0% found this document useful (0 votes)
165 views17 pages

Understanding the Replisome in DNA Replication

The replisome is a complex molecular machine that carries out DNA replication. It unwinds double-stranded DNA into single strands and synthesizes a new complementary strand for each resulting single strand, duplicating the DNA. The replisome is composed of proteins including helicase, DNA polymerase, and other factors that work together to solve the structural and chemical challenges of duplicating DNA, such as unwinding its double helix structure, protecting the single strands, ensuring accurate synthesis of both leading and lagging strands, and joining the resulting DNA fragments.

Uploaded by

Sibam Kairi
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
165 views17 pages

Understanding the Replisome in DNA Replication

The replisome is a complex molecular machine that carries out DNA replication. It unwinds double-stranded DNA into single strands and synthesizes a new complementary strand for each resulting single strand, duplicating the DNA. The replisome is composed of proteins including helicase, DNA polymerase, and other factors that work together to solve the structural and chemical challenges of duplicating DNA, such as unwinding its double helix structure, protecting the single strands, ensuring accurate synthesis of both leading and lagging strands, and joining the resulting DNA fragments.

Uploaded by

Sibam Kairi
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Replisome

The replisome is a complex molecular machine t hat carries out replicat ion of DNA. The
replisome first unwinds double st randed DNA int o t wo single st rands. For each of t he result ing
single st rands, a new complement ary sequence of DNA is synt hesized. The Tot al result is
format ion of t wo new double st randed DNA sequences t hat are exact copies of t he original
double st randed DNA sequence.[1]

A representation of the structures of the replisome during DNA replication


In t erms of st ruct ure, t he replisome is composed of t wo replicat ive polymerase complexes, one
of which synt hesizes t he leading st rand, while t he ot her synt hesizes t he lagging st rand. The
replisome is composed of a number of prot eins including helicase, RFC, PCNA,
gyrase/t opoisomerase, SSB/RPA, primase, DNA polymerase III, RNAse H, and ligase.

Overview of prokaryotic DNA replication process

For prokaryot es, each dividing nucleoid (region cont aining genet ic mat erial which is not a nucleus)
requires t wo replisomes for bidirect ional replicat ion. The t wo replisomes cont inue replicat ion at
bot h forks in t he middle of t he cell. Finally, as t he t erminat ion sit e replicat es, t he t wo replisomes
separat e from t he DNA. The replisome remains at a fixed, midcell locat ion in t he cell, at t ached
t o t he membrane, and t he t emplat e DNA t hreads t hrough it . DNA is fed t hrough t he st at ionary
pair of replisomes locat ed at t he cell membrane.

Overview of eukaryotic DNA replication process

For eukaryot es, numerous replicat ion bubbles form at origins of replicat ion t hroughout t he
chromosome. As wit h prokaryot es, t wo replisomes are required, one at each replicat ion fork
locat ed at t he t erminus of t he replicat ion bubble. Because of significant differences in
chromosome size, and t he associat ed complexit ies of highly condensed chromosomes, various
aspect s of t he DNA replicat ion process in eukaryot es, including t he t erminal phases, are less
well-charact erised t han for prokaryot es.

Challenges of DNA replication

The replisome is a syst em in which various fact ors work t oget her t o solve t he st ruct ural and
chemical challenges of DNA replicat ion. Chromosome size and st ruct ure varies bet ween
organisms, but since DNA molecules are t he reservoir of genet ic informat ion for all forms of life,
many replicat ion challenges and solut ions are t he same for different organisms. As a result , t he
replicat ion fact ors t hat solve t hese problems are highly conserved in t erms of st ruct ure,
chemist ry, funct ionalit y, or sequence. General st ruct ural and chemical challenges include t he
following:

Efficient replisome assembly at origins of replicat ion (origin recognit ion complexes or specific
replicat ion origin sequences in some organisms)
Separat ing t he duplex int o t he leading and lagging t emplat e st rands (helicases)

Prot ect ing t he leading and lagging st rands from damage aft er duplex separat ion (SSB and RPA
fact ors)

Priming of t he leading and lagging t emplat e st rands (primase or DNA polymerase alpha)

Ensuring processivit y (clamp loading fact ors, ring-shaped clamp prot eins, st rand binding
prot eins)

High-fidelit y DNA replicat ion (DNA polymerase III, DNA polymerase delt a, DNA polymerase
epsilon. All have int rinsically low error rat es because of t heir st ruct ure and chemist ry.)

Error correct ion (replicat ive polymerase act ive sit es sense errors; 3' t o 5' exonuclease domains
of replicat ive polymerases fix errors)

Synchronised polymerisat ion of leading and lagging st rands despit e ant i-parallel st ruct ure
(replicat ion fork st ruct ure, dimerisat ion of replicat ive polymerases)

Primer removal (DNA polymerase I, RNAse H, flap endonucleases such as FEN1, or ot her DNA
repair fact ors)

Format ion of phosphodiest er bonds at gaps bet ween Okazaki fragment s (ligase)

In general, t he challenges of DNA replicat ion involve t he st ruct ure of t he molecules, t he


chemist ry of t he molecules, and, from a syst ems perspect ive, t he underlying relat ionships
bet ween t he st ruct ure and t he chemist ry.

Solving the challenges of DNA replication

Many of t he st ruct ural and chemical problems associat ed wit h DNA replicat ion are managed by
molecular machinery t hat is highly conserved across organisms. This sect ion discusses how
replisome fact ors solve t he st ruct ural and chemical challenges of DNA replicat ion.

Replisome assembly

DNA replicat ion begins at sit es called origins of replicat ion. In organisms wit h small genomes and
simple chromosome st ruct ure, such as bact eria, t here may be only a few origins of replicat ion on
each chromosome. Organisms wit h large genomes and complex chromosome st ruct ure, such as
humans, may have hundreds, or even t housands, of origins of replicat ion spread across mult iple
chromosomes.
DNA st ruct ure varies wit h t ime, space, and sequence, and it is t hought t hat t hese variat ions, in
addit ion t o t heir role in gene expression, also play act ive roles in replisome assembly during DNA
synt hesis. Replisome assembly at an origin of replicat ion is roughly divided int o t hree phases.

For prokaryot es:

Format ion of pre-replicat ion complex. DnaA binds t o t he origin recognit ion complex and
separat es t he duplex. This at t ract s DnaB helicase and DnaC, which maint ain t he replicat ion
bubble.

Format ion of pre-init iat ion complex. SSB binds t o t he single st rand and t hen gamma (clamp
loading fact or) binds t o SSB.

Format ion of init iat ion complex. Gamma deposit s t he sliding clamp (bet a) and at t ract s DNA
polymerase III.

For eukaryot es:

Format ion of pre-replicat ion complex. MCM fact ors bind t o t he origin recognit ion complex and
separat e t he duplex, forming a replicat ion bubble.

Format ion of pre-init iat ion complex. Replicat ion prot ein A (RPA) binds t o t he single st randed
DNA and t hen RFC (clamp loading fact or) binds t o RPA.

Format ion of init iat ion complex. RFC deposit s t he sliding clamp (PCNA) and at t ract s DNA
polymerases such as alpha (α), delt a (δ), epsilon (ε).

For bot h prokaryot es and eukaryot es, t he next st age is generally referred t o as 'elongat ion', and
it is during t his phase t hat t he majorit y of DNA synt hesis occurs.

Separating the duplex

DNA is a duplex formed by t wo ant i-parallel st rands. Following Meselson-St ahl, t he process of
DNA replicat ion is semi-conservat ive, whereby during replicat ion t he original DNA duplex is
separat ed int o t wo daught er st rands (referred t o as t he leading and lagging st rand t emplat es).
Each daught er st rand becomes part of a new DNA duplex. Fact ors generically referred t o as
helicases unwind t he duplex.

Helicases
Helicase is an enzyme which breaks hydrogen bonds bet ween t he base pairs in t he middle of t he
DNA duplex. It s doughnut like st ruct ure wraps around DNA and separat es t he st rands ahead of
DNA synt hesis. In eukaryot es, t he Mcm2-7 complex act s as a helicase, t hough which subunit s
are required for helicase act ivit y is not ent irely clear.[2] This helicase t ranslocat es in t he same
direct ion as t he DNA polymerase (3' t o 5' wit h respect t o t he t emplat e st rand). In prokaryot ic
organisms, t he helicases are bet t er ident ified and include dnaB, which moves 5' t o 3' on t he
st rand opposit e t he DNA polymerase.

Unwinding supercoils and decatenation

Examples of topological coils introduced during duplex unwinding and strand separation.

As helicase unwinds t he double helix, t opological changes induced by t he rot at ional mot ion of
t he helicase lead t o supercoil format ion ahead of t he helicase (similar t o what happens when you
t wist a piece of t hread).

Gyrase and topoisomerases

Gyrase (a form of t opoisomerase) relaxes and undoes t he supercoiling caused by helicase. It


does t his by cut t ing t he DNA st rands, allowing it t o rot at e and release t he supercoil, and t hen
rejoining t he st rands. Gyrase is most commonly found upst ream of t he replicat ion fork, where t he
supercoils form.

Protecting the leading and lagging strands


A rendering of the 70kd sub-unit of Replication protein A

Single-st randed DNA is highly unst able and can form hydrogen bonds wit h it self t hat are referred
t o as 'hairpins' (or t he single st rand can improperly bond t o t he ot her single st rand). To
count eract t his inst abilit y, single-strand binding proteins (SSB in prokaryot es and Replicat ion
prot ein A in eukaryot es) bind t o t he exposed bases t o prevent improper ligat ion.

If you consider each st rand as a "dynamic, st ret chy st ring", t he st ruct ural pot ent ial for improper
ligat ion should be obvious.

The lagging strand without binding proteins.

TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Lagging strand bases


=========================================== Sugar phosphate backbone

An expanded schemat ic reveals t he underlying chemist ry of t he problem: t he pot ent ial for
hydrogen bond format ion bet ween unrelat ed base pairs.
Schematic view of newly separated DNA strands without strand binding proteins.

--HH--------HH-HH--H--HH----------HH--HH--H Hydrogen bond schematic


HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Hydrogen bond schematic
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Hydrogen bond schematic
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Lagging strand bases
=========================================== Sugar phosphate backbone

Binding prot eins st abilise t he single st rand and prot ect ed t he st rand from damage caused by
unlicensed chemical react ions.

The lagging strand coated with binding proteins (*) that prevent improper ligation.

******************************************* Strand binding proteins


TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Lagging strand bases
=========================================== Sugar phosphate backbone

The combinat ion of a single st rand and it s binding prot eins serves as a bet t er subst rat e for
replicat ive polymerases t han a naked single st rand (binding prot eins provide ext ra t hermodynamic
driving force for t he polymerisat ion react ion). St rand binding prot eins are removed by replicat ive
polymerases.

Priming the leading and lagging strands

From bot h a st ruct ural and chemical perspect ive, a single st rand of DNA by it self (and t he
associat ed single st rand binding prot eins) is not suit able for polymerisat ion. This is because t he
chemical react ions cat alysed by replicat ive polymerases require a free 3' OH in order t o init iat e
nucleot ide chain elongat ion. In t erms of st ruct ure, t he conformat ion of replicat ive polymerase
act ive sit es (which is highly relat ed t o t he inherent accuracy of replicat ive polymerases) means
t hese fact ors cannot st art chain elongat ion wit hout a pre-exist ing chain of nucleot ides, because
no known replicat ive polymerase can st art chain elongat ion de novo.

Priming enzymes, (which are DNA-dependent RNA polymerases), solve t his problem by creat ing
an RNA primer on t he leading and lagging st rands. The leading st rand is primed once, and t he
lagging st rand is primed approximat ely every 1000 (+/- 200) base pairs (one primer for each
Okazaki fragment on t he lagging st rand). Each RNA primer is approximat ely 10 bases long.
Single strand of DNA with strand binding proteins (*) and RNA primer added by priming
enzymes (UAGCUAUAUAUA).

=========================================== Sugar phosphate backbone


ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Lagging strand bases
UAGCUAUAUAUA******************************* RNA primer and strand
binding proteins

The int erface at (A*) cont ains a free 3' OH t hat is chemically suit able for t he react ion cat alysed
by replicat ive polymerases, and t he "overhang" configurat ion is st ruct urally suit able for chain
elongat ion by a replicat ive polymerase. Thus, replicat ive polymerases can begin chain elongat ion
at (A*).

Primase

In prokaryot es, t he primase creat es an RNA primer at t he beginning of t he newly separat ed


leading and lagging st rands.

DNA polymerase alpha

In eukaryot es, DNA polymerase alpha creat es an RNA primer at t he beginning of t he newly
separat ed leading and lagging st rands, and, unlike primase, DNA polymerase alpha also
synt hesizes a short chain of deoxynucleot ides aft er creat ing t he primer.

Ensuring processivity and synchronisation

Processivit y refers t o bot h speed and cont inuit y of DNA replicat ion, and high processivit y is a
requirement for t imely replicat ion. High processivit y is in part ensured by ring-shaped prot eins
referred t o as 'clamps' t hat help replicat ive polymerases st ay associat ed wit h t he leading and
lagging st rands. There are ot her variables as well: from a chemical perspect ive, st rand binding
prot eins st imulat e polymerisat ion and provide ext ra t hermodynamic energy for t he react ion. From
a syst ems perspect ive, t he st ruct ure and chemist ry of many replisome fact ors (such as t he
AAA+ ATPase feat ures of t he individual clamp loading sub-unit s, along wit h t he helical
conformat ion t hey adopt ), and t he associat ions bet ween clamp loading fact ors and ot her
accessory fact ors, also increases processivit y.

To t his point , according t o research by Kuriyan et al.,[3] due t o t heir role in recruit ing and binding
ot her fact ors such as priming enzymes and replicat ive polymerases, clamp loaders and sliding
clamps are at t he heart of t he replisome machinery. Research has found t hat clamp loading and
sliding clamp fact ors are absolut ely essent ial t o replicat ion, which explains t he high degree of
st ruct ural conservat ion observed for clamp loading and sliding clamp fact ors. This archit ect ural
and st ruct ural conservat ion is seen in organisms as diverse as bact eria, phages, yeast , and
humans. That such a significant degree of st ruct ural conservat ion is observed wit hout sequence
homology furt her underpins t he significance of t hese st ruct ural solut ions t o replicat ion
challenges.

Clamp loader

Clamp loader is a generic t erm t hat refers t o replicat ion fact ors called gamma (prokaryot es) or
RFC (eukaryot es). The combinat ion of t emplat e DNA and primer RNA is referred t o as 'A-form
DNA' and it is t hought t hat clamp loading replicat ion prot eins (helical het eropent amers) want t o
associat e wit h A-form DNA because of it s shape (t he st ruct ure of t he major/minor groove) and
chemist ry (pat t erns of hydrogen bond donors and accept ors).[3][4] Thus, clamp loading prot eins
associat e wit h t he primed region of t he st rand which causes hydrolysis of ATP and provides
energy t o open t he clamp and at t ach it t o t he st rand.[3][4]

Sliding clamp
A rendering of a fully assembled, trimeric PCNA clamp

Sliding clamp is a generic t erm t hat refers t o ring-shaped replicat ion fact ors called bet a
(prokaryot es) or PCNA (eukaryot es). Clamp prot eins at t ract and t et her replicat ive polymerases,
such as DNA polymerase III, in order t o ext end t he amount of t ime t hat a replicat ive polymerase
st ays associat ed wit h t he st rand. From a chemical perspect ive, t he clamp has a slight ly posit ive
charge at it s cent re t hat is a near perfect mat ch for t he slight ly negat ive charge of t he DNA
st rand.

In some organisms, t he clamp is a dimer, and in ot her organisms t he clamp is a t rimer. Regardless,
t he conserved ring archit ect ure allows t he clamp t o enclose t he st rand.

Dimerisation of replicative polymerases

Replicat ive polymerases form an asymmet ric dimer at t he replicat ion fork by binding t o sub-unit s
of t he clamp loading fact or. This asymmet ric conformat ion is capable of simult aneously
replicat ing t he leading and lagging st rands, and t he collect ion of fact ors t hat includes t he
replicat ive polymerases is generally referred t o as a holoenzyme. However, significant challenges
remain: t he leading and lagging st rands are ant i-parallel. This means t hat nucleot ide synt hesis on
t he leading st rand nat urally occurs in t he 5' t o 3' direct ion. However, t he lagging st rand runs in t he
opposit e direct ion and t his present s quit e a challenge since no known replicat ive polymerases
can synt hesise DNA in t he 3' t o 5' direct ion.

The dimerisat ion of t he replicat ive polymerases solves t he problems relat ed t o efficient
synchronisat ion of leading and lagging st rand synt hesis at t he replicat ion fork, but t he t ight
spat ial-st ruct ural coupling of t he replicat ive polymerases, while solving t he difficult issue of
synchronisat ion, creat es anot her challenge: dimerisat ion of t he replicat ive polymerases at t he
replicat ion fork means t hat nucleot ide synt hesis for bot h st rands must t ake place at t he same
spat ial locat ion, despit e t he fact t hat t he lagging st rand must be synt hesised backwards
relat ive t o t he leading st rand. Lagging st rand synt hesis t akes place aft er t he helicase has
unwound a sufficient quant it y of t he lagging st rand, and t his "sufficient quant it y of t he lagging
st rand" is polymerised in discret e nucleot ide chains called Okazaki fragment s.

Consider t he following: t he helicase cont inuously unwinds t he parent al duplex, but t he lagging
st rand must be polymerised in t he opposit e direct ion. This means t hat , while polymerisat ion of
t he leading st rand proceeds, polymerisat ion of t he lagging st rand only occurs aft er enough of
t he lagging st rand has been unwound by t he helicase. At t his point , t he lagging st rand replicat ive
polymerase associat es wit h t he clamp and primer in order t o st art polymerisat ion. During lagging
st rand synt hesis, t he replicat ive polymerase sends t he lagging st rand back t oward t he
replicat ion fork. The replicat ive polymerase disassociat es when it reaches an RNA primer.
Helicase cont inues t o unwind t he parent al duplex, t he priming enzyme affixes anot her primer, and
t he replicat ive polymerase reassociat es wit h t he clamp and primer when a sufficient quant it y of
t he lagging st rand has unwound.

Collect ively, leading and lagging st rand synt hesis is referred t o as being 'semidiscont inuous'.

High-fidelity DNA replication

Prokaryot ic and eukaryot ic organisms use a variet y of replicat ive polymerases, some of which are
well-charact erised:

DNA polymerase III

DNA polymerase delt a

DNA polymerase epsilon


DNA polymerase III

This polymerase synt hesizes leading and lagging st rand DNA in prokaryot es.

DNA polymerase delta

This polymerase synt hesizes lagging st rand DNA in eukaryot es.[5] (Thought t o form an
asymmet ric dimer wit h DNA polymerase epsilon.)[6]

DNA polymerase epsilon

This polymerase synt hesizes leading st rand DNA in eukaryot es.[7] (Thought t o form an
asymmet ric dimer wit h DNA polymerase delt a.)[5]

Proof-reading and error correction

Alt hough rare, incorrect base pairing polymerisat ion does occur during chain elongat ion. (The
st ruct ure and chemist ry of replicat ive polymerases mean t hat errors are unlikely, but t hey do
occur.) Many replicat ive polymerases cont ain an "error correct ion" mechanism in t he form of a 3'
t o 5' exonuclease domain t hat is capable of removing base pairs from t he exposed 3' end of t he
growing chain. Error correct ion is possible because base pair errors dist ort t he posit ion of t he
magnesium ions in t he polymerisat ion sub-unit , and t he st ruct ural-chemical dist ort ion of t he
polymerisat ion unit effect ively st alls t he polymerisat ion process by slowing t he react ion.[8]
Subsequent ly, t he chemical react ion in t he exonuclease unit t akes over and removes nucleot ides
from t he exposed 3' end of t he growing chain.[9] Once an error is removed, t he st ruct ure and
chemist ry of t he polymerisat ion unit ret urns t o normal and DNA replicat ion cont inues. Working
collect ively in t his fashion, t he polymerisat ion act ive sit e can be t hought of as t he "proof-
reader", since it senses mismat ches, and t he exonuclease is t he "edit or", since it correct s t he
errors.

Base pair errors dist ort t he polymerase act ive sit e for bet ween 4 and 6 nucleot ides, which
means, depending on t he t ype of mismat ch, t here are up t o six chances for error correct ion.[8]
The error sensing and error correct ion feat ures, combined wit h t he inherent accuracy t hat arises
from t he st ruct ure and chemist ry of replicat ive polymerases, cont ribut e t o an error rat e of
approximat ely 1 base pair mismat ch in 108 t o 1010 base pairs.

Schematic view of correct base pairs followed by 8 possible base pair mismatches.[10]

=========================================== Sugar phosphate backbone


ATCG AGAC TTCG xxxxxxxxxxxxxxxxxxxxxxxxxxxx Original lagging strand bases
TAGC AGGC TCAT xxxxxxxxxxxxxxxxxxxxxxxxxxxx Correctly matched bases
followed by 8 possible mismatches
=========================================== Sugar phosphate backbone

Errors can be classified in t hree cat egories: purine-purine mismat ches, pyrimidine-pyrimidine
mismat ches, and pyrimidine-purine mismat ches. The chemist ry of each mismat ch varies, and so
does t he behaviour of t he replicat ive polymerase wit h respect t o it s mismat ch sensing act ivit y.

The replicat ion of bact eriophage T4 DNA upon infect ion of E. coli is a well-st udied DNA
replicat ion syst em. During t he period of exponent ial DNA increase at 37°C, t he rat e of elongat ion
is 749 nucleot ides per second.[11] The mut at ion rat e during replicat ion is 1.7 mut at ions per 108
base pairs.[12] Thus DNA replicat ion in t his syst em is bot h very rapid and highly accurat e.

Primer removal and nick ligation

There are t wo problems aft er leading and lagging st rand synt hesis: RNA remains in t he duplex
and t here are nicks bet ween each Okazaki fragment in t he lagging duplex. These problems are
solved by a variet y of DNA repair enzymes t hat vary by organism, including: DNA polymerase I,
DNA polymerase bet a, RNAse H, ligase, and DNA2. This process is well-charact erised in
prokaryot es and much less well-charact erised in many eukaryot es.

In general, DNA repair enzymes complet e t he Okazaki fragment s t hrough a variet y of means,
including: base pair excision and 5' t o 3' exonuclease act ivit y t hat removes t he chemically
unst able ribonucleot ides from t he lagging duplex and replaces t hem wit h st able
deoxynucleot ides. This process is referred t o as 'mat urat ion of Okazaki fragment s', and ligase
(see below) complet es t he final st ep in t he mat urat ion process.

RNA-DNA duplex with ribonucleotides added by a priming enzyme (-) and


deoxynucleotides added by a replicative polymerase (+).

=========================================== Sugar phosphate backbone


ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Original lagging strand bases
UAGCUAUAUAUACGTCGATCTTCGAATTTATATACGATCGTAC With the primer, newly
synthesised bases are a combination of uracil, adenine, thymine, cytosine, and guanine.
=========================================== With the primer, the sugar
phosphate backbone is made of ribose and deoxyribose.
------------+++++++++++++++++++++++++++++++ - indicates ribonucleotide and
+ indicates deoxynucleotide

Primer removal and nick ligat ion can be t hought of as DNA repair processes t hat produce a
chemically-st able, error-free duplex. To t his point , wit h respect t o t he chemist ry of an RNA-DNA
duplex, in addit ion t o t he presence of uracil in t he duplex, t he presence of ribose (which has a
react ive 2' OH) t ends t o make t he duplex much less chemically-st able t han a duplex cont aining
only deoxyribose (which has a non-react ive 2' H).

DNA polymerase I

DNA polymerase I is an enzyme t hat repairs DNA.

RNAse H

RNAse H is an enzyme t hat removes RNA from an RNA-DNA duplex.

Ligase

Aft er DNA repair fact ors replace t he ribonucleot ides of t he primer wit h deoxynucleot ides, a
single gap remains in t he sugar-phosphat e backbone bet ween each Okazaki fragment in t he
lagging duplex. An enzyme called DNA ligase connect s t he gap in t he backbone by forming a
phosphodiest er bond bet ween each gap t hat separat es t he Okazaki fragment s. The st ruct ural
and chemical aspect s of t his process, generally referred t o as 'nick t ranslat ion', exceed t he
scope of t his art icle.

A schematic view of the new, lagging strand daughter DNA duplex is shown below, along
with the sugar-phosphate backbone.

=========================================== Original lagging strand


deoxyribose-phosphate backbone
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Original lagging strand bases
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC After DNA repair factor
activity, the bases are adenine, thymine, cytosine, and guanine.
========|=============|============|======= After DNA repair factor
activity, the backbone is pure deoxyribose-phosphate with nicks between each Okazaki
fragment.

The finished duplex:

=========================================== Original lagging strand


deoxyribose-phosphate backbone
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Original lagging strand bases
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Newly synthesized bases
=========================================== Newly synthesized
deoxyribose-phosphate backbone without Okazaki fragments.

Replication stress

Replicat ion st ress can result in a st alled replicat ion fork. One t ype of replicat ive st ress result s
from DNA damage such as int er-st rand cross-links (ICLs). An ICL can block replicat ive fork
progression due t o failure of DNA st rand separat ion. In vert ebrat e cells, replicat ion of an ICL-
cont aining chromat in t emplat e t riggers recruit ment of more t han 90 DNA repair and genome
maint enance fact ors.[13] These fact ors include prot eins t hat perform sequent ial incisions and
homologous recombinat ion.

History
Kat herine Lemon and Alan Grossman showed using Bacillus subtilis t hat replisomes do not move
like t rains along a t rack but DNA is act ually fed t hrough a st at ionary pair of replisomes locat ed at
t he cell membrane. In t heir experiment , t he replisomes in B. subtilis were each t agged wit h green
fluorescent prot ein, and t he locat ion of t he complex was monit ored in replicat ing cells using
fluorescence microscopy. If t he replisomes moved like a t rain on a t rack, t he polymerase-GFP
prot ein would be found at different posit ions in each cell. Inst ead, however, in every replicat ing
cell, replisomes were observed as dist inct fluorescent foci locat ed at or near midcell. Cellular
DNA st ained wit h a blue fluorescent dye (DAPI) clearly occupied most of t he cyt oplasmic
space.[14]

References

1. Yao, Nina Y.; O'Donnell, Mike (2010). "SnapShot: The Replisome" ([Link]
cles/PMC4007198) . Cell. Elsevier BV. 141 (6): 1088–1088.e1. doi:10.1016/[Link].2010.05.042 (https://
[Link]/10.1016%[Link].2010.05.042) . ISSN 0092-8674 ([Link]
4) . PMC 4007198 ([Link] . PMID 20550941 (htt
ps://[Link]/20550941) .

2. Bochman ML, Schwacha A (July 2008). "The Mcm2-7 complex has in vitro helicase activity" ([Link]
org/10.1016%[Link].2008.05.020) . Mol. Cell. 31 (2): 287–93. doi:10.1016/[Link].2008.05.020
([Link] . PMID 18657510 ([Link]
v/18657510) .

3. Kelch BA, Makino DL, O'Donnell M, Kuriyan J (2012). "Clamp loader ATPases and the evolution of DNA
replication machinery" ([Link] . BMC Biol. 10: 34.
doi:10.1186/1741-7007-10-34 ([Link] . PMC 3331839 (https://
[Link]/pmc/articles/PMC3331839) . PMID 22520345 ([Link]
v/22520345) .

4. Bowman GD, O'Donnell M, Kuriyan J (June 2004). "Structural analysis of a eukaryotic sliding DNA
clamp-clamp loader complex". Nature. 429 (6993): 724–30. doi:10.1038/nature02585 ([Link]
0.1038%2Fnature02585) . PMID 15201901 ([Link] .

5. Swan MK, Johnson RE, Prakash L, Prakash S, Aggarwal AK (September 2009). "Structural basis of high-
fidelity DNA synthesis by yeast DNA polymerase delta" ([Link]
3055789) . Nat. Struct. Mol. Biol. 16 (9): 979–86. doi:10.1038/nsmb.1663 ([Link]
Fnsmb.1663) . PMC 3055789 ([Link] .
PMID 19718023 ([Link] .
6. Miyabe I, Kunkel TA, Carr AM (December 2011). "The major roles of DNA polymerases epsilon and delta
at the eukaryotic replication fork are evolutionarily conserved" ([Link]
es/PMC3228825) . PLOS Genet. 7 (12): e1002407. doi:10.1371/[Link].1002407 ([Link]
g/10.1371%[Link].1002407) . PMC 3228825 ([Link]
C3228825) . PMID 22144917 ([Link] .

7. Pursell ZF, Isoz I, Lundström EB, Johansson E, Kunkel TA (July 2007). "Yeast DNA polymerase epsilon
participates in leading-strand DNA replication" ([Link]
713) . Science. 317 (5834): 127–30. doi:10.1126/science.1144067 ([Link]
e.1144067) . PMC 2233713 ([Link] .
PMID 17615360 ([Link] .

8. Johnson SJ, Beese LS (March 2004). "Structures of mismatch replication errors observed in a DNA
polymerase" ([Link] . Cell. 116 (6): 803–16.
doi:10.1016/S0092-8674(04)00252-1 ([Link] .
PMID 15035983 ([Link] .

9. Jiricny J (March 2004). "Unfaithful DNA polymerase caught in the act" ([Link]
nt/31202/1/[Link]) (PDF). Mol. Cell. 13 (6): 768–9. doi:10.1016/S1097-2765(04)00149-2 ([Link]
g/10.1016%2FS1097-2765%2804%2900149-2) . PMID 15053870 ([Link]
053870) .

10. "Mutagenesis and DNA repair" ([Link] .


ATDBio Ltd.

11. McCarthy D, Minner C, Bernstein H, Bernstein C (1976). "DNA elongation rates and growing point
distributions of wild-type phage T4 and a DNA-delay amber mutant". J. Mol. Biol. 106 (4): 963–81.
doi:10.1016/0022-2836(76)90346-6 ([Link] .
PMID 789903 ([Link] .

12. Drake JW (1970) The Molecular Basis of Mutation. Holden-Day, San Francisco ISBN 0816224501
ISBN 978-0816224500

13. Räschle M, Smeenk G, Hansen RK, Temu T, Oka Y, Hein MY, Nagaraj N, Long DT, Walter JC, Hofmann K,
Storchova Z, Cox J, Bekker-Jensen S, Mailand N, Mann M (2015). "DNA repair. Proteomics reveals
dynamic assembly of repair complexes during bypass of DNA cross-links" ([Link]
v/pmc/articles/PMC5331883) . Science. 348 (6234): 1253671. doi:10.1126/science.1253671 (https://
[Link]/10.1126%2Fscience.1253671) . PMC 5331883 ([Link]
MC5331883) . PMID 25931565 ([Link] .

14. Foster JB, Slonczewski J (2010). Microbiology: An Evolving Science (Second ed.). New York: W. W.
Norton & Company. ISBN 978-0-393-93447-2.

Further reading
Pomerantz RT, O'Donnell M (April 2007). "Replisome mechanics: insights into a twin DNA polymerase
machine". Trends Microbiol. 15 (4): 156–64. doi:10.1016/[Link].2007.02.007 ([Link]
m.2007.02.007) . PMID 17350265 ([Link] .

External links

DNA+replisome (ht t ps://[Link]/record/ui?name=DNA%20replisome) at t he US


Nat ional Library of Medicine Medical Subject Headings (MeSH)

Retrieved from
"[Link]
title=Replisome&oldid=1087390953"


Last edited 2 hours ago by Mild Bill Hiccup

Common questions

Powered by AI

Replication stress can obstruct DNA replication processes by causing stalled replication forks, often due to DNA damages like inter-strand cross-links. In response, cells deploy a sophisticated network involving over 90 DNA repair and genome maintenance factors, which are recruited to the site of stalled forks. These factors facilitate a range of responses, including sequential incision, repair of cross-links, and homologous recombination to resolve the stall and restore replication progression . This dynamic assembly of repair complexes ensures survival and genomic integrity under conditions of replication stress .

The synchronization of leading and lagging strand synthesis at the replication fork is achieved by forming an asymmetric dimer of replicative polymerases, which allows for simultaneous replication of both strands . However, this synchronization introduces the challenge of having to synthesize the lagging strand in a direction opposite of the fork movement. Consequently, the lagging strand is synthesized discontinuously in Okazaki fragments, which are initiated only after helicase unwinds sufficient DNA . This spatial-structural solution creates the problem of having to periodically associate and disassociate polymerases with the DNA strand, making the overall process 'semidiscontinuous' .

Semidiscontinuous replication refers to the simultaneous continuous synthesis of the leading strand and the discontinuous synthesis of the lagging strand during DNA replication. While the leading strand is synthesized in a continuous 5’ to 3’ manner, the lagging strand, due to its opposite polarity, is synthesized in small, separate segments called Okazaki fragments. These fragments are initiated only when sufficient template DNA becomes available. The disconnected nature of Okazaki fragments necessitates additional processing, including primer removal, gap filling, and strand ligation, ultimately impacting the efficiency and complexity of lagging strand synthesis .

In Bacillus subtilis, experimental observations using fluorescence microscopy revealed that replisomes are stationary, as opposed to moving along the DNA. Tagged with green fluorescent proteins, replisomes were found consistently at midcell rather than moving as trains along DNA tracks . This finding challenges the previously held notion of dynamic replisome movement and suggests a model where DNA is fed through a stationary pair of replisomes. This stationary framework may aid in efficient coordination and synchronization of DNA replication activity and provide insights into optimizations of spatial constraints in cellular environments .

Asymmetrical dimerization of replicative polymerases plays a crucial role in synchronizing the synthesis of leading and lagging strands at the replication fork. This structural adaptation allows the concurrent synthesis of both strands, significantly enhancing the efficiency of replication. Though the lagging strand is synthesized discontinuously as Okazaki fragments due to antiparallel alignment, the dimerization facilitates simultaneous processing within the same replication complex. While solving the problem of strand synthesis synchronization, it necessitates complex coordination of polymerase activities, primer removal, and ligation steps, highlighting a sophisticated yet efficient evolutionary adaptation for DNA replication .

Magnesium ions play a catalytic role in the polymerization process by stabilizing the negatively charged DNA backbone and facilitating the nucleophilic attack on the phosphate backbone of the incoming nucleotides. These ions are critical in aligning the substrates correctly within the active site of the polymerase. When error in base pairing occurs, the incorrect nucleotide affects the precise positioning of magnesium ions, causing structural-chemical distortions in the polymerase. This distortion slows down the replicative process, allowing time for the 3' to 5' exonuclease activity to excise the error, thus ensuring the accuracy of DNA replication .

RNA primers provide the necessary 3' OH group required for the initiation of DNA synthesis. Following primer addition and DNA strand synthesis, these primers must be removed to ensure DNA strand continuity. This removal is efficiently executed by RNAse H, which degrades the RNA primer, followed by primer replacement with DNA by DNA polymerase I . Finally, gaps between Okazaki fragments are sealed by DNA ligase, restoring the integrity of the sugar-phosphate backbone to produce a chemically-stable, continuous DNA duplex. This process is crucial for establishing an error-free and stable DNA structure, necessary for genetic information preservation .

High-fidelity in DNA replication is achieved through the intrinsic accuracy of replicative polymerases and their associated proofreading activities. During replication, incorrect base pairing is rare due to the precise structural and chemical characteristics of polymerases. However, when mismatches occur, the error is detected and corrected by the 3' to 5' exonuclease activity present in many replicative polymerases. This domain removes incorrect nucleotides by excising the recently added mismatches, thus preserving the accuracy of the DNA replication process. Such proofreading mechanisms prevent the propagation of replication errors, critical for maintaining genomic integrity .

In prokaryotic cells, a specific enzyme called primase synthesizes an RNA primer at the beginning of both the leading and lagging strands to enable the initiation of DNA replication . In eukaryotic cells, DNA polymerase alpha performs a dual function: it creates an RNA primer and subsequently synthesizes a short DNA chain using deoxynucleotides. This provides a dual advantage of initiating replication and extending the DNA chain after primer formation .

Clamp loader and sliding clamp factors play crucial roles in DNA replication by recruiting and binding other factors, such as priming enzymes and replicative polymerases, enhancing the processivity of DNA synthesis. These factors are essential in ensuring timely replication by helping replicative polymerases remain associated with the DNA strand . Their structural conservation across diverse organisms, including bacteria, phages, yeast, and humans, underscores their fundamental importance in addressing replication challenges. The conservation has occurred despite a lack of sequence homology, indicating that their structural design is a highly effective solution for the mechanical demands of replication .

You might also like