0% found this document useful (0 votes)
24 views52 pages

Minimum Edit Distance in NLP

The document defines minimum edit distance and describes how it can be used to measure the similarity between two strings. Minimum edit distance is the minimum number of edit operations (insertions, deletions, or substitutions) needed to transform one string into another. It can be computed using a dynamic programming algorithm that fills out an edit distance table in a bottom-up manner to iteratively build up the distances between prefixes of the two strings.

Uploaded by

yetsedaw
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
24 views52 pages

Minimum Edit Distance in NLP

The document defines minimum edit distance and describes how it can be used to measure the similarity between two strings. Minimum edit distance is the minimum number of edit operations (insertions, deletions, or substitutions) needed to transform one string into another. It can be computed using a dynamic programming algorithm that fills out an edit distance table in a bottom-up manner to iteratively build up the distances between prefixes of the two strings.

Uploaded by

yetsedaw
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Minimum

 Edit  
Distance  
 
Defini'on  of  Minimum  
Edit  Distance  
 
Dan  Jurafsky  

How  similar  are  two  strings?  


•  Spell  correc'on   •  Computa'onal  Biology  
•  The  user  typed  “graffe”   •  Align  two  sequences  of  nucleo'des  
Which  is  closest?     AGGCTATCACCTGACCTCCAGGCCGATGCCC
•  graf   TAGCTATCACGACCGCGGTCGATTTGCCCGAC
•  graB   •  Resul'ng  alignment:  
•  grail  
•  giraffe   -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC---
TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC

•  Also  for  Machine  Transla'on,  Informa'on  Extrac'on,  Speech  Recogni'on  


Dan  Jurafsky  

Edit  Distance  
•  The  minimum  edit  distance  between  two  strings  
•  Is  the  minimum  number  of  edi'ng  opera'ons  
•  Inser'on  
•  Dele'on  
•  Subs'tu'on  
•  Needed  to  transform  one  into  the  other  
Dan  Jurafsky  

Minimum  Edit  Distance  


•  Two  strings  and  their  alignment:  
Dan  Jurafsky  

Minimum  Edit  Distance  

•  If  each  opera'on  has  cost  of  1  


•  Distance  between  these  is  5  
•  If  subs'tu'ons  cost  2  (Levenshtein)  
•  Distance  between  them  is  8  
Dan  Jurafsky  

Alignment  in  Computa9onal  Biology  


•  Given  a  sequence  of  bases  

AGGCTATCACCTGACCTCCAGGCCGATGCCC
  TAGCTATCACGACCGCGGTCGATTTGCCCGAC
•  An  alignment:  
-AGGCTATCACCTGACCTCCAGGCCGA--TGCCC---
TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC
•  Given  two  sequences,  align  each  leXer  to  a  leXer  or  gap  
Dan  Jurafsky  

Other  uses  of  Edit  Distance  in  NLP  

•  Evalua'ng  Machine  Transla'on  and  speech  recogni'on  


R Spokesman confirms senior government adviser was shot!
H Spokesman said the senior adviser was shot dead!
S I D I!
•  Named  En'ty  Extrac'on  and  En'ty  Coreference  
•  IBM  Inc.  announced  today  
•  IBM  profits  
•  Stanford  President  John  Hennessy  announced  yesterday  
•  for  Stanford  University  President  John  Hennessy  

!
Dan  Jurafsky  

How  to  find  the  Min  Edit  Distance?  


•  Searching  for  a  path  (sequence  of  edits)  from  the  start  string  to  
the  final  string:  
•  Ini9al  state:  the  word  we’re  transforming  
•  Operators:  insert,  delete,  subs'tute  
•  Goal  state:    the  word  we’re  trying  to  get  to  
•  Path  cost:  what  we  want  to  minimize:  the  number  of  edits  

8
Dan  Jurafsky  

Minimum  Edit  as  Search  


•  But  the  space  of  all  edit  sequences  is  huge!  
•  We  can’t  afford  to  navigate  naïvely  
•  Lots  of  dis'nct  paths  wind  up  at  the  same  state.  
•  We  don’t  have  to  keep  track  of  all  of  them  
•  Just  the  shortest  path  to  each  of  those  revisted  states.  

9
Dan  Jurafsky  

Defining  Min  Edit  Distance  


•  For  two  strings  
•  X  of  length  n    
•  Y  of  length  m  
•  We  define  D(i,j)  
•  the  edit  distance  between  X[1..i]  and  Y[1..j]    
•  i.e.,  the  first  i  characters  of  X  and  the  first  j  characters  of  Y  
•  The  edit  distance  between  X  and  Y  is  thus  D(n,m)  
Minimum  Edit  
Distance  
 
Defini'on  of  Minimum  
Edit  Distance  
 
Minimum  Edit  
Distance  
 
Compu'ng  Minimum  
Edit  Distance  
 
Dan  Jurafsky  

Dynamic  Programming  for  


Minimum  Edit  Distance  
•  Dynamic  programming:  A  tabular  computa'on  of  D(n,m)  
•  Solving  problems  by  combining  solu'ons  to  subproblems.  
•  BoXom-­‐up  
•  We  compute  D(i,j)  for  small  i,j    
•  And  compute  larger  D(i,j)  based  on  previously  computed  smaller  values  
•  i.e.,  compute  D(i,j)  for  all  i  (0  <  i  <  n)    and  j  (0  <  j  <  m)  
Dan  Jurafsky  

Defining  Min  Edit  Distance  (Levenshtein)  


•  Ini'aliza'on  
D(i,0) = i!
D(0,j) = j  
•  Recurrence  Rela'on:  
For each i = 1…M!
! For each j = 1…N  
D(i-1,j) + 1!
D(i,j)= min D(i,j-1) + 1!
D(i-1,j-1) + 2; if X(i) ≠ Y(j) !
0; if X(i) = Y(j)!
•  Termina'on:  
D(N,M) is distance !

!
Dan  Jurafsky  

The  Edit  Distance  Table  


N 9
O 8
I 7

T 6
N 5
E 4
T 3
N 2
I 1
# 0 1 2 3 4 5 6 7 8 9
# E X E C U T I O N
Dan  Jurafsky  

The  Edit  Distance  Table  


N 9
O 8
I 7
T 6
N 5
E 4
T 3
N 2
I 1
# 0 1 2 3 4 5 6 7 8 9
# E X E C U T I O N
Dan  Jurafsky  

Edit  Distance  
N 9
O 8
I 7

T 6
N 5
E 4
T 3
N 2
I 1
# 0 1 2 3 4 5 6 7 8 9
# E X E C U T I O N
Dan  Jurafsky  

The  Edit  Distance  Table  


N 9 8 9 10 11 12 11 10 9 8
O 8 7 8 9 10 11 10 9 8 9
I 7 6 7 8 9 10 9 8 9 10
T 6 5 6 7 8 9 8 9 10 11
N 5 4 5 6 7 8 9 10 11 10
E 4 3 4 5 6 7 8 9 10 9
T 3 4 5 6 7 8 7 8 9 8
N 2 3 4 5 6 7 8 7 8 7
I 1 2 3 4 5 6 7 6 7 8
# 0 1 2 3 4 5 6 7 8 9
# E X E C U T I O N
Minimum  Edit  
Distance  
 
Compu'ng  Minimum  
Edit  Distance  
 
Minimum  Edit  
Distance  
 
Backtrace  for  
Compu'ng  Alignments  
 
Dan  Jurafsky  

Compu9ng  alignments  
•  Edit  distance  isn’t  sufficient  
•  We  oBen  need  to  align  each  character  of  the  two  strings  to  each  other  
•  We  do  this  by  keeping  a  “backtrace”  
•  Every  'me  we  enter  a  cell,  remember  where  we  came  from  
•  When  we  reach  the  end,    
•  Trace  back  the  path  from  the  upper  right  corner  to  read  off  the  alignment  
Dan  Jurafsky  

Edit  Distance  
N 9
O 8
I 7

T 6
N 5
E 4
T 3
N 2
I 1
# 0 1 2 3 4 5 6 7 8 9
# E X E C U T I O N
Dan  Jurafsky  

MinEdit  with  Backtrace  


Dan  Jurafsky  

Adding  Backtrace  to  Minimum  Edit  Distance  

•  Base  condi'ons:                                                                                                                Termina'on:  


D(i,0) = i D(0,j) = j D(N,M) is distance  
•  Recurrence  Rela'on:  
For each i = 1…M!
! For each j = 1…N  
D(i-1,j) + 1! dele'on  
D(i,j)= min D(i,j-1) + 1! inser'on  
D(i-1,j-1) + 2; if X(i) ≠ Y(j) subs'tu'on  
!
0; if X(i) = Y(j)!
LEFT! inser'on  
ptr(i,j)= DOWN! dele'on  
DIAG! subs'tu'on  
!
Dan  Jurafsky  

The  Distance  Matrix  


xN

Every  non-­‐decreasing  path    


 
from  (0,0)  to  (M,  N)    
 
corresponds  to    
an  alignment    
of  the  two  sequences  
 
x0

An optimal alignment is composed


y0 yM of optimal subalignments
Slide  adapted  from  Serafim  Batzoglou  
Dan  Jurafsky  

Result  of  Backtrace  


•  Two  strings  and  their  alignment:  
Dan  Jurafsky  

Performance  
•  Time:  
       O(nm)  
•  Space:  
       O(nm)  
•  Backtrace  
       O(n+m)  
Minimum  Edit  
Distance  
 
Backtrace  for  
Compu'ng  Alignments  
 
Minimum  Edit  
Distance  
 
Weighted  Minimum  Edit  
Distance  
 
Dan  Jurafsky  

Weighted  Edit  Distance  


•  Why  would  we  add  weights  to  the  computa'on?  
•  Spell  Correc'on:  some  leXers  are  more  likely  to  be  mistyped  than  others  
•  Biology:  certain  kinds  of  dele'ons  or  inser'ons  are  more  likely  than  
others  
Dan  Jurafsky  

Confusion  matrix  for  spelling  errors  


Dan  Jurafsky  
Dan  Jurafsky  

Weighted  Min  Edit  Distance  


•  Ini'aliza'on:  
D(0,0) = 0!
D(i,0) = D(i-1,0) + del[x(i)]; 1 < i ≤ N!
D(0,j) = D(0,j-1) + ins[y(j)]; 1 < j ≤ M  
•  Recurrence  Rela'on:  
D(i-1,j) + del[x(i)]!
D(i,j)= min D(i,j-1) + ins[y(j)]!
D(i-1,j-1) + sub[x(i),y(j)]!
•  Termina'on:  
D(N,M) is distance !
!
Dan  Jurafsky  

Where did the name, dynamic


programming, come from?  
…The 1950s were not good years for mathematical research. [the] Secretary of
Defense …had a pathological fear and hatred of the word, research…

I decided therefore to use the word, “programming”.

I wanted to get across the idea that this was dynamic, this was multistage… I thought,
let’s … take a word that has an absolutely precise meaning, namely dynamic… it’s
impossible to use the word, dynamic, in a pejorative sense. Try thinking of some
combination that will possibly give it a pejorative meaning. It’s impossible.

Thus, I thought dynamic programming was a good name. It was something not even a
Congressman could object to.”

Richard Bellman, “Eye of the Hurricane: an autobiography” 1984.  


Minimum  Edit  
Distance  
 
Weighted  Minimum  Edit  
Distance  
 
Minimum  Edit  
Distance  
 
Minimum  Edit  Distance  
in  Computa'onal  Biology  
 
Dan  Jurafsky  

Sequence  Alignment  

AGGCTATCACCTGACCTCCAGGCCGATGCCC
TAGCTATCACGACCGCGGTCGATTTGCCCGAC

-AGGCTATCACCTGACCTCCAGGCCGA--TGCCC---
TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC
Dan  Jurafsky  

Why  sequence  alignment?  


•  Comparing  genes  or  regions  from  different  species  
•  to  find  important  regions  
•  determine  func'on  
•  uncover  evolu'onary  forces  
•  Assembling  fragments  to  sequence  DNA  
•  Compare  individuals  to  looking  for  muta'ons  
Dan  Jurafsky  

Alignments  in  two  fields  


•  In  Natural  Language  Processing  
• We  generally  talk  about  distance  (minimized)  
•  And  weights  
•  In  Computa'onal  Biology  
• We  generally  talk  about  similarity  (maximized)  
•  And  scores  
Dan  Jurafsky  

The  Needleman-­‐Wunsch  Algorithm  


•  Ini'aliza'on:  
D(i,0) = -i * d!
D(0,j) = -j * d  
•  Recurrence  Rela'on:  
D(i-1,j) - d!
D(i,j)= min D(i,j-1) - d!
D(i-1,j-1) + s[x(i),y(j)]!
•  Termina'on:  
D(N,M) is distance !
!
Dan  Jurafsky  

The  Needleman-­‐Wunsch  Matrix  


x1 xM
y1

(Note  that  the  origin  is  


at  the  upper  leB.)  
yN

Slide  adapted  from  Serafim  Batzoglou  


Dan  Jurafsky  

A  variant  of  the  basic  algorithm:  

•  Maybe  it  is  OK  to  have  an  unlimited  #  of  gaps  in  the  beginning  
and  end:  

----------CTATCACCTGACCTCCAGGCCGATGCCCCTTCCGGC
GCGAGTTCATCTATCAC--GACCGC--GGTCG--------------

•  If so, we don’t want to penalize gaps at the ends

Slide  from  Serafim  Batzoglou  


Dan  Jurafsky  

Different  types  of  overlaps  

Example:
2 overlapping“reads” from a
sequencing project

Example:
Search for a mouse gene
within a human chromosome

Slide  from  Serafim  Batzoglou  


Dan  Jurafsky  

The  Overlap  Detec9on  variant  

x1 xM Changes:  
 
yN

1.  Ini'aliza'on  
For all i, j,!
!F(i, 0) = 0!
!F(0, j) = 0!
 
2.  Termina'on  
! maxi F(i, N)!
FOPT = max!
y1

! maxj F(M, j)!


Slide  from  Serafim  Batzoglou  
Dan  Jurafsky  

The  Local  Alignment  Problem  

Given  two  strings      x  =  x1……xM,    


         y  =  y1……yN  
 
Find  substrings  x’,  y’  whose  similarity    
 (op'mal  global  alignment  value)  
 is  maximum  
 
   x  =  aaaacccccggggXa  
   y  =  Xcccgggaaccaacc   Slide  from  Serafim  Batzoglou  
Dan  Jurafsky  

The  Smith-­‐Waterman  algorithm  


Idea:  Ignore  badly  aligning  regions  
 
Modifica'ons  to  Needleman-­‐Wunsch:  
 
Ini9aliza9on:  F(0, j) = 0!
! ! !F(i, 0) = 0!
           
                                                 0 !!
Itera9on:                      F(i, j) = max F(i – 1, j) – d!
! ! ! ! F(i, j – 1) – d!
! ! ! ! F(i – 1, j – 1) + s(xi, yj) !
Slide  from  Serafim  Batzoglou  
Dan  Jurafsky  

The  Smith-­‐Waterman  algorithm  


Termina9on:  
1.  If  we  want  the  best  local  alignment…  
   
     FOPT  =  maxi,j  F(i,  j)  
   
 Find  FOPT  and  trace  back  

2.  If  we  want  all  local  alignments  scoring  >  t    


 
??    For  all  i,  j  find  F(i,  j)  >  t,  and  trace  back?  
 
Complicated  by  overlapping  local  alignments   Slide  from  Serafim  Batzoglou  
 
 
Dan  Jurafsky  

Local  alignment  example  


A! T! T! A! T! C!
X = ATCAT! 0! 0! 0! 0! 0! 0! 0!
Y = ATTATC!
A! 0!
 
Let:   T! 0!
 m  =  1  (1  point  for  match)   C! 0!
 d  =  1  (-­‐1  point  for  del/ins/sub)  
A! 0!
T! 0!
Dan  Jurafsky  

Local  alignment  example  


A! T! T! A! T! C!
X = ATCAT! 0! 0! 0! 0! 0! 0! 0!
Y = ATTATC! A! 0! 1! 0! 0! 1! 0! 0!
 
T! 0! 0! 2! 1! 0! 2! 0!
C! 0! 0! 1! 1! 0! 1! 3!
A! 0! 1! 0! 0! 2! 1! 2!
T! 0! 0! 2! 0! 1! 3! 2!
Dan  Jurafsky  

Local  alignment  example  


A! T! T! A! T! C!
X = ATCAT! 0! 0! 0! 0! 0! 0! 0!
Y = ATTATC! A! 0! 1! 0! 0! 1! 0! 0!
 
T! 0! 0! 2! 1! 0! 2! 0!
C! 0! 0! 1! 1! 0! 1! 3!
A! 0! 1! 0! 0! 2! 1! 2!
T! 0! 0! 2! 0! 1! 3! 2!
Dan  Jurafsky  

Local  alignment  example  


A! T! T! A! T! C!
X = ATCAT! 0! 0! 0! 0! 0! 0! 0!
Y = ATTATC! A! 0! 1! 0! 0! 1! 0! 0!
 
T! 0! 0! 2! 1! 0! 2! 0!
C! 0! 0! 1! 1! 0! 1! 3!
A! 0! 1! 0! 0! 2! 1! 2!
T! 0! 0! 2! 0! 1! 3! 2!
Minimum  Edit  
Distance  
 
Minimum  Edit  Distance  
in  Computa'onal  Biology  
 

You might also like