Next-Generation Sequencing Advances
Next-Generation Sequencing Advances
a p p l i c at i o n s o f n e x t- g e n e r at i o n s e q u e n c i n g
Sequencing technologies —
the next generation
Michael L. Metzker*‡
Abstract | Demand has never been greater for revolutionary technologies that deliver
fast, inexpensive and accurate genome information. This challenge has catalysed the
development of next-generation sequencing (NGS) technologies. The inexpensive
production of large volumes of sequence data is the primary advantage over conventional
methods. Here, I present a technical review of template preparation, sequencing and
imaging, genome alignment and assembly approaches, and recent advances in current
and near-term commercially available NGS instruments. I also outline the broad range of
applications for NGS technologies, in addition to providing guidelines for platform
selection to address biological questions of interest.
Automated Sanger
Over the past four years, there has been a fundamental determining the order of bases. For example, in
sequencing shift away from the application of automated Sanger gene-expression studies microarrays are now being
This process involves a mixture sequencing for genome analysis. Prior to this depar- replaced by seq-based methods, which can identify and
of techniques: bacterial ture, the automated Sanger method had dominated the quantify rare transcripts without prior knowledge of a
cloning or PCR; template
purification; labelling of DNA
industry for almost two decades and led to a number of particular gene and can provide information regarding
fragments using the chain monumental accomplishments, including the comple- alternative splicing and sequence variation in identified
termination method with tion of the only finished-grade human genome sequence1. genes4,5. The ability to sequence the whole genome of
energy transfer, dye-labelled Despite many technical improvements during this era, many related organisms has allowed large-scale com-
dideoxynucleotides and a
the limitations of automated Sanger sequencing showed parative and evolutionary studies to be performed that
DNA polymerase; capillary
electrophoresis; and
a need for new and improved technologies for sequenc- were unimaginable just a few years ago. The broadest
fluorescence detection that ing large numbers of human genomes. Recent efforts application of NGS may be the resequencing of human
provides four-colour plots to have been directed towards the development of new genomes to enhance our understanding of how genetic
reveal the DNA sequence. methods, leaving Sanger sequencing with fewer reported differences affect health and disease. The variety of
advances. As such, automated Sanger sequencing is not NGS features makes it likely that multiple platforms
covered here, and interested readers are directed to will coexist in the marketplace, with some having clear
previous articles2,3. advantages for particular applications over others.
The automated Sanger method is considered as This Review focuses on commercially available tech-
a ‘first-generation’ technology, and newer methods nologies from Roche/454, Illumina/Solexa, Life/APG
are referred to as next-generation sequencing (NGS). and Helicos BioSciences, the Polonator instrument and
These newer technologies constitute various strategies the near-term technology of Pacific Biosciences, who
*Human Genome Sequencing
that rely on a combination of template preparation, aim to bring their sequencing device to the market in
Center and Department of sequencing and imaging, and genome alignment and 2010. Nanopore sequencing is not covered, although
Molecular & Human assembly methods. The arrival of NGS technologies in interested readers are directed to an article by Branton
Genetics, Baylor College of the marketplace has changed the way we think about and colleagues 6, who describe the advances and remain-
Medicine, One Baylor Plaza,
scientific approaches in basic, applied and clinical ing challenges for this technology. Here, I present a tech-
N1409, Houston, Texas
77030, USA. research. In some respects, the potential of NGS is akin nical review of template preparation, sequencing and
‡
LaserGen, Inc., 8052 El Rio to the early days of PCR, with one’s imagination being imaging, genome alignment and assembly, and current
Street, Houston, Texas the primary limitation to its use. The major advance NGS platform performance to provide guidance on how
77054, USA. offered by NGS is the ability to produce an enormous these technologies work and how they may be applied
e‑mail: mmetzker@[Link]
doi:10.1038/nrg2626
volume of data cheaply — in some cases in excess of to important biological questions. I highlight the appli-
Published online one billion short reads per instrument run. This feature cations of human genome resequencing using targeted
8 December 2009 expands the realm of experimentation beyond just and whole-genome approaches, and discuss the progress
and limitations of these methods, as well as upcoming problem that is inherent in bacterial cloning methods. A
advances and the impact they are expected to have over library of fragment or mate-pair targets is created, and
the next few years. adaptors containing universal priming sites are ligated to
the target ends, allowing complex genomes to be ampli-
next-generation sequencing technologies fied with common PCR primers. After ligation, the
Finished grade Sequencing technologies include a number of methods DNA is separated into single strands and captured onto
A quality measure for a that are grouped broadly as template preparation, beads under conditions that favour one DNA molecule
sequenced genome. A sequencing and imaging, and data analysis. The unique per bead (fIG. 1a). After the successful amplification and
finished-grade genome,
combination of specific protocols distinguishes one enrichment of emPCR beads, millions can be immobi-
commonly referred to as a
‘finished genome’, is of higher technology from another and determines the type of lized in a polyacrylamide gel on a standard microscope
quality than a draft-grade data produced from each platform. These differences slide (Polonator)11, chemically crosslinked to an amino-
genome, with more base in data output present challenges when comparing plat- coated glass surface (Life/APG; Polonator)12 or deposited
coverage and fewer errors and forms based on data quality and cost. Although qual- into individual PicoTiterPlate (PTP) wells (Roche/454)13
gaps (for example, the human
genome reference contains
ity scores and accuracy estimates are provided by each in which the NGS chemistry can be performed.
2.85 Gb, covers 99% of the manufacturer, there is no consensus that a ‘quality base’ Solid-phase amplification can also be used to produce
genome with 341 gaps, and from one platform is equivalent to that from another randomly distributed, clonally amplified clusters from
has an error rate of 1 in every platform. various sequencing metrics are discussed later fragment or mate-pair templates on a glass slide (fIG. 1b).
100,000 bp).
in the article. High-density forward and reverse primers are covalently
Template In the following sections, stages of template prepara- attached to the slide, and the ratio of the primers to the
This recombinant DNA tion and sequencing and imaging are discussed as they template on the support defines the surface density of
molecule is made up of a apply to existing and near-term commercial platforms. the amplified clusters. Solid-phase amplification can
known region, usually a vector There are two methods used in preparing templates produce 100–200 million spatially separated template
or adaptor sequence to which
a universal primer can bind,
for NGS reactions: clonally amplified templates origi- clusters (Illumina/Solexa), providing free ends to which
and the target sequence, which nating from single DNA molecules, and single DNA- a universal sequencing primer can be hybridized to
is typically an unknown portion molecule templates. The term sequencing by synthesis, initiate the NGS reaction.
to be sequenced. which is used to describe numerous DNA polymer-
ase-dependent methods in the literature, is not used Single-molecule templates. Although clonally amplified
Seq-based methods
Assays that use in this article because it fails to delineate the different methods offer certain advantages over bacterial cloning,
next-generation sequencing mechanisms involved in sequencing 2,7. Instead, these some of the protocols are cumbersome to implement
technologies. They include methods are classified as cyclic reversible termination and require a large amount of genomic DNA material
methods for determining the (CRT), single-nucleotide addition (SNA) and real-time (3–20 μg). The preparation of single-molecule tem-
sequence content and
abundance of mRNAs,
sequencing. Sequencing by ligation (SBL), an approach plates is more straightforward and requires less start-
non-coding RNAs and small in which DNA polymerase is replaced by DNA ligase, ing material (<1 μg). more importantly, these methods
RNAs (collectively called is also described. Imaging methods coupled with these do not require PCR, which creates mutations in clon-
RNA–seq) and methods for sequencing strategies range from measuring biolumines- ally amplified templates that masquerade as sequence
measuring genome-wide
cent signals to four-colour imaging of single molecular variants. AT-rich and GC-rich target sequences may
profiles of immunoprecipitated
DNA–protein complexes events. The voluminous data produced by these NGS also show amplification bias in product yield, which
(ChIP–seq), methylation platforms place substantial demands on informa- results in their underrepresentation in genome align-
sites (methyl–seq) and tion technology in terms of data storage, tracking and ments and assemblies. Quantitative applications, such as
DNase I hypersensitivity quality control (see Ref. 8 for details). RNA–seq5, perform more effectively with non-amplified
sites (DNase–seq).
template sources, which do not alter the representational
Polonator template preparation abundance of mRNA molecules.
This Review mostly describes The need for robust methods that produce a representative, Before the NGS reaction is carried out, single-
technology platforms that are non-biased source of nucleic acid material from the molecule templates are usually immobilized on solid sup-
associated with a respective
genome under investigation cannot be overemphasized. ports using one of at least three different approaches. In
company, but the Polonator
G.007 instrument, which is Current methods generally involve randomly breaking the first approach, spatially distributed individual primer
manufactured and distributed genomic DNA into smaller sizes from which either frag- molecules are covalently attached to the solid support 14.
by Danaher Motions (a Dover ment templates or mate-pair templates are created. A com- The template, which is prepared by randomly fragment-
Company), is an open source mon theme among NGS technologies is that the template ing the starting material into small sizes (for example,
platform with freely available
software and protocols. Users
is attached or immobilized to a solid surface or support. ~200–250 bp) and adding common adaptors to the frag-
manufacture their own reagents The immobilization of spatially separated template sites ment ends, is then hybridized to the immobilized primer
based on published reports or allows thousands to billions of sequencing reactions to (fIG. 1c). In the second approach, spatially distributed sin-
by collaborating with George be performed simultaneously. gle-molecule templates are covalently attached to the solid
Church and colleagues or other
support14 by priming and extending single-stranded, sin-
technology developers.
Clonally amplified templates. most imaging systems have gle-molecule templates from immobilized primers (fIG. 1c).
Fragment templates not been designed to detect single fluorescent events, so A common primer is then hybridized to the template
A fragment library is prepared amplified templates are required. The two most common (fIG. 1d). In either approach, DNA polymerase can bind
by randomly shearing genomic methods are emulsion PCR (emPCR)9 and solid-phase to the immobilized primed template configuration to
DNA into small sizes of <1kb,
and requires less DNA than
amplification10. emPCR is used to prepare sequencing initiate the NGS reaction. Both of the above approaches
would be needed for a templates in a cell-free system, which has the advantage are used by Helicos BioSciences. In a third approach,
mate-pair library. of avoiding the arbitrary loss of genomic sequences — a spatially distributed single polymerase molecules
Figure 1 | template immobilization strategies. In emulsion PCR (emPCR) (a), a reaction mixture consisting of
Nature Reviews | Genetics
an oil–aqueous emulsion is created to encapsulate bead–DNA complexes into single aqueous droplets. PCR
amplification is performed within these droplets to create beads containing several thousand copies of the same
template sequence. EmPCR beads can be chemically attached to a glass slide or deposited into PicoTiterPlate
wells (fIG. 3c). Solid-phase amplification (b) is composed of two basic steps: initial priming and extending of the
single-stranded, single-molecule template, and bridge amplification of the immobilized template with immediately
adjacent primers to form clusters. Three approaches are shown for immobilizing single-molecule templates to a solid
support: immobilization by a primer (c); immobilization by a template (d); and immobilization of a polymerase (e).
dNTP, 2′-deoxyribonucleoside triphosphate.
Mate-pair templates
A genomic library is prepared
are attached to the solid support 15, to which a primed sequencing and imaging
by circularizing sheared DNA
that has been selected for a template molecule is bound (fIG. 1e). This approach is There are fundamental differences in sequencing
given size, such as 2 kb, used by Pacific Biosciences15 and is described in patents clonally amplified and single-molecule templates. Clonal
therefore bringing the ends from Life/visiGen16 and LI-COR Biosciences17. Larger amplification results in a population of identical tem-
that were previously distant DNA molecules (up to tens of thousands of base pairs) plates, each of which has undergone the sequencing
from one another into close
proximity. Cutting these circles
can be used with this technique and, unlike the first two reaction. upon imaging, the observed signal is a con-
into linear DNA fragments approaches, the third approach can be used with real-time sensus of the nucleotides or probes added to the iden-
creates mate-pair templates. methods, resulting in potentially longer read lengths. tical templates for a given cycle. This places a greater
demand on the efficiency of the addition process, and errors occurring when the previous incorporated
incomplete extension of the template ensemble results nucleotide is a ‘G’ base24. Genome analysis of Illumina/
in lagging-strand dephasing. The addition of multiple Solexa data has revealed an underrepresentation of
nucleotides or probes can also occur in a given cycle, AT-rich24–26 and GC-rich regions25,26, which is probably
resulting in leading-strand dephasing. Signal dephas- due to amplification bias during template preparation25.
Dephasing ing increases fluorescence noise, causing base-calling Sequence variants are called by aligning reads to a refer-
This occurs with step-wise errors and shorter reads18. Because dephasing is not an ence genome using bioinformatics tools such as mAQ27
addition methods when issue with single-molecule templates, the requirement or eLAND23. Bentley and colleagues reported high con-
growing primers move out of
for cycle efficiency is relaxed. Single molecules, however, cordance (>99.5%) of single-nucleotide variant (SNv)28
synchronicity for any given
cycle. Lagging strands (for are susceptible to multiple nucleotide or probe additions calls with standard genotyping arrays using both align-
example, n – 1 from the in any given cycle. Here, deletion errors will occur owing ment tools, and a false-positive rate of 2.5% with novel
expected cycle) result from to quenching effects between adjacent dye molecules or SNvs23. Other reports have described a higher false-
incomplete extension, and no signal will be detected because of the incorporation positive rate associated with novel SNv detection using these
leading strands (for example,
n + 1) result from the addition
of dark nucleotides or probes. In the following sections, alignment tools29,30.
of multiple nucleotides or sequencing and imaging strategies that use both clonally The difficulty involved in identifying a modified
probes in a population of amplified and single-molecule templates are discussed. enzyme that efficiently incorporates 3′-blocked termi-
identical templates. nators — a process that entails screening large libraries
Cyclic reversible termination. As the name implies, CRT of mutant DNA polymerases — has spurred the develop-
Dark nucleotides or probes
A nucleotide or probe that uses reversible terminators in a cyclic method that com- ment of 3′-unblocked reversible terminators. LaserGen,
does not contain a fluorescent prises nucleotide incorporation, fluorescence imaging Inc. was the first group to show that a small terminating
label. It can be generated from and cleavage2. In the first step, a DNA polymerase, bound group attached to the base of a 3′-unblocked nucleotide
its cleavage and carry-over to the primed template, adds or incorporates just one flu- can act as an effective reversible terminator and be effi-
from the previous cycle or be
hydrolysed in situ from its
orescently modified nucleotide (BOX 1), which represents ciently incorporated by wild-type DNA polymerases31.
dye-labelled counterpart in the complement of the template base. The termination of This led to the development of Lightning Terminators32
the current cycle. DNA synthesis after the addition of a single nucleotide is (BOX 1). Helicos BioSciences has reported the develop-
an important feature of CRT. Following incorporation, ment of virtual Terminators, which are 3′-unblocked
Total internal reflection
the remaining unincorporated nucleotides are washed terminators with a second nucleoside analogue that
fluorescence
A total internal reflection away. Imaging is then performed to determine the iden- acts as an inhibitor 33. The challenge for 3′-unblocked
fluorescence imaging device tity of the incorporated nucleotide. This is followed by terminators is creating the appropriate modifications
produces an evanescent a cleavage step, which removes the terminating/inhibit- to the terminating (Lightning Terminators)32 or inhib-
wave — that is, a near-field ing group and the fluorescent dye. Additional washing iting (virtual Terminators)33 groups so that DNA syn-
stationary excitation wave with
an intensity that decreases
is performed before starting the next incorporation step. thesis is terminated after a single base addition. This
exponentially away from the fIG. 2a depicts a four-colour CRT cycle used by Illumina/ is important because an unblocked 3′-OH group is the
surface. This wave propagates Solexa, and fIG. 2c illustrates a one-colour CRT cycle natural substrate for incorporating the next incoming
across a boundary surface, used by Helicos BioSciences. nucleotide. Cleavage of only a single bond is required
such as a glass slide, resulting
The key to the CRT method is the reversible ter- to remove both the terminating or inhibiting group and
in the excitation of fluorescent
molecules near (<200 nm) or minator, of which there are two types: 3′ blocked and the fluorophore group from the nucleobase, which is a
at the surface and the 3′ unblocked (BOX 1). The use of a dideoxynucleotide, more efficient strategy than 3′-blocked terminators for
subsequent collection of their which acts as a chain terminator in Sanger sequenc- restoring the nucleotide for the next CRT cycle.
emission signals by a detector. ing, provided the basis for the initial development Helicos BioSciences was the first group to commer-
Libraries of mutant DNA
of reversible blocking groups attached to the 3′ end of cialize a single-molecule sequencer, the HeliScope, which
polymerases nucleotides19,20. Blocking groups, such as 3′-O-allyl- was based on the work of Quake and colleagues34. The
Large numbers of genetically 2′-deoxyribonucleoside triphosphates (dNTPs)21 and HeliScope uses the single-molecule template methods
engineered DNA polymerases 3′-O-azidomethyl-dNTPs22, have been successfully used shown in fIG. 1c and fIG. 1d coupled with the one-colour
can be created by either
in CRT. 3′-blocked terminators require the cleavage of (Cy5 dye) CRT method shown in fIG. 2c. Incorporation
site-directed or random
mutagenesis, which leads two chemical bonds to remove the fluorophore from the of a nucleotide results in a fluorescent signal. The
to one or more amino acid nucleobase and restore the 3′-OH group. HeliScope also uses TIRF to image the Cy5 dye34, the
substitutions, insertions and/or Currently, the Illumina/Solexa Genome Analyzer imaging output of which is shown in fIG. 2d. Harris and
deletions in the polymerase. (GA)23 dominates the NGS market. It uses the clonally colleagues14 used Cy5-12ss-dNTPs, which are earlier ver-
The goal of this approach is
to incorporate modified
amplified template method illustrated in fIG. 1b, coupled sions of their virtual Terminators that lack the inhibiting
nucleotides more efficiently with the four-colour CRT method illustrated in fIG. 2a. group, and reported that deletion errors in homopoly-
during the sequencing reaction. The four colours are detected by total internal reflection meric repeat regions were the most common error type
fluorescence (TIRF) imaging using two lasers, the output (~5% frequency) when using the primer-immobilized
Consensus reads
of which is depicted in fIG. 2b. The slide is partitioned strategy shown in fIG. 1c. This is likely to be related
These are only useful for
single-molecule techniques and into eight channels, which allows independent sam- to the incorporation of two or more Cy5-12ss-dNTPs
are produced by sequencing ples to be run simultaneously. TABLe 1 shows the cur- in a given cycle. These errors can be greatly reduced
the same template molecule rent sequencing statistics of the Illumina/Solexa GA II with two-pass sequencing, which provides ~25-base
more than once. The data are platform operating at the Baylor College of medicine consensus reads using the template-immobilized strat-
then aligned to produce a
‘consensus read’, reducing
Human Genome Sequencing Center (BCm-HGSC; egy shown in fIG. 1d. At the 2009 Advances in Genome
stochastic errors that may D. muzny, personal communication). Substitutions are Biology and Technology (AGBT) meeting, the Helicos
occur in a given sequence read. the most common error type, with a higher portion of group reported their recent progress in sequencing the
HN Illumina/Solexa O
Fluor
O
NH
HN
O
O NO2
Lightning Terminator
(LaserGen, Inc.) HN O
O
O
O N
O NH N3 O HO O O O
P P P
O O
–O O –O O –O O
HN O OH
Ju et al. Fluor
O N
O NH
HO O O O
P P P O
O O HN O
–O O –O O –O O
O S O
HN N S
O H
HN NH
O N
HO O O O O N
P P P
O
–O O –O O –O O HO O O O
P P P O
At the core of most O
–O O –O O –O O
O N3
next-generation sequencing HN N
(NGS) methods is the use of OH
dye-labelled modified nucleotides. Ideally, these nucleotides are Virtual Terminator O
(Helicos BioSciences) O
incorporated specifically, cleaved efficiently during or following
fluorescence imaging, and extended as modified or natural bases O OH
in ensuing cycles. In the figure, red chemical structures denote P O
HO
terminating functional groups, except in the Helicos BioSciences O–
structure, which is characterized by an inhibitory function33.
Arrows indicate the site of cleavage separating the fluorophore
from the nucleotide, and the blue chemical structures denote
c Real-time nucleotides O
Incorporate F Incorporate F F
C G T A C G T F C G F
all four F F F G A C single, C C G
F F F
nucleotides, dye-labelled
each label nucleotides Each cycle,
with a add a
different dye different
dye-labelled
dNTP
F
C G T C
G
G
A
T
C F G F
F F F C C G
F F F
Wash, four- Wash, one-
colour imaging colour imaging
C G T C G T G
Cleave dye G A C Cleave dye C C G
and terminating and inhibiting
groups, wash groups, cap,
wash
b d
C T A G
C T A G
C A
Top: CATCGT
T G Bottom: CCCCCC Top: CTAGTG
Bottom: CAGCTA
Figure 2 | Four-colour and one-colour cyclic reversible termination methods. a | The four-colour cyclic reversible
termination (CRT) method uses Illumina/Solexa’s 3′-O-azidomethyl reversible terminator chemistry Nature23,101
(BOX 1)
Reviews using
| Genetics
solid-phase-amplified template clusters (fIG. 1b, shown as single templates for illustrative purposes). Following
imaging, a cleavage step removes the fluorescent dyes and regenerates the 3′-OH group using the reducing agent
tris(2-carboxyethyl)phosphine (TCEP)23. b | The four-colour images highlight the sequencing data from two clonally
amplified templates. c | Unlike Illumina/Solexa’s terminators, the Helicos Virtual Terminators33 are labelled with the
same dye and dispensed individually in a predetermined order, analogous to a single-nucleotide addition method.
Following total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and inhibitory
groups using TCEP to permit the addition of the next Cy5-2′-deoxyribonucleoside triphosphate (dNTP) analogue. The
free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition33 (step not shown).
One-base-encoded probe d | The one-colour images highlight the sequencing data from two single-molecule templates.
An oligonucleotide sequence in
which one interrogation base is
associated with a particular
dye (for example, A in the first
Caenorhabditis elegans genome. From a single HeliScope Sequencing by ligation. SBL is another cyclic method
position corresponds to a green
dye). An example of a one-base run using only 7 of the instrument’s 50 channels, approx- that differs from CRT in its use of DNA ligase35 and
degenerate probe set is imately 2.8 Gb of high-quality data were generated in either one-base-encoded probes or two-base-encoded
‘1-probes’, which indicates 8 days from >25-base consensus reads with 0, 1 or 2 probes. In its simplest form, a fluorescently labelled
that the first nucleotide is the errors. Greater than 99% coverage of the genome was probe hybridizes to its complementary sequence adja-
interrogation base. The
remaining bases consist of
reported, and for regions that showed >5-fold coverage, cent to the primed template. DNA ligase is then added
either degenerate (four possible the consensus accuracy was 99.999% (j. w. efcavitch, to join the dye-labelled probe to the primer. Non-ligated
bases) or universal bases. personal communication). probes are washed away, followed by fluorescence
imaging to determine the identity of the ligated probe36. then with the A1 primer but using 3-probes, and so
The cycle can be repeated either by using cleavable on. The other three primers, A2, A3 and A4, were then
probes to remove the fluorescent dye and regenerate cycled in an analogous manner to yield six (A2 and A4)
a 5′-PO4 group for subsequent ligation cycles (fIG. 3a) and seven (A1 and A3) base reads (albeit discontiguous)
or by removing and hybridizing a new primer to the from each genomic end, making a total of 26 base reads
template (not shown in the figure). per mate-pair template. From two instrument runs, the
Two-base-encoded probe Shendure and colleagues11 used the SBL method to authors reported the production of approximately 48
An oligonucleotide sequence sequence the Escherichia coli mG1655 genome. mate- million high-quality bases, which mapped to about 70%
in which two interrogation pair templates were prepared with four priming sites of the E. coli genome11. This SBL method is being used
bases are associated with a
(named A1 to A4) and were amplified by emPCR (fIG. 1a). on the Polonator instrument.
particular dye (for example,
AA, CC, GG and TT are coded A number of one-base-encoded probes, 1-probes to Life/APG has commercialized their SBL platform
with a blue dye). ‘1,2-probes’ 7-probes, were used. In the first SBL cycle, the A1 primer called support oligonucleotide ligation detection
indicates that the first and was annealed to the template, followed by the hybridiza- (SOLiD)37. The method uses two-base-encoded probes,
second nucleotides are the tion and ligation of 1-probes, four-colour imaging and which has the primary advantage of improved accuracy
interrogation bases. The
remaining bases consist
removal of the entire primer–probe strand from the in colour calling and SNv calling, the latter of which
of either degenerate or solid-phase-bound template. The SBL cycle was then requires an adjacent valid colour change. Colour space
universal bases. repeated with the A1 primer but using 2-probes, and is a unique feature of the SOLiD system. A primer is
a c
Life/APG — Sequencing by ligation P OH Roche/454 — Pyrosequencing
Primer round 1 + Ligase 1–2 million template beads loaded into PTP wells
3′ 5′ AT
xynnnzzz P
3′
TA
3′ 5′
xynnnzzz
Polymerase
APS
PPi
Primer round 2 1 base shift
Universal seq –1 Sulphurylase
primer (n – 1) ATP
AA CT GC TG AT CC CG Luciferase Luciferin
3′
3′
T GA CG AC TA GG GC
Reset primer three more times Light and oxyluciferin
C CG CA CC TC 3 3-mer
G GC GT GG AG SNP 2 2-mer
T TA TG TT CT 1 1-mer
TCGGATTCAGCCTGCTGCTCTATCA
A 0
Figure 3 | next-generation sequencing technologies that use emulsion phosphoramidates 107, which are cleaved by ribonucleases and acid,
PcR. a | A four-colour sequencing by ligation method using Life/APG’s respectively. b | A two-base encoding scheme inNature
which Reviews | Genetics
four dinucleotide
support oligonucleotide ligation detection (SOLiD) platform is shown. sequences are associated with one colour (for example, AA, CC, GG and TT
Upon the annealing of a universal primer, a library of 1,2-probes is added. are coded with a blue dye). Each template base is interrogated twice and
Unlike polymerization, the ligation of a probe to the primer can be compiled into a string of colour-space data bits. The colour-space reads are
performed bi-directionally from either its 5′-PO4 or 3′-OH end. Appropriate aligned to a colour-space reference sequence to decode the DNA
conditions enable the selective hybridization and ligation of probes to sequence. c | Pyrosequencing using Roche/454’s Titanium platform.
complementary positions. Following four-colour imaging, the ligated Following loading of the DNA-amplified beads into individual PicoTiterPlate
1,2-probes are chemically cleaved with silver ions to generate a 5′-PO4 (PTP) wells, additional beads, coupled with sulphurylase and luciferase, are
group. The SOLiD cycle is repeated nine more times. The extended primer added. In this example, a single type of 2′-deoxyribonucleoside
is then stripped and four more ligation rounds are performed, each with triphosphate (dNTP) — cytosine — is shown flowing across the PTP wells.
ten ligation cycles. The 1,2-probes are designed to interrogate the first (x) The fibre-optic slide is mounted in a flow chamber, enabling the delivery of
and second (y) positions adjacent to the hybridized primer, such that the sequencing reagents to the bead-packed wells. The underneath of the
16 dinucleotides are encoded by four dyes (coloured stars). The probes also fibre-optic slide is directly attached to a high-resolution charge-coupled
contain inosine bases (z) to reduce the complexity of the 1,2-probe library device (CCD) camera, which allows detection of the light generated from
and a phosphorothiolate linkage between the fifth and six nucleotides of each PTP well undergoing the pyrosequencing reaction. d | The light
the probe sequence, which is cleaved with silver ions106. Other cleavable generated by the enzymatic cascade is recorded as a series of peaks called
probe designs include RNA nucleotides 107,108 and internucleosidic a flowgram. PPi, inorganic pyrophosphate.
hybridized to templates amplified by emPCR (fIG. 1a). require the run time to be doubled for the sequencing
The SOLiD cycle of 1,2-probe hybridization and liga- of mate-pair templates. For homopolymeric repeats of
tion, imaging, and probe cleavage is repeated ten times up to six nucleotides, the number of dNTPs added is
to yield ten colour calls spaced in five-base intervals directly proportional to the light signal. Insertions are
(fIG. 3a). The extended primer is then stripped from the the most common error type, followed by deletions.
solid-phase-bound templates. A second ligation round
is performed with an ‘n – 1’ primer, which resets the Real-time sequencing. The next technology method
interrogation bases and the corresponding ten colour to hit the commercial sector is likely to be real-time
calls one position to the left. Ten ligation cycles ensue, sequencing, and Pacific Biosciences is currently lead-
followed by three more rounds of ligation cycles. Colour ing this effort 15. unlike reversible terminators, real-time
calls from the five ligation rounds are then ordered into nucleotides do not halt the process of DNA synthesis.
Adjacent valid colour a linear sequence (that is, the colour space) and aligned Simply put, the method of real-time sequencing involves
A nucleotide substitution will to a reference genome to decode the DNA sequence imaging the continuous incorporation of dye-labelled
have two colour calls, one from
(fIG. 3b). SOLiD uses two slides per run; each can be nucleotides during DNA synthesis42. with the Pacific
the 5′ position and one
from the 3′ position of the partitioned into four or eight regions called spots. Biosciences platform, single DNA polymerase mol-
dinucleotide sequence. When TABLe 1 depicts the current sequencing statistics of ecules are attached to the bottom surface of individual
compared with a reference the Life/APG platform operating at the BCm-HGSC zero-mode waveguide detectors (Zmw detectors)43 (fIG. 4a)
genome, base substitution in
(D. muzny, personal communication). Substitutions are that can obtain sequence information while phos-
the target sequence is encoded
by two specific, adjacent the most common error type. Similar to the genome pholinked nucleotides (BOX 1) are being incorporated
colours. In figure 3b, the analysis of Illumina/Solexa reads, SOLiD data have also into the growing primer strand15 (fIG. 4b).
sequence ‘CCT’ is encoded revealed an underrepresentation of AT-rich and GC-rich Other approaches have been proposed to enhance
as blue-yellow (‘CC’ = blue; regions26. Shen and colleagues38 recently showed that signal-to-noise measurements in real-time sequencing
‘CT’ = yellow), but substituting
the middle ‘C’ for ‘A’ would
mAQ alignment of SOLiD data may be undercalling using more conventional detection schemes. For exam-
result in two colour changes to true variants. ple, Life/visiGen has engineered DNA polymerases
green-red. Any other colour with an attached fluorescent dye that, upon incor-
sequence can be discarded as Single-nucleotide addition: py rosequencing. poration of their γ-labelled nucleotides, produce
an error.
Pyrosequencing is a non-electrophoretic, biolumines- an enhanced signal by fluorescence resonance energy
Colour space cence method that measures the release of inorganic transfer16. LI-COR Biosciences, whose technology was
With two-base-encoded pyrophosphate by proportionally converting it into acquired by Pacific Biosciences, has been developing
probes, the fluorescent signal visible light using a series of enzymatic reactions39,40 dye-quencher nucleotides (BOX 1), which in their native
or colour obtained during (fIG. 3c). unlike other sequencing approaches that use state produce low signals owing to the presence of a
imaging is associated with four
dinucleotide sequences having
modified nucleotides to terminate DNA synthesis, the quencher group attached to the base. The release and
a 5′- and 3′-base. Colour space pyrosequencing method manipulates DNA polymerase diffusion of the dye-labelled pyrophosphate analogue
is the sequence of overlapping by the single addition of a dNTP in limiting amounts. away from the immobilized DNA polymerase produces a
dinucleotides that codes four upon incorporation of the complementary dNTP, DNA fluorescent signal17.
simultaneous nucleotide
polymerase extends the primer and pauses. DNA syn- Pacific Biosciences used the highly processive, strand-
sequences. Alignment with a
reference genome is the most thesis is reinitiated following the addition of the next displacing φ29 DNA polymerase because it efficiently
accurate method for translating complementary dNTP in the dispensing cycle. The incorporates phospholinked nucleotides and enables the
colour space into a single order and intensity of the light peaks are recorded resequencing of closed circular templates15. To assess
nucleotide sequence. as flowgrams, which reveal the underlying DNA the accuracy of this method, a four-colour sequencing
Zero-mode waveguide
sequence (fIG. 3d). experiment was conducted using a known 150 bp linear
detectors margulies and colleagues41 described the first NGS template. Base calls from the real-time reads were deter-
This nanostructure device platform to integrate pyrosequencing using their PTP mined from their corresponding fluorescence pulses
is 100 nm in diameter, which is device. Commercialized by Roche/454, the instrument (fIG. 4b). when the reads were compared to a known
smaller than the 532 nm and
uses DNA templates prepared by emPCR (fIG. 1a), with sequence, 27 errors consisting of deletions, insertions
643 nm laser wavelengths used
in the Pacific Biosciences 1–2 million beads deposited into PTP wells. Roche/454 and mismatches were identified, corresponding to a
platform. Light cannot recently released a titanium-coated PTP design, which read accuracy of approximately 83% (131/158). Factors
propagate through these substantially increases read length and improves data that led to sequencing errors included extremely short
small waveguides, hence the quality by reducing crosstalk between adjacent wells interphase intervals between two incorporation events,
term zero-mode. These
aluminium-clad waveguides
containing single clonally amplified beads (T. Harkins, and the binding and release of nucleotides in the active
are designed to produce an personal communication). Smaller beads, which have site before incorporation into the primer strand. Given
evanescent wave (see the ‘total sulphurylase and luciferase attached to them to facilitate that most errors appear as stochastic events, the authors
internal reflection fluorescence’ light production, are loaded into wells surrounding the showed that repeated sequencing of the same template
glossary term) that substantially
template beads. Individual dNTPs are then streamed molecule 15 times or more could improve the consen-
reduces the observation
volume at the surface of the across the wells and dispensed in a predetermined sus read accuracy to >99%15. At the 2009 AGBT meeting,
polymerase reaction down to sequential order. The bioluminescence is imaged with Pacific Biosciences reported improvements to their plat-
the zeptolitre range (10–21 l). a charge-coupled device (CCD) camera (fIG. 3c). TABLe 1 form; when it was used to sequence the E. coli genome
This provides an advantage for shows the current sequencing statistics of the Roche/454 at 38-fold base coverage, 99.3% genome coverage was
the polymerization reaction,
which can be performed at
platform operating at the BCm-HGSC (D. muzny, per- obtained. The consensus accuracy reached was >99.999%
higher dye-labelled nucleotide sonal communication). unlike platforms that produce for the entire genome, with read lengths averaging
concentrations. shorter read lengths, the Roche/454 platform does not 964 bases (S. Turner, personal communication).
G A T C
100 nm
Limit of detection zone
genome alignment and assembly (averaging 258 bases), derived from 3-kb sized mate-pair
After NGS reads have been generated, they are aligned to genomic libraries, could capture a larger fraction of
a known reference sequence or assembled de novo8,44,45. Svs in the human genome, although this approach
The decision to use either strategy is based on the still identified fewer Svs than traditional fosmid-end
Fluorescence resonance intended biological application as well as cost, effort and sequencing approaches54.
energy transfer time considerations. For example, identifying and cata- De novo assemblies have been reported for bacte-
This is generally a system that loguing genetic variation in multiple strains of highly rial genomes and mammalian bacterial artificial chro-
consists of two fluorescent
related genomes, such as those found in specific species mosomes55–59, but substantial challenges exist for their
dyes, one being a donor dye
(a bluer fluorophore) and of bacteria46–51, C. elegans 25,30,38 and Arabidopsis thal- application to human genomes. A reasonable strategy for
the other an acceptor dye iana52, can be accomplished by aligning NGS reads to improving the quality of the alignment or assembly has
(a redder fluorophore). When their reference genomes. This approach is substantially been to increase the read coverage. An article by Frazer
the two dye molecules are cheaper and faster than Sanger sequencing. SNvs can be and colleagues26 challenges this approach by reporting
brought into close proximity
(usually ≤30 nm), the energy
readily identified, although in many cases, validation of systematic variability in local sequence coverage that
from the excited donor dye is these findings is required. was specific to different human genomic regions for the
transferred to the acceptor There are limitations to the alignment approach, such Roche/454, Illumina/Solexa and Life/APG platforms
dye, increasing its emission as placing reads within repetitive regions in the reference (other commercially available platforms were not evalu-
intensity signal.
genome or in corresponding regions that may not exist ated). Because each NGS platform examined produced a
Structural variants in the reference genome28; the latter situation may result uniquely reproducible pattern of variable sequence cov-
All sequence variants other from gaps in the reference genome or the presence of erage, the mixing of different NGS read types in the align-
than single-nucleotide structural variants (Svs) in the genome being analysed. ment or assembly may remedy this shortcoming. Recently
variants, including block mate-pair reads can resolve the correct genome assign- it was reported that mixing Roche/454 and Illumina/
substitutions, insertions or
deletions, inversions,
ment for some repetitive regions as long as one read in Solexa read data resulted in improved de novo assem-
segmental duplications and the pair is unique to the genome. A study by egholm, blies of microbial genomes compared with assemblies
copy-number differences. Snyder and colleagues53 showed that Roche/454 read data based on data from either platform alone60,61.
Merging area
Biotin–UTP
Cut transcription
probes
b Solid-phase capture
Isolate
Solution hybridization
Target
gDNA
Affinity enrichment
Hybridize and wash
unbound fragments away
Extend and
ligate
MIP
Figure 5 | targeted capture scheme. a | A microfluidic nozzle creates aqueous droplets (8 pl) ofNature
forward- and| Genetics
Reviews
reverse-targeting primers in oil (not shown), which are dispensed into a channel in a microfluidic chip. Fragmented
genomic DNA and associated PCR reagents are separately dispensed as aqueous microdroplets (14 pl) and paired
together with the primer droplets at a 1/1 ratio. Paired droplets pass through a merging area for coalescence into
PCR-competent microdroplets, which are collected into a single tube for thermal cycling. b | Solid-phase capture
methods ligate adaptor sequences to fragmented genomic DNA before microarray hybridization. Following stringent
washing to remove non-selected genomic fragments, the enriched targets are eluted, PCR amplified and sequenced.
Adaptor sequences can also be designed specifically for a given next-generation sequencing platform, which
eliminates the PCR step. c | Solution-phase methods use custom-designed microarrays from Agilent Technologies to
synthesize long, target-specific oligonucleotides, which are cleaved as a pool of probes from the support and eluted
into a single tube. In the molecular inversion probe (MIP)-based approach, single-stranded probes (ss-probes) are
hybridized to their corresponding templates. DNA polymerase extends the 3′-end of the probes across the exon
region, and a ligation step creates closed circular DNAs. The biotinylated RNA-based approach introduces a T7
promoter sequence, which allows the incorporation of biotin-labelled uridine-5′-triphosphate (UTP) into the probe
sequence by in vitro transcription. Following solution hybridization with genomic targets, the RNA–DNA hybrids are
enriched by their binding to streptavidin-coated magnetic beads. RCA, rolling circle amplification.
Han Illumina/ 66% Frag: 1,921‡ 35 36 Aligned* 99.9 3.07 (SOAP) 35 500,000¶
Chinese Solexa 150–250 bp
male
34% MP: 135 bp 1,029 35
& 440 bp
Korean Illumina/ 21% Frag: 130 bp & 393‡ 36 27.8 Aligned* 99.8 3.45 (GSNAP) 30 200,000¶
male (AK1) Solexa 440 bp
79% MP: 130 bp, 1,156 36, 88,
390 bp & 2.7 kb 106
Korean Illumina/ MP: 100 bp, 1,647‡ 35, 74 29.0 Aligned* 99.9 3.44 (MAQ) 15 250,000¶,#
male (SJK) Solexa 200 bp & 300 bp
Yoruban Life/APG 9% Frag: 211‡ 50 17.9 Aligned* 98.6 3.87 9.5 60,000¶,**
male 100–500 bp (Corona-lite)
(NA18507)
91% MP: 2,075‡ 25, 50
600–3,500 bp
Stephen R. Helicos Frag: 100–500 bp 2,725‡ 32§ 28 Aligned* 90 2.81 4 48,000¶
Quake BioSciences (IndexDP)
AML Illumina/ Frag: 150–200 bp‡‡ 2,730‡,‡‡ 32 32.7 Aligned* 91 3.81‡‡ (MAQ) 98 1,600,000||||
female Solexa
Frag: 150–200 bp§§ 1,081‡,§§ 35 13.9 83 2.92§§ (MAQ) 34
AML male Illumina/ MP: 200–250 bp ‡‡
1,620 ‡,‡‡
35 23.3 Aligned* 98.5 3.46‡‡ (MAQ) 16.5 500,000||||
Solexa
MP: 200–250 bp§§ 1,351‡,§§ 50 21.3 97.4 3.45§§ (MAQ) 13.1
James R. Life/APG 16% Frag: 238 ‡
35 29.6 Aligned* 99.8 3.42 3 75,000¶,¶¶
Lupski 100–500 bp (Corona-lite)
CMT male
84% MP: 1,211‡ 25, 50
600–3,500 bp
*A minimum of one read aligning to the National Center for Biotechnology Information build 36 reference genome. ‡Mappable reads for aligned assemblies.
§
Average read-length. ||D. Wheeler, personal communication. ¶Reagent cost only. #S.-M. Ahn, personal communication. **K. McKernan, personal
communication. ‡‡Tumour sample. §§Normal sample. ||||Tumour & normal samples: reagent, instrument, labour, bioinformatics and data storage cost, E. Mardis,
personal communication. ¶¶R. Gibbs, personal communication. AML, acute myeloid leukaemia; BAC, bacterial artificial chromosome;
CMT, Charcot–Marie–Tooth disease; Frag, fragment; MP, mate-pair; N/A, not available; SNV, single-nucleotide variant.
Personal genomes. Human genome studies aim to The first group to apply NGS to whole human
catalogue SNvs and Svs and their association to pheno- genomes was Roche/454 in collaboration with Gibbs
typic differences, with the eventual goal of personalized and colleagues at the BCm-HGSC, who reported the
genomics for medical purposes. In 2004, the International diploid genome of james D. watson82 (TABLe 2). when
Human Genome Sequencing Consortium published the watson genome was compared with the reference
the first, and still only, finished-grade human reference genome, roughly 3.3 million SNvs were identified, but
genome (currently National Center for Biotechnology far fewer Svs were found than in the study by venter
Information (NCBI) build 36)1. Its cost was estimated and colleagues. This is important because undiscov-
at uS$300 million. In October 2007, venter and col- ered Svs could account for a substantial fraction of
leagues81 described the genome sequence of j. Craig the total number of sequence variants, many of which
venter using a whole-genome shotgun approach cou- could be potentially causative in disease 83–86. within
pled with automated Sanger sequencing (TABLe 2). when the past year, five additional human genomes have
the venter genome was compared with the reference been described23,87–91, one of which was sequenced on
genome, 3.2 million SNvs were identified. In addition, two different NGS platforms (TABLe 2). As with the
there were over 900,000 Svs, which altogether accounted watson genome, far fewer Svs were reported than in
for more variant bases than the SNvs. the study by venter and colleagues.
1. International Human Genome Consortium. Finishing 6. Branton, D. et al. The potential and challenges 10. Fedurco, M., Romieu, A., Williams, S., Lawrence, I. &
the euchromatic sequence of the human genome. of nanopore sequencing. Nature Biotech. 26, Turcatti, G. BTA, a novel reagent for DNA attachment on
Nature 431, 931–945 (2004). 1146–1153 (2008). glass and efficient generation of solid-phase amplified
2. Metzker, M. L. Emerging technologies in DNA An excellent review of the current state of DNA colonies. Nucleic Acids Res. 34, e22 (2006).
sequencing. Genome Res. 15, 1767–1776 nanopore sequencing that highlights recent 11. Shendure, J. et al. Accurate multiplex polony
(2005). accomplishments and remaining challenges in sequencing of an evolved bacterial genome. Science
3. Hutchison, C. A. III. DNA sequencing: bench to the field. 309, 1728–1732 (2005).
bedside and beyond. Nucleic Acids Res. 35, 7. Fan, J.-B., Chee, M. S. & Gunderson, K. L. This paper describes the development of the
6227–6237 (2007). Highly parallel genomic assays. Nature Rev. Genet. 7, non-cleavable SBL method and shows its
4. Wold, B. & Myers, R. M. Sequence census methods 632–644 (2006). feasibility by sequencing the E. coli genome.
for functional genomics. Nature Methods 5, 19–21 8. Pop, M. & Salzberg, S. L. Bioinformatics challenges The prototype described led to the development
(2008). of new sequencing technology. Trends Genet. 24, of the Polonator instrument.
5. Wang, Z., Gerstein, M. & Snyder, M. RNA-Seq: 142–149 (2008). 12. Kim, J. B. et al. Polony multiplex analysis of gene
a revolutionary tool for transcriptomics. Nature Rev. 9. Dressman, D., Yan, H., Traverso, G., Kinzler, K. W. & expression (PMAGE) in mouse hypertrophic
Genet. 10, 57–63 (2009). Vogelstein, B. Transforming single DNA cardiomyopathy. Science 316, 1481–1484 (2007).
The Review provides a comprehensive overview of molecules into fluorescent magnetic particles 13. Leamon, J. H. A massively parallel PicoTiterPlate
recent advances and challenges in techniques that for detection and enumeration of genetic variations. based platform for discrete picoliter-scale
are used in transcriptome profiling methods that Proc. Natl. Acad. Sci. USA 100, 8817–8822 polymerase chain reactions. Electrophoresis 24,
use NGS technologies (RNA–seq). (2003). 3769–3777 (2003).
14. Harris, T. D. et al. Single-molecule DNA sequencing of 37. Valouev, A. et al. A high-resolution, nucleosome 61. Reinhardt, J. A. et al. De novo assembly using
a viral genome. Science 320, 106–109 (2008). position map of C. elegans reveals a lack of universal low-coverage short read sequence data from the rice
Developers from Helicos BioSciences and sequence-dictated positioning. Genome Res. 18, pathogen Pseudomonas syringae pv. oryzae. Genome
colleagues describe the development of the first 1051–1063 (2008). Res. 19, 294–305 (2009).
single-molecule sequencing method using reversible This paper describes Life/APG’s SBL method, 62. Schloss, J. A. How to get genomes at one
terminators and demonstrate the technology by which uses cleavable two-base-encoded probes on ten-thousandth the cost. Nature Biotech. 26,
sequencing the M13 genome. the SOLiD platform. The authors demonstrate the 1113–1115 (2008).
15. Eid, J. et al. Real-time DNA sequencing from single technology through the application of genome-wide 63. Altshuler, D., Daly, M. J. & Lander, E. S.
polymerase molecules. Science 323, 133–138 (2009). nucleosome mapping in C. elegans. Genetic mapping in human disease. Science 322,
The authors describe the development of a 38. Shen, Y., Sarin, S., Liu, Y., Hobert, O. & Pe’er, I. 881–888 (2008).
real-time sequencing method using their ZMW Comparing platforms for C. elegans mutant 64. Wang, L. & Weinshilboum, R. M. Pharmacogenomics:
detection system and demonstrate its feasibility by identification using high-throughput whole-genome candidate gene identification, functional validation
sequencing synthetic templates. sequencing. PLoS ONE 3, e4012 (2008). and mechanisms. Hum. Mol. Genet. 17, R174–R179
16. Hardin, S., Gao, X., Briggs, J., Willson, R. & Tu, S.-C. 39. Ronaghi, M., Uhlén, M. & Nyrén, P. A sequencing (2008).
Methods for real-time single molecule sequence method based on real-time pyrophosphate. Science 65. Haaland, W. C. et al. A–β– subtype of ketosis-prone
determination. US Patent 7,329,492 (2000). 281, 363–365 (1998). diabetes is not predominantly a monogenic diabetic
17. Williams, J. G. K. System and methods for nucleic acid 40. Ronaghi, M., Karamohamed, S., Pettersson, B., syndrome. Diabetes Care 32, 873–877 (2009).
sequencing of single molecules by polymerase Uhlén, M. & Nyrén, P. Real-time DNA sequencing 66. Tewhey, R. et al. Microdroplet-based PCR enrichment
synthesis. US Patent 6,255,083 (1998). using detection of pyrophosphate release. Anal. for large-scale targeted sequencing. Nature Biotech.
18. Erlich, Y., Mitra, P. P., delaBastide, M., McCombie, W. R. Biochem. 242, 84–89 (1996). 27, 1025–1031 (2009).
& Hannon, G. J. Alta-Cyclic: a self-optimizing base 41. Margulies, M. et al. Genome sequencing in 67. Singh-Gasson, S. et al. Maskless fabrication of
caller for next-generation sequencing. Nature microfabricated high-density picolitre reactors. Nature light-directed oligonucleotide microarrays using
Methods 5, 679–682 (2008). 437, 376–380 (2005). a digital micromirror array. Nature Biotech. 17,
19. Metzker, M. L. et al. Termination of DNA synthesis by The authors describe the development of the first 974–978 (1999).
novel 3′-modified deoxyribonucleoside triphosphates. NGS technology using the pyrosequencing method 68. Albert, T. J. et al. Direct selection of human genomic
Nucleic Acids Res. 22, 4259–4267 (1994). and demonstrate its feasibility through the loci by microarray hybridization. Nature Methods 4,
20. Canard, B. & Sarfati, R. DNA polymerase fluorescent sequencing and de novo assembly of the 903–905 (2007).
substrates with reversible 3′-tags. Gene 148, 1–6 Mycoplasma genitalium genome. 69. Hodges, E. et al. Genome-wide in situ exon capture
(1994). 42. Metzker, M. L. Sequencing in real time. Nature for selective resequencing. Nature Genet. 39,
21. Ju, J. et al. Four-color DNA sequencing by synthesis Biotech. 27, 150–151 (2009). 1522–1527 (2007).
using cleavable fluorescent nucleotide reversible 43. Levene, M. J. et al. Zero-mode waveguides for single- 70. Okou, D. T. et al. Microarray-based genomic selection
terminators. Proc. Natl. Acad. Sci. USA 103, molecule analysis at high concentrations. Science for high-throughput resequencing. Nature Methods 4,
19635–19640 (2006). 299, 682–686 (2003). 907–909 (2007).
22. Guo, J. et al. Four-color DNA sequencing with 44. Trapnell, C. & Salzberg, S. L. How to map billions 71. Porreca, G. J. et al. Multiplex amplification of large
3′-O-modified nucleotide reversible terminators and of short reads onto genomes. Nature Biotech. 27, sets of human exons. Nature Methods 4, 931–936
chemically cleavable fluorescent dideoxynucleotides. 455–457 (2009). (2007).
Proc. Natl Acad. Sci. USA 105, 9145–9150 (2008). 45. Chaisson, M. J., Brinza, D. & Pevzner, P. A. 72. Krishnakumar, S. et al. A comprehensive assay
23. Bentley, D. R. et al. Accurate whole human genome De novo fragment assembly with short mate-paired for targeted multiplex amplification of human
sequencing using reversible terminator chemistry. reads: does the read length matter? Genome Res. 19, DNA sequences. Proc. Natl Acad. Sci. USA 105,
Nature 456, 53–59 (2008). 336–346 (2009). 9296–9301 (2008).
Developers from Illumina/Solexa and colleagues 46. Hofreuter, D. et al. Unique features of a highly 73. Turner, E. H., Lee, C., Ng, S. B., Nickerson, D. A. &
report details on their reversible terminator pathogenic Campylobacter jejuni strain. Infect. Shendure, J. Massively parallel exon capture and
platform and demonstrate the technology by Immun. 74, 4694–4707 (2006). library-free resequencing across 16 genomes. Nature
sequencing a flow-sorted X chromosome and the 47. Holt, K. E. et al. High-throughput sequencing Methods 6, 315–316 (2009).
genome from a Yoruban male. provides insights into genome variation and 74. Gnirke, A. et al. Solution hybrid selection with ultra-
24. Dohm, J. C., Lottaz, C., Borodina, T. & Himmelbauer, H. evolution in Salmonella Typhi. Nature Genet. 40, long oligonucleotides for massively parallel targeted
Substantial biases in ultra-short read data sets from 987–993 (2008). sequencing. Nature Biotech. 27, 182–189 (2009).
high-throughput DNA sequencing. Nucleic Acids Res. 48. Srivatsan, A. et al. High-precision, whole-genome 75. Olson, M. Enrichment of super-sized resequencing
36, e105 (2008). sequencing of laboratory strains facilitates genetic targets from the human genome. Nature Methods 4,
25. Hillier, L. W. et al. Whole-genome sequencing and studies. PLoS Genet. 4, e1000139 (2008). 891–892 (2007).
variant discovery in C. elegans. Nature Methods 5, 49. Suchland, R. J. et al. Identification of concomitant 76. Garber, K. Fixing the front end. Nature Biotech. 26,
183–188 (2008). infection with Chlamydia trachomatis IncA-negative 1101–1104 (2008).
26. Harismendy, O. et al. Evaluation of next generation mutant and wild-type strains by genomic, 77. Petrosino, J. F., Highlander, S., Luna, R. A., Gibbs, R. A.
sequencing platforms for population targeted transcriptional, and biological characterizations. & Versalovic, J. Metagenomic pyrosequencing and
sequencing studies. Genome Biol. 10, R32 (2009). Infect. Immun. 76, 5438–5446 (2008). microbial identification. Clin. Chem. 55, 856–866
27. Li, H., Ruan, J. & Durbin, R. Mapping short DNA 50. Nusbaum, C. et al. Sensitive, specific polymorphism (2009).
sequencing reads and calling variants using mapping discovery in bacteria using massively parallel These authors describe the current state of
quality scores. Genome Res. 18, 1851–1858 (2008). sequencing. Nature Methods 6, 67–69 (2009). metagenomics research and highlight the use of the
28. Frazer, K. A., Murray, S. S., Schork, N. J. & Topol, E. J. 51. Moran, N. A., McLaughlin, H. J. & Sorek, R. Roche/454 platform for microbial identification
Human genetic variation and its contribution to The dynamics and time scale of ongoing genomic through 16S ribosomal DNA phylogenetic analysis;
complex traits. Nature Rev. Genet. 10, 241–251 erosion in symbiotic bacteria. Science 323, other NGS platforms may be better suited for gene
(2009). 379–382 (2009). discovery efforts (see Table 2).
29. Ley, T. J. et al. DNA sequencing of a cytogenetically 52. Ossowski, S. et al. Sequencing of natural strains 78. Lipson, D. et al. Quantification of the yeast
normal acute myeloid leukaemia genome. Nature of Arabidopsis thaliana with short reads. Genome Res. transcriptome by single-molecule sequencing. Nature
456, 66–72 (2008). 18, 2024–2033 (2008). Biotech. 27, 652–658 (2009).
30. Sarin, S., Prabhu, S., O’Meara, M. M., Pe’er, I. & 53. Korbel, J. O. et al. Paired-end mapping reveals 79. Ozsolak, F. et al. Direct RNA sequencing. Nature 461,
Hobert, O. Caenorhabditis elegans mutant allele extensive structural variation in the human genome. 814–818 (2009).
identification by whole-genome sequencing. Nature Science 318, 420–426 (2007). 80. Park, P. J. ChIP–seq: advantages and challenges
Methods 5, 865–867 (2008). 54. Kidd, J. M. et al. Mapping and sequencing of of a maturing technology. Nature Rev. Genet. 10,
31. Wu, W. et al. Termination of DNA synthesis by structural variation from eight human genomes. 669–680 (2009).
N6-alkylated, not 3′-O-alkylated, photocleavable Nature 453, 56–64 (2008). The article provides a comprehensive review of
2′-deoxyadenosine triphosphates. Nucleic Acid Res. 55. Warren, R. L., Sutton, G. G., Jones, S. J. M. & recent technological advances and challenges in
35, 6339–6349 (2007). Holt, R. A. Assembling millions of short DNA genome-wide profiling of DNA-binding proteins,
32. Wu, W., Litosh, V. A., Stupi, B. P. & Metzker, M. L. sequences using SSAKE. Bioinformatics 23, 500–501 histone modifications and nucleosomes using NGS
Photocleavable labeled nucleotides and nucleosides (2007). technologies (ChIP–seq).
and methods for their use in DNA sequencing. US 56. Chaisson, M. J. & Pevzner, P. A. Short read fragment 81. Levy, S. et al. The diploid genome sequence of an
Patent Application 11/567,189 (2009). assembly of bacterial genomes. Genome Res. 18, individual human. PLoS Biol. 5, e254 (2007).
33. Bowers, J. et al. Virtual terminator nucleotides for 324–330 (2008). 82. Wheeler, D. A. et al. The complete genome of an
next-generation DNA sequencing. Nature Methods 6, 57. Hernandez, D., François, P., Farinelli, L., Østerås, M. & individual by massively parallel DNA sequencing.
593–595 (2009). Schrenzel, J. De novo bacterial genome sequencing: Nature 452, 872–876 (2008).
34. Braslavsky, I., Hebert, B., Kartalov, E. & Quake, S. R. millions of very short reads assembled on a desktop 83. Iafrate, A. J. et al. Detection of large-scale variation in
Sequence information can be obtained from single computer. Genome Res. 18, 802–809 (2008). the human genome. Nature Genet. 36, 949–951
DNA molecules. Proc. Natl. Acad. Sci. USA 100, 58. Butler, J. et al. ALLPATHS: de novo assembly of (2004).
3960–3964 (2003). whole-genome shotgun microreads. Genome Res. 18, 84. Sebat, J. et al. Large-scale copy number
35. Tomkinson, A. E., Vijayakumar, S., Pascal, J. M. & 810–820 (2008). polymorphism in the human genome. Science 305,
Ellenberger, T. DNA ligases: structure, reaction 59. Zerbino, D. R. & Birney, E. Velvet: algorithms for 525–528 (2004).
mechanism, and function. Chem. Rev. 106, 687–699 de novo short read assembly using de Bruijn graphs. 85. Tuzun, E. et al. Fine-scale structural variation of the
(2006). Genome Res. 18, 821–829 (2008). human genome. Nature Genet. 37, 727–732 (2005).
36. Landegren, U., Kaiser, R., Sanders, J. & Hood, L. A 60. Aury, J.-M. et al. High quality draft sequences for 86. Stranger, B. E. et al. Relative impact of nucleotide and
ligase-mediated gene detection technique. Science prokaryotic genomes using a mix of new sequencing copy number variation on gene expression
241, 1077–1080 (1988). technologies. BMC Genomics 9, 603 (2008). phenotypes. Science 315, 848–853 (2007).
87. Wang, J. et al. The diploid genome sequence of an 100. Carthew, R. W. & Sontheimer, E. J. Origins and Acknowledgements
Asian individual. Nature 456, 60–65 (2008). mechanisms of miRNAs and siRNAs. Cell 136, I am extremely grateful to S.-M. Ahn, J. Edwards,
88. Kim, J. I. et al. A highly annotated whole-genome 642–655 (2009). J. W. Efcavitch, R. A. Gibbs, T. Harkin, E. Mardis, K. McKernan,
sequence of a Korean individual. Nature 460, 101. Barnes, C., Balasubramanian, S., Liu, X., D. Muzny, S. Turner and D. Wheeler for providing current
1011–1015 (2009). Swerdlow, H. & Milton, J. Labelled nucleotides. performance data for the NGS platforms, and to the National
89. Ahn, S. M. et al. The first Korean genome sequence US Patent 7,057,026 (2002). Human Genome Research Institute for their support from
and analysis: full genome sequencing for a socio-ethnic 102. Mitra, R. D., Shendure, J., Olejnik, J., grants R01 HG003573, R41 HG003072, R41 HG003265
group. Genome Res. 19, 1622–1629 (2009). Edyta-Krzymanska-Olejnik & Church, G. M. and R21 HG002443.
90. McKernan, K. J. et al. Sequence and structural Fluorescent in situ sequencing on polymerase
variation in a human genome uncovered by short- colonies. Anal. Biochem. 320, 55–65 (2003). Competing interests statement
read, massively parallel ligation sequencing using two- 103. Turcatti, G., Romieu, A., Fedurco, M. & The author declares competing financial interests: see Web
base encoding. Genome Res. 19, 1527–1541 (2009). Tairi, A.-P. A new class of cleavable fluorescent version for details.
91. Pushkarev, D., Neff, N. F. & Quake, S. R. nucleotides: synthesis and optimization as
Single-molecule sequencing of an individual human reversible terminators for DNA sequencing
genome. Nature Biotech. 27, 847–850 (2009). by synthesis. Nucleic Acids Res. 36, e25
92. Mardis, E. R. et al. Recurring mutations found by (2008). furtHer inforMation
sequencing an acute myeloid leukemia genome. 104. Yarbrough, L. R., Schlageck, J. G. & Baughman, M. Michael L. Metzker’s homepage:
N. Engl. J. Med. 361, 1058–1066 (2009). Synthesis and properties of fluorescent [Link]
93. Lupski, J. R. et al. Complete genome sequencing nucleotide substrates for DNA-dependent RNA 1000 Genomes Project: [Link]
identifies recessive alleles in SH3TC2 causing a CMT1 polymerases. J. Biol. Chem. 254, 12069–12073 Advances in Genome Biology and Technology meeting:
neuropathy. N. Engl. J. Med. (in the press). (1979). [Link]
94. Collins, F. S. & Barker, A. D. Mapping the cancer 105. Kumar, S. et al. Terminal phosphate labeled The Cancer Genome Atlas: [Link]
genome. Sci. Am. 296, 50–57 (2007). nucleotides: synthesis, applications, and linker The Exome Project:
95. Drmanac, R. et al. Human genome sequencing using effect on incorporation by DNA polymerases. [Link]
unchained base reads on self-assembling DNA Nucleosides Nucleotides Nucleic Acids 24, Human Microbiome Project:
nanoarrays. Science 5 Nov 2009 (doi:10.1126/ 401–408 (2005). [Link]
science.1181498). 106. McKernan, K., Blanchard, A., Kotler, L. & National Human Genome Research Institute:
96. Sanderson, K. Personal genomes: standard and pores. Costa, G. Reagents, methods, and libraries for [Link]
Nature 456, 23–25 (2008). bead-based sequencing. US Patent Application National Human Genome Research Institute — Fruitfly
97. Green, R. E. et al. Analysis of one million base pairs of 11/345,979 (2005). Genome Sequencing: [Link]
Neanderthal DNA. Nature 444, 330–336 (2006). 107. Macevicz, S. C. DNA sequencing by parallel Nature Reviews Genetics poster ‘Sequencing technologies
98. Briggs, A. W. et al. Targeted retrieval and analysis oligonucleotide extensions. US Patent 5,969,119 — the next generation’: [Link]
of five Neandertal mtDNA genomes. Science 325, (1995). posters/sequencing/[Link]
318–321 (2009). 108. Mir, K. U., Qi, H., Salata, O. & Scozzafava, G. Personal Genome Project:
99. Ponting, C. P., Oliver, P. L. & Reik, W. Evolution and Sequencing by cyclic ligation and cleavage (CycLiC) [Link]
functions of long noncoding RNAs. Cell 136, 629–641 directly on a microarray captured template. Nucleic ALL Links ARe ActiVe in the onLine PdF
(2009). Acids Res. 37, e5 (2009).