD4) is a signaling protein in humans that is
operate by the neurotransmitter dopamine. Mutation to DRD4 is associated
with risk taking behavior and many other things.

Procedure:

 Clean your mouth with water and then rub inside of cheek with tip of cotton
swab
 Take cheek swab and place in 300uL 50mM NaOH micro centrifuge tube
 Stir swab in tube for about 1 minute until solution is cloudy
 Heat tube in almost boiling water for 10 minutes at 95°C
 Add 300uL of 50mM Tris
 For a 50uL PCR reaction:
 1-microliter of cheek cell solution for PCR reaction template
 1-microliter of DRD4 primer
 10-microliter of 5x Master Mix(or 25-microliter of 2x Master Mix)
 38-microliter water with 5x Master Mix(or 23 microliter with 2x Master
Mix)
 Use the PCR protocol below:
 1x 95C 10 Minutes
 30 x
 95C 15s
 55C 1 minute
 72C 2 minute
 1x 72C 10 minutes
 Compare the samples to the DNA ladder using a Gel electrophoresis

[Wheat Germ DNA Extraction]


Procedure:
 Measure a 1 gram of raw wheat germ into a vial.
 Measure 20 mL of hot water about 55-60C into a graduated cylinder.
 Stream the hot water into the vial of wheat germ
 Shake vigorously for about 3 minutes.
 Add 1 mL of dishwashing soap.
 Shake gently to minimize foam for about 2 minutes.
 Remove foam
 Gently add 10 mL of ice-cold ethanol or rubbing alcohol.
 Add it slowly so that the alcohol floats in a layer on top of the wheat
germ mixture.

 Where the alcohol and mixture meet together, a white precipitate will
form. Collect the precipitate by spooling it onto a wooden stick.

 White precipitate contain a genomic DNA

[Dot and Slot hybridization


protocol]

Dot blotting and slot blotting are techniques for immobilizing preparations
of nucleic acid on the solid support usually a charged nylon membrane.
Procedure:
 In the procedure DNA or RNA is extracted from the given cell sample.
 DNA is applied for PCR amplification
 Electrophoresis is not need to separated DNA or RNA
 Denature the double stranded DNA with NAOH or by high
temperature(95c)
 The DNA or RNA mixture is blotted to a membrane where the
hybridization is carried out.
 Single stranded DNA or RNA is applied directly to prepared blot strips of
nitrocellulose or nylon membrane is bound to a filter
support(nitrocellulose)
 Sample are usually applied to the membrane by using manifold attached to
the suction device
 Immobilized by baking 70-80c for about 2-3 hours
 Each dot on the strip carry a different labeled DNA or RNA probe from
different sources.
 The DNA probes present in the dot on the nitrocellulose strip are attached
to the enzyme complex that can converted into colorless substrate into a
colored one if bind can take place.
 Incubate with radioactive labeled single stranded DNA or RNA fragments
complementary to the nucleic acids of interest.
 In washing step the non-hybridized probe is remove washout the non-
hybridized probe such as buffer
 Autoradiograph or color changes.

[16s rDNA Amplification]


The 16s rRNA gene is used to identify different species of bacteria.
Procedure:

 Set your PCR reaction by adding:


 0.5uL of 10uM 515F primer
 0.5uL of 10uM 1492R primer
 25uL 2x Master Mix or 10uL of 5x Master Mix
 Distilled water to 50uL (23uL for 2x Master Mix, 38uL for 5x
Master Mix)
 By Using an inoculation loop or pipette tip scrape a single colony or
a bit of bacteria and mix it into the tube. The amount of bacteria
should be visible to the naked eye.
 By Using PCR protocol:
 1x 95C for 10 Minutes
 30 x for 95C 15s
 55C for 1 minute
 68C for 2 minute
 1x 68C for 10 minutes
 Run a Gel Electrophoresis on samples to determine success.
 If you have a gel electrophoresis run a gel and see if there is a band
of DNA. This is so you know your PCR was successful or not.
 By using your PCR purification kit to purify the rDNA that you
amplified.
 Send your samples to a company to sequence along with primers.
 Once they receive your samples they will send you back two files
for each sequencing run

[DIY Human CRISPR Guide]


CRISPR-Cas is a system with an awful name that, contrary to popular belief, does
not actually directly perform any genetic engineering or modification of DNA
bases. Instead, the system uses a trick that has been well known in genetic design
for many years. It cuts DNA. Yes, that's all Cas9 does is cut DNA. Look, when
the DNA is damaged or cut most all organisms start doing DNA repair and it can
end up in one of three ways 1) The DNA is repaired perfectly and everything is
fine 2) The DNA is repaired but some mistakes are made leading to problems
with by translating a gene into a protein due to frame shifts or mutations 3) DNA
is repaired using an artificially supplied template, resulting in an entirely new
sequence. When using CRISPR, people try to use (2) or (3), but most of the time
when people talk about CRISPR, they usually only mean (3), but not always.

 Most CRISPR systems consist of 2-3 components


 The Cas9 protein that cleaves DNA
 TracrRNA and crRNA, which after synthetic combination are called "guide
RNA", but also sgRNA (synthetic guide RNA) or gRNA.
 Repair template if homology-controlled repair is performed
 For any CRISPR experiment, you need to find out before you start:
 Where in the genome does this happen?
 What do I want to insert into the genome or what basic changes do I want
to make?
 TLDR; If you do a gene knockout
 Choose your guideRNA that will target your desired gene using one of
these websites and order it from Addgene or Atum.
 [Link]
 [Link]
 [Link]
 Buy a maxiprep kit without an end prosthesis and clean your DNA of
bacteria or pay at one of the many places that will make your DNA for you
 [Link]
 [Link]
 Mix with polyethyleneimine (PEI) at a ratio of about 1μg DNA to 10μg
PEI and inject >20μg DNA. The injections will most likely need to be given
multiple times to create enough cells to have an effect.

Step 1: Which Cas9 should I use?


There are more Cas9s out there then seasons of Survivor which is still running
(one of my favorite shows). SpCas9, SaCas9, nickase Cas9, Cpf1, and [Link]
you are interested. However, in most cases it is easiest to use the wild type
SpCas9. While there might be so called “off-target” effects. The efficiency,
accessibility and usability you have with it are better than the rest. Most systems
that you order pre-made will come with wild type spCas9 and so this makes your
work much less.
Step 2: Where do you want to make your
change?

 This usually leads to two things

 Want to edit a specific gene?

 You just want to insert something into the genome and it doesn't matter
where?
 Specific genes

When using CRISPR Cas9-mediated genome modification, you either modify an


existing gene or insert something new. When modifying an existing gene, the
gene sequence can be obtained from one of the many databases that store
information about the human genome. Many companies now have programs that
can automatically target most genes, so all you really need to know is the name
of the gene you want to target.

 You can search and retrieve gene sequences at NCBI:


[Link]

Step 3: Designing Your Guide RNA:


One massive problem with CRISPR is terminology. You are not actually
designing a gRNA. You only design ~20 bases >90 bases of gRNA. This ~20 bp
region contains two elements that you should know about, one is called the proto
spacer or sometimes just "spacer" and one is called the PAM or Proto spacer
Adjacent Motif. Geesh I know. PAM is required in the genome for gRNA binding
but is not required in gRNA.

If you want to try to be hardcore, you can design gRNAs by hand, but the great
thing is that many companies and organizations have built platforms and
infrastructure so that gRNA or (proto) spacer design is automated.
Addgene has a list of validated gRNAs in a range of organisms including humans
that you can order at will.

 [Link]

 My favorite is Atum which easily allows you to design a gRNA from


either your own sequence or a gene found in their database. It costs ~$300
for a gRNA in a plasmid that also expresses Cas9. i.e. it is ready for use in
humans.

 [Link]

 ChopChop is great and gives a lot more targets than the others and a lot
more information

 [Link]

 Note that when I say we are designing a guide RNA, we are actually
designing only 20 base pairs of the guide RNA known as the (proto)spacer.
The rest of the guide RNA almost always stays the same. A (proto)spacer
is also placed in the crRNA for those working with crRNA

The (proto)spacer should be 20 bases long and should match the genome
where the cut will be made, the only caveat being that you can't compare
anywhere only where there is an NGG ("N" stands for any nucleotide)
sequence. So to design your gRNA what you do is find the NGG in the
top strand (what we have) and use the 20 nucleotides preceding it as your
spacer.

Example:
Partial Sequence Homo sapiens myostatin (MSTN), RefSeqGene (LRG_200)
on chromosome 2

4801 agatttattt cttttatgaa gtagtcaaat gaatcagctc acccttgact gtaacaaaat


4861 actgcttggt gacttgggac agacagggtt ttaacctctg acagcgagat tcattgtgga
4921 gcaagagcca atcatagatc ctgacgacac ttgtctcatc taagttggaa tataaaaagc
4981 cacttggaat acagtataaa agattcactg gtgtggcaag ttgtctctca gactgtacat
5041 gcattaaaat tttgcttggc attactcaaa agcaaaagaa aagtaaaagg aagaaacaag
5101 aacaagaaaa aagattatat tgattttaaa atcatgcaaa aactgcaact ctgtgtttat
5161 atttacctgt ttatgctgat tgttgctggt ccagtggatc taaatgagaa cagtgagcaa
5221 aaagaaaatg tggaaaaaga ggggctgtgt aatgcatgta cttggagaca aaacactaaa
5281 tcttcaagaa tagaagccat taagatacaa atcctcagta aacttcgtct ggaaacagct
5341 cctaacatca gcaaagatgt tataagacaa cttttaccca aagctcctcc actccgggaa
5401 ctgattgatc agtatgatgt ccagagggat gacagcagcg atggctcttt ggaagatgac
5461 gattatcacg ctacaacgga aacaatcatt accatgccta cagagtgtaa gtagtcctat
5521 tagtgtatat caacagttct gctgactgtt gttctagtgt ttatgagaaa cagatctatt
5581 ttcaggctct tttaaacaag ctgttggcct gtatgtaagt agaaaggaaa agagtttctc
5641 tttttcaaga ttgcatgaga atatattaat gagacaaaaa tctgctgcat tatttgtttt
5701 cttatagaga caaaaaacta aaaaataaag tacttgcata gcattaattt aataaggcaa
5761 atatagatag catgcttatg ctttcacaat aataccacca aggcaaggac tgggagatac

 gRNA (proto)spacer
 TGACAGCAGCGATGGCTCTT
 Total gRNA as DNA
 TGACAGCAGCGATGGCTCTTGTTTTAGAGCTAGAAATAGCAA
GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA
CCGAGTCGGTGC
 Looking at the information on NCBI we can find out that these sequence
is in the first exon. It is usually best to target the first exon when using
NHEJ(Non-Homologous End Joining) to knock out the function of a gene.
You can then proceed to compare this to the whole human genome to see
if it matches other places using BLAST.

Step 4: Getting CRISPR-Cas9 into your


Cells
There are three main ways to get the CRISPR Cas9 system into your cells

 Adeno-Associated Viruses (AAV)

 Lentiviruses

 DNA transfection

Adeno-Associated Viruses (AAV):

AAVs are one of the safest and easiest ways to get DNA into your cells. They are
fast becoming the method of choice for getting DNA into cells for gene therapy.
However, they have two limitations that make them difficult to use for CRISPR-
Cas9. The first is that AAVs are limited in the amount of DNA they can
accommodate. Cas9 is quite a large protein and usually takes up a large portion
of the AAV, so you can't usually do HDR with a single AAV. What usually
happens is that Cas9 is inserted into one AAV and the guide and template into
another AAV. The need for two viruses to infect cells greatly reduces efficiency,
as cells must be infected with both viruses for HDR to occur. The second problem
is that it is not easy to produce viruses because they require growing cells that can
be infected with the virus (mammalian cells), which are difficult to grow in large
quantities, so viruses can be unaffordable in size, cost and materials, especially
for someone who works at home. However, there are many companies that will
make and sell you a custom AAV. Understand that these AAVs are replication
deficient, so they don't replicate, they just infect cells and release your own DNA.
Search the internet, you'll find plenty.

Lentiviruses:
Lenti-viruses have some advantages and disadvantages compared to AAV. They
have a larger genome size so you can put a lot more in them and you only need
one virus for an HDR CRISPR-Cas9 experiment. But they also integrate into the
genome, which can be dangerous because it increases the chance that something
will go wrong with the genetic engineering or gene therapy you're doing. Like
AAV, they are not as DIY friendly, but you can certainly find places to make your
own lentiviruses.
DNA transfection:
DNA transfection is a general term used to describe getting artificial produced
DNA (usually replicated in bacteria) and introduce this DNA into cells using one
of a variety of methods, including chemical transformation or electroporation. I
am a sucker for transfection because the DNA can be replicated in bacteria which
can be grown on basically some sugar water. It can be purified for human usage
in most any basic lab setup. All you really need is a centrifuge and some pipettes.
What it lacks in efficiency as compared to viruses can be made up for in quantity.
You can purify alot easily so even if the efficiency is lower you can use more.
This DNA can literally be applied directly to the skin (though very lower
efficiency), can be injected with the DNA in water, higher efficiency), injected
with the DNA mixed with a chemical or lipid (even higher efficiency and best
choice) or injected and then stimulated with an electrical current (highest
efficiency but more impractical). The best compound to use based on efficiency,
price and ability to obtain is probably polyethylenimine (PEI).

[Bento DIY Lab Device]


Bento lab is a mobile genetic setup with the combination of PCR, Centrifuge and
gel visualization.
1. Micro centrifuge
2. Blue led trans illuminator
3. Gel electrophoresis
4. On board graphical interference
5. Tube rack
6. Bento lab device
Centrifuge Specifications:

 Rotor Capacity 6 x 1.5 mL tubes / 6 x 2 mL tubes


 Centrifugal Force 500 g – 8000 g (Bento Lab Pro)
 2,700 g fixed (Bento Lab Entry)
 Modes: Burst Spin
 Time Spin of up to 60 minutes
 To operate the centrifuge, select the module from the status
screen.
 There are two ways to use; Burst Spin and Time Spin. Burst Spin is used
for short spins with no predefined time. This mode is usually used when
you need to run the centrifuge for a few seconds, for example when
collecting samples at the bottom of a tube. Time Spin is used to spin at
user-defined speeds for a pre-defined time.
 And lid must be closed in both methods

 To use the Burst Spin option, select the circle arrow using the orange
spinner. Hold down the orange button and the centrifuge will start spinning.
The counter records how many seconds the centrifuge has been active. To
stop the centrifuge, simply release the button and the centrifuge will slow
down and stop. When the engine stops, the lid unlocks automatically and
can be opened safely. Wait until you hear a click from the lid, indicating
that the lock is open.
 To use the Time Spin option, select the clock symbol using the orange dial.
The G force and timer can be adjusted by pressing and turning the orange
click dial while holding it. Turn clockwise to increase the value, turn
counter-clockwise to decrease it. Click the confirm button to start the run
 When the centrifuge is running with a timer, the remaining time is
displayed in the upper right position (1). The clock button (2) allows you
to set the timer and the cancel button (3) can be used to manually turn off
the centrifuge.

Gel electrophoresis bento device:


The gel box consists of two parts. The base (2) is made of clear acrylic. It is used
for casting gels and as a gel reservoir in electrophoresis. Also stocks casting caps
and combs. The lid (1) is made of orange acrylic, which acts as a filter for the
blue light illuminator. On the left side of the Bento Lab system (3), a red and
black socket provides power for gel electrophoresis. The blue LED illuminator
(4) is located on the left side of the device.

 Voltage 50V – 120V


 Box Dimensions 91mm x 78mm
 Visualization: 470nm blue light and diffuser
 Viewing Window As box dimensions
 Filter Amber acrylic

 To use the gel electrophoresis and Tran’s illuminator module, select it from
the home screen.

 To set the gel tension, first select the tension button. To change the value,
press and hold the orange click wheel down and rotate it. Turn clockwise
to increase tension and counterclockwise to decrease tension.

 To start the gel at the selected voltage, press the timer button. On the next
screen, set the timer. To change the duration, push down on the orange
click wheel and hold it while rotating it to change the value. Turning it
clockwise increases the duration, and turning it counter-clockwise
decreases it.

 Make sure your gel is ready and connected to the Bento Lab before pressing
the confirm button.

 If Bento Lab does not detect the current subscription or if the current
subscription is too high, an error message will be displayed. If no current
is detected even though the gel box is connected, this may indicate a broken
platinum wire.
 When the gel is running, the remaining time is displayed in the upper right
position (1) and a flashing flash indicates that current is flowing (2). The
clock button (3) allows you to set the timer and the cancel button (4) can
be used to turn off the power to the gel.

 All Bento Lab protocols use 0.5X TBE buffer in the gel electrophoresis
step. We recommend preparing a stock solution of 0.5X TBE buffer by
adding 50 ml of 10X TBE buffer to 950 ml of deionized water in a glass or
plastic bottle.
 Pour the desired amount of 0.5X TBE buffer into a microwave container
and add the agarose tablets according to the protocol you are following.
For 1% gel, add 1 tablet to 50ml buffer (1.5% gel is 1 tablet in 33ml buffer;
2% gel is 2 tablets in 50ml buffer; 3% gel is 2 tablets in 33ml buffer.)

 Wait ~2 minutes for the tablet to disintegrate, then microwave the solution
on full power for 20-30 seconds. Mix the solution between doses until the
agarose is completely dissolved. Avoid boiling the mixture as this will
evaporate the buffer and you will end up with a higher concentration of
agarose.
 Make sure you are working on a flat surface to pour the gel at a uniform
thickness.
 Gently remove the orange cap from the gel reservoir.
 Place the dams in the tank so that the buffer zones around the electrodes
are covered.
 Remove the comb and insert the comb into the holder
 Once the agarose has cooled to about 55°C, it should be hot but not too hot
to the touch - add your DNA dye (1μl per 10ml TBE buffer) and pour the
dissolved gel into the gel reservoir.
 Let the gel cool and harden. This takes about 30 minutes at room
temperature or 15 minutes in a cool room or refrigerator.
 Gently remove the gel comb and dam from both ends of the gel tank and
prepare to start the gel.
 The Bento Lab contains a mini gel electrophoresis system, so it has a higher
voltage gradient than larger gel systems because the distance used to
determine voltage gradients is the distance between the electrodes, not the
length of the gel. If the voltage is too high, you may see streaks. For best
results we recommend running the gels at 50V with 0.5X TBE.
 Pour 0.5X TBE buffer solution into the gel reservoir onto the prepared gel
until the liquid covers the gel and the level is about 2-3 mm above the gel.
 Carefully insert the molecular weight ladder into the first lane of the gel.
 Load the samples into the remaining wells of the gel.
 Gently slide the orange lid onto the gel reservoir until it clicks into place.
 Set the voltage to the desired electrophoresis voltage for your protocol. To
make voltage changes, select the voltage value button. Press and hold the
orange click wheel while rotating to change the value. Turn clockwise to
increase tension and counterclockwise to decrease. Once the desired
tension is reached, release the orange click wheel.
 Set the desired time by selecting the time value, pushing down and turning
the orange click wheel.
 Confirm your settings by clicking the check mark on the right and set the
gel to run.
 Allow the gel to set until the dye line has moved down about 75% of the
length of the gel. Typical run time with Bento Lab is about 30-45 minutes,
depending on gel concentration and voltage.
 Wait until the run is finished or cancel the run. Disconnect the electrodes
from the power source and then carefully remove the gel from the gel box.
 Place the gel on the Trans illuminator and press the Trans illuminator
button to turn on the blue light to visualize your strips.

PCR Thermo cycler / Heating Block:

The thermo cycler module is on the right side of the Bento Lab system. The
thermo cycling block (1) is suitable for 0.2 ml tubes with flat or round caps
in a 4 x 8 arrangement. Tape tubes can be fitted. The heated lid (2) is spring-
loaded and automatically adjusts according to the tubes. The fan is used to
remove heat from the system through the vents (3) on the right side. Make
sure there are no objects blocking the air flow to avoid overheating.

 Capacity 32 x 0.2mL tubes


 Thermal cycling system Peltier temperature control, active cooling
 Temperature Range 12°C – 99 °C
 Heated Lid 120°C / ambient (off)

 The Bento Lab Thermo cycler module is ready to use out of the box with
no additional equipment or software required. Everything can be
programmed and configured directly from the integrated GUI using Bento
Lab's intuitive button and wheel.
 To get started, turn on your Bento Lab using the power switch on the back.
After a while, the Bento Lab status screens will appear with three module
icons (left: Gel Electrophoresis, middle: Centrifuge, right: Thermo cycler).
Click on the thermal cycler icon to activate the module. This will bring up
the thermal cycler screen.
 The thermal cycler screen displays status information about the current
state of the module in the upper half of the screen, such as block and lid
temperature. When the log is running on the module, an estimate of the
remaining time is also displayed.
 When the module is idle, the bottom buttons are used to open the Thermo
cycler log editor. The first two buttons open the editor with the default PCR
protocol (1) or the default thermal block protocol (2). The disk button (3)
on the right leads to a list of all previously saved thermo cycler protocols.

 When the module is running, the bottom buttons change. The control
button on the left (4) can be used to display the exact position in the
currently running program. The Cancel button on the right (5) is used to
exit the program and can be used to either cancel it or turn off the module
when it is held in the last step.

 Before loading samples, ensure that the heat indicator light of the module
is off. This means that the lid is safe to open and that no element is hot.
 Open the Bento Lab Thermo cycler lid. The lid opens easily with little
resistance.
 Load PCR tubes (0.2mL) into the block. Up to 32 tubes can be loaded. If
the protocol makes use of the heated lid, ensure that all PCR tubes have the
same height, so that the heated lid applies evenly when the lid is closed.
 Ensure that the Thermo cycler block is clean and no dust or other elements
prevent contact between the block and the tubes. Ensure that PCR tubes sit
tightly in the block.
 Close the lid and ensure it is fully engaged.

 To create a new protocol, start by selecting a default PCR protocol from


the Thermo cycler menu. This will open the editor with pre-installed
default settings.

 Alternatively, when using the Bento Lab thermal cycler as a thermal block,
a convenient default protocol is available that contains only one
temperature step.
 The left button with the key icon (1) unlocks the log for editing. The middle
button with the disk icon (2) gives the possibility to name and save the log.
The right button with the start icon (3) activates the module and starts the
protocol.
 From the default protocol view, click on the spanner icon.

 The three buttons on the bottom right disappear. Instead, the first
temperature stage is highlighted and the precise properties of the stage is
displayed below. Using the orange click-wheel you can now scroll through
each stage in the protocol. The detailed properties at the bottom of the
screen change accordingly.

 To return to the default protocol view in order to save your changes or run
the protocol, push the green back button

 Highlight the temperature stage you want to change by scrolling to it with


the orange click wheel.
 Push down the orange click wheel. The temperature stage is now selected
and the properties are editable.

 To make changes to the temperature, select the temperature value button.
Push down the orange click-wheel and keep holding it down whilst rotating
it to change the value. Dial clockwise to increase the temperature, and
counter-clockwise to decrease it. Release the orange click-wheel once you
have reached the desired temperature.
 To make changes to the duration, select the duration value button and
change the value in the same manner as the temperature.

 Once you are done, confirm your changes by clicking on the confirmation
button on the right. The properties become locked again.
 If you do not want to keep your changes, you can also use the green back
button. In this case the properties also become locked again, but the
changes are not kept
 Highlight the cycle you want to change by scrolling to it with the orange
click wheel.
 Push down the orange click wheel. The cycle is now selected and the
properties are editable.
 To change the number of repeats, select the cycle repeat value button at the
bottom of the screen. Push down the orange click-wheel and keep holding
it down whilst rotating it to change the value. Dial clockwise to add cycles,
and counter-clockwise to reduce the number of cycles. Release the orange
click-wheel once you have set the desired number of cycles.
 To change the start and end point of the cycle, buttons with a left-right icon
are shown on the left and right sides of the cycle.
 To change the start point of the cycle, highlight the button on the left side
of the cycle. Push down the orange click-wheel and keep holding it down
whilst rotating it. Dial counter-clockwise to move the starting point of the
cycle to the left, or clockwise to move it to the right.
 The end point of the cycle can be similarly changed.
 If the last stage is a hold stage, it cannot be included in a cycle.
 Once you are done, confirm your changes by clicking on the confirmation
button on the right. The properties become locked again.
 If you do not want to keep your changes, you can also use the green back
button. In this case the properties also become locked again, but the
changes are not kept.
 Add a temperature stage, select a temperature stage next to the position
where the new stage should be.
 Push down the orange click wheel.
 A new stage can be added either to the left or to the right side of the selected
stage, by clicking on the button with the plus icon on either side of the
stage.
 Once the plus has been clicked, a new stage is added on the selected side.
The new stage has the same properties as its neighbor that was selected to
add the stage.
 The new stage is automatically selected to be edited.
 To delete a stage, click on the button with the bin icon at the bottom left. If
the stage is the only remaining stage in a cycle, the cycle will also be
removed.

 Advanced protocols sometimes require landing cycles. This means that the
temperature step within the cycle decreases by the set value after a certain
number of repetitions within the cycle. For example, the temperature phase
may start at 60 degrees of the cycle, but is reduced by 0.2 degrees for the
first 10 repetitions of the cycle and ends at 58 degrees for all remaining
cycles.
 To add a touch step to a cycle, highlight the temperature phase to which
you want to add a touch step. This will usually be in the cycle before the
main PCR cycle.
 Push down on the orange click wheel.
 A touch button appears between the left and right plus buttons. The touch
button is only visible when the temperature stage is in a cycle.
 Select the touch button and press the orange click wheel.
 The temperature stage is now marked with a touchdown icon. The icon can
be selected and the touch phase configured.
 The left option is temperature delta, i.e. how much the cycle temperature
changes with each iteration.
 The correct choice determines how many times delta touch is applied.
Multiply this number by the temperature delta value to get the total amount
by which the temperature step will be reduced.

 To configure the temperature of the heated lid, select the gear icon in the
upper right corner of the editor.
 Push down on the orange click wheel.
 Lid temperature is now adjustable. It can be tuned in a similar way to the
temperature of any temperature stage in the editor.
 In addition, the heated lid can be completely switched off and on again by
pressing the temperature value button.
 Click the confirmation button on the right to confirm the changes. The
properties will be locked again.
 You can also use the green back button if you don't want to keep your
changes. In this case, the properties will also be locked again, but the
changes will not be preserved

Genetic Modification Crops Detection


Protocol
Today, modern biotechnology and genetic engineering allow scientists and
breeders to converse very specific traits by rapidly introducing certain genes
directly into plants. The introduced genes (or transgenes) can come from the same
plant species, from another plant species, or even from animals or bacteria. For
example, the insecticidal toxin gene in transgenic cotton, potato and maize plants
originate from the bacterium Bacillus thuringiensis (Bt).One of the genes
enabling the production of vitamin A in golden rice comes from this bacterium
Erwinia uredovora, commonly found in soil.

Procedure:

 Label 200 µl thin-walled PCR tubes per lab group on the side of the tube,
not on the cap tubes
 1 tube labeled “F1”: For DNA extraction from food 1
 1 tube labeled “F2”: For DNA extraction from food 2
 Add 50 µL of DNA-EZ™ Lysis Solution to each tube
 Prepare test foods or plant tissues for DNA extraction
 Tightly cap the 200 µL tube containing the DNA-EZ™ Lysis Solution and
test foods
 Ensure that the food fragments are well mixed into the lysis solution
 Incubate the food mixture in DNA-EZ Lysis Solution for 5 minutes at 95°C
 Remove the tubes from the heat and let them rest in the tube rack at room
temperature
 Add 5 µL of DNA-EZ™ Neutralization Solution to each tube
 If a micro centrifuge is available, centrifuge the residue before PCR
10,000 rpm for 2 minutes
 Label 4 clean PCR tubes (200 µL thin-walled tubes) per group on the
sidewall
 1 tube labeled “T1”: Test DNA extracted from Food 1
 1 tube labeled “T2”: Test DNA extracted from Food 2
 1 tube labeled “G”: ‘GMO Banana’ DNA supplied in the kit
 1 tube marked “W”: “Non-GMO Banana” DNA supplied in the kit

Tube 1 Tube 2 Tube G Tube w


GMO Lab 20 µL 20 µL 20 µL 20 µL
Primers
5X EZ PCR 5 µL 5 µL 5 µL 5 µL
Mix

 Add DNA samples to each tube using a clean tip


 Tubes T1 and T2 (food DNA extracts):
 Add 2 µL of DNA extract, avoiding large food particles as
they may clog
 The tip of your pipette. If a blockage occurs, pipet up and
down to clear the blockage.
 ii. G and W tubes (controls supplied with the kit):
 Pipette 2 µl of “GMO Banana DNA” and “non-GMO
Banana” samples.
 Supplied with the GMO Lab mini-PCR kit

Tube 1 Tube 2 Tube G Tube W


Template DNA DNA Control Control
extract extract ‘GMO ‘Wild
DNA from Test from Test Banana’ Banana’
Food 1 2 Food 2 2 DNA DNA
µL µL supplied Supplied
w/kit 2 µL w/kit 2 µL
FINAL
VOLUME 27 µL 27 µL 27 µL 27 µL

 Cap the tubes


 Place the tubes inside the PCR machine
 Open the mini-PCR software app and remain on the "Protocol
Library" tab

 Click the "New Protocol" button on the lower left corner


 Select the PCR "Protocol Type" from the top drop-down menu
 Enter a name for the Protocol; for example "Group 1 – GMO Lab"
 Enter the PCR protocol parameters:
 Initial Denaturation 94°C, 60 sec
 Denaturation 94°C, 10 sec
 Annealing 55°C, 10 sec
 Extension 72°C, 15 sec
 Number of Cycles 35
 Final Extension 72°C, 30 sec
 Heated Lid ON
 Click "Save" to store the protocol
 Click “Upload to miniPCR” (and select the name of your miniPCR
machine in the
 Dialogue window) to finish programming the thermal cycler.
 Make sure that the power switch in the back of miniPCR is in the
ON position
 Click on “miniPCR [machine name]” tab to begin monitoring the
PCR reaction
 Once the PCR run is completed (approximately 60 min), the screen
will display:
 Status: Completed”. All LEDs on the miniPCR machine will light
up.
 After PCR perform a DIY gel electrophoresis protocol in order to
confirm your experiment.

[Protein Structure and Function Protocol]


Proteins are essential tools for life.
They perform functions as varied as
Generating movement, transmitting
Signals, providing structural support,
And catalyzing enzymatic reactions.
Every protein has a specific function,
Which is dependent on its shape,
Or structure
Procedure:

 Label and number each tube in your strip with four BioBits
 pellets, 1-4
 Mark the numbers on the sides of the tube, not on the cap.
 Label the group name/symbol somewhere on the tubes.
 Tube 1 will be used to produce the original GFP
 Researchers started with (FP1)
 Pipe 2 and 3 will be used to produce a potential new one
 GFP (FP2 and FP3). You have formed hypotheses about how
 these proteins can function based on the sequence before the lab
 Analytical activity.
 Tube 4 will be for your negative control.
 Prepare and uncap tubes with BioBits strips
 Gently tap the tubes on the table before removing
 Collect the pellets at the bottom
 To open the tubes, CAREFULLY remove each cap in the strip
 One at a time, being careful not to dislodge the BioBits pellets.
 Add 5 μl of FP1 DNA to tube 1 according to the instructions below
 Repeat step 3 to add the remaining DNA samples and water to each BioBits
in the strip
 (use a new tip for each sample)
 Add 5 μl of FP2 DNA to tube 2.
 Add 5 µL of FP3 DNA to tube 3.
 Add 5 μl of water to test tube 4.
 When finished, each tube should have the amounts shown in the table
below

Tube 1 Tube 2 Tube 3 Tube 4


5 μl DNA FP1 5 μl DNA FP2 5 μl DNA FP3 5 μl of water

 Close the caps on the tubes


 You should feel the caps "snap" into place if they are properly
closed.
 Make sure all the liquid has dissolved the pellets and is at the bottom
of the tube.
 If there is liquid stuck to the sides of the tubes, shake it off with a
flick of the wrist or
 Spin briefly in a microcentrifuge
 You will observe the samples under UV light and blue light for at
least three time points: 0 min,
 30 minutes and another day
 Instantly track your pods
 UV light and under blue light
 Dim the ambient lights to make it easier
 Observe any fluorescence.
 Place tubes at 37˚C for at least 30 minutes
 After 30 minutes, observe your tubes under UV light and under blue
light
 Record your observations.
References:
1. Zarubin, Margarita; Belkin, Shimshon; Ionescu, Michael; Genin, Amatzia (2012-01-17).
"Bacterial bioluminescence as a lure for marine zooplankton and fish". Proceedings of
the National Academy of Sciences of the United States of America. 109 (3): 853–857.
Bibcode:2012PNAS..109..853Z. doi:10.1073/pnas.1116683109. ISSN 1091-6490. PMC
3271926. PMID 22203999
2. Tanet, Lisa; Martini, Séverine; Casalot, Laurie; Tamburini, Christian (2020). "Reviews
and syntheses: Bacterial bioluminescence – ecology and impact in the biological
carbon pump". Biogeosciences. 17 (14):
3. Nealson, K. H. and Hastings, J. W. (1979) "Bacterial bioluminescence: its control and
ecological significance", Microbiol. Rev., 43: 496–518. doi:10.1128/MMBR.43.4.496-
518.1979.
4. Urbanczyk, Henryk; Ast, Jennifer C.; Dunlap, Paul V. (2011-03-01). "Phylogeny,
genomics, and symbiosis of Photobacterium". FEMS Microbiology Reviews. 35 (2):
324–342. doi:10.1111/j.1574-6976.2010.00250.x. ISSN 0168-6445. PMID 20883503.

5. Ruby, E. G.; Lee, K. H. (1998-03-01). "The Vibrio fischeri-Euprymna scolopes Light


Organ Association: Current Ecological Paradigms". Applied and Environmental
Microbiology. 64 (3): 805–812. Bibcode:1998ApEnM..64..805R.
doi:10.1128/AEM.64.3.805-812.1998. ISSN 0099-2240. PMC 106330. PMID
16349524.
6. Naughton, Lynn M.; Mandel, Mark J. (2012-03-01). "Colonization of Euprymna
scolopes Squid by Vibrio fischeri". Journal of Visualized Experiments (61): e3758.
doi:10.3791/3758. ISSN 1940-087X. PMC 3399469. PMID 22414870
7. Szpilewska, Hanna; Czyz, Agata; Wegrzyn, Grzegorz (2003-11-01). "Experimental
evidence for the physiological role of bacterial luciferase in the protection of cells
against oxidative stress". Current Microbiology. 47 (5): 379–382. doi:10.1007/s00284-
002-4024-y. ISSN 0343-8651. PMID 14669913. S2CID 20132449.
8. More-than-Human Media Architecture | Proceedings of the 4th Media Architecture
Biennale Conference" (PDF). doi:10.1145/3284389.3284495. S2CID 69160272.
9. Latz, Michael I. (2019). "The Making of Infinity Cube, a Bioluminescence Art Exhibit".
Limnology and Oceanography Bulletin. 28 (4): 130–134. doi:10.1002/lob.10345. ISSN
1539-6088.
10. DYBAS, CHERYL LYN (2019). "A New Wave SCIENCE AND ART MEET IN THE SEA".
Oceanography. 32 (1): 10–12. ISSN 1042-8275. JSTOR 26604937.
11. Fuqua, W. C.; Winans, S. C.; Greenberg, E. P. (1994-01-01). "Quorum sensing in
bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators".
Journal of Bacteriology. 176 (2): 269–275. doi:10.1128/jb.176.2.269-275.1994. ISSN
0021-9193. PMC 205046. PMID 8288518.
12. Hicks, Jennifer (2014-03-15). "The Biohacking Hobbyist". Forbes. Retrieved 2016-06-
19.
13. Michels, Spencer (2014-09-23). "What is biohacking and why should we care?". PBS
NewsHour. Retrieved 2015-10-30.

14. Katz, Sylvan (6 January 1990). "Forum: Roses are black, violets are green – The
emergence of amateur genetic engineers". New Scientist. Retrieved 2015-10-25.

15. Katz, J. S. (1990). "That which is not forbidden is Mandatory". Education. 4 (1). ISSN
0955-6621.

16. Schrage, Michael (1988-01-31). "Playing God in your basement". The Washington
Post. ISSN 0190-8286. Retrieved 2015-10-25.

17. Carlson, Rob (May 2005). "Splice It Yourself: Who needs a geneticist? Build your own
lab". Wired.

18. Ledford, Heidi (2010). "Garage : Life hackers". Nature. 467 (7316): 650–2.
doi:10.1038/467650a. PMID 20930820.

19. Mosher, Dave (2010-12-16). "DIY Biotech Hacker Space Opens in NYC". Wired.
Retrieved 2017-07-25.

20. PBS News Hour". YouTube. 31 Dec 2008. Archived from the original on 2021-12-20

21. BioCurious Officially Opens — Test DNA, Build Equipment, Find a Co-founder and
More…". Make Magazine. 2011-10-14. Retrieved 2017-07-25.

22. Dariusz Jemielniak; Aleksandra Przegalinska (18 February 2020). Collaborative


Society. MIT Press. ISBN 978-0-262-35645-9

23. Rob Carlson on synthetic biology". The Economist. Archived from the original on
2011-10-09.

24. Biohack the Planet Conference". Biohack the Planet. Retrieved 2016-06-19.
25. Wu, Chen-Yi; Hu, Hsiao-Yun; Chow, Lok-Hi; et al. (22 June 2015). "The Effects of Anti-
Dementia and Nootropic Treatments on the Mortality of Patients with Dementia: A
Population-Based Cohort Study in Taiwan". PLOS ONE. 10 (6): e0130993.
Bibcode:2015PLoSO..1030993W. doi:10.1371/[Link].0130993. PMC 4476616.
PMID 26098910.

26. Singh, Honey (2 February 2020). "How to Biohack Your Metabolism?". Do


BioHacking.

27. Heindel, Jerrold J.; Blumberg, Bruce; Cave, Mathew; et al. (March 2017).
"Metabolism disrupting chemicals and metabolic disorders". Reproductive
Toxicology. 68: 3–33. doi:10.1016/[Link].2016.10.001. PMC 5365353. PMID
27760374.

28. Prigent, Sylvain; Frioux, Clémence; Dittami, Simon M.; Thiele, Sven; Larhlimi,
Abdelhalim; Collet, Guillaume; Gutknecht, Fabien; Got, Jeanne; Eveillard, Damien;
Bourdon, Jérémie; Plewniak, Frédéric; Tonon, Thierry; Siegel, Anne (27 January
2017). "Meneco, a Topology-Based Gap-Filling Tool Applicable to Degraded
Genome-Wide Metabolic Networks". PLOS Computational Biology. 13 (1): e1005276.
Bibcode:2017PLSCB..13E5276P. doi:10.1371

29. Anderson, Jason R.; Hagerdorn, Payton L.; Gunstad, John; Spitznagel, Mary Beth (July
2018). "Using coffee to compensate for poor sleep: Impact on vigilance and
implications for workplace performance". Applied Ergonomics. 70: 142–147.
doi:10.1016/[Link].2018.02.026. PMID 29866304.

30. Pearce, Joshua M. (14 September 2012). "Building Research Equipment with Free,
Open-Source Hardware". Science. 337 (6100): 1303–1304.
Bibcode:2012Sci...337.1303P. doi:10.1126/science.1228183. PMID 22984059. S2CID
44722829.

31. Pearce, Joshua M. (14 September 2012). "Building Research Equipment with Free,
Open-Source Hardware". Science. 337 (6100): 1303–1304.
Bibcode:2012Sci...337.1303P. doi:10.1126/science.1228183. PMID 22984059. S2CID
44722829.

32. "Counter Culture Labs Membership". Counter Culture Labs. Retrieved 2016-06-17.

33. Pocket PCR for pennies". LavaAmp. Archived from the original on 2015-11-06.
Retrieved 2015-10-26.

34. "Coffee Cup - PCR Thermocycler costing under 350$". Instructables. 2009-06-13.
Retrieved 2016-06-17

35. Landoni, Boris (11 July 2014). "Interview to Open Trons | Open Electronics". Open
Source Electronics. Retrieved 1 November 2016.
36. Open Cell is hosting monthly biohackathons to develop equipment, software and
products to make better and more affordable biolaboratories". [Link].
OpenCell. Retrieved 2019-08-17.

You might also like