Genetic Principles and Inheritance Patterns
Genetic Principles and Inheritance Patterns
6. In Cucurbita, W is epistatic over Y and y gene normally responsible for yellow and green colour fruits. It
produces white fruits. What is the ratio of fruits in the progeny of cross Ww Yy × wwYy ?
(A) 9 white : 7 yellow : 0 green (B) 3 white : 4 yellow : 1 green
(C) 4 white : 3 yellow : 1 green (D) 2 white : 1 yellow : 1 green.
7. A recessive trait in Garden Pea is
(A) Wrinkled seeds (B) Tall stem (C) Round seeds (D) Coloured seed coat.
8. Mendel is called father of
(A) Taxonomy (B) Genetics (C) Palaeobotany (D) Modern Physiology.
9. Which is correct about traits chosen by Mendel ?
(A) Terminal pod is dominant (B) Constricted pod is dominant
(C) Green coloured pod is dominant (D) Tall plants are recessive.
10. Tallness (T–) is dominant over dwarfness (tt) while red flower colour (R–) is dominant over white colour (rr). A
plant with genotype TtRr is crossed with plant of genotype ttrr. Percentage of progeny having tall plants with
red flowers is
(A) 25% (B) 50% (C) 75% (D) 100%
12. Mendel could not find recombination and crossing over because
(A) Traits he chose were either present on diferent chromsomes or were far apart
(B) Traits chosen by him were not influenced by genes
(C) He did not have high power microscope
(D) He selected only pure types.
16. Heterozygous tall plant is selfed. It produces both tall and dwarf plants. This confirms Mendel’s law
(A) Law of dominance (B) Law of segregation
(C) Law of independent assortment (D) Incomplete dominance.
KVPY_SX_BOTANY # 91
17. Which one is a dominant trait out of the characters chosen by Mendel
(A) Pod Colour – Yellow (B) Seed Colour – White
(C) Flower Position – Axile (D) Plant height – Dwarf.
18. R is dominant red flower trait while r is recessive white flower trait. Heterozygous red flowered plant is crossed
with homozygous red flowered plant. 64 offspring are produced. Number of white flowered plants is
(A) 64 (B) 32 (C) 16 (D) 0
24. In Pea, wrinkling of seeds is due to nonformation of starch because of the absence of an enzyme
(A) Amylase (B) Invertase (C) Branching enzyme (D) Diastase.
27. Heterozygous tall (Tt ) is crossed with homozygous tall (TT). Percentage of heteozygous tall in the progeny
would be
(A) 25% (B) 50% (C) 75% (D) 100%
28. Pleiotropic effect is found in
(A) Human skin colour (B) Night blindness (C) haemophilia (D) Sickle cell anaemia.
29. Tt × tt is
(A) Test cross (B) Back cross (C) Hybridisation (D) Reciprocal cross.
30. In sickle cell anaemia, there is change in amino acid in chain at position
(A) VI (B) VII (C) IX (D) X
31. How many types of gametes are formed by Pea plant having YYRRtt genotype
(A) 2 (B) 4 (C) 8 (D) None of the above.
32. Blood group of a couple are AB and O. The possible blood group of children would be
(A) O group only (B) AB blood group (C) A or B (D) AB and O.
33. In Mirabilis jalapa, RR, Rr and rr determine red, pink and white colour [Link] F1 hybrid of RR and
rr was crossed with dominant parent, the ratio produced is.
(A) All red (B) 1 Red : 1 Pink (C) All white (D) 2 Pink : 2 white
KVPY_SX_BOTANY # 92
34. Alleles are
(A) Alternate forms of gene (B) Pairs of sex chromosomes
(C) Homologus chromosomes (D) None of the above.
35. In quantitative inheritance F2 ratio obtained in a dihybrid cross is
(A) 1 : 4 : 6 : 4 : 1 (B) 15 : 1 (C) 12 : 3 : 1 (D) 9 : 7.
38. Out of a population of 800 individuals in F2 generation of a cross between yellow round and green wrinkled
Pea plant, what would be number of yellow and wrinkled seeded plants.
(A) 800 (B) 400 (C) 200 (D) 150.
39. Which one of the following traits of Garden Pea studied by Mendel was a recessive feature
(A) Axial flower position (B) Green seeds colour (C) Green pod colour (D) Round seed shape.
40. Two crosses between the same pair of genotypes/phenotypes in which the sources of gametes are reversed
in one cross are called
(A) Test cross (B) Reverse cross (C) Dihybrid cross (D) Reciprocal cross.
41. When a cluster of genes show linkage behaviour , they
(A) Do not show chromosome map (B) Induce cell division
(C) Do not show independent assortment (D) Show recombination during meiosis.
42. Three children in a family have blood types O, AB and B respectively . What are the genotypes of their
parents
(A) IAi and IBi (B) IAIB and ii (C) IBIB and IAIA (D) IAIA and IBi
43. Pink flowered progeny of red and white flowered parents of Antirrhinum majus is produced due to
(A) Dominance (B) Epistasis (C) Codominance (D) Incomplete dominance.
44. Multiple alleles control inheritance of
(A) Colour blindness (B) Sickle cell anaemia (C) Blood groups (D) Phenylketonuria.
49. A hybrid formed by the cross between pure tall green seeded and pure dwarf yellow seeded Pea plant is
crossed with pure dwarf green seeded plants. Number of phenotypes would be
(A) 2 (B) 4 (C) 6 (D) 8.
KVPY_SX_BOTANY # 93
51. In a plant, red fruit (R) is dominant over yellow fruit (r) and tallness (T) dominant over shortness (t) . A plant
with RRTt genotype is crossed with plant of rrtt genotype. The progeny is
(A) All red fruit, tall 25% (B) All red fruit, tall 50%
(C) All red fruit and tall 75% (D) All red fruit and tall.
52. A person with blood groups A possesses
(A) Antigen A and antibody B (B) Antigen B and antibody a
(C) Antigen A and antibody b (D) No antigen and no antibody.
53. How many type of gametes are found in F1 progeny of cross between AABBCC and aabbcc
(A) 3 (B) 8 (C) 27 (D) 64.
54. B-blood group man marries A blood group woman. The first child has B-blood group. Genotype of the child is
(A) IAIO (B) IBIO (C) IAIB (D) IBIB
55. Children of a father with ‘O’ blood group and mother of AB blood group could have blood group
(A) O (B) AB (C) O or AB (D) A or B.
56. Height in humans is
(A) Somatogenic variation (B) Discontinuous variation
(C) Continuous variation (D) Both 1 and 3
57. Multiple alleles represents.
(A) More than two alternate forms of gene found at same locus
(B) More than two alternate forms of a gene found at different loci
(C) Occurrence of one gene in two chromosomes
(D) None of the above.
58. Number of genotypes produced when individuals of genotype ‘YyRrTt’ are crossed with each other
(A) 4 (B) 45 (C) 28 (D) 27
59. Independent assortment can be deduced from
(A) Monohybrid cross (B) Test cross (C) Back cross (D) Dihybird cros.
60. Which trait was not incorporated by Mendel for his experiments ?
(A) Colour of Pea seed (B) Colour of Pea flower
(C) Colour of Pea plant (D) Colour of Pea pod.
61. Incomplete dominance was discovered by
(A) Correns (B) Mendel (C) Johannsen (D) Bateson.
62. Which blood group can safely be transfused in emergency when there is no time to analyse the blood group
of recipient ?
(A) O and Rh — (B) O and Rh + (C) B and Rh— (D) AB and Rh +
63. For finding the different types of gametes produced by genotype AaBb, it should be crossed with
genotype
(A) AABB (B) aabb (C) AaBb (D) aaBB.
64. Grain colour of wheat is determined by three pairs of polygenes. What proportion of F2 progeny will resemble
either parents following a cross of AABBCC (dark colour) with aabbcc (light colour).
(A) None (B) Half (C) Less than 5% (D) One third.
65. In Pisum sativum there are 14 chromosomes. How many pairs with different chromosomal composition can
be prepared.
(A) 214 (B) 27 (C) 7 (D) 14.
66. Pure tall plant is crossed to dwarf plant F1 generation has only tall plants while F2 generation has both tall and
dwarf in ratio of 3 : 1. The phenomenon is due to
(A) Dominance (B) Codominance
(C) Incomplete dominance (D) Heredity.
67. A baby of blood group A cannot belong to parents of blood group
(A) Husband O, wife AB (B) Husband A, wife B
(C) Husband B, wife O (D) Husband AB, wife A
KVPY_SX_BOTANY # 94
68. Cross between homozygous black rough (BBRR) guinea pig and homozgous white smooth guinea pig (bbrr)
produced black and rough animals in F1 generation. Presuming the genes to be present ondifferent
chromosomes, the percentage of F2 individuals which are heterozygous for both the gene pairs would be
(A) 25% (B) 35% (C) 50% (D) 75%
69. Phenotype of an organism is the result to
(A) Mutations and linkages (B) Genotype and environment interactions
(C) Cytoplasmic effects and nutrition (D) Environmental changes and sexaul dimorphism.
70. In Mendel’s experiments with Garden Pea, round seed shape (RR) was dominant over wrinkled seeds (rr),
yellow cotyledons (YY) was dominant over green cotyledons (yy) What are expected phenotypes in F2
generation of RRYY x rryy ?
(A) Only wrinkled seeds with green cotyledons
(B) Only wrinkled seeds with yellow cotyledons
(C) Only round seeds with green cotyledons
(D) Round seeds with yellow cotyledons and wrinkled seeds with green cotyedons.
71. Test cross involves
(A) Crossing between two genotypes with dominant trait
(B) Crossing between two genotypes with recessive trait
(C) Crossing the F1 hybrid with double recessive genotype
(D) Crossing between two F1 hybrids.
72. Which pair of features represents polygenic inheritance?
(A) Human eye colour and sickle cell anaemia
(B) Hair pigment of mouse and tongue rolling in humans
(C) ABO blood groups in humans and flower colour of Mirabilis jalapa
(D) Human height and skin colour.
73. Mating of an organism to double recessive for determining homozygosity or heterozygosity is called
(A) Reciprocal cross (B) Back cross (C) Dihybrid cross (D) Test cross.
74. A test cross is performed
(A) By selfing of F2 generation plants
(B) By selfing of F1 generation plants
(C) To determine whether F1 plants are Homozygous or Heterozygous
(D) Between homozygous plants
75. Possible blood groups of children born to parents having A and AB groups are
(A) O, A (B) A,B, AB (C) O,A,B (D) O,A,B, AB.
76. When pure long plant having white flower is crossed with pure dwarf plant having red flower, the dwarf progeny
in F2 generation will be
(A) 1 / 16 (B) 2 / 16 (C) 4 / 16 (D) 9 / 16
77. Which of the following is correct for dihybrid cross ?
(A) 1 YYRR, 2YyRR, 2yyRr, 4 YyRr (B) 1 YYRR, 3YyRR, 2yyRr, 3 YyRr
(C) 3 YYRR, 3YyRR, 2yyRr, 4YyRr (D) 3 YYRR, 1YyRR, 2yyRr, 3 YyRr
78. Match the genetic phenomena with their respective ratios
a Inhibitory gene ratio 1 9:3:4
b Complementary gene ratio 2 1:1:1:1
c Recessive test cross ratio 3 12 : 3 : 1
d Dihybrid test cross ratio 4 13 : 3
e Dominant epistasis ratio 5 9:7
(A) a – 5, b – 4, c – 3, d –2, e – 1 (B) a – 4, b – 5, c – 1, d –2, e – 3
(C) a – 1, b – 2, c – 4, d –3, e – 5 (D) a – 2, b – 1, c – 4, d –5, e – 3
79. A tall pea plant with round seeds (TTRR) is crossed with a dwarf wrinkle seeded plant (ttrr). F1 has tall plants
with rounded seeds. What is the proportion of dwarf plants with wrinkled seeds in F2 generation
(A) Zero (B) 1/2 (C) 1/4 (D) 1/16
80. The number of phenotypes in ABO blood groups is
(A) 1 (B) 4 (C) 6 (D) 8.
KVPY_SX_BOTANY # 95
81. Mendel’s experimental material was
(A) Drosophila melanogaster (B) Homo sapiens
(C) Pisum sativum (D) Antirrhinum majus.
82. The offspring of AA bb × aa BB is crossed with, aabb. The genotypic ratio of progeny will be
(A) 9 : 3 : 3 : 1 (B) 1 : 2 : 1 (C) 1 : 1 : 1 : 1 (D) 4 : 1
84. When heterozygous red flowered plant is crossed with white flowered plant the progeny will show ratio of
(A) 350 red : 350 white (B) 450 red : 250 white (C) 380 red : 220 white (D) None of the above.
85. Genotype of hybrid is known by crossing
(A) F2 progeny with female parent (B) F1 × F1
(C) Crossing F1 with recessive parent (D) F2 with recessive parent.
86. In pea, yellow seed colour is dominant over green colour . Heterozygous yellow seeded plant is crossed with
green seeded plant. The ratio of yellow & green seeded offspring will be
(A) 9 : 1 (B) 1 : 3 (C) 3 : 1 (D) 50 : 50
87. A human male produce diallelic sperms in equal proportion AB, Ab, aB and ab. The genotype of the person
would be
(A) Aa Bb (B) Aa BB (C) AA Bb (D) AA BB.
88. In a given plant, red colour (R) of fruits is dominant over white fruit (r) ; and tallness (T) is dominant over
dwarfness (t). If a plant with genotype RRTt is crossed with a plant of genotypes rrtt, what will be the
percentage of tall plants with red fruits in the next generation?
(A) 100% (B) 75% (C) 50% (D) 25%
89. Grain colour in wheat is determined by three pairs of polygenes. Following the cross AABBCC (dark colour)
X aa bb cc (light colour), in F2 generation what proportion of progeny is likely to resemble either parent?
(A) One third (B) Half
(C) Less than 5 percent (D) None of the above
90. Which one of the following characters studied by Mendel in graden pea was found to be dominant ?
(A) Green seed colour (B) Terminal flower
(C) Green pod colour (D) Wrinkled seed.
93. The gene which masks the effect of another gene is called.
(A) Epistatic (B) Multiple allele
(C) Lethal gene (D) Complementary gene.
KVPY_SX_BOTANY # 96
97. How many combination of gametes will be produced by an organism with AaBBCc genotypes ?
(A) 3 (B) 4 (C) 9 (D) 6
98. Which of the following pair of features is a good example of polygenic inheritance
(A) Hair pigment of mouse and tongue rolling in humans
(B) Human height and skin colour
(C) human eye colour and sickle cell anaemia
(D) ABO blood group in humans and flower colour of Mirabilis jalapa.
101. When a dihybrid cross is fit into a punnett square with 16 boxes, the maximum number of different
phenotypes available are
(A) 8 (B) 4 (C) 2 (D) 16
102. The most popularly known blood grouping is the ABO grouping . It is named ABO and not ABC, because”
O” in it refers to having:
(A) No anitgens A and B on RBCs
(B) other antigens besides A and B on RBCs
(C) overdominance of this types on the genes for A and B types
(D) one antibody only - either anti- A or anit B on the RBCs
103. Which one of the following cannot be explained on the basis of Mendel’s Law of Dominance
(A) Out of one pair of factors one is dominant and the other recessive
(B) Alleles do not show any blending and both the characters recover as such in F2 generation.
(C) Factors occur in pairs
(D) The discrete unit controlling a particular character is called a factor
104. ABO blood groups in humans are controlled by the gene I. It has three alleles -IA,IB and i. Since there are
three different alleles, six different genotypes are possible. How many phenotypes can occur.
(A) One (B) Four (C) Two (D) Three
105. A person with unknown blood group under ABO system, has suffered much blood loss in an accident and
needs immediate blood transfusion. His one friend who has a valid certificate of his own blood type. offers
blood donation without delay. What would have been the type of blood group of the donor friend.
(A) Type B (B) Type AB (C) Type O (D) Type A
KVPY_SX_BOTANY # 97
108. In Drosophila, during organ differentiation, one organ can be replaced by another like wings by legs. Genes
responsible for it are.
(A) Plastid genes (B) Homeotic genes
(C) Complementary genes (D) Supplementary genes.
109. Albinism and phenylketonuria are disorders due to
(A) Recessive autosomal genes (B) Dominant atuosomal genes
(C) Dominant sex genes (D) Recessive sex genes.
110. A woman has a child with Klinefelter’s syndrome. Number of barr bodies present in the child is
(A) One (B) Two (C) Three (D) None.
111. Number of Nucleosomes found in helical coil of 30 nm chromatin fibre is
(A) 6 (B) 10 (C) 12 (D) 15
112. Presence of recessive trait is 16%. The frequency of dominant allele in populations is
(A) 0·6 (B) 0·32 (C) 0·84 (D) 0·92
113. Strength of linkage is related inversely to distance between .
(A) Genes (B) Chromatids (C) Chromosomes (D) Telomeres.
114. A disease sometimes found in persons above 40 which is characterised by poor CNS coordination,
forgetfullness and tremor of hands is
(A) Epilepsy (B) Alzheimer’s disease (C) Migraine (D) Schizophrenia.
115. A boy with normal brother and colourblind sister has his parents
(A) Father normal, mother colourblind
(B) Both normal
(C) Both colourblind
(D) Father colourblind, mother normal.
116. Deficiency of VIII factor leads to
(A) Haemophilia A (B) Haemophilia B (C) Haemophilia C (D) Haemophilia D.
117. Polydactyly in man is due to
(A) Autosomal recessive allele (B) Autosomal dominant allele
(C) Sex linked recessive allele (D) Sex linked dominant allele.
118. As per Lyon’s hypothesis, one of the two X- chromosomes undergoes heterochromatisation and is called.
(A) Barr body (B) karyotypic body (C) Genotypic body (D) Phenotypic body.
119. Which one brings about point mutation?
(A) 5-methyl cytosine (B) Guanine (C) Adenine (D) 5-Bromouracil.
120. Frequency of recessive allele is 0·2 What is the frequency of homozygous dominant
(A) 0·64 (B) 0·32 (C) 0·8 (D) 0·064
121. One of the following is holandric inheritance
(A) Haemphilia (B) Epidermolysis (C) Webbed toes (D) Turner’s syndrome.
KVPY_SX_BOTANY # 98
126. A diseased man marries a normal woman. The couple has 3 daughters and 5 sons. The daughters are
diseased while the sons are normal. The gene of the disease is
(A) Sex-linked recessive (B) Sex linked dominant
(C) Autosomal character (D) Sex limited character.
127. Linkage map of X-chromosome of fruitfly has 66 map units with yellow body gene(y) at one end bobbed hair
(b) at the other. The recombination frequency between y an b gene would be
(A) 66% (B) > 50% (C) 50% (D) 100%
128. Pattern baldness, moustaches and beard in human males are examples of
(A) Sex- linked traits (B) Sex differentiating traits
(C) Sex limited traits (D) Sex determining traits.
129. A harmful condition which is also a potential saviour form a mosquito borne infectious disease
(A) Thalassemia (B) Sickle cell anaemia (C) Leukemia (D) Pernicious anaemia.
130. Genetic map is one that
(A) Establishes sites of the gene on a chromosome
(B) Establishes the various stages in gene evolution
(C) Shows the stages during cell division
(D) Shows distribution of various species in a region.
131. One of the genes present exclusively on the X-chromosome in humans is concerned with
(A) Baldness (B) Red-green colourblindness
(C) Facial hair / moustaches in males (D) Night blindness.
132. The ‘Christmas disease’ patient lacks antihaemophilic
(A) Homogentisic acid oxidase (B) Factor VIII
(C) Factor XI (D) Factor IX.
133. Ishiara charts are used by opthalamologists for detecting
(A) Eye infection (B) Night blindness (C) Colour blindness (D) Finger prints.
134. haemophilia does not occur in women because
(A) It is autosomal recessive (B) Women have to be homozygous which is fatal
(C) They have only one X-chromosome (D) They are more resistant to this disorder.
135. Albinism is due to herditary deficiency of enzyme.
(A) Amylase (B) Carbonic anhydrase
(C) Acetyl choline esterase (D) Tyrosinase.
136. In Melandrium, sex determination is of
(A) XX – XO (B) ZZ – ZW (C) XX – XY (D) XY – XO
137. Presence of one Barr body in WBC indicates that the person is
(A) Colour blind (B) Normal male (C) Normal female (D) Haemophilic.
138. Mode of inheritance of haemophilia resembles that of
(A) Myopia (B) Skin colour (C) Colour blindness (D) Night blindness.
139. Tay Sach’s disease is due to
(A) Sex-linked recessive gene (B) Sex -linked dominant gene
(C) Autosomal dominant gene (D) Autosomal recessive gene.
140. Chromsomal doubling for producing polyploid plants is carried out by
(A) PEG (B) NAA (C) EMS (D) Colchicine.
141. A man and woman, both having colour blind fathers, marry, Probability of their first daughter being colour
blind is
(A) 100% (B) 50% (C) 25% (D) 0%
142. Number of linkage groups in Pisum sativum is
(A) 4 (B) 5 (C) 7 (D) 10
143. The male has a mutation in his mitochondria. During segregation, the mutation is found in
(A) None of the progeny (B) One third of progeny
(C) Half of progeny (D) Whole of progeny
KVPY_SX_BOTANY # 99
144. Lack of independent assortment between two genes A and B would be due to
(A) Crossing over (B) Linkage (C) Repulsion (D) Recombination.
145. Recessive gene present on one X- chromosome of humans will be
(A) Lethal (B) Sublethal
(C) Expressed in males (D) Expressed in females.
146. A mutation at a gene locus changes a character due to change in
(A) DNA replication (B) Protein synthesis pattern
(C) RNA transcription pattern (D) Protein structure
147. A normal woman whose father was colour blind is married to normal visioned man. Their sons would be
(A) 75% colour blind (B) 50% colour blind (C) 100% colour blind (D) All normal.
150. Number of Barr bodies in human female suffering from Down’s syndrome would be
(A) 3 (B) 1 (C) 2 (D) zero
KVPY_SX_BOTANY # 100
158. Given in the figure is chromosome mutation. It is
KVPY_SX_BOTANY # 101
173. Given below is a pedigree chart with symbols for sex-linked trait in humans.
KVPY_SX_BOTANY # 102
184. Given below is a highly simplified representation of the human sex chromosomes from a karyotype. The
genes a and b could be of
(A) Colour blindness and body height (B) Attached earlobe and Rhesus blood group
(C) Haemophilia and red green colour blindness (D) Phenylketonuria and haemophilia
185. Genes present in the cytoplasm of eukaryotic cells are found in
(A) Mitochondria and inherited via egg cytoplasm (B) Lysosomes and peroxisomes
(C) Golgi body and ER (D) Plastids and inherited via male gametes.
186. Which represents correct hexaploid nature of Wheat
Monosomic haploid Nullisomic Trisomic
(A) 12 28 42 43
(B) 7 28 40 42
(C) 21 7 42 43
(D) 41 21 40 43
187. Accumulation of protein, amyloid - peptide, in human brain causes
(A) Addison’s disease (B) Huntington’s disease
(C) Alzheimer’s disease (D) Parkinson’s disease
188. Lampbrush chromosomes occur inside
(A) Nucleus of man (B) Oocytes of Frog
(C) Salivary glands of Silkmoth (D) Salivary glands of Drosophila
189. Down’s syndrome is due to nondisjunction of
(A) X-chromosome (B) Y-chromosome
(C) Autosome (D) Second chromosome of Drosophila
190. The gene for cystic fibrosis is located over chromosome
(A) 4 (B) 7 (C) 11 (D) 12.
191. Drosopohila is metamale with chromosomal formulation.
(A) 2A + 3X (B) 3A + 3X (C) 4A + 3X (D) 3A + XY
192. Match the columns
[Link]. I II
1. Sickle cell anaemia a 7th chromosome
2. Phenylketonuria b 4th chromosome
3. Cystic fibrosis c 11th chromosome
4. Huntington’s disease d X-chromosome
5. Colour blindness e 12th chromosome
(A) 1 – a, 2 – c, 3 – d, 4– b, 5 – e (B) 1 – c, 2 – e, 3 – a, 4– b, 5 – d
(C) 1 – b, 2 – c, 3 – d, 4– e, 5 – a (D) 1 – b, 2 – a, 3 – c, 4– e, 5 – d
193. Down’s syndrome and Turner’s syndrome are due to respectively
(A) Monosomic and nullisomic conditions (B) Trisomic and monosomic conditions
(C) Trisomic and tertrasomic conditions (D) Trisomic and tetrasomic conditions
194. Number of chromosomes in male grasshopper is
(A) 8 (B) 45 (C) 46 (D) 23
195. Epicanthus skin fold above the eyes and transverse palmer crease are typical symptoms of
(A) Cri-du-chat (B) Klinefelter’s syndrome
(C) Down’s syndrome (D) Turner’s syndrome.
KVPY_SX_BOTANY # 103
196. Longest chromosomes occur in
(A) Lilium (B) Zea mays (C) Allium (D) Trillium.
199. R and Y genes of Maize lie very close to each other. When RRYY and rryy genotype are hybridised, F2
generation will show
(A) Sagregation in 9: 3 : 3 : 1 ratio (B) Sagregation is 3 : 1 ratio
(C) Higher number of parental types (D) Higher number of recombinant types
201. Down’s syndrome is caused by an extra copy of chromosome number 21. What percentage of offspring
produced by an affected mother and a normal father would be affected by this disorder
(A) 25% (B) 50% (C) 75% (D) 100%
202. Drosophila flies with XXY genotype are females, but human beings with such genotype are abnormal males.
It shows that
(A) Y-chromosome is essential for sex determination of drosophila
(B) Y-chromosome is female determining in Drosophila
(C) Y-chromosome is male determining in human beings
(D) Y-chromosome has no role in sex detrmination either in Drosophila or human beings
203. Genes when close together on a chromosome it is called.
(A) Mutation (B) Linkage (C) Translation (D) Transcription
204. In human beings 45 chromosomes/single X/XO abnormality causes
(A) Down’s syndrome (B) Turner’s syndrome
(C) Klinefelter’s syndrome (D) Edward’s syndrome.
205. A normal woman whose father was colourblind person is married to a normal man. Her sons would likely to be
(A) 75% colour blind (B) 50% colour blind (C) All normal (D) All colourblind.
206. Which one of the following conditions in humans is correctly matched with its chromosomal abnormality /
linkage ?
(A) Erythroblastosis foetalis – X- linked
(B) Down’s syndrome – 44 autosomes + XO
(C) Klinefelter’s syndrome – 44 autosomes + XXY
(D) Colour blindness – Y-linked
KVPY_SX_BOTANY # 104
207. The absence of which clotting factor leads to haemophia A
(A) Factor VII (B) Factor VIII (C) Factor IX (D) Factor X.
208. A normal woman whose father was colour blind, is married to a normal man. The sons would be
(A) 75% colourblind (B) 50% colourblind (C) All colourblind (D) All normal
210. Match the human genetic disorder with the causative abnormal chomosome
(a) Sickle cell anaemia 1. Sex linked (X-chromosome)
(b) Colour blindness 2. Autosomal chromosome 7
(c) Phenylketonuria 3. Autosomal chromosome 11
(d) Cystic fibrosis 4. Autosomal chromosome 4
(e) Huntington’s disease 5. Autosomal chromosome 12
(A) a-3, b-5, c-1, d-2, e-4 (B) a-5, b-1, c-2, d-3, e-4
(C) a-4, b-1, c-5, d-2, e-3 (D) a-3, b-1, c-5, d-2, e-4
211. Gynaecomastia is a symptom of
(A) Down’s syndrome (B) Klinefelter’s syndrome
(C) Turner’s syndrome (D) Alzheimer’s disease
212. Both sickle cell anaemia and Huntingtion’s chorea are
(A) Congenital disorders (B) Pollutant induced disorders
(C) Bacteria-related diseases (D) Virus-related disorders.
213. Point mutation involves
(A) Deletion (B) Insertion
(C) Change in single base pair (D) Duplication
214. Study the pedigree chart given below
216. Which one of the following conditions correctly describes the manner of determining the sex in the given
example
(A) Homozygous sex chromosomes (ZZ) determine female sex in Birds .
(B) XO type of sex chromosomes determine male sex in grasshopper
(C) XO condition in human as found in Turner Syndrome, determines female sex.
(D) Homozygous sex chromosomes (XX) produce male in Drosophila.
KVPY_SX_BOTANY # 105
EXERCISE
101 (B) 102 (A) 103 (B) 104 (B) 105 (C)
106 (A) 107 (D) 108 (B) 109 (A) 110 (A)
111 (A) 112 (A) 113 (A) 114 (B) 115 (D)
116 (A) 117 (B) 118 (A) 119 (D) 120 (A)
KVPY_SX_BOTANY # 106
121 (C) 122 (D) 123 (A) 124 (D) 125 (C)
126 (B) 127 (C) 128 (C) 129 (B) 130 (A)
131 (B) 132 (D) 133 (C) 134 (B) 135 (D)
136 (C) 137 (C) 138 (C) 139 (D) 140 (D)
141 (D) 142 (C) 143 (A) 144 (B) 145 (C)
146 (D) 147 (B) 148 (B) 149 (A) 150 (B)
151 (C) 152 (B) 153 (D) 154 (B) 155 (B)
156 (D) 157 (D) 158 (B) 159 (C) 160 (C)
161 (D) 162 (B) 163 (A) 164 (D) 165 (B)
166 (A) 167 (D) 168 (C) 169 (D) 170 (B)
171 (A) 172 (C) 173 (D) 174 (C) 175 (A)
176 (B) 177 (D) 178 (A) 179 (C) 180 (D)
181 (D) 182 (B) 183 (C) 184 (C) 185 (A)
186 (D) 187 (C) 188 (B) 189 (C) 190 (B)
191 (D) 192 (B) 193 (B) 194 (D) 195 (C)
196 (D) 197 (A) 198 (A) 199 (C) 200 (D)
201 (B) 202 (C) 203 (B) 204 (B) 205 (B)
206 (C) 207 (B) 208 (B) 209 (A) 210 (D)
211 (B) 212 (A) 213 (C) 214 (C) 215 (D)
216 (B)
EXERCISE
MOLECULAR BASIS OF INHERITANCE
1. Which is true according to Chargaff’s rule
AT
(A) A + G = T + C (B) A = C (C) G = T (D) =1
CG
2. tRNA takes part in
(A) Transfer of genetic code to cytoplasm (B) Carry amino acids to ribosomes
(C) Collection of RNA in ribosome (D) Copy the genetic code from DNA in nucleus.
3. RNA code for DNA codon ATG will be
(A) ATG (B) AUG (C) UAC (D) TAC
4. Intron is part of DNA which
(A) Codes for protein synthesis (B) Helps in joining pieces of DNA
(C) Does not code for protein synthesis (D) Initiates transcription.
5. In operon model, regulator gene function as
(A) Repressor (B) Regulator (C) Inhibitor (D) All the above
KVPY_SX_BOTANY # 107
6. Reverse transcriptase
(A) Disintegrates host DNA (B) Polymerises host DNA
(C) Translates host DNA (D) Transcribes viral RNA to c DNA
7. Operon contains
(A) Operator and regulator genes
(B) Operator and structural gene
(C) Operator and regulator genes repressor
(D) Operator gene, regulator gene repressor, structural genes and promoter gene.
KVPY_SX_BOTANY # 108
20. Proteins are synthesised by the process
(A) Transcription (B) Translation (C) Transduction (D) Translocation.
21. Correct sequence of code transfer during polypeptide formation is
(A) DNA, mRNA, tRNA and amino acids (B) DNA, tRNA, rDNA and mRNA
(C) mRNA, tRNA, DNA and amino acids (D) rRNA, DNA, mRNA and tRNA.
22. Length of one coil of B-DNA helix is
(A) 0·34 nm (B) 3·4 nm (C) 10 nm (D) 20 nm
23. Three dimensional shape of tRNA is
(A) L-shaped (B) Clover leaf-like (C) X-shaped (D) Y- shaped.
24. Similarity between DNA and RNA is that both have
(A) Similar sugars (B) Similar mode of replication
(C) Similar pyrimidines (D) Polymers of nucleotides.
25. Formation of mRNA over DNA template is called
(A) Translation (B) Transcription
(C) Reverse transcription (D) Transduction.
26. Best method to determine parternity is
(A) Protein analysis (B) Chromosome counting
(C) Gene counting (D) DNA finger printing.
27. Enzyme that catalyses union of DNA fragments is
(A) Ligase (B) Polymerase (C) Helicase (D) Endonuclease
28. Codon AUG specifies
(A) Methionine (B) Valine (C) Tyrosine (D) Phenylalanine
29. Enzyme required for peptide formation is
(A) Peptidase (B) Peptidyl transferase (C) Protease (D) Nitrate reductase
(5) Nitrogenase.
30. Extrachromosomal DNA is present in
(A) Nucleus (B) Glyoxysome (C) Ribosome (D) Chloroplast.
31. Which one codes for an amino acid
(A) Cistron (B) Exon (C) Intron (D) Codon.
32. Okazaki fragments are
(A) RNA primers (B) Short DNA fragments on leading strand
(C) Short DNA fragements on lagging strand (D) DNA fragements from dimerisation
33. Heat killed pathogenic NL cells and live nonpathogenic cells are mixed and injected into mice. The result
would be
(A) Mice develop disease and die (B) Mice die without developing disease
(C) Mice remain healthy (D) 50% mice develop disease and die
KVPY_SX_BOTANY # 109
39. Frame shift mutation occurs when
(A) Base is deleted or added (B) Base is added
(C) Base is deleted (D) Anticodons are not present.
40. Which of the following causes point mutation
(A) Deletion (B) Inversion (C) Transition (D) All the above
41. Repressor binds to operator of lac operon
(A) Lactose is unable to remove the repressor (B) RNA polymerase is activated
(C) Galactosidase does not act on lactose (D) Structural genes X, Y and Z fail to transcribe.
42. Jacob and Mond proposed operon concept on the basis of their study of lactose metabolism in Escherichia
coli. The concept is applicable to
(A) All prokaryotes only
(B) All prokaryotes and some eukaryotes
(C) All prokaryotes and all eukaryotes
(D) All prokaryotes and some protozoans
43. First transformation experiment on bacteria was performed on
(A) Escherichia coli (B) Salmonella typhimurium
(C) Pasteurella pestis (D) Diplococcus pneumoniae.
44. Enzyme catalysing peptide formation in located in
(A) Smaller subunit of ribosome (B) Larger subunit of ribosome
(C) Central part of tRNA (D) None of the above.
45. Diameter of DNA double helix is
(A) 34 Å (B) 20 Å (C) 3·4 Å (D) 340 Å
46. Wobble hypothesis was proposed by
(A) Holley (B) Nirenberg (C) Khorana (D) Crick.
47. Which is important for transcription
(A) CAAT Box (B) Promoter (C) DNA polymerase (D) DNA methylase
48. Chargaff’s rules are applicable to
(A) Single stranded RNA (B) Single stranded DNA and RNA
(C) Single stranded DNA (D) Double stranded DNA.
49. Who was awarded Nobel Prize for in vitro synthesis of polyribonucleotides
(A) Kornberg (B) Tatum (C) Ochoa (D) Khorana.
50. What is correct
(A) mRNA is polycistronic in eukaryotes and moncistronic in prokaryotes
(B) mRNA is polycistronic in both eukaryotes and prokaryotes
(C) mRNA is monocistronic in both eukaryotes and prokaryotes
(D) mRNA is polycistronic in prokaryotes and monocistronic in eukaryotes.
52. Out of 64 codons, 61 codes are for 20 types of amino acids. It is due to
(A) Overlapping genes (B) Degeneracy of genetic code
(C) Wobbling of codons (D) Universality of codons.
KVPY_SX_BOTANY # 110
55. DNA molecule has small units called
(A) Purines (B) Adenine and thymine
(C) Cistron, Muton and Recon (D) Adenine.
56 In eukaryotes transcription occurs in
(A) Cytoplasm (B) Nucleus (C) Cytosol (D) Matrix.
57. Which one is correctly matched with its specificity for an amino acid, start or stop in protein synthesis
(A) UCG – start (B) UUU – stop (C) UGU – Leucine (D) UAC – Tyrosine.
58. A gene encoding for polypeptide of 50 amino acids get mutated at 25 codon UAU becoming UAA. The
result would be
(A) Polypeptide of 24 amino acid
(B) Two polypeptides one with 24 amino acids and second with 25 amino acids
(C) A polypeptide with 49 amino acid
(D) A polypeptide of 25 amino acids.
59. During transcription, RNA polymerase binds to DNA site
(A) Regulator (B) Promoter (C) Enhancer (D) Receptor.
60. Degeneration of genetic code is due to
(A) First member of codons (B)Second member of codons
(C) Third member of codons (D) Entire codons.
61. What does lac refer to in lac operon
(A) Lactase (B) 1,00,000 (C) Lac insect (D) Lactose
62. During translation, initiation in prokaryotes GTP is required for
(A) Formation of formyl met - tRNA
(B) Binding of 30 S subunit of ribosome with mRNA
(C) Association of 30S - mRNA with formyl - met - tRNA
(D) Association of 50 S subunit of ribosome with initiation complex.
63. In genetic code dictionary, codons used to code for all the 20 essential amino acids are
(A) 20 (B) 60 (C) 61 (D) 64
64. Which of the following is the Pribnow box
(A) 5’ TATAAT3’ (B) 5’ TAATTA3’ (C) 5’ AATAAT3’ (D) 5’ATATTA’3.
65. What is true of tRNA
(A) It binds with an amino acid at its 3’ end
(B) It has five double stranded regions
(C) It has a codon at one end which recognises anticodon of mRNA
(D) It looks like clover leaf in 3-dimensional structure.
66. Which one represents the correct manner of DNA replication
67. Which one of the following codons codes for the same information as UGC
(A) UGU (B) UGA (C) UAG (D) UGG.
68. Who discovered genetic code
(A) Nirenberg (B) Khorana (C) Ochoa (D) Crick.
69. Who discovered jumping gene in Maize
(A) Khorana (B) Morgan (C) McClintock (D) Beadle and Tatum.
KVPY_SX_BOTANY # 111
70. Genes are organised over
(A) Chromosome (B) Chromonema (C) Lysosome (D) Golgi body.
71. Find out the correct matching
a Helicase i Joining of nucleotides
b Gyrase ii Opening of DNA
c Primase iii Unwinding of DNA
d DNA polymerase III iv RNA priming.
(A) a – ii, b – iii, c – iv, d – i (B) a – i, b – ii, c – iii, d – iv
(C) a – iv, b – iii, c – i, d – ii (D) a – ii, b – iv, c – iii, d – i
72. Watson and Crick shared the Nobel Prize for DNA structure with
(A) Franklin (B) Pauling (C) Wilkins (D) Tatum.
73. DNA was proved to be genetic material through experiment of
(A) Transduction (B) Replica experiment
(C) Viral infection of Tobacco (D) Transformation
74. DNA and RNA differs by
(A) Nitrogen bases and sugars (B) Nitrogen bases and phosphate groups
(C) Number of C- atoms in sugars (D) Sugar and phosphate groups
75. Break through of the year 2002 is
(A) mRNA (B) cDNA (C) miRNA (D) rDNA
76. Which one is joining or repair enzyme
(A) DNA kinase (B) DNA ligase (C) DNA polymerase (D) Transcriptase.
77. cDNA is formed by
(A) DNA dependent DNA polymerase (B) RNA dependent DNA polymerase
(C) DNA dependent RNA polymerase (D) DNA ligase
78. In gene mutation, adenine is replaced by guanine. It is
(A) Frame-shift mutation (B) Transcription
(C) Transition (D) Transversion
79. The ratio constant for a species is
(A) A + G/C + T (B) T + C/G + A (C) A + C/T + G (D) G + C/A + T
80. In bacterial DNA replication, synthesis starting from the site of origin of replication.
(A) Involves RNA primers (B) Requires telomerase
(C) Proceeds unidirectionally (D) Moves bidirectionally
81. Telomere of eucaryotic chromosome possesses short segments of
(A) Guanine rich repeats (B) Thymine rich repeats
(C) Cytosine rich repeats (D) Adenine rich repeats.
82. Length of DNA with 23 base pairs is
(A) 78·4 Å (B) 78·2 Å (C) 78 Å (D) 74 ·8 Å
83. The function of promoter in lac-operon is to
(A) Bind to gyrase (B) Bind to RNA polymerase
(C) Code for DNA polymerse (D) Process mRNA.
84. Find the correct match
(A) UUA – Valine (B) AUG – Cysteine (C) AAA – Lysine (D) CCC– Alanine.
85. DNA finger printing is related to
(A) Molecular analysis of profiles of DNA samples
(B) Analysis of DNA samples using imprinting devices
(C) Techniques used for molecular analysis of different specimens of DNA
(D) Techniques used in identification of finger prints of different persons.
86. A nutritionally wild type organism which does not require additional biochemicals is
(A) Prototroph (B) Auxotroph (C) Phenotype (D) Autotroph.
KVPY_SX_BOTANY # 112
87. On which organism Beadle and Tatum worked to porpose one gene-one enzyme hypothesis
(A) Drosophila (B) Escherichia coli (C) Neurospora crassa (D) Nostoc.
88. In lac-operon, repressor protein binds to
(A) Regulator gene (B) Operator gene (C) Promoter gene (D) Structural gene.
89. – CCA 3’ end of t-RNA is called
(A) Anticodon loop (B) DHU loop (C) TC (D) Amino acid binding site
90. Main function of mRNA is
(A) Acting as template for RNA (B) DNA synthesis
(C) Protein synthesis (D) Conversion of DNA to RNA
91. Portion of gene which is transcribed but not translated is
(A) Exon (B) Intron (C) Cistron (D) Codon.
92. cDNA is copied from mRNA molecule with the help of
(A) Restriction enzyme (B) Reverse transcriptase
(C) DNA polymerase (D) Adenosine deaminase.
93. Haploid and monoploid numbers of chromosomes of hexaploid Wheat are
(A) 21 and 42 (B) 7 and 21 (C) 21 and 7 (D) 42 and 21
94. Mode of DNA replication in Escherichia coli is
(A) Conservative and unidirectional (B) Semiconservative and unidirectional
(C) Conservative and bidirectional (D) Semiconservative and bidirectional.
95. Which one is wrong ?
(A) DNA cannot produce its copies without DNA polymermase
(B) DNA cannot produce RNA
(C) RNA produces complementary DNA
(D) DNA helps in protein synthesis.
96. Denaturation of DNA after heating can be studied by comparing
(A) Number of nucleotides (B) A : T ratio
(C) C : G ratio (D) Sugar p hosphate ratio.
97. Supercoiled DNA occurs in
(A) Prokaryotes and eukaryotes (B) Prokaryotes only
(C) Eukaryotes only (D) None of these
98. The bond formed between phosphate and pentose sugars of DNA is
(A) Sulphide bond (B) Phosphodiester bond
(C) Hydrogen bond (D) Covalent bond.
99. In DNA finger printing, analysis is made of
(A) Satellite DNA (B) Moderately repetitive sequences
(C) Microsatellites (D) Variable number of tandem repeats.
100. Matching DNA sequence of criminal with suspect is known as
(A) DNA finger printing (B) DNA amplification (C) Gene mapping (D) DNA resolution.
101. Unwinding due to release of coiling tension ahead of moving replication fork is due to
(A) Gyrase (B) Unwindase (C) Topoisomerase (D) All the above.
102. Synthesis of RNA molecule is terminated by
(A) Alpha factor (B) Gamma factor (C) Delta factor (D) rho factor.
103. Lac operon concept was proposed by
(A) Jacob and Monod in 1961 (B) Jacob and Monod in 1969
(C) Watson and Crick in 1953 (D) Watson and Crick in 1963.
104. Transcription
(A) Starts at initiations region and ends at stop region
(B) Starts at operator region and ends at telomeric end
(C) Starts at promoter region and ends are terminator region
(D) Starts at CCA box and ends at TATA box.
KVPY_SX_BOTANY # 113
105. Chromosome breaks and the two fragments join together but after rotating at 180º. The aberration is called
(A) Translocation (B) Inversion
(C) Tandem duplication (D) Reverse tandem duplication.
106. In ATG ACC AGG ACC CCA ACA sequence, the first base gets mutated. It will affect
(A) Change in types and sequence of amino acids (B) Change in first amino acid only
(C) No change (D) One amino acid less
107. Protein synthesis in an animal cell occurs
(A) On cytosolic ribosomes only
(B) On ribosomes attached to E.R. and nuclear envelope
(C) On ribosomes present in nucleolus as well as cytoplasm
(D) On ribosomes present both in cytoplasm as well as mitochondria.
108. During transcription, holoenzyme RNA polymerase binds to DNA sequence and DNA assumes a saddle
like structure at that point. The sequence is called
(A) AAAT box (B) TATA box (C) GGTT box (D) CAAT box.
109. In lac operon system, lac gene –1 codes for
(A) Inducer (B) Repressor (C) Promoter (D) -galactosidase
110. Why does cytosine make pair with guanine and not with adenine
(A) Polar nature of C and A
(B) C - A pair would not reach across the double helix
(C) C - A pair would be wider than double helix
(D) Hydrogen bond forming functional groups are not complementary between C and A.
111. UV exerts action through
(A) Photodynamic action (B) Destruction of H-bonds
(C) Formation of pyrimidine (D) Formation of sticky metaphase.
112. Adenine is 30%. What would be percentage of guanine
(A) 10% B) 20% (C) 30% (D) 40%
113. Hn-RNA is
(A) Heteronuclear RNA (B) Homonuclear RNA (C) Heterogeneous RNA (D) Useful RNA
114. In lac operon, sturctural gene ‘Z’ synthesises
(A) -galactosidase (B) Galactosidase permease
(C) Galactosidase transacetylase (D) None of the above.
115. Continuously functional genes which are regulated on the tissue level are
(A) House keeping genes (B) Luxury genes
(C) Mild genes (D) Gene battery.
116. When lactose is added to culture of Escherichia coli, its molecules get into cell with the help of
(A) Lactase (B) Galactosidase (C) Permease (D) Transacetylase.
117. Amino acid sequence in protein synthesis is determined by sequence of
(A) rRNA (B) tRNA (C) mRNA (D) cDNA.
118. Antibiotic inhibiting interaction between tRNA and mRNA during protein synthesis in bacteria is
(A) Tetracycline (B) Neomycin (C) Erythromycin (D) Streptomycin.
119. Antiparallel strands of DNA molecules means
(A) One strand turns clockwise
(B) One strand turns anticlockwise
(C) Phosphate groups of the two strands share the same position their ends
(D) Phosphate groups at the start of the DNA strands are in opposite position
120. Which are termination codons ?
(A) UAA, UAG and UGA (B) GUA, GUG, GCG and GAA
(C) UUG, UUG, CCU, CAA and CUA (D) UUA, UUG, CUU, CUC, CUA and CUG
KVPY_SX_BOTANY # 114
121. Match the columns
I II
a Termination 1 Aminoacyl tRNA synthetase
(A) a – 2, b – 3, c – 1, d – 4 (B) a – 1, b – 4, c – 2, d – 3
(C) a – 3, b – 1, c – 4, d – 2 (D) a – 2, b – 4, c – 1, d – 3
122. In double helix model of DNA, how far is each base pair from the next base pair
(A) 3 · 4 nm (B) 0 · 34 nm (C) 2 · 0 nm (D) 34 nm
123. Which amino acid is specified by genetic codes ACU, ACC, ACA, ACG showing degeneracy
(A) Leucine (B) methionine (C) Glycine (D) Threonine.
124. Transfer of DNA bands from agarose gel to nitrocellulose or nylon membrane is
(A) Southern transfer (B) Western transfer (C) Northern transfer (D) Eastern transfer
125. DNA element with ability to change its position is
(A) Cistron (B) Trasnposon (C) Intron (D) Recon
126. Match the columns I and II
I II
1 450 – 700 genes a Escherichia coli
(A) 1 – b, 2 – a, 3 – e, 4 – c, 5 – d (B) 1 – c, 2 – a, 3 – b, 4 – e, 5 – d
(C) 1 – c, 2 – b, 3 – a, 4 – e, 5 – d (D) 1 – b, 2 – c, 3 – a, 4 – e, 5 – d
127. The genome of Coenorhabditis elegans has
(A) 3 billiion bp and 30, 000 genes (B) 180 million bp and 13000 genes
(C) 4· 7 million bp and 4000 genes (D) 97 million bp and 18000 genes
128. Complete turns in 45000 bp DNA would
(A) 45 (B) 450 (C) 4500 (D) 45, 000.
129. Terminious central dogma of protein synthesis is
(A) DNA — DNA — mRNA — protein (B) mRNA — gRNA — DNA — Protein
(C) gRNA — DNA — mRNA — Protein (D) DNA — gRNA — mRNA — Protein
130. Which is wrong
(A) A + G = T + C (B) A + T =G + C (C) G = C (D) A = T.
131. Enzyme responsible for DNA chain elongation is
(A) DNA polymerase II (B) DNA ligase (C) RNA poymerase III (D) DNA polymerase III.
132. AUG codon is
(A) Ochre (B) Amber (C) Initiation codon (D) Opal.
133. While working on Neurospora crassa Beadle and Tatum proved
(A) Every gene is responsible for a specific enzyme
(B) Plant cells are totipotent
(C) DNA replication is semiconservative
(D) Viruses have genetic material.
KVPY_SX_BOTANY # 115
134. C-value paradox is
(A) Diploid DNA content (B) Haploid DNA content
(C) Variation is C- value (D) Constancy of C-value
135. DNA replication requires
(A) DNA polymerase (B) DNA ligase (C) RNA polymerase (D) All the above.
136. DNA is acidic acid due to
(A) Sugar (B) Purine (C) Phosphoric acid (D) Pyrimidine.
137. Which conserved motifs occur in Escherichia coli genes
(A) TATA box (B) CAAT box (C) Pribnow box (D) None of the above.
138. Central dogma of molecular biology was modified with the discovery of
(A) Ligase (B) RNA polymerase (C) DNA polymerase (D) Reverse trascriptase
139. Okazaki fragments during DNA replication
(A) Polymerise in 3 5 direction and form replication fork
(B) Prove semiconservative DNA replication
(C) Polymerise in 5 3direction and explain 3 5 DNA replication
(D) Cause transcription
140. A sequential expression of a set of human genes occurs when a steroid molecule binds to
(A) mRNA (B) DNA sequence (C) tRNA (D) Ribosome
141. Differentiation of tissues and organs is connected with
(A) Differential expression of genes (B) Deletion of genes
(C) Lethal mutations (D) Developmental mutations
142. The two polynucleotide chains of DNA are
(A) Discontinuous (B) Antiparallel (C) Parallel (D) Semiconservative
143. [Link] about to replicate was placed in a medium containing radioactive thymidine for five minutes. Then it
was made to replicate in a normal medium. Which of the following observation will be correct.
(A) Each strand half radioactive (B) Both the strands of DNA will be radioactive
(C) One strand radioactive (D) None is radioactive.
144. During translation initiation in prokaryotes, a GTP molecule is needed in.
(A) Association of 50 S subunit of ribosome with initiation complex
(B) formation of formyl-met-RNA
(C) Association of 30S m-RNA with formyl-met-tRNA.
(D) Binding of 30S subuit of ribosome with mRNA.
145. The telomeres of eukaryotic chromosomes consists of short sequences of
(A) Cytosine rich repeats (B) Thymine rich repeats
(C) Adenine rich repeats (D) Guanine rich repeats.
146. Match the following
(a) tRNA 1. Linking of amino acids
(b) mRNA 2. Transfer of gentic Information
(c) rRNA 3. Nucleolar organising region
(d) Peptidyl transferse 4. Transfer of amino acid from cytoplasm to ribosome.
(A) a – 4, b – 2, c –3, d –1 (B) a – 1, b – 4, c –3, d –2
(C) a – 1, b – 2, c –3, d – 4 (D) a – 4, b – 3, c –2, d –4.
147. What would happen if a gene encoding a polypeptide do 50 amino acids has UAC at 25th position mutated
to UAA
(A) A polypeptide of 25 amino acids will be formed
(B) A polypeptide of 24 amino acids will be formed
(C) A polypeptide of 49 amino acids will be formed
(D) Two plypeptides of 24 and 25 amino acids will be formed.
KVPY_SX_BOTANY # 116
148. Anitcodon is present on
(A) rRNA (B) mtRNA (C) tRNA (D) mRNA.
149. In retroviruses RNA dependent DNA polymerase synthesizes
(A) DNA (B) RNA (C) RNA - DNA (D) None of these.
150. The RNA primer is used in
(A) Translation (B) Replication (C) Conjugation (D) Transformation.
151. In the DNA molecule
(A) The proportion of adenine in relation of thymine varies with the organism
(B) There are two strands which run antiparallel one in 5’ 3’ direction and other in 3’ 5’
(C) The total amount of purine nucleotides and pyrimidine nucleotides is not run always equal
(D) There are two strands which run paralled in the 5’ 3’ direction.
152. Which one of the following pairs of codons is correctly matched with their function or the signal for the the
particular amino acid ?
(A) AUG, ACG – start/methionine (B) UUA, UCA – Leucine
(C) GUU – Alanine (D) UAG, UGA – stop.
KVPY_SX_BOTANY # 117
162. The total number of nitrogenous bases in human genome is estimated to be about
(A) 3·5 million (B) 35 million (C) 35 thousand (D) 3·1 billion.
163. Which one of the following pairs is correctly matched with regard to the codon and the amino acid coded by it ?
(A) UUA-valine (B) AUG-cysteine (C) CCC-alanine (D) AAA-lysine.
164. The haploid content of human DNA is
(A) 3·3 × 109 bp (B) 3·3 × 109 kbp (C) 4·6 × 106 bp (D) 48502 bp
165. The basis of DNA finger-printing is
(A) The double helix (B) Error in base sequence
(C) Polymorphism in sequence (D) DNA replication
166. What is not for genetic code
(A) It is unambiguous (B) A codon in mRNA is read in a non-contiguous fashion
(C) It is nearly universal (D) It is degenerate
167. Removal of introns and joining the exons in a defined order in a transcription unit is called
(A) Capping (B) Splicing (C) Tailing (D) Transformation
168. Semiconservative replication of DNA was first demonstrated in
(A) Salmonella typhimurium (B) Drosophila melangaster
(C) Escherichia coli (D) Streptococcus pneumoniae
169. Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a “triplet”
(A) Beadle and Tatum (B) Nirenberg and Mathaei
(C) Hershey and Chase (D) Morgan and sturtevant
170. The one aspect which is not a salient feature of genetic code, is its being
(A) Ambiguous (B) Universal (C) Specific (D) Degenerate
171. Select the two correct statements out of the four (a-d) given below about lac operon.
(a) Glucose or galactose may bind with the repressor and inactivate it
(b) In the absence of lactose the repressor binds with the operator region
(c) The z-gene codes for permease
(d) This was elucidated by Francois Jacob and jacque Monod
The correct statements are
(A) (a) and (c) (B) (b) and (d) (C) (a) and (b) (D) (b) and (c)
172. Satellite DNA is useful tool in
(A) Sex determination (B) Forensic science (C) Genetic engineering (D) Organ transplantation
173. What are those structures that appear as beads - on - string in the chromosomes when viewed under
electron microscope ?
(A) Genes (B) Nucleotides (C) Nucleosomes (D) Base pairs
EXERCISE
MOLECULAR BASIS OF INHERITANCE
1 (A) 2 (B) 3 (C) 4 (C) 5 (A)
6 (D) 7 (D) 8 (B) 9 (D) 10 (A)
11 (C) 12 (A) 13 (A) 14 (A) 15 (A)
16 (A) 17 (B) 18 (B) 19 (D) 20 (B)
21 (A) 22 (B) 23 (A) 24 (D) 25 (B)
26 (D) 27 (A) 28 (A) 29 (B) 30 (D)
31 (D) 32 (C) 33 (A) 34 (B) 35 (C)
KVPY_SX_BOTANY # 118
36 (C) 37 (A) 38 (B) 39 (A) 40 (C)
41 (D) 42 (C) 43 (D) 44 (B) 45 (B)
46 (D) 47 (B) 48 (D) 49 (C) 50 (D)
51 (B) 52 (C) 53 (D) 54 (D) 55 (C)
56 (B) 57 (D) 58 (A) 59 (B) 60 (C)
61 (D) 62 (C) 63 (C) 64 (A) 65 (A)
66 (D) 67 (A) 68 (A) 69 (C) 70 (B)
71 (A) 72 (A) 73 (D) 74 (A) 75 (C)
76 (B) 77 (B) 78 (C) 79 (D) 80 (D)
81 (A) 82 (B) 83 (B) 84 (C) 85 (A)
86 (A) 87 (C) 88 (B) 89 (D) 90 (C)
91 (B) 92 (B) 93 (C) 94 (D) 95 (B)
96 (A) 97 (A) 98 (B) 99 (D) 100 (A)
101 (C) 102 (D) 103 (A) 104 (C) 105 (B)
106 (B) 107 (D) 108 (B) 109 (D) 110 (B)
111 (B) 112 (B) 113 (C) 114 (A) 115 (A)
116 (C) 117 (C) 118 (B) 119 (D) 120 (A)
121 (C) 122 (B) 123 (D) 124 (A) 125 (B)
126 (B) 127 (D) 128 (C) 129 (C) 130 (B)
131 (D) 132 (C) 133 (A) 134 (B) 135 (D)
136 (C) 137 (C) 138 (D) 139 (C) 140 (B)
141 (A) 142 (B) 143 (C) 144 (C) 145 (D)
146 (A) 147 (B) 148 (C) 149 (C) 150 (B)
151 (B) 152 (D) 153 (A) 154 (A) 155 (B)
156 (B) 157 (C) 158 (B) 159 (B) 160 (D)
161 (D) 162 (D) 163 (D) 164 (A) 165 (C)
166 (B) 167 (B) 168 (C) 169 (B) 170 (A)
171 (B) 172 (B) 173 (C)
KVPY_SX_BOTANY # 119
5. The number of genes in man (Homo sapiens) is X-fold more than in a fly (Drosophila melanogaster). The value
of X is [KVPY_2008_SB]
(A) 2 (B) 10 (C) 250 (D) 10000
6. You are supposed to mix a 3000 bp DNA fragment and a 600 bp DNA fragment in 1 : 5 molar ratio. If you take
100 ng of the 3000 bp fragment how much of the 600 bp fragment do you require to get desired ratio
[KVPY_2008_SB]
(A) 10 ng (B) 100 ng (C) 500 ng (D) 2500 ng
7. An enzyme that cleaves DNA recognizes an 8 base-pair unique DNA sequence. The probable number of
times this enzyme will cleave a 70 kilobase pair random DNA sequence is [KVPY_2008_SB]
(A) 1 (B) 2 (C) 3 (D) 4
8. Mendel’s law of independent assortment when interpreted in a modern context indicates :
[KVPY_2008_SB]
(A) Alleles are present on the same chromosome, but they assort independently due to recombination
(B) Alleles are present on independent chromosomes and these separate and assort independently
(C) Alleles are present on independent chromosomes and they can be sorted during meiosis.
(D) Alleles are present on the same chromosome and their combination is dependen
9. Identify the protein with more than one polypeptide chain. [KVPY_2008_SB]
(A) Myoglobin (B) Trypsin (C) Immunoglobulin (D) Lysozyme
10. Sickle cell anemia is caused by : [KVPY_2009_SB]
(A) complete absence of the haemoglobin gene
(B) point mutation of the haemoglobin gene
(C) increased affinity of haemoglobin for oxygen
(D) truncation of the haemoglobin protein
11. The probability of having a girl child with blood group O when the parents have blood group A and B is :
[KVPY_2009_SB]
(A) 0% (B) at least 50% (C) at most 25% (D) exactly 75 %
12. Instead of 3, if 2 bases code for an amino acid, the degeneracy of codons coding for the same amino acid
would have : [KVPY_2009_SB]
(A) increased (B) decreased
(C) remained the same (D) been uncertain
13. Gregor Mendel showed that unit factors exist in pairs and exhibit as dominant-recessive relationship. These
unit factors, in modern terminology, are called : [KVPY_2009_SB]
(A) genes (B) alleles (C) Ioci (D) determinants
14. Male offsprings of which of the following couples have the highest chance of haemophilia ?
[KVPY_2009_SB]
(A) Haemophiliac father and normal, non-carrier mother
(B) Haemophiliac father and normal, carrier mother
(C) Normal father and normal, carrier mother
(D) Normal father and haemophiliac mother
15. Which fo the following diseases is NOT sexually transmitted ? [KVPY_2009_SB]
(A) Syphilis (B) Gonorrhoea (C) AIDS (D) Tuberculosis
16. Nucleotides are monomers of DNA. What does each nucleotide consist of ? [KVPY_2009_SB]
(A) A nitrogenous base and a pentose sugar
(B) A nitrogenous base and a phosphate group
(C) A pentose sugar and a phosphate group
(D) A nitrogenous base, a pentose sugar and a phosphate group
17. A horse has 64 chromosomes and a donkey has 62. Mules result from crossing a horse and donkey. State
which of the following is INCORRECT? [KVPY_2010_SB]
(A) Mules can have either 64, 63 or 62 chromosomes
(B) Mules are infertile
(C) Mules have well defined gender (male/female)
(D) Mules have 63 chromosomes
KVPY_SX_BOTANY # 120
18. A couple went to a doctor and reported that both of them are "carriers" for a particular disorder, their first child
is suffering from that disorder and that they are expecting their second child. What is the probability that the
new child would be affected by the same disorder? [KVPY_2010_SB]
(A) 100% (B) 50% (C) 25% (D) 75%
19. Conversion of the Bt toxin produced by Bacillus thuringienesis to its active form in the gut of the insects is
mediated by [KVPY_2010_SB]
(A) acidic pH of the gut (B) alkaline pH of the gut
(C) lipid modification of the protein (D) cleavage by chymotrypsin
20. Restriction endonucleases are enzymes that cleave DNA molecules into smaller fragments. Which type of
bond do they act on? [KVPY_2010_SB]
(A) N-glycosidic Bond (B) Phosphodiester bond (C) Hydrogen bond (D) Disulfide bond
21. The distance between two consecutive DNA base pairs is 0.34 nm. If the length of a chromosome is 1 mm
the number of base pairs in the chromosome is approximately [KVPY_2010_SB]
(A) 3 million (B) 1.5 million (C) 30 million (D) 6 million
22. A host cell has intracellular bacterial symbionts. If the growth rate of the bacterial symbiont is always 10%
higher than that of the host cell, after 10 generations of the host cell the density of bacteria in host cells will
increase [KVPY_2010_SB]
(A) by 10% (B) two-fold (C) ten-fold (D) hundred-fold
23. In a diploid organism, there are three different alleles for a particular gene. Of these three alleles one is
recessive and the other two alleles exhibit co-dominance. How many phenotypes are possible with this set
of alleles? [KVPY_2010_SB]
(A) 3 (B) 6 (C) 4 (D) 2
24. Two students are given two different double stranded DNA molecules of equal length. They are asked to
denature the DNA molecules by heating. The DNA given to student A has a following composition of base
(A:G:T:C::35:15:35:15). While that given to student B is (A : G : T : C : : 12 : 38 : 12 : 38) Which of the
following statements is true ? [KVPY_2010_SB]
(A) Both the DNA molecules would denature at the same rate
(B) The information given is insufficient to draw any conclusion
(C) DNA molecule given to student B would denature faster than that of student A
(D) DNA molecule given to student A would denature faster than that given to student B
25. The amino acid sequences of a bacterial protein and a human protein carrying out similar function are found
to be 60% identical. However, the DNA sequences of the genes coding for these proteins are only 45%
identical. This is possible because [KVPY_2010_SB]
(A) Protein sequence does not depend on DNA sequence
(B) DNA codons having different nucleotides in the third position can code for the same amino acids
(C) DNA codons having different nucleotides in the second position can code for the same amino acids
(D) Same DNA codons can code for multiple amino acids.
26. The following DNA sequence (5´ 3´) specifies part of a protein coding sequence, starting from position 1.
Which of the following mutations will give rise to a protein that is shorter than the full-length protein?
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
A T G C A A G A T A T A G C T
KVPY_SX_BOTANY # 121
28. In humans , the composition of a zygote that will develop into a female is [KVPY_2011_SB]
(A) 44A +XX (B) 44A + XY (C) 22 + X (D) 23 A
29. A protein with 100 amino acid residues has been translated based on triplet genetic code. Had the
genetic code been quadruplet. the gene that codes for the protein would have been.[KVPY_2011_SB]
(A) same in size (B) longer in size by 25%
(C) longer in size by 100% (D) shorter in size
30. If the sequence of base in DNA is 5'- ATGTATCTCAAT- 3', than the sequence of bases in its transcript
will be : [KVPY_2011_SB]
(A) 5' - TACATAGAGTTA - 3' (B) 5' - UACAUAGAGUUA - 3'
(C) 5' - AUGUAUCUCAAU - 3' (D) 5' - AUUGAGAUACAU - 3'
31. According to the original model of DNA. as proposed by Watson & Crick 1953, DNA is a
(A) left handed helix [KVPY_2011_SB]
(B) helix that makes a full turn every 70 nm.
(C) helix where one turn of DNA contains 20 basepairs
(D) two stranded helix where each strand has opposite polarity.
32. Rice has a diploid genome with 2n = 24. If crossing over is stopped in a rice plant and then selfed
seeds are collected, will all the offsprings be genetically identical to the parent plant ?
[KVPY_2011_SB]
(A) yes, because crossing-over is the only source of genetic variation
(B) no, because stopping of crossing over automatically increases rate of point mutation
(C) yes, only if the parent plant was a completely inbred line
(D) yes, only if the parent plant was a hybrid between two prue-bred lines
33. [Link] about to replicate was pulsed with tritiated thymidine for 5 min and then transferred to normal 1
medium . After one cell division which one of the following observations would be correct ?
[KVPY_2011_SB]
(A) both the strands of DNA will be radioactive (B) one strand of DNA will be radioactive
(C) none of the strands will be radioactive (D) half of one strand of DNA will be radioactive
34. For a human male what is the probability that all the maternal chromosomes will end up in the same
gamete ? [KVPY_2011_SB]
23 th 23
(A) 1/23 (B) 2 (C) 2 (D) (½)
35. The length of one complete true of a DNA double helix is [KVPY_2011_SB]
(A) 34 A (B) 34 nm
(C) 3.4 A (D) 3.4 m
36. Selection of lysine auxotroph (bacteria which requires lysine for growth) from a mixed population of
bacteria can be done growing bacterial population in the presence of [KVPY_2011_SB]
(A) lysine (B) penicillin
(B) lysine and penicillin (D) glucose
37. The following sequence contains the open reading frame of a polypeptide. How many amino acids will the
polypeptide consist of ? [KVPY_2012_SB]
5’ – AGCATATGATCGTTTCTCTGCTTTGAACT–3
(A) 4 (B) 2 (C) 10 (D) 7
38. The restriction endonuclease EcoR-I recognises and cleaves DNA sequence as shown below -
5’ – G A A T T C – 3’
3’ – C T T A A G – 5’
What is the probable number of cleavage sites that can occur in a 10 kb long random DNA sequence?
[KVPY_2012_SB]
(A) 10 (B) 2 (C) 100 (D) 50
KVPY_SX_BOTANY # 122
39. If the sequence of bases in sense strand of DNA is 5'-GTTCATCG-3, then the sequence ofd bases in its RNA
transcript would be [KVPY_2012_SB]
(A) 5'-GTTCATCG-3' (B) 5'GUUCAUCG-3 (C) 5'CAAGTAGC-3' (D) 5'CAAGUAGC -3
40. DNA mutations that do not cause my functional change in the protein product are known as
[KVPY_2012_SB]
(A) nonsense mutations (B) missense mutations
(C) deletion mutations (D) silent mutations
41. Transfer RNA (tRNA) [KVPY_2012_SB]
(A) is present in the ribosomes and provides structural integrity
(B) usually has clover leaf-like structure
(C) carries genetic information from DNA to ribosomes
(D) codes for proteins
42. If DNA codons are ATG GAA, insertion of thymine after the first codon results in, [KVPY_2013_SB]
(A) non-sense mutation (B) mis-sense mutation
(C) frameshift mutation (D) silent mutation
43. In a large isolated population, alleles p and q at a locus are at Hardy Weinberg equilibrium. The frequencies
are p = 0.6 and q = 0.4. The proportion of the heterozygous genotype in the population is [KVPY_2013_SB]
(A) 0.24 (B) 1 (C) 0.48 (D) 0.12
44. Watson and Crick model of DNA is [KVPY_2013_SB+]
(A) B-form DNA with a spiral length of 34 Å and a diameter of 20 Å
(B) A-form DNA with a spiral length of 15 Å and a diameter of 20 Å
(C) Z-form DNA with a spiral length of 34 Å and a diameter of 20 Å
(D) B-form DNA with a spiral length of 28 Å and a diameter of 14 Å
45. The sequences of four DNA molecules are given below : [KVPY_2013_SB]
i. TATATATATATATA ii. TTTCCCGGGAAA
ATATATATATATAT AAAGGGCCCTTT
48. How many linear DNA fragments will be produced when a circular plasmid is digested with a restriction
enzyme having 3 sites ? [KVPY_2014_SB]
(A) 4 (B) 5 (C) 3 (D) 2
49. Which one of the following is the complementary sequence for the DNA with 5’-CGTACTA-3’
[KVPY_2014_SB]
(A) 5’-TAGTACG-3’ (B) 5’-ATCATGC-3’ (C) 5’-UTCUTGC-3’ (D) 5’-GCUAGCA-3’
50. A flower with Tt genotype is cross-pollinated by TT pollens. What will the genotypes of the resulting endosperm
and embro,respectively, be? [KVPY_2014_SB]
(A) TTT,(TT+Tt) (B) (TTT+TTt),TT (C) TTt,Tt (D) TTt,(TT+Tt)
51. A new life from discovered on a distant has a genetic code consisting of five unique nucleotides and only one
stop [Link] each codon has four bases,what is the maximum number of unique amino acids this life from
can use ? [KVPY_2014_SB]
(A) 624 (B) 20 (C) 124 (D) 3124
KVPY_SX_BOTANY # 123
52. A spontaneous mulation results in a couple having only female [Link] the daughter marries and has
children,none of them are [Link],in the third generation there are few male offspring. What is the
most likely explanation of this observation ? [KVPY_2014_SB]
(A) The mutation reverses spontaneously in the third generation
(B) The mutation occurs on the X chromosome and is both recessive and ethal
(C) The mutation occurs on the X chromosome and is both recessive and dominant
(D) The mutation occurs on an autosome and is dominant
54. Which one of these substances will repress the lac operon? (KVPY 2015 SX) (1 Mark)
(A) Arabinose (B) Glucose (C) Lactose (D) Tryptopham
55. In a random DNA sequence, what is the lowest frequency of encountering a stop codon?
(KVPY 2015 SX) (1 Mark)
(A) 1 in 20 (B) 1 in 3 (C) 1 in 64 (D) 1 in 10
56. The two alleles that determine the blood group AB of an individual are located on
(KVPY 2015 SX) (1 Mark)
(A) two different autosomes
(B) the same autosome
(C) two different sex chromosomes
(D) one on sex chromosome and the other on an autosome
57. Given the fact that histone binds DNA, it should be rich in (KVPY 2015 SX) (1 Mark)
(A) arginine, lysine (B) cysteine, methionine
(C) glutamate, aspartate (D) isoleucine, leucine
58. Melting temperature for double stranded molecules are converted into single stranded molecules. Which one
of the following DNA will have the highest melting temperature? (KVPY 2015 SX) (1 Mark)
(A) DNA with 15% guanine (B) DNA with 30% cytosine
(C) DNA with 40% Thymine (D) DNA with 50% adenine
59. Mutation in a single gene can lead to changes in multiple traits. This is an example of
(KVPY 2015 SX) (1 Mark)
(A] Heterotrophy [B] Co-dominance [C] Penetrance [D] Pleiotropy
60. Which of the following processes leads to DNA ladder formation? (KVPY 2015 SX) (1 Mark)
(A) Necrosis (B) Plasmolysis (C) Apoptosis (D) Mitosis
61. The activity of Certain protein is dependent on its phosphorylation. A mutation in its gene changed a single
amino acid which affected the function of molecule. Which amino acid change is most likely to account for
this observation? (KVPY 2015 SX) (2 Marks)
(A) Tyrosine to Tryptophan (B) Lysine to valine
(C) Leucine to isoleucine (D) Valine to alanine
62. Enzymes X catalyzes hydrolysis of GTP into GDP. The GTP-bon from of Z transmits a signal that leads to
cell proliferation. The GDP-bound from does not transmit any such signal. Mutations in X are in many can-
cers. Which of the following alterations of X are most likely to contribute to cancer?
(KVPY 2015 SX) (2 Marks)
(A) Mutation that increase the affinity of X for GDP.
(B) Mutation that decrease the affinity of X for GDP.
(C) Mutation that decrease the rate of GTP hydrolysis.
(D) Mutation that prevent expression of enzyme X
KVPY_SX_BOTANY # 124
63. Consider the following pedigree over four generations and mark the correct answer below about the
inheritance of haemophilia. (KVPY 2015 SX) (2 Marks)
Normal male
Haemophilic male
Normal female
Haemophilic female
KVPY_SX_BOTANY # 125