Protocol
Protocol
Push thumb plunger down to Desired Measurement and immerse tip far
enough into product for the betterment
Throwaway the tip
References:
1. "Biotechnology Outreach". Retrieved 3 March [Link], M (2005). "When a
common problem meets an ingenious mind". EMBO Rep. 6 (9): 797–800.
doi:10.1038/[Link].7400520. PMC 1369176. PMID 16138087.
2. Zinnen, Tom (June 2004), The Micropipette Story, retrieved November 12, 2011
3. Shohl, Alfred T. (February 1928). "A Pipet for Micro-Analyses". Journal of the American
Chemical Society. 50 (2): 417. doi:10.1021/ja01389a502.
4. Ainla, Alar; Jansson, Erik T.; Stepanyants, Natalia; Orwar, Owe; Jesorka, Aldo (June
2010). "A Microfluidic Pipette for Single-Cell Pharmacology". Analytical Chemistry. 82
(11): 4529–4536. doi:10.1021/ac100480f. PMID 20443547.
5. Motorized Pipette Controllers | Motorized Controller | [Link]".
[Link].
6. Aimee Cunningham (2007-04-18). "A New Low: Lilliputian pipette releases tiniest
drops". Science News. Vol. 171. pp. 244–245
7. "Pipette Confidently with PipetteRite – Control the Immersion Depth, Steady Your
Hand, and Improve Ergonomics". hands-free use of pipettes, August 2012, retr
8. "Micro Pipette Calibration – Accumaximum". Archived from the original on 30 June
2013. Retrieved 3 March 2016.
9. Ovation Ergonomic Pipettes generate ideal pipetting posture". Archived from the
original on 3 March 2016. Retrieved 3 March 2016
10. electronic pipette made smart through connectivity, April 2019, retrieved April 11,
2019
[DNA Extraction]
DNA Extraction protocol:
Reagents:
lysis buffer: 1% SDS, 0.5 M NaCl
isopropanol
References:
1. Gupta, Nalini (2019). "DNA extraction and polymerase chain reaction". Journal of
Cytology. 36 (2): 116. doi:10.4103/JOC.JOC_110_18. ISSN 0970-9371. PMC 6425773.
PMID 30992648.
2. DNA Extraction - an overview | ScienceDirect Topics". [Link]. Retrieved
2023-01-27.
3. Dehasque, Marianne; Pečnerová, Patrícia; Kempe Lagerholm, Vendela; Ersmark, Erik;
Danilov, Gleb K.; Mortensen, Peter; Vartanyan, Sergey; Dalén, Love (2022-04-13).
"Development and Optimization of a Silica Column-Based Extraction Protocol for Ancient
DNA". Genes. 13 (4): 687. doi:10.3390/genes13040687. ISSN 2073-4425. PMC 9032354.
PMID 35456493.
4. Yoshikawa H, Dogruman-Al F, Dogruman-Ai F, Turk S, Kustimur S, Balaban N, Sultan N
(October 2011). "Evaluation of DNA extraction kits for molecular diagnosis of human
Blastocystis subtypes from fecal samples". Parasitology Research. 109 (4): 1045–50.
doi:10.1007/s00436-011-2342-3. PMID 21499752. S2CID 37191780
5. Fahle, Gary A.; Fischer, Steven H. (October 2000). "Comparison of Six Commercial DNA
Extraction Kits for Recovery of Cytomegalovirus DNA from Spiked Human Specimens".
Journal of Clinical Microbiology. 38 (10): 3860–3863. doi:10.1128/JCM.38.10.3860-
3863.2000. ISSN 0095-1137
6. Elkins KM (2013). "DNA Extraction". Forensic DNA Biology. pp. 39–52.
doi:10.1016/B978-0-12-394585-3.00004-3. ISBN 9780123945853.
7. Marmur, J. (1961). "A procedure for the isolation of deoxyribonucleic acid from micro-
organisms". Journal of Molecular Biology. 3 (2): 208–IN1. doi:10.1016/S0022-
2836(61)80047-8.
8. Li, Richard (11 March 2015). Forensic biology (2nd ed.). Boca Raton. ISBN 978-
1439889725. OCLC 907517669.
9. "Fluorescence In Situ Hybridization (FISH)". [Link]. Retrieved 2022-10-23
10. Butler JM (2005). Forensic DNA typing : biology, technology, and genetics of STR markers
(2nd ed.). Amsterdam: Elsevier Academic Press. ISBN 9780080470610. OCLC 123448124.
References:
1. Pääbo S (March 1989). "Ancient DNA: extraction, characterization, molecular cloning, and
enzymatic amplification". Proceedings of the National Academy of Sciences of the United
States of America. 86 (6): 1939–43. Bibcode:1989PNAS...86.1939P.
2. Li, Zhigang; Parris, Stephen; Saski, Christopher A. (2020). "A simple plant high-molecular-
weight DNA extraction method suitable for single-molecule technologies". Plant Methods. 16:
38. doi:10.1186/s13007-020-00579-4. ISSN 1746-4811. PMC 7071634. PMID 32190102. CC BY
[Link] Text was copied from this source, which is available under a Creative Commons
Attribution 4.0 International License.
3. Coudy, Delphine; Colotte, Marthe; Luis, Aurélie; Tuffet, Sophie; Bonnet, Jacques (2021-11-11).
Xu, Jian (ed.). "Long term conservation of DNA at ambient temperature. Implications for DNA
data storage". PLOS ONE. 16 (11): e0259868. doi:10.1371/[Link].0259868. ISSN 1932-
6203. PMC 8585539. PMID 34763344.
4. Appendix S2: DNA extraction method and DNA quality". [Link]. Retrieved 2023-01-27.
5. Fuchs, Florence (2002-11-01). "Quality control of biotechnology-derived vaccines: technical
and regulatory considerations". Biochimie. 84 (11): 1173–1179. doi:10.1016/S0300-
9084(02)00028-7. ISSN 0300-9084.
H2O 745 μL
EDTA (0.5M) 9 mL
Proteinase K (10mg\mL) 250 μL
Tween-20 5 μL
Restricting Buffer:
Restricting Buffer(50mL):
GuHCl (5 M) 23.88 g
Water 30 mL.
isopropanol 20 mL
Tween-20. 25 μL
Sample Preparation:
Gather 10–150 mg powdered (grind) sample in a 2 mL tube.
Put-on 1 mL of extraction buffer and Mix gently by vertexing
Incubate at 37°C for 16-24h
DNA RESTRICTION:
For each sample along control, shift approximately 10 mL of
restriction buffer to a tagged 15 mL tube, put-on (400 μL 3M) sodium
acetate.
Centrifuge samples for 2 min
Shift supernatant to the 15 mL tube carrying a restriction buffer. Mix
well by shaking.
Stream the restriction buffer mixture into the reservoir of the spin-
column assembly, cover the 50 mL tube with a screw cap
Centrifuge at 400g for 4min
Spin tubes 90°
Centrifuge again at 400g for 2min
Discard the screw cap from the 50 mL tube, and shift the spin-column
assembly to a clean 2 mL tube and discard the extension reservoir.
Close and tagged the spin-column cap
Complete a dry spin at 3000g for 1min using benchtop centrifuge
Remove any flow-through.
Put-on 750 μL PE buffer to each column. centrifuge at 3000 for 30s
and Remove any flow-through
Repeat step 13
Complete a dry spin at 16,000 g for 1min
Shift the column to a new 1.5 mL tube
Put-on 50 μL TET buffer immediately on to the silica membrane.
keep sit for 5 min
Centrifuge at maximum speed for 1 min
Repeat steps 16 and 17 by shifting the eluate back on to the silica
membrane
Shift the (final DNA extract) to a new 1.5 mL tube and stored at -
20°C
References:
1. Danielewski M, Żuraszek J, Zielińska A, Herzig KH, Słomski R, Walkowiak J, Wielgus
[Link] (Basel). 2023 Jan 16;14(1):234. doi: 10.3390/[Link]:
36672975
2. Šuligoj A, Mesesnel S, Leskovar T, Podovšovnik E, Zupanič Pajnič [Link] J Legal Med. 2022
Nov;136(6):1521-1539. doi: 10.1007/s00414-022-02881-3. Epub 2022 Sep [Link]:
36048257
3. Hyun JY, Kim TW, Pandey P, Kim KS, Jeong SJ, Kang JK, Kong DY, Jung SH, Jeong HK,
Han SH, Han SH, Lee [Link] Cells Syst (Seoul). 2022 Sep 20;26(5):214-222. doi:
10.1080/19768354.2022.2112755. eCollection [Link]: 36275447
4. Paszkiewicz, Konrad H.; Farbos, Audrey; O'Neill, Paul; Moore, Karen (2014). "Quality
control on the frontier". Frontiers in Genetics. 5. doi:10.3389/fgene.2014.00157. ISSN
1664-8021. PMC 4033843. PMID 24904650.
5. Coudy, Delphine; Colotte, Marthe; Luis, Aurélie; Tuffet, Sophie; Bonnet, Jacques (2021-11-
11). Xu, Jian (ed.). "Long term conservation of DNA at ambient temperature. Implications for
DNA data storage". PLOS ONE. 16 (11): e0259868. doi:10.1371/[Link].0259868. ISSN
1932-6203. PMC 8585539. PMID 34763344.
[Mitochondrial DNA isolation
protocol]
Mitochondrial DNA isolation protocol:
Gather the cells 5 x 10^6 along with centrifugation at 600 x g for 5 min at
4ºC
Clean cells with 5-10 ml of ice-cold Phosphate-buffered saline
Centrifuge at 600 x g for 5 min at 4ºC
Discard the supernatant
Re-suspend cells in (1.0ml of 1X) cytosol isolation buffer
Incubate for 10min within ice
Homogenize cells in an ice-cold Dounce tissue blender. Process the task
with the blender on ice, 50 - 100 passes with the blender.
Shift homogenate to a clean 1.5 ml micro centrifuge tube, centrifuge at
1200 x g for 10 min at 4ºC
Shift supernatant to a clean 1.5 ml tube, centrifuge at 10,000 x g for 30 min
at 4ºC.
Discard supernatant
Re-suspend the pellet in 1ml 1X cystosol isolation buffer
centrifuge at 10000 x g for 30min at 4ºC
Discard the supernatant
Lyse the mitochondria in 30µl of the mitochondria lysis buffer, remain on
ice for 10 min
Put-on 5 µl lyophilized, Incubate at 50ºC water bath for 60min
Put-on 100 µl entire ethanol next mix and remain at -20ºC for 10 min
Micro centrifuge at maximum speed for 5min at room temperature
Discard the supernatant.
Wash the DNA pellet more than one time with 1 ml of 70 % ethanol.
Discard the trace amount ethanol using a pipet tip.
Air dry approximately for 5 min.
Re-suspend the DNA using 20 µl TE buffer
Store the DNA at -20ºC
References:
1. Graham [Link] Protoc Cell Biol. 2001 May;Chapter 3:Unit 3.3. doi:
10.1002/[Link]: 18228355
3. Franko A, Baris OR, Bergschneider E, von Toerne C, Hauck SM, Aichler M, Walch AK, Wurst W,
Wiesner RJ, Johnston IC, de Angelis [Link] One. 2013 Dec 12;8(12):e82392. doi:
10.1371/[Link].0082392. eCollection [Link]: 2434927
References:
1. Zangala T. Isolation of genomic DNA from mouse tails. J Vis Exp. 2007;(6):246. doi:
10.3791/246. Epub 2007 Jul 29. PMID: 18997894; PMCID: PMC2557115.
2. Marmur, J. (1961). "A procedure for the isolation of deoxyribonucleic acid from micro-
organisms". Journal of Molecular Biology. 3 (2): 208–IN1. doi:10.1016/S0022-2836(61)80047-
8.
3. Appendix S2: DNA extraction method and DNA quality". [Link]. Retrieved 2023-01-27.
[ISOLATION OF DROSOPHILA
GENOMIC DNA PROTOCOL]
Isolation of Drosophila Genomic DNA protocol:
Acquire 30 healthy, freshly flies freeze them at −80°C for 5 min.
put-on 200 μL Buffer A and crush with tissue grinder round about 5min
Put-on 200 μL Buffer A and continue to crush until only pieces of cuticle
remain. incubate at 65°C for 30min
put-on 800 μL 1:2.5 [5 M]KOAc:[6 M] LiCl precipitate along the ice for
10 min. centrifuge at 14,000 rpm for 15 min
Shift supernatant to 2 Eppendorf tubes observe volume in each tube
Put-on 700 μL Isopropanol per mL supernatant. centrifuge at 14,000 rmp
for 15min, discard supernatant
Washed with 1 mL cold ethanol
centrifuge at 14,000 rpm for 5 min
Discard the supernatant and resuspend in 100 μL TE.
References:
1. Identification of methylated sequences in genomic DNA of adult Drosophila
[Link] A, Fisher O, Siman-Tov R, Ankri [Link] Biophys Res Commun. 2004
Sep 17;322(2):465-9. doi: 10.1016/[Link]: 15325253
2. Brzobohatý B, Karlovská L, Vyskot B, Bezdĕk [Link] Biol (Praha). 1988;34(1):[Link]:
[Link] AV, Churikov [Link]. 1991 Sep;27(9):[Link]: 1778465
Russian.
3. Ashburner M, Bergman [Link] Res. 2005 Dec;15(12):1661-7. doi:
10.1101/[Link]: 16339363
4. Gibson [Link] Biol. 2003 Oct;1(1):E15. doi: 10.1371/[Link].0000015. Epub 2003 Oct
PMID: 14551912
Procedure:
Develop a culture
Mix specimen directly with ice cold Killing Buffer (ratio 1:1) and add on
ice
Spin down cells 3 min
Re-suspend in 300 μL TE
Put-on 40 μL 10% SDS and 3 μL 0.5 M EDTA
Incubate 5m at 65°C
Put-on 750 μL isopropanol
Spin at max speed 5 min and reject supernatant
Re-suspend pellet in 500 μL TE and put-on 2 μL RNase A
incubate for 30m at 65°C
Put-on 2 μL proteinase K and incubate at 37°C for 15m
Remove phenol
precipitate whole night with 1 ml ethanol and 40 μL 3M Na-Acetate
Turn down DNA at 4°C for a 15m, wash in 70% ethanol and re-suspend
pellet in 50 μLdH2
References
1. Blattner F R, et al. The complete genome sequence of Escherichia coli K-12. Science.
1997;277:1453–1474. [PubMed] [Google Scholar]
Procedure:
Culture E. coli with plasmid in LB media with anti-infection separating
pressure, entire near on a shaker at 37°C
Pellet 1.5 ml of bacterial culture in a microfuge tube by centrifuging for 2
minutes justly. 10,000 rpm.
Decant the supernatant and put-on 200 µl of the resuspension buffer. In
organization to resuspend the pellet you may have to vortex.
Put-on 250 µl of the lysis buffer, upturn the tube 10 times to mix
rigorously. The solution should become clear and viscous.
Put-on 350 µl of the neutralization buffer, upturn the tube 10 times or till a
precipitate form. The precipitate is a mixture of protein and chromosomal
DNA.
Centrifuge the tube for 10 minutes at 10,000 rpm. Shift the supernatant to a
microfuge tube and add 0.7 isopropanol. Incubate justly -20°C for 15
minutes
Shift the solution to a spin column.
Centrifuge the spin column for 1 minute at 7,000 rpm. throwaway the flow
through
Put-on 400 µl of the wash buffer and centrifuge for 1 minute at 7,000 rpm.
Throw away the flow through. Repeat this step.
Centrifuge for an added 2 minutes at 10,000 rpm to remove the remaining
wash buffer.
Shift the column to a clean microfuge tube. Put-on 50 µl of elution buffer
and centrifuge for 1 minute at 10,000 rpm.
References
1. Halary, S., Leigh, J. W., Cheaib, B., Lopez, P., and Bapteste, E. (2010). Network analyses
structure genetic diversity in independent genetic worlds. Proc. Natl. Acad. Sci. U.S.A. 107,
127–132. doi: 10.1073/pnas.0908978107
2. Dib, J. R., Wagenknecht, M., Farías, M. E., and Meinhardt, F. (2015). Strategies and approaches
in plasmidome studies—uncovering plasmid diversity disregarding of linear elements? Front.
Microbiol. 6:463. doi: 10.3389/fmicb.2015.00463
3. De Toro, M., Garcillán-Barcia, M. P., and De La Cruz, F. (2014). Plasmid diversity and
adaptation analyzed by massive sequencing of Escherichia coli plasmids. Microb. Spectr. 2,
219–235. doi: 10.1128/[Link]-0031-2014
4. Birnboim, H. C., and Doly, J. (1979). A rapid alkaline extraction procedure for screening
recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523.
6. Arredondo-Alonso, S., Willems, R. J., Van Schaik, W., and Schürch, A. C. (2017). On the (im)
possibility of reconstructing plasmids from whole genome short-read sequencing data.
Microb. Genom. 3:e000128. doi: 10.1099/mgen.0.000128
References:
1. Orr-Weaver TL, Szostak JW, Rothstein [Link] Enzymol. 1983;101:228-45. doi:
10.1016/0076-6879(83)[Link]: 6310326
3. Gnügge R, Rudolf [Link]. 2017 May;34(5):205-221. doi: 10.1002/yea.3228. Epub 2017 Feb
[Link]: 28072905
References
2. O'Mahony K, Freitag R, Hilbrig F, Müller P, Schumacher I.J Biotechnol. 2005 Sep 23;119(2):118-
32. doi: 10.1016/[Link]: 15993505
3. Stadler J, Lemmens R, Nyhammar T.J Gene Med. 2004 Feb;6 Suppl 1:S54-66. doi:
10.1002/[Link]: 14978751
References:
1. Rhoads DD, Wolcott RD, Kuskowski MA, Wolcott BM, Ward LS, Sulakvelidze A (June
2009). "Bacteriophage therapy of venous leg ulcers in humans: results of a phase I
safety trial". Journal of Wound Care. 18 (6): 237–8, 240–3.
doi:10.12968/jowc.2009.18.6.42801. PMID 19661847
2. Twort FW (1915). "An Investigation on the Nature of Ultra-Microscopic Viruses". The Lancet.
186 (4814): 1241–43. doi:10.1016/S0140-6736(01)20383-3.
3. Callanan J, Stockdale SR, Adriaenssens EM, Kuhn JH (January 2021). "Rename one class
(Leviviricetes - formerly Allassoviricetes), rename one order (Norzivirales - formerly
Levivirales), create one new order (Timlovirales), and expand the class to a total of six
families, 420 genera and 883 species". ResearchGate. doi:10.13140/RG.2.2.25363.40481
6. Borrell B, Fishchetti V (August 2012). "Science talk: Phage factor". Scientific American.
pp. 80–83. JSTOR 26016042
7. Bunting J (1997). "The Virus that Cures". BBC Horizon. BBC Worldwide Ltd. OCLC
224991186. – Documentary about the history of phage medicine in Russia and the
West
8. Wommack KE, Colwell RR (March 2000). "Virioplankton: viruses in aquatic
ecosystems". Microbiology and Molecular Biology Reviews. 64 (1): 69–114.
doi:10.1128/MMBR.64.1.69-114.2000. PMC 98987. PMID 10704475.
9. Suttle CA (September 2005). "Viruses in the sea". Nature. 437 (7057): 356–61.
Bibcode:2005Natur.437..356S. doi:10.1038/nature04160. PMID 16163346. S2CID
4370363
10. McGrath S, van Sinderen D, eds. (2007). Bacteriophage: Genetics and Molecular
Biology (1st ed.). Caister Academic Press. ISBN 978-1-904455-14-1.
Apparatus:
Casting tray
Well combs
Voltage source
Gel box
UV light source
Microwave
Reagents:
TAE
Agarose
Procedure:
Standard 1 g of agarose.
Associate agarose powder with 100 mL 1xTAE in a microwavable flask.
Microwave for 1-3 min till the agarose is totally dissolved.
Let agarose solution cool down to about 50 °C regarding 5 mins.
Add ethidium bromide (EtBr) to a concluding concentration of round about
0.2- 0.5 μg/mL
Stream the agarose into a gel tray with the well comb in location
Place newly stream gel at 4 °C for 10-15 mins OR let settle down at room
temperature for 20-30 mins, until it has totally solidified.
References:
1. Kastenholz, Bernd (2004). "Preparative Native Continuous Polyacrylamide Gel Electrophoresis
(PNC‐PAGE): An Efficient Method for Isolating Cadmium Cofactors in Biological Systems".
Analytical Letters. Informa UK Limited. 37 (4): 657–665. doi:10.1081/al-120029742. ISSN
0003-2719. S2CID 97636537
2. Smithies O (1955). "Zone electrophoresis in starch gels: group variations in the serum proteins
of normal human adults". Biochem J. 61 (4): 629–41. doi:10.1042/bj0610629. PMC 1215845.
PMID 13276348
3. Gordon, A.H. (1969). Electrophoresis of Proteins in Polyacrylamide and Starch Gels:
Laboratory Techniques in Biochemistry and Molecular Biology. Amsterdam: North-Holland
Pub. Co. ISBN 978-0-7204-4202-1. OCLC 21766.
4. Smisek, David L.; Hoagland, David A. (1989). "Agarose gel electrophoresis of high molecular
weight, synthetic polyelectrolytes". Macromolecules. American Chemical Society (ACS). 22 (5):
2270–2277. Bibcode:1989MaMol..22.2270S. doi:10.1021/ma00195a048. ISSN 0024-9297.
5. Tom Maniatis; E. F. Fritsch; Joseph Sambrook (1982). "Chapter 5, protocol 1". Molecular
Cloning - A Laboratory Manual. Vol. 1 (3rd ed.). p. 5.2–5.3. ISBN 978-0879691363
6. Lee PY, Costumbrado J, Hsu CY, Kim YH (2012). "Agarose gel electrophoresis for the separation
of DNA fragments". J Vis Exp (62). doi:10.3791/3923. PMC 4846332. PMID 22546956.
7. Robyt, John (1990). Biochemical techniques : theory and practice. Prospect Heights, Ill:
Waveland Press. ISBN 978-0-88133-556-9. OCLC 22549624
8. Boyer, Rodney (2000). Modern experimental biochemistry (in Estonian). San Francisco:
Benjamin Cummings. ISBN 978-0-8053-3111-0. OCLC 44493241
9. Sambrook, Joseph (2001). Molecular cloning : a laboratory manual (in Spanish). Cold Spring
Harbor, N.Y: Cold Spring Harbor Laboratory Press. ISBN 978-0-87969-576-7. OCLC 45015638.
10. Kryndushkin DS, Alexandrov IM, Ter-Avanesyan MD, Kushnirov VV (2003). "Yeast [PSI+] prion
aggregates are formed by small Sup35 polymers fragmented by Hsp104". J Biol Chem. 278
(49): 49636–43. doi:10.1074/jbc.M307996200. PMID 14507919.
[DETERMINATION OF
NUCLEOTIDE SEQUENCE OF
DNA BY DIDEOXY CHAIN
TERMINATION METHOD]
Determination of Nucleotide Sequence of DNA by
Dideoxy Chain Termination Method:
put-on the following to an Eppendorf tube to assemble a template
primer mixture:(U1)
Template DNA (700 ng) 7.0 μL
Primer DNA (5 ng) 2.0 μL
10×polymerase reaction buffer
pH 7.5 1.0 μL
Paraffin fluid 15.0 μL
Stay in boiling water bath for 5 min
put-on the components to another Eppendorf tube:
[35S] dATP 1.0 μL
0.1 M DTT 1.0 μL
Klenow enzyme 2–3 units
SDW 1.0 μL
Template primer mix 10.0 μL
Prepared in step U1
Mix the given contents and tag it as enzyme and template, primer mix
Set out the sequencing reaction in four different Eppendorf tubes
tagged as G, A, T, C
Incubate the tubes at room temperature as 20 min
Put-on 1 mL 0.5 μM dATP to all tube and permit the tubes to stand
for another 20 min at room temperature.
Put-on 10 μL formamide dye mix
Perform gel electrophoresis protocol.
References:
1. Shendure J, Ji H (October 2008). "Next-generation DNA sequencing". Nature Biotechnology.
26 (10): 1135–1145. doi:10.1038/nbt1486. PMID 18846087. S2CID 6384349.
3. Murphy KM, Berg KD, Eshleman JR (January 2005). "Sequencing of genomic DNA by combined
amplification and cycle sequencing reaction". Clinical Chemistry. 51 (1): 35–39
4. Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Connell CR, et al. (1986). "Fluorescence
detection in automated DNA sequence analysis". Nature. 321 (6071): 674–679.
Bibcode:1986Natur.321..674S.
6. Kan CW, Fredlake CP, Doherty EA, Barron AE (November 2004). "DNA sequencing and
genotyping in miniaturized electrophoresis systems". Electrophoresis. 25 (21–22): 3564–3588.
MATERIALS:
20µl Victim DNA
20µl Suspect 1 DNA
20µl Suspect 2 DNA
20µl Crime Scene 1 DNA
20µl Crime Scene 2 DNA
120µl restriction enzyme Mix
55µl DNA Loading Buffer
In a clean, glass 500ml container put-on 1gm Agarose for each and every
100ml of the TAE Buffer. The pack has 5gm Agarose.
Heat the solution in a microwave on high power, using 10-second bursts.
Examine to realize if all the agarose has dissolved. Repeat until agarose
has dissolved.
Once the agarose has cooled to the end it can be held comfortably in your
hand, Nucleic Acid Stain to the agarose and whirl to mix
You will need 25 wells that each holds 30µl for each group, use a suitable
size comb.
Once the gels have set, remove the comb, shift to the running equipment
and cover with the running buffer until ready to use.
Procedure:
Label 6 sets of 5 tubes with “Crime Scene 1”, “Crime Scene 2”, “Victim”,
“Suspect 1” and “Suspect 2”. Shift 20µl of each DNA sample into the
suitably labeled tube and provide each group with one of each sample
tube.
Shift 20µl Cleaving Enzyme blend into the five tubes of DNA. Use a clean
tip for each and every DNA sample
Setting each tube in a water bath or incubator at 37°C for one hour.
Following incubation, put-on 10µl DNA Loading Buffer to each tube
The agarose gels should have been prepared by you.
Once the samples are all loaded, supply a current at 12-15V/cm. For an
8cm long gel run at 96-120 volts
Once the blue dye front has roam ¾ the length of the gel, turn off the power
and gently shift the gel to a UV Light box
References:
1. Ravikumar D, Gurunathan D, Gayathri R, Priya VV, Geetha RV (1 January 2018). "DNA profiling
of Streptococcus mutans in children with and without black tooth stains: A polymerase chain
reaction analysis". Dental Research Journal. 15 (5): 334–339. doi:10.4103/1735-3327.240472.
PMC 6134728. PMID 30233653
2. Curtis C, Hereward J (29 August 2017). "From the crime scene to the courtroom: the journey
of a DNA sample". The Conversastion.
3. Evans C (2007) [1998]. The Casebook of Forensic Detection: How Science Solved 100 of the
World's Most Baffling Crimes (2nd ed.). New York: Berkeley Books. p. 86–89. ISBN 978-
1440620539.
4. Jeffreys AJ (November 2013). "The man behind the DNA fingerprints: an interview with
Professor Sir Alec Jeffreys". Investigative Genetics. 4 (1): 21. doi:10.1186/2041-2223-4-21.
PMC 3831583. PMID 24245655.
5. US 5766847, Jäckle, Herbert & Tautz, Diethard, "Process for analyzing length polymorphisms
in DNA regions", published 1998-06-16, assigned to Max-Planck-Gesellschaft zur Forderung
der Wissenschaften
7. Chambers GK, Curtis C, Millar CD, Huynen L, Lambert DM (February 2014). "DNA fingerprinting
in zoology: past, present, future". Investigative Genetics. 5 (1): 3. doi:10.1186/2041-2223-5-3.
PMC 3909909. PMID 24490906.
8. DNA pioneer's 'eureka' momen". BBC. 9 September 2009. Archived from the original on 22
August 2017. Retrieved 14 October 2011.
9. Petersen, K., J.. Handbook of Surveillance Technologies. 3rd ed. Boca Raton, FL. CRC Press,
2012. p815
10. Eureka moment that led to the discovery of DNA fingerprinting". The Guardian. 24 May 2009.
Archived from the original on 26 April 2021. Retrieved 11 December 2016
[Purifying DNA from an agarose
gel]
Purifying DNA from an Agarose Gel Protocol:
Slash the required DNA bands out of the gel with as small excess agarose
as possible
Place the gel slice(s) in a water bath at 65C till the agarose has completely
melted vortex frequently to help the process
Put-on a uniform volume of Phenol.
Vortex to an emulsion.
Rotator for 10min RT 13,000rpm
Pipette off and remain the top (aqueous layer) avoiding picking and
precipitated protein or phenol.
put-on and uniform volume of phenol chloroform
Vortex to an emulsion.
Rotator for 10min RT 13,000rpm.
Put-on 1/10 volume sodium acetate pH 5.5.
Put-on 2 volumes of 100% ethanol.
Vortex or upturn to mix well for a few seconds
Rotate for 15min RT 13,000rpm.
gently remove the ethanol
Put-on 70% ethanol – generally 500µl in 1.5ml micro tube.
rotate 2min max speed to re-pellet the DNA
Evacuate ALL the ethanol
Air dry for 5-10 minutes to make sure ALL ethanol has gone.
Re-suspend in dH2O or TE as suitable
References:
1. Cuatrecasas P, Wilchek M (2004). Lennarz WJ, Lane MD (eds.). Encyclopedia of Biological
Chemistry. Vol. 1. Academic Press. p. 52. ISBN 9780124437104.
3. Keren D (26 September 2003). Protein Electrophoresis in Clinical Diagnosis. CRC Press. pp. 7–
8. ISBN 978-0340812136.
4. Park H, Park K, Shalaby WS (1993). Biodegradable Hydrogels for Drug Delivery. CRC Press. p.
102. ISBN 978-1566760041
5. Stephen AM, Phillips GO, eds. (2006). Food Polysaccharides and Their Applications. CRC Press.
p. 226. ISBN 978-0824759223. Workshop on Marine Algae Biotechnology: Summary Report.
National Academy Press. 1986. p. 25.
7. Jeppsson JO, Laurell CB, Franzén B (April 1979). "Agarose gel electrophoresis". Clinical
Chemistry. 25 (4): 629–38. doi:10.1093/clinchem/25.4.629. PMID 313856. Agar Archived
October 16, 2007, at the Way back Machine at [Link] Water Structure and [Link]".
Food and Agricultural Organization of the United Nations
Shift the gel to a glass Pyrex dish and cut away from any unexploited areas
of the gel with a scalpel, Remove the gel beneath the bromophenol blue
dye.
This portion of the gel does not carry DNA fragments. Cut the lower side
of the gel at the bottom of the lane with size standards.
Shifting the gel to a UV Trans illuminator. Put an acetate sheet on top of
the gel and draw an outline of the gel with a marker pen, Mark the positions
of the wells and the position of the cutting side. Set on the Trans
illuminator, label the site of standard DNA bands on the acetate sheet.
Shift the gel back to the Pyrex dish and put-on sufficient 0.25N HCl to
permit the gel to move freely in the solution (150–200ml of solution
standardized gel size).
Set the dish on an orbital shaker, incubate for 10min. Revolving
At 10–20r.p.m.
Wash the gel for 10–20 seconds in 200ml of distilled water. Discard the
water and begin straight away to the next step
Put-on 200ml of denaturation solution to the dish and disconcert it for
20min on a rotary shaker. (A)
Drain the denaturation solution and repeat step A
Put-on 200ml of water and wash the gel for 10–20 seconds in order to
remove the denaturation solution confine on the surface of the gel. Drain
the water, holding the gel with the palm of your hand.
Put-on 100–200ml of neutralization solution to the dish and tend the gel
for 20 min with gentle disconcertment (B)
Dispose the neutralization solution and repeat step B
The gel is being tended, prepare the nylon membrane for shifting, cut the
nylon membrane to the length of the gel.
Set the membrane in a separate Pyrex dish fill-up with distilled water.
Leave the membrane inside water for 1–2 min. Drain the water and
submerge the membrane in ten times SSC (saline-sodium citrate). Cut 3
sheets of Whitman 3MM paper to the length of the nylon membrane.
Produce a long strip of Whitman 3MM paper to utilize as a wick. The wick
should be about 30cm long and 10cm wide
Build the blot sandwich. Put-on 400–600ml of ten times SSC to a large
Pyrex dish. Place a glass platform over the center of the dish and cover it
with the wick. Both ends of the wick are submerged in the SSC solution.
Wet the wick with 10–20ml of ten times SSC solution, remove confine air
bubbles by rolling a 10ml glass pipette over it
Carefully hold the gel from the Pyrex dish and place it in
Cover the complete dish, plus the surface of the gel, with saran wrap, the
razor blade removes the saran wrap covering the gel itself and discard it.
Set the nylon membrane on top of the gel. Put-on 5ml of ten times SSC to
the top of the membrane and remove air bubbles by spinning a pipette over
it.
Cut the left bottom corner side of the membrane to occur at the same time
with the cut made in the gel
Set three sheets of dry Whitman 3MM paper, prepared on the top of the
membrane. Place respective inches of paper towels on top of the 3MM
paper. Place a glass plate on top of the paper towel stack and weigh it
down with a 1 flask filled (500ml water).
Permit a minimum of 17 hours for the shifting.
References:
1. Sapkota, Anupama (2021-06-03). "Southern Blot- Definition, Principle, Steps, Results,
Applications". Microbe Notes. Retrieved 2023-01-04
2. Green, Michael R.; Sambrook, Joseph (July 2021). "Analysis of DNA by Southern
Blotting". Cold Spring Harbor Protocols. 2021 (7): pdb.top100396.
doi:10.1101/pdb.top100396. ISSN 1940-3402. PMID 34210774. S2CID
[Link] 3rd Edition, Matthews, Van Holde et al, Addison Wesley
Publishing, pg 977
3. Glenn, Gary; Andreou, Lefkothea-Vasiliki (2013-01-01), Lorsch, Jon (ed.), "Chapter Five
- Analysis of DNA by Southern Blotting", Methods in Enzymology, Laboratory Methods
in Enzymology: DNA, Academic Press, 529: 47–63, doi:10.1016/b978-0-12-418687-
3.00005-7, PMID 24011036, retrieved 2023-01-04
4. Burnette, W. Neal (April 1981). "Western Blotting: Electrophoretic Transfer of Proteins from
Sodium Dodecyl Sulfate-Polyacrylamide Gels to Unmodified Nitrocellulose and Radiographic
Detection with Antibody and Radioiodinated Protein A". Analytical Biochemistry. 112 (2):
195–203. doi:10.1016/0003-2697(81)90281-5. ISSN 0003-2697. PMID 6266278.
Apparatus:
Protein mini gel cassettes
Heating block module
Centrifuge
Power supply
Gloves
Filter paper
Sample preparation:
Prepare a similar amount of protein samples according to BCA assay
result, see bicinchoninic acid protein assay
Put-on the similar volume of 2x protein sample buffer to each protein
sample, blend and boil the samples at 95 °C heating block module for 10
min.
Rotate the samples at the high speed for 1 min
Procedure:
Manufacture the SDS-PAGE gel
Clean and totally dry glass plates, combs, and spacers are required.
construct gel cassette
Prepare 10% lower gel by adding the following solutions
2 ml ddH2O
1.67 ml 30% acrylamide/Bis
1.25 ml 1.5 M Tris (pH 8.8)
25 μl 20% SDS
25 μl 10% ammonium per sulfate
2.5 μl TEMED
To keep away polymerization, after adding TEMED, mix well and quickly
shift the gel solution by using 1 ml pipette to the casting chamber in the
middle of the glass plates and fill up to about 0.7 cm below the bottom of
comb when the comb is in place.
Put-on a little layer of isopropanol to the top of the gel early to
polymerization to straighten the level of the gel.
once the gel has polymerized, produce stacking gel (5%) by adding the
following solutions
2.088 ml dH2O
0.506 ml 30% acrylamide/Bis
0.375 ml 1 M Tris (pH 6.8)
15 μl 20% (w/v) SDS
15 μl 10% ammonium per sulfate
1.5 μl TEMED
Remove the isopropanol layer by using filter paper. Wash the top layer of
the gel with ddH2O and dry off as much of the water as possible by utilize
filter paper.
Put-on TEMED and mix the stacking gel solution well. Rapidly shift the
gel solution by utilize a 1 ml pipette till the space is full, and then insert
the suitable comb.
Permit the top part to solidify and then carefully remove the comb.
References:
1. Song D, Ma S, Khor SP (2002). "Gel electrophoresis-autoradiographic image analysis
of radiolabeled protein drug concentration in serum for pharmacokinetic studies".
Journal of Pharmacological and Toxicological Methods. 47 (1): 59–66.
doi:10.1016/s1056-8719(02)00203-4. PMID 12387940.
4. Ancrews D (2007). "SDS-PAGE". Andrews Lab. Archived from the original on 2 July
2017. Retrieved 27 September 2009.
5. Quandt N, Stindl A, Keller U (1993). "Sodium Dodecyl Sulfate-Polyacrylamide Gel
Electrophoresis for Mr Estimations of High-Molecular-Weight Polypeptides". Anal.
Biochem. 214 (2): 490–494. doi:10.1006/abio.1993.1527. PMID 8109738.
6. Davis BJ, Ornstein L (1959). "A new high resolution electrophoresis method".
Delivered at the Society for the Study of Blood at the New York Academy of Medicine
[PROTEIN FINGERPRINTING
PROTOCOL]
Protein fingerprinting protocol:
Protein Fingerprinting is a technique for protein identification.
Before the experiment:
Put-on 50µl Sample Loading Buffer and 50µl distilled water to each vial
of proteins. Immerse the protein samples for 5 minutes with periodical
overtaxing to dissolve them completely.
Materials:
50ml Lab Safe Gel Blue
15μl Brain Protein
15μl Heart Protein
15μl Liver Protein
15μl Lung Protein
1X Electrophoresis running buffer
1 8‐12% Polyacrylamide gel
1 pin
PROCEDURE:
Utilize the pin punch a little opening into the caps of the four protein
samples and then place in a boiling water bath for 5m
Vortex the tubes in short and centrifuge for 1m
For running the samples, construct the gel
Load the samples in separate wells.
Run the gel at 30mA/gel until the blue color front is 0.5‐2cm from the gel
base
Add 50ml Lab Safe Gel Blue to cover the gel. Lightly tremble the gel for
60 minutes at room temperature.
Think about the protein fingerprints and discuss the differences and
similarities between the samples
References:
1. Yates JR, Speicher S, Griffin PR, Hunkapiller T (1993). "Peptide mass maps: a highly
informative approach to protein identification". Anal. Biochem. 214 (2): 397–408.
doi:10.1006/abio.1993.1514. PMID 8109726.
2. LoPachin R (2004). "The changing view of acrylamide neurotoxicity".
Neurotoxicology. 25 (4): 617–30. doi:10.1016/[Link].2004.01.004. PMID 15183015.
3. Kerenyi L, Gallyas F (1973). "Über Probleme der quantitiven Auswertung der mit
physikalischer Entwicklung versilberten
5. Hempelmann E, Schulze M, Götze O (1984). "Free SH-groups are important for the
polychromatic staining of proteins with silver nitrat". In Neuhof V (ed.).
Electrophoresis '84. Weinheim: Verlag Chemie. pp. 328–3
6. Grant G (2007). "How the 1906 Nobel Prize in Physiology or Medicine was shared
between Golgi and Cajal". Brain Res Rev. 55 (2): 490–8.
doi:10.1016/[Link].2006.11.004. PMID 17306375. S2CID 24331507.
[PCR protocol]
Polymerase chain reaction:
Pcr is a method broadly used in molecular biology to manufacture several copies
of a specific DNA segment.
Material require:
Protocol:
Deoxyribonucleoside triphosphates
A polymerase enzyme including taq polymerase
Buffer
Primers
Nuclease-free distilled water
Procedure:
Thaw all reagents on ice.
Construct reaction mix into 50 µL volume in a slim walled 0.2 mL PCR
tubes.
Add reagents in following sequence: water, buffer, dNTPs, Mg CL2,
template primers, Taq polymerase.
Lightly mix by tapping tube. in short centrifuge to settle tube contents.
Produce negative control reaction without template DNA.
Produce positive control reaction with template of known size and suitable
primers.
References:
1. Schwartz JJ, Lee C, Shendure J (September 2012). "Accurate gene synthesis with tag-directed
retrieval of sequence-verified DNA molecules". Nature Methods. 9 (9): 913–15.
doi:10.1038/nmeth.2137. PMC 3433648. PMID 22886093.
3. Kellogg DE, Rybalkin I, Chen S, Mukhamedova N, Vlasik T, Siebert PD, Chenchik A (June
1994). "TaqStart Antibody: "hot start" PCR facilitated by a neutralizing monoclonal antibody
directed against Taq DNA polymerase". BioTechniques. 16 (6): 1134–37. PMID 8074881
5. Chien A, Edgar DB, Trela JM (September 1976). "Deoxyribonucleic acid polymerase from the
extreme thermophile Thermus aquaticus". Journal of Bacteriology. 127 (3): 1550–57.
doi:10.1128/jb.127.3.1550-1557.1976. PMC 232952. PMID 8432.
6. Pavlov AR, Pavlova NV, Kozyavkin SA, Slesarev AI (May 2004). "Recent developments in the
optimization of thermostable DNA polymerases for efficient applications". Trends in
Biotechnology. 22 (5): 253–60. doi:10.1016/[Link].2004.02.011. PMID 15109812
Reaction microliter
water 32.5
Green hf buffer 10.0
DNTPs(10mM) 1.0
F primer (10 μM) 2.5
R primer (10 μM) 2.5
References:
1. Joseph Sambrook & David W. Russel (2001). Molecular Cloning: A Laboratory
Manual (third ed.). Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.
ISBN 978-0-879-69576-7. Chapter 8: In vitro Amplification of DNA by the Polymerase
Chain Reaction
2. Carr AC, Moore SD (2012). Lucia A (ed.). "Robust quantification of polymerase chain
reactions using global fitting". PLOS ONE. 7 (5): e37640.
Bibcode:2012PLoSO...737640C.
3. Cheng S, Fockler C, Barnes WM, Higuchi R (June 1994). "Effective amplification of
long targets from cloned inserts and human genomic
5. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. (January 1988).
"Primer-directed enzymatic amplification of DNA with a thermostable DNA
polymerase". Science. 239 (4839): 487–91. Bibcode:1988Sci...239..487S.
doi:10.1126/science.239.4839.487. PMID 2448875.
6. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N (December
1985). "Enzymatic amplification of beta-globin genomic sequences and restriction
site analysis for diagnosis of sickle cell anemia". Science. 230 (4732): 1350–54.
[DESIGNING PRIMER]
Broad guideline Designing primer.
Avoid overflow three nucleotide (AAA)
Long extend of G, in particular condition:
18-30bp long nucleotides'
Primer should differ in length under 3bp.
3’ end must be G or C
Primer melting temperature must be 50-60°C
GC content between 40% to 60%
Keep away palindromes and inverted repeat sequences.
examine dimer binding and hairpins in Vector
Long primers maximum >50 bp
Fraction of synthesized oligo(0.99n-1)
confirm that your primers are designed in the right direction
References:
1. Adenosine added on the primer 50 end improved TA cloning efficiency of polymerase chain
reaction products, Ri-He Peng, Ai-Sheng Xiong, Jin-ge Liu, Fang Xu, Cai Bin, Hong Zhu, Quan-
Hong Ya
2. "Electronic PCR". NCBI - National Center for Biotechnology Information. Retrieved 13 March
2012.
3. Doudna; Cox; O'Donnell, Jennifer; Michael M.; Michael (December 21, 2016). Molecular
Biology: Principles and practice. W. H. Freeman. ISBN 9781319116378.
4. Henneke, Ghislaine (2012-09-26). "In vitro reconstitution of RNA primer removal in Archaea
reveals the existence of two pathways". Biochemical Journal. 447 (2): 271–280.
doi:10.1042/BJ20120959. ISSN 0264-6021. PMID 22849643.
5. Cox, Michael M. (2015). Molecular Biology: Principles and Practice. New York: W. H. Freeman
and Company. pp. 221–238, 369–376, 592–593. ISBN 9781464126147.
[Gene cloning]
Gene cloning:
DNA cloning is a molecular biology technique that assemble many identical
copies of apiece of DNA. In a representative cloning experiment, a target gene is
load into a circular piece of DNA called a plasmid.
Protocol:
Steps of the gene cloning protocol:
Rna isolation
Cdna synthesis.
Restriction digestion and ligation
Transformation
RNA ISOLATION:
Assemble the cells into 2 ml tubes.
rotate the cell suspension at high speed for 1 min using a centrifuge,
reject the supernatant and resuspend in 1 ml of lysis buffer prewarmed at
65 ºC
put-on 900 μl of acid phenol: chloroform and vortex for 10 sec
Permit the 2 ml tube in the bench for 10 min at room temperature.
rotate at high speed for 10 min at 4 °C
shift the supernatant to new 2 ml tube
put-on 0.3 volume of 5 M sodium acetate and 0.7 capacity of acid
phenol:chloroform
Blend slowly the tube and incubate on ice for 10 min.
Top rotation for 10 min at 4 °C
Shift the supernatant to fresh 2 ml tubes.
Put-on 0.1 volume of 3 M sodium acetate and the identical volume of
isopropanol
Incubate the tubes at -20 °C for 1 hour
Rotation at high speed for 10 min at 4 °C and throwaway the supernatant.
Clean the pellet with 500 μl ethanol (70 %)
Centrifuge at 7,500 g for 5 min at 4 °C.
Air dry the pellet for 5–10 min
Diffuse in 25 μl RNase free water.
Put into a 1ml tube 10ug of RNA
put-on 5 μl of DNase buffer,
Put-on 1 μl of DNase and totally the capacity up to 50 μl with RNase free
water.
Incubate at 37 ºC for 30 m
Put-on 500 μl ethanol (70 %)
Centrifuge at 7,500 g for 5m at 4 °C.
Air dry the pellet for 5–10 min
utilize the nano-drop equipment to approach RNA concentration and
standard
References:
1. Gil, Gideon (17 January 2008). "California biotech says it cloned a human embryo, but no stem
cells produced". Boston Globe.
2. McFarland, Douglas (2000). "Preparation of pure cell cultures by cloning". Methods in Cell
Science. 22 (1): 63–66. doi:10.1023/A:1009838416621. PMID 10650336
3. Peter J. Russel (2005). iGenetics: A Molecular Approach. San Francisco, California, United
States of America: Pearson Education. ISBN 978-0-8053-4665-7.
4. Mock, K.E.; Rowe, C.A.; Hooten, M.B.; Dewoody, J.; Hipkins, V.D. (2008). "Blackwell Publishing
Ltd Clonal dynamics in western North American aspen (Populus tremuloides)". U.S.
Department of Agriculture, Oxford, UK : Blackwell Publishing Ltd. p. 17. Archived from the
original on 11 August 2014. Retrieved 5 December 2013.
5. DeWoody, J.; Rowe, C.A.; Hipkins, V.D.; Mock, K.E. (2008). ""Pando" Lives: Molecular Genetic
Evidence of a Giant Aspen Clone in Central Utah". Western North American Naturalist. 68 (4):
493–497. doi:10.3398/1527-0904-68.4.493. S2CID 59135424.
6. "Ibiza's Monster Marine Plant". Ibiza Spotlight. Archived from the original on 26 December
2007. Retrieved 7 May 2008.
7. Tasmanian bush could be oldest living organism". Discovery Channel. Archived from the
original on 23 July 2006. Retrieved 7 May 2008.
8. American Association for the Advancement of Science (1903). Science. Moses King. pp. 502–.
Retrieved 8 October 2010.
9. "Torrey Botanical Club: Volumes 42–45". Torreya. 42–45: 133. 1942.
ligation protocol:
Defrost all reagents on ice
Collect reaction blend into 10 µL volume in a microfuge tube
Put-on reagents in following sequence: water, buffer, insert, vector, T4
ligase.
Slowly blend by stirring gently with pipette tip
Representative Incubation time and temperature is 15°C for at a minimum
(4h)
References:
1. Ying, Shao-Yao (2004). "Complementary DNA Libraries: An Overview".
Molecular Biotechnology. 27 (3): 245–252. doi:10.1385/MB:27:3:245.
ISSN 1073-6085. PMID 15247497. S2CID 25600775.
2. P., Clark, David (2009). Biotechnology : applying the genetic revolution. Pazdernik, Nanette
Jean. Amsterdam: Academic Press/Elsevier. ISBN 9780121755522. OCLC 226038060.
References:
1. Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME, Rosenfeld MG, Birnberg NC, Evans RM
(December 1982). "Dramatic growth of mice that develop from eggs microinjected with
metallothionein-growth hormone fusion genes". Nature. 300 (5893): 611–5.
4. Cohen SN, Chang AC, Hsu L (August 1972). "Nonchromosomal antibiotic resistance in
bacteria: genetic transformation of Escherichia coli by R-factor DNA". Proceedings of the
National Academy of Sciences of the United States of America. 69 (8): 2110–4.
Bibcode:1972PNAS...69.2110C. doi:10.1073/pnas.69.8.2110. PMC 426879. PMID 4559594.
Procedure:
Along PCR tube:
Cycle:
15-120 cycles
References:
1. Pryor, John M.; Potapov, Vladimir; Kucera, Rebecca B.; Bilotti, Katharina; Cantor, Eric J.;
Lohman, Gregory J. S. (2020-09-02). "Enabling one-pot Golden Gate assemblies of
unprecedented complexity using data-optimized assembly design". PLOS ONE. 15 (9):
e0238592. Bibcode:2020PLoSO..1538592P. doi:10.1371/[Link].0238592. ISSN 1932-
6203. PMC 7467295. PMID 32877448
2. Sands, Bryan; Brent, Roger (2016-01-01). "Overview of post Cohen-Boyer methods for single
segment cloning and for multisegment DNA assembly". Current Protocols in Molecular
Biology. 113 (1): 3.26.1–3.26.20. doi:10.1002/0471142727.mb0326s113. ISSN 1934-3647.
PMC 4853029. PMID 27152131.
5. Weber, Ernst; Engler, Carola; Gruetzner, Ramona; Werner, Stefan; Marillonnet, Sylvestre
(2011-02-18). "A Modular Cloning System for Standardized Assembly of Multigene
Constructs". PLOS ONE. 6 (2): e16765. Bibcode:2011PLoSO...616765W.
doi:10.1371/[Link].0016765. ISSN 1932-6203. PMC 3041749. PMID 21364738.
6. Engler, Carola; Kandzia, Romy; Marillonnet, Sylvestre (2008-11-05). "A One Pot, One Step,
Precision Cloning Method with High Throughput Capability". PLOS ONE. 3 (11): e3647.
Bibcode:2008PLoSO...3.3647E. doi:10.1371/[Link].0003647. ISSN 1932-6203. PMC
2574415. PMID 18985154.
5 mM magnesium chloride
-32P-dCTP 5 microliter
ddH20 Up to 20 microliter
Mix and centrifuge in short Incubate at 15 °C for 2 hours
Stop the reaction by putting the tubes in -20 °C (2 ml 0.5M EDTA pH8.0)
Chill on ice.
References:
1. Tytgat, Olivier (2021). "STRide probes: Single-labeled short tandem repeat
identification probes". Biosensors and Bioelectronics. 180: 113135.
doi:10.1016/[Link].2021.113135. PMID 33690100.
2. Amann R, Ludwig W (2000). "Ribosomal RNA-targeted nucleic acid probes for studies
in microbial ecology". FEMS Microbiology Reviews. 24 (5): 555–565.
doi:10.1111/j.1574-6976.2000.tb00557.x. PMID 11077149.
3. Olsen, G.J.; Lane, D.J.; Giovannoni, S.J.; Pace, N.R.; Stahl, D.A. (1986). "Microbial
ecology and evolution: a ribosomal RNA approach". Annu. Rev. Microbiol. 40: 337–
365. doi:10.1146/[Link].40.100186.002005. PMID 2430518.
4. Fox, G.E.; Wisotzkey, J.D.; Jurtshuk Jr., P. (1992). "How close is close: 16S rRNA
sequence identity may not be sufficient to guarantee species identity". Int. J. Syst.
Bacteriol. 42 (1): 166–170. doi:10.1099/00207713-42-1-166. PMID 1371061.
6. Amann, R.; Ludwig, W.; Schleifer, K.-H. (1995). "Phylogenetic identification and in situ
detection of individual microbial cells without cultivation". Microbiological Reviews.
59 (1): 143–169. doi:10.1128/MMBR.59.1.143-169.1995. PMC 239358. PMID
7535888.
7. Amann R, Ludwig W (2000). "Ribosomal RNA-targeted nucleic acid probes for studies
in microbial ecology". FEMS Microbiology Reviews. 24 (5): 555–565.
doi:10.1111/j.1574-6976.2000.tb00557.x. PMID 11077149.
References:
1. Halevy, Revital; Sofiya Kolusheval; Robert E.W. Hancock; Raz Jelinek (2002). "Colorimetric
Biosensor Vesicles for Biotechnological
2. Chen X, Smith LM, Bradbury EM (March 2000). "Site-specific mass tagging with stable isotopes
in proteins for accurate and efficient protein identification". Analytical Chemistry. 72 (6):
1134–43. doi:10.1021/ac9911600. PMID 10740850.
3. Jing C, Cornish VW (September 2011). "Chemical tags for labeling proteins inside living cells".
Accounts of Chemical Research. 44 (9): 784–92. doi:10.1021/ar200099f. PMC 3232020. PMID
21879706.
4. Kricka LJ, Fortina P (April 2009). "Analytical ancestry: "firsts" in fluorescent labeling of
nucleosides, nucleotides, and nucleic acids". Clinical Chemistry. 55 (4): 670–83.
doi:10.1373/clinchem.2008.116152. PMID 19233914.
5. Gwynne and Page, Peter and Guy. "Laboratory Technology Trends: Fluorescence + Labeling".
Science. Retrieved 10 March 2013.
Procedure:
Put-on 0.1 ml colcemid, which can cave in mitotic spindles and prevent
the completion of mitosis, to each dish and mix lightly.
Incubated at 37 °C, 5 % CO2 for 2 h.
Shift medium to centrifuge tubes from the cell culture dishes. utilize PBS
to washthe dishes, and remove PBS.
Put-on 1 ml 0.1% Trypsine into the dishes at 37 °C, 5% CO2 for 2m.
Also, shift the mixture (Trypsine and cells) into the centrifuge tubes and
mix with the medium which is shifted to centrifuge tubes before we use
PBS to wash the dishes.
centrifuge at 100 RCF for 10m
Reject the supernatant and leave 0.5 ml medium to mix the pellet lightly
Resuspend the pellet in 5-7 ml 37 °C hypotonic solution and mix
completely
incubate at 37 °C for 10 min.
centrifuge at 100 RCF for 10m
Rejected the supernatant and leave 0.5 ml solution to mix the pellet lightly
Resuspend the pellet in 5 ml cold fixative
Set the centrifuge tube on ice minimum 20 min
Centrifuge at 100 RCF for 10m ................ (a)
Rejected the supernatant and put-on 3-5 ml cold fixative . (b)
Repeat step a and b
After the final centrifugation, suspend the cells in a few drops of cold
fixative to give a slightly non-transparent suspension.
1-2 drops of cold fixative
Dry the slides at 37°C temperature
Notice the chromosomes with the microscope.
References:
1. Stebbins, G.L. (1971). Chromosomal evolution in higher plants. London: Arnold. pp.
85–86. ISBN 9780713122879.
3. Lee M. Silver (1995). Mouse Genetics, Concepts and Applications. Chapter 5.2:
KARYOTYPES, CHROMOSOMES, AND TRANSLOCATIONS. Oxford University Press.
Revised August 2004, January 2008
4. A preparation which includes the dyes Methylene Blue, Eosin Y and Azure-A,B,C
5. Stebbins, G.L. (1950). "Chapter XII: The Karyotype". Variation and evolution in plants.
Columbia University Press. ISBN 9780231017336.
6. King, R.C.; Stansfield, W.D.; Mulligan, P.K. (2006). A dictionary of genetics (7th ed.).
Oxford University Press. p. 242.
7. Judd, Walter S.; Campbell, Christopher S.; Kellogg, Elizabeth A.; Stevens, Peter F.;
Donoghue, Michael J. (2002). Plant systematics, a phylogenetic approach (2 ed.).
Sunderland MA, USA: Sinauer Associates Inc. p. 544. ISBN 0-87893-403-0.
[Phosphatase treatment of
linearized vector]
Phosphatase treatment of the linearized vector:
To limit the self-ligated vector in your transformation.
Materials:
Linear DNA from the restriction digest
Antarctic Phosphatase
10X Antarctic Phosphatase buffer
Procedure:
Put-on Antarctic Phosphatase buffer to a standard concentration of 1X
put-on 1μL Antarctic Phosphatase
Incubate 60m at 37°C
Heat-deactivation for 5 mins at 65°C.
Begin directly to ligation step.
References:
1. del Solar, Gloria; Giraldo, Rafael; Ruiz-Echevarría, María Jesús; Espinosa, Manuel; Díaz-
Orejas, Ramón (June 1998). "Replication and Control of Circular Bacterial Plasmids".
Microbiology and Molecular Biology Reviews. 62 (2): 434–464. doi:10.1128/MMBR.62.2.434-
464.1998. ISSN 1092-2172. PMC 98921. PMID 9618448.
2. Hartl DL, Jones EW (1998). Genetics: principles and analysis (4th ed.). Sudbury, Mass.: Jones
and Bartlett Publishers. ISBN 978-0-7637-0489-6. OCLC 45730915.
4. Acquaah G (16 August 2012). Principles of Plant Genetics and Breeding. John Wiley & Sons Inc.
ISBN 978-1-118-31369-5.
5. Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell J (2000). "DNA Cloning with
Plasmid Vectors". Molecular Cell Biology (4th ed.). New York: W. H. Freeman.
[Dnase Protocol]
DNase that catalyzes the hydrolytic cleavage of phosphodiester linkages in the
DNA backbone.
Procedure:
In order to DNase 20ug of RNA in a 100ul reaction, add reagents in the
following sequence:
10μL 10X DNase buffer
78μL dH20
2μL DNase
10μL RNA
incubate at 37° C for 20m
put-on 0.1 volume resuspended DNase deactivation Reagent
Incubate 2m
RT mixing each30s.
Centrifuge(axis) at 10,000xg for 1m
move solution to a new tube
References:
1. Bowen RA, Austgen L, Rouge M (20 February 2000). "Restriction Endonucleases and
DNA Modifying Enzymes". Nucleases: DNase and RNase. Biotechnology and Genetic
Engineering. Archived from the original on 5 August 2004. Retrieved 8 January 2017.
2. Varela-Ramirez, Armando; Abendroth, Jan; Mejia, Adrian A.; Phan, Isabelle Q.;
Lorimer, Donald D.; Edwards, Thomas E.; Aguilera, Renato J. (2017-06-02). "Structure
of acid deoxyribonuclease". Nucleic Acids Research. 45 (10): 6217–6227.
doi:10.1093/nar/gkx222. ISSN 0305-1048. PMC 5449587. PMID 28369538.
PROCEDURE:
Label four tubes
Plasmid 1 uncut
Plasmid 1 digested with HindIII and EcoRI
Plasmid 2 uncut
Plasmid 2 digested with HindIII and EcoRI
Spot the tubes in the ice bucket
Utilize a clean pipette tip for every reagent, add reagents in following
sequence on ice to avoid cross contamination:
Tube 1 Tube 2 Tube 3 Tube 4
Plasmid 1 20µl 20µl none none
Plasmid 2 none none 20µl 20µl
HindIII none 5µl none 5µl
EcoRI none 5 none 5µl
4x buffer 10µl 10µl 10µl 10µl
Sterile Water 10µl none 10µl none
Mix the contents of each tube by lightly pipetting 4-5 times
References:
1. Micklos DA, Bloom MV, Freyer GA (1996). Laboratory DNA science: an introduction to
recombinant DNA techniques and methods of genome analysis. Menlo Park, Calif:
Benjamin/Cummings Pub. Co. ISBN 0-8053-3040-2.
3. Roberts RJ, Vincze T, Posfai J, Macelis D (January 2007). "REBASE--enzymes and genes
for DNA restriction and modification". Nucleic Acids Research. 35 (Database issue):
D269-70. doi:10.1093/nar/gkl891. PMC 1899104. PMID 17202163.
Put-on the required amount of water, Add buffer, 10 times dNTP solution,
DNA mix by micropipette up and down
Set the reaction by the addition of the couple enzymes, mix by pipetting.
Incubate for 25min
Put an end to reactions by the incorporation of 1ml 0.5M EDTA and 50ml
of TE
Buffer. Mix by pipetting.
Put-on 100ml of the PCI solution and mix by put upside down the tube
respective times
to form an emulsion .......... (A)
shifting 100ml of the repair reaction mixture develop in step A into the
PLG tube
Centrifuge the PLG tube at 10,000 r.p.m. for 30sec
Remove the tube from the centrifuge and put-on 100ml of dihydrogen
hexachloroiridate(CIA) solution to the aqueous phase
Centrifuge the PLG tube at 10,000 r.p.m. for 30sec
Shifting the aqueous phase, collected from the above the gel, to a new
1.5ml microfuge tube. (aqueous stage 100ml)
Put-on 50ml of 7.5M ammonium acetate to the tube. Precipitate nucleic
acids by the incorporation (320ml of 95 percent ethanol). mix well
Centrifuge at high speed for 10min
Remove the tube from the centrifuge. Drain all the ethanol.
Clean the pellet with 700ml of cold 70 percent ethanol. Transfer the ethanol
to the side ofthe tube.
Later the last clean, set the tube into the centrifuge (2-3sec). And Remove
totally ethanol.
Resuspend the DNA pellet (unable to be seen). in the 4ml of water
Repeat this process many times. utilize 4ml for ligation, the concluding
concentration ofthe DNA solution will (12ngml –1 see in table)
Tag the tube U- DNA. Store in a -20°C freezer
References:
1. Wayengera M (2003). "HIV and Gene Therapy: The proposed [R-M enzymatic] model for a
gene therapy against HIV". Makerere Med J. 38: 28–30.
2. Wolff JN, Gemmell NJ (February 2008). "Combining allele-specific fluorescent probes and
restriction assay in real-time PCR to achieve SNP scoring beyond allele ratios of 1:1000".
BioTechniques. 44 (2): 193–4, 196, 199. doi:10.2144/000112719. PMID 18330346.
3. Zhang R, Zhu Z, Zhu H, Nguyen T, Yao F, Xia K, et al. (July 2005). "SNP Cutter: a
comprehensive tool for SNP PCR-RFLP assay design". Nucleic Acids Research. 33 (Web Server
issue): W489-92. doi:10.1093/nar/gki358. PMC 1160119. PMID 15980518.
4. Tebas P, Stein D, Tang WW, Frank I, Wang SQ, Lee G, et al. (March 2014). "Gene editing of
CCR5 in autologous CD4 T cells of persons infected with HIV". The New England Journal of
Medicine. 370 (10): 901–10. doi:10.1056/NEJMoa1300662. PMC 4084652. PMID 24597865.
5. Russell DW, Sambrook J (2001). Molecular cloning: a laboratory manual. Cold Spring Harbor,
N.Y: Cold Spring Harbor Laboratory. ISBN 0-87969-576-5.
PROCEDURE:
clamp the Hydrophobic Column in an upstanding situation on to a stand
Open the top cap first and then the bottom cap of the column to stop air
bubbles entering the column. Buffer move out of the column under gravity
to a waste container.
Balanced the column: put in 2 bed volumes (4ml) of 1X HP Loading
Buffer. Put-on 0.5ml 1X HP Loading Buffer and let the buffer move out
freely in to a waste container. Repeat until all 4ml has been applied.
Cautiously load 50µl GB Lysate to the column.
Wash the column 3 times with 0.5ml 1X HP Loading Buffer: put in 0.5ml
1X HP loading Buffer to the column and let the buffer move out into a
waste container
transport the proteins with 10x0.5ml elution steps: put in 0.5ml HP Elution
Buffer to the column and let the buffer move out a 1.5ml tube
Gather all 10 fractions separately.
Observe under the UV light.
7. Peter Walter; Alberts, Bruce; Johnson, Alexander S.; Lewis, Julian; Raff, Martin C.;
Roberts, Keith (2008). Molecular Biology of the Cell (5th edition, Extended version).
New York: Garland Science. ISBN 978-0-8153-4111-6.. Fourth edition is available
online through the NCBI Bookshelf: link
8. Rosano, Germán L.; Ceccarelli, Eduardo A. (2014-04-17). "Recombinant protein
expression in Escherichia coli: advances and challenges". Frontiers in Microbiology. 5:
172. doi:10.3389/fmicb.2014.00172. ISSN 1664-302X. PMC 4029002. PMID
24860555.
Single Stranded:
SS Carrier DNA is known to help or guidance DNA enter into yeast. It is
thought to stop nucleases from digesting the plasmid and also bind to the
yeast cell membrane and plasmid DNA enter to the cell.
References:
1. Gietz RD, Woods RA (2002). "Transformation of yeast by lithium acetate/single-stranded
carrier DNA/polyethylene glycol method". Guide to Yeast Genetics and Molecular and Cell
Biology - Part B. Methods in Enzymology. Vol. 350. pp. 87–96. doi:10.1016/S0076-
6879(02)50957-5. ISBN 9780121822538. PMID 12073338.
5. Albertini S, Chételat AA, Miller B, Muster W, Pujadas E, Strobel R, Gocke E (July 1995).
"Genotoxicity of 17 gyrase- and four mammalian topoisomerase II-poisons in prokaryotic and
eukaryotic test systems". Mutagenesis. 10 (4): 343–51. doi:10.1093/mutage/10.4.343. PMID
7476271.
[ISOLATION OF
BACTERIOPHAGE FROM
SEWAGE PROTOCOL]
Gather the raw sewage from sewage treatment
Mix the sewage (100 ml) along 10 ml of 10× nutrient phage broth,10
ml of e. coli suspension
Incubate the mixture on 37°c for 24h
Centrifuge the sewage at 2500 rpm round about 10 min
Repeat the process more than once to acquire the filter
Filter the supernatant utilizing the membrane filter (0.45 μm)
Shift aseptically the final filtrate so acquire into a pre-sterilized flask
Incubate both of them cultures at 37°c, shaking for 24 h.
Obtain four tubes of soft nutrient agar of jelly-like substance, remain
on a water bath at 50°c. tag them as 1, 2, 3, , 4
Pour 1 ml filtrate in tube 1, 2 ml filtrate in a tube 2, and 4 ml in a
tube 3 and remain tube 4 as blank having no filtrate
Inoculate all the given tubes with 0.5 ml in e. coli, pour into petri
dishes formerly carry hard agar and tag them 1, 2, 3, 4.
After the medium is solidified, an incubator for several hours and
observe for plaque formation
References:
1. Takahashi I, Marmur J (February 1963). "Replacement of thymidylic acid by deoxyuridylic acid
in the deoxyribonucleic acid of a transducing phage for Bacillus subtilis". Nature. 197 (4869):
794–5. Bibcode:1963Natur.197..794T. doi:10.1038/197794a0. PMID 13980287. S2CID
4166988
3. Morris P, Marinelli LJ, Jacobs-Sera D, Hendrix RW, Hatfull GF (March 2008). "Genomic
characterization of mycobacteriophage Giles: evidence for phage acquisition of host DNA by
illegitimate recombination". Journal of Bacteriology. 190 (6): 2172–82. doi:10.1128/JB.01657-
07. PMC 2258872. PMID 18178732.
4. Al-Shayeb B, Sachdeva R, Chen LX, Ward F, Munk P, Devoto A, et al. (February 2020). "Clades
of huge phages from across Earth's ecosystems". Nature. 578 (7795): 425–431.
Bibcode:2020Natur.578..425A. doi:10.1038/s41586-020-2007-4. PMC 7162821. PMID
32051592.
5. Petrov AS, Harvey SC (July 2008). "Packaging double-helical DNA into viral capsids: structures,
forces, and energetics". Biophysical Journal. 95 (2): 497–502. Bibcode:2008BpJ....95..497P.
doi:10.1529/biophysj.108.131797. PMC 2440449. PMID 18487310.
References:
1. Darnton NC, Turner L, Rojevsky S, Berg HC (March 2007). "On torque and tumbling in
swimming Escherichia coli". Journal of Bacteriology. 189 (5): 1756–64. doi:10.1128/JB.01501-
06. PMC 1855780. PMID 17189361.
2. Kubitschek HE (January 1990). "Cell volume increase in Escherichia coli after shifts to richer
media". Journal of Bacteriology. 172 (1): 94–101. doi:10.1128/jb.172.1.94-101.1990. PMC
208405. PMID 2403552
3. Yu AC, Loo JF, Yu S, Kong SK, Chan TF (January 2014). "Monitoring bacterial growth using
tunable resistive pulse sensing with a pore-based technique". Applied Microbiology and
Biotechnology. 98 (2): 855–62. doi:10.1007/s00253-013-5377-9. PMID 24287933. S2CID
2956197.
5. Montealegre MC, Roy S, Böni F, Hossain MI, Navab-Daneshmand T, Caduff L, et al. (December
2018). "Risk Factors for Detection, Survival, and Growth of Antibiotic-Resistant and Pathogenic
Escherichia coli in Household Soils in Rural Bangladesh". Applied and Environmental
Microbiology. 84 (24): e01978–18. Bibcode:2018ApEnM..84E1978M.
doi:10.1128/AEM.01978-18. PMC 6275341. PMID 30315075.
6. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, et al. (June 2005).
"Diversity of the human intestinal microbial flora". Science. 308 (5728): 1635–38.
Bibcode:2005Sci...308.1635E. doi:10.1126/science.1110591. PMC 1395357. PMID 15831718.
2. Sakharkar M, Passetti F, de Souza JE, Long M, de Souza SJ (2002). "ExInt: an Exon Intron
Database". Nucleic Acids Res. 30 (1): 191–4. doi:10.1093/nar/30.1.191. PMC 99089. PMID
11752290.
3. Liu AY, Van der Ploeg LH, Rijsewijk FA, Borst P (June 1983). "The transposition unit of variant
surface glycoprotein gene 118 of Trypanosoma brucei. Presence of repeated elements at its
border and absence of promoter-associated sequences". Journal of Molecular Biology. 167
(1): 57–75. doi:10.1016/S0022-2836(83)80034-5. PMID 6306255.
4. Gilbert W (February 1978). "Why genes in pieces?". Nature. 271 (5645): 501.
Bibcode:1978Natur.271..501G. doi:10.1038/271501a0. PMID 622185.
5. Valenzuela P, Venegas A, Weinberg F, Bishop R, Rutter WJ (January 1978). "Structure of
yeast phenylalanine-tRNA genes: an intervening DNA segment within the region coding for
the tRNA". Proceedings of the National Academy of Sciences of the United States of
America. 75 (1): 190–4. Bibcode:1978PNAS...75..190V. doi:10.1073/pnas.75.1.190. PMC
411211. PMID 343104.
6. Kister KP, Eckert WA (March 1987). "Characterization of an authentic intermediate in the self-
splicing process of ribosomal precursor RNA in macronuclei of Tetrahymena thermophila".
Nucleic Acids Research. 15 (5): 1905–20. doi:10.1093/nar/15.5.1905. PMC 340607. PMID
3645543.
References:
1. Zhang F, Wen Y, Guo X (2014). "CRISPR/Cas9 for genome editing: progress, implications and
challenges". Human Molecular Genetics. 23 (R1): R40–6. doi:10.1093/hmg/ddu125. PMID
24651067.
2. Bak RO, Gomez-Ospina N, Porteus MH (August 2018). "Gene Editing on Center Stage".
Trends in Genetics. 34 (8): 600–611. doi:10.1016/[Link].2018.05.004. PMID 29908711. S2CID
49269023.
3. Horvath P, Barrangou R (January 2010). "CRISPR/Cas, the immune system of bacteria and
archaea". Science. 327 (5962): 167–170. Bibcode:2010Sci...327..167H.
doi:10.1126/science.1179555. PMID 20056882. S2CID 17960960.
4. Hille F, Richter H, Wong SP, Bratovič M, Ressel S, Charpentier E (March 2018). "The Biology
of CRISPR-Cas: Backward and Forward". Cell. 172 (6): 1239–1259.
doi:10.1016/[Link].2017.11.032. hdl:21.11116/0000-0003-FC0D-4. PMID 29522745. S2CID
3777503.
5. Marraffini LA, Sontheimer EJ (December 2008). "CRISPR interference limits horizontal gene
transfer in staphylococci by targeting DNA". Science. 322 (5909): 1843–1845.
Bibcode:2008Sci...322.1843M. doi:10.1126/science.1165771. PMC 2695655. PMID
19095942.
[CRISPR-BACTERIAL
PROTOCOL]
Making plates:
Take an Agar media, such as “LB Agar Media”, “LB Strep/Kan Agar
Media” and discard its contents into the 250mL glass bottle
utilize the 50mL conical tube add 150mL of water to the glass bottle
Heat the agar to dissolve it, then it will harden when it cools
pour the seven plates
store in your fridge at 4ºC
Streak out a new plate of bacteria using an inoculation loop and let it
grow overnight
100uL of Transformation mix to a new micro centrifuge tube
Utilize an inoculation loop, soothing scrape some bacteria off of your
fresh plate and mix it into the transformation mix. Mix until any big
cluster have disappeared.
DNA Transformation & CRISPR:
Find the DNA tube tag “Cas9 and tracrRNA” and, utilize your
pipette, put-on 10uL to your competent cell mixture
Find the DNA tube tag “crRNA” and, utilize your pipette, add 10uL
to the same competent cell mixture
Find the DNA tube tag “Template DNA” and, utilize your pipette,
add 10uL to the same competent cell mixture
Incubate tube in the fridge for 30 minutes
Incubate the tube for 30 seconds in 42ºC water
Put-on 1mL water to one of the LB media microcentrifuge tubes and
waggle to dissolve the LB.
utilize the pipette, put-on 100uL of LB media to your competent cell
mixture containing your DNA
Incubate the tube at 37C for 1 hour
utilize the pipette, put-on100uL of your CRISPR transformation
mixture on top of an LB Strep/Kan Agar plate
utilize an inoculation loop, softly spread the bacteria around the plate
and let dry for 10 minutes
Incubate the plate at 37ºC for 16-24 hours
Procedure:
Delicately aspirate the media from the cells and clean once with 100 μl
1X PBS
collect the cells and extract genomic DNA using the method of choice
Govern DNA concentration
Amplification reactions:
Set up and run the PCR utilize a template, primers, and element of the
MethylTaq polymerase
50 μl reaction:
Components Amount
MethylTaq 10x buffer 5 µl
--------------------------------------------------
dNTPs (5 mM stock solution): 2 µl
Cycling condition:
steps condition cycles
MethylTaqDNA 10 min at 95°C 1
Heteroduplex development:
200 ng of the amplified DNA
T7 Endonuclease use 10 µ
Components Amount
PCR 10 µl or 200 ng
10X NEBuffer 2* 2 µl
Nuclease free H2O Up To 19 µl
Hetero duplex:
A hetero duplex is a double-stranded molecule of nucleic acid arise through the
genetic recombination of single complementary strands obtain from the different
origin such as from different homologous chromosomes or even from a different
organism
References:
1. Gesner EM, Schellenberg MJ, Garside EL, George MM, Macmillan AM (June 2011).
"Recognition and maturation of effector RNAs in a CRISPR interference pathway". Nature
Structural & Molecular Biology. 18 (6): 688–692. doi:10.1038/nsmb.2042. PMID 21572444.
S2CID 677704.
2. Datsenko KA, Pougach K, Tikhonov A, Wanner BL, Severinov K, Semenova E (July 2012).
"Molecular memory of prior infections activates the CRISPR/Cas adaptive bacterial immunity
system". Nature Communications. 3: 945. Bibcode:2012NatCo...3..945D.
doi:10.1038/ncomms1937. PMID 22781758.
3. Goren MG, Yosef I, Auster O, Qimron U (October 2012). "Experimental definition of a clustered
regularly interspaced short palindromic duplicon in Escherichia coli". Journal of Molecular
Biology. 423 (1): 14–16. doi:10.1016/[Link].2012.06.037. PMID 22771574.
4. Pride DT, Sun CL, Salzman J, Rao N, Loomer P, Armitage GC, et al. (January 2011). "Analysis of
streptococcal CRISPRs from human saliva reveals substantial sequence diversity within and
between subjects over time". Genome Research. 21 (1): 126–136.
doi:10.1101/gr.111732.110. PMC 3012920. PMID 21149389.
5. Andersson AF, Banfield JF (May 2008). "Virus population dynamics and acquired virus
resistance in natural microbial communities". Science. 320 (5879): 1047–1050.
Bibcode:2008Sci...320.1047A. doi:10.1126/science.1157358. PMID 18497291. S2CID
26209623.
6. Shah SA, Erdmann S, Mojica FJ, Garrett RA (May 2013). "Protospacer recognition motifs: mixed
identities and functional diversity". RNA Biology. 10 (5): 891–899. doi:10.4161/rna.23764.
PMC 3737346. PMID 23403393.
7. Erdmann S, Garrett RA (September 2012). "Selective and hyperactive uptake of foreign DNA
by adaptive immune systems of an archaeon via two distinct mechanisms". Molecular
Microbiology. 85 (6): 1044–1056. doi:10.1111/j.1365-2958.2012.08171.x. PMC 3468723.
PMID 22834906.
8. Díez-Villaseñor C, Guzmán NM, Almendros C, García-Martínez J, Mojica FJ (May 2013).
"CRISPR-spacer integration reporter plasmids reveal distinct genuine acquisition specificities
among CRISPR-Cas I-E variants of Escherichia coli". RNA Biology. 10 (5): 792–802.
doi:10.4161/rna.24023. PMC 3737337. PMID 23445770.
9. Shah SA, Hansen NR, Garrett RA (February 2009). "Distribution of CRISPR spacer matches in
viruses and plasmids of crenarchaeal acidothermophiles and implications for their inhibitory
mechanism". Biochemical Society Transactions. 37 (Pt 1): 23–28. doi:10.1042/BST0370023.
PMID 19143596. S2CID 19093261
10. Lillestøl RK, Shah SA, Brügger K, Redder P, Phan H, Christiansen J, Garrett RA (April 2009).
"CRISPR families of the crenarchaeal genus Sulfolobus: bidirectional transcription and dynamic
properties". Molecular Microbiology. 72 (1): 259–272. doi:10.1111/j.1365-
2958.2009.06641.x. PMID 19239620. S2CID 36258923.
11. Mojica FJ, Díez-Villaseñor C, García-Martínez J, Almendros C (March 2009). "Short motif
sequences determine the targets of the prokaryotic CRISPR defence system". Microbiology.
155 (Pt 3): 733–740. doi:10.1099/mic.0.023960-0. PMID 19246744.
12. Deveau H, Barrangou R, Garneau JE, Labonté J, Fremaux C, Boyaval P, Romero DA, Horvath
P, Moineau S (February 2008). "Phage response to CRISPR-encoded resistance in
Streptococcus thermophilus". Journal of Bacteriology. 190 (4): 1390–1400.
doi:10.1128/JB.01412-07. PMC 2238228. PMID 18065545.
13. Horvath P, Romero DA, Coûté-Monvoisin AC, Richards M, Deveau H, Moineau S, et al.
(February 2008). "Diversity, activity, and evolution of CRISPR loci in Streptococcus
thermophilus". Journal of Bacteriology. 190 (4): 1401–1412. doi:10.1128/JB.01415-07. PMC
2238196. PMID 18065539.
14. Nuñez JK, Harrington LB, Kranzusch PJ, Engelman AN, Doudna JA (November 2015). "Foreign
DNA capture during CRISPR-Cas adaptive immunity". Nature. 527 (7579): 535–538.
Bibcode:2015Natur.527..535N. doi:10.1038/nature15760. PMC 4662619. PMID 26503043
15. Sorek R, Lawrence CM, Wiedenheft B (2013). "CRISPR-mediated adaptive immune systems in
bacteria and archaea". Annual Review of Biochemistry. 82 (1): 237–266.
doi:10.1146/annurev-biochem-072911-172315. PMID 23495939.
16. Fagerlund RD, Wilkinson ME, Klykov O, Barendregt A, Pearce FG, Kieper SN, Maxwell HW,
Capolupo A, Heck AJ, Krause KL, Bostina M, Scheltema RA, Staals RH, Fineran PC (June 2017).
"Spacer capture and integration by a type I-F Cas1-Cas2–3 CRISPR adaptation complex".
Proceedings of the National Academy of Sciences of the United States of America. 114 (26):
E5122–E5128. doi:10.1073/pnas.1618421114. PMC 5495228. PMID 28611213
[Cloning gRNA into lent virus
vector protocol]
Annealing:
ddH2O 23μL
100uM top oligo 1μL
100uM bottom oligo 1μL
2X Annealing Buffer 25μL
total reaction volume 50μL
Incubate for 5min at 95°C
Ligation:
digested vector(BstXI and BlpI) 10ng
1:40 diluted annealed oligo 1μL
10X T4 ligase buffer 1μL
T4 ligase 1μL
ddH2O --------------------------
total reaction volume 10μL
Incubate for 2-4hr at RT
Shift into 2.5μL DH5α bacteria
References:
1. Rollie C, Graham S, Rouillon C, White MF (February 2018). "Prespacer processing and specific
integration in a Type I-A CRISPR system". Nucleic Acids Research. 46 (3): 1007–1020.
doi:10.1093/nar/gkx1232. PMC 5815122. PMID 29228332.
2. Nuñez JK, Bai L, Harrington LB, Hinder TL, Doudna JA (June 2016). "CRISPR Immunological
Memory Requires a Host Factor for Specificity". Molecular Cell. 62 (6): 824–833.
doi:10.1016/[Link].2016.04.027. PMID 27211867.
3. Wang J, Li J, Zhao H, Sheng G, Wang M, Yin M, Wang Y (November 2015). "Structural and
Mechanistic Basis of PAM-Dependent Spacer Acquisition in CRISPR-Cas Systems". Cell. 163
(4): 840–853. doi:10.1016/[Link].2015.10.008. PMID 26478180.
4. Nuñez JK, Kranzusch PJ, Noeske J, Wright AV, Davies CW, Doudna JA (June 2014). "Cas1-Cas2
complex formation mediates spacer acquisition during CRISPR-Cas adaptive immunity".
Nature Structural & Molecular Biology. 21 (6): 528–534. doi:10.1038/nsmb.2820. PMC
4075942. PMID 24793649.
6. Wiedenheft B, Zhou K, Jinek M, Coyle SM, Ma W, Doudna JA (June 2009). "Structural basis
for DNase activity of a conserved protein implicated in CRISPR-mediated genome defense".
Structure. 17 (6): 904–912. doi:10.1016/[Link].2009.03.019. PMID 19523907
Procedure:
Take a tube marked Agar media, such as “LB Agar Media” and Throw
away its contents into the 250mL glass bottle.
Utilizing the 50mL conical tube add 150mL of water to the glass bottle
Making agar, Heat the bottle in the microwave for 30 seconds
When the liquid looks yellow. This must take about 2 -3 minutes
Take the bottle out and let it cool
pour the seven plates
Place your sample in the mortar, put-on buffer using the plastic pipette
and then crush
Take a new pipette and put-on a some drops of bacteria from culture you
started in a previous day and spread over the whole plate using the plate
spreader
Allow the bacteria dry on the plate before you continue
Tag the back of the plate in 8 different sections one section for your
antibacterial control and one section for your buffer control
Using tweezers take a paper disc and permit it to take up a drop of each
sample.
Control sections add a drop from your buffer tube and antibiotic control
tube (Kan) on paper discs and put them in their sections on the plate
Observe after 12 hours and 18 hours, Bacterial growth able to be seen on
the plate. A clear ring should form around your antibiotic control and your
buffer control should have no effect
References:
1. Gould, Kate (1 March 2016). "Antibiotics: from prehistory to the present day". Journal
of Antimicrobial Chemotherapy. 71 (3): 572–575. doi:10.1093/jac/dkv484. ISSN 0305-
7453. PMID 26851273.
2. Laxminarayan R, Duse A, Wattal C, Zaidi AK, Wertheim HF, Sumpradit N, et al.
(December 2013). "Antibiotic resistance-the need for global solutions". The Lancet.
Infectious Diseases. 13 (12): 1057–98. doi:10.1016/S1473-3099(13)70318-9.
hdl:10161/8996. PMID 24252483.
3. Antimicrobial resistance: global report on surveillance (PDF). The World Health Organization.
April 2014. ISBN 978-92-4-156474-8. Retrieved 13 June 2016.
4. Murray, Christopher JL; Ikuta, Kevin Shunji; Sharara, Fablina; Swetschinski, Lucien;
Aguilar, Gisela Robles; Gray, Authia; Han, Chieh; Bisignano, Catherine; Rao, Puja;
Wool, Eve; Johnson, Sarah C. (12 February 2022). "Global burden of bacterial
antimicrobial resistance in 2019: a systematic analysis". The Lancet. 399 (10325): 629–
655. doi:10.1016/S0140-6736(21)02724-0. ISSN 0140-6736. PMC 8841637. PMID
35065702.
5. General Background: Antibiotic Agents". Alliance for the Prudent Use of Antibiotics.
Archived from the original on 14 December 2014. Retrieved 21 December 2014.
6. Foster W, Raoult A (December 1974). "Early descriptions of antibiosis". The Journal of
the Royal College of General Practitioners. 24 (149): 889–94. PMC 2157443. PMID
4618289.
[ELECTROPORATION
PROTOCOL]
Electroporation is a technique in which an electrical field is provided to cells to
increase the permeability of the cell membrane.
Procedure:
Assemble 3*106 cells and spin cells at 800 rpm for 5 minutes
Drain supernatant and clean cells with PBS. Spin cells once more
Re-suspend cells, 65 μl electroporation buffer. (C)
Mix 16 μl Cas9 nuclease ............ (A)
4 μl annealed crRNA : tracRNA .........(A)
sgRNA 1.5 ml EP tube ............ (A)
put-on electroporation buffer in the tube of volume 65 μl and mix
lightly, Incubate(10min) at room temperature
Mix the solution of step A and the resuspended cells of step C lightly
incubate at 10 min. (U)
shifting the mixture of step U to the electroporation tube
Electroporate suitable voltage: 700V
Gather the cells about 48-72 hours after transfection
References:
1. Al-Sakere B, André F, Bernat C, Connault E, Opolon P, Davalos RV, Rubinsky B, Mir LM
(November 2007). "Tumor ablation with irreversible electroporation". PLO
2. Vilquin JT, Kennel PF, Paturneau-Jouas M, Chapdelaine P, Boissel N, Delaère P,
Tremblay JP, Scherman D, Fiszman MY, Schwartz K (July 2001). "Electrotransfer of
naked DNA in the skeletal muscles of animal models of muscular dystrophies". Gene
Therapy. 8 (14): 1097–107. doi:10.1038/[Link].3301484. PMID 11526457. S2CID
1081582.
3. Chuang IC, Jhao CM, Yang CH, Chang HC, Wang CW, Lu CY, Chang YJ, Lin SH, Huang PL,
Yang LC (2004). "Intramuscular electroporation with the pro-opiomelanocortin gene
in rat adjuvant arthritis". Arthritis Research & Therapy. 6 (1): R7–R14.
doi:10.1186/ar1014. PMC 400409. PMID 14979933.
4. Heller LC, Coppola D (October 2002). "Electrically mediated delivery of vector plasmid
DNA elicits an antitumor effect". Gene Therapy. 9 (19): 1321–5.
doi:10.1038/[Link].3301802. PMID 12224015.
5. Titomirov AV, Sukharev S, Kistanova E (January 1991). "In vivo electroporation and
stable transformation of skin cells of newborn mice by plasmid DNA". Biochimica et
Biophysica Acta (BBA) - Gene Structure and Expression. 1088 (1): 131–4.
doi:10.1016/0167-4781(91)90162-F. PMID 1703441.
6. Saito, Tetsuichiro (2010), Embryonic In Vivo Electroporation in the Mouse, Methods in
Enzymology, vol. 477, Elsevier, pp. 37–50, doi:10.1016/s0076-6879(10)77003-8, ISBN 978-0-
12-384880-2, PMID 20699135, retrieved 2022-09-19
[DNA library preparation]
DNA library:
A DNA library is a group of DNA piece that have been cloned into vectors. There
are basically two types of libraries:
genomic DNA
CDNA libraries
Restriction digestion:
200 μl tube add 2 μl of cDNA or genomic DNA
Put-on 15 μl of DEPC-treated water
Put-on 2 μl of restriction enzyme buffer (10x)
Put-on 1μlof restriction enzyme
Incubate for 2h at actual temperature correspondingly the restriction
enzyme selected
deactivate the restriction enzyme at high temperature: normally 20 min at
65 ºC
Cloning:
200μl tube add 5 μl of digested cDNA
Put-on 3 μl of digested vector
Put-on 1 μl of ligase buffer (10x)
Put-on 1 μl of ligase enzyme
Incubate at 4ºC whole night
Use 5μl of the ligation solution to transform host capable cells
References:
1. Wang, Tian-Wen; Zhu, Hu; Ma, Xing-Yuan; Zhang, Ting; Ma, Yu-Shu; Wei, Dong-Zhi (2006-09-
01). "Mutant library construction in directed molecular evolution". Molecular Biotechnology.
34 (1): 55–68. doi:10.1385/MB:34:1:55. ISSN 1559-0305. PMID 16943572. S2CID 44393645.
2. Jones DD (May 2005). "Triplet nucleotide removal at random positions in a target gene: the
tolerance of TEM-1 beta-lactamase to an amino acid deletion". Nucleic Acids Research. 33 (9):
e80. doi:10.1093/nar/gni077. PMC 1129029. PMID 15897323.
3. Crameri A, Raillard SA, Bermudez E, Stemmer WP (January 1998). "DNA shuffling of a family
of genes from diverse species accelerates directed evolution". Nature. 391 (6664): 288–91.
Bibcode:1998Natur.391..288C. doi:10.1038/34663. PMID 9440693. S2CID 4352696
4. McCullum, Elizabeth O.; Williams, Berea A. R.; Zhang, Jinglei; Chaput, John C. (2010), Braman,
Jeff (ed.), "Random Mutagenesis by Error-Prone PCR", In Vitro Mutagenesis Protocols: Third
Edition, Methods in Molecular Biology, Humana Press, vol. 634, pp. 103–109,
doi:10.1007/978-1-60761-652-8_7, ISBN 9781607616528, PMID 20676978
5. Wajapeyee, Narendra; Liu, Alex Y.; Forloni, Matteo (2018-03-01). "Random Mutagenesis Using
Error-Prone DNA Polymerases". Cold Spring Harbor Protocols. 2018 (3): pdb.prot097741.
doi:10.1101/pdb.prot097741. ISSN 1940-3402. PMID 29496818.
References:
1. Hoshika, Shuichi (2020). "Hachimoji DNA and RNA. A Genetic System with Eight Building
Blocks". Science. 363 (6429): 884–887. doi:10.1126/science.aat0971. PMC 6413494. PMID
30792304.
2. Tabatabaei, S. Kasra (2020). "DNA punch cards for storing data on native DNA sequences via
enzymatic nicking". Nature Communications. 11 (1): 1742. doi:10.1038/s41467-020-15588-z.
PMC 7142088. PMID 32269230.
3. Perkel, Jeffrey M. (2019). "The race for enzymatic DNA synthesis heats up". Nature. 566
(7745): 565. doi:10.1038/d41586-019-00682-0. PMID 30804572.
4. Palluk, Sebastian; Arlow, Daniel H; et al. (2018). "De novo DNA synthesis using polymerase-
nucleotide conjugates". Nature Biotechnology. 36 (7): 645–650. doi:10.1038/nbt.4173. OSTI
1461176. PMID 29912208. S2CID 49271982.
5. Fikes, Bradley J. (May 8, 2014). "Life engineered with expanded genetic code". San Diego
Union Tribune. Archived from the original on 9 May 2014. Retrieved 8 May 2014.
6. Forloni, M (2018). "Random Mutagenesis Using Error-prone DNA Polymerases". Cold Spring
Harbor Protocols. 2018 (3): pdb.prot097741. doi:10.1101/pdb.prot097741. PMID 29496818.
water bath
streak plates of E. coli
pGREEN plasmid
distilled water
37 C incubator
Procedure:
Label one sterile microtube “A”. Mark another “B”.
Utilize a micropipette, add 250 μl of CaCl2 solution (50 mM) to each tube
Utilize a sterile plastic loop to shift one or more than one 3 mm bacterial
colonies from the streak plate to the “A” tube.
Close the tube lid and place the tube on ice
Utilize a new sterile loop to shift a mass of bacteria to the “B“ tube
Add 10ul of pGREEN directly into your “A”
Come back the “A and B” tube to the ice. Incubate both tubes on ice for
15 minutes
Add 250 μl of Luria broth to the “A” tube
Add 250 μl of Luria broth to the “B” tube
Label 1 LB plate “+ PLASMID” and 1 LB/AMP plate “+ PLASMID”
Label 1 LB plate “– PLASMID” and 1 LB/AMP plate “‐ PLASMID”
Put-on 100μl of cell suspension from the “B” tube to the “LB ‐ PLASMID
Put-on 100 μl of cell suspension from the “A” tube to the “LB +
PLASMID
Utilize a new sterile loop for each plate, spread the suspensions evenly
around the surface
Muffle Parafilm around your four plates
Place the four plates upside down in a 37 C incubator. Incubate for 24
hours.
Remove plates from incubator and observe the growth
Observe plates with handheld UV light
References:
1. Mahaffee, W. F.; Bauske, E. M.; van Vuurde, J. W.; van der Wolf, J. M.; van den Brink,
M.; Kloepper, J. W. (1997-04-01). "Comparative analysis of antibiotic resistance,
immunofluorescent colony staining, and a transgenic marker (bioluminescence) for
monitoring the enviro
2. Ptitsyn, L. R.; Horneck, G.; Komova, O.; Kozubek, S.; Krasavin, E. A.; Bonev, M.;
Rettberg, P. (1997-11-01). "A biosensor for environmental genotoxin screening based
on an SOS lux assay in recombinant Escherichia coli cells". Applied and Environmental
Microbiology. 63 (11): 4377–4384. Bibcode:1997ApEnM..63.4377P.
doi:10.1128/AEM.63.11.4377-4384.1997. ISSN 0099-2240. PMC 168758. PMID
9361425
5. Fisher, Andrew J.; Thompson, Thomas B.; Thoden, James B.; Baldwin, Thomas O.;
Rayment, Ivan (1996-09-06). "The 1.5-Å Resolution Crystal Structure of Bacterial
Luciferase in Low Salt Conditions". Journal of Biological Chemistry. 271 (36): 21956–
21968. doi:10.1074/jbc.271.36.21956. ISSN 0021-9258. PMID 8703001.
9. Eberhard, A.; Burlingame, A. L.; Eberhard, C.; Kenyon, G. L.; Nealson, K. H.;
Oppenheimer, N. J. (1981-04-01). "Structural identification of autoinducer of
Photobacterium fischeri luciferase". Biochemistry. 20 (9): 2444–2449.
doi:10.1021/bi00512a013. ISSN 0006-2960. PMID 7236614.
10. Ruby, E. G.; Morin, J. G. (1979-09-01). "Luminous enteric bacteria of marine fishes: a
study of their distribution, densities, and dispersion". Applied and Environmental
Microbiology. 38 (3): 406–411. Bibcode:1979ApEnM..38..406R.
doi:10.1128/AEM.38.3.406-411.1979. ISSN 0099-2240. PMC 243508. PMID
16345429.
1. Mini PCR (polymerase chain reaction):
PCR is a method broadly used in molecular biology to manufacture several copies
of a specific DNA segment.
Procedure:
Construct reaction mix into 50 μL volume in a slim walled 0.2 mL PCR
tubes.
Add reagents in following sequence: water, buffer, dNTPs, Mg CL2,
template primers, Taq polymerase.
Produce negative control reaction without template DNA.
Produce positive control reaction with template of known size and suitable
primers.
water to 50 μL
Buffer 1x
Taq polymerase 0.05 units/μL
dNTP mix 200 μM
MgCl2 0.1-0.5 mM
Forward primer 0.1-0.5 mM
2. Blue Gel-Electrophoresis:
Gel electrophoresis is a technique used to split-up DNA pieces. According to their
size, DNA samples are fill into wells., And an electric current is applied to drag
them through the gel. DNA pieces are negatively charged, so they progress
towards the positive electrode.
Blue-Gel-Electrophoresis protocol:
Material and reagents:
Agarose gel powder
Micro wave Heating oven
1XTBE-Buffer
Flask
DNA sample and DNA-Dyes
Blue-Gel-Electrophoresis instrument
Micropipette
Procedure:
Prepare a gel utilizing 1XTBE-Buffer
Agarose 0.2g
1XTBE-Buffer 25ml
Gene-expression protocol:
Material and reagents:
Nuclease free water
DNA A
DNA B
Kanamycin
Heat source 37°C
Micropipette
Procedure:
Label a tube 1 to 4
Add a DNA to each pellet in the strip
Tube 2 and 3 Add DNA(A) 5 μL
Tube 4 Add DNA(B) 5 μL
Water tube 1 7 μL
Kanamycin tube 3 2 μL
4. Pocket PCR:
PCR is a method broadly used in molecular biology to manufacture several
copies of a specific DNA segment
After scrolling through all the given parameter set cancel menu is show
choose set to store the setting in the memory
Back in the main menu choose run pcr to the pcr reaction
The pcr run can be end by rotating the knob press to stop will appear in the
display
Controlling screen
Controlling screen
The left Colum control the incubator (30°C,37°C,40°C)
The central Colum control the hot station (30°C,37°C,40°C)
The right Colum control the cold station which can be set to 4°C to replace
ice and 16°C
Procedure:
Label one sterile microtube “A”. Mark another “B”
Utilize a micropipette, add 250 μl of CaCl2 solution (50 mM) to each tube
Utilize a sterile plastic loop to shift one or more than one 3 mm bacterial
colonies from the streak plate to the “A” tube
Close the tube lid and place the tube on ice
Utilize a new sterile loop to shift a mass of bacteria to the “B“tube
Add 10ul of pGREEN directly into your “A”
Come back the “A and B” tube to the ice. Incubate both tubes on ice for 15
minutes
Add 250 μl of Luria broth to the “A” tube
Add 250 μl of Luria broth to the “B” tube
Label 1 LB plate “+ PLASMID” and 1 LB/AMP plate “+ PLASMID”
Label 1 LB plate “– PLASMID” and 1 LB/AMP plate “‐ PLASMID”
Put-on 100μl of cell suspension from the “B” tube to the “LB ‐ PLASMID
Put-on 100 μl of cell suspension from the “A” tube to the “LB + PLASMID
Utilize a new sterile loop for each plate, spread the suspensions evenly
around the surface
muffle Parafilm around your four plates
Place the four plates upside down in a 37 C incubator. Incubate for 24 hours
Observe plates with handheld UV light
Thermo cycler step 3-5 cycle with annealing temperature to the forward or
reverse primer with minimum [Link] to adjust for every gene
Thermo cycler step4: setup the elongation time with 30 sec for each kb
Thermo cycler step 6: 30 cycles along with 72°C for elongation and setup
extension time. Change time with 30-sec per kb
Procedure:
Defrost all reagents on ice.
collect reaction mix into 50 µL volume in a microfuge tube
Put-on reagents in following sequence: water, buffer, BSA, DNA template,
restriction enzyme
Slowly mix by tapping the tube. in a short centrifuge to settle tube contents.
Produce negative control reaction without template DNA
Produce positive control reaction with template of known cutting site
corresponding to the restriction enzyme of option
representative Incubation time and temperature is 37°C for 1h
Incubation time temperature is 65°C for 20m
water to 50 µL
Buffer 1X
DNA template 1 µg
Ligation protocol:
Material:
Water
Ligase buffer
Vector
Insert
T4 DNA ligase
Centrifuge
incubator
Procedure:
Defrost all reagents on ice
collect reaction mix into 10 µL volume in a microfuge tube
Put-on reagents in following sequence: water, buffer, insert, vector, T4
ligase.
Slowly mixed by stirring gently with pipette tip
Representative Incubation time and temperature is 15°C for at a minimum
4h
water to 10 µL
Vector 25 ng
Insert 75 ng 75 ng
T4 DNA ligase 0.1 to 1 Weiss unit
Procedure:
Defrost all reagents completely on ice
Put-on 1 µL of ligation reaction to defrost competent cells.
Slowly mix by tapping tube of competent cells.
Incubate reaction on ice for 30m
Heat shock the capable cell fusion by incubation for 30 to 60s in a 42°C
water bath
Incubate tubes on ice for 2m
Put-on 250 to 500 µL, SOC or LB media
Incubate at 37°C
Warm selection plates to 37°C.
Layout 10, 50, and 100 µL of transformed cells on selection plates
Incubate plates at 30°C whole night.
Competent cells to 50 µL
Ligation reaction 1-5 µL
LB media 950 ml
Material:
Mini PCR
T4-DNA ligase
Restriction enzyme
Vector
Procedure:
Along with PCR tube:
T4 DNA Ligase 0.5 µL
10X T4 DNA Ligase Buffer 2 µL
Type IIS restriction enzyme 0.5 µL
vector 100ng
Complete with water QS 20 µL
Mix gently
15-120 cycles
Activation of the 37°C 5 min
restriction enzyme
Activation of the Ligase 16°C 5 min
Inactivation of the 55°C 15 min
enzyme
Inactivation of the ligase 85°C 20 min
Hold 4°C
------------------------------------------------------------------------------------------------
Material:
Agarose gel powder
Micro wave Heating oven
1XTBE-Buffer
Blue-Gel-Electrophoresis instrument
20µl Victim DNA
20µl Suspect 1 DNA
20µl Suspect 2 DNA
20µl Crime Scene 1 DNA
20µl Crime Scene 2 DNA
120µl restriction enzyme Mix
Procedure:
Label 6 sets of 5 tubes with “Crime Scene 1”, “Crime Scene 2”, “Victim”,
“Suspect 1” and “Suspect 2”. shift 20µl of each DNA sample into the
suitably labeled tube and provide each group with one of each sample tube
Shift 20µl Cleaving Enzyme blend into the five tubes of DNA. Use a clean
tip for each and every DNA sample
Setting each tube in a water bath or incubator at 37°C for one hour •
Following incubation, put-on 10µl DNA Loading Buffer to each tube
Load 10 μl sample of each dye into the wells in the given sequence
Once the samples are all loaded, supply a current at 12-15V/cm. For an
8cm long gel run at 96-120 volts
Once the blue dye front has roam ¾ the length of the gel, turn off the power
and gently shift the gel to a UV Light box
DIY-CRISPRCas9 mutation
detection System with miss
cleavage protocol:
CRISPRCas9 is utilizing for selected mutagenesis. The investigation of mutants
obtained utilize CRISPRCas9 requires particular methods for mutation detection
and the enzyme mismatch cleavage technique is used for this purpose. T7
Endonuclease (cleaves non-perfectly matched DNA) to detect on-selected
CRISPRCas9 editing events in cells. The PCR by-product is denatured and
annealed to construct hetero duplex mismatches where double-strand breaks have
to happen, resulting in insertion, deletion.
Material requirement:
Mini-PCR machine
MethylTaq 10x buffer
DNTPs
MethylTaq DNA polymerase
Nuclease-free water
T7 Endonuclease
Procedure:
Delicately aspirate the media from the cells and clean once with 100 μl 1X
PBS
collect the cells and extract genomic DNA using the method of choice
Amplification reactions:
Set up and run the PCR utilize a template, primers, and element of the
MethylTaq
Polymerase
50 μl reaction:
Cycling condition:
Procedure:
Label the tubes 1,2,3 and 4
Add 10 μl buffer to each tube
Add 10 μl dye to each tube
Add 5 μl of DNA sample to tube 1,2 and 3
Do not add an any DNA to tube 4 because tube 4 is serve as negative control
Mix the regent by pipetting up and down 3-4 time
Guide-RNA (VNTR)
The main part of our technique is gRNA or VNTR the guide RNA is a specific
that recognizes the target DNA area of interest and directs the Cas nuclease there
for editing
Template DNA:
The template DNA is our target DNA that we want to check either Specific STR
are present or not.
Component 20 µl Reaction
Template DNA x µl (~100 ng)
Guide RNA x µl (~4000 ng)
10X Cas9 Reaction Buffer 3.0 µl
Cas9 Nuclease 1.0 µl
water 30.0 µl
Procedure:
Take a syringe and tip
Place a tip on the syringe
Note that micropipette tip is with printed scale of microliter
--------------------------------------------------------------------------------------------------------------
[DNA Quantification by
using Spectrophotometer]
DNA quantification mean to determine the average concentration of DNA in a
sample prior to downstream experiments.
A small circular DNA molecule found in bacteria and some other organism with
particular function called plasmid.
Make sure the primer only anneals once in the whole assemble or construct.
Primer should be a minimum of 50 nucleotides and a maximum of 300
nucleotides from your Plasmid
A standard sequencing reaction between 300-900 base pairs of useable
sequence. You should receive your sequencing results as a trace file. Which
graphically depicts the sequence as a series of colored peaks corresponding
to one of the four nucleotide bases. This is an example of a trace file from
a high-quality portion of a sequencing reaction:
Sequence near the beginning or end of a sequencing reaction is frequently
unreliable. Despite the fact that your sequencing outcomes can also suggest
bases at unique locations, by means of looking at the trace file, you may
see that those base calls are unreliable. That is an instance of a trace record
from a portion of a sequencing response with high background
[PTC Genotyping]
This kit consists of everything you need to genotype samples for the bitter taste
receptor.
Procedure:
Clean your mouth with water and then swab inside of cheek.
Grasp cheek swab place in 300uL 50mM NaOH in 1.5mL micro centrifuge
tube
Stir swab in tube for about 1 minute until solution is cloudy
Heat tube in boiling water for 10 minutes 95 °C
Add 300uL of 50mM Tris
For a 50uL PCR reaction:
1-microliter of cheek cell solution for PCR reaction template
1-microliter of PTC primer
10-microliter of 5x Master Mix(or 25uL of 2x Master Mix)
38-microliter water with 5x Master Mix(or 23uL with 2x Master Mix)
PCR Reaction:
1x 95C 10 Minutes
35 x 95C 30s
55C 1 minute
72C 1 minute
1x 72C 10 minutes
AACTGGCAGATTAAAGATCTCAATTTAT
AACACAAACCATCACCCCTATTTT
After run your PCR reaction remove 20uL from each reaction and place
them in separate tubes.
HaeIII restriction enzyme only cuts the DNA of the taster allele at the
sequence GGCC and creates two bands in Gel electrophoresis
[How to create your own guide RNA for
Bacterial CRISPR cas9 experiment]
A manual RNA is a bit or piece of RNA that functions as a manual for RNA- or
DNA-targeting enzymes, with which it forms complexes. Very often these
enzymes will delete, insert or otherwise adjust the targeted RNA or DNA
Procedure:
Go to [Link]
[DRD4 Genotyping]
Dopamine receptor D4 (DRD4) is a signaling protein in humans that is
operate by the neurotransmitter dopamine. Mutation to DRD4 is associated
with risk taking behavior and many other things.
Procedure:
Clean your mouth with water and then rub inside of cheek with tip of cotton
swab
Take cheek swab and place in 300uL 50mM NaOH micro centrifuge tube
Stir swab in tube for about 1 minute until solution is cloudy
Heat tube in almost boiling water for 10 minutes at 95°C
Add 300uL of 50mM Tris
For a 50uL PCR reaction:
1-microliter of cheek cell solution for PCR reaction template
1-microliter of DRD4 primer
10-microliter of 5x Master Mix(or 25-microliter of 2x Master Mix)
38-microliter water with 5x Master Mix(or 23 microliter with 2x Master
Mix)
Use the PCR protocol below:
1x 95C 10 Minutes
30 x
95C 15s
55C 1 minute
72C 2 minute
1x 72C 10 minutes
Compare the samples to the DNA ladder using a Gel electrophoresis
Where the alcohol and mixture meet together, a white precipitate will
form. Collect the precipitate by spooling it onto a wooden stick.
Dot blotting and slot blotting are techniques for immobilizing preparations
of nucleic acid on the solid support usually a charged nylon membrane.
Procedure:
In the procedure DNA or RNA is extracted from the given cell sample.
DNA is applied for PCR amplification
Electrophoresis is not need to separated DNA or RNA
Denature the double stranded DNA with NAOH or by high
temperature(95c)
The DNA or RNA mixture is blotted to a membrane where the
hybridization is carried out.
Single stranded DNA or RNA is applied directly to prepared blot strips of
nitrocellulose or nylon membrane is bound to a filter
support(nitrocellulose)
Sample are usually applied to the membrane by using manifold attached to
the suction device
Immobilized by baking 70-80c for about 2-3 hours
Each dot on the strip carry a different labeled DNA or RNA probe from
different sources.
The DNA probes present in the dot on the nitrocellulose strip are attached
to the enzyme complex that can converted into colorless substrate into a
colored one if bind can take place.
Incubate with radioactive labeled single stranded DNA or RNA fragments
complementary to the nucleic acids of interest.
In washing step the non-hybridized probe is remove washout the non-
hybridized probe such as buffer
Autoradiograph or color changes.
You just want to insert something into the genome and it doesn't matter
where?
Specific genes
If you want to try to be hardcore, you can design gRNAs by hand, but the great
thing is that many companies and organizations have built platforms and
infrastructure so that gRNA or (proto) spacer design is automated.
Addgene has a list of validated gRNAs in a range of organisms including humans
that you can order at will.
[Link]
[Link]
ChopChop is great and gives a lot more targets than the others and a lot
more information
[Link]
Note that when I say we are designing a guide RNA, we are actually
designing only 20 base pairs of the guide RNA known as the (proto)spacer.
The rest of the guide RNA almost always stays the same. A (proto)spacer
is also placed in the crRNA for those working with crRNA
The (proto)spacer should be 20 bases long and should match the genome
where the cut will be made, the only caveat being that you can't compare
anywhere only where there is an NGG ("N" stands for any nucleotide)
sequence. So to design your gRNA what you do is find the NGG in the
top strand (what we have) and use the 20 nucleotides preceding it as your
spacer.
Example:
Partial Sequence Homo sapiens myostatin (MSTN), RefSeqGene (LRG_200)
on chromosome 2
gRNA (proto)spacer
TGACAGCAGCGATGGCTCTT
Total gRNA as DNA
TGACAGCAGCGATGGCTCTTGTTTTAGAGCTAGAAATAGCAA
GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA
CCGAGTCGGTGC
Looking at the information on NCBI we can find out that these sequence
is in the first exon. It is usually best to target the first exon when using
NHEJ(Non-Homologous End Joining) to knock out the function of a gene.
You can then proceed to compare this to the whole human genome to see
if it matches other places using BLAST.
Lentiviruses
DNA transfection
AAVs are one of the safest and easiest ways to get DNA into your cells. They are
fast becoming the method of choice for getting DNA into cells for gene therapy.
However, they have two limitations that make them difficult to use for CRISPR-
Cas9. The first is that AAVs are limited in the amount of DNA they can
accommodate. Cas9 is quite a large protein and usually takes up a large portion
of the AAV, so you can't usually do HDR with a single AAV. What usually
happens is that Cas9 is inserted into one AAV and the guide and template into
another AAV. The need for two viruses to infect cells greatly reduces efficiency,
as cells must be infected with both viruses for HDR to occur. The second problem
is that it is not easy to produce viruses because they require growing cells that can
be infected with the virus (mammalian cells), which are difficult to grow in large
quantities, so viruses can be unaffordable in size, cost and materials, especially
for someone who works at home. However, there are many companies that will
make and sell you a custom AAV. Understand that these AAVs are replication
deficient, so they don't replicate, they just infect cells and release your own DNA.
Search the internet, you'll find plenty.
Lentiviruses:
Lenti-viruses have some advantages and disadvantages compared to AAV. They
have a larger genome size so you can put a lot more in them and you only need
one virus for an HDR CRISPR-Cas9 experiment. But they also integrate into the
genome, which can be dangerous because it increases the chance that something
will go wrong with the genetic engineering or gene therapy you're doing. Like
AAV, they are not as DIY friendly, but you can certainly find places to make your
own lentiviruses.
DNA transfection:
DNA transfection is a general term used to describe getting artificial produced
DNA (usually replicated in bacteria) and introduce this DNA into cells using one
of a variety of methods, including chemical transformation or electroporation. I
am a sucker for transfection because the DNA can be replicated in bacteria which
can be grown on basically some sugar water. It can be purified for human usage
in most any basic lab setup. All you really need is a centrifuge and some pipettes.
What it lacks in efficiency as compared to viruses can be made up for in quantity.
You can purify alot easily so even if the efficiency is lower you can use more.
This DNA can literally be applied directly to the skin (though very lower
efficiency), can be injected with the DNA in water, higher efficiency), injected
with the DNA mixed with a chemical or lipid (even higher efficiency and best
choice) or injected and then stimulated with an electrical current (highest
efficiency but more impractical). The best compound to use based on efficiency,
price and ability to obtain is probably polyethylenimine (PEI).
To use the Burst Spin option, select the circle arrow using the orange
spinner. Hold down the orange button and the centrifuge will start spinning.
The counter records how many seconds the centrifuge has been active. To
stop the centrifuge, simply release the button and the centrifuge will slow
down and stop. When the engine stops, the lid unlocks automatically and
can be opened safely. Wait until you hear a click from the lid, indicating
that the lock is open.
To use the Time Spin option, select the clock symbol using the orange dial.
The G force and timer can be adjusted by pressing and turning the orange
click dial while holding it. Turn clockwise to increase the value, turn
counter-clockwise to decrease it. Click the confirm button to start the run
When the centrifuge is running with a timer, the remaining time is
displayed in the upper right position (1). The clock button (2) allows you
to set the timer and the cancel button (3) can be used to manually turn off
the centrifuge.
To use the gel electrophoresis and Tran’s illuminator module, select it from
the home screen.
To set the gel tension, first select the tension button. To change the value,
press and hold the orange click wheel down and rotate it. Turn clockwise
to increase tension and counterclockwise to decrease tension.
To start the gel at the selected voltage, press the timer button. On the next
screen, set the timer. To change the duration, push down on the orange
click wheel and hold it while rotating it to change the value. Turning it
clockwise increases the duration, and turning it counter-clockwise
decreases it.
Make sure your gel is ready and connected to the Bento Lab before pressing
the confirm button.
If Bento Lab does not detect the current subscription or if the current
subscription is too high, an error message will be displayed. If no current
is detected even though the gel box is connected, this may indicate a broken
platinum wire.
When the gel is running, the remaining time is displayed in the upper right
position (1) and a flashing flash indicates that current is flowing (2). The
clock button (3) allows you to set the timer and the cancel button (4) can
be used to turn off the power to the gel.
All Bento Lab protocols use 0.5X TBE buffer in the gel electrophoresis
step. We recommend preparing a stock solution of 0.5X TBE buffer by
adding 50 ml of 10X TBE buffer to 950 ml of deionized water in a glass or
plastic bottle.
Pour the desired amount of 0.5X TBE buffer into a microwave container
and add the agarose tablets according to the protocol you are following.
For 1% gel, add 1 tablet to 50ml buffer (1.5% gel is 1 tablet in 33ml buffer;
2% gel is 2 tablets in 50ml buffer; 3% gel is 2 tablets in 33ml buffer.)
Wait ~2 minutes for the tablet to disintegrate, then microwave the solution
on full power for 20-30 seconds. Mix the solution between doses until the
agarose is completely dissolved. Avoid boiling the mixture as this will
evaporate the buffer and you will end up with a higher concentration of
agarose.
Make sure you are working on a flat surface to pour the gel at a uniform
thickness.
Gently remove the orange cap from the gel reservoir.
Place the dams in the tank so that the buffer zones around the electrodes
are covered.
Remove the comb and insert the comb into the holder
Once the agarose has cooled to about 55°C, it should be hot but not too hot
to the touch - add your DNA dye (1μl per 10ml TBE buffer) and pour the
dissolved gel into the gel reservoir.
Let the gel cool and harden. This takes about 30 minutes at room
temperature or 15 minutes in a cool room or refrigerator.
Gently remove the gel comb and dam from both ends of the gel tank and
prepare to start the gel.
The Bento Lab contains a mini gel electrophoresis system, so it has a higher
voltage gradient than larger gel systems because the distance used to
determine voltage gradients is the distance between the electrodes, not the
length of the gel. If the voltage is too high, you may see streaks. For best
results we recommend running the gels at 50V with 0.5X TBE.
Pour 0.5X TBE buffer solution into the gel reservoir onto the prepared gel
until the liquid covers the gel and the level is about 2-3 mm above the gel.
Carefully insert the molecular weight ladder into the first lane of the gel.
Load the samples into the remaining wells of the gel.
Gently slide the orange lid onto the gel reservoir until it clicks into place.
Set the voltage to the desired electrophoresis voltage for your protocol. To
make voltage changes, select the voltage value button. Press and hold the
orange click wheel while rotating to change the value. Turn clockwise to
increase tension and counterclockwise to decrease. Once the desired
tension is reached, release the orange click wheel.
Set the desired time by selecting the time value, pushing down and turning
the orange click wheel.
Confirm your settings by clicking the check mark on the right and set the
gel to run.
Allow the gel to set until the dye line has moved down about 75% of the
length of the gel. Typical run time with Bento Lab is about 30-45 minutes,
depending on gel concentration and voltage.
Wait until the run is finished or cancel the run. Disconnect the electrodes
from the power source and then carefully remove the gel from the gel box.
Place the gel on the Trans illuminator and press the Trans illuminator
button to turn on the blue light to visualize your strips.
The thermo cycler module is on the right side of the Bento Lab system. The
thermo cycling block (1) is suitable for 0.2 ml tubes with flat or round caps
in a 4 x 8 arrangement. Tape tubes can be fitted. The heated lid (2) is spring-
loaded and automatically adjusts according to the tubes. The fan is used to
remove heat from the system through the vents (3) on the right side. Make
sure there are no objects blocking the air flow to avoid overheating.
The Bento Lab Thermo cycler module is ready to use out of the box with
no additional equipment or software required. Everything can be
programmed and configured directly from the integrated GUI using Bento
Lab's intuitive button and wheel.
To get started, turn on your Bento Lab using the power switch on the back.
After a while, the Bento Lab status screens will appear with three module
icons (left: Gel Electrophoresis, middle: Centrifuge, right: Thermo cycler).
Click on the thermal cycler icon to activate the module. This will bring up
the thermal cycler screen.
The thermal cycler screen displays status information about the current
state of the module in the upper half of the screen, such as block and lid
temperature. When the log is running on the module, an estimate of the
remaining time is also displayed.
When the module is idle, the bottom buttons are used to open the Thermo
cycler log editor. The first two buttons open the editor with the default PCR
protocol (1) or the default thermal block protocol (2). The disk button (3)
on the right leads to a list of all previously saved thermo cycler protocols.
When the module is running, the bottom buttons change. The control
button on the left (4) can be used to display the exact position in the
currently running program. The Cancel button on the right (5) is used to
exit the program and can be used to either cancel it or turn off the module
when it is held in the last step.
Before loading samples, ensure that the heat indicator light of the module
is off. This means that the lid is safe to open and that no element is hot.
Open the Bento Lab Thermo cycler lid. The lid opens easily with little
resistance.
Load PCR tubes (0.2mL) into the block. Up to 32 tubes can be loaded. If
the protocol makes use of the heated lid, ensure that all PCR tubes have the
same height, so that the heated lid applies evenly when the lid is closed.
Ensure that the Thermo cycler block is clean and no dust or other elements
prevent contact between the block and the tubes. Ensure that PCR tubes sit
tightly in the block.
Close the lid and ensure it is fully engaged.
Alternatively, when using the Bento Lab thermal cycler as a thermal block,
a convenient default protocol is available that contains only one
temperature step.
The left button with the key icon (1) unlocks the log for editing. The middle
button with the disk icon (2) gives the possibility to name and save the log.
The right button with the start icon (3) activates the module and starts the
protocol.
From the default protocol view, click on the spanner icon.
The three buttons on the bottom right disappear. Instead, the first
temperature stage is highlighted and the precise properties of the stage is
displayed below. Using the orange click-wheel you can now scroll through
each stage in the protocol. The detailed properties at the bottom of the
screen change accordingly.
To return to the default protocol view in order to save your changes or run
the protocol, push the green back button
Once you are done, confirm your changes by clicking on the confirmation
button on the right. The properties become locked again.
If you do not want to keep your changes, you can also use the green back
button. In this case the properties also become locked again, but the
changes are not kept
Highlight the cycle you want to change by scrolling to it with the orange
click wheel.
Push down the orange click wheel. The cycle is now selected and the
properties are editable.
To change the number of repeats, select the cycle repeat value button at the
bottom of the screen. Push down the orange click-wheel and keep holding
it down whilst rotating it to change the value. Dial clockwise to add cycles,
and counter-clockwise to reduce the number of cycles. Release the orange
click-wheel once you have set the desired number of cycles.
To change the start and end point of the cycle, buttons with a left-right icon
are shown on the left and right sides of the cycle.
To change the start point of the cycle, highlight the button on the left side
of the cycle. Push down the orange click-wheel and keep holding it down
whilst rotating it. Dial counter-clockwise to move the starting point of the
cycle to the left, or clockwise to move it to the right.
The end point of the cycle can be similarly changed.
If the last stage is a hold stage, it cannot be included in a cycle.
Once you are done, confirm your changes by clicking on the confirmation
button on the right. The properties become locked again.
If you do not want to keep your changes, you can also use the green back
button. In this case the properties also become locked again, but the
changes are not kept.
Add a temperature stage, select a temperature stage next to the position
where the new stage should be.
Push down the orange click wheel.
A new stage can be added either to the left or to the right side of the selected
stage, by clicking on the button with the plus icon on either side of the
stage.
Once the plus has been clicked, a new stage is added on the selected side.
The new stage has the same properties as its neighbor that was selected to
add the stage.
The new stage is automatically selected to be edited.
To delete a stage, click on the button with the bin icon at the bottom left. If
the stage is the only remaining stage in a cycle, the cycle will also be
removed.
Advanced protocols sometimes require landing cycles. This means that the
temperature step within the cycle decreases by the set value after a certain
number of repetitions within the cycle. For example, the temperature phase
may start at 60 degrees of the cycle, but is reduced by 0.2 degrees for the
first 10 repetitions of the cycle and ends at 58 degrees for all remaining
cycles.
To add a touch step to a cycle, highlight the temperature phase to which
you want to add a touch step. This will usually be in the cycle before the
main PCR cycle.
Push down on the orange click wheel.
A touch button appears between the left and right plus buttons. The touch
button is only visible when the temperature stage is in a cycle.
Select the touch button and press the orange click wheel.
The temperature stage is now marked with a touchdown icon. The icon can
be selected and the touch phase configured.
The left option is temperature delta, i.e. how much the cycle temperature
changes with each iteration.
The correct choice determines how many times delta touch is applied.
Multiply this number by the temperature delta value to get the total amount
by which the temperature step will be reduced.
To configure the temperature of the heated lid, select the gear icon in the
upper right corner of the editor.
Push down on the orange click wheel.
Lid temperature is now adjustable. It can be tuned in a similar way to the
temperature of any temperature stage in the editor.
In addition, the heated lid can be completely switched off and on again by
pressing the temperature value button.
Click the confirmation button on the right to confirm the changes. The
properties will be locked again.
You can also use the green back button if you don't want to keep your
changes. In this case, the properties will also be locked again, but the
changes will not be preserved
Procedure:
Label 200 µl thin-walled PCR tubes per lab group on the side of the tube,
not on the cap tubes
1 tube labeled “F1”: For DNA extraction from food 1
1 tube labeled “F2”: For DNA extraction from food 2
Add 50 µL of DNA-EZ™ Lysis Solution to each tube
Prepare test foods or plant tissues for DNA extraction
Tightly cap the 200 µL tube containing the DNA-EZ™ Lysis Solution and
test foods
Ensure that the food fragments are well mixed into the lysis solution
Incubate the food mixture in DNA-EZ Lysis Solution for 5 minutes at 95°C
Remove the tubes from the heat and let them rest in the tube rack at room
temperature
Add 5 µL of DNA-EZ™ Neutralization Solution to each tube
If a micro centrifuge is available, centrifuge the residue before PCR
10,000 rpm for 2 minutes
Label 4 clean PCR tubes (200 µL thin-walled tubes) per group on the
sidewall
1 tube labeled “T1”: Test DNA extracted from Food 1
1 tube labeled “T2”: Test DNA extracted from Food 2
1 tube labeled “G”: ‘GMO Banana’ DNA supplied in the kit
1 tube marked “W”: “Non-GMO Banana” DNA supplied in the kit
Label and number each tube in your strip with four BioBits
pellets, 1-4
Mark the numbers on the sides of the tube, not on the cap.
Label the group name/symbol somewhere on the tubes.
Tube 1 will be used to produce the original GFP
Researchers started with (FP1)
Pipe 2 and 3 will be used to produce a potential new one
GFP (FP2 and FP3). You have formed hypotheses about how
these proteins can function based on the sequence before the lab
Analytical activity.
Tube 4 will be for your negative control.
Prepare and uncap tubes with BioBits strips
Gently tap the tubes on the table before removing
Collect the pellets at the bottom
To open the tubes, CAREFULLY remove each cap in the strip
One at a time, being careful not to dislodge the BioBits pellets.
Add 5 μl of FP1 DNA to tube 1 according to the instructions below
Repeat step 3 to add the remaining DNA samples and water to each BioBits
in the strip
(use a new tip for each sample)
Add 5 μl of FP2 DNA to tube 2.
Add 5 µL of FP3 DNA to tube 3.
Add 5 μl of water to test tube 4.
When finished, each tube should have the amounts shown in the table
below
14. Katz, Sylvan (6 January 1990). "Forum: Roses are black, violets are green – The
emergence of amateur genetic engineers". New Scientist. Retrieved 2015-10-25.
15. Katz, J. S. (1990). "That which is not forbidden is Mandatory". Education. 4 (1). ISSN
0955-6621.
16. Schrage, Michael (1988-01-31). "Playing God in your basement". The Washington
Post. ISSN 0190-8286. Retrieved 2015-10-25.
17. Carlson, Rob (May 2005). "Splice It Yourself: Who needs a geneticist? Build your own
lab". Wired.
18. Ledford, Heidi (2010). "Garage : Life hackers". Nature. 467 (7316): 650–2.
doi:10.1038/467650a. PMID 20930820.
19. Mosher, Dave (2010-12-16). "DIY Biotech Hacker Space Opens in NYC". Wired.
Retrieved 2017-07-25.
20. PBS News Hour". YouTube. 31 Dec 2008. Archived from the original on 2021-12-20
21. BioCurious Officially Opens — Test DNA, Build Equipment, Find a Co-founder and
More…". Make Magazine. 2011-10-14. Retrieved 2017-07-25.
23. Rob Carlson on synthetic biology". The Economist. Archived from the original on
2011-10-09.
24. Biohack the Planet Conference". Biohack the Planet. Retrieved 2016-06-19.
25. Wu, Chen-Yi; Hu, Hsiao-Yun; Chow, Lok-Hi; et al. (22 June 2015). "The Effects of Anti-
Dementia and Nootropic Treatments on the Mortality of Patients with Dementia: A
Population-Based Cohort Study in Taiwan". PLOS ONE. 10 (6): e0130993.
Bibcode:2015PLoSO..1030993W. doi:10.1371/[Link].0130993. PMC 4476616.
PMID 26098910.
27. Heindel, Jerrold J.; Blumberg, Bruce; Cave, Mathew; et al. (March 2017).
"Metabolism disrupting chemicals and metabolic disorders". Reproductive
Toxicology. 68: 3–33. doi:10.1016/[Link].2016.10.001. PMC 5365353. PMID
27760374.
28. Prigent, Sylvain; Frioux, Clémence; Dittami, Simon M.; Thiele, Sven; Larhlimi,
Abdelhalim; Collet, Guillaume; Gutknecht, Fabien; Got, Jeanne; Eveillard, Damien;
Bourdon, Jérémie; Plewniak, Frédéric; Tonon, Thierry; Siegel, Anne (27 January
2017). "Meneco, a Topology-Based Gap-Filling Tool Applicable to Degraded
Genome-Wide Metabolic Networks". PLOS Computational Biology. 13 (1): e1005276.
Bibcode:2017PLSCB..13E5276P. doi:10.1371
29. Anderson, Jason R.; Hagerdorn, Payton L.; Gunstad, John; Spitznagel, Mary Beth (July
2018). "Using coffee to compensate for poor sleep: Impact on vigilance and
implications for workplace performance". Applied Ergonomics. 70: 142–147.
doi:10.1016/[Link].2018.02.026. PMID 29866304.
30. Pearce, Joshua M. (14 September 2012). "Building Research Equipment with Free,
Open-Source Hardware". Science. 337 (6100): 1303–1304.
Bibcode:2012Sci...337.1303P. doi:10.1126/science.1228183. PMID 22984059. S2CID
44722829.
31. Pearce, Joshua M. (14 September 2012). "Building Research Equipment with Free,
Open-Source Hardware". Science. 337 (6100): 1303–1304.
Bibcode:2012Sci...337.1303P. doi:10.1126/science.1228183. PMID 22984059. S2CID
44722829.
32. "Counter Culture Labs Membership". Counter Culture Labs. Retrieved 2016-06-17.
33. Pocket PCR for pennies". LavaAmp. Archived from the original on 2015-11-06.
Retrieved 2015-10-26.
34. "Coffee Cup - PCR Thermocycler costing under 350$". Instructables. 2009-06-13.
Retrieved 2016-06-17
35. Landoni, Boris (11 July 2014). "Interview to Open Trons | Open Electronics". Open
Source Electronics. Retrieved 1 November 2016.
36. Open Cell is hosting monthly biohackathons to develop equipment, software and
products to make better and more affordable biolaboratories". [Link].
OpenCell. Retrieved 2019-08-17.