Molecular Detection of Nepoviruses in Pakistani Grapevine Germplasm Using Real Time QRT-PCR and Conventional RT-PCR
Molecular Detection of Nepoviruses in Pakistani Grapevine Germplasm Using Real Time QRT-PCR and Conventional RT-PCR
Younas of Naz
and Animal & Plant Sciences, 31(6): 2021, Page: 1814-1821 The J. Anim. Plant Sci., 31 (6) 2021
ISSN (print): 1018-7081; ISSN (online): 2309-8694
[Link]
MOLECULAR DETECTION OF NEPOVIRUSES IN PAKISTANI GRAPEVINE
GERMPLASM USING REAL TIME qRT-PCR AND CONVENTIONAL RT-PCR
A. Younas1 and S. Naz1
1
Department of Biotechnology, Lahore College for Women University, Lahore, Pakistan Corresponding Author’s email:
drsnaz31@[Link]
ABSTRACT
The aim of the present work was to investigate the molecular identification and characterization of the three different
viruses including Grapevine Fanleaf virus (GFLV), Arabis Mosaic virus (ArMV) and Tobacco ringspot virus (TRSV)
from Nepovirus group in the main grape producing regions of Pakistan by using reverse transcription polymerase
reaction (RT-PCR) and real time polymerase reaction (qRT-PCR). Total 370 symptomatic and asymptomatic samples
were screened for these viruses. Total RNA of all samples was extracted by guanidine isothiocyanate and CTAB method
and the efficient one was further used as a template for the amplification by RT-PCR. 28 out of 370 were detected as
positive for GFLV while none of other viruses were found positive in the screened samples. The results from the analysis
of the conventional PCR confirmed the presence of only GFLV as the gene fragment was amplified by PCR at desired
size of 322 bp. One of the positive PCR amplified product of GFLV was subjected to Sanger sequencing and
phylogenetic relationship using MEGA 7.0. The phylogenetic analysis showed 90% homology with American isolates.
The real-time TaqMan® RT-PCR assay was compared to the conventional RT-PCR assay for the detection of viruses
using purified total RNA. This study showed that TaqMan® RT-PCR was more sensitive than conventional RT-PCR for
testing different isolates of these viruses present in low titer and it also gave the amount of virus present in each sample.
The current study produces a significant preliminary data showing the current status of Nepoviruses that can be used for
the establishment of a pathogen tested grapevine germplasm program for grape cultivation in Pakistan.
Keywords: GFLV, ArMV, Pakistani grapevine germplasm, RT-PCR, TRSV, Phylogenetic analysis
Published first online March 31, 2021 Published final Nov. 20, 2021.
1814
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
Detection of grapevine viruses by nucleic acid-based then loaded into the wells and visualized under UV light.
methods has been proven more sensitive and reliable RNA purity and concentration were assessed by
method. Molecular method (polymerase chain reaction) is determining the absorbance of the samples by
the utmost specific, accurate and reliable technique for NanoDropTM-1000 (Thermo Fisher Scientific Inc) at 260
the screening of grapevine viruses as compared to and 280 nm.
biological indexing and serological assays (Osman et al.,
cDNA synthesis: First-strand cDNA synthesis was
2008). Real time quantitative reverse transcription PCR
performed using 1 µg of total RNA treated with DNase
(RT-qPCR) is very sensitive method to determine and
following manufacturer’s instructions (Thermo Scientific
quantify the low titer of pathogens in the infected tissue
RevertAid). 3ul of RNA, 1ul of random hexamers and 7ul
(Agindotan et al., 2007; Osman et al., 2007). In Pakistan,
of RNAase free water were incubated at 70°C for 5min.
grapes yield is low as compare to the developed and
After incubation, a cocktail containing 4 ul of 5X RT
developing countries especially our neighboring country
buffer, 2.5μl of 10 mM dNTPs, 1 μl of 50mM DTT, 0.5
India. This needs to categorize the features responsible
μl of 40 U inhibitor (RiboLockTM RNase inhibitor kit)
for the low productivity of grapes. The present study was
and 1μl of 200U Moloney murine leukemia virus (Mu-
conducted to identify the most prevalent grapevine
MLV) Reverse transcriptase was added in the reaction
Nepoviruses in Pakistani germplasm and to determine the
tube. The mix for reverse transcriptase (20 µl) was
genetic relationship of Pakistani Nepovirus isolate with
incubated for 10 min at 25°C, 60 min at 42°C and 10
the rest of the world. This report shows that conventional
minutes at 70°C.
PCR tests using published primers are inadequate for
detecting all Nepoviruses present in Pakistani germplasm. RT-PCR: The PCR cocktail (25 µl) contained 2 µl of
To improve virus detection, a qRT-PCR assay was cDNA (10% of the first strand reaction, corresponding to
developed which was capable of detecting more positive about 100 ng of total RNA), 1× (2.5 µl) PCR buffer
isolates. (Invitrogen Life Technologies), 2.5 mM dNTPs, 10 mM
each primer, 2.5 mM MgCl2, and 1 U of Taq polymerase
MATERIALS AND METHODS (Thermo Scientific Fisher). Cycling conditions for all
primer pairs consisted of initial denaturation at 95°C for 2
Pathogens and plant materials: Viruses targeted in this min followed by 35 cycles at 95°C for 1 min, 58°C for 1
study included Grapevine Fanleaf virus (GFLV), min, and 72°C for 1 min. A final extension of 7 min at
Tobacco ringspot virus (TRSV) and Arabis mosaic virus 72℃ was part of PCR amplification prior to holding the
(ArMV). Different local and commercial vineyards were samples at 4℃. The specific primers used for the analysis
surveyed for the sample collection. A total of 370 of GFLV, ArMV and TRSVare shown in Table 1.
samples were collected from Sillanwali, Lahore, Reaction products were analyzed by electrophoresis on
Fortabbas, Quetta, Pishin, Kila Abdullah, Khuzdaar and 1.5% agarose gels and visualized on gel documentation
Kalaam during the months of July and August, 2017 to system after staining with ethidium bromide.
study the occurrence of these pathogens. The grapevine TaqMan RT-PCR: Single-tube TaqMan® RT-PCR
leaves were collected from plants showing vein reactions were set up in 394-well reaction plates using a
yellowing, yellow speckles or no apparent symptoms. TaqMan® Fast virus one step Master mix kit (ABI) as
Considering the possible even distribution of viruses follows: 2.5 ul one-step RT-PCR Master Mix, 0.5
within a given plant, samples from at least five different primer/probe mix (250 nM probe and 900 nM primer),
shoots or canes of the same plant were mixed. Samples and 2ul of total RNA template in 10ul reaction. Reactions
were taken from all sides of vine. were carried out in a thermocycler Quant Studio™ 7 Flex
Sample processing: The collected leaf samples were Real-Time PCR System (Thermo Fisher Scientific) in a
cleaned, labelled and packed in zip lock plastic bags and one-step reaction as recommended by ABI (RT-PCR
were transported in ice box to Plant tissue culture Master Mix procedure). Reverse transcription and
Laboratory, Lahore College for women university, amplification conditions were as follows: 45 ◦C for 35
Lahore. The samples were stored in freezer (-20 °C) until min, 95 ◦C for 10 min, followed by 40 cycles of 95 ◦C for
the RNA extractions were performed. Total RNA was 30 s and 60 ◦C for 30 s. The data was analyzed
extracted from 1 g of grapevine tissues (petiole and mid quantitatively by measuring the threshold cycles (CT) in
rib). Two methods were evaluated to select a reliable one a Microsoft Excel program and graphically by an
for RNA extraction i.e CTAB method (Iandolino et al., amplification plot using Quant Studio™ 7 Flex Real-
2004) and Guanidine isothiocyanate method (Osman et Time PCR System Software. The threshold cycle (CT) is
al., 2008). To assess the quality of extracted RNA, 1% the cycle at which a significant increase in fluorescence
agarose gel was prepared in TBE buffer (Sambrook et al., occurs; hence a CT value below 30 indicates a positive
1989) and stained with ethidium bromide. 5ul of result in this setup. The Primers and probes used for
extracted RNA was mixed with 3ul of loading dye and
1815
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
GFLV, ArMV and TRSV amplification are shown in quantity of extracted RNA by both methods were
Table 2. analyzed by using agarose gel electrophoresis and
Nanodrop. The sharp bands of RNA extracted by
Agarose gel purification and Sequence Analysis: To
Guanidine isothiocyanate method showed better quality
purify the expected amplicon size on gel, Thermo
as compare CTAB to as shown in Fig 1 (A) and 1 (B).
Scientific Gene Jet PCR Gel Extraction Kit was used.
The quantity of RNA extracted by Guanidine
The expected amplicon from the PCR was cut out of the
isothiocyanate method was in the range (A260/280=
gel and purified. Thermo Scientific Gene JET PCR
1.56-2.29) while with CTAB method the range was low
Purification Kit purified the PCR products and
(A260/280= 1.21-1.83). The results showed that the
sequencing was done using primer pair in both
Guanidine isothiocyanate method showed better quality
orientations using the same set of primer as in
RNA as compare to CTAB. So, for the detection of
amplification. The obtained nucleotide sequence was
concerned Nepoviruses by RT-PCR, RNA extracted by
analyzed by using BLAST with default parameters. The
Guanidine isothiocyanate method was used.
consensus coat protein sequence of the positive isolate
was compared and analyzed with coat protein sequences Nepoviruses detection by RT-PCR: All samples were
obtained from Genbank databases. The phylogenetic tested by conventional PCR for the presence of
relationship was determined by using neighbor joining Grapevine Fanleaf virus (GFLV), Tobacco ringspot virus
method using MEGA 7. (TRSV) and Arabis Mosaic Virus (ArMV) using specific
primers given in Table 1. Only 18 samples were found
RESULTS positive for the GFLV while none came up positive for
other two viruses except their positive controls. Analysis
Total nucleic acid Extraction: Total RNA was extracted by agarose gel electrophoresis of the PCR products
from both symptomatic and asymptomatic grapevine (Figure 3: A) revealed the presence of the expected band
samples to check the presence of Nepoviruses in the of 322 bp in GFLV isolates while in Fig 3 (B and C) the
Pakistani grapevine germplasm. Two different extraction PCR amplification of ArMV and TRSV showed that none
methods were used to extract RNA. The quality and of the isolate came up positive except positive control.
1816
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
(A) (B)
Fig. 2. Comparison of total RNA isolation by two different methods (A) by CTAB method (B) by Guanidine
isothiocyanate method.
Fig 3: PCR amplification of Nepoviruses (A) GFLV (B) ArMV (C) TRSV from different isolates of Pakistani
Grapevine Germplasm.
Table 1. Primer set used for Nepoviruses amplification by RT-PCR
1817
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
Nepoviruses detection by TaqMan RT-PCR: Three infection rate. The distribution of GFLV was observed in
main viruses (GFLV, ArMV and TRSV) from the Sillanwali, Qila Abdullah and Pishin. The widespread
Nepovirus group was detected by TaqMan RT-PCR. infection of GFLV was seen in 19 cultivars of Sillanwali
Only Grapevine fanleaf virus (GFLV) was the frequently region. The CT values of these samples were ranged from
encountered virus in the grape growing region of 22-32 (Table 3). Negative and positive control was also
Pakistan. Previously reported TaqMan primers and run. The amplification curve by Rn and ∆Rn vs cycle for
probes were used for the diagnosis of these viruses. Total each virus is shown in Fig 4 (A-C).
28 isolates were positive with GFLV and showed 7.5%
(A) (B)
(C)
Fig4. Amplification plot of Relative grapevine Nepoviruses quantification of the TaqMan RT-PCR assay.
Table 2. Real time RT-PCR primers and probes information for Grapevine Fanleaf Virus (GFLV), Arabis mosaic
virus (ArMV) and Tobacco ringspot virus (TRSV).
Virus Primer/Probe Name Primer/ Probe Sequence (5’-3’) Location Size Size (bp)
GFLV GFLV 2801F GTTAGTGAGTGGAACGGGACC Coat protein 151
GFLV 2822R TTCCACATACACCCCGGGATA
GFLV 2825P CTATGGATTGGAATGAA
ArMV ArMV cp F TAGCCCTTGGAGACAATCCT Coat protein
1818
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
ArMV cp R CCTCCAAATCCCACATTAAC
ArMVcp P TGCCCATATGATAGCTTGTCATGGAC
TRSV TRSV-1710F AGGATGGTCCGGCTCTTAGG Coat Protein 93
TRSV-1795R GCTGACAGACAGACATTCTTGGG
TRSV-1743P TGTATAAACTCAGCTTCTTGGG
Real-time RT-PCR primers and probes information for Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Lily
symptomless
virus (LSV), Tobacco rattle virus (TRV) and Tulip virus X (TVX
Real-time RT-PCR primers and probes information for Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Lily
symptomless
virus (LSV), Tobacco rattle virus (TRV) and Tulip virus X (TVX
Sr. No. Variety Name Sample Code Target Name Reporter Quencher CT value
1. Midgerly’s Purple SL 1 GFLV FAM NFQ-MGB 25.22
2. Lake Mount SL 2 GFLV FAM NFQ-MGB 27.54
3. Delight SL 3 GFLV FAM NFQ-MGB 26.39
4. Lomanto SL 4 GFLV FAM NFQ-MGB 29.09
5. Kings Ruby L2 P1 PSH 22 GFLV FAM NFQ-MGB 28.87
6. Toran L1 P2 ARI 2 GFLV FAM NFQ-MGB 28.53
7. Thomcord SL 7 GFLV FAM NFQ-MGB 29.77
8. Perlette SL 8 GFLV FAM NFQ-MGB 30.11
9. Red Globe PSH 23 GFLV FAM NFQ-MGB 27.68
10. Thompson Seedless SL 10 GFLV FAM NFQ-MGB 31.01
Phylogenetic Analysis of GFLV CP: In order to understand the relationship between the Pakistani and the other GFLV
isolates available at the GenBank, a phylogenetic tree was established. The newly characterized nucleotide sequence of
the Pakistani isolate was blasted with previously reported GFLV isolates in NCBI. It appeared that the newly generated
sequence corresponds to the CP gene of GFLV. When the sequence of new isolate of GFLV was subjected to BLAST
analysis, more than 90% similarity was shown between the new isolate and other GFLV isolates previously reported
from USA, Chile, China, Poland and Iran. Little cherry virus CP is used an as outgroup while determining the
evolutionary relationship within the group.
Fig. 3. Evolutionary relationships of taxa: Neighbor joining phylogenetic tree based on nucleic acid sequences of
CP gene of GFLV isolate generated by MEGA 7. The optimal tree with the sum of branch length=
1.429598 is shown. The p-distance method is used to compute the evolutionary distance. Total 17
nucleotides sequences are involved in the analysis. Branches with bootstrap value of <50% are
unrevealed. Pakistani isolate is shown by bold letters.
1819
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
1820
Younas and Naz The J. Anim. Plant Sci., 31 (6) 2021
1821