0% found this document useful (0 votes)
34 views1,386 pages

Matlab Prog

Uploaded by

Gaurav Singh
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
34 views1,386 pages

Matlab Prog

Uploaded by

Gaurav Singh
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

MATLAB®

Programming Fundamentals

R2020b
How to Contact MathWorks

Latest news: [Link]

Sales and services: [Link]/sales_and_services

User community: [Link]/matlabcentral

Technical support: [Link]/support/contact_us

Phone: 508-647-7000

The MathWorks, Inc.


1 Apple Hill Drive
Natick, MA 01760-2098
MATLAB Programming Fundamentals
© COPYRIGHT 1984–2020 by The MathWorks, Inc.
The software described in this document is furnished under a license agreement. The software may be used or copied
only under the terms of the license agreement. No part of this manual may be photocopied or reproduced in any form
without prior written consent from The MathWorks, Inc.
FEDERAL ACQUISITION: This provision applies to all acquisitions of the Program and Documentation by, for, or through
the federal government of the United States. By accepting delivery of the Program or Documentation, the government
hereby agrees that this software or documentation qualifies as commercial computer software or commercial computer
software documentation as such terms are used or defined in FAR 12.212, DFARS Part 227.72, and DFARS 252.227-7014.
Accordingly, the terms and conditions of this Agreement and only those rights specified in this Agreement, shall pertain
to and govern the use, modification, reproduction, release, performance, display, and disclosure of the Program and
Documentation by the federal government (or other entity acquiring for or through the federal government) and shall
supersede any conflicting contractual terms or conditions. If this License fails to meet the government's needs or is
inconsistent in any respect with federal procurement law, the government agrees to return the Program and
Documentation, unused, to The MathWorks, Inc.
Trademarks
MATLAB and Simulink are registered trademarks of The MathWorks, Inc. See
[Link]/trademarks for a list of additional trademarks. Other product or brand names may be
trademarks or registered trademarks of their respective holders.
Patents
MathWorks products are protected by one or more U.S. patents. Please see [Link]/patents for
more information.
Revision History
June 2004 First printing New for MATLAB 7.0 (Release 14)
October 2004 Online only Revised for MATLAB 7.0.1 (Release 14SP1)
March 2005 Online only Revised for MATLAB 7.0.4 (Release 14SP2)
June 2005 Second printing Minor revision for MATLAB 7.0.4
September 2005 Online only Revised for MATLAB 7.1 (Release 14SP3)
March 2006 Online only Revised for MATLAB 7.2 (Release 2006a)
September 2006 Online only Revised for MATLAB 7.3 (Release 2006b)
March 2007 Online only Revised for MATLAB 7.4 (Release 2007a)
September 2007 Online only Revised for Version 7.5 (Release 2007b)
March 2008 Online only Revised for Version 7.6 (Release 2008a)
October 2008 Online only Revised for Version 7.7 (Release 2008b)
March 2009 Online only Revised for Version 7.8 (Release 2009a)
September 2009 Online only Revised for Version 7.9 (Release 2009b)
March 2010 Online only Revised for Version 7.10 (Release 2010a)
September 2010 Online only Revised for Version 7.11 (Release 2010b)
April 2011 Online only Revised for Version 7.12 (Release 2011a)
September 2011 Online only Revised for Version 7.13 (Release 2011b)
March 2012 Online only Revised for Version 7.14 (Release 2012a)
September 2012 Online only Revised for Version 8.0 (Release 2012b)
March 2013 Online only Revised for Version 8.1 (Release 2013a)
September 2013 Online only Revised for Version 8.2 (Release 2013b)
March 2014 Online only Revised for Version 8.3 (Release 2014a)
October 2014 Online only Revised for Version 8.4 (Release 2014b)
March 2015 Online only Revised for Version 8.5 (Release 2015a)
September 2015 Online only Revised for Version 8.6 (Release 2015b)
October 2015 Online only Rereleased for Version 8.5.1 (Release 2015aSP1)
March 2016 Online only Revised for Version 9.0 (Release 2016a)
September 2016 Online only Revised for Version 9.1 (Release 2016b)
March 2017 Online only Revised for Version 9.2 (Release 2017a)
September 2017 Online only Revised for Version 9.3 (Release 2017b)
March 2018 Online only Revised for Version 9.4 (Release 2018a)
September 2018 Online only Revised for Version 9.5 (Release 2018b)
March 2019 Online only Revised for MATLAB 9.6 (Release 2019a)
September 2019 Online only Revised for MATLAB 9.7 (Release 2019b)
March 2020 Online only Revised for MATLAB 9.8 (Release 2020a)
September 2020 Online only Revised for MATLAB 9.9 (Release 2020b)
Contents

Language

Syntax Basics
1
Continue Long Statements on Multiple Lines . . . . . . . . . . . . . . . . . . . 1-2

Ignore Function Outputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-3

Variable Names . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-4


Valid Names . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-4
Conflicts with Function Names . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-4

Case and Space Sensitivity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-5

Command vs. Function Syntax . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-6


Command and Function Syntaxes . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-6
Avoid Common Syntax Mistakes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-6
How MATLAB Recognizes Command Syntax . . . . . . . . . . . . . . . . . . . 1-7

Common Errors When Calling Functions . . . . . . . . . . . . . . . . . . . . . . 1-9


Conflicting Function and Variable Names . . . . . . . . . . . . . . . . . . . . . 1-9
Undefined Functions or Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-9

Program Components
2
MATLAB Operators and Special Characters . . . . . . . . . . . . . . . . . . . . 2-2
Arithmetic Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-2
Relational Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-2
Logical Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-2
Special Characters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-3
String and Character Formatting . . . . . . . . . . . . . . . . . . . . . . . . . . 2-16

Array vs. Matrix Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-20


Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-20
Array Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-20
Matrix Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-22

Compatible Array Sizes for Basic Operations . . . . . . . . . . . . . . . . . . 2-25


Inputs with Compatible Sizes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-25

v
Inputs with Incompatible Sizes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-27
Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-27

Array Comparison with Relational Operators . . . . . . . . . . . . . . . . . . 2-29


Array Comparison . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-29
Logic Statements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-31

Operator Precedence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-32


Precedence of AND and OR Operators . . . . . . . . . . . . . . . . . . . . . . 2-32
Overriding Default Precedence . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-32

Average Similar Data Points Using a Tolerance . . . . . . . . . . . . . . . . 2-34

Group Scattered Data Using a Tolerance . . . . . . . . . . . . . . . . . . . . . . 2-36

Bit-Wise Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-38

Perform Cyclic Redundancy Check . . . . . . . . . . . . . . . . . . . . . . . . . . 2-44

Conditional Statements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-47

Loop Control Statements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-49

Regular Expressions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-51


What Is a Regular Expression? . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-51
Steps for Building Expressions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-52
Operators and Characters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-55

Lookahead Assertions in Regular Expressions . . . . . . . . . . . . . . . . . 2-63


Lookahead Assertions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-63
Overlapping Matches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-63
Logical AND Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-64

Tokens in Regular Expressions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-66


Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-66
Multiple Tokens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-68
Unmatched Tokens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-69
Tokens in Replacement Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-69
Named Capture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-70

Dynamic Regular Expressions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-72


Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-72
Dynamic Match Expressions — (??expr) . . . . . . . . . . . . . . . . . . . . . 2-73
Commands That Modify the Match Expression — (??@cmd) . . . . . . 2-73
Commands That Serve a Functional Purpose — (?@cmd) . . . . . . . . 2-74
Commands in Replacement Expressions — ${cmd} . . . . . . . . . . . . 2-76

Comma-Separated Lists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-79


What Is a Comma-Separated List? . . . . . . . . . . . . . . . . . . . . . . . . . 2-79
Generating a Comma-Separated List . . . . . . . . . . . . . . . . . . . . . . . . 2-79
Assigning Output from a Comma-Separated List . . . . . . . . . . . . . . . 2-81
Assigning to a Comma-Separated List . . . . . . . . . . . . . . . . . . . . . . . 2-81
How to Use the Comma-Separated Lists . . . . . . . . . . . . . . . . . . . . . 2-82
Fast Fourier Transform Example . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-84

vi Contents
Alternatives to the eval Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-86
Why Avoid the eval Function? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-86
Variables with Sequential Names . . . . . . . . . . . . . . . . . . . . . . . . . . 2-86
Files with Sequential Names . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-87
Function Names in Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-87
Field Names in Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-88
Error Handling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-88

Classes (Data Types)

Overview of MATLAB Classes


3
Fundamental MATLAB Classes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3-2

Numeric Classes
4
Integers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-2
Integer Classes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-2
Creating Integer Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-2
Arithmetic Operations on Integer Classes . . . . . . . . . . . . . . . . . . . . . 4-4
Largest and Smallest Values for Integer Classes . . . . . . . . . . . . . . . . 4-4

Floating-Point Numbers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-6


Double-Precision Floating Point . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-6
Single-Precision Floating Point . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-6
Creating Floating-Point Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-6
Arithmetic Operations on Floating-Point Numbers . . . . . . . . . . . . . . 4-8
Largest and Smallest Values for Floating-Point Classes . . . . . . . . . . . 4-9
Accuracy of Floating-Point Data . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-10
Avoiding Common Problems with Floating-Point Arithmetic . . . . . . 4-11

Create Complex Numbers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-13

Infinity and NaN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-14


Infinity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-14
NaN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-14

Identifying Numeric Classes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-16

Display Format for Numeric Values . . . . . . . . . . . . . . . . . . . . . . . . . . 4-17

Integer Arithmetic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-19

Single Precision Math . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-26

vii
The Logical Class
5
Find Array Elements That Meet a Condition . . . . . . . . . . . . . . . . . . . . 5-2

Reduce Logical Arrays to Single Value . . . . . . . . . . . . . . . . . . . . . . . . 5-6

Characters and Strings


6
Text in String and Character Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-2

Create String Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-5

Cell Arrays of Character Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-12


Create Cell Array of Character Vectors . . . . . . . . . . . . . . . . . . . . . . 6-12
Access Character Vectors in Cell Array . . . . . . . . . . . . . . . . . . . . . . 6-12
Convert Cell Arrays to String Arrays . . . . . . . . . . . . . . . . . . . . . . . . 6-13

Analyze Text Data with String Arrays . . . . . . . . . . . . . . . . . . . . . . . . . 6-15

Test for Empty Strings and Missing Values . . . . . . . . . . . . . . . . . . . . 6-20

Formatting Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-24


Fields of the Formatting Operator . . . . . . . . . . . . . . . . . . . . . . . . . . 6-24
Setting Field Width and Precision . . . . . . . . . . . . . . . . . . . . . . . . . . 6-28
Restrictions on Using Identifiers . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-30

Compare Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-32

Search and Replace Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-37

Build Pattern Expressions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-40

Convert Numeric Values to Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-45

Convert Text to Numeric Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-49

Unicode and ASCII Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-53

Hexadecimal and Binary Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-55

Frequently Asked Questions About String Arrays . . . . . . . . . . . . . . . 6-59


Why Does Using Command Form With Strings Return An Error? . . 6-59
Why Do Strings in Cell Arrays Return an Error? . . . . . . . . . . . . . . . 6-60
Why Does length() of String Return 1? . . . . . . . . . . . . . . . . . . . . . . 6-60
Why Does isempty("") Return 0? . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-61
Why Does Appending Strings Using Square Brackets Return Multiple
Strings? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-62

viii Contents
Update Your Code to Accept Strings . . . . . . . . . . . . . . . . . . . . . . . . . 6-64
What Are String Arrays? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-64
Recommended Approaches for String Adoption in Old APIs . . . . . . 6-64
How to Adopt String Arrays in Old APIs . . . . . . . . . . . . . . . . . . . . . 6-66
Recommended Approaches for String Adoption in New Code . . . . . 6-66
How to Maintain Compatibility in New Code . . . . . . . . . . . . . . . . . . 6-67
How to Manually Convert Input Arguments . . . . . . . . . . . . . . . . . . 6-68
How to Check Argument Data Types . . . . . . . . . . . . . . . . . . . . . . . . 6-68
Terminology for Character and String Arrays . . . . . . . . . . . . . . . . . 6-70

Function Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-72

Dates and Time


7
Represent Dates and Times in MATLAB . . . . . . . . . . . . . . . . . . . . . . . 7-2

Specify Time Zones . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-5

Convert Date and Time to Julian Date or POSIX Time . . . . . . . . . . . . 7-7

Set Date and Time Display Format . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-10


Formats for Individual Date and Duration Arrays . . . . . . . . . . . . . . 7-10
datetime Display Format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-10
duration Display Format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-11
calendarDuration Display Format . . . . . . . . . . . . . . . . . . . . . . . . . . 7-11
Default datetime Format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-12

Generate Sequence of Dates and Time . . . . . . . . . . . . . . . . . . . . . . . 7-14


Sequence of Datetime or Duration Values Between Endpoints with
Step Size . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-14
Add Duration or Calendar Duration to Create Sequence of Dates . . 7-16
Specify Length and Endpoints of Date or Duration Sequence . . . . . 7-17
Sequence of Datetime Values Using Calendar Rules . . . . . . . . . . . . 7-17

Share Code and Data Across Locales . . . . . . . . . . . . . . . . . . . . . . . . . 7-20


Write Locale-Independent Date and Time Code . . . . . . . . . . . . . . . . 7-20
Write Dates in Other Languages . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-21
Read Dates in Other Languages . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-21

Extract or Assign Date and Time Components of Datetime Array . . 7-23

Combine Date and Time from Separate Variables . . . . . . . . . . . . . . 7-26

Date and Time Arithmetic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-28

Compare Dates and Time . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-33

Plot Dates and Durations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-36


Line Plot with Dates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-36
Line Plot with Durations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-37
Scatter Plot with Dates and Durations . . . . . . . . . . . . . . . . . . . . . . 7-39

ix
Plots that Support Dates and Durations . . . . . . . . . . . . . . . . . . . . . 7-40

Core Functions Supporting Date and Time Arrays . . . . . . . . . . . . . . 7-41

Convert Between Datetime Arrays, Numbers, and Text . . . . . . . . . . 7-42


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-42
Convert Between Datetime and Character Vectors . . . . . . . . . . . . . 7-42
Convert Between Datetime and String Arrays . . . . . . . . . . . . . . . . . 7-44
Convert Between Datetime and Date Vectors . . . . . . . . . . . . . . . . . 7-44
Convert Serial Date Numbers to Datetime . . . . . . . . . . . . . . . . . . . 7-45
Convert Datetime Arrays to Numeric Values . . . . . . . . . . . . . . . . . . 7-45

Carryover in Date Vectors and Strings . . . . . . . . . . . . . . . . . . . . . . . . 7-47

Converting Date Vector Returns Unexpected Output . . . . . . . . . . . . 7-48

Categorical Arrays
8
Create Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-2

Convert Text in Table Variables to Categorical . . . . . . . . . . . . . . . . . . 8-6

Plot Categorical Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-10

Compare Categorical Array Elements . . . . . . . . . . . . . . . . . . . . . . . . 8-16

Combine Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-19

Combine Categorical Arrays Using Multiplication . . . . . . . . . . . . . . 8-22

Access Data Using Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . . . 8-24


Select Data By Category . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-24
Common Ways to Access Data Using Categorical Arrays . . . . . . . . . 8-24

Work with Protected Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . 8-30

Advantages of Using Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . 8-34


Natural Representation of Categorical Data . . . . . . . . . . . . . . . . . . 8-34
Mathematical Ordering for Character Vectors . . . . . . . . . . . . . . . . . 8-34
Reduce Memory Requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-34

Ordinal Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-36


Order of Categories . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-36
How to Create Ordinal Categorical Arrays . . . . . . . . . . . . . . . . . . . 8-36
Working with Ordinal Categorical Arrays . . . . . . . . . . . . . . . . . . . . 8-38

Core Functions Supporting Categorical Arrays . . . . . . . . . . . . . . . . 8-39

x Contents
Tables
9
Create and Work with Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-2

Add and Delete Table Rows . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-11

Add, Delete, and Rearrange Table Variables . . . . . . . . . . . . . . . . . . . 9-14

Clean Messy and Missing Data in Tables . . . . . . . . . . . . . . . . . . . . . . 9-21

Modify Units, Descriptions, and Table Variable Names . . . . . . . . . . 9-26

Add Custom Properties to Tables and Timetables . . . . . . . . . . . . . . 9-29

Access Data in Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-34


Summary of Table Indexing Syntaxes . . . . . . . . . . . . . . . . . . . . . . . 9-34
Tables Containing Specified Rows and Variables . . . . . . . . . . . . . . . 9-37
Extract Data Using Dot Notation and Logical Values . . . . . . . . . . . . 9-40
Dot Notation with Any Variable Name or Expression . . . . . . . . . . . . 9-42
Extract Data from Specified Rows and Variables . . . . . . . . . . . . . . . 9-44

Calculations on Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-47

Split Data into Groups and Calculate Statistics . . . . . . . . . . . . . . . . 9-50

Split Table Data Variables and Apply Functions . . . . . . . . . . . . . . . . 9-53

Advantages of Using Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-57

Grouping Variables To Split Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-62


Grouping Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-62
Group Definition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-62
The Split-Apply-Combine Workflow . . . . . . . . . . . . . . . . . . . . . . . . . 9-63
Missing Group Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9-63

Changes to DimensionNames Property in R2016b . . . . . . . . . . . . . . 9-65

Timetables
10
Create Timetables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10-2

Resample and Aggregate Data in Timetable . . . . . . . . . . . . . . . . . . . 10-5

Combine Timetables and Synchronize Their Data . . . . . . . . . . . . . . 10-8

Retime and Synchronize Timetable Variables Using Different


Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10-14

xi
Select Timetable Data by Row Time and Variable Type . . . . . . . . . 10-19

Clean Timetable with Missing, Duplicate, or Nonuniform Times


.................................................... 10-25

Using Row Labels in Table and Timetable Operations . . . . . . . . . . 10-33

Loma Prieta Earthquake Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 10-38

Preprocess and Explore Time-stamped Data Using timetable . . . . 10-48

Structures
11
Create Structure Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-2

Access Data in Structure Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-5


Access Data in Scalar Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-5
Access Data by Indexing into Structure Array . . . . . . . . . . . . . . . . . 11-6

Concatenate Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-9

Generate Field Names from Variables . . . . . . . . . . . . . . . . . . . . . . . 11-11

Access Data in Nested Structures . . . . . . . . . . . . . . . . . . . . . . . . . . 11-12

Access Elements of a Nonscalar Struct Array . . . . . . . . . . . . . . . . . 11-14

Ways to Organize Data in Structure Arrays . . . . . . . . . . . . . . . . . . . 11-16


Plane Organization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-16
Element-by-Element Organization . . . . . . . . . . . . . . . . . . . . . . . . 11-17

Memory Requirements for Structure Array . . . . . . . . . . . . . . . . . . 11-19

Cell Arrays
12
What Is a Cell Array? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-2

Create Cell Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-3

Access Data in Cell Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-5

Add Cells to Cell Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-8

Delete Data from Cell Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-9

Combine Cell Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-10

xii Contents
Pass Contents of Cell Arrays to Functions . . . . . . . . . . . . . . . . . . . . 12-11

Preallocate Memory for Cell Array . . . . . . . . . . . . . . . . . . . . . . . . . . 12-15

Cell vs. Structure Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-16

Multilevel Indexing to Access Parts of Cells . . . . . . . . . . . . . . . . . . 12-20

Function Handles
13
Create Function Handle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-2
What Is a Function Handle? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-2
Creating Function Handles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-2
Anonymous Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-3
Arrays of Function Handles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-4
Saving and Loading Function Handles . . . . . . . . . . . . . . . . . . . . . . 13-4

Pass Function to Another Function . . . . . . . . . . . . . . . . . . . . . . . . . . 13-5

Call Local Functions Using Function Handles . . . . . . . . . . . . . . . . . 13-6

Compare Function Handles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-8

Map Containers
14
Overview of Map Data Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-2

Description of Map Class . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-4


Properties of Map Class . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-4
Methods of Map Class . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-4

Create Map Object . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-6


Construct Empty Map Object . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-6
Construct Initialized Map Object . . . . . . . . . . . . . . . . . . . . . . . . . . 14-6
Combine Map Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-7

Examine Contents of Map . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-8

Read and Write Using Key Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-9


Read From Map . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-9
Add Key/Value Pairs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-10
Build Map with Concatenation . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-10

Modify Keys and Values in Map . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-13


Remove Keys and Values from Map . . . . . . . . . . . . . . . . . . . . . . . . 14-13
Modify Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-13
Modify Keys . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-14

xiii
Modify Copy of Map . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-14

Map to Different Value Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-15


Map to Structure Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-15
Map to Cell Array . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-16

Combining Unlike Classes


15
Valid Combinations of Unlike Classes . . . . . . . . . . . . . . . . . . . . . . . . 15-2

Combining Unlike Integer Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15-3


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15-3
Example of Combining Unlike Integer Sizes . . . . . . . . . . . . . . . . . . 15-3
Example of Combining Signed with Unsigned . . . . . . . . . . . . . . . . . 15-4

Combining Integer and Noninteger Data . . . . . . . . . . . . . . . . . . . . . 15-5

Combining Cell Arrays with Non-Cell Arrays . . . . . . . . . . . . . . . . . . 15-6

Empty Matrices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15-7

Concatenation Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15-8


Combining Single and Double Types . . . . . . . . . . . . . . . . . . . . . . . . 15-8
Combining Integer and Double Types . . . . . . . . . . . . . . . . . . . . . . . 15-8
Combining Character and Double Types . . . . . . . . . . . . . . . . . . . . . 15-8
Combining Logical and Double Types . . . . . . . . . . . . . . . . . . . . . . . 15-8

Using Objects
16
Object Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Two Copy Behaviors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Handle Object Copy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Value Object Copy Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Handle Object Copy Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-3
Testing for Handle or Value Class . . . . . . . . . . . . . . . . . . . . . . . . . . 16-5

xiv Contents
Defining Your Own Classes
17

Scripts and Functions

Scripts
18
Create Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-2

Add Comments to Programs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-3

Code Sections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-5


Divide Your File into Code Sections . . . . . . . . . . . . . . . . . . . . . . . . . 18-5
Evaluate Code Sections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-5
Navigate Among Code Sections in a File . . . . . . . . . . . . . . . . . . . . . 18-6
Example of Evaluating Code Sections . . . . . . . . . . . . . . . . . . . . . . . 18-6
Change the Appearance of Code Sections . . . . . . . . . . . . . . . . . . . . 18-9
Use Code Sections with Control Statements and Functions . . . . . . . 18-9

Scripts vs. Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-12

Add Functions to Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-14


Create a Script with Local Functions . . . . . . . . . . . . . . . . . . . . . . 18-14
Run Scripts with Local Functions . . . . . . . . . . . . . . . . . . . . . . . . . 18-14
Restrictions for Local Functions and Variables . . . . . . . . . . . . . . . 18-15
Access Help for Local Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 18-15

Live Scripts and Functions


19
What Is a Live Script or Function? . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-2
Differences with Plain Code Scripts and Functions . . . . . . . . . . . . . 19-3
Requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-4
Unsupported Features . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-5

Create Live Scripts in the Live Editor . . . . . . . . . . . . . . . . . . . . . . . . 19-6


Create Live Script . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-6
Add Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-6
Run Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-8
Display Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-8
Format Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-9
Save Live Scripts as Plain Code . . . . . . . . . . . . . . . . . . . . . . . . . . 19-10

xv
Run Sections in Live Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-12
Divide Your File Into Sections . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-12
Evaluate Sections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-12

Debug Code in the Live Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-14


Show Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-14
Debug Using Run to Here . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-15
View Variable Value While Debugging . . . . . . . . . . . . . . . . . . . . . . 19-17
Pause a Running File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-17
End Debugging Session . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-17
Step Into Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-18
Add Breakpoints and Run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-18

Modify Figures in Live Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-22


Explore Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-22
Update Code with Figure Changes . . . . . . . . . . . . . . . . . . . . . . . . 19-24
Add Formatting and Annotations . . . . . . . . . . . . . . . . . . . . . . . . . 19-24
Add and Modify Multiple Subplots . . . . . . . . . . . . . . . . . . . . . . . . 19-26
Save and Print Figure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-30

Format Files in the Live Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-31


Autoformatting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-33

Insert Equations into the Live Editor . . . . . . . . . . . . . . . . . . . . . . . 19-36


Insert Equation Interactively . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-36
Insert LaTeX Equation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-38

Add Interactive Controls to a Live Script . . . . . . . . . . . . . . . . . . . . 19-45


Insert Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-45
Modify Control Execution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-46
Modify Control Labels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-47
Create Live Script with Multiple Interactive Controls . . . . . . . . . . 19-47
Share Live Script . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-49

Add Interactive Tasks to a Live Script . . . . . . . . . . . . . . . . . . . . . . . 19-50


What Are Live Editor Tasks? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-50
Insert Tasks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-50
Run Tasks and Surrounding Code . . . . . . . . . . . . . . . . . . . . . . . . . 19-53
Modify Output Argument Name . . . . . . . . . . . . . . . . . . . . . . . . . . 19-54
View and Edit Generated Code . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-54

Create Live Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-56


Create Live Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-56
Add Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-56
Add Help . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-57
Run Live Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-57
Save Live Functions as Plain Code . . . . . . . . . . . . . . . . . . . . . . . . 19-58

Add Help for Live Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-59

Share Live Scripts and Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-63


Hide Code Before Sharing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-64

Live Code File Format (.mlx) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-65


Benefits of Live Code File Format . . . . . . . . . . . . . . . . . . . . . . . . . 19-65

xvi Contents
Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-65

Introduction to the Live Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-66

Accelerate Exploratory Programming Using the Live Editor . . . . . 19-71

Create an Interactive Narrative with the Live Editor . . . . . . . . . . . 19-76

Create Interactive Course Materials Using the Live Editor . . . . . . 19-84

Create Examples Using the Live Editor . . . . . . . . . . . . . . . . . . . . . . 19-90

Create an Interactive Form Using the Live Editor . . . . . . . . . . . . . 19-91

Create a Real-time Dashboard Using the Live Editor . . . . . . . . . . . 19-94

Function Basics
20
Create Functions in Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-2
Syntax for Function Definition . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-2
Contents of Functions and Files . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-3
End Statements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-4

Add Help for Your Program . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-5

Configure the Run Button for Functions . . . . . . . . . . . . . . . . . . . . . . 20-7

Base and Function Workspaces . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-9

Share Data Between Workspaces . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-10


Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-10
Best Practice: Passing Arguments . . . . . . . . . . . . . . . . . . . . . . . . . 20-10
Nested Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-10
Persistent Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-11
Global Variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-12
Evaluating in Another Workspace . . . . . . . . . . . . . . . . . . . . . . . . . 20-12

Check Variable Scope in Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-14


Use Automatic Function and Variable Highlighting . . . . . . . . . . . . 20-14
Example of Using Automatic Function and Variable Highlighting . 20-14

Types of Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-17


Local and Nested Functions in a File . . . . . . . . . . . . . . . . . . . . . . 20-17
Private Functions in a Subfolder . . . . . . . . . . . . . . . . . . . . . . . . . . 20-18
Anonymous Functions Without a File . . . . . . . . . . . . . . . . . . . . . . 20-18

Anonymous Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-20


What Are Anonymous Functions? . . . . . . . . . . . . . . . . . . . . . . . . . 20-20
Variables in the Expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-21
Multiple Anonymous Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-21

xvii
Functions with No Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-22
Functions with Multiple Inputs or Outputs . . . . . . . . . . . . . . . . . . 20-22
Arrays of Anonymous Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 20-23

Local Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-25

Nested Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-27


What Are Nested Functions? . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-27
Requirements for Nested Functions . . . . . . . . . . . . . . . . . . . . . . . 20-27
Sharing Variables Between Parent and Nested Functions . . . . . . . 20-28
Using Handles to Store Function Parameters . . . . . . . . . . . . . . . . 20-29
Visibility of Nested Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-31

Variables in Nested and Anonymous Functions . . . . . . . . . . . . . . . 20-33

Private Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-34

Function Precedence Order . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-35


Change in Rules For Function Precedence Order . . . . . . . . . . . . . 20-36

Update Code for R2019b Changes to Function Precedence Order


.................................................... 20-38
Identifiers cannot be used for two purposes inside a function . . . . 20-38
Identifiers without explicit declarations might not be treated as
variables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-38
Variables cannot be implicitly shared between parent and nested
functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-39
Change in precedence of wildcard-based imports . . . . . . . . . . . . . 20-40
Fully qualified import functions cannot have the same name as nested
functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-40
Fully qualified imports shadow outer scope definitions of the same
name . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-41
Error handling when import not found . . . . . . . . . . . . . . . . . . . . . 20-41
Nested functions inherit import statements from parent functions
................................................ 20-42
Change in precedence of compound name resolution . . . . . . . . . . 20-42
Anonymous functions can include resolved and unresolved identifiers
................................................ 20-43

Indexing into Function Call Results . . . . . . . . . . . . . . . . . . . . . . . . 20-44


Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-44
Supported Syntaxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-44

Function Arguments
21
Find Number of Function Arguments . . . . . . . . . . . . . . . . . . . . . . . . 21-2

Support Variable Number of Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . 21-4

Support Variable Number of Outputs . . . . . . . . . . . . . . . . . . . . . . . . 21-5

xviii Contents
Validate Number of Function Arguments . . . . . . . . . . . . . . . . . . . . . 21-6

Argument Checking in Nested Functions . . . . . . . . . . . . . . . . . . . . . 21-8

Ignore Function Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21-10

Check Function Inputs with validateattributes . . . . . . . . . . . . . . . 21-11

Parse Function Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21-13

Input Parser Validation Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 21-16

Debugging MATLAB Code


22
Debug a MATLAB Program . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-2
Set Breakpoint . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-2
Run File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-3
Pause a Running File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-3
Find and Fix a Problem . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-3
Step Through File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-5
End Debugging Session . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-6

Set Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-7


Standard Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-7
Conditional Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-8
Error Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-9
Breakpoints in Anonymous Functions . . . . . . . . . . . . . . . . . . . . . . 22-10
Invalid Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-10
Disable Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-10
Clear Breakpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-11

Examine Values While Debugging . . . . . . . . . . . . . . . . . . . . . . . . . . 22-12


Select Workspace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-12
View Variable Value . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22-12

Presenting MATLAB Code


23
Publish and Share MATLAB Code . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-2
Create and Share Live Scripts in the Live Editor . . . . . . . . . . . . . . . 23-2
Publish MATLAB Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-2
Add Help and Create Documentation . . . . . . . . . . . . . . . . . . . . . . . 23-4

Publishing Markup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-5


Markup Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-5
Sections and Section Titles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-7
Text Formatting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-8
Bulleted and Numbered Lists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-9

xix
Text and Code Blocks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-9
External File Content . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-10
External Graphics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-11
Image Snapshot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-13
LaTeX Equations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-13
Hyperlinks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-15
HTML Markup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-17
LaTeX Markup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-18

Output Preferences for Publishing . . . . . . . . . . . . . . . . . . . . . . . . . 23-20


How to Edit Publishing Options . . . . . . . . . . . . . . . . . . . . . . . . . . 23-20
Specify Output File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-21
Run Code During Publishing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-21
Manipulate Graphics in Publishing Output . . . . . . . . . . . . . . . . . . 23-23
Save a Publish Setting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-26
Manage a Publish Configuration . . . . . . . . . . . . . . . . . . . . . . . . . . 23-27

Coding and Productivity Tips


24
Open and Save Files in the Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-2
Open Existing Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-2
Save Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-3

Check Code for Errors and Warnings . . . . . . . . . . . . . . . . . . . . . . . . . 24-5


Automatically Check Code in the Editor and Live Editor — Code
Analyzer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-5
Create a Code Analyzer Message Report . . . . . . . . . . . . . . . . . . . . . 24-8
Adjust Code Analyzer Message Indicators and Messages . . . . . . . . 24-8
Understand Code Containing Suppressed Messages . . . . . . . . . . . 24-11
Understand the Limitations of Code Analysis . . . . . . . . . . . . . . . . 24-12
Enable MATLAB Compiler Deployment Messages . . . . . . . . . . . . . 24-14

Improve Code Readability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-16


Indenting Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-16
Right-Side Text Limit Indicator . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-17
Code Folding — Expand and Collapse Code Constructs . . . . . . . . . 24-18
Code Refactoring — Automatically convert selected code to a function
................................................ 24-21

Find and Replace Text in Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-22


Find Any Text in the Current File . . . . . . . . . . . . . . . . . . . . . . . . . 24-22
Find and Replace Functions or Variables in the Current File . . . . . 24-22
Automatically Rename All Functions or Variables in a File . . . . . . 24-23
Find and Replace Any Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-24
Find Text in Multiple File Names or Files . . . . . . . . . . . . . . . . . . . 24-25
Function Alternative for Finding Text . . . . . . . . . . . . . . . . . . . . . . 24-25
Perform an Incremental Search in the Editor . . . . . . . . . . . . . . . . 24-25
Go To Location in File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-25

Add Reminders to Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-29


Working with TODO/FIXME Reports . . . . . . . . . . . . . . . . . . . . . . . 24-29

xx Contents
MATLAB Code Analyzer Report . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-31
Running the Code Analyzer Report . . . . . . . . . . . . . . . . . . . . . . . . 24-31
Changing Code Based on Code Analyzer Messages . . . . . . . . . . . . 24-32
Other Ways to Access Code Analyzer Messages . . . . . . . . . . . . . . 24-32

MATLAB Code Compatibility Report . . . . . . . . . . . . . . . . . . . . . . . . 24-34


Generate the Code Compatibility Report . . . . . . . . . . . . . . . . . . . . 24-34
Programmatic Use . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-36
Unsupported Functionality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-36

Programming Utilities
25
Identify Program Dependencies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-2
Simple Display of Program File Dependencies . . . . . . . . . . . . . . . . 25-2
Detailed Display of Program File Dependencies . . . . . . . . . . . . . . . 25-2
Dependencies Within a Folder . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-2

Protect Your Source Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-6


Building a Content Obscured Format with P-Code . . . . . . . . . . . . . . 25-6
Building a Standalone Executable . . . . . . . . . . . . . . . . . . . . . . . . . . 25-7

Create Hyperlinks that Run Functions . . . . . . . . . . . . . . . . . . . . . . . 25-8


Run a Single Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-8
Run Multiple Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-9
Provide Command Options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-9
Include Special Characters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-9

Create and Share Toolboxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-11


Create Toolbox . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-11
Share Toolbox . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-15

Function Argument Validation


26
Function Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-2
Introduction to Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . 26-2
Where to Use Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . 26-2
arguments Block Syntax . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-2
Examples of Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . 26-5
Kinds of Arguments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-6
Required and Optional Positional Arguments . . . . . . . . . . . . . . . . . 26-6
Repeating Arguments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-8
Name-Value Arguments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-10
Name-Value Arguments from Class Properties . . . . . . . . . . . . . . . 26-13
Argument Validation in Class Methods . . . . . . . . . . . . . . . . . . . . . 26-14
Order of Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-15
Avoiding Class and Size Conversions . . . . . . . . . . . . . . . . . . . . . . 26-15
nargin in Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-18

xxi
Restrictions on Variable and Function Access . . . . . . . . . . . . . . . . 26-19

Argument Validation Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-21


Numeric Value Attributes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-21
Comparison with Other Values . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-22
Data Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-22
Size . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-22
Membership and Range . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-23
Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-23
Define Validation Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-23

Ways to Parse Function Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-25


Function Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-25
validateattributes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-25
inputParser . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-25

Transparency in MATLAB Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-26


Writing Transparent Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-26

Software Development

Error Handling
27
Exception Handling in a MATLAB Application . . . . . . . . . . . . . . . . . 27-2
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-2
Getting an Exception at the Command Line . . . . . . . . . . . . . . . . . . 27-2
Getting an Exception in Your Program Code . . . . . . . . . . . . . . . . . . 27-3
Generating a New Exception . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-3

Throw an Exception . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-4


Suggestions on How to Throw an Exception . . . . . . . . . . . . . . . . . . 27-4

Respond to an Exception . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-6


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-6
The try/catch Statement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-6
Suggestions on How to Handle an Exception . . . . . . . . . . . . . . . . . 27-7

Clean Up When Functions Complete . . . . . . . . . . . . . . . . . . . . . . . . . 27-9


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-9
Examples of Cleaning Up a Program Upon Exit . . . . . . . . . . . . . . . 27-10
Retrieving Information About the Cleanup Routine . . . . . . . . . . . . 27-11
Using onCleanup Versus try/catch . . . . . . . . . . . . . . . . . . . . . . . . 27-12
onCleanup in Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-12

Issue Warnings and Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-13


Issue Warnings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-13
Throw Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-13
Add Run-Time Parameters to Your Warnings and Errors . . . . . . . . 27-14

xxii Contents
Add Identifiers to Warnings and Errors . . . . . . . . . . . . . . . . . . . . . 27-14

Suppress Warnings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-16


Turn Warnings On and Off . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-16

Restore Warnings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-18


Disable and Restore a Particular Warning . . . . . . . . . . . . . . . . . . . 27-18
Disable and Restore Multiple Warnings . . . . . . . . . . . . . . . . . . . . . 27-19

Change How Warnings Display . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-20


Enable Verbose Warnings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-20
Display a Stack Trace on a Specific Warning . . . . . . . . . . . . . . . . . 27-20

Use try/catch to Handle Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-21

Program Scheduling
28
Schedule Command Execution Using Timer . . . . . . . . . . . . . . . . . . . 28-2
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-2
Example: Displaying a Message . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-2

Timer Callback Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-4


Associating Commands with Timer Object Events . . . . . . . . . . . . . . 28-4
Creating Callback Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-5
Specifying the Value of Callback Function Properties . . . . . . . . . . . 28-6

Handling Timer Queuing Conflicts . . . . . . . . . . . . . . . . . . . . . . . . . . 28-8


Drop Mode (Default) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-8
Error Mode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-9
Queue Mode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-10

Performance
29
Measure the Performance of Your Code . . . . . . . . . . . . . . . . . . . . . . 29-2
Overview of Performance Timing Functions . . . . . . . . . . . . . . . . . . 29-2
Time Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-2
Time Portions of Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-2
The cputime Function vs. tic/toc and timeit . . . . . . . . . . . . . . . . . . . 29-2
Tips for Measuring Performance . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-3

Profile Your Code to Improve Performance . . . . . . . . . . . . . . . . . . . . 29-4


What Is Profiling? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-4
Profile Your Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-4
Profile Multiple Statements in Command Window . . . . . . . . . . . . . 29-10
Profile an App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-11

Determine Code Coverage Using the Profiler . . . . . . . . . . . . . . . . . 29-12

xxiii
Techniques to Improve Performance . . . . . . . . . . . . . . . . . . . . . . . . 29-14
Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-14
Code Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-14
Programming Practices for Performance . . . . . . . . . . . . . . . . . . . . 29-14
Tips on Specific MATLAB Functions . . . . . . . . . . . . . . . . . . . . . . . 29-15

Preallocation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-16
Preallocating a Nondouble Matrix . . . . . . . . . . . . . . . . . . . . . . . . 29-16

Vectorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-18
Using Vectorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-18
Array Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-19
Logical Array Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-20
Matrix Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-21
Ordering, Setting, and Counting Operations . . . . . . . . . . . . . . . . . 29-22
Functions Commonly Used in Vectorization . . . . . . . . . . . . . . . . . 29-23

Memory Usage
30
Strategies for Efficient Use of Memory . . . . . . . . . . . . . . . . . . . . . . . 30-2
Use Appropriate Data Storage . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-2
Avoid Temporary Copies of Data . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-3
Reclaim Used Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-4

Resolve “Out of Memory” Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-6


Leverage tall Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-6
Leverage the Memory of Multiple Machines . . . . . . . . . . . . . . . . . . 30-7
Load Only as Much Data as You Need . . . . . . . . . . . . . . . . . . . . . . . 30-7
Increase System Swap Space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-8
Set the Process Limit on Linux Systems . . . . . . . . . . . . . . . . . . . . . 30-8
Disable Java VM on Linux Systems . . . . . . . . . . . . . . . . . . . . . . . . . 30-9

How MATLAB Allocates Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-10


Memory Allocation for Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-10
Data Structures and Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-13

Avoid Unnecessary Copies of Data . . . . . . . . . . . . . . . . . . . . . . . . . . 30-17


Passing Values to Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-17
Why Pass-by-Value Semantics . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-19
Handle Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-20

Custom Help and Documentation


31
Create Help for Classes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-2
Help Text from the doc Command . . . . . . . . . . . . . . . . . . . . . . . . . . 31-2
Custom Help Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-3

xxiv Contents
Check Which Programs Have Help . . . . . . . . . . . . . . . . . . . . . . . . . . 31-8

Create Help Summary Files — Contents.m . . . . . . . . . . . . . . . . . . . 31-10


What Is a Contents.m File? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-10
Create a Contents.m File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-10
Check an Existing Contents.m File . . . . . . . . . . . . . . . . . . . . . . . . 31-11

Customize Code Suggestions and Completions . . . . . . . . . . . . . . . 31-12


Function Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-13
Signature Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-13
Argument Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-14
Create Function Signature File . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-17
How Function Signature Information is Used . . . . . . . . . . . . . . . . 31-18
Multiple Signatures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-19

Display Custom Documentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-21


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-21
Create HTML Help Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-22
Create [Link] File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-23
Create [Link] File . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-24
Build a Search Database . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-26
Address Validation Errors for [Link] Files . . . . . . . . . . . . . . . . . 31-27

Display Custom Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-29


How to Display Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-29
Elements of the [Link] File . . . . . . . . . . . . . . . . . . . . . . . . . . 31-30

Projects
32
Create Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-2
What Are Projects? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-2
Create Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-2
Open Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-2
Set up Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-3
Add Files to Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-5
Other Ways to Create Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-6

Automate Startup and Shutdown Tasks . . . . . . . . . . . . . . . . . . . . . . . 32-8


Specify Project Path . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-8
Set Startup Folder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-8
Specify Startup and Shutdown Files . . . . . . . . . . . . . . . . . . . . . . . . 32-8

Manage Project Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-10


Automatic Updates When Renaming, Deleting, or Removing Files
................................................ 32-11

Find Project Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-12


Group and Sort Project Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-12
Search for and Filter Project Files . . . . . . . . . . . . . . . . . . . . . . . . 32-12
Search the Content in Project Files . . . . . . . . . . . . . . . . . . . . . . . . 32-12

xxv
Create Shortcuts to Frequent Tasks . . . . . . . . . . . . . . . . . . . . . . . . 32-14
Run Shortcuts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-14
Create Shortcuts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-14
Organize Shortcuts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-14

Add Labels to Project Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-16


Add Labels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-16
View and Edit Label Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-16
Create Labels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-17

Create Custom Tasks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-18


Create a Custom Task Function . . . . . . . . . . . . . . . . . . . . . . . . . . 32-18
Run a Custom Task . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-18
Save Custom Task Report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-19

Componentize Large Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-20


Add or Remove Reference to a Project . . . . . . . . . . . . . . . . . . . . . 32-20
View, Edit, or Run Referenced Project Files . . . . . . . . . . . . . . . . . 32-20
Extract Folder to Create a Referenced Project . . . . . . . . . . . . . . . 32-21
Manage Changes in Referenced Project Using Checkpoints . . . . . 32-21

Share Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-23


Create an Export Profile . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-26

Upgrade Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-27


Run Upgrade Project Tool . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-27
Examine Upgrade Project Report . . . . . . . . . . . . . . . . . . . . . . . . . 32-28

Analyze Project Dependencies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-30


Run a Dependency Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-30
Explore the Dependency Graph, Views, and Filters . . . . . . . . . . . . 32-32
Investigate and Resolve Problems . . . . . . . . . . . . . . . . . . . . . . . . . 32-37
Find Required Products and Toolboxes . . . . . . . . . . . . . . . . . . . . . 32-39
Find File Dependencies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-40
Export Dependency Analysis Results . . . . . . . . . . . . . . . . . . . . . . 32-42

Clone from Git Repository . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-44

Use Source Control with Projects . . . . . . . . . . . . . . . . . . . . . . . . . . 32-45


Setup Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-45
Perform Source Control Operations . . . . . . . . . . . . . . . . . . . . . . . 32-47
Work with Derived Files in Projects . . . . . . . . . . . . . . . . . . . . . . . 32-54
Find Project Files With Unsaved Changes . . . . . . . . . . . . . . . . . . . 32-55
Manage Open Files When Closing a Project . . . . . . . . . . . . . . . . . 32-55

Create and Edit Projects Programmatically . . . . . . . . . . . . . . . . . . 32-56

Explore an Example Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32-63

xxvi Contents
Source Control Interface
33
About MathWorks Source Control Integration . . . . . . . . . . . . . . . . . 33-2
Classic and Distributed Source Control . . . . . . . . . . . . . . . . . . . . . . 33-2

Select or Disable Source Control System . . . . . . . . . . . . . . . . . . . . . 33-4


Select Source Control System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-4
Disable Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-4

Create New Repository . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-5


Create Git Repository on Your Local System . . . . . . . . . . . . . . . . . . 33-5
Create SVN Repository . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-5

Review Changes in Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . 33-7

Mark Files for Addition to Source Control . . . . . . . . . . . . . . . . . . . . 33-8

Resolve Source Control Conflicts . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-9


Examining and Resolving Conflicts . . . . . . . . . . . . . . . . . . . . . . . . . 33-9
Resolve Conflicts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-9
Merge Text Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-10
Extract Conflict Markers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-10

Commit Modified Files to Source Control . . . . . . . . . . . . . . . . . . . . 33-12

Revert Changes in Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . 33-13


Revert Local Changes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-13
Revert a File to a Specified Revision . . . . . . . . . . . . . . . . . . . . . . . 33-13

Set Up SVN Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-14


SVN Source Control Options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-14
Register Binary Files with SVN . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-14
Standard Repository Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-17
Tag Versions of Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-17
Enforce Locking Files Before Editing . . . . . . . . . . . . . . . . . . . . . . 33-17
Share a Subversion Repository . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-18

Check Out from SVN Repository . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-19


Retrieve Tagged Version of Repository . . . . . . . . . . . . . . . . . . . . . 33-20

Update SVN File Status and Revision . . . . . . . . . . . . . . . . . . . . . . . 33-21


Refresh Status of Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-21
Update Revisions of Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-21

Get SVN File Locks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-22


Manage SVN Repository Locks . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-22

Set Up Git Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-23


Configure MATLAB on Windows . . . . . . . . . . . . . . . . . . . . . . . . . . 33-23
Use SSH Authentication with MATLAB . . . . . . . . . . . . . . . . . . . . . 33-23
Register Binary Files with Git . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-24

xxvii
Add Git Submodules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-26
Update Submodules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-26
Use Fetch and Merge with Submodules . . . . . . . . . . . . . . . . . . . . 33-26
Use Push to Send Changes to the Submodule Repository . . . . . . . 33-26

Retrieve Files from Git Repository . . . . . . . . . . . . . . . . . . . . . . . . . . 33-28


Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-28

Update Git File Status and Revision . . . . . . . . . . . . . . . . . . . . . . . . 33-29


Refresh Status of Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-29
Update Revisions of Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-29

Branch and Merge with Git . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-30


Create Branch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-30
Switch Branch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-31
Compare Branches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-32
Merge Branches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-32
Revert to Head . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-33
Delete Branches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-33

Pull, Push and Fetch Files with Git . . . . . . . . . . . . . . . . . . . . . . . . . 33-34


Pull and Push . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-34
Fetch and Merge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-35
Use Git Stashes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-35

Move, Rename, or Delete Files Under Source Control . . . . . . . . . . 33-37

Customize External Source Control to Use MATLAB for Diff and


Merge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-38
Finding the Full Paths for MATLAB Diff, Merge, and AutoMerge . . 33-38
Integration with Git . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-39
Integration with SVN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-40
Integration with Other Source Control Tools . . . . . . . . . . . . . . . . . 33-41

MSSCCI Source Control Interface . . . . . . . . . . . . . . . . . . . . . . . . . . 33-43

Set Up MSSCCI Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-44


Create Projects in Source Control System . . . . . . . . . . . . . . . . . . . 33-44
Specify Source Control System with MATLAB Software . . . . . . . . 33-45
Register Source Control Project with MATLAB Software . . . . . . . . 33-46
Add Files to Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-48

Check Files In and Out from MSSCCI Source Control . . . . . . . . . . 33-49


Check Files Into Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . 33-49
Check Files Out of Source Control . . . . . . . . . . . . . . . . . . . . . . . . 33-49
Undoing the Checkout . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-50

Additional MSSCCI Source Control Actions . . . . . . . . . . . . . . . . . . 33-51


Getting the Latest Version of Files for Viewing or Compiling . . . . . 33-51
Removing Files from the Source Control System . . . . . . . . . . . . . . 33-52
Showing File History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-52
Comparing the Working Copy of a File to the Latest Version in Source
Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-53
Viewing Source Control Properties of a File . . . . . . . . . . . . . . . . . 33-54
Starting the Source Control System . . . . . . . . . . . . . . . . . . . . . . . 33-55

xxviii Contents
Access MSSCCI Source Control from Editors . . . . . . . . . . . . . . . . . 33-57

Troubleshoot MSSCCI Source Control Problems . . . . . . . . . . . . . . 33-58


Source Control Error: Provider Not Present or Not Installed Properly
................................................ 33-58
Restriction Against @ Character . . . . . . . . . . . . . . . . . . . . . . . . . . 33-59
Add to Source Control Is the Only Action Available . . . . . . . . . . . . 33-59
More Solutions for Source Control Problems . . . . . . . . . . . . . . . . 33-59

Unit Testing
34
Write Test Using Live Script . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-3

Write Script-Based Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-6

Write Script-Based Test Using Local Functions . . . . . . . . . . . . . . . 34-11

Extend Script-Based Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-14


Test Suite Creation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-14
Test Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-14
Programmatic Access of Test Diagnostics . . . . . . . . . . . . . . . . . . . 34-15
Test Runner Customization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-15

Run Tests in Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-17

Write Function-Based Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-20


Create Test Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-20
Run the Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-22
Analyze the Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-23

Write Simple Test Case Using Functions . . . . . . . . . . . . . . . . . . . . . 34-24

Write Test Using Setup and Teardown Functions . . . . . . . . . . . . . . 34-28

Extend Function-Based Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-33


Fixtures for Setup and Teardown Code . . . . . . . . . . . . . . . . . . . . . 34-33
Test Logging and Verbosity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-34
Test Suite Creation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-34
Test Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-34
Test Running . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-35
Programmatic Access of Test Diagnostics . . . . . . . . . . . . . . . . . . . 34-35
Test Runner Customization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-36

Author Class-Based Unit Tests in MATLAB . . . . . . . . . . . . . . . . . . . 34-37


The Test Class Definition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-37
The Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-37
Additional Features for Advanced Test Classes . . . . . . . . . . . . . . . 34-38

Write Simple Test Case Using Classes . . . . . . . . . . . . . . . . . . . . . . . 34-40

xxix
Write Setup and Teardown Code Using Classes . . . . . . . . . . . . . . . 34-43
Test Fixtures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-43
Test Case with Method-Level Setup Code . . . . . . . . . . . . . . . . . . . 34-43
Test Case with Class-Level Setup Code . . . . . . . . . . . . . . . . . . . . . 34-44

Table of Verifications, Assertions, and Other Qualifications . . . . . 34-46

Tag Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-48


Tag Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-48
Select and Run Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-49

Write Tests Using Shared Fixtures . . . . . . . . . . . . . . . . . . . . . . . . . . 34-52

Create Basic Custom Fixture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-55

Create Advanced Custom Fixture . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-57

Use Parameters in Class-Based Tests . . . . . . . . . . . . . . . . . . . . . . . 34-62


How to Write Parameterized Tests . . . . . . . . . . . . . . . . . . . . . . . . 34-62
Specify Parameterization Level . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-63
Specify How Parameters Are Combined . . . . . . . . . . . . . . . . . . . . 34-64
Use External Parameters in Tests . . . . . . . . . . . . . . . . . . . . . . . . . 34-64

Create Basic Parameterized Test . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-66

Create Advanced Parameterized Test . . . . . . . . . . . . . . . . . . . . . . . . 34-71

Use External Parameters in Parameterized Test . . . . . . . . . . . . . . . 34-78

Create Simple Test Suites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-82

Run Tests for Various Workflows . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-84


Set Up Example Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-84
Run All Tests in Class or Function . . . . . . . . . . . . . . . . . . . . . . . . . 34-84
Run Single Test in Class or Function . . . . . . . . . . . . . . . . . . . . . . . 34-84
Run Test Suites by Name . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-85
Run Test Suites from Test Array . . . . . . . . . . . . . . . . . . . . . . . . . . 34-85
Run Tests with Customized Test Runner . . . . . . . . . . . . . . . . . . . . 34-86

Programmatically Access Test Diagnostics . . . . . . . . . . . . . . . . . . . 34-87

Add Plugin to Test Runner . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-88

Write Plugins to Extend TestRunner . . . . . . . . . . . . . . . . . . . . . . . . 34-90


Custom Plugins Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-90
Extending Test Session Level Plugin Methods . . . . . . . . . . . . . . . . 34-90
Extending Test Suite Level Plugin Methods . . . . . . . . . . . . . . . . . . 34-91
Extending Test Class Level Plugin Methods . . . . . . . . . . . . . . . . . 34-91
Extending Test Level Plugin Methods . . . . . . . . . . . . . . . . . . . . . . 34-92

Create Custom Plugin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-93

Run Tests in Parallel with Custom Plugin . . . . . . . . . . . . . . . . . . . . 34-98

xxx Contents
Write Plugin to Add Data to Test Results . . . . . . . . . . . . . . . . . . . 34-106

Write Plugin to Save Diagnostic Details . . . . . . . . . . . . . . . . . . . . 34-111

Plugin to Generate Custom Test Output Format . . . . . . . . . . . . . . 34-115

Analyze Test Case Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-118

Analyze Failed Test Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-121

Rerun Failed Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-123

Dynamically Filtered Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-126


Test Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-126
Method Setup and Teardown Code . . . . . . . . . . . . . . . . . . . . . . . 34-128
Class Setup and Teardown Code . . . . . . . . . . . . . . . . . . . . . . . . . 34-129

Create Custom Constraint . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-132

Create Custom Boolean Constraint . . . . . . . . . . . . . . . . . . . . . . . . 34-135

Create Custom Tolerance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-139

Overview of App Testing Framework . . . . . . . . . . . . . . . . . . . . . . . 34-143


App Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-143
Gesture Support of UI Components . . . . . . . . . . . . . . . . . . . . . . 34-143
Write a Test for an App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-145

Write Test for App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-148

Write Test That Uses App Testing and Mocking Frameworks . . . 34-152
Create App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-152
Test App With Manual Intervention . . . . . . . . . . . . . . . . . . . . . . . 34-153
Create Fully Automated Test . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-154

Overview of Performance Testing Framework . . . . . . . . . . . . . . . . 34-157


Determine Bounds of Measured Code . . . . . . . . . . . . . . . . . . . . . 34-157
Types of Time Experiments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-158
Write Performance Tests with Measurement Boundaries . . . . . . . 34-158
Run Performance Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-159
Understand Invalid Test Results . . . . . . . . . . . . . . . . . . . . . . . . . 34-159

Test Performance Using Scripts or Functions . . . . . . . . . . . . . . . . 34-161

Test Performance Using Classes . . . . . . . . . . . . . . . . . . . . . . . . . . 34-165

Measure Fast Executing Test Code . . . . . . . . . . . . . . . . . . . . . . . . 34-171

Create Mock Object . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-174

Specify Mock Object Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-181


Define Mock Method Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . 34-181
Define Mock Property Behavior . . . . . . . . . . . . . . . . . . . . . . . . . 34-182
Define Repeating and Subsequent Behavior . . . . . . . . . . . . . . . . 34-183

xxxi
Summary of Behaviors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-185

Qualify Mock Object Interaction . . . . . . . . . . . . . . . . . . . . . . . . . . 34-186


Qualify Mock Method Interaction . . . . . . . . . . . . . . . . . . . . . . . . 34-186
Qualify Mock Property Interaction . . . . . . . . . . . . . . . . . . . . . . . 34-187
Use Mock Object Constraints . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-188
Summary of Qualifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-190

Ways to Write Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-192


Script-Based Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-192
Function-Based Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-193
Class-Based Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-193
Extend Unit Testing Framework . . . . . . . . . . . . . . . . . . . . . . . . . 34-194

Compile MATLAB Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-195


Run Tests with Standalone Applications . . . . . . . . . . . . . . . . . . . 34-195
Run Tests in Parallel with Standalone Applications . . . . . . . . . . . 34-196
TestRand Class Definition Summary . . . . . . . . . . . . . . . . . . . . . . 34-196

Develop and Integrate Software with Continuous Integration . . 34-198


Continuous Integration Workflow . . . . . . . . . . . . . . . . . . . . . . . . 34-198
Continuous Integration with MathWorks Products . . . . . . . . . . . 34-200

Generate Artifacts Using MATLAB Unit Test Plugins . . . . . . . . . . 34-202

Continuous Integration with MATLAB on CI Platforms . . . . . . . . 34-206


Azure DevOps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-206
CircleCI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-206
Jenkins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-206
Other Platforms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-206

System object Usage and Authoring


35
What Are System Objects? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-2
Running a System Object . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-3
System Object Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-3

System Objects vs MATLAB Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-5


System Objects vs. MATLAB Functions . . . . . . . . . . . . . . . . . . . . . . . . . . 35-5
Process Audio Data Using Only MATLAB Functions Code . . . . . . . . . . . . 35-5
Process Audio Data Using System Objects . . . . . . . . . . . . . . . . . . . . . . . 35-6

System Design in MATLAB Using System Objects . . . . . . . . . . . . . . . . . . 35-7


System Design and Simulation in MATLAB . . . . . . . . . . . . . . . . . . . . . . . 35-7
Create Individual Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-7
Configure Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-8
Create and Configure Components at the Same Time . . . . . . . . . . . . . . . 35-8
Assemble Components Into System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-9
Run Your System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-9
Reconfiguring Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-10

xxxii Contents
Define Basic System Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-11
Create System Object Class . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-11
Define Algorithm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-11

Change the Number of Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-13

Validate Property and Input Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-16


Validate a Single Property . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-16
Validate Interdependent Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-16
Validate Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-16
Complete Class Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-16

Initialize Properties and Setup One-Time Calculations . . . . . . . . . . . . . 35-18

Set Property Values at Construction Time . . . . . . . . . . . . . . . . . . . . . . . 35-20

Reset Algorithm and Release Resources . . . . . . . . . . . . . . . . . . . . . . . . . 35-22


Reset Algorithm State . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-22
Release System Object Resources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-22

Define Property Attributes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-24


Specify Property as Nontunable . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-24
Specify Property as DiscreteState . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-24
Example Class with Various Property Attributes . . . . . . . . . . . . . . . . . . 35-24

Hide Inactive Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-26


Specify Inactive Property . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-26
Complete Class Definition File with Inactive Properties Method . . . . . . 35-26

Limit Property Values to Finite List . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-28


Property Validation with mustBeMember . . . . . . . . . . . . . . . . . . . . . . . 35-28
Enumeration Property . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-28
Create a Whiteboard System object . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-29

Process Tuned Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-32

Define Composite System Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-34

Define Finite Source Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-36


Use the FiniteSource Class and Specify End of the Source . . . . . . . . . . 35-36
Complete Class Definition File with Finite Source . . . . . . . . . . . . . . . . . 35-36

Save and Load System Object . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-38


Save System Object and Child Object . . . . . . . . . . . . . . . . . . . . . . . . . . 35-38
Load System Object and Child Object . . . . . . . . . . . . . . . . . . . . . . . . . . 35-38
Complete Class Definition Files with Save and Load . . . . . . . . . . . . . . . 35-38

Define System Object Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-41

Handle Input Specification Changes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-43


React to Input Specification Changes . . . . . . . . . . . . . . . . . . . . . . . . . . 35-43
Restrict Input Specification Changes . . . . . . . . . . . . . . . . . . . . . . . . . . 35-43

Summary of Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-45


Setup Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-45

xxxiii
Running the Object or Step Call Sequence . . . . . . . . . . . . . . . . . . . . . . 35-45
Reset Method Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-46
Release Method Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-47

Detailed Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-48


setup Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-48
Running the Object or step Call Sequence . . . . . . . . . . . . . . . . . . . . . . 35-48
reset Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-49
release Call Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-49

Tips for Defining System Objects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-50


General . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-50
Inputs and Outputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-50
Using ~ as an Input Argument in Method Definitions . . . . . . . . . . . . . . 35-50
Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-50
Text Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-51
Simulink . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-51
Code Generation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-52

Insert System Object Code Using MATLAB Editor . . . . . . . . . . . . . . . . . 35-53


Define System Objects with Code Insertion . . . . . . . . . . . . . . . . . . . . . . 35-53
Create a Temperature Enumeration . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-55
Create Custom Property for Freezing Point . . . . . . . . . . . . . . . . . . . . . . 35-56
Add Method to Validate Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-57

Analyze System Object Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-58


View and Navigate System object Code . . . . . . . . . . . . . . . . . . . . . . . . 35-58
Example: Go to StepImpl Method Using Analyzer . . . . . . . . . . . . . . . . . 35-58

Use Global Variables in System Objects . . . . . . . . . . . . . . . . . . . . . . . . . 35-60


System Object Global Variables in MATLAB . . . . . . . . . . . . . . . . . . . . . 35-60
System Object Global Variables in Simulink . . . . . . . . . . . . . . . . . . . . . 35-60

Create Moving Average System object . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-64

Create New System Objects for File Input and Output . . . . . . . . . . . . . 35-69

Create Composite System object . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-75

xxxiv Contents
Language

35
1

Syntax Basics

• “Continue Long Statements on Multiple Lines” on page 1-2


• “Ignore Function Outputs” on page 1-3
• “Variable Names” on page 1-4
• “Case and Space Sensitivity” on page 1-5
• “Command vs. Function Syntax” on page 1-6
• “Common Errors When Calling Functions” on page 1-9
1 Syntax Basics

Continue Long Statements on Multiple Lines


This example shows how to continue a statement to the next line using ellipsis (...).

s = 1 - 1/2 + 1/3 - 1/4 + 1/5 ...


- 1/6 + 1/7 - 1/8 + 1/9;

Build a long character vector by concatenating shorter vectors together:

mytext = ['Accelerating the pace of ' ...


'engineering and science'];

The start and end quotation marks for a character vector must appear on the same line. For example,
this code returns an error, because each line contains only one quotation mark:

mytext = 'Accelerating the pace of ...


engineering and science'

An ellipsis outside a quoted text is equivalent to a space. For example,

x = [1.23...
4.56];

is the same as

x = [1.23 4.56];

1-2
Ignore Function Outputs

Ignore Function Outputs


This example shows how to ignore specific outputs from a function using the tilde (~) operator.

Request all three possible outputs from the fileparts function.

helpFile = which('help');
[helpPath,name,ext] = fileparts(helpFile);

The current workspace now contains three variables from fileparts: helpPath, name, and ext. In
this case, the variables are small. However, some functions return results that use much more
memory. If you do not need those variables, they waste space on your system.

If you do not use the tilde operator, you can request only the first N outputs of a function (where N is
less than or equal to the number of possible outputs) and ignore any remaining outputs. For example,
request only the first output, ignoring the second and third.

helpPath = fileparts(helpFile);

If you request more than one output, enclose the variable names in square brackets, []. The
following code ignores the output argument ext.

[helpPath,name] = fileparts(helpFile);

To ignore function outputs in any position in the argument list, use the tilde operator. For example,
ignore the first output using a tilde.

[~,name,ext] = fileparts(helpFile);

You can ignore any number of function outputs using the tilde operator. Separate consecutive tildes
with a comma. For example, this code ignores the first two output arguments.

[~,~,ext] = fileparts(helpFile);

See Also

More About
• “Ignore Function Inputs” on page 21-10

1-3
1 Syntax Basics

Variable Names
In this section...
“Valid Names” on page 1-4
“Conflicts with Function Names” on page 1-4

Valid Names
A valid variable name starts with a letter, followed by letters, digits, or underscores. MATLAB is case
sensitive, so A and a are not the same variable. The maximum length of a variable name is the value
that the namelengthmax command returns.

You cannot define variables with the same names as MATLAB keywords, such as if or end. For a
complete list, run the iskeyword command.

Examples of valid names: Examples of invalid names:


x6 6x
lastValue end
n_factorial n!

Conflicts with Function Names


Avoid creating variables with the same name as a function (such as i, j, mode, char, size, and
path). In general, variable names take precedence over function names. If you create a variable that
uses the name of a function, you sometimes get unexpected results.

Check whether a proposed name is already in use with the exist or which function. exist returns
0 if there are no existing variables, functions, or other artifacts with the proposed name. For example:

exist checkname

ans =
0

If you inadvertently create a variable with a name conflict, remove the variable from memory with the
clear function.

Another potential source of name conflicts occurs when you define a function that calls load or eval
(or similar functions) to add variables to the workspace. In some cases, load or eval add variables
that have the same names as functions. Unless these variables are in the function workspace before
the call to load or eval, the MATLAB parser interprets the variable names as function names. For
more information, see:

• “Unexpected Results When Loading Variables Within a Function”


• “Alternatives to the eval Function” on page 2-86

See Also
clear | exist | iskeyword | isvarname | namelengthmax | which

1-4
Case and Space Sensitivity

Case and Space Sensitivity


MATLAB code is sensitive to casing, and insensitive to blank spaces except when defining arrays.

Uppercase and Lowercase

In MATLAB code, use an exact match with regard to case for variables, files, and functions. For
example, if you have a variable, a, you cannot refer to that variable as A. It is a best practice to use
lowercase only when naming functions. This is especially useful when you use both Microsoft®
Windows® and UNIX®1 platforms because their file systems behave differently with regard to case.

When you use the help function, the help displays some function names in all uppercase, for
example, PLOT, solely to distinguish the function name from the rest of the text. Some functions for
interfacing to Oracle® Java® software do use mixed case and the command-line help and the
documentation accurately reflect that.

Spaces

Blank spaces around operators such as -, :, and ( ), are optional, but they can improve readability.
For example, MATLAB interprets the following statements the same way.

y = sin (3 * pi) / 2
y=sin(3*pi)/2

However, blank spaces act as delimiters in horizontal concatenation. When defining row vectors, you
can use spaces and commas interchangeably to separate elements:

A = [1, 0 2, 3 3]

A =

1 0 2 3 3

Because of this flexibility, check to ensure that MATLAB stores the correct values. For example, the
statement [1 sin (pi) 3] produces a much different result than [1 sin(pi) 3] does.

[1 sin (pi) 3]

Error using sin


Not enough input arguments.

[1 sin(pi) 3]

ans =

1.0000 0.0000 3.0000

1. UNIX is a registered trademark of The Open Group in the United States and other countries.

1-5
1 Syntax Basics

Command vs. Function Syntax

Command and Function Syntaxes


In MATLAB, these statements are equivalent:

load [Link] % Command syntax


load('[Link]') % Function syntax

This equivalence is sometimes referred to as command-function duality.

All functions support this standard function syntax:

[output1, ..., outputM] = functionName(input1, ..., inputN)

If you do not require any outputs from the function, and all of the inputs are character vectors (that
is, text enclosed in single quotation marks), you can use this simpler command syntax:

functionName input1 ... inputN

With command syntax, you separate inputs with spaces rather than commas, and do not enclose input
arguments in parentheses. Command syntax always passes inputs as character vectors. To use strings
as inputs, use the function syntax. If a character vector contains a space, use the function syntax.

When a function input is a variable, you must use function syntax to pass the value to the function.
Command syntax always passes inputs as character vectors and cannot pass variable values. For
example, create a variable and call the disp function with function syntax to pass the value of the
variable:

A = 123;
disp(A)

This code returns the expected result,

123

You cannot use command syntax to pass the value of A, because this call

disp A

is equivalent to

disp('A')

and returns

Avoid Common Syntax Mistakes


Suppose that your workspace contains these variables:

filename = '[Link]';
A = int8(1:8);
B = A;

1-6
Command vs. Function Syntax

The following table illustrates common misapplications of command syntax.

This Command... Is Equivalent to... Correct Syntax for Passing Value


open filename open('filename') open(filename)
isequal A B isequal('A','B') isequal(A,B)
strcmp class(A) int8 strcmp('class(A)','int8') strcmp(class(A),'int8')
cd matlabroot cd('matlabroot') cd(matlabroot)
isnumeric 500 isnumeric('500') isnumeric(500)
round 3.499 round('3.499'), which is round(3.499)
equivalent to round([51 46 52
57 57])
disp hello world disp('hello','world') disp('hello world')
disp "string" disp('"string"') disp("string")

Passing Variable Names

Some functions expect character vectors for variable names, such as save, load, clear, and whos.
For example,

whos -file [Link] X

requests information about variable X in the example file [Link]. This command is equivalent to

whos('-file','[Link]','X')

How MATLAB Recognizes Command Syntax


Consider the potentially ambiguous statement

ls ./d

This could be a call to the ls function with the folder ./d as its argument. It also could request
element-wise division on the array ls, using the variable d as the divisor.

If you issue such a statement at the command line, MATLAB can access the current workspace and
path to determine whether ls and d are functions or variables. However, some components, such as
the Code Analyzer and the Editor/Debugger, operate without reference to the path or workspace. In
those cases, MATLAB uses syntactic rules to determine whether an expression is a function call using
command syntax.

In general, when MATLAB recognizes an identifier (which might name a function or a variable), it
analyzes the characters that follow the identifier to determine the type of expression, as follows:

• An equal sign (=) implies assignment. For example:

ls =d
• An open parenthesis after an identifier implies a function call. For example:

ls('./d')
• Space after an identifier, but not after a potential operator, implies a function call using command
syntax. For example:

1-7
1 Syntax Basics

ls ./d
• Spaces on both sides of a potential operator, or no spaces on either side of the operator, imply an
operation on variables. For example, these statements are equivalent:

ls ./ d

ls./d

Therefore, the potentially ambiguous statement ls ./d is a call to the ls function using command
syntax.

The best practice is to avoid defining variable names that conflict with common functions, to prevent
any ambiguity.

1-8
Common Errors When Calling Functions

Common Errors When Calling Functions


In this section...
“Conflicting Function and Variable Names” on page 1-9
“Undefined Functions or Variables” on page 1-9

Conflicting Function and Variable Names


MATLAB throws an error if a variable and function have been given the same name and there is
insufficient information available for MATLAB to resolve the conflict. You may see an error message
something like the following:
Error: <functionName> was previously used as a variable,
conflicting with its use here as the name of a function
or command.

where <functionName> is the name of the function.

Certain uses of the eval and load functions can also result in a similar conflict between variable and
function names. For more information, see:

• “Conflicts with Function Names” on page 1-4


• “Unexpected Results When Loading Variables Within a Function”
• “Alternatives to the eval Function” on page 2-86

Undefined Functions or Variables


You may encounter the following error message, or something similar, while working with functions
or variables in MATLAB:
Undefined function or variable 'x'.

These errors usually indicate that MATLAB cannot find a particular variable or MATLAB program file
in the current directory or on the search path. The root cause is likely to be one of the following:

• The name of the function has been misspelled.


• The function name and name of the file containing the function are not the same.
• The toolbox to which the function belongs is not installed.
• The search path to the function has been changed.
• The function is part of a toolbox that you do not have a license for.

Follow the steps described in this section to resolve this situation.

Verify the Spelling of the Function Name

One of the most common errors is misspelling the function name. Especially with longer function
names or names containing similar characters (e.g., letter l and numeral one), it is easy to make an
error that is not easily detected.

If you misspell a MATLAB function, a suggested function name appears in the Command Window. For
example, this command fails because it includes an uppercase letter in the function name:

1-9
1 Syntax Basics

accumArray

Undefined function or variable 'accumArray'.

Did you mean:


>> accumarray

Press Enter to execute the suggested command or Esc to dismiss it.

Make Sure the Function Name Matches the File Name

You establish the name for a function when you write its function definition line. This name should
always match the name of the file you save it to. For example, if you create a function named
curveplot,

function curveplot(xVal, yVal)


- program code -

then you should name the file containing that function curveplot.m. If you create a pcode file for
the function, then name that file curveplot.p. In the case of conflicting function and file names, the
file name overrides the name given to the function. In this example, if you save the curveplot
function to a file named curveplotfunction.m, then attempts to invoke the function using the
function name will fail:

curveplot
Undefined function or variable 'curveplot'.

If you encounter this problem, change either the function name or file name so that they are the
same. If you have difficulty locating the file that uses this function, use the MATLAB Find Files utility
as follows:

1
On the Home tab, in the File section, click Find Files.
2 Under Find files named: enter *.m
3 Under Find files containing text: enter the function name.
4 Click the Find button

1-10
Common Errors When Calling Functions

Make Sure the Toolbox Is Installed

If you are unable to use a built-in function from MATLAB or its toolboxes, make sure that the function
is installed.

If you do not know which toolbox supports the function you need, search for the function
documentation at [Link] The toolbox name appears at the top of the
function reference page.

Once you know which toolbox the function belongs to, use the ver function to see which toolboxes
are installed on the system from which you run MATLAB. The ver function displays a list of all
currently installed MathWorks® products. If you can locate the toolbox you need in the output
displayed by ver, then the toolbox is installed. For help with installing MathWorks products, see the
Installation Guide documentation.

If you do not see the toolbox and you believe that it is installed, then perhaps the MATLAB path has
been set incorrectly. Go on to the next section.

Verify the Path Used to Access the Function

This step resets the path to the default.

Because MATLAB stores the toolbox information in a cache file, you will need to first update this
cache and then reset the path. To do this,

1
On the Home tab, in the Environment section, click Preferences.

The Preference dialog box appears.


2 Under the MATLAB > General node, click the Update Toolbox Path Cache button.
3
On the Home tab, in the Environment section, click Set Path....

1-11
1 Syntax Basics

The Set Path dialog box opens.


4 Click Default.

A small dialog box opens warning that you will lose your current path settings if you proceed.
Click Yes if you decide to proceed.

(If you have added any custom paths to MATLAB, you will need to restore those later)

Run ver again to see if the toolbox is installed. If not, you may need to reinstall this toolbox to use
this function. For more information about installing a toolbox, see How do I install additional
toolboxes into an existing installation of MATLAB.

Once ver shows your toolbox, run the following command to see if you can find the function:

which -all <functionname>

replacing <functionname> with the name of the function. You should be presented with the path(s)
of the function file. If you get a message indicating that the function name was not found, you may
need to reinstall that toolbox to make the function active.

1-12
2

Program Components

• “MATLAB Operators and Special Characters” on page 2-2


• “Array vs. Matrix Operations” on page 2-20
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “Array Comparison with Relational Operators” on page 2-29
• “Operator Precedence” on page 2-32
• “Average Similar Data Points Using a Tolerance” on page 2-34
• “Group Scattered Data Using a Tolerance” on page 2-36
• “Bit-Wise Operations” on page 2-38
• “Perform Cyclic Redundancy Check” on page 2-44
• “Conditional Statements” on page 2-47
• “Loop Control Statements” on page 2-49
• “Regular Expressions” on page 2-51
• “Lookahead Assertions in Regular Expressions” on page 2-63
• “Tokens in Regular Expressions” on page 2-66
• “Dynamic Regular Expressions” on page 2-72
• “Comma-Separated Lists” on page 2-79
• “Alternatives to the eval Function” on page 2-86
2 Program Components

MATLAB Operators and Special Characters


This page contains a comprehensive listing of all MATLAB operators, symbols, and special characters.

Arithmetic Operators
Symbol Role More Information
+ Addition plus
+ Unary plus uplus
- Subtraction minus
- Unary minus uminus
.* Element-wise multiplication times
* Matrix multiplication mtimes
./ Element-wise right division rdivide
/ Matrix right division mrdivide
.\ Element-wise left division ldivide
\ Matrix left division mldivide

(also known as backslash)


.^ Element-wise power power
^ Matrix power mpower
.' Transpose transpose
' Complex conjugate transpose ctranspose

Relational Operators
Symbol Role More Information
== Equal to eq
~= Not equal to ne
> Greater than gt
>= Greater than or equal to ge
< Less than lt
<= Less than or equal to le

Logical Operators
Symbol Role More Information
& Find logical AND and
| Find logical OR or
&& Find logical AND (with short- Logical Operators: Short-
circuiting) Circuit && ||

2-2
MATLAB Operators and Special Characters

Symbol Role More Information


|| Find logical OR (with short-
circuiting)
~ Find logical NOT not

Special Characters
@ Name: At symbol

Uses:

• Function handle construction and reference


• Calling superclass methods

Description: The @ symbol forms a handle to either the named function that follows the @
sign, or to the anonymous function that follows the @ sign. You can also use @ to call
superclass methods from subclasses.

Examples

Create a function handle to a named function:

fhandle = @myfun

Create a function handle to an anonymous function:

fhandle = @(x,y) x.^2 + y.^2;

Call the disp method of MySuper from a subclass:

disp@MySuper(obj)

Call the superclass constructor from a subclass using the object being constructed:

obj = obj@MySuper(arg1,arg2,...)

More Information:

• “Create Function Handle” on page 13-2


• “Call Superclass Methods on Subclass Objects”

2-3
2 Program Components

. Name: Period or dot

Uses:

• Decimal point
• Element-wise operations
• Structure field access
• Object property or method specifier

Description: The period character separates the integral and fractional parts of a
number, such as 3.1415. MATLAB operators that contain a period always work element-
wise. The period character also enables you to access the fields in a structure, as well as
the properties and methods of an object.

Examples

Decimal point:

102.5543

Element-wise operations:

A.*B
A.^2

Structure field access:

myStruct.f1

Object property specifier:

[Link]

More Information

• “Array vs. Matrix Operations” on page 2-20


• “Structures”
• “Access Property Values”

2-4
MATLAB Operators and Special Characters

... Name: Dot dot dot or ellipsis

Uses: Line continuation

Description: Three or more periods at the end of a line continues the current command
on the next line. If three or more periods occur before the end of a line, then MATLAB
ignores the rest of the line and continues to the next line. This effectively makes a
comment out of anything on the current line that follows the three periods.

Note MATLAB interprets the ellipsis as a space character. Therefore, multi-line


commands must be valid as a single line with the ellipsis replaced by a space character.

Examples

Continue a function call on the next line:

sprintf(['The current value '...


'of %s is %d'],vname,value)

Break a character vector up on multiple lines and concatenate the lines together:

S = ['If three or more periods occur before the '...


'end of a line, then the rest of that line is ' ...
'ignored and MATLAB continues to the next line']

To comment out one line in a multiline command, use ... at the beginning of the line to
ensure that the command remains complete. If you use % to comment out a line it
produces an error:

y = 1 +...
2 +...
% 3 +...
4;

However, this code runs properly since the third line does not produce a gap in the
command:

y = 1 +...
2 +...
... 3 +...
4;

More Information

• “Continue Long Statements on Multiple Lines” on page 1-2

2-5
2 Program Components

, Name: Comma

Uses: Separator

Description: Use commas to separate row elements in an array, array subscripts,


function input and output arguments, and commands entered on the same line.

Examples

Separate row elements to create an array:

A = [12,13; 14,15]

Separate subscripts:

A(1,2)

Separate input and output arguments in function calls:

[Y,I] = max(A,[],2)

Separate multiple commands on the same line (showing output):

figure, plot(sin(-pi:0.1:pi)), grid on

More Information

• horzcat

2-6
MATLAB Operators and Special Characters

: Name: Colon

Uses:

• Vector creation
• Indexing
• For-loop iteration

Description: Use the colon operator to create regularly spaced vectors, index into
arrays, and define the bounds of a for loop.

Examples

Create a vector:

x = 1:10

Create a vector that increments by 3:

x = 1:3:19

Reshape a matrix into a column vector:

A(:)

Assign new elements without changing the shape of an array:

A = rand(3,4);
A(:) = 1:12;

Index a range of elements in a particular dimension:

A(2:5,3)

Index all elements in a particular dimension:

A(:,3)

for loop bounds:

x = 1;
for k = 1:25
x = x + x^2;
end

More Information

• colon
• “Creating, Concatenating, and Expanding Matrices”

2-7
2 Program Components

; Name: Semicolon

Uses:

• Signify end of row


• Suppress output of code line

Description: Use semicolons to separate rows in an array creation command, or to


suppress the output display of a line of code.

Examples

Separate rows to create an array:

A = [12,13; 14,15]

Suppress code output:

Y = max(A);

Separate multiple commands on a single line (suppressing output):

A = 12.5; B = 42.7, C = 1.25;


B =
42.7000

More Information

• vertcat

2-8
MATLAB Operators and Special Characters

( ) Name: Parentheses

Uses:

• Operator precedence
• Function argument enclosure
• Indexing

Description: Use parentheses to specify precedence of operations, enclose function input


arguments, and index into an array.

Examples

Precedence of operations:

(A.*(B./C)) - D

Function argument enclosure:

plot(X,Y,'r*')
C = union(A,B)

Indexing:

A(3,:)
A(1,2)
A(1:5,1)

More Information

• “Operator Precedence” on page 2-32


• “Array Indexing”

2-9
2 Program Components

[ ] Name: Square brackets

Uses:

• Array construction
• Array concatenation
• Empty matrix and array element deletion
• Multiple output argument assignment

Description: Square brackets enable array construction and concatenation, creation of


empty matrices, deletion of array elements, and capturing values returned by a function.

Examples

Construct a three-element vector:

X = [10 12 -3]

Add a new bottom row to a matrix:

A = rand(3);
A = [A; 10 20 30]

Create an empty matrix:

A = []

Delete a matrix column:

A(:,1) = []

Capture three output arguments from a function:

[C,iA,iB] = union(A,B)

More Information

• “Creating, Concatenating, and Expanding Matrices”


• horzcat
• vertcat

2-10
MATLAB Operators and Special Characters

{ } Name: Curly brackets

Uses: Cell array assignment and contents

Description: Use curly braces to construct a cell array, or to access the contents of a
particular cell in a cell array.

Examples

To construct a cell array, enclose all elements of the array in curly braces:

C = {[2.6 4.7 3.9], rand(8)*6, 'C. Coolidge'}

Index to a specific cell array element by enclosing all indices in curly braces:

A = C{4,7,2}

More Information

• “Cell Arrays”
% Name: Percent

Uses:

• Comment
• Conversion specifier

Description: The percent sign is most commonly used to indicate nonexecutable text
within the body of a program. This text is normally used to include comments in your
code.

Some functions also interpret the percent sign as a conversion specifier.

Two percent signs, %%, serve as a cell delimiter as described in “Code Sections” on page
18-5.

Examples

Add a comment to a block of code:

% The purpose of this loop is to compute


% the value of ...

Use conversion specifier with sprintf:

sprintf('%s = %d', name, value)

More Information

• “Add Comments to Programs” on page 18-3

2-11
2 Program Components

%{ %} Name: Percent curly bracket

Uses: Block comments

Description: The %{ and %} symbols enclose a block of comments that extend beyond
one line.

Note With the exception of whitespace characters, the %{ and %} operators must appear
alone on the lines that immediately precede and follow the block of help text. Do not
include any other text on these lines.

Examples

Enclose any multiline comments with percent followed by an opening or closing brace:

%{
The purpose of this routine is to compute
the value of ...
%}

More Information

• “Add Comments to Programs” on page 18-3


! Name: Exclamation point

Uses: Operating system command

Description: The exclamation point precedes operating system commands that you want
to execute from within MATLAB.

Not available in MATLAB Online™.

Examples

The exclamation point initiates a shell escape function. Such a function is to be performed
directly by the operating system:

!rmdir oldtests

More Information

• “Shell Escape Function Example”

2-12
MATLAB Operators and Special Characters

? Name: Question mark

Uses: Metaclass for MATLAB class

Description: The question mark retrieves the [Link] object for a particular class
name. The ? operator works only with a class name, not an object.

Examples

Retrieve the [Link] object for class inputParser:

?inputParser

More Information

• metaclass
'' Name: Single quotes

Uses: Character array constructor

Description: Use single quotes to create character vectors that have class char.

Examples

Create a character vector:

chr = 'Hello, world'

More Information

• “Text in String and Character Arrays” on page 6-2


"" Name: Double quotes

Uses: String constructor

Description: Use double quotes to create string scalars that have class string.

Examples

Create a string scalar:

S = "Hello, world"

More Information

• “Text in String and Character Arrays” on page 6-2

2-13
2 Program Components

N/A Name: Space character

Uses: Separator

Description: Use the space character to separate row elements in an array constructor,
or the values returned by a function. In these contexts, the space character and comma
are equivalent.

Examples

Separate row elements to create an array:

% These statements are equivalent


A = [12 13; 14 15]
A = [12,13; 14,15]

Separate output arguments in function calls:

% These statements are equivalent


[Y I] = max(A)
[Y,I] = max(A)
N/A Name: Newline character

Uses: Separator

Description: Use the newline character to separate rows in an array construction


statement. In that context, the newline character and semicolon are equivalent.

Examples

Separate rows in an array creation command:

% These statements are equivalent


A = [12 13
14 15]
A = [12 13; 14 15]

2-14
MATLAB Operators and Special Characters

~ Name: Tilde

Uses:

• Logical NOT
• Argument placeholder

Description: Use the tilde symbol to represent logical NOT or to suppress specific input
or output arguments.

Examples

Calculate the logical NOT of a matrix:

A = eye(3);
~A

Determine where the elements of A are not equal to those of B:

A = [1 -1; 0 1]
B = [1 -2; 3 2]
A~=B

Return only the third output value of union:

[~,~,iB] = union(A,B)

More Information

• not
• “Ignore Function Inputs” on page 21-10
• “Ignore Function Outputs” on page 1-3
= Name: Equal sign

Uses: Assignment

Description: Use the equal sign to assign values to a variable. The syntax B = A stores
the elements of A in variable B.

Note The = character is for assignment, whereas the == character is for comparing the
elements in two arrays. See eq for more information.

Examples

Create a matrix A. Assign the values in A to a new variable, B. Lastly, assign a new value
to the first element in B.

A = [1 0; -1 0];
B = A;
B(1) = 200;

2-15
2 Program Components

< & Name: Left angle bracket and ampersand

Uses: Specify superclasses

Description: Specify one or more superclasses in a class definition

Examples

Define a class that derives from one superclass:

classdef MyClass < MySuperclass



end

Define a class that derives from multiple superclasses:

classdef MyClass < Superclass1 & Superclass2 & …



end

More Information:

• “Subclass Syntax”
.? Name: Dot question mark

Uses: Specify fields of name-value structure

Description:

When using function argument validation, you can define the fields of the name-value
structure as the names of all writeable properties of the class.

Examples

Specify the field names of the propArgs structure as the writeable properties of the
[Link] class.

function f(propArgs)
arguments
propArgs.?[Link]
end
% Function code
...
end

More Information:

• “Name-Value Arguments from Class Properties” on page 26-13

String and Character Formatting


Some special characters can only be used in the text of a character vector or string. You can use
these special characters to insert new lines or carriage returns, specify folder paths, and more.

Use the special characters in this table to specify a folder path using a character vector or string.

2-16
MATLAB Operators and Special Characters

/ Name: Slash and Backslash

\ Uses: File or folder path separation

Description: In addition to their use as mathematical operators, the slash and backslash
characters separate the elements of a path or folder. On Microsoft Windows based
systems, both slash and backslash have the same effect. On The Open Group UNIX based
systems, you must use slash only.

Examples

On a Windows system, you can use either backslash or slash:

dir([matlabroot '\toolbox\matlab\elmat\shiftdim.m'])
dir([matlabroot '/toolbox/matlab/elmat/shiftdim.m'])

On a UNIX system, use only the forward slash:

dir([matlabroot '/toolbox/matlab/elmat/shiftdim.m'])
.. Name: Dot dot

Uses: Parent folder

Description: Two dots in succession refers to the parent of the current folder. Use this
character to specify folder paths relative to the current folder.

Examples

To go up two levels in the folder tree and down into the test folder, use:

cd ..\..\test

More Information

• cd
* Name: Asterisk

Uses: Wildcard character

Description: In addition to being the symbol for matrix multiplication, the asterisk * is
used as a wildcard character.

Wildcards are generally used in file operations that act on multiple files or folders.
MATLAB matches all characters in the name exactly except for the wildcard character *,
which can match any one or more characters.

Examples

Locate all files with names that start with january_ and have a .mat file extension:

dir('january_*.mat')

2-17
2 Program Components

@ Name: At symbol

Uses: Class folder indicator

Description: An @ sign indicates the name of a class folder.

Examples

Refer to a class folder:

\@myClass\get.m

More Information

• “Class and Path Folders”


+ Name: Plus

Uses: Package directory indicator

Description: A + sign indicates the name of a package folder.

Examples

Package folders always begin with the + character:

+mypack
+mypack/pkfcn.m % a package function
+mypack/@myClass % class folder in a package

More Information

• “Packages Create Namespaces”

There are certain special characters that you cannot enter as ordinary text. Instead, you must use
unique character sequences to represent them. Use the symbols in this table to format strings and
character vectors on their own or in conjunction with formatting functions like compose, sprintf,
and error. For more information, see “Formatting Text” on page 6-24.

Symbol Effect on Text


'' Single quotation mark
%% Single percent sign
\\ Single backslash
\a Alarm
\b Backspace
\f Form feed
\n New line
\r Carriage return
\t Horizontal tab
\v Vertical tab
\xN Hexadecimal number, N

2-18
MATLAB Operators and Special Characters

Symbol Effect on Text


\N Octal number, N

See Also

More About
• “Array vs. Matrix Operations” on page 2-20
• “Array Comparison with Relational Operators” on page 2-29
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “Operator Precedence” on page 2-32
• “Find Array Elements That Meet a Condition” on page 5-2
• “Greek Letters and Special Characters in Chart Text”

2-19
2 Program Components

Array vs. Matrix Operations


In this section...
“Introduction” on page 2-20
“Array Operations” on page 2-20
“Matrix Operations” on page 2-22

Introduction
MATLAB has two different types of arithmetic operations: array operations and matrix operations.
You can use these arithmetic operations to perform numeric computations, for example, adding two
numbers, raising the elements of an array to a given power, or multiplying two matrices.

Matrix operations follow the rules of linear algebra. By contrast, array operations execute element by
element operations and support multidimensional arrays. The period character (.) distinguishes the
array operations from the matrix operations. However, since the matrix and array operations are the
same for addition and subtraction, the character pairs .+ and .- are unnecessary.

Array Operations
Array operations execute element by element operations on corresponding elements of vectors,
matrices, and multidimensional arrays. If the operands have the same size, then each element in the
first operand gets matched up with the element in the same location in the second operand. If the
operands have compatible sizes, then each input is implicitly expanded as needed to match the size of
the other. For more information, see “Compatible Array Sizes for Basic Operations” on page 2-25.

As a simple example, you can add two vectors with the same size.
A = [1 1 1]

A =

1 1 1

B = [1 2 3]

B =

1 2 3

A+B

ans =

2 3 4

If one operand is a scalar and the other is not, then MATLAB implicitly expands the scalar to be the
same size as the other operand. For example, you can compute the element-wise product of a scalar
and a matrix.
A = [1 2 3; 1 2 3]

A =

2-20
Array vs. Matrix Operations

1 2 3
1 2 3

3.*A

ans =

3 6 9
3 6 9

Implicit expansion also works if you subtract a 1-by-3 vector from a 3-by-3 matrix because the two
sizes are compatible. When you perform the subtraction, the vector is implicitly expanded to become
a 3-by-3 matrix.

A = [1 1 1; 2 2 2; 3 3 3]

A =

1 1 1
2 2 2
3 3 3

m = [2 4 6]

m =

2 4 6

A - m

ans =

-1 -3 -5
0 -2 -4
1 -1 -3

A row vector and a column vector have compatible sizes. If you add a 1-by-3 vector to a 2-by-1 vector,
then each vector implicitly expands into a 2-by-3 matrix before MATLAB executes the element-wise
addition.

x = [1 2 3]

x =

1 2 3

y = [10; 15]

y =

10
15

x + y

ans =

11 12 13
16 17 18

2-21
2 Program Components

If the sizes of the two operands are incompatible, then you get an error.
A = [8 1 6; 3 5 7; 4 9 2]

A =

8 1 6
3 5 7
4 9 2

m = [2 4]

m =

2 4

A - m

Matrix dimensions must agree.

The following table provides a summary of arithmetic array operators in MATLAB. For function-
specific information, click the link to the function reference page in the last column.

Operator Purpose Description Reference


Page
+ Addition A+B adds A and B. plus
+ Unary plus +A returns A. uplus
- Subtraction A-B subtracts B from A minus
- Unary minus -A negates the elements of A. uminus
.* Element-wise A.*B is the element-by-element product of A and times
multiplication B.
.^ Element-wise A.^B is the matrix with elements A(i,j) to the power
power B(i,j) power.
./ Right array A./B is the matrix with elements A(i,j)/ rdivide
division B(i,j).
.\ Left array A.\B is the matrix with elements B(i,j)/ ldivide
division A(i,j).
.' Array transpose A.' is the array transpose of A. For complex transpose
matrices, this does not involve conjugation.

Matrix Operations
Matrix operations follow the rules of linear algebra and are not compatible with multidimensional
arrays. The required size and shape of the inputs in relation to one another depends on the operation.
For nonscalar inputs, the matrix operators generally calculate different answers than their array
operator counterparts.

For example, if you use the matrix right division operator, /, to divide two matrices, the matrices
must have the same number of columns. But if you use the matrix multiplication operator, *, to
multiply two matrices, then the matrices must have a common inner dimension. That is, the number
of columns in the first input must be equal to the number of rows in the second input. The matrix
multiplication operator calculates the product of two matrices with the formula,

2-22
Array vs. Matrix Operations

n
C(i, j) = ∑ A(i, k)B(k, j) .
k=1

To see this, you can calculate the product of two matrices.

A = [1 3;2 4]

A =

1 3
2 4

B = [3 0;1 5]

B =

3 0
1 5

A*B

ans =

6 15
10 20

The previous matrix product is not equal to the following element-wise product.

A.*B

ans =

3 0
2 20

The following table provides a summary of matrix arithmetic operators in MATLAB. For function-
specific information, click the link to the function reference page in the last column.

Operator Purpose Description Reference


Page
* Matrix C = A*B is the linear algebraic product of the mtimes
multiplication matrices A and B. The number of columns of A
must equal the number of rows of B.
\ Matrix left x = A\B is the solution to the equation Ax = B. mldivide
division Matrices A and B must have the same number of
rows.
/ Matrix right x = B/A is the solution to the equation xA = B. mrdivide
division Matrices A and B must have the same number of
columns. In terms of the left division operator,
B/A = (A'\B')'.
^ Matrix power A^B is A to the power B, if B is a scalar. For other mpower
values of B, the calculation involves eigenvalues
and eigenvectors.

2-23
2 Program Components

Operator Purpose Description Reference


Page
' Complex A' is the linear algebraic transpose of A. For ctranspose
conjugate complex matrices, this is the complex conjugate
transpose transpose.

See Also

More About
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “MATLAB Operators and Special Characters” on page 2-2
• “Operator Precedence” on page 2-32

2-24
Compatible Array Sizes for Basic Operations

Compatible Array Sizes for Basic Operations


Most binary (two-input) operators and functions in MATLAB support numeric arrays that have
compatible sizes. Two inputs have compatible sizes if, for every dimension, the dimension sizes of the
inputs are either the same or one of them is 1. In the simplest cases, two array sizes are compatible if
they are exactly the same or if one is a scalar. MATLAB implicitly expands arrays with compatible
sizes to be the same size during the execution of the element-wise operation or function.

Inputs with Compatible Sizes


2-D Inputs

These are some combinations of scalars, vectors, and matrices that have compatible sizes:

• Two inputs which are exactly the same size.

• One input is a scalar.

• One input is a matrix, and the other is a column vector with the same number of rows.

• One input is a column vector, and the other is a row vector.

2-25
2 Program Components

Multidimensional Arrays

Every array in MATLAB has trailing dimensions of size 1. For multidimensional arrays, this means
that a 3-by-4 matrix is the same as a matrix of size 3-by-4-by-1-by-1-by-1. Examples of
multidimensional arrays with compatible sizes are:

• One input is a matrix, and the other is a 3-D array with the same number of rows and columns.

• One input is a matrix, and the other is a 3-D array. The dimensions are all either the same or one
of them is 1.

Empty Arrays

The rules are the same for empty arrays or arrays that have a dimension size of zero. The size of the
dimension that is not equal to 1 determines the size of the output. This means that dimensions with a

2-26
Compatible Array Sizes for Basic Operations

size of zero must be paired with a dimension of size 1 or 0 in the other array, and that the output has
a dimension size of 0.

A: 1-by-0
B: 3-by-1
Result: 3-by-0

Inputs with Incompatible Sizes


Incompatible inputs have sizes that cannot be implicitly expanded to be the same size. For example:

• One of the dimension sizes are not equal, and neither is 1.

A: 3-by-2
B: 4-by-2
• Two nonscalar row vectors with lengths that are not the same.

A: 1-by-3
B: 1-by-4

Examples
Subtract Vector from Matrix

To simplify vector-matrix operations, use implicit expansion with dimensional functions such as sum,
mean, min, and others.

For example, calculate the mean value of each column in a matrix, then subtract the mean value from
each element.

A = magic(3)

A =

8 1 6
3 5 7
4 9 2

C = mean(A)

C =

5 5 5

A - C

ans =

3 -4 1
-2 0 2
-1 4 -3

Add Row and Column Vector

Row and column vectors have compatible sizes, and when you perform an operation on them the
result is a matrix.

2-27
2 Program Components

For example, add a row and column vector. The result is the same as bsxfun(@plus,a,b).

a = [1 2 3 4]

ans =

1 2 3 4

b = [5; 6; 7]

ans =

5
6
7

a + b

ans =

6 7 8 9
7 8 9 10
8 9 10 11

See Also
bsxfun

More About
• “Array vs. Matrix Operations” on page 2-20
• “MATLAB Operators and Special Characters” on page 2-2

2-28
Array Comparison with Relational Operators

Array Comparison with Relational Operators


In this section...
“Array Comparison” on page 2-29
“Logic Statements” on page 2-31

Relational operators compare operands quantitatively, using operators like “less than”, “greater
than”, and “not equal to.” The result of a relational comparison is a logical array indicating the
locations where the relation is true.

These are the relational operators in MATLAB.

Symbol Function Equivalent Description


< lt Less than
<= le Less than or equal to
> gt Greater than
>= ge Greater than or equal to
== eq Equal to
~= ne Not equal to

Array Comparison
Numeric Arrays

The relational operators perform element-wise comparisons between two arrays. The arrays must
have compatible sizes to facilitate the operation. Arrays with compatible sizes are implicitly expanded
to be the same size during execution of the calculation. In the simplest cases, the two operands are
arrays of the same size, or one is a scalar. For more information, see “Compatible Array Sizes for
Basic Operations” on page 2-25.

For example, if you compare two matrices of the same size, then the result is a logical matrix of the
same size with elements indicating where the relation is true.

A = [2 4 6; 8 10 12]

A =

2 4 6
8 10 12

B = [5 5 5; 9 9 9]

B =

5 5 5
9 9 9

A < B

ans =

2-29
2 Program Components

1 1 0
1 0 0

Similarly, you can compare one of the arrays to a scalar.

A > 7

ans =

0 0 0
1 1 1

If you compare a 1-by-N row vector to an M-by-1 column vector, then MATLAB expands each vector
into an M-by-N matrix before performing the comparison. The resulting matrix contains the
comparison result for each combination of elements in the vectors.

A = 1:3

A =

1 2 3

B = [2; 3]

B =

2
3

A >= B

ans =

0 1 1
0 0 1

Empty Arrays

The relational operators work with arrays for which any dimension has size zero, as long as both
arrays have compatible sizes. This means that if one array has a dimension size of zero, then the size
of the corresponding dimension in the other array must be 1 or zero, and the size of that dimension in
the output is zero.

A = ones(3,0);
B = ones(3,1);
A == B

ans =

Empty matrix: 3-by-0

However, expressions such as

A == []

return an error if A is not 0-by-0 or 1-by-1. This behavior is consistent with that of all other binary
operators, such as +, -, >, <, &, |, and so on.

To test for empty arrays, use isempty(A).

2-30
Array Comparison with Relational Operators

Complex Numbers

• The operators >, <, >=, and <= use only the real part of the operands in performing comparisons.
• The operators == and ~= test both real and imaginary parts of the operands.

Inf, NaN, NaT, and undefined Element Comparisons

• Inf values are equal to other Inf values.


• NaN values are not equal to any other numeric value, including other NaN values.
• NaT values are not equal to any other datetime value, including other NaT values.
• Undefined categorical elements are not equal to any other categorical value, including other
undefined elements.

Logic Statements
Use relational operators in conjunction with the logical operators A & B (AND), A | B (OR),
xor(A,B) (XOR), and ~A (NOT), to string together more complex logical statements.

For example, you can locate where negative elements occur in two arrays.

A = [2 -1; -3 10]

A =

2 -1
-3 10

B = [0 -2; -3 -1]

B =

0 -2
-3 -1

A<0 & B<0

ans =

0 1
1 0

For more examples, see “Find Array Elements That Meet a Condition” on page 5-2.

See Also
eq | ge | gt | le | lt | ne

More About
• “Array vs. Matrix Operations” on page 2-20
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “MATLAB Operators and Special Characters” on page 2-2

2-31
2 Program Components

Operator Precedence
You can build expressions that use any combination of arithmetic, relational, and logical operators.
Precedence levels determine the order in which MATLAB evaluates an expression. Within each
precedence level, operators have equal precedence and are evaluated from left to right. The
precedence rules for MATLAB operators are shown in this list, ordered from highest precedence level
to lowest precedence level:

1 Parentheses ()
2 Transpose (.'), power (.^), complex conjugate transpose ('), matrix power (^)
3 Power with unary minus (.^-), unary plus (.^+), or logical negation (.^~) as well as matrix
power with unary minus (^-), unary plus (^+), or logical negation (^~).

Note Although most operators work from left to right, the operators (^-), (.^-), (^+), (.^+),
(^~), and (.^~) work from second from the right to left. It is recommended that you use
parentheses to explicitly specify the intended precedence of statements containing these
operator combinations.
4 Unary plus (+), unary minus (-), logical negation (~)
5 Multiplication (.*), right division (./), left division (.\), matrix multiplication (*), matrix
right division (/), matrix left division (\)
6 Addition (+), subtraction (-)
7 Colon operator (:)
8 Less than (<), less than or equal to (<=), greater than (>), greater than or equal to (>=),
equal to (==), not equal to (~=)
9 Element-wise AND (&)
10 Element-wise OR (|)
11 Short-circuit AND (&&)
12 Short-circuit OR (||)

Precedence of AND and OR Operators


MATLAB always gives the & operator precedence over the | operator. Although MATLAB typically
evaluates expressions from left to right, the expression a|b&c is evaluated as a|(b&c). It is a good
idea to use parentheses to explicitly specify the intended precedence of statements containing
combinations of & and |.

The same precedence rule holds true for the && and || operators.

Overriding Default Precedence


The default precedence can be overridden using parentheses, as shown in this example:
A = [3 9 5];
B = [2 1 5];
C = A./B.^2
C =
0.7500 9.0000 0.2000

2-32
Operator Precedence

C = (A./B).^2
C =
2.2500 81.0000 1.0000

See Also

More About
• “Array vs. Matrix Operations” on page 2-20
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “Array Comparison with Relational Operators” on page 2-29
• “MATLAB Operators and Special Characters” on page 2-2

2-33
2 Program Components

Average Similar Data Points Using a Tolerance


This example shows how to use uniquetol to find the average z-coordinate of 3-D points that have
similar (within tolerance) x and y coordinates.

Use random points picked from the peaks function in the domain [ − 3, 3] × [ − 3, 3] as the data set.
Add a small amount of noise to the data.

xy = rand(10000,2)*6-3;
z = peaks(xy(:,1),xy(:,2)) + 0.5-rand(10000,1);
A = [xy z];
plot3(A(:,1), A(:,2), A(:,3), '.')
view(-28,32)

Find points that have similar x and y coordinates using uniquetol with these options:

• Specify ByRows as true, since the rows of A contain the point coordinates.
• Specify OutputAllIndices as true to return the indices for all points that are within tolerance
of each other.
• Specify DataScale as [1 1 Inf] to use an absolute tolerance for the x and y coordinates, while
ignoring the z-coordinate.

DS = [1 1 Inf];
[C,ia] = uniquetol(A, 0.3, 'ByRows', true, ...
'OutputAllIndices', true, 'DataScale', DS);

2-34
Average Similar Data Points Using a Tolerance

Average each group of points that are within tolerance (including the z-coordinates), producing a
reduced data set that still holds the general shape of the original data.

for k = 1:length(ia)
aveA(k,:) = mean(A(ia{k},:),1);
end

Plot the resulting averaged-out points on top of the original data.

hold on
plot3(aveA(:,1), aveA(:,2), aveA(:,3), '.r', 'MarkerSize', 15)

See Also
uniquetol

More About
• “Group Scattered Data Using a Tolerance” on page 2-36

2-35
2 Program Components

Group Scattered Data Using a Tolerance


This example shows how to group scattered data points based on their proximity to points of interest.

Create a set of random 2-D points. Then create and plot a grid of equally spaced points on top of the
random data.

x = rand(10000,2);
[a,b] = meshgrid(0:0.1:1);
gridPoints = [a(:), b(:)];
plot(x(:,1), x(:,2), '.')
hold on
plot(gridPoints(:,1), gridPoints(:,2), 'xr', 'Markersize', 6)

Use ismembertol to locate the data points in x that are within tolerance of the grid points in
gridPoints. Use these options with ismembertol:

• Specify ByRows as true, since the point coordinates are in the rows of x.
• Specify OutputAllIndices as true to return all of the indices for rows in x that are within
tolerance of the corresponding row in gridPoints.

[LIA,LocB] = ismembertol(gridPoints, x, 0.05, ...


'ByRows', true, 'OutputAllIndices', true);

For each grid point, plot the points in x that are within tolerance of that grid point.

2-36
Group Scattered Data Using a Tolerance

figure
hold on
for k = 1:length(LocB)
plot(x(LocB{k},1), x(LocB{k},2), '.')
end
plot(gridPoints(:,1), gridPoints(:,2), 'xr', 'Markersize', 6)

See Also
ismembertol

More About
• “Average Similar Data Points Using a Tolerance” on page 2-34

2-37
2 Program Components

Bit-Wise Operations
This topic shows how to use bit-wise operations in MATLAB® to manipulate the bits of numbers.
Operating on bits is directly supported by most modern CPUs. In many cases, manipulating the bits of
a number in this way is quicker than performing arithmetic operations like division or multiplication.

Number Representations

Any number can be represented with bits (also known as binary digits). The binary, or base 2, form of
a number contains 1s and 0s to indicate which powers of 2 are present in the number. For example,
the 8-bit binary form of 7 is

00000111

A collection of 8 bits is also called 1 byte. In binary representations, the bits are counted from the
right to the left, so the first bit in this representation is a 1. This number represents 7 because

2 1 0
2 + 2 + 2 = 7.

When you type numbers into MATLAB, it assumes the numbers are double precision (a 64-bit binary
representation). However, you can also specify single-precision numbers (32-bit binary
representation) and integers (signed or unsigned, from 8 to 64 bits). For example, the most memory
efficient way to store the number 7 is with an 8-bit unsigned integer:

a = uint8(7)

a = uint8
7

You can even specify the binary form directly using the prefix 0b followed by the binary digits (for
more information, see “Hexadecimal and Binary Values” on page 6-55). MATLAB stores the number
in an integer format with the fewest number of bits. Instead of specifying all the bits, you need to
specify only the left-most 1 and all the digits to the right of it. The bits to the left of that bit are
trivially zero. So the number 7 is:

b = 0b111

b = uint8
7

MATLAB stores negative integers using two's complement. For example, consider the 8-bit signed
integer -8. To find the two's complement bit pattern for this number:

1 Start with the bit pattern of the positive version of the number, 8: 00001000.
2 Next, flip all of the bits: 11110111.
3 Finally, add 1 to the result: 11111000.

The result, 11111000, is the bit pattern for -8:

n = 0b11111000s8

n = int8
-8

2-38
Bit-Wise Operations

MATLAB does not natively display the binary format of numbers. For that, you can use the dec2bin
function, which returns a character vector of binary digits for positive integers. Again, this function
returns only the digits that are not trivially zero.
dec2bin(b)

ans =
'111'

You can use bin2dec to switch between the two formats. For example, you can convert the binary
digits 10110101 to decimal format with the commands
data = [1 0 1 1 0 1 0 1];
dec = bin2dec(num2str(data))

dec = 181

The cast and typecast functions are also useful to switch among different data types. These
functions are similar, but they differ in how they treat the underlying storage of the number:

• cast — Changes the underlying data type of a variable.


• typecast — Converts data types without changing the underlying bits.

Because MATLAB does not display the digits of a binary number directly, you must pay attention to
data types when you work with bit-wise operations. Some functions return binary digits as a
character vector (dec2bin), some return the decimal number (bitand), and others return a vector of
the bits themselves (bitget).

Bit Masking with Logical Operators

MATLAB has several functions that enable you to perform logical operations on the bits of two equal-
length binary representations of numbers, known as bit masking:

• bitand — If both digits are 1, then the resulting digit is also a 1. Otherwise, the resulting digit is
0.
• bitor — If either digit is 1, then the resulting digit is also a 1. Otherwise, the resulting digit is 0.
• bitxor — If the digits are different, then the resulting digit is a 1. Otherwise, the resulting digit
is 0.

In addition to these functions, the bit-wise complement is available with bitcmp, but this is a unary
operation that flips the bits in only one number at a time.

One use of bit masking is to query the status of a particular bit. For example, if you use a bit-wise
AND operation with the binary number 00001000, you can query the status of the fourth bit. You can
then shift that bit to the first position so that MATLAB returns a 0 or 1 (the next section describes bit
shifting in more detail).
n = 0b10111001;
n4 = bitand(n,0b1000);
n4 = bitshift(n4,-3)

n4 = uint8
1

Bit-wise operations can have surprising applications. For example, consider the 8-bit binary
representation of the number n = 8:

2-39
2 Program Components

00001000

8 is a power of 2, so its binary representation contains a single 1. Now consider the number
n − 1 = 7:

00000111

By subtracting 1, all of the bits starting at the right-most 1 are flipped. As a result, when n is a power
of 2, corresponding digits of n and n − 1 are always different, and the bit-wise AND returns zero.

n = 0b1000;
bitand(n,n-1)

ans = uint8
0

0
However, when n is not a power of 2, then the right-most 1 is for the 2 bit, so n and n − 1 have all
0
the same bits except for the 2 bit. For this case, the bit-wise AND returns a nonzero number.

n = 0b101;
bitand(n,n-1)

ans = uint8
4

This operation suggests a simple function that operates on the bits of a given input number to check
whether the number is a power of 2:

function tf = isPowerOfTwo(n)
tf = n && ~bitand(n,n-1);
end

The use of the short-circuit AND operator && checks to make sure that n is not zero. If it is, then the
function does not need to calculate bitand(n,n-1) to know that the correct answer is false.

Shifting Bits

Because bit-wise logical operations compare corresponding bits in two numbers, it is useful to be able
to move the bits around to change which bits are compared. You can use bitshift to perform this
operation:

• bitshift(A,N) shifts the bits of A to the left by N digits. This is equivalent to multiplying A by
N
2 .
• bitshift(A,-N) shifts the bits of A to the right by N digits. This is equivalent to dividing A by
N
2 .

These operations are sometimes written A<<N (left shift) and A>>N (right shift), but MATLAB does not
use << and >> operators for this purpose.

When the bits of a number are shifted, some bits fall off the end of the number, and 0s or 1s are
introduced to fill in the newly created space. When you shift bits to the left, the bits are filled in on
the right; when you shift bits to the right, the bits are filled in on the left.

For example, if you shift the bits of the number 8 (binary: 1000) to the right by one digit, you get 4
(binary: 100).

2-40
Bit-Wise Operations

n = 0b1000;
bitshift(n,-1)

ans = uint8
4

Similarly, if you shift the number 15 (binary: 1111) to the left by two digits, you get 60 (binary:
111100).

n = 0b1111;
bitshift(15,2)

ans = 60

When you shift the bits of a negative number, bitshift preserves the signed bit. For example, if you
shift the signed integer -3 (binary: 11111101) to the right by 2 digits, you get -1 (binary: 11111111).
In these cases, bitshift fills in on the left with 1s rather than 0s.

n = 0b11111101s8;
bitshift(n,-2)

ans = int8
-1

Writing Bits

You can use the bitset function to change the bits in a number. For example, change the first bit of
the number 8 to a 1 (which adds 1 to the number):

bitset(8,1)

ans = 9

By default, bitset flips bits to on or 1. You can optionally use the third input argument to specify the
bit value.

bitset does not change multiple bits at once, so you need to use a for loop to change multiple bits.
Therefore, the bits you change can be either consecutive or nonconsecutive. For example, change the
first two bits of the binary number 1000:

bits = [1 2];
c = 0b1000;
for k = 1:numel(bits)
c = bitset(c,bits(k));
end
dec2bin(c)

ans =
'1011'

Another common use of bitset is to convert a vector of binary digits into decimal format. For
example, use a loop to set the individual bits of the integer 11001101.

data = [1 1 0 0 1 1 0 1];
n = length(data);
dec = 0b0u8;
for k = 1:n
dec = bitset(dec,n+1-k,data(k));

2-41
2 Program Components

end
dec

dec = uint8
205

dec2bin(dec)

ans =
'11001101'

Reading Consecutive Bits

Another use of bit shifting is to isolate consecutive sections of bits. For example, read the last four
bits in the 16-bit number 0110000010100000. Recall that the last four bits are on the left of the
binary representation.

n = 0b0110000010100000;
dec2bin(bitshift(n,-12))

ans =
'110'

To isolate consecutive bits in the middle of the number, you can combine the use of bit shifting with
logical masking. For example, to extract the 13th and 14th bits, you can shift the bits to the right by
12 and then mask the resulting four bits with 0011. Because the inputs to bitand must be the same
integer data type, you can specify 0011 as an unsigned 16-bit integer with 0b11u16. Without the -
u16 suffix, MATLAB stores the number as an unsigned 8-bit integer.

m = 0b11u16;
dec2bin(bitand(bitshift(n,-12),m))

ans =
'10'

Another way to read consecutive bits is with bitget, which reads specified bits from a number. You
can use colon notation to specify several consecutive bits to read. For example, read the last 8 bits of
n.

bitget(n,16:-1:8)

ans = 1x9 uint16 row vector

0 1 1 0 0 0 0 0 1

Reading Nonconsecutive Bits

You can also use bitget to read bits from a number when the bits are not next to each other. For
example, read the 5th, 8th, and 14th bits from n.

bits = [14 8 5];


bitget(n,bits)

ans = 1x3 uint16 row vector

2-42
Bit-Wise Operations

1 1 0

See Also
bitand | bitcmp | bitget | bitor | bitset | bitshift | bitxor

More About
• “Integers” on page 4-2
• “Perform Cyclic Redundancy Check” on page 2-44
• “Hexadecimal and Binary Values” on page 6-55

2-43
2 Program Components

Perform Cyclic Redundancy Check


This example shows how to perform a cyclic redundancy check (CRC) on the bits of a number. CRCs
are used to detect errors in the transmission of data in digital systems. When a piece of data is sent, a
short check value is attached to it. The check value is obtained by polynomial division with the bits in
the data. When the data is received, the polynomial division is repeated, and the result is compared
with the check value. If the results differ, then the data was corrupted during transmission.

Calculate Check Value by Hand

Start with a 16-bit binary number, which is the message to be transmitted:

1101100111011010

To obtain the check value, divide this number by the polynomial x3 + x2 + x + 1. You can represent
this polynomial with its coefficients: 1111.

The division is performed in steps, and after each step the polynomial divisor is aligned with the left-
most 1 in the number. Because the result of dividing by the four term polynomial has three bits (in
general dividing by a polynomial of length n + 1 produces a check value of length n), append the
number with 000 to calculate the remainder. At each step, the result uses the bit-wise XOR of the four
bits being operated on, and all other bits are unchanged.

The first division is

1101100111011010 000
1111
----------------
0010100111011010 000

Each successive division operates on the result of the previous step, so the second division is

0010100111011010 000
1111
----------------
0001010111011010 000

The division is completed once the dividend is all zeros. The complete division, including the above
two steps, is

1101100111011010 000
1111
0010100111011010 000
1111
0001010111011010 000
1111
0000101111011010 000
1111
0000010011011010 000
1111
0000001101011010 000
1111
0000000010011010 000
1111
0000000001101010 000
1111

2-44
Perform Cyclic Redundancy Check

0000000000010010 000
1111
0000000000001100 000
1111
0000000000000011 000
11 11
0000000000000000 110

The remainder bits, 110, are the check value for this message.

Calculate Check Value Programmatically

In MATLAB®, you can perform this same operation to obtain the check value using bit-wise
operations. First, define variables for the message and polynomial divisor. Use unsigned 32-bit
integers so that extra bits are available for the remainder.
message = 0b1101100111011010u32;
messageLength = 16;
divisor = 0b1111u32;
divisorDegree = 3;

Next, initialize the polynomial divisor. Use dec2bin to display the bits of the result.
divisor = bitshift(divisor,messageLength-divisorDegree-1);
dec2bin(divisor)

ans =
'1111000000000000'

Now, shift the divisor and message so that they have the correct number of bits (16 bits for the
message and 3 bits for the remainder).
divisor = bitshift(divisor,divisorDegree);
remainder = bitshift(message,divisorDegree);
dec2bin(divisor)

ans =
'1111000000000000000'

dec2bin(remainder)

ans =
'1101100111011010000'

Perform the division steps of the CRC using a for loop. The for loop always advances a single bit
each step, so include a check to see if the current digit is a 1. If the current digit is a 1, then the
division step is performed; otherwise, the loop advances a bit and continues.
for k = 1:messageLength
if bitget(remainder,messageLength+divisorDegree)
remainder = bitxor(remainder,divisor);
end
remainder = bitshift(remainder,1);
end

Shift the bits of the remainder to the right to get the check value for the operation.
CRC_check_value = bitshift(remainder,-messageLength);
dec2bin(CRC_check_value)

2-45
2 Program Components

ans =
'110'

Check Message Integrity

You can use the check value to verify the integrity of a message by repeating the same division
operation. However, instead of using a remainder of 000 to start, use the check value 110. If the
message is error free, then the result of the division will be zero.

Reset the remainder variable, and add the CRC check value to the remainder bits using a bit-wise OR.
Introduce an error into the message by flipping one of the bit values with bitset.

remainder = bitshift(message,divisorDegree);
remainder = bitor(remainder,CRC_check_value);
remainder = bitset(remainder,6);
dec2bin(remainder)

ans =
'1101100111011110110'

Perform the CRC division operation and then check if the result is zero.

for k = 1:messageLength
if bitget(remainder,messageLength+divisorDegree)
remainder = bitxor(remainder,divisor);
end
remainder = bitshift(remainder,1);
end
if remainder == 0
disp('Message is error free.')
else
disp('Message contains errors.')
end

Message contains errors.

References
[1] Sklar, Bernard. Digital Communications: Fundamentals and Applications. Englewood Cliffs, NJ:
Prentice Hall, 1988.

[2] Wicker, Stephen B. Error Control Systems for Digital Communication and Storage. Upper Saddle
River, NJ: Prentice Hall, 1995.

See Also
bitshift | bitxor

More About
• “Bit-Wise Operations” on page 2-38
• “Hexadecimal and Binary Values” on page 6-55

2-46
Conditional Statements

Conditional Statements
Conditional statements enable you to select at run time which block of code to execute. The simplest
conditional statement is an if statement. For example:

% Generate a random number


a = randi(100, 1);

% If it is even, divide by 2
if rem(a, 2) == 0
disp('a is even')
b = a/2;
end

if statements can include alternate choices, using the optional keywords elseif or else. For
example:

a = randi(100, 1);

if a < 30
disp('small')
elseif a < 80
disp('medium')
else
disp('large')
end

Alternatively, when you want to test for equality against a set of known values, use a switch
statement. For example:

[dayNum, dayString] = weekday(date, 'long', 'en_US');

switch dayString
case 'Monday'
disp('Start of the work week')
case 'Tuesday'
disp('Day 2')
case 'Wednesday'
disp('Day 3')
case 'Thursday'
disp('Day 4')
case 'Friday'
disp('Last day of the work week')
otherwise
disp('Weekend!')
end

For both if and switch, MATLAB executes the code corresponding to the first true condition, and
then exits the code block. Each conditional statement requires the end keyword.

In general, when you have many possible discrete, known values, switch statements are easier to
read than if statements. However, you cannot test for inequality between switch and case values.
For example, you cannot implement this type of condition with a switch:

yourNumber = input('Enter a number: ');

if yourNumber < 0

2-47
2 Program Components

disp('Negative')
elseif yourNumber > 0
disp('Positive')
else
disp('Zero')
end

See Also
end | if | return | switch

2-48
Loop Control Statements

Loop Control Statements


With loop control statements, you can repeatedly execute a block of code. There are two types of
loops:

• for statements loop a specific number of times, and keep track of each iteration with an
incrementing index variable.

For example, preallocate a 10-element vector, and calculate five values:

x = ones(1,10);
for n = 2:6
x(n) = 2 * x(n - 1);
end
• while statements loop as long as a condition remains true.

For example, find the first integer n for which factorial(n) is a 100-digit number:

n = 1;
nFactorial = 1;
while nFactorial < 1e100
n = n + 1;
nFactorial = nFactorial * n;
end

Each loop requires the end keyword.

It is a good idea to indent the loops for readability, especially when they are nested (that is, when one
loop contains another loop):

A = zeros(5,100);
for m = 1:5
for n = 1:100
A(m, n) = 1/(m + n - 1);
end
end

You can programmatically exit a loop using a break statement, or skip to the next iteration of a loop
using a continue statement. For example, count the number of lines in the help for the magic
function (that is, all comment lines until a blank line):

fid = fopen('magic.m','r');
count = 0;
while ~feof(fid)
line = fgetl(fid);
if isempty(line)
break
elseif ~strncmp(line,'%',1)
continue
end
count = count + 1;
end
fprintf('%d lines in MAGIC help\n',count);
fclose(fid);

2-49
2 Program Components

Tip If you inadvertently create an infinite loop (a loop that never ends on its own), stop execution of
the loop by pressing Ctrl+C.

See Also
break | continue | end | for | while

2-50
Regular Expressions

Regular Expressions
In this section...
“What Is a Regular Expression?” on page 2-51
“Steps for Building Expressions” on page 2-52
“Operators and Characters” on page 2-55

This topic describes what regular expressions are and how to use them to search text. Regular
expressions are flexible and powerful, though they use complex syntax. An alternative to regular
expressions is a pattern (since R2020b), which is simpler to define and results in code that is easier
to read. For more information, see “Build Pattern Expressions” on page 6-40.

What Is a Regular Expression?


A regular expression is a sequence of characters that defines a certain pattern. You normally use a
regular expression to search text for a group of words that matches the pattern, for example, while
parsing program input or while processing a block of text.

The character vector 'Joh?n\w*' is an example of a regular expression. It defines a pattern that
starts with the letters Jo, is optionally followed by the letter h (indicated by 'h?'), is then followed
by the letter n, and ends with any number of word characters, that is, characters that are alphabetic,
numeric, or underscore (indicated by '\w*'). This pattern matches any of the following:

Jon, John, Jonathan, Johnny

Regular expressions provide a unique way to search a volume of text for a particular subset of
characters within that text. Instead of looking for an exact character match as you would do with a
function like strfind, regular expressions give you the ability to look for a particular pattern of
characters.

For example, several ways of expressing a metric rate of speed are:

km/h
km/hr
km/hour
kilometers/hour
kilometers per hour

You could locate any of the above terms in your text by issuing five separate search commands:

strfind(text, 'km/h');
strfind(text, 'km/hour');
% etc.

To be more efficient, however, you can build a single phrase that applies to all of these search terms:

2-51
2 Program Components

Translate this phrase into a regular expression (to be explained later in this section) and you have:

pattern = 'k(ilo)?m(eters)?(/|\sper\s)h(r|our)?';

Now locate one or more of the terms using just a single command:

text = ['The high-speed train traveled at 250 ', ...


'kilometers per hour alongside the automobile ', ...
'travelling at 120 km/h.'];
regexp(text, pattern, 'match')

ans =

1×2 cell array

{'kilometers per hour'} {'km/h'}

There are four MATLAB functions that support searching and replacing characters using regular
expressions. The first three are similar in the input values they accept and the output values they
return. For details, click the links to the function reference pages.

Function Description
regexp Match regular expression.
regexpi Match regular expression, ignoring case.
regexprep Replace part of text using regular expression.
regexptranslate Translate text into regular expression.

When calling any of the first three functions, pass the text to be parsed and the regular expression in
the first two input arguments. When calling regexprep, pass an additional input that is an
expression that specifies a pattern for the replacement.

Steps for Building Expressions


There are three steps involved in using regular expressions to search text for a particular term:

1 Identify unique patterns in the string on page 2-53

This entails breaking up the text you want to search for into groups of like character types. These
character types could be a series of lowercase letters, a dollar sign followed by three numbers
and then a decimal point, etc.
2 Express each pattern as a regular expression on page 2-53

2-52
Regular Expressions

Use the metacharacters and operators described in this documentation to express each segment
of your search pattern as a regular expression. Then combine these expression segments into the
single expression to use in the search.
3 Call the appropriate search function on page 2-54

Pass the text you want to parse to one of the search functions, such as regexp or regexpi, or to
the text replacement function, regexprep.

The example shown in this section searches a record containing contact information belonging to a
group of five friends. This information includes each person's name, telephone number, place of
residence, and email address. The goal is to extract specific information from the text..
contacts = { ...
'Harry 287-625-7315 Columbus, OH hparker@[Link]'; ...
'Janice 529-882-1759 Fresno, CA jan_stephens@[Link]'; ...
'Mike 793-136-0975 Richmond, VA sue_and_mike@[Link]'; ...
'Nadine 648-427-9947 Tampa, FL nadine_berry@[Link]'; ...
'Jason 697-336-7728 Montrose, CO jason_blake@[Link]'};

The first part of the example builds a regular expression that represents the format of a standard
email address. Using that expression, the example then searches the information for the email
address of one of the group of friends. Contact information for Janice is in row 2 of the contacts cell
array:
contacts{2}

ans =

'Janice 529-882-1759 Fresno, CA jan_stephens@[Link]'

Step 1 — Identify Unique Patterns in the Text

A typical email address is made up of standard components: the user's account name, followed by an
@ sign, the name of the user's internet service provider (ISP), a dot (period), and the domain to which
the ISP belongs. The table below lists these components in the left column, and generalizes the
format of each component in the right column.

Unique patterns of an email address General description of each pattern


Start with the account name One or more lowercase letters and underscores
jan_stephens . . .
Add '@' @ sign
jan_stephens@ . . .
Add the ISP One or more lowercase letters, no underscores
jan_stephens@horizon . . .
Add a dot (period) Dot (period) character
jan_stephens@horizon. . . .
Finish with the domain com or net
jan_stephens@[Link]

Step 2 — Express Each Pattern as a Regular Expression

In this step, you translate the general formats derived in Step 1 into segments of a regular
expression. You then add these segments together to form the entire expression.

2-53
2 Program Components

The table below shows the generalized format descriptions of each character pattern in the left-most
column. (This was carried forward from the right column of the table in Step 1.) The second column
shows the operators or metacharacters that represent the character pattern.

Description of each segment Pattern


One or more lowercase letters and underscores [a-z_]+
@ sign @
One or more lowercase letters, no underscores [a-z]+
Dot (period) character \.
com or net (com|net)

Assembling these patterns into one character vector gives you the complete expression:

email = '[a-z_]+@[a-z]+\.(com|net)';

Step 3 — Call the Appropriate Search Function

In this step, you use the regular expression derived in Step 2 to match an email address for one of the
friends in the group. Use the regexp function to perform the search.

Here is the list of contact information shown earlier in this section. Each person's record occupies a
row of the contacts cell array:

contacts = { ...
'Harry 287-625-7315 Columbus, OH hparker@[Link]'; ...
'Janice 529-882-1759 Fresno, CA jan_stephens@[Link]'; ...
'Mike 793-136-0975 Richmond, VA sue_and_mike@[Link]'; ...
'Nadine 648-427-9947 Tampa, FL nadine_berry@[Link]'; ...
'Jason 697-336-7728 Montrose, CO jason_blake@[Link]'};

This is the regular expression that represents an email address, as derived in Step 2:

email = '[a-z_]+@[a-z]+\.(com|net)';

Call the regexp function, passing row 2 of the contacts cell array and the email regular
expression. This returns the email address for Janice.

regexp(contacts{2}, email, 'match')

ans =

1×1 cell array

{'jan_stephens@[Link]'}

MATLAB parses a character vector from left to right, “consuming” the vector as it goes. If matching
characters are found, regexp records the location and resumes parsing the character vector, starting
just after the end of the most recent match.

Make the same call, but this time for the fifth person in the list:

regexp(contacts{5}, email, 'match')

ans =

2-54
Regular Expressions

1×1 cell array

{'jason_blake@[Link]'}

You can also search for the email address of everyone in the list by using the entire cell array for the
input argument:

regexp(contacts, email, 'match');

Operators and Characters


Regular expressions can contain characters, metacharacters, operators, tokens, and flags that specify
patterns to match, as described in these sections:

• “Metacharacters” on page 2-55


• “Character Representation” on page 2-56
• “Quantifiers” on page 2-56
• “Grouping Operators” on page 2-57
• “Anchors” on page 2-58
• “Lookaround Assertions” on page 2-58
• “Logical and Conditional Operators” on page 2-59
• “Token Operators” on page 2-60
• “Dynamic Expressions” on page 2-60
• “Comments” on page 2-61
• “Search Flags” on page 2-61

Metacharacters

Metacharacters represent letters, letter ranges, digits, and space characters. Use them to construct a
generalized pattern of characters.

Metacharacter Description Example


. Any single character, including white '..ain' matches sequences of five
space consecutive characters that end with 'ain'.
[c1c2c3] Any character contained within the '[rp.]ain' matches 'rain' or 'pain' or
square brackets. The following '.ain'.
characters are treated literally: $ | . *
+ ? and - when not used to indicate a
range.
[^c1c2c3] Any character not contained within the '[^*rp]ain' matches all four-letter
square brackets. The following sequences that end in 'ain', except 'rain'
characters are treated literally: $ | . * and 'pain' and '*ain'. For example, it
+ ? and - when not used to indicate a matches 'gain', 'lain', or 'vain'.
range.
[c1-c2] Any character in the range of c1 through '[A-G]' matches a single character in the
c2 range of A through G.

2-55
2 Program Components

Metacharacter Description Example


\w Any alphabetic, numeric, or underscore '\w*' identifies a word comprised of any
character. For English character sets, \w grouping of alphabetic, numeric, or underscore
is equivalent to [a-zA-Z_0-9] characters.
\W Any character that is not alphabetic, '\W*' identifies a term that is not a word
numeric, or underscore. For English comprised of any grouping of alphabetic,
character sets, \W is equivalent to [^a- numeric, or underscore characters.
zA-Z_0-9]
\s Any white-space character; equivalent to '\w*n\s' matches words that end with the
[ \f\n\r\t\v] letter n, followed by a white-space character.
\S Any non-white-space character; '\d\S' matches a numeric digit followed by
equivalent to [^ \f\n\r\t\v] any non-white-space character.
\d Any numeric digit; equivalent to [0-9] '\d*' matches any number of consecutive
digits.
\D Any nondigit character; equivalent to '\w*\D\>' matches words that do not end
[^0-9] with a numeric digit.
\oN or \o{N} Character of octal value N '\o{40}' matches the space character,
defined by octal 40.
\xN or \x{N} Character of hexadecimal value N '\x2C' matches the comma character, defined
by hex 2C.

Character Representation

Operator Description
\a Alarm (beep)
\b Backspace
\f Form feed
\n New line
\r Carriage return
\t Horizontal tab
\v Vertical tab
\char Any character with special meaning in regular expressions that you want to match literally
(for example, use \\ to match a single backslash)

Quantifiers

Quantifiers specify the number of times a pattern must occur in the matching text.

Quantifier Number of Times Expression Occurs Example


expr* 0 or more times consecutively. '\w*' matches a word of any length.
expr? 0 times or 1 time. '\w*(\.m)?' matches words that optionally
end with the extension .m.

2-56
Regular Expressions

Quantifier Number of Times Expression Occurs Example


expr+ 1 or more times consecutively. '<img src="\w+\.gif">' matches an
<img> HTML tag when the file name contains
one or more characters.
expr{m,n} At least m times, but no more than n times '\S{4,8}' matches between four and eight
consecutively. non-white-space characters.

{0,1} is equivalent to ?.
expr{m,} At least m times consecutively. '<a href="\w{1,}\.html">' matches an
<a> HTML tag when the file name contains one
{0,} and {1,} are equivalent to * and +, or more characters.
respectively.
expr{n} Exactly n times consecutively. '\d{4}' matches four consecutive digits.

Equivalent to {n,n}.

Quantifiers can appear in three modes, described in the following table. q represents any of the
quantifiers in the previous table.

Mode Description Example


exprq Greedy expression: match as many characters Given the text '<tr><td><p>text</p></
as possible. td>', the expression '</?t.*>' matches all
characters between <tr and /td>:

'<tr><td><p>text</p></td>'
exprq? Lazy expression: match as few characters as Given the text'<tr><td><p>text</p></
necessary. td>', the expression '</?t.*?>' ends each
match at the first occurrence of the closing
angle bracket (>):

'<tr>' '<td>' '</td>'


exprq+ Possessive expression: match as much as Given the text'<tr><td><p>text</p></
possible, but do not rescan any portions of the td>', the expression '</?t.*+>' does not
text. return any matches, because the closing
angle bracket is captured using .*, and is not
rescanned.

Grouping Operators

Grouping operators allow you to capture tokens, apply one operator to multiple elements, or disable
backtracking in a specific group.

Grouping Description Example


Operator
(expr) Group elements of the expression and capture 'Joh?n\s(\w*)' captures a token that
tokens. contains the last name of any person with the
first name John or Jon.

2-57
2 Program Components

Grouping Description Example


Operator
(?:expr) Group, but do not capture tokens. '(?:[aeiou][^aeiou]){2}' matches two
consecutive patterns of a vowel followed by a
nonvowel, such as 'anon'.

Without grouping, '[aeiou][^aeiou]


{2}'matches a vowel followed by two
nonvowels.
(?>expr) Group atomically. Do not backtrack within the 'A(?>.*)Z' does not match 'AtoZ',
group to complete the match, and do not although 'A(?:.*)Z' does. Using the atomic
capture tokens. group, Z is captured using .* and is not
rescanned.
(expr1|expr2) Match expression expr1 or expression '(let|tel)\w+' matches words that start
expr2. with let or tel.

If there is a match with expr1, then expr2 is


ignored.

You can include ?: or ?> after the opening


parenthesis to suppress tokens or group
atomically.

Anchors

Anchors in the expression match the beginning or end of a character vector or word.

Anchor Matches the... Example


^expr Beginning of the input text. '^M\w*' matches a word starting with M at
the beginning of the text.
expr$ End of the input text. '\w*m$' matches words ending with m at the
end of the text.
\<expr Beginning of a word. '\<n\w*' matches any words starting with
n.
expr\> End of a word. '\w*e\>' matches any words ending with e.

Lookaround Assertions

Lookaround assertions look for patterns that immediately precede or follow the intended match, but
are not part of the match.

The pointer remains at the current location, and characters that correspond to the test expression
are not captured or discarded. Therefore, lookahead assertions can match overlapping character
groups.

2-58
Regular Expressions

Lookaround Description Example


Assertion
expr(?=test) Look ahead for characters that match test. '\w*(?=ing)' matches terms that are
followed by ing, such as 'Fly' and 'fall'
in the input text 'Flying, not falling.'
expr(?!test) Look ahead for characters that do not 'i(?!ng)' matches instances of the letter i
match test. that are not followed by ng.
(?<=test)expr Look behind for characters that match '(?<=re)\w*' matches terms that follow
test. 're', such as 'new', 'use', and 'cycle'
in the input text 'renew, reuse,
recycle'
(?<!test)expr Look behind for characters that do not '(?<!\d)(\d)(?!\d)' matches single-
match test. digit numbers (digits that do not precede or
follow other digits).

If you specify a lookahead assertion before an expression, the operation is equivalent to a logical AND.

Operation Description Example


(?=test)expr Match both test and expr. '(?=[a-z])[^aeiou]' matches
consonants.
(?!test)expr Match expr and do not match test. '(?![aeiou])[a-z]' matches consonants.

For more information, see “Lookahead Assertions in Regular Expressions” on page 2-63.

Logical and Conditional Operators

Logical and conditional operators allow you to test the state of a given condition, and then use the
outcome to determine which pattern, if any, to match next. These operators support logical OR and if
or if/else conditions. (For AND conditions, see “Lookaround Assertions” on page 2-58.)

Conditions can be tokens on page 2-60, lookaround assertions on page 2-58, or dynamic expressions
on page 2-60 of the form (?@cmd). Dynamic expressions must return a logical or numeric value.

Conditional Operator Description Example


expr1|expr2 Match expression expr1 or expression '(let|tel)\w+' matches words that
expr2. start with let or tel.

If there is a match with expr1, then


expr2 is ignored.
(?(cond)expr) If condition cond is true, then match '(?(?@ispc)[A-Z]:\\)' matches a
expr. drive name, such as C:\, when run on a
Windows system.
(?(cond)expr1|expr2) If condition cond is true, then match 'Mr(s?)\..*?(?(1)her|his) \w*'
expr1. Otherwise, match expr2. matches text that includes her when
the text begins with Mrs, or that
includes his when the text begins with
Mr.

2-59
2 Program Components

Token Operators

Tokens are portions of the matched text that you define by enclosing part of the regular expression in
parentheses. You can refer to a token by its sequence in the text (an ordinal token), or assign names
to tokens for easier code maintenance and readable output.

Ordinal Token Operator Description Example


(expr) Capture in a token the characters that 'Joh?n\s(\w*)' captures a token that
match the enclosed expression. contains the last name of any person
with the first name John or Jon.
\N Match the Nth token. '<(\w+).*>.*</\1>' captures tokens
for HTML tags, such as 'title' from
the text '<title>Some text</
title>'.
(?(N)expr1|expr2) If the Nth token is found, then match 'Mr(s?)\..*?(?(1)her|his) \w*'
expr1. Otherwise, match expr2. matches text that includes her when
the text begins with Mrs, or that
includes his when the text begins with
Mr.

Named Token Operator Description Example


(?<name>expr) Capture in a named token the '(?<month>\d+)-(?<day>\d+)-(?
characters that match the enclosed <yr>\d+)' creates named tokens for
expression. the month, day, and year in an input
date of the form mm-dd-yy.
\k<name> Match the token referred to by name. '<(?<tag>\w+).*>.*</\k<tag>>'
captures tokens for HTML tags, such as
'title' from the text '<title>Some
text</title>'.
(?(name)expr1|expr2) If the named token is found, then 'Mr(?<sex>s?)\..*?(?(sex)her|
match expr1. Otherwise, match his) \w*' matches text that includes
expr2. her when the text begins with Mrs, or
that includes his when the text begins
with Mr.

Note If an expression has nested parentheses, MATLAB captures tokens that correspond to the
outermost set of parentheses. For example, given the search pattern '(and(y|rew))', MATLAB
creates a token for 'andrew' but not for 'y' or 'rew'.

For more information, see “Tokens in Regular Expressions” on page 2-66.

Dynamic Expressions

Dynamic expressions allow you to execute a MATLAB command or a regular expression to determine
the text to match.

The parentheses that enclose dynamic expressions do not create a capturing group.

2-60
Regular Expressions

Operator Description Example


(??expr) Parse expr and include the resulting term '^(\d+)((??\\w{$1}))' determines
in the match expression. how many characters to match by reading
a digit at the beginning of the match. The
When parsed, expr must correspond to a dynamic expression is enclosed in a
complete, valid regular expression. second set of parentheses so that the
Dynamic expressions that use the backslash resulting match is captured in a token. For
escape character (\) require two instance, matching '5XXXXX' captures
backslashes: one for the initial parsing of tokens for '5' and 'XXXXX'.
expr, and one for the complete match.
(??@cmd) Execute the MATLAB command '(.{2,}).?(??@fliplr($1))' finds
represented by cmd, and include the output palindromes that are at least four
returned by the command in the match characters long, such as 'abba'.
expression.
(?@cmd) Execute the MATLAB command '\w*?(\w)(?@disp($1))\1\w*'
represented by cmd, but discard any output matches words that include double letters
the command returns. (Helpful for (such as pp), and displays intermediate
diagnosing regular expressions.) results.

Within dynamic expressions, use the following operators to define replacement terms.

Replacement Operator Description


$& or $0 Portion of the input text that is currently a match
$` Portion of the input text that precedes the current match
$' Portion of the input text that follows the current match (use $'' to represent $')
$N Nth token
$<name> Named token
${cmd} Output returned when MATLAB executes the command, cmd

For more information, see “Dynamic Regular Expressions” on page 2-72.

Comments

The comment operator enables you to insert comments into your code to make it more maintainable.
The text of the comment is ignored by MATLAB when matching against the input text.

Characters Description Example


(?#comment) Insert a comment in the regular expression. '(?# Initial digit)\<\d\w+'
The comment text is ignored when includes a comment, and matches words
matching the input. that begin with a number.

Search Flags

Search flags modify the behavior for matching expressions.

Flag Description
(?-i) Match letter case (default for regexp and regexprep).
(?i) Do not match letter case (default for regexpi).

2-61
2 Program Components

Flag Description
(?s) Match dot (.) in the pattern with any character (default).
(?-s) Match dot in the pattern with any character that is not a newline character.
(?-m) Match the ^ and $ metacharacters at the beginning and end of text (default).
(?m) Match the ^ and $ metacharacters at the beginning and end of a line.
(?-x) Include space characters and comments when matching (default).
(?x) Ignore space characters and comments when matching. Use '\ ' and '\#' to
match space and # characters.

The expression that the flag modifies can appear either after the parentheses, such as

(?i)\w*

or inside the parentheses and separated from the flag with a colon (:), such as

(?i:\w*)

The latter syntax allows you to change the behavior for part of a larger expression.

See Also
pattern | regexp | regexpi | regexprep | regexptranslate

More About
• “Lookahead Assertions in Regular Expressions” on page 2-63
• “Tokens in Regular Expressions” on page 2-66
• “Dynamic Regular Expressions” on page 2-72
• “Search and Replace Text” on page 6-37

2-62
Lookahead Assertions in Regular Expressions

Lookahead Assertions in Regular Expressions


In this section...
“Lookahead Assertions” on page 2-63
“Overlapping Matches” on page 2-63
“Logical AND Conditions” on page 2-64

Lookahead Assertions
There are two types of lookaround assertions for regular expressions: lookahead and lookbehind. In
both cases, the assertion is a condition that must be satisfied to return a match to the expression.

A lookahead assertion has the form (?=test) and can appear anywhere in a regular expression.
MATLAB looks ahead of the current location in the text for the test condition. If MATLAB matches the
test condition, it continues processing the rest of the expression to find a match.

For example, look ahead in a character vector specifying a path to find the name of the folder that
contains a program file (in this case, fileread.m).

chr = which('fileread')

chr =

'matlabroot\toolbox\matlab\iofun\fileread.m'

regexp(chr,'\w+(?=\\\w+\.[mp])','match')

ans =

1×1 cell array

{'iofun'}

The match expression, \w+, searches for one or more alphanumeric or underscore characters. Each
time regexp finds a term that matches this condition, it looks ahead for a backslash (specified with
two backslashes, \\), followed by a file name (\w+) with an .m or .p extension (\.[mp]). The
regexp function returns the match that satisfies the lookahead condition, which is the folder name
iofun.

Overlapping Matches
Lookahead assertions do not consume any characters in the text. As a result, you can use them to find
overlapping character sequences.

For example, use lookahead to find every sequence of six nonwhitespace characters in a character
vector by matching initial characters that precede five additional characters:

chr = 'Locate several 6-char. phrases';


startIndex = regexpi(chr,'\S(?=\S{5})')

startIndex =

1 8 9 16 17 24 25

2-63
2 Program Components

The starting indices correspond to these phrases:


Locate severa everal 6-char -char. phrase hrases

Without the lookahead operator, MATLAB parses a character vector from left to right, consuming the
vector as it goes. If matching characters are found, regexp records the location and resumes parsing
the character vector from the location of the most recent match. There is no overlapping of
characters in this process.
chr = 'Locate several 6-char. phrases';
startIndex = regexpi(chr,'\S{6}')

startIndex =

1 8 16 24

The starting indices correspond to these phrases:


Locate severa 6-char phrase

Logical AND Conditions


Another way to use a lookahead operation is to perform a logical AND between two conditions. This
example initially attempts to locate all lowercase consonants in a character array consisting of the
first 50 characters of the help for the normest function:
helptext = help('normest');
chr = helptext(1:50)

chr =

' NORMEST Estimate the matrix 2-norm.


NORMEST(S'

Merely searching for non-vowels ([^aeiou]) does not return the expected answer, as the output
includes capital letters, space characters, and punctuation:
c = regexp(chr,'[^aeiou]','match')

c =

1×43 cell array

Columns 1 through 14

{' '} {'N'} {'O'} {'R'} {'M'} {'E'} {'S'} {'T'} {' '} {'E'} {'s

Columns 15 through 28

{' '} {'t'} {'h'} {' '} {'m'} {'t'} {'r'} {'x'} {' '} {'2'} {'-

Columns 29 through 42

{'.'} {'↵'} {' '} {' '} {' '} {' '} {'N'} {'O'} {'R'} {'M'} {'E

Column 43

{'S'}

2-64
Lookahead Assertions in Regular Expressions

Try this again, using a lookahead operator to create the following AND condition:

(lowercase letter) AND (not a vowel)

This time, the result is correct:

c = regexp(chr,'(?=[a-z])[^aeiou]','match')

c =

1×13 cell array

{'s'} {'t'} {'m'} {'t'} {'t'} {'h'} {'m'} {'t'} {'r'} {'x'} {'n

Note that when using a lookahead operator to perform an AND, you need to place the match
expression expr after the test expression test:

(?=test)expr or (?!test)expr

See Also
regexp | regexpi | regexprep

More About
• “Regular Expressions” on page 2-51

2-65
2 Program Components

Tokens in Regular Expressions


In this section...
“Introduction” on page 2-66
“Multiple Tokens” on page 2-68
“Unmatched Tokens” on page 2-69
“Tokens in Replacement Text” on page 2-69
“Named Capture” on page 2-70

Introduction
Parentheses used in a regular expression not only group elements of that expression together, but
also designate any matches found for that group as tokens. You can use tokens to match other parts
of the same text. One advantage of using tokens is that they remember what they matched, so you
can recall and reuse matched text in the process of searching or replacing.

Each token in the expression is assigned a number, starting from 1, going from left to right. To make
a reference to a token later in the expression, refer to it using a backslash followed by the token
number. For example, when referencing a token generated by the third set of parentheses in the
expression, use \3.

As a simple example, if you wanted to search for identical sequential letters in a character array, you
could capture the first letter as a token and then search for a matching character immediately
afterwards. In the expression shown below, the (\S) phrase creates a token whenever regexp
matches any nonwhitespace character in the character array. The second part of the expression,
'\1', looks for a second instance of the same character immediately following the first.
poe = ['While I nodded, nearly napping, ' ...
'suddenly there came a tapping,'];

[mat,tok,ext] = regexp(poe, '(\S)\1', 'match', ...


'tokens', 'tokenExtents');
mat

mat =

1×4 cell array

{'dd'} {'pp'} {'dd'} {'pp'}

The cell array tok contains cell arrays that each contain a token.
tok{:}

ans =

1×1 cell array

{'d'}

ans =

2-66
Tokens in Regular Expressions

1×1 cell array

{'p'}

ans =

1×1 cell array

{'d'}

ans =

1×1 cell array

{'p'}

The cell array ext contains numeric arrays that each contain starting and ending indices for a token.

ext{:}

ans =

11 11

ans =

26 26

ans =

35 35

ans =

57 57

For another example, capture pairs of matching HTML tags (e.g., <a> and </a>) and the text
between them. The expression used for this example is

expr = '<(\w+).*?>.*?</\1>';

The first part of the expression, '<(\w+)', matches an opening angle bracket (<) followed by one or
more alphabetic, numeric, or underscore characters. The enclosing parentheses capture token
characters following the opening angle bracket.

The second part of the expression, '.*?>.*?', matches the remainder of this HTML tag (characters
up to the >), and any characters that may precede the next opening angle bracket.

The last part, '</\1>', matches all characters in the ending HTML tag. This tag is composed of the
sequence </tag>, where tag is whatever characters were captured as a token.

hstr = '<!comment><a name="752507"></a><b>Default</b><br>';


expr = '<(\w+).*?>.*?</\1>';

2-67
2 Program Components

[mat,tok] = regexp(hstr, expr, 'match', 'tokens');


mat{:}

ans =

'<a name="752507"></a>'

ans =

'<b>Default</b>'

tok{:}

ans =

1×1 cell array

{'a'}

ans =

1×1 cell array

{'b'}

Multiple Tokens
Here is an example of how tokens are assigned values. Suppose that you are going to search the
following text:

andy ted bob jim andrew andy ted mark

You choose to search the above text with the following search pattern:

and(y|rew)|(t)e(d)

This pattern has three parenthetical expressions that generate tokens. When you finally perform the
search, the following tokens are generated for each match.

Match Token 1 Token 2


andy y
ted t d
andrew rew
andy y
ted t d

Only the highest level parentheses are used. For example, if the search pattern and(y|rew) finds the
text andrew, token 1 is assigned the value rew. However, if the search pattern (and(y|rew)) is
used, token 1 is assigned the value andrew.

2-68
Tokens in Regular Expressions

Unmatched Tokens
For those tokens specified in the regular expression that have no match in the text being evaluated,
regexp and regexpi return an empty character vector ('') as the token output, and an extent that
marks the position in the string where the token was expected.

The example shown here executes regexp on a character vector specifying the path returned from
the MATLAB tempdir function. The regular expression expr includes six token specifiers, one for
each piece of the path. The third specifier [a-z]+ has no match in the character vector because this
part of the path, Profiles, begins with an uppercase letter:
chr = tempdir

chr =

'C:\WINNT\Profiles\bpascal\LOCALS~1\Temp\'

expr = ['([A-Z]:)\\(WINNT)\\([a-z]+)?.*\\' ...


'([a-z]+)\\([A-Z]+~\d)\\(Temp)\\'];

[tok, ext] = regexp(chr, expr, 'tokens', 'tokenExtents');

When a token is not found in the text, regexp returns an empty character vector ('') as the token
and a numeric array with the token extent. The first number of the extent is the string index that
marks where the token was expected, and the second number of the extent is equal to one less than
the first.

In the case of this example, the empty token is the third specified in the expression, so the third token
returned is empty:
tok{:}

ans =

1×6 cell array

{'C:'} {'WINNT'} {0×0 char} {'bpascal'} {'LOCALS~1'} {'Temp'}

The third token extent returned in the variable ext has the starting index set to 10, which is where
the nonmatching term, Profiles, begins in the path. The ending extent index is set to one less than
the starting index, or 9:
ext{:}

ans =

1 2
4 8
10 9
19 25
27 34
36 39

Tokens in Replacement Text


When using tokens in replacement text, reference them using $1, $2, etc. instead of \1, \2, etc. This
example captures two tokens and reverses their order. The first, $1, is 'Norma Jean' and the

2-69
2 Program Components

second, $2, is 'Baker'. Note that regexprep returns the modified text, not a vector of starting
indices.
regexprep('Norma Jean Baker', '(\w+\s\w+)\s(\w+)', '$2, $1')

ans =

'Baker, Norma Jean'

Named Capture
If you use a lot of tokens in your expressions, it may be helpful to assign them names rather than
having to keep track of which token number is assigned to which token.

When referencing a named token within the expression, use the syntax \k<name> instead of the
numeric \1, \2, etc.:
poe = ['While I nodded, nearly napping, ' ...
'suddenly there came a tapping,'];

regexp(poe, '(?<anychar>.)\k<anychar>', 'match')

ans =

1×4 cell array

{'dd'} {'pp'} {'dd'} {'pp'}

Named tokens can also be useful in labeling the output from the MATLAB regular expression
functions. This is especially true when you are processing many pieces of text.

For example, parse different parts of street addresses from several character vectors. A short name is
assigned to each token in the expression:
chr1 = '134 Main Street, Boulder, CO, 14923';
chr2 = '26 Walnut Road, Topeka, KA, 25384';
chr3 = '847 Industrial Drive, Elizabeth, NJ, 73548';

p1 = '(?<adrs>\d+\s\S+\s(Road|Street|Avenue|Drive))';
p2 = '(?<city>[A-Z][a-z]+)';
p3 = '(?<state>[A-Z]{2})';
p4 = '(?<zip>\d{5})';

expr = [p1 ', ' p2 ', ' p3 ', ' p4];

As the following results demonstrate, you can make your output easier to work with by using named
tokens:
loc1 = regexp(chr1, expr, 'names')

loc1 =

struct with fields:

adrs: '134 Main Street'


city: 'Boulder'
state: 'CO'
zip: '14923'

2-70
Tokens in Regular Expressions

loc2 = regexp(chr2, expr, 'names')

loc2 =

struct with fields:

adrs: '26 Walnut Road'


city: 'Topeka'
state: 'KA'
zip: '25384'

loc3 = regexp(chr3, expr, 'names')

loc3 =

struct with fields:

adrs: '847 Industrial Drive'


city: 'Elizabeth'
state: 'NJ'
zip: '73548'

See Also
regexp | regexpi | regexprep

More About
• “Regular Expressions” on page 2-51

2-71
2 Program Components

Dynamic Regular Expressions

In this section...
“Introduction” on page 2-72
“Dynamic Match Expressions — (??expr)” on page 2-73
“Commands That Modify the Match Expression — (??@cmd)” on page 2-73
“Commands That Serve a Functional Purpose — (?@cmd)” on page 2-74
“Commands in Replacement Expressions — ${cmd}” on page 2-76

Introduction
In a dynamic expression, you can make the pattern that you want regexp to match dependent on the
content of the input text. In this way, you can more closely match varying input patterns in the text
being parsed. You can also use dynamic expressions in replacement terms for use with the
regexprep function. This gives you the ability to adapt the replacement text to the parsed input.

You can include any number of dynamic expressions in the match_expr or replace_expr
arguments of these commands:

regexp(text, match_expr)
regexpi(text, match_expr)
regexprep(text, match_expr, replace_expr)

As an example of a dynamic expression, the following regexprep command correctly replaces the
term internationalization with its abbreviated form, i18n. However, to use it on a different
term such as globalization, you have to use a different replacement expression:

match_expr = '(^\w)(\w*)(\w$)';

replace_expr1 = '$118$3';
regexprep('internationalization', match_expr, replace_expr1)

ans =

'i18n'

replace_expr2 = '$111$3';
regexprep('globalization', match_expr, replace_expr2)

ans =

'g11n'

Using a dynamic expression ${num2str(length($2))} enables you to base the replacement


expression on the input text so that you do not have to change the expression each time. This
example uses the dynamic replacement syntax ${cmd}.

match_expr = '(^\w)(\w*)(\w$)';
replace_expr = '$1${num2str(length($2))}$3';

regexprep('internationalization', match_expr, replace_expr)

2-72
Dynamic Regular Expressions

ans =

'i18n'

regexprep('globalization', match_expr, replace_expr)

ans =

'g11n'

When parsed, a dynamic expression must correspond to a complete, valid regular expression. In
addition, dynamic match expressions that use the backslash escape character (\) require two
backslashes: one for the initial parsing of the expression, and one for the complete match. The
parentheses that enclose dynamic expressions do not create a capturing group.

There are three forms of dynamic expressions that you can use in match expressions, and one form
for replacement expressions, as described in the following sections

Dynamic Match Expressions — (??expr)


The (??expr) operator parses expression expr, and inserts the results back into the match
expression. MATLAB then evaluates the modified match expression.

Here is an example of the type of expression that you can use with this operator:
chr = {'5XXXXX', '8XXXXXXXX', '1X'};
regexp(chr, '^(\d+)(??X{$1})$', 'match', 'once');

The purpose of this particular command is to locate a series of X characters in each of the character
vectors stored in the input cell array. Note however that the number of Xs varies in each character
vector. If the count did not vary, you could use the expression X{n} to indicate that you want to match
n of these characters. But, a constant value of n does not work in this case.

The solution used here is to capture the leading count number (e.g., the 5 in the first character vector
of the cell array) in a token, and then to use that count in a dynamic expression. The dynamic
expression in this example is (??X{$1}), where $1 is the value captured by the token \d+. The
operator {$1} makes a quantifier of that token value. Because the expression is dynamic, the same
pattern works on all three of the input vectors in the cell array. With the first input character vector,
regexp looks for five X characters; with the second, it looks for eight, and with the third, it looks for
just one:
regexp(chr, '^(\d+)(??X{$1})$', 'match', 'once')

ans =

1×3 cell array

{'5XXXXX'} {'8XXXXXXXX'} {'1X'}

Commands That Modify the Match Expression — (??@cmd)


MATLAB uses the (??@cmd) operator to include the results of a MATLAB command in the match
expression. This command must return a term that can be used within the match expression.

For example, use the dynamic expression (??@flilplr($1)) to locate a palindrome, “Never Odd or
Even”, that has been embedded into a larger character vector.

2-73
2 Program Components

First, create the input string. Make sure that all letters are lowercase, and remove all nonword
characters.

chr = lower(...
'Find the palindrome Never Odd or Even in this string');

chr = regexprep(chr, '\W*', '')

chr =

'findthepalindromeneveroddoreveninthisstring'

Locate the palindrome within the character vector using the dynamic expression:

palindrome = regexp(chr, '(.{3,}).?(??@fliplr($1))', 'match')

palindrome =

1×1 cell array

{'neveroddoreven'}

The dynamic expression reverses the order of the letters that make up the character vector, and then
attempts to match as much of the reversed-order vector as possible. This requires a dynamic
expression because the value for $1 relies on the value of the token (.{3,}).

Dynamic expressions in MATLAB have access to the currently active workspace. This means that you
can change any of the functions or variables used in a dynamic expression just by changing variables
in the workspace. Repeat the last command of the example above, but this time define the function to
be called within the expression using a function handle stored in the base workspace:

fun = @fliplr;

palindrome = regexp(chr, '(.{3,}).?(??@fun($1))', 'match')

palindrome =

1×1 cell array

{'neveroddoreven'}

Commands That Serve a Functional Purpose — (?@cmd)


The (?@cmd) operator specifies a MATLAB command that regexp or regexprep is to run while
parsing the overall match expression. Unlike the other dynamic expressions in MATLAB, this operator
does not alter the contents of the expression it is used in. Instead, you can use this functionality to
get MATLAB to report just what steps it is taking as it parses the contents of one of your regular
expressions. This functionality can be useful in diagnosing your regular expressions.

The following example parses a word for zero or more characters followed by two identical
characters followed again by zero or more characters:

regexp('mississippi', '\w*(\w)\1\w*', 'match')

ans =

1×1 cell array

2-74
Dynamic Regular Expressions

{'mississippi'}

To track the exact steps that MATLAB takes in determining the match, the example inserts a short
script (?@disp($1)) in the expression to display the characters that finally constitute the match.
Because the example uses greedy quantifiers, MATLAB attempts to match as much of the character
vector as possible. So, even though MATLAB finds a match toward the beginning of the string, it
continues to look for more matches until it arrives at the very end of the string. From there, it backs
up through the letters i then p and the next p, stopping at that point because the match is finally
satisfied:
regexp('mississippi', '\w*(\w)(?@disp($1))\1\w*', 'match')

i
p
p

ans =

1×1 cell array

{'mississippi'}

Now try the same example again, this time making the first quantifier lazy (*?). Again, MATLAB
makes the same match:
regexp('mississippi', '\w*?(\w)\1\w*', 'match')

ans =

1×1 cell array

{'mississippi'}

But by inserting a dynamic script, you can see that this time, MATLAB has matched the text quite
differently. In this case, MATLAB uses the very first match it can find, and does not even consider the
rest of the text:
regexp('mississippi', '\w*?(\w)(?@disp($1))\1\w*', 'match')

m
i
s

ans =

1×1 cell array

{'mississippi'}

To demonstrate how versatile this type of dynamic expression can be, consider the next example that
progressively assembles a cell array as MATLAB iteratively parses the input text. The (?!) operator
found at the end of the expression is actually an empty lookahead operator, and forces a failure at
each iteration. This forced failure is necessary if you want to trace the steps that MATLAB is taking to
resolve the expression.

MATLAB makes a number of passes through the input text, each time trying another combination of
letters to see if a fit better than last match can be found. On any passes in which no matches are

2-75
2 Program Components

found, the test results in an empty character vector. The dynamic script (?@if(~isempty($&)))
serves to omit the empty character vectors from the matches cell array:

matches = {};
expr = ['(Euler\s)?(Cauchy\s)?(Boole)?(?@if(~isempty($&)),' ...
'matches{end+1}=$&;end)(?!)'];

regexp('Euler Cauchy Boole', expr);

matches

matches =

1×6 cell array

{'Euler Cauchy Bo…'} {'Euler Cauchy '} {'Euler '} {'Cauchy Boole'} {'Cauchy '}

The operators $& (or the equivalent $0), $`, and $' refer to that part of the input text that is
currently a match, all characters that precede the current match, and all characters to follow the
current match, respectively. These operators are sometimes useful when working with dynamic
expressions, particularly those that employ the (?@cmd) operator.

This example parses the input text looking for the letter g. At each iteration through the text, regexp
compares the current character with g, and not finding it, advances to the next character. The
example tracks the progress of scan through the text by marking the current location being parsed
with a ^ character.

(The $` and $´ operators capture that part of the text that precedes and follows the current parsing
location. You need two single-quotation marks ($'') to express the sequence $´ when it appears
within text.)

chr = 'abcdefghij';
expr = '(?@disp(sprintf(''starting match: [%s^%s]'',$`,$'')))g';

regexp(chr, expr, 'once');

starting match: [^abcdefghij]


starting match: [a^bcdefghij]
starting match: [ab^cdefghij]
starting match: [abc^defghij]
starting match: [abcd^efghij]
starting match: [abcde^fghij]
starting match: [abcdef^ghij]

Commands in Replacement Expressions — ${cmd}


The ${cmd} operator modifies the contents of a regular expression replacement pattern, making this
pattern adaptable to parameters in the input text that might vary from one use to the next. As with
the other dynamic expressions used in MATLAB, you can include any number of these expressions
within the overall replacement expression.

In the regexprep call shown here, the replacement pattern is '${convertMe($1,$2)}'. In this
case, the entire replacement pattern is a dynamic expression:

regexprep('This highway is 125 miles long', ...


'(\d+\.?\d*)\W(\w+)', '${convertMe($1,$2)}');

2-76
Dynamic Regular Expressions

The dynamic expression tells MATLAB to execute a function named convertMe using the two tokens
(\d+\.?\d*) and (\w+), derived from the text being matched, as input arguments in the call to
convertMe. The replacement pattern requires a dynamic expression because the values of $1 and $2
are generated at runtime.

The following example defines the file named convertMe that converts measurements from imperial
units to metric.
function valout = convertMe(valin, units)
switch(units)
case 'inches'
fun = @(in)in .* 2.54;
uout = 'centimeters';
case 'miles'
fun = @(mi)mi .* 1.6093;
uout = 'kilometers';
case 'pounds'
fun = @(lb)lb .* 0.4536;
uout = 'kilograms';
case 'pints'
fun = @(pt)pt .* 0.4731;
uout = 'litres';
case 'ounces'
fun = @(oz)oz .* 28.35;
uout = 'grams';
end
val = fun(str2num(valin));
valout = [num2str(val) ' ' uout];
end

At the command line, call the convertMe function from regexprep, passing in values for the
quantity to be converted and name of the imperial unit:
regexprep('This highway is 125 miles long', ...
'(\d+\.?\d*)\W(\w+)', '${convertMe($1,$2)}')

ans =

'This highway is 201.1625 kilometers long'

regexprep('This pitcher holds 2.5 pints of water', ...


'(\d+\.?\d*)\W(\w+)', '${convertMe($1,$2)}')

ans =

'This pitcher holds 1.1828 litres of water'

regexprep('This stone weighs about 10 pounds', ...


'(\d+\.?\d*)\W(\w+)', '${convertMe($1,$2)}')

ans =

'This stone weighs about 4.536 kilograms'

As with the (??@ ) operator discussed in an earlier section, the ${ } operator has access to
variables in the currently active workspace. The following regexprep command uses the array A
defined in the base workspace:
A = magic(3)

2-77
2 Program Components

A =

8 1 6
3 5 7
4 9 2

regexprep('The columns of matrix _nam are _val', ...


{'_nam', '_val'}, ...
{'A', '${sprintf(''%d%d%d '', A)}'})

ans =

'The columns of matrix A are 834 159 672'

See Also
regexp | regexpi | regexprep

More About
• “Regular Expressions” on page 2-51

2-78
Comma-Separated Lists

Comma-Separated Lists
In this section...
“What Is a Comma-Separated List?” on page 2-79
“Generating a Comma-Separated List” on page 2-79
“Assigning Output from a Comma-Separated List” on page 2-81
“Assigning to a Comma-Separated List” on page 2-81
“How to Use the Comma-Separated Lists” on page 2-82
“Fast Fourier Transform Example” on page 2-84

What Is a Comma-Separated List?


Typing in a series of numbers separated by commas gives you what is called a comma-separated list.
The MATLAB software returns each value individually:
1,2,3

ans =

ans =

ans =

Such a list, by itself, is not very useful. But when used with large and more complex data structures
like MATLAB structures and cell arrays, the comma-separated list can enable you to simplify your
MATLAB code.

Generating a Comma-Separated List


This section describes how to generate a comma-separated list from either a cell array or a MATLAB
structure.

Generating a List from a Cell Array

Extracting multiple elements from a cell array yields a comma-separated list. Given a 4-by-6 cell array
as shown here
C = cell(4,6);
for k = 1:24
C{k} = k*2;
end
C

C =

2-79
2 Program Components

[2] [10] [18] [26] [34] [42]


[4] [12] [20] [28] [36] [44]
[6] [14] [22] [30] [38] [46]
[8] [16] [24] [32] [40] [48]

extracting the fifth column generates the following comma-separated list:

C{:,5}

ans =

34

ans =

36

ans =

38

ans =

40

This is the same as explicitly typing

C{1,5},C{2,5},C{3,5},C{4,5}

Generating a List from a Structure

For structures, extracting a field of the structure that exists across one of its dimensions yields a
comma-separated list.

Start by converting the cell array used above into a 4-by-1 MATLAB structure with six fields: f1
through f6. Read field f5 for all rows and MATLAB returns a comma-separated list:

S = cell2struct(C,{'f1','f2','f3','f4','f5','f6'},2);
S.f5

ans =

34

ans =

36

ans =

38

2-80
Comma-Separated Lists

ans =

40

This is the same as explicitly typing

S(1).f5,S(2).f5,S(3).f5,S(4).f5

Assigning Output from a Comma-Separated List


You can assign any or all consecutive elements of a comma-separated list to variables with a simple
assignment statement. Using the cell array C from the previous section, assign the first row to
variables c1 through c6:

C = cell(4,6);
for k = 1:24
C{k} = k*2;
end
[c1,c2,c3,c4,c5,c6] = C{1,1:6};
c5

c5 =

34

If you specify fewer output variables than the number of outputs returned by the expression, MATLAB
assigns the first N outputs to those N variables, and then discards any remaining outputs. In this next
example, MATLAB assigns C{1,1:3} to the variables c1, c2, and c3, and then discards C{1,4:6}:

[c1,c2,c3] = C{1,1:6};

You can assign structure outputs in the same manner:

S = cell2struct(C,{'f1','f2','f3','f4','f5','f6'},2);
[sf1,sf2,sf3] = S.f5;
sf3

sf3 =

38

You also can use the deal function for this purpose.

Assigning to a Comma-Separated List


The simplest way to assign multiple values to a comma-separated list is to use the deal function. This
function distributes all of its input arguments to the elements of a comma-separated list.

This example uses deal to overwrite each element in a comma-separated list. First create a list.

c{1} = [31 07];


c{2} = [03 78];
c{:}

ans =

31 7

2-81
2 Program Components

ans =

3 78

Use deal to overwrite each element in the list.

[c{:}] = deal([10 20],[14 12]);


c{:}

ans =

10 20

ans =

14 12

This example does the same as the one above, but with a comma-separated list of vectors in a
structure field:

s(1).field1 = [31 07];


s(2).field1 = [03 78];
s.field1

ans =

31 7

ans =

3 78

Use deal to overwrite the structure fields.

[s.field1] = deal([10 20],[14 12]);


s.field1

ans =

10 20

ans =

14 12

How to Use the Comma-Separated Lists


Common uses for comma-separated lists are

• “Constructing Arrays” on page 2-83


• “Displaying Arrays” on page 2-83

2-82
Comma-Separated Lists

• “Concatenation” on page 2-83


• “Function Call Arguments” on page 2-84
• “Function Return Values” on page 2-84

The following sections provide examples of using comma-separated lists with cell arrays. Each of
these examples applies to MATLAB structures as well.

Constructing Arrays

You can use a comma-separated list to enter a series of elements when constructing a matrix or array.
Note what happens when you insert a list of elements as opposed to adding the cell itself.

When you specify a list of elements with C{:, 5}, MATLAB inserts the four individual elements:
A = {'Hello',C{:,5},magic(4)}

A =

'Hello' [34] [36] [38] [40] [4x4 double]

When you specify the C cell itself, MATLAB inserts the entire cell array:
A = {'Hello',C,magic(4)}

A =

'Hello' {4x6 cell} [4x4 double]

Displaying Arrays

Use a list to display all or part of a structure or cell array:


A{:}

ans =

Hello

ans =

[2] [10] [18] [26] [34] [42]


[4] [12] [20] [28] [36] [44]
[6] [14] [22] [30] [38] [46]
[8] [16] [24] [32] [40] [48]

ans =

16 2 3 13
5 11 10 8
9 7 6 12
4 14 15 1

Concatenation

Putting a comma-separated list inside square brackets extracts the specified elements from the list
and concatenates them:

2-83
2 Program Components

A = [C{:,5:6}]

A =

34 36 38 40 42 44 46 48

Function Call Arguments

When writing the code for a function call, you enter the input arguments as a list with each argument
separated by a comma. If you have these arguments stored in a structure or cell array, then you can
generate all or part of the argument list from the structure or cell array instead. This can be
especially useful when passing in variable numbers of arguments.

This example passes several attribute-value arguments to the plot function:

X = -pi:pi/10:pi;
Y = tan(sin(X)) - sin(tan(X));
C = cell(2,3);
C{1,1} = 'LineWidth';
C{2,1} = 2;
C{1,2} = 'MarkerEdgeColor';
C{2,2} = 'k';
C{1,3} = 'MarkerFaceColor';
C{2,3} = 'g';
figure
plot(X,Y,'--rs',C{:})

Function Return Values

MATLAB functions can also return more than one value to the caller. These values are returned in a
list with each value separated by a comma. Instead of listing each return value, you can use a comma-
separated list with a structure or cell array. This becomes more useful for those functions that have
variable numbers of return values.

This example returns three values to a cell array:

C = cell(1,3);
[C{:}] = fileparts('work/mytests/[Link]')

C =

'work/mytests' 'strArrays' '.mat'

Fast Fourier Transform Example


The fftshift function swaps the left and right halves of each dimension of an array. For a simple
vector such as [0 2 4 6 8 10] the output would be [6 8 10 0 2 4]. For a multidimensional
array, fftshift performs this swap along each dimension.

fftshift uses vectors of indices to perform the swap. For the vector shown above, the index [1 2
3 4 5 6] is rearranged to form a new index [4 5 6 1 2 3]. The function then uses this index
vector to reposition the elements. For a multidimensional array, fftshift must construct an index
vector for each dimension. A comma-separated list makes this task much simpler.

Here is the fftshift function:

2-84
Comma-Separated Lists

function y = fftshift(x)
numDims = ndims(x);
idx = cell(1,numDims);
for k = 1:numDims
m = size(x,k);
p = ceil(m/2);
idx{k} = [p+1:m 1:p];
end
y = x(idx{:});
end

The function stores the index vectors in cell array idx. Building this cell array is relatively simple.
For each of the N dimensions, determine the size of that dimension and find the integer index nearest
the midpoint. Then, construct a vector that swaps the two halves of that dimension.

By using a cell array to store the index vectors and a comma-separated list for the indexing operation,
fftshift shifts arrays of any dimension using just a single operation: y = x(idx{:}). If you were
to use explicit indexing, you would need to write one if statement for each dimension you want the
function to handle:

if ndims(x) == 1
y = x(index1);
else if ndims(x) == 2
y = x(index1,index2);
end
end

Another way to handle this without a comma-separated list would be to loop over each dimension,
converting one dimension at a time and moving data each time. With a comma-separated list, you
move the data just once. A comma-separated list makes it very easy to generalize the swapping
operation to an arbitrary number of dimensions.

2-85
2 Program Components

Alternatives to the eval Function


In this section...
“Why Avoid the eval Function?” on page 2-86
“Variables with Sequential Names” on page 2-86
“Files with Sequential Names” on page 2-87
“Function Names in Variables” on page 2-87
“Field Names in Variables” on page 2-88
“Error Handling” on page 2-88

Why Avoid the eval Function?


Although the eval function is very powerful and flexible, it is not always the best solution to a
programming problem. Code that calls eval is often less efficient and more difficult to read and
debug than code that uses other functions or language constructs. For example:

• MATLAB compiles code the first time you run it to enhance performance for future runs. However,
because code in an eval statement can change at run time, it is not compiled.
• Code within an eval statement can unexpectedly create or assign to a variable already in the
current workspace, overwriting existing data.
• Concatenated character vectors within an eval statement are often difficult to read. Other
language constructs can simplify the syntax in your code.

For many common uses of eval, there are preferred alternate approaches, as shown in the following
examples.

Variables with Sequential Names


A frequent use of the eval function is to create sets of variables such as A1, A2, ..., An, but this
approach does not use the array processing power of MATLAB and is not recommended. The
preferred method is to store related data in a single array. If the data sets are of different types or
sizes, use a structure or cell array.

For example, create a cell array that contains 10 elements, where each element is a numeric array:

numArrays = 10;
A = cell(numArrays,1);
for n = 1:numArrays
A{n} = magic(n);
end

Access the data in the cell array by indexing with curly braces. For example, display the fifth element
of A:

A{5}

ans =
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22

2-86
Alternatives to the eval Function

10 12 19 21 3
11 18 25 2 9

The assignment statement A{n} = magic(n) is more elegant and efficient than this call to eval:
eval(['A', int2str(n),' = magic(n)']) % Not recommended

For more information, see:

• “Create Cell Array” on page 12-3


• “Create Structure Array” on page 11-2

Files with Sequential Names


Related data files often have a common root name with an integer index, such as [Link]
through [Link]. A common (but not recommended) use of the eval function is to construct
and pass each file name to a function using command syntax, such as
eval(['save myfile',int2str(n),'.mat']) % Not recommended

The best practice is to use function syntax, which allows you to pass variables as inputs. For example:
currentFile = '[Link]';
save(currentFile)

You can construct file names within a loop using the sprintf function (which is usually more
efficient than int2str), and then call the save function without eval. This code creates 10 files in
the current folder:
numFiles = 10;
for n = 1:numFiles
randomData = rand(n);
currentFile = sprintf('myfile%[Link]',n);
save(currentFile,'randomData')
end

For more information, see:

• “Command vs. Function Syntax” on page 1-6


• “Import or Export a Sequence of Files”

Function Names in Variables


A common use of eval is to execute a function when the name of the function is in a variable
character vector. There are two ways to evaluate functions from variables that are more efficient than
using eval:

• Create function handles with the @ symbol or with the str2func function. For example, run a
function from a list stored in a cell array:
examples = {@odedemo,@sunspots,@fitdemo};
n = input('Select an example (1, 2, or 3): ');
examples{n}()
• Use the feval function. For example, call a plot function (such as plot, bar, or pie) with data
that you specify at run time:

2-87
2 Program Components

plotFunction = input('Specify a plotting function: ','s');


data = input('Enter data to plot: ');
feval(plotFunction,data)

Field Names in Variables


Access data in a structure with a variable field name by enclosing the expression for the field in
parentheses. For example:

[Link] = [67, 72, 58];


[Link] = [140, 205, 90];

fieldName = input('Select data (height or weight): ','s');


dataToUse = myData.(fieldName);

If you enter weight at the input prompt, then you can find the minimum weight value with the
following command.

min(dataToUse)

ans =
90

For an additional example, see “Generate Field Names from Variables” on page 11-11.

Error Handling
The preferred method for error handling in MATLAB is to use a try, catch statement. For example:

try
B = A;
catch exception
disp('A is undefined')
end

If your workspace does not contain variable A, then this code returns:

A is undefined

Previous versions of the documentation for the eval function include the syntax
eval(expression,catch_expr). If evaluating the expression input returns an error, then eval
evaluates catch_expr. However, an explicit try/catch is significantly clearer than an implicit
catch in an eval statement. Using the implicit catch is not recommended.

2-88
Classes (Data Types)

89
3

Overview of MATLAB Classes


3 Overview of MATLAB Classes

Fundamental MATLAB Classes


There are many different data types, or classes, that you can work with in MATLAB. You can build
matrices and arrays of floating-point and integer data, characters and strings, logical true and
false values, and so on. Function handles connect your code with any MATLAB function regardless
of the current scope. Tables, timetables, structures, and cell arrays provide a way to store dissimilar
types of data in the same container.

There are 16 fundamental classes in MATLAB. Each of these classes is in the form of a matrix or
array. With the exception of function handles, this matrix or array is a minimum of 0-by-0 in size and
can grow to an n-dimensional array of any size. A function handle is always scalar (1-by-1).

All of the fundamental MATLAB classes are shown in the diagram below:

Numeric classes in the MATLAB software include signed and unsigned integers, and single- and
double-precision floating-point numbers. By default, MATLAB stores all numeric values as double-
precision floating point. (You cannot change the default type and precision.) You can choose to store
any number, or array of numbers, as integers or as single-precision. Integer and single-precision
arrays offer more memory-efficient storage than double-precision.

All numeric types support basic array operations, such as subscripting, reshaping, and mathematical
operations.

You can create two-dimensional double and logical matrices using one of two storage formats:
full or sparse. For matrices with mostly zero-valued elements, a sparse matrix requires a fraction
of the storage space required for an equivalent full matrix. Sparse matrices invoke methods
especially tailored to solve sparse problems.

These classes require different amounts of storage, the smallest being a logical value or 8-bit
integer which requires only 1 byte. It is important to keep this minimum size in mind if you work on
data in files that were written using a precision smaller than 8 bits.

The following table describes the fundamental classes in more detail.

3-2
Fundamental MATLAB Classes

Class Name Documentation Intended Use


double, single Floating-Point • Required for fractional numeric data.
Numbers on page 4- • Double on page 4-6 and Single on page 4-6 precision.
6
• Use realmin and realmax to show range of values on page 4-
9.
• Two-dimensional arrays can be sparse.
• Default numeric type in MATLAB.
int8, uint8, Integers on page 4- • Use for signed and unsigned whole numbers.
int16, uint16, 2 • More efficient use of memory. on page 30-2
int32, uint32,
int64, uint64 • Use intmin and intmax to show range of values on page 4-
4.
• Choose from 4 sizes (8, 16, 32, and 64 bits).
char, string “Characters and • Data type for text.
Strings” • Native or Unicode®.
• Converts to/from numeric.
• Use with regular expressions on page 2-51.
• For multiple character arrays, use cell arrays.
• Starting in R2016b, you also can store text in string arrays. For
more information, see string.
logical “Logical Operations” • Use in relational conditions or to test state.
• Can have one of two values: true or false.
• Also useful in array indexing.
• Two-dimensional arrays can be sparse.
function_handle “Function Handles” • Pointer to a function.
• Enables passing a function to another function
• Can also call functions outside usual scope.
• Use to specify graphics callback functions.
• Save to MAT-file and restore later.
table, timetable “Tables”, • Tables are rectangular containers for mixed-type, column-
“Timetables” oriented data.
• Tables have row and variable names that identify contents.
• Timetables also provide storage for data in a table with rows
labeled by time. Timetable functions can synchronize, resample,
or aggregate timestamped data.
• Use the properties of a table or timetable to store metadata
such as variable units.
• Manipulation of elements similar to numeric or logical arrays.
• Access data by numeric or named index.
• Can select a subset of data and preserve the table container or
can extract the data from a table.

3-3
3 Overview of MATLAB Classes

Class Name Documentation Intended Use


struct “Structures” • Fields store arrays of varying classes and sizes.
• Access one or all fields/indices in single operation.
• Field names identify contents.
• Method of passing function arguments.
• Use in comma-separated lists on page 2-79.
• More memory required for overhead
cell “Cell Arrays” • Cells store arrays of varying classes and sizes.
• Allows freedom to package data as you want.
• Manipulation of elements is similar to numeric or logical arrays.
• Method of passing function arguments.
• Use in comma-separated lists.
• More memory required for overhead

See Also

More About
• “Valid Combinations of Unlike Classes” on page 15-2

3-4
4

Numeric Classes

• “Integers” on page 4-2


• “Floating-Point Numbers” on page 4-6
• “Create Complex Numbers” on page 4-13
• “Infinity and NaN” on page 4-14
• “Identifying Numeric Classes” on page 4-16
• “Display Format for Numeric Values” on page 4-17
• “Integer Arithmetic” on page 4-19
• “Single Precision Math” on page 4-26
4 Numeric Classes

Integers
In this section...
“Integer Classes” on page 4-2
“Creating Integer Data” on page 4-2
“Arithmetic Operations on Integer Classes” on page 4-4
“Largest and Smallest Values for Integer Classes” on page 4-4

Integer Classes
MATLAB has four signed and four unsigned integer classes. Signed types enable you to work with
negative integers as well as positive, but cannot represent as wide a range of numbers as the
unsigned types because one bit is used to designate a positive or negative sign for the number.
Unsigned types give you a wider range of numbers, but these numbers can only be zero or positive.

MATLAB supports 1-, 2-, 4-, and 8-byte storage for integer data. You can save memory and execution
time for your programs if you use the smallest integer type that accommodates your data. For
example, you do not need a 32-bit integer to store the value 100.

Here are the eight integer classes, the range of values you can store with each type, and the MATLAB
conversion function required to create that type:

Class Range of Values Conversion Function


7 7
Signed 8-bit integer -2 to 2 -1 int8
15 15
Signed 16-bit integer -2 to 2 -1 int16
31 31
Signed 32-bit integer -2 to 2 -1 int32
Signed 64-bit integer -263 to 263-1 int64
Unsigned 8-bit integer 0 to 28-1 uint8
16
Unsigned 16-bit integer 0 to 2 -1 uint16
32
Unsigned 32-bit integer 0 to 2 -1 uint32
64
Unsigned 64-bit integer 0 to 2 -1 uint64

Creating Integer Data


MATLAB stores numeric data as double-precision floating point (double) by default. To store data as
an integer, you need to convert from double to the desired integer type. Use one of the conversion
functions shown in the table above.

For example, to store 325 as a 16-bit signed integer assigned to variable x, type
x = int16(325);

If the number being converted to an integer has a fractional part, MATLAB rounds to the nearest
integer. If the fractional part is exactly 0.5, then from the two equally nearby integers, MATLAB
chooses the one for which the absolute value is larger in magnitude:
x = 325.499;
int16(x)

4-2
Integers

ans =

int16

325

x = x + .001;
int16(x)
ans =

int16

326

If you need to round a number using a rounding scheme other than the default, MATLAB provides
four rounding functions: round, fix, floor, and ceil. The fix function enables you to override the
default and round towards zero when there is a nonzero fractional part:
x = 325.9;

int16(fix(x))
ans =

int16

325

Arithmetic operations that involve both integers and floating-point always result in an integer data
type. MATLAB rounds the result, when necessary, according to the default rounding algorithm. The
example below yields an exact answer of 1426.75 which MATLAB then rounds to the next highest
integer:
int16(325) * 4.39
ans =

int16

1427

The integer conversion functions are also useful when converting other classes, such as strings, to
integers:
str = 'Hello World';

int8(str)
ans =

1×11 int8 row vector

72 101 108 108 111 32 87 111 114 108 100

If you convert a NaN value into an integer class, the result is a value of 0 in that integer class. For
example,
int32(NaN)
ans =

int32

4-3
4 Numeric Classes

Arithmetic Operations on Integer Classes


MATLAB can perform integer arithmetic on the following types of data:

• Integers or integer arrays of the same integer data type. This yields a result that has the same
data type as the operands:

x = uint32([132 347 528]) .* uint32(75);


class(x)
ans =
uint32
• Integers or integer arrays and scalar double-precision floating-point numbers. This yields a result
that has the same data type as the integer operands:

x = uint32([132 347 528]) .* 75.49;


class(x)
ans =
uint32

For all binary operations in which one operand is an array of integer data type (except 64-bit
integers) and the other is a scalar double, MATLAB computes the operation using element-wise
double-precision arithmetic, and then converts the result back to the original integer data type. For
binary operations involving a 64-bit integer array and a scalar double, MATLAB computes the
operation as if 80-bit extended-precision arithmetic were used, to prevent loss of precision.

Operations involving complex numbers with integer types is not supported.

Largest and Smallest Values for Integer Classes


For each integer data type, there is a largest and smallest number that you can represent with that
type. The table shown under “Integers” on page 4-2 lists the largest and smallest values for each
integer data type in the “Range of Values” column.

You can also obtain these values with the intmax and intmin functions:

intmax('int8')
ans =

int8

127

intmin('int8')
ans =

int8

-128

If you convert a number that is larger than the maximum value of an integer data type to that type,
MATLAB sets it to the maximum value. Similarly, if you convert a number that is smaller than the
minimum value of the integer data type, MATLAB sets it to the minimum value. For example,

4-4
Integers

x = int8(300)
x =

int8

127

x = int8(-300)
x =

int8

-128

Also, when the result of an arithmetic operation involving integers exceeds the maximum (or
minimum) value of the data type, MATLAB sets it to the maximum (or minimum) value:

x = int8(100) * 3
x =

int8

127

x = int8(-100) * 3
x =

int8

-128

4-5
4 Numeric Classes

Floating-Point Numbers
In this section...
“Double-Precision Floating Point” on page 4-6
“Single-Precision Floating Point” on page 4-6
“Creating Floating-Point Data” on page 4-6
“Arithmetic Operations on Floating-Point Numbers” on page 4-8
“Largest and Smallest Values for Floating-Point Classes” on page 4-9
“Accuracy of Floating-Point Data” on page 4-10
“Avoiding Common Problems with Floating-Point Arithmetic” on page 4-11

MATLAB represents floating-point numbers in either double-precision or single-precision format. The


default is double precision, but you can make any number single precision with a simple conversion
function.

Double-Precision Floating Point


MATLAB constructs the double-precision (or double) data type according to IEEE® Standard 754 for
double precision. Any value stored as a double requires 64 bits, formatted as shown in the table
below:

Bits Usage
63 Sign (0 = positive, 1 = negative)
62 to 52 Exponent, biased by 1023
51 to 0 Fraction f of the number 1.f

Single-Precision Floating Point


MATLAB constructs the single-precision (or single) data type according to IEEE Standard 754 for
single precision. Any value stored as a single requires 32 bits, formatted as shown in the table
below:

Bits Usage
31 Sign (0 = positive, 1 = negative)
30 to 23 Exponent, biased by 127
22 to 0 Fraction f of the number 1.f

Because MATLAB stores numbers of type single using 32 bits, they require less memory than
numbers of type double, which use 64 bits. However, because they are stored with fewer bits,
numbers of type single are represented to less precision than numbers of type double.

Creating Floating-Point Data


Use double-precision to store values greater than approximately 3.4 x 1038 or less than approximately
-3.4 x 1038. For numbers that lie between these two limits, you can use either double- or single-
precision, but single requires less memory.

4-6
Floating-Point Numbers

Creating Double-Precision Data

Because the default numeric type for MATLAB is double, you can create a double with a simple
assignment statement:
x = 25.783;

The whos function shows that MATLAB has created a 1-by-1 array of type double for the value you
just stored in x:
whos x
Name Size Bytes Class

x 1x1 8 double

Use isfloat if you just want to verify that x is a floating-point number. This function returns logical
1 (true) if the input is a floating-point number, and logical 0 (false) otherwise:
isfloat(x)
ans =

logical

You can convert other numeric data, characters or strings, and logical data to double precision using
the MATLAB function, double. This example converts a signed integer to double-precision floating
point:
y = int64(-589324077574); % Create a 64-bit integer

x = double(y) % Convert to double


x =
-5.8932e+11

Creating Single-Precision Data

Because MATLAB stores numeric data as a double by default, you need to use the single
conversion function to create a single-precision number:
x = single(25.783);

The whos function returns the attributes of variable x in a structure. The bytes field of this structure
shows that when x is stored as a single, it requires just 4 bytes compared with the 8 bytes to store it
as a double:
xAttrib = whos('x');
[Link]
ans =
4

You can convert other numeric data, characters or strings, and logical data to single precision using
the single function. This example converts a signed integer to single-precision floating point:
y = int64(-589324077574); % Create a 64-bit integer

x = single(y) % Convert to single


x =

4-7
4 Numeric Classes

single

-5.8932e+11

Arithmetic Operations on Floating-Point Numbers


This section describes which classes you can use in arithmetic operations with floating-point
numbers.

Double-Precision Operations

You can perform basic arithmetic operations with double and any of the following other classes.
When one or more operands is an integer (scalar or array), the double operand must be a scalar. The
result is of type double, except where noted otherwise:

• single — The result is of type single


• double
• int* or uint* — The result has the same data type as the integer operand
• char
• logical

This example performs arithmetic on data of types char and double. The result is of type double:

c = 'uppercase' - 32;

class(c)
ans =
double

char(c)
ans =
UPPERCASE

Single-Precision Operations

You can perform basic arithmetic operations with single and any of the following other classes. The
result is always single:

• single
• double
• char
• logical

In this example, 7.5 defaults to type double, and the result is of type single:

x = single([1.32 3.47 5.28]) .* 7.5;

class(x)
ans =
single

4-8
Floating-Point Numbers

Largest and Smallest Values for Floating-Point Classes


For the double and single classes, there is a largest and smallest number that you can represent
with that type.

Largest and Smallest Double-Precision Values

The MATLAB functions realmax and realmin return the maximum and minimum values that you
can represent with the double data type:

str = 'The range for double is:\n\t%g to %g and\n\t %g to %g';


sprintf(str, -realmax, -realmin, realmin, realmax)

ans =
The range for double is:
-1.79769e+308 to -2.22507e-308 and
2.22507e-308 to 1.79769e+308

Numbers larger than realmax or smaller than -realmax are assigned the values of positive and
negative infinity, respectively:

realmax + .0001e+308
ans =
Inf

-realmax - .0001e+308
ans =
-Inf

Largest and Smallest Single-Precision Values

The MATLAB functions realmax and realmin, when called with the argument 'single', return the
maximum and minimum values that you can represent with the single data type:

str = 'The range for single is:\n\t%g to %g and\n\t %g to %g';


sprintf(str, -realmax('single'), -realmin('single'), ...
realmin('single'), realmax('single'))

ans =
The range for single is:
-3.40282e+38 to -1.17549e-38 and
1.17549e-38 to 3.40282e+38

Numbers larger than realmax('single') or smaller than -realmax('single') are assigned the
values of positive and negative infinity, respectively:

realmax('single') + .0001e+038
ans =

single

Inf

-realmax('single') - .0001e+038
ans =

single

4-9
4 Numeric Classes

-Inf

Accuracy of Floating-Point Data


If the result of a floating-point arithmetic computation is not as precise as you had expected, it is
likely caused by the limitations of your computer's hardware. Probably, your result was a little less
exact because the hardware had insufficient bits to represent the result with perfect accuracy;
therefore, it truncated the resulting value.

Double-Precision Accuracy

Because there are only a finite number of double-precision numbers, you cannot represent all
numbers in double-precision storage. On any computer, there is a small gap between each double-
precision number and the next larger double-precision number. You can determine the size of this
gap, which limits the precision of your results, using the eps function. For example, to find the
distance between 5 and the next larger double-precision number, enter

format long

eps(5)
ans =
8.881784197001252e-16

This tells you that there are no double-precision numbers between 5 and 5 + eps(5). If a double-
precision computation returns the answer 5, the result is only accurate to within eps(5).

The value of eps(x) depends on x. This example shows that, as x gets larger, so does eps(x):

eps(50)
ans =
7.105427357601002e-15

If you enter eps with no input argument, MATLAB returns the value of eps(1), the distance from 1
to the next larger double-precision number.

Single-Precision Accuracy

Similarly, there are gaps between any two single-precision numbers. If x has type single, eps(x)
returns the distance between x and the next larger single-precision number. For example,

x = single(5);
eps(x)

returns

ans =

single

4.7684e-07

Note that this result is larger than eps(5). Because there are fewer single-precision numbers than
double-precision numbers, the gaps between the single-precision numbers are larger than the gaps
between double-precision numbers. This means that results in single-precision arithmetic are less
precise than in double-precision arithmetic.

4-10
Floating-Point Numbers

For a number x of type double, eps(single(x)) gives you an upper bound for the amount that x is
rounded when you convert it from double to single. For example, when you convert the double-
precision number 3.14 to single, it is rounded by
double(single(3.14) - 3.14)
ans =
1.0490e-07

The amount that 3.14 is rounded is less than


eps(single(3.14))
ans =

single

2.3842e-07

Avoiding Common Problems with Floating-Point Arithmetic


Almost all operations in MATLAB are performed in double-precision arithmetic conforming to the
IEEE standard 754. Because computers only represent numbers to a finite precision (double precision
calls for 52 mantissa bits), computations sometimes yield mathematically nonintuitive results. It is
important to note that these results are not bugs in MATLAB.

Use the following examples to help you identify these cases:

Example 1 — Round-Off or What You Get Is Not What You Expect

The decimal number 4/3 is not exactly representable as a binary fraction. For this reason, the
following calculation does not give zero, but rather reveals the quantity eps.
e = 1 - 3*(4/3 - 1)

e =
2.2204e-16

Similarly, 0.1 is not exactly representable as a binary number. Thus, you get the following
nonintuitive behavior:
a = 0.0;
for i = 1:10
a = a + 0.1;
end
a == 1
ans =

logical

Note that the order of operations can matter in the computation:


b = 1e-16 + 1 - 1e-16;
c = 1e-16 - 1e-16 + 1;
b == c
ans =

4-11
4 Numeric Classes

logical

There are gaps between floating-point numbers. As the numbers get larger, so do the gaps, as
evidenced by:

(2^53 + 1) - 2^53

ans =
0

Since pi is not really π, it is not surprising that sin(pi) is not exactly zero:

sin(pi)

ans =
1.224646799147353e-16

Example 2 — Catastrophic Cancellation

When subtractions are performed with nearly equal operands, sometimes cancellation can occur
unexpectedly. The following is an example of a cancellation caused by swamping (loss of precision
that makes the addition insignificant).

sqrt(1e-16 + 1) - 1

ans =
0

Some functions in MATLAB, such as expm1 and log1p, may be used to compensate for the effects of
catastrophic cancellation.

Example 3 — Floating-Point Operations and Linear Algebra

Round-off, cancellation, and other traits of floating-point arithmetic combine to produce startling
computations when solving the problems of linear algebra. MATLAB warns that the following matrix A
is ill-conditioned, and therefore the system Ax = b may be sensitive to small perturbations:

A = diag([2 eps]);
b = [2; eps];
y = A\b;
Warning: Matrix is close to singular or badly scaled.
Results may be inaccurate. RCOND = 1.110223e-16.

These are only a few of the examples showing how IEEE floating-point arithmetic affects
computations in MATLAB. Note that all computations performed in IEEE 754 arithmetic are affected,
this includes applications written in C or FORTRAN, as well as MATLAB.

References
[1] Moler, Cleve. “Floating Points.” MATLAB News and Notes. Fall, 1996.

[2] Moler, Cleve. Numerical Computing with MATLAB. Natick, MA: The MathWorks, Inc., 2004.

4-12
Create Complex Numbers

Create Complex Numbers


Complex numbers consist of two separate parts: a real part and an imaginary part. The basic
imaginary unit is equal to the square root of -1. This is represented in MATLAB by either of two
letters: i or j.

The following statement shows one way of creating a complex value in MATLAB. The variable x is
assigned a complex number with a real part of 2 and an imaginary part of 3:

x = 2 + 3i;

Another way to create a complex number is using the complex function. This function combines two
numeric inputs into a complex output, making the first input real and the second imaginary:

x = rand(3) * 5;
y = rand(3) * -8;

z = complex(x, y)
z =
4.7842 -1.0921i 0.8648 -1.5931i 1.2616 -2.2753i
2.6130 -0.0941i 4.8987 -2.3898i 4.3787 -3.7538i
4.4007 -7.1512i 1.3572 -5.2915i 3.6865 -0.5182i

You can separate a complex number into its real and imaginary parts using the real and imag
functions:

zr = real(z)
zr =
4.7842 0.8648 1.2616
2.6130 4.8987 4.3787
4.4007 1.3572 3.6865

zi = imag(z)
zi =
-1.0921 -1.5931 -2.2753
-0.0941 -2.3898 -3.7538
-7.1512 -5.2915 -0.5182

4-13
4 Numeric Classes

Infinity and NaN


In this section...
“Infinity” on page 4-14
“NaN” on page 4-14

Infinity
MATLAB represents infinity by the special value Inf. Infinity results from operations like division by
zero and overflow, which lead to results too large to represent as conventional floating-point values.
MATLAB also provides a function called Inf that returns the IEEE arithmetic representation for
positive infinity as a double scalar value.

Several examples of statements that return positive or negative infinity in MATLAB are shown here.

x = 1/0 x = 1.e1000
x = x =
Inf Inf
x = exp(1000) x = log(0)
x = x =
Inf -Inf

Use the isinf function to verify that x is positive or negative infinity:

x = log(0);

isinf(x)
ans =
1

NaN
MATLAB represents values that are not real or complex numbers with a special value called NaN,
which stands for “Not a Number”. Expressions like 0/0 and inf/inf result in NaN, as do any
arithmetic operations involving a NaN:

x = 0/0
x =

NaN

You can also create NaNs by:

x = NaN;

whos x
Name Size Bytes Class

x 1x1 8 double

The NaN function returns one of the IEEE arithmetic representations for NaN as a double scalar
value. The exact bit-wise hexadecimal representation of this NaN value is,

4-14
Infinity and NaN

format hex
x = NaN

x =

fff8000000000000

Always use the isnan function to verify that the elements in an array are NaN:

isnan(x)
ans =

MATLAB preserves the “Not a Number” status of alternate NaN representations and treats all of the
different representations of NaN equivalently. However, in some special cases (perhaps due to
hardware limitations), MATLAB does not preserve the exact bit pattern of alternate NaN
representations throughout an entire calculation, and instead uses the canonical NaN bit pattern
defined above.

Logical Operations on NaN

Because two NaNs are not equal to each other, logical operations involving NaN always return false,
except for a test for inequality, (NaN ~= NaN):

NaN > NaN


ans =
0

NaN ~= NaN
ans =
1

4-15
4 Numeric Classes

Identifying Numeric Classes


You can check the data type of a variable x using any of these commands.

Command Operation
whos x Display the data type of x.
xType = class(x); Assign the data type of x to a variable.
isnumeric(x) Determine if x is a numeric type.
isa(x, 'integer') Determine if x is the specified numeric type. (Examples for any
isa(x, 'uint64') integer, unsigned 64-bit integer, any floating point, double precision,
isa(x, 'float') and single precision are shown here).
isa(x, 'double')
isa(x, 'single')
isreal(x) Determine if x is real or complex.
isnan(x) Determine if x is Not a Number (NaN).
isinf(x) Determine if x is infinite.
isfinite(x) Determine if x is finite.

4-16
Display Format for Numeric Values

Display Format for Numeric Values


By default, MATLAB uses a 5-digit short format to display numbers. For example,

x = 4/3

x =

1.3333

You can change the display in the Command Window or Editor using the format function.

format long
x

x =

1.333333333333333

Using the format function only sets the format for the current MATLAB session. To set the format for
subsequent sessions, click Preferences on the Home tab in the Environment section. Select
MATLAB > Command Window, and then choose a Numeric format option.

The following table summarizes the numeric output format options.

Style Result Example


short Short, fixed-decimal format with 4 digits after the 3.1416
(default) decimal point.
long Long, fixed-decimal format with 15 digits after the 3.141592653589793
decimal point for double values, and 7 digits after
the decimal point for single values.
shortE Short scientific notation with 4 digits after the 3.1416e+00
decimal point.
longE Long scientific notation with 15 digits after the 3.141592653589793e+00
decimal point for double values, and 7 digits after
the decimal point for single values.
shortG Short, fixed-decimal format or scientific notation, 3.1416
whichever is more compact, with a total of 5
digits.
longG Long, fixed-decimal format or scientific notation, 3.14159265358979
whichever is more compact, with a total of 15
digits for double values, and 7 digits for single
values.
shortEng Short engineering notation (exponent is a multiple 3.1416e+000
of 3) with 4 digits after the decimal point.
longEng Long engineering notation (exponent is a multiple 3.14159265358979e+000
of 3) with 15 significant digits.
+ Positive/Negative format with +, -, and blank +
characters displayed for positive, negative, and
zero elements.

4-17
4 Numeric Classes

Style Result Example


bank Currency format with 2 digits after the decimal 3.14
point.
hex Hexadecimal representation of a binary double- 400921fb54442d18
precision number.
rat Ratio of small integers. 355/113

The display format only affects how numbers are displayed, not how they are stored in MATLAB.

See Also
format

Related Examples
• “Format Output”

4-18
Integer Arithmetic

Integer Arithmetic
This example shows how to perform arithmetic on integer data representing signals and images.

Load Integer Signal Data

Load measurement datasets comprising signals from four instruments using 8 and 16-bit A-to-D's
resulting in data saved as int8, int16 and uint16. Time is stored as uint16.

load integersignal

% Look at variables
whos Signal1 Signal2 Signal3 Signal4 Time1

Name Size Bytes Class Attributes

Signal1 7550x1 7550 int8


Signal2 7550x1 7550 int8
Signal3 7550x1 15100 int16
Signal4 7550x1 15100 uint16
Time1 7550x1 15100 uint16

Plot Data

First we will plot two of the signals to see the signal ranges.

plot(Time1, Signal1, Time1, Signal2);


grid;
legend('Signal1','Signal2');

4-19
4 Numeric Classes

It is likely that these values would need to be scaled to calculate the actual physical value that the
signal represents e.g. Volts.

Process Data

We can perform standard arithmetic on integers such as +, -, *, and /. Let's say we wished to find the
sum of Signal1 and Signal2.

SumSig = Signal1 + Signal2; % Here we sum the integer signals.

Now let's plot the sum signal and see where it saturates.

cla;
plot(Time1, SumSig);
hold on
Saturated = (SumSig == intmin('int8')) | (SumSig == intmax('int8')); % Find where it has saturate
plot(Time1(Saturated),SumSig(Saturated),'rd')
grid
hold off

4-20
Integer Arithmetic

The markers show where the signal has saturated.

Load Integer Image Data

Next we will look at arithmetic on some image data.

street1 = imread('[Link]'); % Load image data


street2 = imread('[Link]');
whos street1 street2

Name Size Bytes Class Attributes

street1 480x640x3 921600 uint8


street2 480x640x3 921600 uint8

Here we see the images are 24-bit color, stored as three planes of uint8 data.

Display Images

Display first image.

cla;
image(street1); % Display image
axis equal
axis off

4-21
4 Numeric Classes

Display second image

image(street2); % Display image


axis equal
axis off

4-22
Integer Arithmetic

Scale an Image

We can scale the image by a double precision constant but keep the image stored as integers. For
example,

duller = 0.5 * street2; % Scale image with a double constant but create an integer
whos duller

Name Size Bytes Class Attributes

duller 480x640x3 921600 uint8

subplot(1,2,1);
image(street2);
axis off equal tight
title('Original'); % Display image

subplot(1,2,2);
image(duller);
axis off equal tight
title('Duller'); % Display image

4-23
4 Numeric Classes

Add the Images

We can add the two street images together and plot the ghostly result.

combined = street1 + duller; % Add |uint8| images


subplot(1,1,1)
cla;
image(combined); % Display image
title('Combined');
axis equal
axis off

4-24
Integer Arithmetic

4-25
4 Numeric Classes

Single Precision Math


This example shows how to perform arithmetic and linear algebra with single precision data. It also
shows how the results are computed appropriately in single-precision or double-precision, depending
on the input.

Create Double Precision Data

Let's first create some data, which is double precision by default.

Ad = [1 2 0; 2 5 -1; 4 10 -1]

Ad = 3×3

1 2 0
2 5 -1
4 10 -1

Convert to Single Precision

We can convert data to single precision with the single function.

A = single(Ad); % or A = cast(Ad,'single');

Create Single Precision Zeros and Ones

We can also create single precision zeros and ones with their respective functions.

n = 1000;
Z = zeros(n,1,'single');
O = ones(n,1,'single');

Let's look at the variables in the workspace.

whos A Ad O Z n

Name Size Bytes Class Attributes

A 3x3 36 single
Ad 3x3 72 double
O 1000x1 4000 single
Z 1000x1 4000 single
n 1x1 8 double

We can see that some of the variables are of type single and that the variable A (the single precision
version of Ad) takes half the number of bytes of memory to store because singles require just four
bytes (32-bits), whereas doubles require 8 bytes (64-bits).

Arithmetic and Linear Algebra

We can perform standard arithmetic and linear algebra on singles.

B = A' % Matrix Transpose

B = 3x3 single matrix

1 2 4

4-26
Single Precision Math

2 5 10
0 -1 -1

whos B

Name Size Bytes Class Attributes

B 3x3 36 single

We see the result of this operation, B, is a single.


C = A * B % Matrix multiplication

C = 3x3 single matrix

5 12 24
12 30 59
24 59 117

C = A .* B % Elementwise arithmetic

C = 3x3 single matrix

1 4 0
4 25 -10
0 -10 1

X = inv(A) % Matrix inverse

X = 3x3 single matrix

5 2 -2
-2 -1 1
0 -2 1

I = inv(A) * A % Confirm result is identity matrix

I = 3x3 single matrix

1 0 0
0 1 0
0 0 1

I = A \ A % Better way to do matrix division than inv

I = 3x3 single matrix

1 0 0
0 1 0
0 0 1

E = eig(A) % Eigenvalues

E = 3x1 single column vector

4-27
4 Numeric Classes

3.7321
0.2679
1.0000

F = fft(A(:,1)) % FFT

F = 3x1 single column vector

7.0000 + 0.0000i
-2.0000 + 1.7321i
-2.0000 - 1.7321i

S = svd(A) % Singular value decomposition

S = 3x1 single column vector

12.3171
0.5149
0.1577

P = round(poly(A)) % The characteristic polynomial of a matrix

P = 1x4 single row vector

1 -5 5 -1

R = roots(P) % Roots of a polynomial

R = 3x1 single column vector

3.7321
1.0000
0.2679

Q = conv(P,P) % Convolve two vectors

Q = 1x7 single row vector

1 -10 35 -52 35 -10 1

R = conv(P,Q)

R = 1x10 single row vector

1 -15 90 -278 480 -480 278 -90 15 -1

stem(R); % Plot the result

4-28
Single Precision Math

A Program that Works for Either Single or Double Precision

Now let's look at a function to compute enough terms in the Fibonacci sequence so the ratio is less
than the correct machine epsilon (eps) for datatype single or double.

% How many terms needed to get single precision results?


fibodemo('single')

ans = 19

% How many terms needed to get double precision results?


fibodemo('double')

ans = 41

% Now let's look at the working code.


type fibodemo

function nterms = fibodemo(dtype)


%FIBODEMO Used by SINGLEMATH demo.
% Calculate number of terms in Fibonacci sequence.

% Copyright 1984-2014 The MathWorks, Inc.

fcurrent = ones(dtype);
fnext = fcurrent;

4-29
4 Numeric Classes

goldenMean = (ones(dtype)+sqrt(5))/2;
tol = eps(goldenMean);
nterms = 2;
while abs(fnext/fcurrent - goldenMean) >= tol
nterms = nterms + 1;
temp = fnext;
fnext = fnext + fcurrent;
fcurrent = temp;
end

Notice that we initialize several of our variables, fcurrent, fnext, and goldenMean, with values
that are dependent on the input datatype, and the tolerance tol depends on that type as well. Single
precision requires that we calculate fewer terms than the equivalent double precision calculation.

4-30
5

The Logical Class

• “Find Array Elements That Meet a Condition” on page 5-2


• “Reduce Logical Arrays to Single Value” on page 5-6
5 The Logical Class

Find Array Elements That Meet a Condition


This example shows how to filter the elements of an array by applying conditions to the array. For
instance, you can examine the even elements in a matrix, find the location of all 0s in a
multidimensional array, or replace NaN values in data. You can perform these tasks using a
combination of the relational and logical operators. The relational operators (>, <, >=, <=, ==, ~=)
impose conditions on the array, and you can apply multiple conditions by connecting them with the
logical operators and, or, and not, respectively denoted by the symbols &, |, and ~.

Apply a Single Condition

To apply a single condition, start by creating a 5-by-5 matrix that contains random integers between 1
and 15. Reset the random number generator to the default state for reproducibility.

rng default
A = randi(15,5)

A = 5×5

13 2 3 3 10
14 5 15 7 1
2 9 15 14 13
14 15 8 12 15
10 15 13 15 11

Use the relational less than operator, <, to determine which elements of A are less than 9. Store the
result in B.

B = A < 9

B = 5x5 logical array

0 1 1 1 0
0 1 0 1 1
1 0 0 0 0
0 0 1 0 0
0 0 0 0 0

The result is a logical matrix. Each value in B represents a logical 1 (true) or logical 0 (false) state
to indicate whether the corresponding element of A fulfills the condition A < 9. For example, A(1,1)
is 13, so B(1,1) is logical 0 (false). However, A(1,2) is 2, so B(1,2) is logical 1 (true).

Although B contains information about which elements in A are less than 9, it doesn’t tell you what
their values are. Rather than comparing the two matrices element by element, you can use B to index
into A.

A(B)

ans = 8×1

2
2
5
3
8

5-2
Find Array Elements That Meet a Condition

3
7
1

The result is a column vector of the elements in A that are less than 9. Since B is a logical matrix, this
operation is called logical indexing. In this case, the logical array being used as an index is the
same size as the other array, but this is not a requirement. For more information, see “Array
Indexing”.

Some problems require information about the locations of the array elements that meet a condition
rather than their actual values. In this example, you can use the find function to locate all of the
elements in A less than 9.

I = find(A < 9)

I = 8×1

3
6
7
11
14
16
17
22

The result is a column vector of linear indices. Each index describes the location of an element in A
that is less than 9, so in practice A(I) returns the same result as A(B). The difference is that A(B)
uses logical indexing, whereas A(I) uses linear indexing.

Apply Multiple Conditions

You can use the logical and, or, and not operators to apply any number of conditions to an array; the
number of conditions is not limited to one or two.

First, use the logical and operator, denoted &, to specify two conditions: the elements must be less
than 9 and greater than 2. Specify the conditions as a logical index to view the elements that
satisfy both conditions.

A(A<9 & A>2)

ans = 5×1

5
3
8
3
7

The result is a list of the elements in A that satisfy both conditions. Be sure to specify each condition
with a separate statement connected by a logical operator. For example, you cannot specify the
conditions above by A(2<A<9), since it evaluates to A(2<A | A<9).

Next, find the elements in A that are less than 9 and even numbered.

5-3
5 The Logical Class

A(A<9 & ~mod(A,2))

ans = 3×1

2
2
8

The result is a list of all even elements in A that are less than 9. The use of the logical NOT operator,
~, converts the matrix mod(A,2) into a logical matrix, with a value of logical 1 (true) located where
an element is evenly divisible by 2.

Finally, find the elements in A that are less than 9 and even numbered and not equal to 2.
A(A<9 & ~mod(A,2) & A~=2)

ans = 8

The result, 8, is even, less than 9, and not equal to 2. It is the only element in A that satisfies all three
conditions.

Use the find function to get the index of the element equal to 8 that satisfies the conditions.
find(A<9 & ~mod(A,2) & A~=2)

ans = 14

The result indicates that A(14) = 8.

Replace Values That Meet a Condition

Sometimes it is useful to simultaneously change the values of several existing array elements. Use
logical indexing with a simple assignment statement to replace the values in an array that meet a
condition.

Replace all values in A that are greater than 10 with the number 10.
A(A>10) = 10

A = 5×5

10 2 3 3 10
10 5 10 7 1
2 9 10 10 10
10 10 8 10 10
10 10 10 10 10

Next, replace all values in A that are not equal to 10 with a NaN value.
A(A~=10) = NaN

A = 5×5

10 NaN NaN NaN 10


10 NaN 10 NaN NaN
NaN NaN 10 10 10
10 10 NaN 10 10

5-4
Find Array Elements That Meet a Condition

10 10 10 10 10

Lastly, replace all of the NaN values in A with zeros and apply the logical NOT operator, ~A.

A(isnan(A)) = 0;
C = ~A

C = 5x5 logical array

0 1 1 1 0
0 1 0 1 1
1 1 0 0 0
0 0 1 0 0
0 0 0 0 0

The resulting matrix has values of logical 1 (true) in place of the NaN values, and logical 0 (false)
in place of the 10s. The logical NOT operation, ~A, converts the numeric array into a logical array
such that A&C returns a matrix of logical 0 (false) values and A|C returns a matrix of logical 1
(true) values.

See Also
Logical Operators: Short Circuit | and | find | isnan | nan | not | or | xor

5-5
5 The Logical Class

Reduce Logical Arrays to Single Value


This example shows how to use the any and all functions to reduce an entire array to a single
logical value.

The any and all functions are natural extensions of the logical | (OR) and & (AND) operators,
respectively. However, rather than comparing just two elements, the any and all functions compare
all of the elements in a particular dimension of an array. It is as if all of those elements are connected
by & or | operators and the any or all functions evaluate the resulting long logical expressions.
Therefore, unlike the core logical operators, the any and all functions reduce the size of the array
dimension that they operate on so that it has size 1. This enables the reduction of many logical values
into a single logical condition.

First, create a matrix A that contains random integers between 1 and 25. Reset the random number
generator to the default state for reproducibility.

rng default
A = randi(25,5)

A = 5×5

21 3 4 4 17
23 7 25 11 1
4 14 24 23 22
23 24 13 20 24
16 25 21 24 17

Next, use the mod function along with the logical NOT operator, ~, to determine which elements in A
are even.

A = ~mod(A,2)

A = 5x5 logical array

0 0 1 1 0
0 0 0 0 0
1 1 1 0 1
0 1 0 1 1
1 0 0 1 0

The resulting matrices have values of logical 1 (true) where an element is even, and logical 0
(false) where an element is odd.

Since the any and all functions reduce the dimension that they operate on to size 1, it normally
takes two applications of one of the functions to reduce a 2–D matrix into a single logical condition,
such as any(any(A)). However, if you use the notation A(:) to regard all of the elements of A as a
single column vector, you can use any(A(:)) to get the same logical information without nesting the
function calls.

Determine if any elements in A are even.

any(A(:))

5-6
Reduce Logical Arrays to Single Value

ans = logical
1

You can perform logical and relational comparisons within the function call to any or all. This makes
it easy to quickly test an array for a variety of properties.

Determine if all elements in A are odd.

all(~A(:))

ans = logical
0

Determine whether any main or super diagonal elements in A are even. Since the vectors returned by
diag(A) and diag(A,1) are not the same size, you first need to reduce each diagonal to a single
scalar logical condition before comparing them. You can use the short-circuit OR operator || to
perform the comparison, since if any elements in the first diagonal are even then the entire
expression evaluates to true regardless of what appears on the right-hand side of the operator.

any(diag(A)) || any(diag(A,1))

ans = logical
1

See Also
Logical Operators: Short Circuit | all | and | any | or | xor

5-7
6

Characters and Strings

• “Text in String and Character Arrays” on page 6-2


• “Create String Arrays” on page 6-5
• “Cell Arrays of Character Vectors” on page 6-12
• “Analyze Text Data with String Arrays” on page 6-15
• “Test for Empty Strings and Missing Values” on page 6-20
• “Formatting Text” on page 6-24
• “Compare Text” on page 6-32
• “Search and Replace Text” on page 6-37
• “Build Pattern Expressions” on page 6-40
• “Convert Numeric Values to Text” on page 6-45
• “Convert Text to Numeric Values” on page 6-49
• “Unicode and ASCII Values” on page 6-53
• “Hexadecimal and Binary Values” on page 6-55
• “Frequently Asked Questions About String Arrays” on page 6-59
• “Update Your Code to Accept Strings” on page 6-64
• “Function Summary” on page 6-72
6 Characters and Strings

Text in String and Character Arrays


There are two ways to represent text in MATLAB®. Starting in R2016b, you can store text in string
arrays. And in any version of MATLAB, you can store text in character arrays. A typical use for
character arrays is to store pieces of text as character vectors. MATLAB displays strings with double
quotes and character vectors with single quotes.

Represent Text with String Arrays

You can store any 1-by-n sequence of characters as a string, using the string data type. Starting in
R2017a, enclose text in double quotes to create a string.

str = "Hello, world"

str =
"Hello, world"

Though the text "Hello, world" is 12 characters long, str itself is a 1-by-1 string, or string scalar.
You can use a string scalar to specify a file name, plot label, or any other piece of textual information.

To find the number of characters in a string, use the strlength function.

n = strlength(str)

n = 12

If the text includes double quotes, use two double quotes within the definition.

str = "They said, ""Welcome!"" and waved."

str =
"They said, "Welcome!" and waved."

To add text to the end of a string, use the plus operator, +. If a variable can be converted to a string,
then plus converts it and appends it.

fahrenheit = 71;
celsius = (fahrenheit-32)/1.8;
tempText = "temperature is " + celsius + "C"

tempText =
"temperature is 21.6667C"

Starting in R2019a, you can also concatenate text using the append function.

tempText2 = append("Today's ",tempText)

tempText2 =
"Today's temperature is 21.6667C"

The string function can convert different types of inputs, such as numeric, datetime, duration, and
categorical values. For example, convert the output of pi to a string.

ps = string(pi)

ps =
"3.1416"

6-2
Text in String and Character Arrays

You can store multiple pieces of text in a string array. Each element of the array can contain a string
having a different number of characters, without padding.

str = ["Mercury","Gemini","Apollo";...
"Skylab","Skylab B","ISS"]

str = 2x3 string


"Mercury" "Gemini" "Apollo"
"Skylab" "Skylab B" "ISS"

str is a 2-by-3 string array. You can find the lengths of the strings with the strlength function.

N = strlength(str)

N = 2×3

7 6 6
6 8 3

As of R2018b, string arrays are supported throughout MATLAB and MathWorks® products. Functions
that accept character arrays (and cell arrays of character vectors) as inputs also accept string arrays.

Represent Text with Character Vectors

To store a 1-by-n sequence of characters as a character vector, using the char data type, enclose it in
single quotes.

chr = 'Hello, world'

chr =
'Hello, world'

The text 'Hello, world' is 12 characters long, and chr stores it as a 1-by-12 character vector.

whos chr

Name Size Bytes Class Attributes

chr 1x12 24 char

If the text includes single quotes, use two single quotes within the definition.

chr = 'They said, ''Welcome!'' and waved.'

chr =
'They said, 'Welcome!' and waved.'

Character vectors have two principal uses:

• To specify single pieces of text, such as file names and plot labels.
• To represent data that is encoded using characters. In such cases, you might need easy access to
individual characters.

For example, you can store a DNA sequence as a character vector.

seq = 'GCTAGAATCC';

6-3
6 Characters and Strings

You can access individual characters or subsets of characters by indexing, just as you would index
into a numeric array.

seq(4:6)

ans =
'AGA'

Concatenate character vector with square brackets, just as you concatenate other types of arrays.

seq2 = [seq 'ATTAGAAACC']

seq2 =
'GCTAGAATCCATTAGAAACC'

Starting in R2019a, you also can concatenate text using append. The append function is
recommended because it treats string arrays, character vectors, and cell arrays of character vectors
consistently.

seq2 = append(seq,'ATTAGAAACC')

seq2 =
'GCTAGAATCCATTAGAAACC'

MATLAB functions that accept string arrays as inputs also accept character vectors and cell arrays of
character vectors.

See Also
append | cellstr | char | horzcat | plus | string | strlength

Related Examples
• “Create String Arrays” on page 6-5
• “Analyze Text Data with String Arrays” on page 6-15
• “Frequently Asked Questions About String Arrays” on page 6-59
• “Update Your Code to Accept Strings” on page 6-64
• “Cell Arrays of Character Vectors” on page 6-12

6-4
Create String Arrays

Create String Arrays


String arrays were introduced in R2016b. String arrays store pieces of text and provide a set of
functions for working with text as data. You can index into, reshape, and concatenate strings arrays
just as you can with arrays of any other type. You also can access the characters in a string and
append text to strings using the plus operator. To rearrange strings within a string array, use
functions such as split, join, and sort.

Create String Arrays from Variables

MATLAB® provides string arrays to store pieces of text. Each element of a string array contains a 1-
by-n sequence of characters.

Starting in R2017a, you can create a string using double quotes.


str = "Hello, world"

str =
"Hello, world"

As an alternative, you can convert a character vector to a string using the string function. chr is a
1-by-17 character vector. str is a 1-by-1 string that has the same text as the character vector.
chr = 'Greetings, friend'

chr =
'Greetings, friend'

str = string(chr)

str =
"Greetings, friend"

Create a string array containing multiple strings using the [] operator. str is a 2-by-3 string array
that contains six strings.
str = ["Mercury","Gemini","Apollo";
"Skylab","Skylab B","ISS"]

str = 2x3 string


"Mercury" "Gemini" "Apollo"
"Skylab" "Skylab B" "ISS"

Find the length of each string in str with the strlength function. Use strlength, not length, to
determine the number of characters in strings.
L = strlength(str)

L = 2×3

7 6 6
6 8 3

As an alternative, you can convert a cell array of character vectors to a string array using the string
function. MATLAB displays strings in string arrays with double quotes, and displays characters
vectors in cell arrays with single quotes.

6-5
6 Characters and Strings

C = {'Mercury','Venus','Earth'}

C = 1x3 cell
{'Mercury'} {'Venus'} {'Earth'}

str = string(C)

str = 1x3 string


"Mercury" "Venus" "Earth"

In addition to character vectors, you can convert numeric, datetime, duration, and categorical values
to strings using the string function.

Convert a numeric array to a string array.


X = [5 10 20 3.1416];
string(X)

ans = 1x4 string


"5" "10" "20" "3.1416"

Convert a datetime value to a string.


d = datetime('now');
string(d)

ans =
"09-Nov-2020 15:50:11"

Also, you can read text from files into string arrays using the readtable, textscan, and fscanf
functions.

Create Empty and Missing Strings

String arrays can contain both empty and missing values. An empty string contains zero characters.
When you display an empty string, the result is a pair of double quotes with nothing between them
(""). The missing string is the string equivalent to NaN for numeric arrays. It indicates where a string
array has missing values. When you display a missing string, the result is <missing>, with no
quotation marks.

Create an empty string array using the strings function. When you call strings with no
arguments, it returns an empty string. Note that the size of str is 1-by-1, not 0-by-0. However, str
contains zero characters.
str = strings

str =
""

Create an empty character vector using single quotes. Note that the size of chr is 0-by-0.
chr = ''

chr =

0x0 empty char array

6-6
Create String Arrays

Create a string array where every element is an empty string. You can preallocate a string array with
the strings function.

str = strings(2,3)

str = 2x3 string


"" "" ""
"" "" ""

To create a missing string, convert a missing value using the string function. The missing string
displays as <missing>.

str = string(missing)

str =
<missing>

You can create a string array with both empty and missing strings. Use the ismissing function to
determine which elements are strings with missing values. Note that the empty string is not a
missing string.

str(1) = "";
str(2) = "Gemini";
str(3) = string(missing)

str = 1x3 string


"" "Gemini" <missing>

ismissing(str)

ans = 1x3 logical array

0 0 1

Compare a missing string to another string. The result is always 0 (false), even when you compare a
missing string to another missing string.

str = string(missing);
str == "Gemini"

ans = logical
0

str == string(missing)

ans = logical
0

Access Elements of String Array

String arrays support array operations such as indexing and reshaping. Use array indexing to access
the first row of str and all the columns.

6-7
6 Characters and Strings

str = ["Mercury","Gemini","Apollo";
"Skylab","Skylab B","ISS"];
str(1,:)

ans = 1x3 string


"Mercury" "Gemini" "Apollo"

Access the second element in the second row of str.

str(2,2)

ans =
"Skylab B"

Assign a new string outside the bounds of str. MATLAB expands the array and fills unallocated
elements with missing values.

str(3,4) = "Mir"

str = 3x4 string


"Mercury" "Gemini" "Apollo" <missing>
"Skylab" "Skylab B" "ISS" <missing>
<missing> <missing> <missing> "Mir"

Access Characters Within Strings

You can index into a string array using curly braces, {}, to access characters directly. Use curly
braces when you need to access and modify characters within a string element. Indexing with curly
braces provides compatibility for code that could work with either string arrays or cell arrays of
character vectors. But whenever possible, use string functions to work with the characters in strings.

Access the second element in the second row with curly braces. chr is a character vector, not a
string.

str = ["Mercury","Gemini","Apollo";
"Skylab","Skylab B","ISS"];
chr = str{2,2}

chr =
'Skylab B'

Access the character vector and return the first three characters.

str{2,2}(1:3)

ans =
'Sky'

Find the space characters in a string and replace them with dashes. Use the isspace function to
inspect individual characters within the string. isspace returns a logical vector that contains a true
value wherever there is a space character. Finally, display the modified string element, str(2,2).

TF = isspace(str{2,2})

TF = 1x8 logical array

6-8
Create String Arrays

0 0 0 0 0 0 1 0

str{2,2}(TF) = "-";
str(2,2)

ans =
"Skylab-B"

Note that in this case, you can also replace spaces using the replace function, without resorting to
curly brace indexing.
replace(str(2,2)," ","-")

ans =
"Skylab-B"

Concatenate Strings into String Array

Concatenate strings into a string array just as you would concatenate arrays of any other kind.

Concatenate two string arrays using square brackets, [].


str1 = ["Mercury","Gemini","Apollo"];
str2 = ["Skylab","Skylab B","ISS"];
str = [str1 str2]

str = 1x6 string


"Mercury" "Gemini" "Apollo" "Skylab" "Skylab B" "ISS"

Transpose str1 and str2. Concatenate them and then vertically concatenate column headings onto
the string array. When you concatenate character vectors into a string array, the character vectors
are automatically converted to strings.
str1 = str1';
str2 = str2';
str = [str1 str2];
str = [["Mission:","Station:"] ; str]

str = 4x2 string


"Mission:" "Station:"
"Mercury" "Skylab"
"Gemini" "Skylab B"
"Apollo" "ISS"

Append Text to Strings

To append text to strings, use the plus operator, +. The plus operator appends text to strings but
does not change the size of a string array.

Append a last name to an array of names. If you append a character vector to strings, then the
character vector is automatically converted to a string.
names = ["Mary";"John";"Elizabeth";"Paul";"Ann"];
names = names + ' Smith'

names = 5x1 string


"Mary Smith"

6-9
6 Characters and Strings

"John Smith"
"Elizabeth Smith"
"Paul Smith"
"Ann Smith"

Append different last names. You can append text to a string array from a string array or from a cell
array of character vectors. When you add nonscalar arrays, they must be the same size.
names = ["Mary";"John";"Elizabeth";"Paul";"Ann"];
lastnames = ["Jones";"Adams";"Young";"Burns";"Spencer"];
names = names + " " + lastnames

names = 5x1 string


"Mary Jones"
"John Adams"
"Elizabeth Young"
"Paul Burns"
"Ann Spencer"

Append a missing string. When you append a missing string with the plus operator, the output is a
missing string.
str1 = "Jones";
str2 = string(missing);
str1 + str2

ans =
<missing>

Split, Join, and Sort String Array

MATLAB provides a rich set of functions to work with string arrays. For example, you can use the
split, join, and sort functions to rearrange the string array names so that the names are in
alphabetical order by last name.

Split names on the space characters. Splitting changes names from a 5-by-1 string array to a 5-by-2
array.
names = ["Mary Jones";"John Adams";"Elizabeth Young";"Paul Burns";"Ann Spencer"];
names = split(names)

names = 5x2 string


"Mary" "Jones"
"John" "Adams"
"Elizabeth" "Young"
"Paul" "Burns"
"Ann" "Spencer"

Switch the columns of names so that the last names are in the first column. Add a comma after each
last name.
names = [names(:,2) names(:,1)];
names(:,1) = names(:,1) + ','

names = 5x2 string


"Jones," "Mary"

6-10
Create String Arrays

"Adams," "John"
"Young," "Elizabeth"
"Burns," "Paul"
"Spencer," "Ann"

Join the last and first names. The join function places a space character between the strings it joins.
After the join, names is a 5-by-1 string array.

names = join(names)

names = 5x1 string


"Jones, Mary"
"Adams, John"
"Young, Elizabeth"
"Burns, Paul"
"Spencer, Ann"

Sort the elements of names so that they are in alphabetical order.

names = sort(names)

names = 5x1 string


"Adams, John"
"Burns, Paul"
"Jones, Mary"
"Spencer, Ann"
"Young, Elizabeth"

See Also
ismissing | isspace | join | plus | sort | split | string | strings | strlength

Related Examples
• “Analyze Text Data with String Arrays” on page 6-15
• “Search and Replace Text” on page 6-37
• “Compare Text” on page 6-32
• “Test for Empty Strings and Missing Values” on page 6-20
• “Frequently Asked Questions About String Arrays” on page 6-59
• “Update Your Code to Accept Strings” on page 6-64

6-11
6 Characters and Strings

Cell Arrays of Character Vectors


To store text as a character vector, enclose it single quotes. Typically, a character vector has text that
you consider to be a single piece of information, such as a file name or a label for a plot. If you have
many pieces of text, such as a list of file names, then you can store them in a cell array. A cell array
whose elements are all character vectors is a cell array of character vectors.

Note

• As of R2018b, the recommended way to store text is to use string arrays. If you create variables
that have the string data type, store them in string arrays, not cell arrays. For more information,
see “Text in String and Character Arrays” on page 6-2 and “Update Your Code to Accept Strings”
on page 6-64.
• While the phrase cell array of strings frequently has been used to describe such cell arrays, the
phrase is no longer accurate because such a cell array holds character vectors, not strings.

Create Cell Array of Character Vectors


To create a cell array of character vectors, use curly braces, {}, just as you would to create any cell
array. For example, use a cell array of character vectors to store a list of names.
C = {'Li','Sanchez','Jones','Yang','Larson'}

C = 1x5 cell
{'Li'} {'Sanchez'} {'Jones'} {'Yang'} {'Larson'}

The character vectors in C can have different lengths because a cell array does not require that its
contents have the same size. To determine the lengths of the character vectors in C, use the
strlength function.
L = strlength(C)

L = 1×5

2 7 5 4 6

Access Character Vectors in Cell Array


To access character vectors in a cell array, index into it using curly braces, {}. Extract the contents of
the first cell and store it as a character vector.
C = {'Li','Sanchez','Jones','Yang','Larson'};
chr = C{1}

chr =
'Li'

Assign a different character vector to the first cell.


C{1} = 'Yang'

6-12
Cell Arrays of Character Vectors

C = 1x5 cell
{'Yang'} {'Sanchez'} {'Jones'} {'Yang'} {'Larson'}

To refer to a subset of cells, instead of their contents, index using smooth parentheses.

C(1:3)

ans = 1x3 cell


{'Yang'} {'Sanchez'} {'Jones'}

While you can access the contents of cells by indexing, most functions that accept cell arrays as
inputs operate on the entire cell array. For example, you can use the strcmp function to compare the
contents of C to a character vector. strcmp returns 1 where there is a match and 0 otherwise.

TF = strcmp(C,'Yang')

TF = 1x5 logical array

1 0 0 1 0

You can sum over TF to find the number of matches.

num = sum(TF)

num = 2

Use TF as logical indices to return the matches in C. If you index using smooth parentheses, then the
output is a cell array containing only the matches.

M = C(TF)

M = 1x2 cell
{'Yang'} {'Yang'}

Convert Cell Arrays to String Arrays


As of R2018b, string arrays are supported throughout MATLAB® and MathWorks® products.
Therefore it is recommended that you use string arrays instead of cell arrays of character vectors.
(However, MATLAB functions that accept string arrays as inputs do accept character vectors and cell
arrays of character vectors as well.)

You can convert cell arrays of character vectors to string arrays. To convert a cell array of character
vectors, use the string function.

C = {'Li','Sanchez','Jones','Yang','Larson'}

C = 1x5 cell
{'Li'} {'Sanchez'} {'Jones'} {'Yang'} {'Larson'}

str = string(C)

6-13
6 Characters and Strings

str = 1x5 string


"Li" "Sanchez" "Jones" "Yang" "Larson"

In fact, the string function converts any cell array, so long as all of the contents can be converted to
strings.

C2 = {5, 10, 'some text', datetime('today')}

C2=1×4 cell array


{[5]} {[10]} {'some text'} {[09-Nov-2020]}

str2 = string(C2)

str2 = 1x4 string


"5" "10" "some text" "09-Nov-2020"

See Also
cellstr | char | iscellstr | strcmp | string

More About
• “Text in String and Character Arrays” on page 6-2
• “Access Data in Cell Array” on page 12-5
• “Create String Arrays” on page 6-5
• “Update Your Code to Accept Strings” on page 6-64
• “Frequently Asked Questions About String Arrays” on page 6-59

6-14
Analyze Text Data with String Arrays

Analyze Text Data with String Arrays


This example shows how to store text from a file as a string array, sort the words by their frequency,
plot the result, and collect basic statistics for the words found in the file.

Import Text File to String Array

Read text from Shakespeare's Sonnets with the fileread function. fileread returns the text as a
1-by-100266 character vector.

sonnets = fileread('[Link]');
sonnets(1:35)

ans =
'THE SONNETS

by William Shakespeare'

Convert the text to a string using the string function. Then, split it on newline characters using the
splitlines function. sonnets becomes a 2625-by-1 string array, where each string contains one
line from the poems. Display the first five lines of sonnets.

sonnets = string(sonnets);
sonnets = splitlines(sonnets);
sonnets(1:5)

ans = 5x1 string


"THE SONNETS"
""
"by William Shakespeare"
""
""

Clean String Array

To calculate the frequency of the words in sonnets, first clean it by removing empty strings and
punctuation marks. Then reshape it into a string array that contains individual words as elements.

Remove the strings with zero characters ("") from the string array. Compare each element of
sonnets to "", the empty string. Starting in R2017a, you can create strings, including an empty
string, using double quotes. TF is a logical vector that contains a true value wherever sonnets
contains a string with zero characters. Index into sonnets with TF and delete all strings with zero
characters.

TF = (sonnets == "");
sonnets(TF) = [];
sonnets(1:10)

ans = 10x1 string


"THE SONNETS"
"by William Shakespeare"
" I"
" From fairest creatures we desire increase,"
" That thereby beauty's rose might never die,"
" But as the riper should by time decease,"

6-15
6 Characters and Strings

" His tender heir might bear his memory:"


" But thou, contracted to thine own bright eyes,"
" Feed'st thy light's flame with self-substantial fuel,"
" Making a famine where abundance lies,"

Replace some punctuation marks with space characters. For example, replace periods, commas, and
semi-colons. Keep apostrophes because they can be part of some words in the Sonnets, such as
light's.
p = [".","?","!",",",";",":"];
sonnets = replace(sonnets,p," ");
sonnets(1:10)

ans = 10x1 string


"THE SONNETS"
"by William Shakespeare"
" I"
" From fairest creatures we desire increase "
" That thereby beauty's rose might never die "
" But as the riper should by time decease "
" His tender heir might bear his memory "
" But thou contracted to thine own bright eyes "
" Feed'st thy light's flame with self-substantial fuel "
" Making a famine where abundance lies "

Strip leading and trailing space characters from each element of sonnets.
sonnets = strip(sonnets);
sonnets(1:10)

ans = 10x1 string


"THE SONNETS"
"by William Shakespeare"
"I"
"From fairest creatures we desire increase"
"That thereby beauty's rose might never die"
"But as the riper should by time decease"
"His tender heir might bear his memory"
"But thou contracted to thine own bright eyes"
"Feed'st thy light's flame with self-substantial fuel"
"Making a famine where abundance lies"

Split sonnets into a string array whose elements are individual words. You can use the split
function to split elements of a string array on whitespace characters, or on delimiters that you
specify. However, split requires that every element of a string array must be divisible into an equal
number of new strings. The elements of sonnets have different numbers of spaces, and therefore are
not divisible into equal numbers of strings. To use the split function on sonnets, write a for-loop
that calls split on one element at a time.

Create the empty string array sonnetWords using the strings function. Write a for-loop that splits
each element of sonnets using the split function. Concatenate the output from split onto
sonnetWords. Each element of sonnetWords is an individual word from sonnets.
sonnetWords = strings(0);
for i = 1:length(sonnets)

6-16
Analyze Text Data with String Arrays

sonnetWords = [sonnetWords ; split(sonnets(i))];


end
sonnetWords(1:10)

ans = 10x1 string


"THE"
"SONNETS"
"by"
"William"
"Shakespeare"
"I"
"From"
"fairest"
"creatures"
"we"

Sort Words Based on Frequency

Find the unique words in sonnetWords. Count them and sort them based on their frequency.

To count words that differ only by case as the same word, convert sonnetWords to lowercase. For
example, The and the count as the same word. Find the unique words using the unique function.
Then, count the number of times each unique word occurs using the histcounts function.

sonnetWords = lower(sonnetWords);
[words,~,idx] = unique(sonnetWords);
numOccurrences = histcounts(idx,numel(words));

Sort the words in sonnetWords by number of occurrences, from most to least common.

[rankOfOccurrences,rankIndex] = sort(numOccurrences,'descend');
wordsByFrequency = words(rankIndex);

Plot Word Frequency

Plot the occurrences of words in the Sonnets from the most to least common words. Zipf's Law states
that the distribution of occurrences of words in a large body text follows a power-law distribution.

loglog(rankOfOccurrences);
xlabel('Rank of word (most to least common)');
ylabel('Number of Occurrences');

6-17
6 Characters and Strings

Display the ten most common words in the Sonnets.


wordsByFrequency(1:10)

ans = 10x1 string


"and"
"the"
"to"
"my"
"of"
"i"
"in"
"that"
"thy"
"thou"

Collect Basic Statistics in Table

Calculate the total number of occurrences of each word in sonnetWords. Calculate the number of
occurrences as a percentage of the total number of words, and calculate the cumulative percentage
from most to least common. Write the words and the basic statistics for them to a table.
numOccurrences = numOccurrences(rankIndex);
numOccurrences = numOccurrences';
numWords = length(sonnetWords);
T = table;
[Link] = wordsByFrequency;

6-18
Analyze Text Data with String Arrays

[Link] = numOccurrences;
[Link] = numOccurrences / numWords * 100.0;
[Link] = cumsum(numOccurrences) / numWords * 100.0;

Display the statistics for the ten most common words.

T(1:10,:)

ans=10×4 table
Words NumOccurrences PercentOfText CumulativePercentOfText
______ ______________ _____________ _______________________

"and" 490 2.7666 2.7666


"the" 436 2.4617 5.2284
"to" 409 2.3093 7.5377
"my" 371 2.0947 9.6324
"of" 370 2.0891 11.722
"i" 341 1.9254 13.647
"in" 321 1.8124 15.459
"that" 320 1.8068 17.266
"thy" 280 1.5809 18.847
"thou" 233 1.3156 20.163

The most common word in the Sonnets, and, occurs 490 times. Together, the ten most common words
account for 20.163% of the text.

See Also
histcounts | join | lower | replace | sort | split | splitlines | string | strip | table |
unique

Related Examples
• “Create String Arrays” on page 6-5
• “Search and Replace Text” on page 6-37
• “Compare Text” on page 6-32
• “Test for Empty Strings and Missing Values” on page 6-20

6-19
6 Characters and Strings

Test for Empty Strings and Missing Values


String arrays can contain both empty strings and missing values. Empty strings contain zero
characters and display as double quotes with nothing between them (""). You can determine if a
string is an empty string using the == operator. The empty string is a substring of every other string.
Therefore, functions such as contains always find the empty string within other strings. String
arrays also can contain missing values. Missing values in string arrays display as <missing>. To find
missing values in a string array, use the ismissing function instead of the == operator.

Test for Empty Strings

You can test a string array for empty strings using the == operator.

Starting in R2017a, you can create an empty string using double quotes with nothing between them
(""). Note that the size of str is 1-by-1, not 0-by-0. However, str contains zero characters.

str = ""

str =
""

Create an empty character vector using single quotes. Note that the size of chr is 0-by-0. The
character array chr actually is an empty array, and not just an array with zero characters.

chr = ''

chr =

0x0 empty char array

Create an array of empty strings using the strings function. Each element of the array is a string
with no characters.

str2 = strings(1,3)

str2 = 1x3 string


"" "" ""

Test if str is an empty string by comparing it to an empty string.

if (str == "")
disp 'str has zero characters'
end

str has zero characters

Do not use the isempty function to test for empty strings. A string with zero characters still has a
size of 1-by-1. However, you can test if a string array has at least one dimension with a size of zero
using the isempty function.

Create an empty string array using the strings function. To be an empty array, at least one
dimension must have a size of zero.

str = strings(0,3)

6-20
Test for Empty Strings and Missing Values

str =

0x3 empty string array

Test str using the isempty function.

isempty(str)

ans = logical
1

Test a string array for empty strings. The == operator returns a logical array that is the same size as
the string array.

str = ["Mercury","","Apollo"]

str = 1x3 string


"Mercury" "" "Apollo"

str == ''

ans = 1x3 logical array

0 1 0

Find Empty Strings Within Other Strings

Strings always contain the empty string as a substring. In fact, the empty string is always at both the
start and the end of every string. Also, the empty string is always found between any two consecutive
characters in a string.

Create a string. Then test if it contains the empty string.

str = "Hello, world";


TF = contains(str,"")

TF = logical
1

Test if str starts with the empty string.

TF = startsWith(str,"")

TF = logical
1

Count the number of characters in str. Then count the number of empty strings in str. The count
function counts empty strings at the beginning and end of str, and between each pair of characters.
Therefore if str has N characters, it also has N+1 empty strings.

str

str =
"Hello, world"

6-21
6 Characters and Strings

strlength(str)

ans = 12

count(str,"")

ans = 13

Replace a substring with the empty string. When you call replace with an empty string, it removes
the substring and replaces it with a string that has zero characters.

replace(str,"world","")

ans =
"Hello, "

Insert a substring after empty strings using the insertAfter function. Because there are empty
strings between each pair of characters, insertAfter inserts substrings between each pair.

insertAfter(str,"","-")

ans =
"-H-e-l-l-o-,- -w-o-r-l-d-"

In general, string functions that replace, erase, extract, or insert substrings allow you to specify
empty strings as the starts and ends of the substrings to modify. When you do so, these functions
operate on the start and end of the string, and between every pair of characters.

Test for Missing Values

You can test a string array for missing values using the ismissing function. The missing string is the
string equivalent to NaN for numeric arrays. It indicates where a string array has missing values. The
missing string displays as <missing>.

To create a missing string, convert a missing value using the string function.

str = string(missing)

str =
<missing>

You can create a string array with both empty and missing strings. Use the ismissing function to
determine which elements are strings with missing values. Note that the empty string is not a
missing string.

str(1) = "";
str(2) = "Gemini";
str(3) = string(missing)

str = 1x3 string


"" "Gemini" <missing>

ismissing(str)

ans = 1x3 logical array

0 0 1

6-22
Test for Empty Strings and Missing Values

Compare str to a missing string. The comparison is always 0 (false), even when you compare a
missing string to another missing string.

str == string(missing)

ans = 1x3 logical array

0 0 0

To find missing strings, use the ismissing function. Do not use the == operator.

See Also
all | any | contains | endsWith | eq | erase | eraseBetween | extractAfter | extractBefore
| extractBetween | insertAfter | insertBefore | ismissing | replace | replaceBetween |
startsWith | string | strings | strlength

Related Examples
• “Create String Arrays” on page 6-5
• “Analyze Text Data with String Arrays” on page 6-15
• “Search and Replace Text” on page 6-37
• “Compare Text” on page 6-32

6-23
6 Characters and Strings

Formatting Text
To convert data to text and control its format, you can use formatting operators with common
conversion functions, such as num2str and sprintf. These operators control notation, alignment,
significant digits, and so on. They are similar to those used by the printf function in the C
programming language. Typical uses for formatted text include text for display and output files.

For example, %f converts floating-point values to text using fixed-point notation. Adjust the format by
adding information to the operator, such as %.2f to represent two digits after the decimal mark, or
%12f to represent 12 characters in the output, padding with spaces as needed.

A = pi*ones(1,3);
txt = sprintf('%f | %.2f | %12f', A)

txt =
'3.141593 | 3.14 | 3.141593'

You can combine operators with ordinary text and special characters in a format specifier. For
instance, \n inserts a newline character.

txt = sprintf('Displaying pi: \n %f \n %.2f \n %12f', A)

txt =
'Displaying pi:
3.141593
3.14
3.141593'

Functions that support formatting operators are compose, num2str, sprintf, fprintf, and the
error handling functions assert, error, warning, and MException.

Fields of the Formatting Operator


A formatting operator can have six fields, as shown in the figure. From right to left, the fields are the
conversion character, subtype, precision, field width, flags, and numeric identifier. (Space characters
are not allowed in the operator. They are shown here only to improve readability of the figure.) The
conversion character is the only required field, along with the leading % character.

Conversion Character

The conversion character specifies the notation of the output. It consists of a single character and
appears last in the format specifier.

Specifier Description
c Single character.

6-24
Formatting Text

Specifier Description
d Decimal notation (signed).
e Exponential notation (using a lowercase e, as in 3.1415e+00).
E Exponential notation (using an uppercase E, as in 3.1415E+00).
f Fixed-point notation.
g The more compact of %e or %f. (Insignificant zeroes do not print.)
G Same as %g, but using an uppercase E.
o Octal notation (unsigned).
s Character vector or string array.
u Decimal notation (unsigned).
x Hexadecimal notation (unsigned, using lowercase letters a–f).
X Hexadecimal notation (unsigned, using uppercase letters A–F).

For example, format the number 46 using different conversion characters to display the number in
decimal, fixed-point, exponential, and hexadecimal formats.

A = 46*ones(1,4);
txt = sprintf('%d %f %e %X', A)

txt =
'46 46.000000 4.600000e+01 2E'

Subtype

The subtype field is a single alphabetic character that immediately precedes the conversion
character. Without the subtype field, the conversion characters %o, %x, %X, and %u treat input data as
integers. To treat input data as floating-point values instead and convert them to octal, decimal, or
hexadecimal representations, use one of following subtype specifiers.

b The input data are double-precision floating-point values rather than unsigned integers. For
example, to print a double-precision value in hexadecimal, use a format like %bx.
t The input data are single-precision floating-point values rather than unsigned integers.

Precision

The precision field in a formatting operator is a nonnegative integer that immediately follows a
period. For example, in the operator %7.3f, the precision is 3. For the %g operator, the precision
indicates the number of significant digits to display. For the %f, %e, and %E operators, the precision
indicates how many digits to display to the right of the decimal point.

Display numbers to different precisions using the precision field.

txt = sprintf('%g %.2g %f %.2f', pi*50*ones(1,4))

txt =
'157.08 1.6e+02 157.079633 157.08'

While you can specify the precision in a formatting operator for input text (for example, in the %s
operator), there is usually no reason to do so. If you specify the precision as p, and p is less than the
number of characters in the input text, then the output contains only the first p characters.

6-25
6 Characters and Strings

Field Width

The field width in a formatting operator is a nonnegative integer that specifies the number of digits or
characters in the output when formatting input values. For example, in the operator %7.3f, the field
width is 7.

Specify different field widths. To show the width for each output, use the | character. By default, the
output text is padded with space characters when the field width is greater than the number of
characters.
txt = sprintf('|%e|%15e|%f|%15f|', pi*50*ones(1,4))

txt =
'|1.570796e+02| 1.570796e+02|157.079633| 157.079633|'

When used on text input, the field width can determine whether to pad the output text with spaces. If
the field width is less than or equal to the number of characters in the input text, then it has no effect.
txt = sprintf('%30s', 'Pad left with spaces')

txt =
' Pad left with spaces'

Flags

Optional flags control additional formatting of the output text. The table describes the characters you
can use as flags.

Character Description Example


Minus sign (-) Left-justify the converted argument %-5.2d
in its field.
Plus sign (+) For numeric values, always print a %+5.2d
leading sign character (+ or -). %+5s
For text values, right-justify the
converted argument in its field.
Space Insert a space before the value. % 5.2f
Zero (0) Pad with zeroes rather than spaces. %05.2f
Pound sign (#) Modify selected numeric %#5.0f
conversions:

• For %o, %x, or %X, print 0, 0x, or


0X prefix.
• For %f, %e, or %E, print decimal
point even when precision is 0.
• For %g or %G, do not remove
trailing zeroes or decimal point.

Right- and left-justify the output. The default behavior is to right-justify the output text.
txt = sprintf('right-justify: %12.2f\nleft-justify: %-12.2f',...
12.3, 12.3)

txt =
'right-justify: 12.30

6-26
Formatting Text

left-justify: 12.30 '

Display a + sign for positive numbers. The default behavior is to omit the leading + sign for positive
numbers.

txt = sprintf('no sign: %12.2f\nsign: %+12.2f',...


12.3, 12.3)

txt =
'no sign: 12.30
sign: +12.30'

Pad to the left with spaces and zeroes. The default behavior is to pad with spaces.

txt = sprintf('Pad with spaces: %12.2f\nPad with zeroes: %012.2f',...


5.2, 5.2)

txt =
'Pad with spaces: 5.20
Pad with zeroes: 000000005.20'

Note You can specify more than one flag in a formatting operator.

Value Identifiers

By default, functions such as sprintf insert values from input arguments into the output text in
sequential order. To process the input arguments in a nonsequential order, specify the order using
numeric identifiers in the format specifier. Specify nonsequential arguments with an integer
immediately following the % sign, followed by a $ sign.

Ordered Sequentially Ordered By Identifier


sprintf('%s %s %s',... sprintf('%3$s %2$s %1$s',...
'1st','2nd','3rd') '1st','2nd','3rd')

ans = ans =

'1st 2nd 3rd' '3rd 2nd 1st'

Special Characters

Special characters can be part of the output text. But because they cannot be entered as ordinary
text, they require specific character sequences to represent them. To insert special characters into
output text, use any of the character sequences in the table.

Special Character Representation in Format


Specifier
Single quotation mark ''
Percent character %%
Backslash \\

6-27
6 Characters and Strings

Special Character Representation in Format


Specifier
Alarm \a
Backspace \b
Form feed \f
New line \n
Carriage return \r
Horizontal tab \t
Vertical tab \v
Character whose Unicode numeric value can be represented by \xN
the hexadecimal number, N
Example: sprintf('\x5A')
returns 'Z'
Character whose Unicode numeric value can be represented by \N
the octal number, N
Example: sprintf('\132')
returns 'Z'

Setting Field Width and Precision


The formatting operator follows a set of rules for formatting output text to the specified field width
and precision. You also can specify values for the field width and precision outside the format
specifier, and use numbered identifiers with the field width and precision.

Rules for Formatting Precision and Field Width

The figure illustrates how the field width and precision settings affect the output of the formatting
functions. In this figure, the zero following the % sign in the formatting operator means to add leading
zeroes to the output text rather than space characters.

• If the precision is not specified, then it defaults to six.


• If the precision p is less than the number of digits in the fractional part of the input, then only p
digits are shown after the decimal point. The fractional value is rounded in the output.
• If the precision p is greater than the number of digits f in the fractional part of the input, then p
digits are shown after the decimal point. The fractional part is extended to the right with p-f
zeroes in the output.
• If the field width is not specified, then it defaults to p+1+n, where n is the number of digits in the
whole part of the input value.

6-28
Formatting Text

• If the field width w is greater than p+1+n, then the whole part of the output value is padded to the
left with w-(p+1+n) additional characters. The additional characters are space characters unless
the formatting operator includes the 0 flag. In that case, the additional characters are zeroes.

Specify Field Width and Precision Outside Format Specifier

You can specify the field width and precision using values from a sequential argument list. Use an
asterisk (*) in place of the field width or precision fields of the formatting operator.

For example, format and display three numbers. In each case, use an asterisk to specify that the field
width or precision come from input arguments that follow the format specifier.

txt = sprintf('%*f %.*f %*.*f',...


15,123.45678,...
3,16.42837,...
6,4,pi)

txt =
' 123.456780 16.428 3.1416'

The table describes the effects of each formatting operator in the example.

Formatting Operator Description


%*f Specify width as the following input argument,
15.
%.*f Specify precision as the following input
argument, 3.
%*.*f Specify width and precision as the following input
arguments, 6, and 4.

You can mix the two styles. For example, get the field width from the following input argument and
the precision from the format specifier.

txt = sprintf('%*.2f', 5, 123.45678)

txt =
'123.46'

Specify Numbered Identifiers in Width and Precision Fields

You also can specify field width and precision as values from a nonsequential argument list, using an
alternate syntax shown in the figure. Within the formatting operator, specify the field width and
precision with asterisks that follow numbered identifiers and $ signs. Specify the values of the field
width and precision with input arguments that follow the format specifier.

For example, format and display three numbers. In each case, use a numbered identifier to specify
that the field width or precision come from input arguments that follow the format specifier.

6-29
6 Characters and Strings

txt = sprintf('%1$*4$f %2$.*5$f %3$*6$.*7$f',...


123.45678, 16.42837, pi, 15, 3, 6, 4)

txt =
' 123.456780 16.428 3.1416'

The table describes the effect of each formatting operator in the example.

Formatting Operator Description


%1$*4$f 1$ specifies the first input argument,
123.45678, as the value
*4$ specifies the fourth input argument, 15, as
the field width
%2$.*5$f 2$ specifies the second input argument,
16.42837, as the value
.*5$ specifies the fifth input argument, 3, as the
precision
%3$*6$.*7$f 3$ specifies the third input argument, pi, as the
value
*6$ specifies the sixth input argument, 6, as the
field width
.*7$ specifies the seventh input argument, 4, as
the precision

Restrictions on Using Identifiers


If any of the formatting operators include an identifier field, then all the operators in the format
specifier must include identifier fields. If you use both sequential and nonsequential ordering in the
same function call, then the output is truncated at the first switch between sequential and
nonsequential identifiers.

Valid Syntax Invalid Syntax


sprintf('%d %d %d %d',... sprintf('%d %3$d %d %d',...
1,2,3,4) 1,2,3,4)

ans = ans =

'1 2 3 4' '1 '

If your function call provides more input arguments than there are formatting operators in the format
specifier, then the operators are reused. However, only function calls that use sequential ordering
reuse formatting operators. You cannot reuse formatting operators when you use numbered
identifiers.

Valid Syntax Invalid Syntax


sprintf('%d',1,2,3,4) sprintf('%1$d',1,2,3,4)

ans = ans =

'1234' '1'

6-30
Formatting Text

If you use numbered identifiers when the input data is a vector or array, then the output does not
contain formatted data.

Valid Syntax Invalid Syntax


v = [1.4 2.7 3.1]; v = [1.4 2.7 3.1];
sprintf('%.4f %.4f %.4f',v) sprintf('%3$.4f %1$.4f %2$.4f',v)

ans = ans =

'1.4000 2.7000 3.1000' 1×0 empty char array

See Also
compose | fprintf | num2str | sprintf

Related Examples
• “Convert Text to Numeric Values” on page 6-49
• “Convert Numeric Values to Text” on page 6-45

6-31
6 Characters and Strings

Compare Text
Compare text in character arrays and string arrays in different ways. String arrays were introduced
in R2016b. You can compare string arrays and character vectors with relational operators and with
the strcmp function. You can sort string arrays using the sort function, just as you would sort
arrays of any other type. MATLAB® also provides functions to inspect characters in pieces of text.
For example, you can determine which characters in a character vector or string array are letters or
space characters.

Compare String Arrays for Equality

You can compare string arrays for equality with the relational operators == and ~=. When you
compare string arrays, the output is a logical array that has 1 where the relation is true, and 0 where
it is not true.

Create two string scalars. Starting in R2017a, you can create strings using double quotes.

str1 = "Hello";
str2 = "World";
str1,str2

str1 =
"Hello"

str2 =
"World"

Compare str1 and str2 for equality.

str1 == str2

ans = logical
0

Compare a string array with multiple elements to a string scalar.

str1 = ["Mercury","Gemini","Apollo";...
"Skylab","Skylab B","International Space Station"];
str2 = "Apollo";
str1 == str2

ans = 2x3 logical array

0 0 1
0 0 0

Compare a string array to a character vector. As long as one of the variables is a string array, you can
make the comparison.

chr = 'Gemini';
TF = (str1 == chr)

TF = 2x3 logical array

0 1 0

6-32
Compare Text

0 0 0

Index into str1 with TF to extract the string elements that matched Gemini. You can use logical
arrays to index into an array.

str1(TF)

ans =
"Gemini"

Compare for inequality using the ~= operator. Index into str1 to extract the elements that do not
match 'Gemini'.

TF = (str1 ~= chr)

TF = 2x3 logical array

1 0 1
1 1 1

str1(TF)

ans = 5x1 string


"Mercury"
"Skylab"
"Skylab B"
"Apollo"
"International Space Station"

Compare two nonscalar string arrays. When you compare two nonscalar arrays, they must be the
same size.

str2 = ["Mercury","Mars","Apollo";...
"Jupiter","Saturn","Neptune"];
TF = (str1 == str2)

TF = 2x3 logical array

1 0 1
0 0 0

Index into str1 to extract the matches.

str1(TF)

ans = 2x1 string


"Mercury"
"Apollo"

Compare String Arrays with Other Relational Operators

You can also compare strings with the relational operators >, >=, <, and <=. Strings that start with
uppercase letters come before strings that start with lowercase letters. For example, the string
"ABC" is less than "abc". Digits and some punctuation marks also come before letters.

6-33
6 Characters and Strings

"ABC" < "abc"

ans = logical
1

Compare a string array that contains names to another name with the > operator. The names
Sanchez, de Ponte, and Nash come after Matthews, because S, d, and N all are greater than M.

str = ["Sanchez","Jones","de Ponte","Crosby","Nash"];


TF = (str > "Matthews")

TF = 1x5 logical array

1 0 1 0 1

str(TF)

ans = 1x3 string


"Sanchez" "de Ponte" "Nash"

Sort String Arrays

You can sort string arrays. MATLAB® stores characters as Unicode® using the UTF-16 character
encoding scheme. Character and string arrays are sorted according to the UTF-16 code point order.
For the characters that are also the ASCII characters, this order means that uppercase letters come
before lowercase letters. Digits and some punctuation also come before letters.

Sort the string array str.

sort(str)

ans = 1x5 string


"Crosby" "Jones" "Nash" "Sanchez" "de Ponte"

Sort a 2-by-3 string array. The sort function sorts the elements in each column separately.

sort(str2)

ans = 2x3 string


"Jupiter" "Mars" "Apollo"
"Mercury" "Saturn" "Neptune"

To sort the elements in each row, sort str2 along the second dimension.

sort(str2,2)

ans = 2x3 string


"Apollo" "Mars" "Mercury"
"Jupiter" "Neptune" "Saturn"

6-34
Compare Text

Compare Character Vectors

You can compare character vectors and cell arrays of character vectors to each other. Use the
strcmp function to compare two character vectors, or strncmp to compare the first N characters.
You also can use strcmpi and strncmpi for case-insensitive comparisons.

Compare two character vectors with the strcmp function. chr1 and chr2 are not equal.

chr1 = 'hello';
chr2 = 'help';
TF = strcmp(chr1,chr2)

TF = logical
0

Note that the MATLAB strcmp differs from the C version of strcmp. The C version of strcmp
returns 0 when two character arrays are the same, not when they are different.

Compare the first two characters with the strncmp function. TF is 1 because both character vectors
start with the characters he.

TF = strncmp(chr1,chr2,2)

TF = logical
1

Compare two cell arrays of character vectors. strcmp returns a logical array that is the same size as
the cell arrays.

C1 = {'pizza'; 'chips'; 'candy'};


C2 = {'pizza'; 'chocolate'; 'pretzels'};
strcmp(C1,C2)

ans = 3x1 logical array

1
0
0

Inspect Characters in String and Character Arrays

You can inspect the characters in string arrays or character arrays with the isstrprop, isletter,
and isspace functions.

• The isstrprop inspects characters in either string arrays or character arrays.


• The isletter and isspace functions inspect characters in character arrays only.

Determine which characters in a character vector are space characters. isspace returns a logical
vector that is the same size as chr.

chr = 'Four score and seven years ago';


TF = isspace(chr)

TF = 1x30 logical array

6-35
6 Characters and Strings

0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 1 0 0 0

The isstrprop function can query characters for many different traits. isstrprop can determine
whether characters in a string or character vector are letters, alphanumeric characters, decimal or
hexadecimal digits, or punctuation characters.

Determine which characters in a string are punctuation marks. isstrprop returns a logical vector
whose length is equal to the number of characters in str.

str = "A horse! A horse! My kingdom for a horse!"

str =
"A horse! A horse! My kingdom for a horse!"

isstrprop(str,"punct")

ans = 1x41 logical array

0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0

Determine which characters in the character vector chr are letters.

isstrprop(chr,"alpha")

ans = 1x30 logical array

1 1 1 1 0 1 1 1 1 1 0 1 1 1 0 1 1 1 1 1 0 1 1 1

See Also
eq | ge | gt | isletter | isspace | isstrprop | le | lt | ne | sort | strcmp

Related Examples
• “Text in String and Character Arrays” on page 6-2
• “Create String Arrays” on page 6-5
• “Analyze Text Data with String Arrays” on page 6-15
• “Search and Replace Text” on page 6-37
• “Test for Empty Strings and Missing Values” on page 6-20

6-36
Search and Replace Text

Search and Replace Text


Since R2016b. Replaces Searching and Replacing (R2016a).

Processing text data often involves finding and replacing substrings. There are several functions that
find text and return different information: some functions confirm that the text exists, while others
count occurrences, find starting indices, or extract substrings. These functions work on character
vectors and string scalars, such as "yes", as well as character and string arrays, such as
["yes","no";"abc","xyz"]. In addition, you can use patterns to define rules for searching, such as
one or more letter or digit characters.

Search for Text

To determine if text is present, use a function that returns logical values, like contains,
startsWith, or endsWith. Logical values of 1 correspond to true, and 0 corresponds to false.

txt = "she sells seashells by the seashore";


TF = contains(txt,"sea")

TF = logical
1

Calculate how many times the text occurs using the count function.

n = count(txt,"sea")

n = 2

To locate where the text occurs, use the strfind function, which returns starting indices.

idx = strfind(txt,"sea")

idx = 1×2

11 28

Find and extract text using extraction functions, such as extract, extractBetween,
extractBefore, or extractAfter.

mid = extractBetween(txt,"sea","shore")

mid =
"shells by the sea"

Optionally, include the boundary text.

mid = extractBetween(txt,"sea","shore","Boundaries","inclusive")

mid =
"seashells by the seashore"

Find Text in Arrays

The search and replacement functions can also find text in multi-element arrays. For example, look
for color names in several song titles.

6-37
6 Characters and Strings

songs = ["Yellow Submarine";


"Penny Lane";
"Blackbird"];

colors =["Red","Yellow","Blue","Black","White"];

TF = contains(songs,colors)

TF = 3x1 logical array

1
0
1

To list the songs that contain color names, use the logical TF array as indices into the original songs
array. This technique is called logical indexing.
colorful = songs(TF)

colorful = 2x1 string


"Yellow Submarine"
"Blackbird"

Use the function replace to replace text in songs that matches elements of colors with the string
"Orange".
replace(songs,colors,"Orange")

ans = 3x1 string


"Orange Submarine"
"Penny Lane"
"Orangebird"

Match Patterns

Since R2020b

In addition to searching for literal text, like “sea” or “yellow”, you can search for text that matches a
pattern. There are many predefined patterns, such as digitsPattern to find numeric digits.
address = "123a Sesame Street, New York, NY 10128";
nums = extract(address,digitsPattern)

nums = 2x1 string


"123"
"10128"

For additional precision in searches, you can combine patterns. For example, locate words that start
with the character “S”. Use a string to specify the “S” character, and lettersPattern to find
additional letters after that character.
pat = "S" + lettersPattern;
StartWithS = extract(address,pat)

StartWithS = 2x1 string


"Sesame"

6-38
Search and Replace Text

"Street"

For more information, see “Build Pattern Expressions” on page 6-40.

See Also
extract | count | pattern | replace | strfind | contains

Related Examples
• “Text in String and Character Arrays” on page 6-2
• “Build Pattern Expressions” on page 6-40
• “Test for Empty Strings and Missing Values” on page 6-20
• “Regular Expressions” on page 2-51

6-39
6 Characters and Strings

Build Pattern Expressions


Since R2020b

Patterns are a tool to aid in searching for and modifying text. Similar to regular expressions, a
pattern defines rules for matching text. Patterns can be used with text-searching functions like
contains, matches, and extract to specify which portions of text these functions act on. You can
build a pattern expression in a way similar to how you would build a mathematical expression, using
pattern functions, operators, and literal text. Because building pattern expressions is open ended,
patterns can become quite complicated. Building patterns in steps and using functions like
maskedPattern and namedPattern can help organize complicated patterns.

Building Simple Patterns

The simplest pattern is built from a single pattern function. For example, lettersPattern matches
any letter characters. There are many pattern functions for matching different types of characters
and other features of text. A list of these functions can be found on the pattern reference page.

txt = "abc123def";
pat = lettersPattern;
extract(txt,pat)

ans = 2x1 string


"abc"
"def"

Patterns combine with other patterns and literal text by using the plus(+) operator. This operator
appends patterns and text together in the order they are defined in the pattern expression. The
combined patterns only match text in the same order. In this example, "YYYY/MM/DD" is not a match
because a four-letter string must be at the end of the text.

txt = "Dates can be expressed as MM/DD/YYYY, DD/MM/YYYY, or YYYY/MM/DD";


pat = lettersPattern(2) + "/" + lettersPattern(2) + "/" + lettersPattern(4);
extract(txt,pat)

ans = 2x1 string


"MM/DD/YYYY"
"DD/MM/YYYY"

Patterns used with the or(|) operator specify that only one of the two specified patterns needs to
match a section of text. If neither pattern is able to match then the pattern expression fails to match.

txt = "123abc";
pat = lettersPattern|digitsPattern;
extract(txt,pat)

ans = 2x1 string


"123"
"abc"

Some pattern functions take patterns as their input and modify them in some way. For example,
optionalPattern makes a specified pattern match if possible, but the pattern is not required for a
successful match.

6-40
Build Pattern Expressions

txt = ["123abc" "abc"];


pat = optionalPattern(digitsPattern) + lettersPattern;
extract(txt,pat)

ans = 1x2 string


"123abc" "abc"

Boundary Patterns

Boundary patterns are a special type of pattern that do not match characters but rather match the
boundaries between a designated character type and other characters or the start or end of that
piece of text. For example, digitBoundary matches the boundaries between digit characters and
nondigit characters and between digit characters and the start or end of the text. It does not match
digit characters themselves. Boundary patterns are useful as delimiters for functions like split.

txt = "123abc";
pat = digitBoundary;
split(txt,pat)

ans = 3x1 string


""
"123"
"abc"

Boundary patterns are special amongst patterns because they can be negated using the not(~)
operator. When negated in this way, boundary patterns match before or after characters that did not
satisfy the requirements above. For example, ~digitBoundary matches the boundary between:

• characters that are both digits


• characters that are both nondigits
• a nondigit character and the start or end of a piece of text

Use replace to mark the locations matched by ~digitBoundary with a "|" character.

txt = "123abc";
pat = ~digitBoundary;
replace(txt,pat,"|")

ans =
"1|2|3a|b|c|"

Building Complicated Patterns in Steps

Sometimes a simple pattern is not sufficient to solve a problem and a more complicated pattern is
needed. As a pattern expression grows it can become difficult to understand what it is matching. One
way to simplify building a complicated pattern is building each part of the pattern separately and
then combining the parts together into a single pattern expression.

For instance, email addresses use the form local_part@[Link]. Each of the three identifiers —
local_part, domain, and TLD — must be a combination of digits, letters and underscore characters. To
build the full pattern, start by defining a pattern for the identifiers. Build a pattern that matches one
letter or digit character or one underscore character.

identCharacters = alphanumericsPattern(1) | "_";

6-41
6 Characters and Strings

Now, use asManyOfPattern to match one or more consecutive instances of identCharacters.

identifier = asManyOfPattern(identCharacters,1);

Next, build a pattern that matches an email containing multiple identifiers.

emailPattern = identifier + "@" + identifier + "." + identifier;

Test the pattern by seeing how well it matches the following example emails.

exampleEmails = ["janedoe@[Link]"
"[Link]@[Link]"
"alberteinstein@[Link]"];
matches(exampleEmails,emailPattern)

ans = 3x1 logical array

1
0
0

The pattern fails to match several of the example emails even though all the emails are valid. Both the
local_part and domain can be made of a series of identifiers that are separated by periods. Use the
identifier pattern to build a pattern that is capable of matching a series of identifiers.
asManyOfPattern matches as many concurrent appearances of the specified pattern as possible,
but if there are none the rest of the pattern is still able to match successfully.

identifierSeries = asManyOfPattern(identifier + ".") + identifier;

Use this pattern to build a new emailPattern that can match all of the example emails.

emailPattern = identifierSeries + "@" + identifierSeries + "." + identifier;


matches(exampleEmails,emailPattern)

ans = 3x1 logical array

1
1
1

Organizing Pattern Display

Complex patterns can sometimes be difficult to read and interpret, especially by those you share
them with who are unfamiliar with the pattern's structure. For example, when displayed,
emailPattern is long and difficult to read.

emailPattern

emailPattern = pattern
Matching:

asManyOfPattern(asManyOfPattern(alphanumericsPattern(1) | "_",1) + ".") + asManyOfPattern(alp

Part of the issue with the display is that there are many repetitions of the identifier pattern. If the
exact details of this pattern are not important to users of the pattern, then the display of the

6-42
Build Pattern Expressions

identifier pattern can be concealed using maskedPattern. This function creates a new pattern
where the display of identifier is masked and the variable name, "identifier", is displayed
instead. Alternatively, you can specify a different name to be displayed. The details of patterns that
are masked in this way can be accessed by clicking "Show all details" in the displayed pattern.
identifier = maskedPattern(identifier);
identifierSeries = asManyOfPattern(identifier + ".") + identifier

identifierSeries = pattern
Matching:

asManyOfPattern(identifier + ".") + identifier

Show all details

Patterns can be further organized using the namedPattern function. namedPattern designates a
pattern as a named pattern that changes how the pattern is displayed when combined with other
patterns. Email addresses have several important portions, local_part@[Link], which each have
their own matching rules. Create a named pattern for each section.
localPart = namedPattern(identifierSeries,"local_part");

Named patterns can be nested, to further delineate parts of a pattern. To nest a named pattern, build
a pattern using named patterns and then designate that pattern as a named pattern. For example,
[Link] can be divided into the domain, subdomains, and the top level domain (TLD). Create
named patterns for each part of [Link].
subdomain = namedPattern(identifierSeries,"subdomain");
domainName = namedPattern(identifier,"domainName");
tld = namedPattern(identifier,"TLD");

Nest the named patterns for the components of domain underneath a single named pattern domain.
domain = optionalPattern(subdomain + ".") + ...
domainName + "." + ...
tld;
domain = namedPattern(domain);

Combine the patterns together into a single named pattern, emailPattern. In the display of
emailPattern you can see each named pattern and what they match as well as the information on
any nested named patterns.
emailPattern = localPart + "@" + domain

emailPattern = pattern
Matching:

local_part + "@" + domain

Using named patterns:

local_part : asManyOfPattern(identifier + ".") + identifier


domain : optionalPattern(subdomain + ".") + domainName + "." + TLD
subdomain : asManyOfPattern(identifier + ".") + identifier
domainName: identifier
TLD : identifier

6-43
6 Characters and Strings

Show all details

You can access named patterns and nested named patterns by dot-indexing into a pattern. For
example, you can access the nested named pattern subdomain by dot-indexing from emailPattern
into domain and then dot-indexing again into subdomain.

[Link]

ans = pattern
Matching:

asManyOfPattern(identifier + ".") + identifier

Show all details

Dot-assignment can be used to change named patterns without needing to rewrite the rest of the
pattern expression.

[Link] = "[Link]"

emailPattern = pattern
Matching:

local_part + "@" + domain

Using named patterns:

local_part: asManyOfPattern(identifier + ".") + identifier


domain : "[Link]"

Show all details

See Also
pattern | string | regexp | contains | replace | extract

More About
• “Search and Replace Text” on page 6-37
• “Regular Expressions” on page 2-51

6-44
Convert Numeric Values to Text

Convert Numeric Values to Text


This example shows how to convert numeric values to text and append them to larger pieces of text.
For example, you might want to add a label or title to a plot, where the label includes a number that
describes a characteristic of the plot.

Convert to Strings

Before R2016b, convert to character vectors using num2str.

To convert a number to a string that represents it, use the string function.

str = string(pi)

str =
"3.1416"

The string function converts a numeric array to a string array having the same size.

A = [256 pi 8.9e-3];
str = string(A)

str = 1x3 string


"256" "3.141593" "0.0089"

You can specify the format of the output text using the compose function, which accepts format
specifiers for precision, field width, and exponential notation.

str = compose("%9.7f",pi)

str =
"3.1415927"

If the input is a numeric array, then compose returns a string array. Return a string array that
represents numbers using exponential notation.

A = [256 pi 8.9e-3];
str = compose("%5.2e",A)

str = 1x3 string


"2.56e+02" "3.14e+00" "8.90e-03"

Add Numbers to Strings

Before R2016b, convert numbers to character vectors and concatenate characters in brackets, [].

The simplest way to combine text and numbers is to use the plus operator (+). This operator
automatically converts numeric values to strings when the other operands are strings.

For example, plot a sine wave. Calculate the frequency of the wave and add a string representing that
value in the title of the plot.

X = linspace(0,2*pi);
Y = sin(X);
plot(X,Y)

6-45
6 Characters and Strings

freq = 1/(2*pi);
str = "Sine Wave, Frequency = " + freq + " Hz"

str =
"Sine Wave, Frequency = 0.15915 Hz"

title(str)

Sometimes existing text is stored in character vectors or cell arrays of character vectors. However,
the plus operator also automatically converts those types of data to strings when another operand is
a string. To combine numeric values with those types of data, first convert the numeric values to
strings, and then use plus to combine the text.

str = 'Sine Wave, Frequency = ' + string(freq) + {' Hz'}

str =
"Sine Wave, Frequency = 0.15915 Hz"

Character Codes

If your data contains integers that represent Unicode® values, use the char function to convert the
values to the corresponding characters. The output is a character vector or array.

u = [77 65 84 76 65 66];
c = char(u)

c =
'MATLAB'

6-46
Convert Numeric Values to Text

Converting Unicode values also allows you to include special characters in text. For instance, the
Unicode value for the degree symbol is 176. To add char(176) to a string, use plus.

deg = char(176);
temp = 21;
str = "Temperature: " + temp + deg + "C"

str =
"Temperature: 21°C"

Before R2016b, use num2str to convert the numeric value to a character vector, and then
concatenate.

str = ['Temperature: ' num2str(temp) deg 'C']

str =
'Temperature: 21°C'

Hexadecimal and Binary Values

Since R2019b

You can represent hexadecimal and binary values in your code either using text or using literals. The
recommended way to represent them is to write them as literals. You can write hexadecimal and
binary literals using the 0x and 0b prefixes respectively. However, it can sometimes be useful to
represent such values as text, using the dec2hex or dec2bin functions.

For example, set a bit in a binary value. If you specify the binary value using a literal, then it is stored
as an integer. After setting one of the bits, display the new binary value as text using the dec2bin
function.

register = 0b10010110

register = uint8
150

register = bitset(register,5,0)

register = uint8
134

binStr = dec2bin(register)

binStr =
'10000110'

See Also
char | compose | dec2bin | dec2hex | plus | string

More About
• “Convert Text to Numeric Values” on page 6-49
• “Hexadecimal and Binary Values” on page 6-55
• “Convert Between Datetime Arrays, Numbers, and Text” on page 7-42
• “Formatting Text” on page 6-24

6-47
6 Characters and Strings

• “Unicode and ASCII Values” on page 6-53

6-48
Convert Text to Numeric Values

Convert Text to Numeric Values


This example shows how to convert text to the numeric values that it represents. Typically, you need
to perform such conversions when you have text that represents numbers to be plotted or used in
calculations. For example, the text might come from a text file or spreadsheet. If you did not already
convert it to numeric values when importing it into MATLAB®, you can use the functions shown in
this example.

You can convert string arrays, character vectors, and cell arrays of character vectors to numeric
values. Text can represent hexadecimal or binary values, though when you convert them to numbers
they are stored as decimal values. You can also convert text representing dates and time to
datetime or duration values, which can be treated like numeric values.

Double-Precision Values

The recommended way to convert text to double-precision values is to use the str2double function.
It can convert character vectors, string arrays, and cell arrays of character vectors.

For example, create a character vector using single quotes and convert it to the number it represents.

X = str2double('3.1416')

X = 3.1416

If the input argument is a string array or cell array of character vectors, then str2double converts
it to a numeric array having the same size. You can create strings using double quotes. (Strings have
the string data type, while character vectors have the char data type.)

str = ["2.718","3.1416";
"137","0.015"]

str = 2x2 string


"2.718" "3.1416"
"137" "0.015"

X = str2double(str)

X = 2×2

2.7180 3.1416
137.0000 0.0150

The str2double function can convert text that includes commas (as thousands separators) and
decimal points. For example, you can use str2double to convert the Balance variable in the table
below. Balance represents numbers as strings, using a comma as the thousands separator.

load balances
balances

balances=3×2 table
Customer Balance
_________ ___________

"Diaz" "13,790.00"
"Johnson" "2,456.10"

6-49
6 Characters and Strings

"Wu" "923.71"

[Link] = str2double([Link])

T=3×2 table
Customer Balance
_________ _______

"Diaz" 13790
"Johnson" 2456.1
"Wu" 923.71

If str2double cannot convert text to a number, then it returns a NaN value.

While the str2num function can also convert text to numbers, it is not recommended. str2num uses
the eval function, which can cause unintended side effects when the text input includes a function
name. To avoid these issues, use str2double.

As an alternative, you can convert strings to double-precision values using the double function. If the
input is a string array, then double returns a numeric array that has the same size, just as
str2double does. However, if the input is a character vector, then double converts the individual
characters to numbers representing their Unicode values.

X = double("3.1416")

X = 3.1416

X = double('3.1416')

X = 1×6

51 46 49 52 49 54

This list summarizes the best practices for converting text to numeric values.

• To convert text to numeric values, use the str2double function. It treats string arrays, character
vectors, and cell arrays of character vectors consistently.
• You can also use the double function for string arrays. However, it treats character vectors
differently.
• Avoid str2num. It calls the eval function which can have unintended consequences.

Hexadecimal and Binary Values

You can represent hexadecimal and binary numbers as text or as literals. When you write them as
literals, you must use the 0x and 0b prefixes. When you represent them as text and then convert
them, you can use the prefixes, but they are not required.

For example, write a hexadecimal number as a literal. The prefix is required.

D = 0x3FF

D = uint16
1023

6-50
Convert Text to Numeric Values

Then convert text representing the same value by using the hex2dec function. It recognizes the
prefix but does not require it.

D = hex2dec('3FF')

D = 1023

D = hex2dec('0x3FF')

D = 1023

Convert text representing binary values using the bin2dec function.

D = bin2dec('101010')

D = 42

D = bin2dec('0b101010')

D = 42

Dates and Times

MATLAB provides the datetime and duration data types to store dates and times, and to treat
them as numeric values. To convert text representing dates and times, use the datetime and
duration functions.

Convert text representing a date to a datetime value. The datetime function recognizes many
common formats for dates and times.

C = '2019-09-20'

C =
'2019-09-20'

D = datetime(C)

D = datetime
20-Sep-2019

You can convert arrays representing dates and times.

str = ["2019-01-31","2019-02-28","2019-03-31"]

str = 1x3 string


"2019-01-31" "2019-02-28" "2019-03-31"

D = datetime(str)

D = 1x3 datetime
31-Jan-2019 28-Feb-2019 31-Mar-2019

If you convert text to duration values, then use the hh:mm:ss or dd:hh:mm:ss formats.

D = duration('12:34:56')

6-51
6 Characters and Strings

D = duration
12:34:56

See Also
bin2dec | datetime | double | duration | hex2dec | str2double | table

More About
• “Convert Numeric Values to Text” on page 6-45
• “Convert Between Datetime Arrays, Numbers, and Text” on page 7-42
• “Hexadecimal and Binary Values” on page 6-55
• “Formatting Text” on page 6-24
• “Unicode and ASCII Values” on page 6-53

6-52
Unicode and ASCII Values

Unicode and ASCII Values


MATLAB® stores all characters as Unicode® characters using the UTF-16 encoding, where every
character is represented by a numeric code value. (Unicode incorporates the ASCII character set as
the first 128 symbols, so ASCII characters have the same numeric codes in Unicode and ASCII.) Both
character arrays and string arrays use this encoding. You can convert characters to their numeric
code values by using various numeric conversion functions. You can convert numbers to characters
using the char function.

Convert Characters to Numeric Code Values

You can convert characters to integers that represent their Unicode code values. To convert a single
character or a character array, use any of these functions:

• double
• uint16, uint32, or uint64

The best practice is to use the double function. However, if you need to store the numeric values as
integers, use unsigned integers having at least 16 bits because MATLAB uses the UTF-16 encoding.

Convert a character vector to Unicode code values using the double function.

C = 'MATLAB'

C =
'MATLAB'

unicodeValues = double(C)

unicodeValues = 1×6

77 65 84 76 65 66

You cannot convert characters in a string array directly to Unicode code values. In particular, the
double function converts strings to the numbers they represent, just as the str2double function
does. If double cannot convert a string to a number, then it returns a NaN value.

str = "MATLAB";
double(str)

ans = NaN

To convert characters in a string, first convert the string to a character vector, or use curly braces to
extract the characters. Then convert the characters using a function such as double.

C = char(str);
unicodeValues = double(C)

unicodeValues = 1×6

77 65 84 76 65 66

Convert Numeric Code Values to Characters

You can convert Unicode values to characters using the char function.

6-53
6 Characters and Strings

D = [77 65 84 76 65 66]

D = 1×6

77 65 84 76 65 66

C = char(D)

C =
'MATLAB'

A typical use for char is to create characters you cannot type and append them to strings. For
example, create the character for the degree symbol and append it to a string. The Unicode code
value for the degree symbol is 176.

deg = char(176)

deg =
'°'

myLabel = append("Current temperature is 21",deg,"C")

myLabel =
"Current temperature is 21°C"

For more information on Unicode, including mappings between characters and code values, see
Unicode.

See Also
char | double | int16 | int32 | int64 | int8 | single | string | uint16 | uint32 | uint64 |
uint8

More About
• “Convert Text to Numeric Values” on page 6-49
• “Convert Numeric Values to Text” on page 6-45

External Websites
• Unicode

6-54
Hexadecimal and Binary Values

Hexadecimal and Binary Values


You can represent numbers as hexadecimal or binary values. In some contexts, these representations
of numbers are more convenient. For example, you can represent the bits of a hardware register
using binary values. In MATLAB®, there are two ways to represent hexadecimal and binary values:

• As literals. Starting in R2019b, you can write hexadecimal and binary values as literals using an
appropriate prefix as notation. For example, 0x2A is a literal that specifies 42—and MATLAB
stores it as a number, not as text.
• As strings or character vectors. For example, the character vector '2A' represents the number 42
as a hexadecimal value. When you represent a hexadecimal or binary value using text, enclose it
in quotation marks. MATLAB stores this representation as text, not a number.

MATLAB provides several functions for converting numbers to and from their hexadecimal and binary
representations.

Write Integers Using Hexadecimal and Binary Notation

Hexadecimal literals start with a 0x or 0X prefix, while binary literals start with a 0b or 0B prefix.
MATLAB stores the number written with this notation as an integer. For example, these two literals
both represent the integer 42.

A = 0x2A

A = uint8
42

B = 0b101010

B = uint8
42

Do not use quotation marks when you write a number using this notation. Use 0-9, A-F, and a-f to
represent hexadecimal digits. Use 0 and 1 to represent binary digits.

By default, MATLAB stores the number as the smallest unsigned integer type that can accommodate
it. However, you can use an optional suffix to specify the type of integer that stores the value.

• To specify unsigned 8-, 16-, 32-, and 64-bit integer types, use the suffixes u8, u16, u32, and u64.
• To specify signed 8-, 16-, 32-, and 64-bit integer types, use the suffixes s8, s16, s32, and s64.

For example, write a hexadecimal literal to be stored as a signed 32-bit integer.

A = 0x2As32

A = int32
42

When you specify signed integer types, you can write literals that represent negative numbers.
Represent negative numbers in two's complement form. For example, specify a negative number with
a literal using the s8 suffix.

A = 0xFFs8

A = int8
-1

6-55
6 Characters and Strings

Since MATLAB stores these literals as numbers, you can use them in any context or function where
you use numeric arrays.

Represent Hexadecimal and Binary Values as Text

You can also convert integers to character vectors that represent them as hexadecimal or binary
values using the dec2hex and dec2bin functions. Convert an integer to hexadecimal.

hexStr = dec2hex(255)

hexStr =
'FF'

Convert an integer to binary.

binStr = dec2bin(16)

binStr =
'10000'

Since these functions produce text, use them when you need text that represents numeric values. For
example, you can append these values to a title or a plot label, or write them to a file that stores
numbers as their hexadecimal or binary representations.

Represent Arrays of Hexadecimal Values as Text

The recommended way to convert an array of numbers to text is to use the compose function. This
function returns a string array having the same size as the input numeric array. To produce
hexadecimal format, use %X as the format specifier.

A = [255 16 12 1024 137]

A = 1×5

255 16 12 1024 137

hexStr = compose("%X",A)

hexStr = 1x5 string


"FF" "10" "C" "400" "89"

The dec2hex and dec2bin functions also convert arrays of numbers to text representing them as
hexadecimal or binary values. However, these functions return character arrays, where each row
represents a number from the input numeric array, padded with zeros as necessary.

Convert Binary Representations to Hexadecimal

To convert a binary value to hexadecimal, start with a binary literal, and convert it to text
representing its hexadecimal value. Since a literal is interpreted as a number, you can specify it
directly as the input argument to dec2hex.

D = 0b1111;
hexStr = dec2hex(D)

hexStr =
'F'

6-56
Hexadecimal and Binary Values

If you start with a hexadecimal literal, then you can convert it to text representing its binary value
using dec2bin.

D = 0x8F;
binStr = dec2bin(D)

binStr =
'10001111'

Bitwise Operations with Binary Values

One typical use of binary numbers is to represent bits. For example, many devices have registers that
provide access to a collection of bits representing data in memory or the status of the device. When
working with such hardware you can use numbers in MATLAB to represent the value in a register.
Use binary values and bitwise operations to represent and access particular bits.

Create a number that represents an 8-bit register. It is convenient to start with binary representation,
but the number is stored as an integer.

register = 0b10010110

register = uint8
150

To get or set the values of particular bits, use bitwise operations. For example, use the bitand and
bitshift functions to get the value of the fifth bit. (Shift that bit to the first position so that
MATLAB returns a 0 or 1. In this example, the fifth bit is a 1.)

b5 = bitand(register,0b10000);
b5 = bitshift(b5,-4)

b5 = uint8
1

To flip the fifth bit to 0, use the bitset function.

register = bitset(register,5,0)

register = uint8
134

Since register is an integer, use the dec2bin function to display all the bits in binary format.
binStr is a character vector, and represents the binary value without a leading 0b prefix.

binStr = dec2bin(register)

binStr =
'10000110'

See Also
bin2dec | bitand | bitset | bitshift | dec2bin | dec2hex | hex2dec | sprintf | sscanf

More About
• “Convert Text to Numeric Values” on page 6-49
• “Convert Numeric Values to Text” on page 6-45

6-57
6 Characters and Strings

• “Formatting Text” on page 6-24


• “Bit-Wise Operations” on page 2-38
• “Perform Cyclic Redundancy Check” on page 2-44

External Websites
• Two's Complement

6-58
Frequently Asked Questions About String Arrays

Frequently Asked Questions About String Arrays


MATLAB introduced the string data type in R2016b. Starting in R2018b, you can use string arrays
to work with text throughout MathWorks products. String arrays store pieces of text and provide a
set of functions for working with text as data. You can index into, reshape, and concatenate strings
arrays just as you can with arrays of any other type. For more information, see “Create String Arrays”
on page 6-5.

In most respects, strings arrays behave like character vectors and cell arrays of character vectors.
However, there are a few key differences between string arrays and character arrays that can lead to
results you might not expect. For each of these differences, there is a recommended way to use
strings that leads to the expected result.

Why Does Using Command Form With Strings Return An Error?


When you use functions such as the cd, dir, copyfile, or load functions in command form, avoid
using double quotes. In command form, arguments enclosed in double quotes can result in errors. To
specify arguments as strings, use functional form.

With command syntax, you separate inputs with spaces rather than commas, and you do not enclose
input arguments in parentheses. For example, you can use the cd function with command syntax to
change folders.
cd C:\Temp

The text C:\Temp is a character vector. In command form, all arguments are always character
vectors. If you have an argument, such as a folder name, that contains spaces, then specify it as one
input argument by enclosing it in single quotes.
cd 'C:\Program Files'

But if you specify the argument using double quotes, then cd throws an error.
cd "C:\Program Files"

Error using cd
Too many input arguments.

The error message can vary depending on the function that you use and the arguments that you
specify. For example, if you use the load function with command syntax and specify the argument
using double quotes, then load throws a different error.
load "[Link]"

Error using load


Unable to read file '"[Link]"': Invalid argument.

In command form, double quotes are treated as part of the literal text rather than as the string
construction operator. If you wrote the equivalent of cd "C:\Program Files" in functional form,
then it would look like a call to cd with two arguments.
cd('"C:\Program','Files"')

When specifying arguments as strings, use function syntax. All functions that support command
syntax also support function syntax. For example, you can use cd with function syntax and input
arguments that are double quoted strings.

6-59
6 Characters and Strings

cd("C:\Program Files")

Why Do Strings in Cell Arrays Return an Error?


When you have multiple strings, store them in a string array, not a cell array. Create a string array
using square brackets, not curly braces. String arrays are more efficient than cell arrays for storing
and manipulating text.

str = ["Venus","Earth","Mars"]

str = 1×3 string array


"Venus" "Earth" "Mars"

Avoid using cell arrays of strings. When you use cell arrays, you give up the performance advantages
that come from using string arrays. And in fact, most functions do not accept cell arrays of strings as
input arguments, options, or values of name-value pairs. For example, if you specify a cell array of
strings as an input argument, then the contains function throws an error.

C = {"Venus","Earth","Mars"}

C = 1×3 cell array


{["Venus"]} {["Earth"]} {["Mars"]}

TF = contains(C,"Earth")

Error using contains


First argument must be a string array, character vector, or cell array of character vectors.

Instead, specify the argument as a string array.

str = ["Venus","Earth","Mars"];
TF = contains(str,"Earth");

Before R2016b, the term "cell array of strings" meant a cell array whose elements all contain
character vectors. But it is more precise to refer to such cell arrays as "cell arrays of character
vectors," to distinguish them from string arrays.

Cell arrays can contain variables having any data types, including strings. It is still possible to create
a cell array whose elements all contain strings. And if you already have specified cell arrays of
character vectors in your code, then replacing single quotes with double quotes might seem like a
simple update. However, it is not recommended that you create or use cell arrays of strings.

Why Does length() of String Return 1?


It is common to use the length function to determine the number of characters in a character vector.
But to determine the number of characters in a string, use the strlength function, not length.

Create a character vector using single quotes. To determine its length, use the length function.
Because C is a vector, its length is equal to the number of characters. C is a 1-by-11 vector.

C = 'Hello world';
L = length(C)

L = 11

6-60
Frequently Asked Questions About String Arrays

Create a string with the same characters, using double quotes. Though it stores 11 characters, str is
a 1-by-1 string array, or string scalar. If you call length on a string scalar, then the output argument is
1, no matter how many characters it stores.

str = "Hello World";


L = length(str)

L = 1

To determine the number of characters in a string, use the strlength function, introduced in
R2016b. For compatibility, strlength operates on character vectors as well. In both cases
strlength returns the number of characters.

L = strlength(C)

L = 11

L = strlength(str)

L = 11

You also can use strlength on string arrays containing multiple strings and on cell arrays of
character vectors.

The length function returns the size of the longest dimension of an array. For a string array, length
returns the number of strings along the longest dimension of the array. It does not return the number
of characters within strings.

Why Does isempty("") Return 0?


A string can have no characters at all. Such a string is an empty string. You can specify an empty
string using an empty pair of double quotes.

L = strlength("")

L = 0

However, an empty string is not an empty array. An empty string is a string scalar that happens to
have no characters.

sz = size("")

sz = 1×2
1 1

If you call isempty on an empty string, then it returns 0 (false) because the string is not an empty
array.

tf = isempty("")

tf = logical
0

However, if you call isempty on an empty character array, then it returns 1 (true). A character
array specified as a empty pair of single quotes, '', is a 0-by-0 character array.

tf = isempty('')

6-61
6 Characters and Strings

tf = logical
1

To test whether a piece of text has no characters, the best practice is to use the strlength function.
You can use the same call whether the input is a string scalar or a character vector.

str = "";
if strlength(str) == 0
disp('String has no text')
end

String has no text

chr = '';
if strlength(chr) == 0
disp('Character vector has no text')
end

Character vector has no text

Why Does Appending Strings Using Square Brackets Return Multiple


Strings?
You can append text to a character vector using square brackets. But if you add text to a string array
using square brackets, then the new text is concatenated as new elements of the string array. To
append text to strings, use the plus operator or the strcat function.

For example, if you concatenate two strings, then the result is a 1-by-2 string array.

str = ["Hello" "World"]

str = 1×2 string array


"Hello" "World"

However, if you concatenate two character vectors, then the result is a longer character vector.

str = ['Hello' 'World']

chr = 'HelloWorld'

To append text to a string (or to the elements of a string array), use the plus operator instead of
square brackets.

str = "Hello" + "World"

str = "HelloWorld"

As an alternative, you can use the strcat function. strcat appends text whether the input
arguments are strings or character vectors.

str = strcat("Hello","World")

str = "HelloWorld"

Whether you use square brackets, plus, or strcat, you can specify an arbitrary number of
arguments. Append a space character between Hello and World.

str = "Hello" + " " + "World"

6-62
Frequently Asked Questions About String Arrays

str = "Hello World"

See Also
cd | contains | copyfile | dir | isempty | length | load | plus | size | sprintf | strcat |
string | strlength

Related Examples
• “Create String Arrays” on page 6-5
• “Test for Empty Strings and Missing Values” on page 6-20
• “Compare Text” on page 6-32
• “Update Your Code to Accept Strings” on page 6-64

6-63
6 Characters and Strings

Update Your Code to Accept Strings


In R2016b, MATLAB introduced string arrays as a data type for text. As of R2018b, all MathWorks
products are compatible with string arrays. Compatible means that if you can specify text as a
character vector or a cell array of character vectors, then you also can specify it as a string array.
Now you can adopt string arrays as a text data type in your own code.

If you write code for other MATLAB users, then it is to your advantage to update your API to accept
string arrays, while maintaining backward compatibility with other text data types. String adoption
makes your code consistent with MathWorks products.

If your code has few dependencies, or if you are developing new code, then consider using string
arrays as your primary text data type for better performance. In that case, best practice is to write or
update your API to accept input arguments that are character vectors, cell arrays of character
vectors, or string arrays.

For the definitions of string array and other terms, see “Terminology for Character and String Arrays”
on page 6-70.

What Are String Arrays?


In MATLAB, you can store text data in two ways. One way is to use a character array, which is a
sequence of characters, just as a numeric array is a sequence of numbers. Or, starting in R2016b, the
other way is to store a sequence of characters in a string. You can store multiple strings in a string
array. For more information, see “Characters and Strings”.

Recommended Approaches for String Adoption in Old APIs


When your code has many dependencies, and you must maintain backward compatibility, follow these
approaches for updating functions and classes to present a compatible API.

Functions

• Accept string arrays as input arguments.

• If an input argument can be either a character vector or a cell array of character vectors, then
update your code so that the argument also can be a string array. For example, consider a
function that has an input argument you can specify as a character vector (using single
quotes). Best practice is to update the function so that the argument can be specified as either
a character vector or a string scalar (using double quotes).
• Accept strings as both names and values in name-value pair arguments.

• In name-value pair arguments, allow names to be specified as either character vectors or


strings—that is, with either single or double quotes around the name. If a value can be a
character vector or cell array of character vectors, then update your code so that it also can be
a string array.
• Do not accept cell arrays of string arrays for text input arguments.

• A cell array of string arrays has a string array in each cell. For example, {"hello","world"}
is a cell array of string arrays. While you can create such a cell array, it is not recommended
for storing text. The elements of a string array have the same data type and are stored

6-64
Update Your Code to Accept Strings

efficiently. If you store strings in a cell array, then you lose the advantages of using a string
array.

However, if your code accepts heterogeneous cell arrays as inputs, then consider accepting cell
arrays that contain strings. You can convert any strings in such a cell array to character
vectors.
• In general, do not change the output type.

• If your function returns a character vector or cell array of character vectors, then do not
change the output type, even if the function accepts string arrays as inputs. For example, the
fileread function accepts an input file name specified as either a character vector or a
string, but the function returns the file contents as a character vector. By keeping the output
type the same, you can maintain backward compatibility.
• Return the same data type when the function modifies input text.

• If your function modifies input text and returns the modified text as the output argument, then
the input and output arguments should have the same data type. For example, the lower
function accepts text as the input argument, converts it to all lowercase letters, and returns it.
If the input argument is a character vector, then lower returns a character vector. If the input
is a string array, then lower returns a string array.
• Consider adding a 'TextType' argument to import functions.

• If your function imports data from files, and at least some of that data can be text, then
consider adding an input argument that specifies whether to return text as a character array or
a string array. For example, the readtable function provides the 'TextType' name-value
pair argument. This argument specifies whether readtable returns a table with text in cell
arrays of character vectors or string arrays.

Classes

• Treat methods as functions.

• For string adoption, treat methods as though they are functions. Accept string arrays as input
arguments, and in general, do not change the data type of the output arguments, as described
in the previous section.
• Do not change the data types of properties.

• If a property is a character vector or a cell array of character vectors, then do not change its
type. When you access such a property, the value that is returned is still a character vector or a
cell array of character vectors.

As an alternative, you can add a new property that is a string, and make it dependent on the
old property to maintain compatibility.
• Set properties using string arrays.

• If you can set a property using a character vector or cell array of character vectors, then
update your class to set that property using a string array too. However, do not change the
data type of the property. Instead, convert the input string array to the data type of the
property, and then set the property.
• Add a string method.

6-65
6 Characters and Strings

• If your class already has a char and/or a cellstr method, then add a string method. If you
can represent an object of your class as a character vector or cell array of character vectors,
then represent it as a string array too.

How to Adopt String Arrays in Old APIs


You can adopt strings in old APIs by accepting string arrays as input arguments, and then converting
them to character vectors or cell arrays of character vectors. If you perform such a conversion at the
start of a function, then you do not need to update the rest of it.

The convertStringsToChars function provides a way to process all input arguments, converting
only those arguments that are string arrays. To enable your existing code to accept string arrays as
inputs, add a call to convertStringsToChars at the beginnings of your functions and methods.

For example, if you have defined a function myFunc that accepts three input arguments, process all
three inputs using convertStringsToChars. Leave the rest of your code unaltered.

function y = myFunc(a,b,c)
[a,b,c] = convertStringsToChars(a,b,c);
<line 1 of original code>
<line 2 of original code>
...

In this example, the arguments [a,b,c] overwrite the input arguments in place. If any input
argument is not a string array, then it is unaltered.

If myFunc accepts a variable number of input arguments, then process all the arguments specified by
varargin.

function y = myFunc(varargin)
[varargin{:}] = convertStringsToChars(varargin{:});
...

Performance Considerations

The convertStringsToChars function is more efficient when converting one input argument. If
your function is performance sensitive, then you can convert input arguments one at a time, while
still leaving the rest of your code unaltered.

function y = myFunc(a,b,c)
a = convertStringsToChars(a);
b = convertStringsToChars(b);
c = convertStringsToChars(c);
...

Recommended Approaches for String Adoption in New Code


When your code has few dependencies, or you are developing entirely new code, consider using
strings arrays as the primary text data type. String arrays provide good performance and efficient
memory usage when working with large amounts of text. Unlike cell arrays of character vectors,
string arrays have a homogeneous data type. String arrays make it easier to write maintainable code.
To use string arrays while maintaining backward compatibility to other text data types, follow these
approaches.

6-66
Update Your Code to Accept Strings

Functions

• Accept any text data types as input arguments.

• If an input argument can be a string array, then also allow it to be a character vector or cell
array of character vectors.
• Accept character arrays as both names and values in name-value pair arguments.

• In name-value pair arguments, allow names to be specified as either character vectors or


strings—that is, with either single or double quotes around the name. If a value can be a string
array, then also allow it to be a character vector or cell array of character vectors.
• Do not accept cell arrays of string arrays for text input arguments.

• A cell array of string arrays has a string array in each cell. While you can create such a cell
array, it is not recommended for storing text. If your code uses strings as the primary text data
type, store multiple pieces of text in a string array, not a cell array of string arrays.

However, if your code accepts heterogeneous cell arrays as inputs, then consider accepting cell
arrays that contain strings.
• In general, return strings.

• If your function returns output arguments that are text, then return them as string arrays.
• Return the same data type when the function modifies input text.

• If your function modifies input text and returns the modified text as the output argument, then
the input and output arguments should have the same data type.

Classes

• Treat methods as functions.

• Accept character vectors and cell arrays of character vectors as input arguments, as described
in the previous section. In general, return strings as outputs.
• Specify properties as string arrays.

• If a property contains text, then set the property using a string array. When you access the
property, return the value as a string array.

How to Maintain Compatibility in New Code


When you write new code, or modify code to use string arrays as the primary text data type, maintain
backward compatibility with other text data types. You can accept character vectors or cell arrays of
character vectors as input arguments, and then immediately convert them to string arrays. If you
perform such a conversion at the start of a function, then the rest of your code can use string arrays
only.

The convertCharsToStrings function provides a way to process all input arguments, converting
only those arguments that are character vectors or cell arrays of character vectors. To enable your
new code to accept these text data types as inputs, add a call to convertCharsToStrings at the
beginnings of your functions and methods.

For example, if you have defined a function myFunc that accepts three input arguments, process all
three inputs using convertCharsToStrings.

6-67
6 Characters and Strings

function y = myFunc(a,b,c)
[a,b,c] = convertCharsToStrings(a,b,c);
<line 1 of original code>
<line 2 of original code>
...

In this example, the arguments [a,b,c] overwrite the input arguments in place. If any input
argument is not a character vector or cell array of character vectors, then it is unaltered.

If myFunc accepts a variable number of input arguments, then process all the arguments specified by
varargin.

function y = myFunc(varargin)
[varargin{:}] = convertCharsToStrings(varargin{:});
...

Performance Considerations

The convertCharsToStrings function is more efficient when converting one input argument. If
your function is performance sensitive, then you can convert input arguments one at a time, while
still leaving the rest of your code unaltered.

function y = myFunc(a,b,c)
a = convertCharsToStrings(a);
b = convertCharsToStrings(b);
c = convertCharsToStrings(c);
...

How to Manually Convert Input Arguments


If it is at all possible, avoid manual conversion of input arguments that contain text, and instead use
the convertStringsToChars or convertCharsToStrings functions. Checking the data types of
input arguments and converting them yourself is a tedious approach, prone to errors.

If you must convert input arguments, then use the functions in this table.

Conversion Function
String scalar to character vector char
String array to cell array of character vectors cellstr
Character vector to string scalar string
Cell array of character vectors to string array string

How to Check Argument Data Types


To check the data type of an input argument that could contain text, consider using the patterns
shown in this table.

Required Input Argument Old Check New Check


Type
Character vector or string ischar(X) ischar(X) ||
scalar isStringScalar(X)

6-68
Update Your Code to Accept Strings

Required Input Argument Old Check New Check


Type
validateattributes(X,
{'char','string'},
{'scalartext'})
Character vector or string validateattributes(X, validateattributes(X,
scalar {'char'},{'row'}) {'char','string'},
{'scalartext'})
Nonempty character vector or ischar(X) && ~isempty(X) (ischar(X) ||
string scalar isStringScalar(X)) &&
strlength(X) ~= 0
(ischar(X) ||
isStringScalar(X)) && X
~= ""
Cell array of character vectors iscellstr(X) iscellstr(X) ||
or string array isstring(X)
Any text data type ischar(X) || ischar(X) ||
iscellstr(X) iscellstr(X) ||
isstring(X)

Check for Empty Strings

An empty string is a string with no characters. MATLAB displays an empty string as a pair of double
quotes with nothing between them (""). However, an empty string is still a 1-by-1 string array. It is
not an empty array.

The recommended way to check whether a string is empty is to use the strlength function.

str = "";
tf = (strlength(str) ~= 0)

Note Do not use the isempty function to check for an empty string. An empty string has no
characters but is still a 1-by-1 string array.

The strlength function returns the length of each string in a string array. If the string must be a
string scalar, and also not empty, then check for both conditions.

tf = (isStringScalar(str) && strlength(str) ~= 0)

If str could be either a character vector or string scalar, then you still can use strlength to
determine its length. strlength returns 0 if the input argument is an empty character vector ('').

tf = ((ischar(str) || isStringScalar(str)) && strlength(str) ~= 0)

Check for Empty String Arrays

An empty string array is, in fact, an empty array—that is, an array that has at least one dimension
whose length is 0.

6-69
6 Characters and Strings

The recommended way to create an empty string array is to use the strings function, specifying 0
as at least one of the input arguments. The isempty function returns 1 when the input is an empty
string array.

str = strings(0);
tf = isempty(str)

The strlength function returns a numeric array that is the same size as the input string array. If the
input is an empty string array, then strlength returns an empty array.

str = strings(0);
L = strlength(str)

Check for Missing Strings

String arrays also can contain missing strings. The missing string is the string equivalent to NaN for
numeric arrays. It indicates where a string array has missing values. The missing string displays as
<missing>, with no quotation marks.

You can create missing strings using the missing function. The recommended way to check for
missing strings is to use the ismissing function.

str = string(missing);
tf = ismissing(str)

Note Do not check for missing strings by comparing a string to the missing string.

The missing string is not equal to itself, just as NaN is not equal to itself.

str = string(missing);
f = (str == missing)

Terminology for Character and String Arrays


MathWorks documentation uses these terms to describe character and string arrays. For consistency,
use these terms in your own documentation, error messages, and warnings.

• Character vector — 1-by-n array of characters, of data type char.


• Character array — m-by-n array of characters, of data type char.
• Cell array of character vectors — Cell array in which each cell contains a character vector.
• String or string scalar — 1-by-1 string array. A string scalar can contain a 1-by-n sequence of
characters, but is itself one object. Use the terms "string scalar" and "character vector" alongside
each other when to be precise about size and data type. Otherwise, you can use the term "string"
in descriptions.
• String vector — 1-by-n or n-by-1 string array. If only one size is possible, then use it in your
description. For example, use "1-by-n string array" to describe an array of that size.
• String array — m-by-n string array.
• Empty string — String scalar that has no characters.
• Empty string array — String array with at least one dimension whose size is 0.
• Missing string — String scalar that is the missing value (displays as <missing>).

6-70
Update Your Code to Accept Strings

See Also
cellstr | char | convertCharsToStrings | convertContainedStringsToChars |
convertStringsToChars | isStringScalar | iscellstr | ischar | isstring | string |
strings | strlength | validateattributes

More About
• “Create String Arrays” on page 6-5
• “Test for Empty Strings and Missing Values” on page 6-20
• “Compare Text” on page 6-32
• “Search and Replace Text” on page 6-37
• “Frequently Asked Questions About String Arrays” on page 6-59

6-71
6 Characters and Strings

Function Summary
MATLAB provides these functions for working with character arrays:

• Functions to Create Character Arrays


• Functions to Modify Character Arrays
• Functions to Read and Operate on Character Arrays
• Functions to Search or Compare Character Arrays
• Functions to Determine Class or Content
• Functions to Convert Between Numeric and Text Data Types
• Functions to Work with Cell Arrays of Character Vectors as Sets

Functions to Create Character Arrays

Function Description
'chr' Create the character vector specified between quotes.
blanks Create a character vector of blanks.
sprintf Write formatted data as text.
strcat Concatenate character arrays.
char Concatenate character arrays vertically.

Functions to Modify Character Arrays

Function Description
deblank Remove trailing blanks.
lower Make all letters lowercase.
sort Sort elements in ascending or descending order.
strjust Justify a character array.
strrep Replace text within a character array.
strtrim Remove leading and trailing white space.
upper Make all letters uppercase.

Functions to Read and Operate on Character Arrays

Function Description
eval Execute a MATLAB expression.
sscanf Read a character array under format control.

6-72
Function Summary

Functions to Search or Compare Character Arrays

Function Description
regexp Match regular expression on page 2-51.
strcmp Compare character arrays.
strcmpi Compare character arrays, ignoring case.
strfind Find a term within a character vector.
strncmp Compare the first N characters of character arrays.
strncmpi Compare the first N characters, ignoring case.
strtok Find a token in a character vector.
textscan Read data from a character array.

Functions to Determine Class or Content

Function Description
iscellstr Return true for a cell array of character vectors.
ischar Return true for a character array.
isletter Return true for letters of the alphabet.
isstrprop Determine if a string is of the specified category.
isspace Return true for white-space characters.

Functions to Convert Between Numeric and Text Data Types

Function Description
char Convert to a character array.
cellstr Convert a character array to a cell array of character vectors.
double Convert a character array to numeric codes.
int2str Represent an integer as text.
mat2str Convert a matrix to a character array you can run eval on.
num2str Represent a number as text.
str2num Convert a character vector to the number it represents.
str2double Convert a character vector to the double-precision value it represents.

Functions to Work with Cell Arrays of Character Vectors as Sets

Function Description
intersect Set the intersection of two vectors.
ismember Detect members of a set.
setdiff Return the set difference of two vectors.
setxor Set the exclusive OR of two vectors.
union Set the union of two vectors.
unique Set the unique elements of a vector.

6-73
7

Dates and Time

• “Represent Dates and Times in MATLAB” on page 7-2


• “Specify Time Zones” on page 7-5
• “Convert Date and Time to Julian Date or POSIX Time” on page 7-7
• “Set Date and Time Display Format” on page 7-10
• “Generate Sequence of Dates and Time” on page 7-14
• “Share Code and Data Across Locales” on page 7-20
• “Extract or Assign Date and Time Components of Datetime Array” on page 7-23
• “Combine Date and Time from Separate Variables” on page 7-26
• “Date and Time Arithmetic” on page 7-28
• “Compare Dates and Time” on page 7-33
• “Plot Dates and Durations” on page 7-36
• “Core Functions Supporting Date and Time Arrays” on page 7-41
• “Convert Between Datetime Arrays, Numbers, and Text” on page 7-42
• “Carryover in Date Vectors and Strings” on page 7-47
• “Converting Date Vector Returns Unexpected Output” on page 7-48
7 Dates and Time

Represent Dates and Times in MATLAB


The primary way to store date and time information is in datetime arrays, which support arithmetic,
sorting, comparisons, plotting, and formatted display. The results of arithmetic differences are
returned in duration arrays or, when you use calendar-based functions, in calendarDuration
arrays.

For example, create a MATLAB datetime array that represents two dates: June 28, 2014 at 6 a.m. and
June 28, 2014 at 7 a.m. Specify numeric values for the year, month, day, hour, minute, and second
components for the datetime.

t = datetime(2014,6,28,6:7,0,0)

t =
28-Jun-2014 06:00:00 28-Jun-2014 07:00:00

Change the value of a date or time component by assigning new values to the properties of the
datetime array. For example, change the day number of each datetime by assigning new values to the
Day property.

[Link] = 27:28

t =

27-Jun-2014 06:00:00 28-Jun-2014 07:00:00

Change the display format of the array by changing its Format property. The following format does
not display any time components. However, the values in the datetime array do not change.

[Link] = 'MMM dd, yyyy'

t =
Jun 27, 2014 Jun 28, 2014

If you subtract one datetime array from another, the result is a duration array in units of fixed
length.

t2 = datetime(2014,6,29,6,30,45)

t2 =

29-Jun-2014 06:30:45

d = t2 - t

d =

48:30:45 23:30:45

By default, a duration array displays in the format, hours:minutes:seconds. Change the display
format of the duration by changing its Format property. You can display the duration value with a
single unit, such as hours.

[Link] = 'h'

d =

48.512 hrs 23.512 hrs

7-2
Represent Dates and Times in MATLAB

You can create a duration in a single unit using the seconds, minutes, hours, days, or years
functions. For example, create a duration of 2 days, where each day is exactly 24 hours.

d = days(2)

d =
2 days

You can create a calendar duration in a single unit of variable length. For example, one month can be
28, 29, 30, or 31 days long. Specify a calendar duration of 2 months.

L = calmonths(2)

L =
2mo

Use the caldays, calweeks, calquarters, and calyears functions to specify calendar durations
in other units.

Add a number of calendar months and calendar days. The number of days remains separate from the
number of months because the number of days in a month is not fixed, and cannot be determined
until you add the calendar duration to a specific datetime.

L = calmonths(2) + caldays(35)

L =
2mo 35d

Add calendar durations to a datetime to compute a new date.

t2 = t + calmonths(2) + caldays(35)

t2 =

Oct 01, 2014 Oct 02, 2014

t2 is also a datetime array.

whos t2

Name Size Bytes Class Attributes

t2 1x2 161 datetime

In summary, there are several ways to represent dates and times, and MATLAB has a data type for
each approach:

• Represent a point in time, using the datetime data type.


Example: Wednesday, June 18, 2014 10:00:00
• Represent a length of time, or a duration in units of fixed length, using the duration data type.
When using the duration data type, 1 day is always equal to 24 hours, and 1 year is always equal
to 365.2425 days.
Example: 72 hours and 10 minutes
• Represent a length of time, or a duration in units of variable length, using the
calendarDuration data type.
Example: 1 month, which can be 28, 29, 30, or 31 days long.

7-3
7 Dates and Time

The calendarDuration data type also accounts for daylight saving time changes and leap years,
so that 1 day might be more or less than 24 hours, and 1 year can have 365 or 366 days.

See Also
calendarDuration | datetime | duration

7-4
Specify Time Zones

Specify Time Zones


In MATLAB, a time zone includes the time offset from Coordinated Universal Time (UTC), the daylight
saving time offset, and a set of historical changes to those values. The time zone setting is stored in
the TimeZone property of each datetime array. When you create a datetime, it is unzoned by
default. That is, the TimeZone property of the datetime is empty (''). If you do not work with
datetime values from multiple time zones and do not need to account for daylight saving time, you
might not need to specify this property.

You can specify a time zone when you create a datetime, using the 'TimeZone' name-value pair
argument. The time zone value 'local' specifies the system time zone. To display the time zone
offset for each datetime, include a time zone offset specifier such as 'Z' in the value for the
'Format' argument.

t = datetime(2014,3,8:9,6,0,0,'TimeZone','local',...
'Format','d-MMM-y HH:mm:ss Z')

t =

8-Mar-2014 06:00:00 -0500 9-Mar-2014 06:00:00 -0400

A different time zone offset is displayed depending on whether the datetime occurs during daylight
saving time.

You can modify the time zone of an existing datetime. For example, change the TimeZone property of
t using dot notation. You can specify the time zone value as the name of a time zone region in the
IANA Time Zone Database. A time zone region accounts for the current and historical rules for
standard and daylight offsets from UTC that are observed in that geographic region.

[Link] = 'Asia/Shanghai'

t =

8-Mar-2014 19:00:00 +0800 9-Mar-2014 18:00:00 +0800

You also can specify the time zone value as a character vector of the form +HH:mm or -HH:mm, which
represents a time zone with a fixed offset from UTC that does not observe daylight saving time.

[Link] = '+08:00'

t =

8-Mar-2014 19:00:00 +0800 9-Mar-2014 18:00:00 +0800

Operations on datetime arrays with time zones automatically account for time zone differences. For
example, create a datetime in a different time zone.

u = datetime(2014,3,9,6,0,0,'TimeZone','Europe/London',...
'Format','d-MMM-y HH:mm:ss Z')

u =

9-Mar-2014 06:00:00 +0000

View the time difference between the two datetime arrays.

dt = t - u

7-5
7 Dates and Time

dt =

-19:00:00 04:00:00

When you perform operations involving datetime arrays, the arrays either must all have a time zone
associated with them, or they must all have no time zone.

See Also
datetime | timezones

Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Convert Date and Time to Julian Date or POSIX Time” on page 7-7

7-6
Convert Date and Time to Julian Date or POSIX Time

Convert Date and Time to Julian Date or POSIX Time


You can convert datetime arrays to represent points in time in specialized numeric formats. In
general, these formats represent a point in time as the number of seconds or days that have elapsed
since a specified starting point. For example, the Julian date is the number of days and fractional days
that have elapsed since the beginning of the Julian period. The POSIX® time is the number of
seconds that have elapsed since 00:00:00 1-Jan-1970 UTC (Universal Coordinated Time). MATLAB®
provides the juliandate and posixtime functions to convert datetime arrays to Julian dates and
POSIX times.

While datetime arrays are not required to have a time zone, converting "unzoned" datetime values
to Julian dates or POSIX times can lead to unexpected results. To ensure the expected result, specify
the time zone before conversion.

Specify Time Zone Before Conversion

You can specify a time zone for a datetime array, but you are not required to do so. In fact, by
default the datetime function creates an "unzoned" datetime array.

Create a datetime value for the current date and time.

d = datetime('now')

d = datetime
09-Nov-2020 15:45:34

d is constructed from the local time on your machine and has no time zone associated with it. In many
contexts, you might assume that you can treat the times in an unzoned datetime array as local
times. However, the juliandate and posixtime functions treat the times in unzoned datetime
arrays as UTC times, not local times. To avoid any ambiguity, it is recommended that you avoid using
juliandate and posixtime on unzoned datetime arrays. For example, avoid using
posixtime(datetime('now')) in your code.

If your datetime array has values that do not represent UTC times, specify the time zone using the
TimeZone name-value pair argument so that juliandate and posixtime interpret the datetime
values correctly.

d = datetime('now','TimeZone','America/New_York')

d = datetime
09-Nov-2020 15:45:34

As an alternative, you can specify the TimeZone property after you create the array.

[Link] = 'America/Los_Angeles'

d = datetime
09-Nov-2020 12:45:34

To see a complete list of time zones, use the timezones function.

7-7
7 Dates and Time

Convert Zoned and Unzoned Datetime Values to Julian Dates

A Julian date is the number of days (including fractional days) since noon on November 24, 4714
BCE, in the proleptic Gregorian calendar, or January 1, 4713 BCE, in the proleptic Julian calendar. To
convert datetime arrays to Julian dates, use the juliandate function.

Create a datetime array and specify its time zone.

DZ = datetime('2016-07-29 10:05:24') + calmonths(1:3);


[Link] = 'America/New_York'

DZ = 1x3 datetime
29-Aug-2016 10:05:24 29-Sep-2016 10:05:24 29-Oct-2016 10:05:24

Convert D to the equivalent Julian dates.

format longG
JDZ = juliandate(DZ)

JDZ = 1×3

2457630.08708333 2457661.08708333 2457691.08708333

Create an unzoned copy of DZ. Convert D to the equivalent Julian dates. As D has no time zone,
juliandate treats the times as UTC times.

D = DZ;
[Link] = '';
JD = juliandate(D)

JD = 1×3

2457629.92041667 2457660.92041667 2457690.92041667

Compare JDZ and JD. The differences are equal to the time zone offset between UTC and the
America/New_York time zone in fractional days.

JDZ - JD

ans = 1×3

0.166666666511446 0.166666666511446 0.166666666511446

Convert Zoned and Unzoned Datetime Values to POSIX Times

The POSIX time is the number of seconds (including fractional seconds) elapsed since 00:00:00 1-
Jan-1970 UTC (Universal Coordinated Time), ignoring leap seconds. To convert datetime arrays to
POSIX times, use the posixtime function.

Create a datetime array and specify its time zone.

DZ = datetime('2016-07-29 10:05:24') + calmonths(1:3);


[Link] = 'America/New_York'

7-8
Convert Date and Time to Julian Date or POSIX Time

DZ = 1x3 datetime
29-Aug-2016 10:05:24 29-Sep-2016 10:05:24 29-Oct-2016 10:05:24

Convert D to the equivalent POSIX times.

PTZ = posixtime(DZ)

PTZ = 1×3

1472479524 1475157924 1477749924

Create an unzoned copy of DZ. Convert D to the equivalent POSIX times. As D has no time zone,
posixtime treats the times as UTC times.

D = DZ;
[Link] = '';
PT = posixtime(D)

PT = 1×3

1472465124 1475143524 1477735524

Compare PTZ and PT. The differences are equal to the time zone offset between UTC and the
America/New_York time zone in seconds.

PTZ - PT

ans = 1×3

14400 14400 14400

See Also
datetime | juliandate | posixtime | timezones

Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Specify Time Zones” on page 7-5

7-9
7 Dates and Time

Set Date and Time Display Format


In this section...
“Formats for Individual Date and Duration Arrays” on page 7-10
“datetime Display Format” on page 7-10
“duration Display Format” on page 7-11
“calendarDuration Display Format” on page 7-11
“Default datetime Format” on page 7-12

Formats for Individual Date and Duration Arrays


datetime, duration, and calendarDuration arrays have a Format property that controls the
display of values in each array. When you create a datetime array, it uses the MATLAB global default
datetime display format unless you explicitly provide a format. Use dot notation to access the Format
property to view or change its value. For example, to set the display format for the datetime array,
t, to the default format, type:

[Link] = 'default'

Changing the Format property does not change the values in the array, only their display. For
example, the following can be representations of the same datetime value (the latter two do not
display any time components):

Thursday, August 23, 2012 12:35:00


August 23, 2012
23-Aug-2012

The Format property of the datetime, duration, and calendarDuration data types accepts
different formats as inputs.

datetime Display Format


You can set the Format property to one of these character vectors.

Value of Format Description


'default' Use the default display format.
'defaultdate' Use the default date display format that does not
show time components.

To change the default formats, see “Default datetime Format” on page 7-12.

Alternatively, you can use the letters A-Z and a-z to specify a custom date format. You can include
nonletter characters such as a hyphen, space, or colon to separate the fields. This table shows several
common display formats and examples of the formatted output for the date, Saturday, April 19, 2014
at 9:41:06 PM in New York City.

Value of Format Example


'yyyy-MM-dd' 2014-04-19

7-10
Set Date and Time Display Format

Value of Format Example


'dd/MM/yyyy' 19/04/2014
'[Link]' 19.04.2014
'yyyy 年 MM 月 dd 日' 2014 年 04 月 19 日
'MMMM d, yyyy' April 19, 2014
'eeee, MMMM d, yyyy h:mm a' Saturday, April 19, 2014 9:41 PM
'MMMM d, yyyy HH:mm:ss Z' April 19, 2014 21:41:06 -0400
'yyyy-MM-dd''T''HH:mmXXX' 2014-04-19T21:41-04:00

For a complete list of valid symbolic identifiers, see the Format property for datetime arrays.

Note The letter identifiers that datetime accepts are different from those used by the datestr,
datenum, and datevec functions.

duration Display Format


To display a duration as a single number that includes a fractional part (for example, 1.234 hours),
specify one of these character vectors:

Value of Format Description


'y' Number of exact fixed-length years. A fixed-length year is
equal to 365.2425 days.
'd' Number of exact fixed-length days. A fixed-length day is equal
to 24 hours.
'h' Number of hours
'm' Number of minutes
's' Number of seconds

To specify the number of fractional digits displayed, use the format function.

To display a duration in the form of a digital timer, specify one of the following character vectors.

• 'dd:hh:mm:ss'
• 'hh:mm:ss'
• 'mm:ss'
• 'hh:mm'

You also can display up to nine fractional second digits by appending up to nine S characters. For
example, 'hh:mm:[Link]' displays the milliseconds of a duration value to 3 digits.

Changing the Format property does not change the values in the array, only their display.

calendarDuration Display Format


Specify the Format property of a calendarDuration array as a character vector that can include
the characters y, q, m, w, d, and t, in this order. The format must include m, d, and t.

7-11
7 Dates and Time

This table describes the date and time components that the characters represent.

Character Unit Required?


y Years no
q Quarters (multiples of 3 no
months)
m Months yes
w Weeks no
d Days yes
t Time (hours, minutes, and yes
seconds)

To specify the number of digits displayed for fractional seconds, use the format function.

If the value of a date or time component is zero, it is not displayed.

Changing the Format property does not change the values in the array, only their display.

Default datetime Format


You can set default formats to control the display of datetime arrays created without an explicit
display format. These formats also apply when you set the Format property of a datetime array to
'default' or 'defaultdate'. When you change the default setting, datetime arrays set to use
the default formats are displayed automatically using the new setting.

Changes to the default formats persist across MATLAB sessions.

To specify a default format, type


[Link]('default',fmt)

where fmt is a character vector composed of the letters A-Z and a-z described for the Format
property of datetime arrays, above. For example,
[Link]('default','yyyy-MM-dd hh:mm:ss')

sets the default datetime format to include a 4-digit year, 2-digit month number, 2-digit day number,
and hour, minute, and second values.

In addition, you can specify a default format for datetimes created without time components. For
example,
[Link]('defaultdate','yyyy-MM-dd')

sets the default date format to include a 4-digit year, 2-digit month number, and 2-digit day number.

To reset the both the default format and the default date-only formats to the factory defaults, type
[Link]('reset')

The factory default formats depend on your system locale.

You also can set the default formats in the Preferences dialog box. For more information, see “Set
Command Window Preferences”.

7-12
Set Date and Time Display Format

See Also
calendarDuration | datetime | duration | format

7-13
7 Dates and Time

Generate Sequence of Dates and Time


In this section...
“Sequence of Datetime or Duration Values Between Endpoints with Step Size” on page 7-14
“Add Duration or Calendar Duration to Create Sequence of Dates” on page 7-16
“Specify Length and Endpoints of Date or Duration Sequence” on page 7-17
“Sequence of Datetime Values Using Calendar Rules” on page 7-17

Sequence of Datetime or Duration Values Between Endpoints with


Step Size
This example shows how to use the colon (:) operator to generate sequences of datetime or
duration values in the same way that you create regularly spaced numeric vectors.

Use Default Step Size

Create a sequence of datetime values starting from November 1, 2013 and ending on November 5,
2013. The default step size is one calendar day.

t1 = datetime(2013,11,1,8,0,0);
t2 = datetime(2013,11,5,8,0,0);
t = t1:t2

t = 1x5 datetime
Columns 1 through 3

01-Nov-2013 08:00:00 02-Nov-2013 08:00:00 03-Nov-2013 08:00:00

Columns 4 through 5

04-Nov-2013 08:00:00 05-Nov-2013 08:00:00

Specify Step Size

Specify a step size of 2 calendar days using the caldays function.

t = t1:caldays(2):t2

t = 1x3 datetime
01-Nov-2013 08:00:00 03-Nov-2013 08:00:00 05-Nov-2013 08:00:00

Specify a step size in units other than days. Create a sequence of datetime values spaced 18 hours
apart.

t = t1:hours(18):t2

t = 1x6 datetime
Columns 1 through 3

01-Nov-2013 08:00:00 02-Nov-2013 02:00:00 02-Nov-2013 20:00:00

Columns 4 through 6

7-14
Generate Sequence of Dates and Time

03-Nov-2013 14:00:00 04-Nov-2013 08:00:00 05-Nov-2013 02:00:00

Use the years, days, minutes, and seconds functions to create datetime and duration sequences
using other fixed-length date and time units. Create a sequence of duration values between 0 and 3
minutes, incremented by 30 seconds.

d = 0:seconds(30):minutes(3)

d = 1x7 duration
0 sec 30 sec 60 sec 90 sec 120 sec 150 sec 180 sec

Compare Fixed-Length Duration and Calendar Duration Step Sizes

Assign a time zone to t1 and t2. In the America/New_York time zone, t1 now occurs just before a
daylight saving time change.

[Link] = 'America/New_York';
[Link] = 'America/New_York';

If you create the sequence using a step size of one calendar day, then the difference between
successive datetime values is not always 24 hours.

t = t1:t2;
dt = diff(t)

dt = 1x4 duration
24:00:00 25:00:00 24:00:00 24:00:00

Create a sequence of datetime values spaced one fixed-length day apart,

t = t1:days(1):t2

t = 1x5 datetime
Columns 1 through 3

01-Nov-2013 08:00:00 02-Nov-2013 08:00:00 03-Nov-2013 07:00:00

Columns 4 through 5

04-Nov-2013 07:00:00 05-Nov-2013 07:00:00

Verify that the difference between successive datetime values is 24 hours.

dt = diff(t)

dt = 1x4 duration
24:00:00 24:00:00 24:00:00 24:00:00

Integer Step Size

If you specify a step size in terms of an integer, it is interpreted as a number of 24-hour days.

t = t1:1:t2

7-15
7 Dates and Time

t = 1x5 datetime
Columns 1 through 3

01-Nov-2013 08:00:00 02-Nov-2013 08:00:00 03-Nov-2013 07:00:00

Columns 4 through 5

04-Nov-2013 07:00:00 05-Nov-2013 07:00:00

Add Duration or Calendar Duration to Create Sequence of Dates


This example shows how to add a duration or calendar duration to a datetime to create a sequence of
datetime values.

Create a datetime scalar representing November 1, 2013 at 8:00 AM.

t1 = datetime(2013,11,1,8,0,0);

Add a sequence of fixed-length hours to the datetime.

t = t1 + hours(0:2)

t = 1x3 datetime
01-Nov-2013 08:00:00 01-Nov-2013 09:00:00 01-Nov-2013 10:00:00

Add a sequence of calendar months to the datetime.

t = t1 + calmonths(1:5)

t = 1x5 datetime
Columns 1 through 3

01-Dec-2013 08:00:00 01-Jan-2014 08:00:00 01-Feb-2014 08:00:00

Columns 4 through 5

01-Mar-2014 08:00:00 01-Apr-2014 08:00:00

Each datetime in t occurs on the first day of each month.

Verify that the dates in t are spaced 1 month apart.

dt = caldiff(t)

dt = 1x4 calendarDuration
1mo 1mo 1mo 1mo

Determine the number of days between each date.

dt = caldiff(t,'days')

dt = 1x4 calendarDuration
31d 31d 28d 31d

7-16
Generate Sequence of Dates and Time

Add a number of calendar months to the date, January 31, 2014, to create a sequence of dates that
fall on the last day of each month.
t = datetime(2014,1,31) + calmonths(0:11)

t = 1x12 datetime
Columns 1 through 5

31-Jan-2014 28-Feb-2014 31-Mar-2014 30-Apr-2014 31-May-2014

Columns 6 through 10

30-Jun-2014 31-Jul-2014 31-Aug-2014 30-Sep-2014 31-Oct-2014

Columns 11 through 12

30-Nov-2014 31-Dec-2014

Specify Length and Endpoints of Date or Duration Sequence


This example shows how to use the linspace function to create equally spaced datetime or duration
values between two specified endpoints.

Create a sequence of five equally spaced dates between April 14, 2014 and August 4, 2014. First,
define the endpoints.
A = datetime(2014,04,14);
B = datetime(2014,08,04);

The third input to linspace specifies the number of linearly spaced points to generate between the
endpoints.
C = linspace(A,B,5)

C = 1x5 datetime
14-Apr-2014 12-May-2014 09-Jun-2014 07-Jul-2014 04-Aug-2014

Create a sequence of six equally spaced durations between 1 and 5.5 hours.
A = duration(1,0,0);
B = duration(5,30,0);
C = linspace(A,B,6)

C = 1x6 duration
01:00:00 01:54:00 02:48:00 03:42:00 04:36:00 05:30:00

Sequence of Datetime Values Using Calendar Rules


This example shows how to use the dateshift function to generate sequences of dates and time
where each instance obeys a rule relating to a calendar unit or a unit of time. For instance, each
datetime must occur at the beginning a month, on a particular day of the week, or at the end of a
minute. The resulting datetime values in the sequence are not necessarily equally spaced.

7-17
7 Dates and Time

Dates on Specific Day of Week

Generate a sequence of dates consisting of the next three occurrences of Monday. First, define
today's date.

t1 = datetime('today','Format','dd-MMM-yyyy eee')

t1 = datetime
09-Nov-2020 Mon

The first input to dateshift is always the datetime array from which you want to generate a
sequence. Specify 'dayofweek' as the second input to indicate that the datetime values in the
output sequence must fall on a specific day of the week. You can specify the day of the week either by
number or by name. For example, you can specify Monday either as 2 or 'Monday'.

t = dateshift(t1,'dayofweek',2,1:3)

t = 1x3 datetime
09-Nov-2020 Mon 16-Nov-2020 Mon 23-Nov-2020 Mon

Dates at Start of Month

Generate a sequence of start-of-month dates beginning with April 1, 2014. Specify 'start' as the
second input to dateshift to indicate that all datetime values in the output sequence should fall at
the start of a particular unit of time. The third input argument defines the unit of time, in this case,
month. The last input to dateshift can be an array of integer values that specifies how t1 should be
shifted. In this case, 0 corresponds to the start of the current month, and 4 corresponds to the start
of the fourth month from t1.

t1 = datetime(2014,04,01);
t = dateshift(t1,'start','month',0:4)

t = 1x5 datetime
01-Apr-2014 01-May-2014 01-Jun-2014 01-Jul-2014 01-Aug-2014

Dates at End of Month

Generate a sequence of end-of-month dates beginning with April 1, 2014.

t1 = datetime(2014,04,01);
t = dateshift(t1,'end','month',0:2)

t = 1x3 datetime
30-Apr-2014 31-May-2014 30-Jun-2014

Determine the number of days between each date.

dt = caldiff(t,'days')

dt = 1x2 calendarDuration
31d 30d

The dates are not equally spaced.

7-18
Generate Sequence of Dates and Time

Other Units of Dates and Time

You can specify other units of time such as week, day, and hour.

t1 = datetime('now')

t1 = datetime
09-Nov-2020 15:57:16

t = dateshift(t1,'start','hour',0:4)

t = 1x5 datetime
Columns 1 through 3

09-Nov-2020 15:00:00 09-Nov-2020 16:00:00 09-Nov-2020 17:00:00

Columns 4 through 5

09-Nov-2020 18:00:00 09-Nov-2020 19:00:00

Previous Occurrences of Dates and Time

Generate a sequence of datetime values beginning with the previous hour. Negative integers in the
last input to dateshift correspond to datetime values earlier than t1.

t = dateshift(t1,'start','hour',-1:1)

t = 1x3 datetime
09-Nov-2020 14:00:00 09-Nov-2020 15:00:00 09-Nov-2020 16:00:00

See Also
dateshift | linspace

7-19
7 Dates and Time

Share Code and Data Across Locales


In this section...
“Write Locale-Independent Date and Time Code” on page 7-20
“Write Dates in Other Languages” on page 7-21
“Read Dates in Other Languages” on page 7-21

Write Locale-Independent Date and Time Code


Follow these best practices when sharing code that handles dates and time with MATLAB® users in
other locales. These practices ensure that the same code produces the same output display and that
output files containing dates and time are read correctly on systems in different countries or with
different language settings.

Create language-independent datetime values. That is, create datetime values that use month
numbers rather than month names, such as 01 instead of January. Avoid using day of week names.

For example, do this:


t = datetime('today','Format','yyyy-MM-dd')

t = datetime
2020-11-09

instead of this:
t = datetime('today','Format','eeee, dd-MMM-yyyy')

t = datetime
Monday, 09-Nov-2020

Display the hour using 24-hour clock notation rather than 12-hour clock notation. Use the 'HH'
identifiers when specifying the display format for datetime values.

For example, do this:


t = datetime('now','Format','HH:mm')

t = datetime
15:29

instead of this:
t = datetime('now','Format','hh:mm a')

t = datetime
03:29 PM

When specifying the display format for time zone information, use the Z or X identifiers instead of the
lowercase z to avoid the creation of time zone names that might not be recognized in other languages
or regions.

7-20
Share Code and Data Across Locales

Assign a time zone to t.

[Link] = 'America/New_York';

Specify a language-independent display format that includes a time zone.

[Link] = 'dd-MM-yyyy Z'

t = datetime
09-11-2020 -0500

If you share files but not code, you do not need to write locale-independent code while you work in
MATLAB. However, when you write to a file, ensure that any text representing dates and times is
language-independent. Then, other MATLAB users can read the files easily without having to specify
a locale in which to interpret date and time data.

Write Dates in Other Languages


Specify an appropriate format for text representing dates and times when you use the char or
cellstr functions. For example, convert two datetime values to a cell array of character vectors
using cellstr. Specify the format and the locale to represent the day, month, and year of each
datetime value as text.

t = [datetime('today');datetime('tomorrow')]

t = 2x1 datetime
09-Nov-2020
10-Nov-2020

S = cellstr(t,'dd. MMMM yyyy','de_DE')

S = 2x1 cell
{'09. November 2020'}
{'10. November 2020'}

S is a cell array of character vectors representing dates in German. You can export S to a text file to
use with systems in the de_DE locale.

Read Dates in Other Languages


You can read text files containing dates and time in a language other than the language that MATLAB
uses, which depends on your system locale. Use the textscan or readtable functions with the
DateLocale name-value pair argument to specify the locale in which the function interprets the
dates in the file. In addition, you might need to specify the character encoding of a file that contains
characters that are not recognized by your computer's default encoding.

• When reading text files using the textscan function, specify the file encoding when opening the
file with fopen. The encoding is the fourth input argument to fopen.
• When reading text files using the readtable function, use the FileEncoding name-value pair
argument to specify the character encoding associated with the file.

7-21
7 Dates and Time

See Also
cellstr | char | datetime | readtable | textscan

7-22
Extract or Assign Date and Time Components of Datetime Array

Extract or Assign Date and Time Components of Datetime


Array
This example shows two ways to extract date and time components from existing datetime arrays:
accessing the array properties or calling a function. Then, the example shows how to modify the date
and time components by modifying the array properties.

Access Properties to Retrieve Date and Time Component

Create a datetime array.

t = datetime('now') + calyears(0:2) + calmonths(0:2) + hours(20:20:60)

t = 1x3 datetime
10-Nov-2020 06:00:19 11-Dec-2021 02:00:19 11-Jan-2023 22:00:19

Get the year values of each datetime in the array. Use dot notation to access the Year property of t.

t_years = [Link]

t_years = 1×3

2020 2021 2023

The output, t_years, is a numeric array.

Get the month values of each datetime in t by accessing the Month property.

t_months = [Link]

t_months = 1×3

11 12 1

You can retrieve the day, hour, minute, and second components of each datetime in t by accessing the
Hour, Minute, and Second properties, respectively.

Use Functions to Retrieve Date and Time Component

Use the month function to get the month number for each datetime in t. Using functions is an
alternate way to retrieve specific date or time components of t.

m = month(t)

m = 1×3

11 12 1

Use the month function rather than the Month property to get the full month names of each datetime
in t.

m = month(t,'name')

7-23
7 Dates and Time

m = 1x3 cell
{'November'} {'December'} {'January'}

You can retrieve the year, quarter, week, day, hour, minute, and second components of each datetime
in t using the year, quarter, week, hour, minute, and second functions, respectively.

Get the week of year numbers for each datetime in t.

w = week(t)

w = 1×3

46 50 2

Get Multiple Date and Time Components

Use the ymd function to get the year, month, and day values of t as three separate numeric arrays.

[y,m,d] = ymd(t)

y = 1×3

2020 2021 2023

m = 1×3

11 12 1

d = 1×3

10 11 11

Use the hms function to get the hour, minute, and second values of t as three separate numeric
arrays.

[h,m,s] = hms(t)

h = 1×3

6 2 22

m = 1×3

0 0 0

s = 1×3

19.0910 19.0910 19.0910

7-24
Extract or Assign Date and Time Components of Datetime Array

Modify Date and Time Components

Assign new values to components in an existing datetime array by modifying the properties of the
array. Use dot notation to access a specific property.

Change the year number of all datetime values in t to 2014. Use dot notation to modify the Year
property.

[Link] = 2014

t = 1x3 datetime
10-Nov-2014 06:00:19 11-Dec-2014 02:00:19 11-Jan-2014 22:00:19

Change the months of the three datetime values in t to January, February, and March, respectively.
You must specify the new value as a numeric array.

[Link] = [1,2,3]

t = 1x3 datetime
10-Jan-2014 06:00:19 11-Feb-2014 02:00:19 11-Mar-2014 22:00:19

Set the time zone of t by assigning a value to the TimeZone property.

[Link] = 'Europe/Berlin';

Change the display format of t to display only the date, and not the time information.

[Link] = 'dd-MMM-yyyy'

t = 1x3 datetime
10-Jan-2014 11-Feb-2014 11-Mar-2014

If you assign values to a datetime component that are outside the conventional range, MATLAB®
normalizes the components. The conventional range for day of month numbers is from 1 to 31. Assign
day values that exceed this range.

[Link] = [-1 1 32]

t = 1x3 datetime
30-Dec-2013 01-Feb-2014 01-Apr-2014

The month and year numbers adjust so that all values remain within the conventional range for each
date component. In this case, January -1, 2014 converts to December 30, 2013.

See Also
datetime | hms | week | ymd

7-25
7 Dates and Time

Combine Date and Time from Separate Variables


This example shows how to read date and time data from a text file. Then, it shows how to combine
date and time information stored in separate variables into a single datetime variable.

Create a space-delimited text file named [Link] that contains the following (to create the
file, use any text editor, and copy and paste):
Date Name Time
10.03.2015 Joe 14:31
10.03.2015 Bob 15:33
11.03.2015 Bob 11:29
12.03.2015 Kim 12:09
12.03.2015 Joe 13:05

Read the file using the readtable function. Use the %D conversion specifier to read the first and
third columns of data as datetime values.
T = readtable('[Link]','Format','%{[Link]}D %s %{HH:mm}D','Delimiter',' ')

T =
Date Name Time
__________ _____ _____
10.03.2015 'Joe' 14:31
10.03.2015 'Bob' 15:33
11.03.2015 'Bob' 11:29
12.03.2015 'Kim' 12:09
12.03.2015 'Joe' 13:05

readtable returns a table containing three variables.

Change the display format for the [Link] and [Link] variables to view both date and time
information. Since the data in the first column of the file ("Date") have no time information, the time
of the resulting datetime values in [Link] default to midnight. Since the data in the third column of
the file ("Time") have no associated date, the date of the datetime values in [Link] defaults to the
current date.
[Link] = '[Link] HH:mm';
[Link] = '[Link] HH:mm';
T

T =
Date Name Time
________________ _____ ________________
10.03.2015 00:00 'Joe' 12.12.2014 14:31
10.03.2015 00:00 'Bob' 12.12.2014 15:33
11.03.2015 00:00 'Bob' 12.12.2014 11:29
12.03.2015 00:00 'Kim' 12.12.2014 12:09
12.03.2015 00:00 'Joe' 12.12.2014 13:05

Combine the date and time information from two different table variables by adding [Link] and the
time values in [Link]. Extract the time information from [Link] using the timeofday function.
myDatetime = [Link] + timeofday([Link])

myDatetime =
10.03.2015 14:31
10.03.2015 15:33

7-26
Combine Date and Time from Separate Variables

11.03.2015 11:29
12.03.2015 12:09
12.03.2015 13:05

See Also
readtable | timeofday

7-27
7 Dates and Time

Date and Time Arithmetic


This example shows how to add and subtract date and time values to calculate future and past dates
and elapsed durations in exact units or calendar units. You can add, subtract, multiply, and divide
date and time arrays in the same way that you use these operators with other MATLAB® data types.
However, there is some behavior that is specific to dates and time.

Add and Subtract Durations to Datetime Array

Create a datetime scalar. By default, datetime arrays are not associated with a time zone.
t1 = datetime('now')

t1 = datetime
09-Nov-2020 09:55:31

Find future points in time by adding a sequence of hours.


t2 = t1 + hours(1:3)

t2 = 1x3 datetime
09-Nov-2020 10:55:31 09-Nov-2020 11:55:31 09-Nov-2020 12:55:31

Verify that the difference between each pair of datetime values in t2 is 1 hour.
dt = diff(t2)

dt = 1x2 duration
01:00:00 01:00:00

diff returns durations in terms of exact numbers of hours, minutes, and seconds.

Subtract a sequence of minutes from a datetime to find past points in time.


t2 = t1 - minutes(20:10:40)

t2 = 1x3 datetime
09-Nov-2020 09:35:31 09-Nov-2020 09:25:31 09-Nov-2020 09:15:31

Add a numeric array to a datetime array. MATLAB® treats each value in the numeric array as a
number of exact, 24-hour days.
t2 = t1 + [1:3]

t2 = 1x3 datetime
10-Nov-2020 09:55:31 11-Nov-2020 09:55:31 12-Nov-2020 09:55:31

Add to Datetime with Time Zone

If you work with datetime values in different time zones, or if you want to account for daylight saving
time changes, work with datetime arrays that are associated with time zones. Create a datetime
scalar representing March 8, 2014 in New York.
t1 = datetime(2014,3,8,0,0,0,'TimeZone','America/New_York')

7-28
Date and Time Arithmetic

t1 = datetime
08-Mar-2014

Find future points in time by adding a sequence of fixed-length (24-hour) days.

t2 = t1 + days(0:2)

t2 = 1x3 datetime
08-Mar-2014 00:00:00 09-Mar-2014 00:00:00 10-Mar-2014 01:00:00

Because a daylight saving time shift occurred on March 9, 2014, the third datetime in t2 does not
occur at midnight.

Verify that the difference between each pair of datetime values in t2 is 24 hours.

dt = diff(t2)

dt = 1x2 duration
24:00:00 24:00:00

You can add fixed-length durations in other units such as years, hours, minutes, and seconds by
adding the outputs of the years, hours, minutes, and seconds functions, respectively.

To account for daylight saving time changes, you should work with calendar durations instead of
durations. Calendar durations account for daylight saving time shifts when they are added to or
subtracted from datetime values.

Add a number of calendar days to t1.

t3 = t1 + caldays(0:2)

t3 = 1x3 datetime
08-Mar-2014 09-Mar-2014 10-Mar-2014

View that the difference between each pair of datetime values in t3 is not always 24 hours due to the
daylight saving time shift that occurred on March 9.

dt = diff(t3)

dt = 1x2 duration
24:00:00 23:00:00

Add Calendar Durations to Datetime Array

Add a number of calendar months to January 31, 2014.

t1 = datetime(2014,1,31)

t1 = datetime
31-Jan-2014

t2 = t1 + calmonths(1:4)

7-29
7 Dates and Time

t2 = 1x4 datetime
28-Feb-2014 31-Mar-2014 30-Apr-2014 31-May-2014

Each datetime in t2 occurs on the last day of each month.

Calculate the difference between each pair of datetime values in t2 in terms of a number of calendar
days using the caldiff function.

dt = caldiff(t2,'days')

dt = 1x3 calendarDuration
31d 30d 31d

The number of days between successive pairs of datetime values in dt is not always the same
because different months consist of a different number of days.

Add a number of calendar years to January 31, 2014.

t2 = t1 + calyears(0:4)

t2 = 1x5 datetime
31-Jan-2014 31-Jan-2015 31-Jan-2016 31-Jan-2017 31-Jan-2018

Calculate the difference between each pair of datetime values in t2 in terms of a number of calendar
days using the caldiff function.

dt = caldiff(t2,'days')

dt = 1x4 calendarDuration
365d 365d 366d 365d

The number of days between successive pairs of datetime values in dt is not always the same
because 2016 is a leap year and has 366 days.

You can use the calquarters, calweeks, and caldays functions to create arrays of calendar
quarters, calendar weeks, or calendar days that you add to or subtract from datetime arrays.

Adding calendar durations is not commutative. When you add more than one calendarDuration
array to a datetime, MATLAB® adds them in the order in which they appear in the command.

Add 3 calendar months followed by 30 calendar days to January 31, 2014.

t2 = datetime(2014,1,31) + calmonths(3) + caldays(30)

t2 = datetime
30-May-2014

First add 30 calendar days to the same date, and then add 3 calendar months. The result is not the
same because when you add a calendar duration to a datetime, the number of days added depends on
the original date.

t2 = datetime(2014,1,31) + caldays(30) + calmonths(3)

7-30
Date and Time Arithmetic

t2 = datetime
02-Jun-2014

Calendar Duration Arithmetic

Create two calendar durations and then find their sum.


d1 = calyears(1) + calmonths(2) + caldays(20)

d1 = calendarDuration
1y 2mo 20d

d2 = calmonths(11) + caldays(23)

d2 = calendarDuration
11mo 23d

d = d1 + d2

d = calendarDuration
2y 1mo 43d

When you sum two or more calendar durations, a number of months greater than 12 roll over to a
number of years. However, a large number of days does not roll over to a number of months, because
different months consist of different numbers of days.

Increase d by multiplying it by a factor of 2. Calendar duration values must be integers, so you can
multiply them only by integer values.
2*d

ans = calendarDuration
4y 2mo 86d

Calculate Elapsed Time in Exact Units

Subtract one datetime array from another to calculate elapsed time in terms of an exact number of
hours, minutes, and seconds.

Find the exact length of time between a sequence of datetime values and the start of the previous
day.
t2 = datetime('now') + caldays(1:3)

t2 = 1x3 datetime
10-Nov-2020 09:55:34 11-Nov-2020 09:55:34 12-Nov-2020 09:55:34

t1 = datetime('yesterday')

t1 = datetime
08-Nov-2020

dt = t2 - t1

7-31
7 Dates and Time

dt = 1x3 duration
57:55:34 81:55:34 105:55:34

whos dt

Name Size Bytes Class Attributes

dt 1x3 40 duration

dt contains durations in the format, hours:minutes:seconds.

View the elapsed durations in units of days by changing the Format property of dt.

[Link] = 'd'

dt = 1x3 duration
2.4136 days 3.4136 days 4.4136 days

Scale the duration values by multiplying dt by a factor of 1.2. Because durations have an exact
length, you can multiply and divide them by fractional values.

dt2 = 1.2*dt

dt2 = 1x3 duration


2.8963 days 4.0963 days 5.2963 days

Calculate Elapsed Time in Calendar Units

Use the between function to find the number of calendar years, months, and days elapsed between
two dates.

t1 = datetime('today')

t1 = datetime
09-Nov-2020

t2 = t1 + calmonths(0:2) + caldays(4)

t2 = 1x3 datetime
13-Nov-2020 13-Dec-2020 13-Jan-2021

dt = between(t1,t2)

dt = 1x3 calendarDuration
4d 1mo 4d 2mo 4d

See Also
between | caldiff | diff

7-32
Compare Dates and Time

Compare Dates and Time


This example shows how to compare datetime and duration arrays. You can perform an element-
by-element comparison of values in two datetime arrays or two duration arrays using relational
operators, such as > and <.

Compare Datetime Arrays

Compare two datetime arrays. The arrays must be the same size or one can be a scalar.

A = datetime(2013,07,26) + calyears(0:2:6)

A = 1x4 datetime
26-Jul-2013 26-Jul-2015 26-Jul-2017 26-Jul-2019

B = datetime(2014,06,01)

B = datetime
01-Jun-2014

A < B

ans = 1x4 logical array

1 0 0 0

The < operator returns logical 1 (true) where a datetime in A occurs before a datetime in B.

Compare a datetime array to text representing a date.

A >= '26-Sep-2014'

ans = 1x4 logical array

0 1 1 1

Comparisons of datetime arrays account for the time zone information of each array.

Compare September 1, 2014 at 4:00 p.m. in Los Angeles with 5:00 p.m. on the same day in New York.

A = datetime(2014,09,01,16,0,0,'TimeZone','America/Los_Angeles',...
'Format','dd-MMM-yyyy HH:mm:ss Z')

A = datetime
01-Sep-2014 16:00:00 -0700

B = datetime(2014,09,01,17,0,0,'TimeZone','America/New_York',...
'Format','dd-MMM-yyyy HH:mm:ss Z')

B = datetime
01-Sep-2014 17:00:00 -0400

A < B

7-33
7 Dates and Time

ans = logical
0

4:00 p.m. in Los Angeles occurs after 5:00 p.m. on the same day in New York.

Compare Durations

Compare two duration arrays.

A = duration([2,30,30;3,15,0])

A = 2x1 duration
02:30:30
03:15:00

B = duration([2,40,0;2,50,0])

B = 2x1 duration
02:40:00
02:50:00

A >= B

ans = 2x1 logical array

0
1

Compare a duration array to a numeric array. Elements in the numeric array are treated as a number
of fixed-length (24-hour) days.

A < [1; 1/24]

ans = 2x1 logical array

1
0

Determine if Dates and Time Are Contained Within an Interval

Use the isbetween function to determine whether values in a datetime array lie within a closed
interval.

Define endpoints of an interval.

tlower = datetime(2014,08,01)

tlower = datetime
01-Aug-2014

tupper = datetime(2014,09,01)

7-34
Compare Dates and Time

tupper = datetime
01-Sep-2014

Create a datetime array and determine whether the values lie within the interval bounded by t1
and t2.

A = datetime(2014,08,21) + calweeks(0:2)

A = 1x3 datetime
21-Aug-2014 28-Aug-2014 04-Sep-2014

tf = isbetween(A,tlower,tupper)

tf = 1x3 logical array

1 1 0

See Also
isbetween

More About
• “Array Comparison with Relational Operators” on page 2-29

7-35
7 Dates and Time

Plot Dates and Durations


You can create plots of datetime and duration values with a variety of graphics functions. You also can
customize the axes, such as changing the format of the tick labels or changing the axis limits.

Line Plot with Dates


Create a line plot with datetime values on the x-axis. Then, change the format of the tick labels and
the x-axis limits.

Create t as a sequence of dates and create y as random data. Plot the vectors using the plot
function.

t = datetime(2014,6,28) + calweeks(0:9);
y = rand(1,10);
plot(t,y);

By default, plot chooses tick mark locations based on the range of data. When you zoom in and out
of a plot, the tick labels automatically adjust to the new axis limits.

Change the x-axis limits. Also, change the format for the tick labels along the x-axis. For a list of
formatting options, see the xtickformat function.

xlim(datetime(2014,[7 8],[12 23]))


xtickformat('dd-MMM-yyyy')

7-36
Plot Dates and Durations

Line Plot with Durations


Create a line plot with duration values on the x-axis. Then, change the format of the tick labels and
the x-axis limits.

Create t as seven linearly spaced duration values between 0 and 3 minutes. Create y as a vector of
random data. Plot the data.

t = 0:seconds(30):minutes(3);
y = rand(1,7);
plot(t,y);

7-37
7 Dates and Time

View the x-axis limits. Since the duration tick labels are in terms of a single unit (minutes), the limits
are stored in terms of that unit.

xl = xlim

xl = 1x2 duration
-4.5 sec 184.5 sec

Change the format for the duration tick labels to display in the form of a digital timer that includes
more than one unit. For a list of formatting options, see the xtickformat function.

xtickformat('mm:ss')

7-38
Plot Dates and Durations

View the x-axis limits again. Since the duration tick labels are now in terms of multiple units, the
limits are stored in units of 24-hour days.

xl = xlim

xl = 1x2 duration
-00:04 03:04

Scatter Plot with Dates and Durations


Create a scatter plot with datetime or duration inputs using the scatter or scatter3 functions. For
example, create a scatter plot with dates along the x-axis.

t = datetime('today') + caldays(1:100);
y = linspace(10,40,100) + 10*rand(1,100);
scatter(t,y)

7-39
7 Dates and Time

Plots that Support Dates and Durations


You can create other types of plots with datetime or duration values. These graphics functions
support datetime and duration values.

bar barh
plot plot3
semilogx (x values must be numeric) semilogy (y values must be numeric)
stem stairs
scatter scatter3
area mesh
surf surface
fill fill3
line text
histogram

See Also
datetime | plot | xtickformat

7-40
Core Functions Supporting Date and Time Arrays

Core Functions Supporting Date and Time Arrays


Many functions in MATLAB operate on date and time arrays in much the same way that they operate
on other arrays.

This table lists notable MATLAB functions that operate on datetime, duration, and
calendarDuration arrays in addition to other arrays.

size isequal intersect plus plot


length isequaln ismember minus plot3
ndims setdiff uminus scatter
numel eq setxor times scatter3
ne unique rdivide bar
isrow lt union ldivide barh
iscolumn le mtimes histogram
ge abs mrdivide
cat gt floor mldivide stem
horzcat ceil diff stairs
vertcat sort round sum area
sortrows mesh
permute issorted min char surf
reshape max string surface
transpose mean cellstr
ctranspose median semilogx
mode semilogy
linspace fill
fill3
line
text

7-41
7 Dates and Time

Convert Between Datetime Arrays, Numbers, and Text


In this section...
“Overview” on page 7-42
“Convert Between Datetime and Character Vectors” on page 7-42
“Convert Between Datetime and String Arrays” on page 7-44
“Convert Between Datetime and Date Vectors” on page 7-44
“Convert Serial Date Numbers to Datetime” on page 7-45
“Convert Datetime Arrays to Numeric Values” on page 7-45

Overview
datetime is the best data type for representing points in time. datetime values have flexible
display formats and up to nanosecond precision, and can account for time zones, daylight saving
time, and leap seconds. However, if you work with code authored in MATLAB R2014a or earlier, or if
you share code with others who use such a version, you might need to work with dates and time
stored in one of these three formats:

• Date String on page 7-42 — A character vector.

Example: Thursday, August 23, 2012 9:45:44.946 AM


• Date Vector on page 7-44 — A 1-by-6 numeric vector containing the year, month, day, hour,
minute, and second.

Example: [2012 8 23 9 45 44.946]


• Serial Date Number on page 7-45 — A single number equal to the number of days since January
0, 0000 in the proleptic ISO calendar (specifying use of the Gregorian calendar). Serial date
numbers are useful as inputs to some MATLAB functions that do not accept the datetime or
duration data types.

Example: 7.3510e+005

Date strings, vectors, and numbers can be stored as arrays of values. Store multiple date strings in a
cell array of character vectors, multiple date vectors in an m-by-6 matrix, and multiple serial date
numbers in a matrix.

You can convert any of these formats to a datetime array using the datetime function. If your
existing MATLAB code expects a serial date number or date vector, use the datenum or datevec
functions, respectively, to convert a datetime array to the expected data format. To convert a
datetime array to character vectors, use the char or cellstr functions.

Starting in R2016b, you also can convert a datetime array to a string array with the string
function.

Convert Between Datetime and Character Vectors


A date string can be a character vector composed of fields related to a specific date and/or time.
There are several ways to represent dates and times in text format. For example, all of the following
are character vectors representing August 23, 2010 at 04:35:42 PM:

7-42
Convert Between Datetime Arrays, Numbers, and Text

'23-Aug-2010 04:35:06 PM'


'Wednesday, August 23'
'08/23/10 16:35'
'Aug 23 16:35:42.946'

A date string includes characters that separate the fields, such as the hyphen, space, and colon used
here:

d = '23-Aug-2010 16:35:42'

Convert one or more date strings to a datetime array using the datetime function. For best
performance, specify the format of the input date strings as an input to datetime.

Note The specifiers that datetime uses to describe date and time formats differ from the specifiers
that the datestr, datevec, and datenum functions accept.

For a complete list of date and time format specifiers, see the Format property of the datetime data
type.

t = datetime(d,'InputFormat','dd-MMM-yyyy HH:mm:ss')

t =

datetime

23-Aug-2010 16:35:42

Although the date string, d, and the datetime scalar, t, look similar, they are not equal. View the
size and data type of each variable.

whos d t

Name Size Bytes Class Attributes

d 1x20 40 char
t 1x1 17 datetime

Convert a datetime array to a character vector using char or cellstr. For example, convert the
current date and time to a timestamp to append to a file name.

t = datetime('now','Format','yyyy-MM-dd''T''HHmmss')

t =

datetime

2017-01-03T151105

S = char(t);
filename = ['myTest_',S]

filename =

'myTest_2017-01-03T151105'

7-43
7 Dates and Time

Convert Between Datetime and String Arrays


Starting in R2016b, you can use the string function to create a string array. If a string array
contains date strings, then you can convert the string array to a datetime array with the datetime
function. Similarly, you can convert a datetime array to a string array with the string function.

Convert a string array. MATLAB displays strings in double quotes. For best performance, specify the
format of the input date strings as an input to datetime.

str = string({'24-Oct-2016 11:58:17';


'19-Nov-2016 09:36:29';
'12-Dec-2016 10:09:06'})

str =

3×1 string array

"24-Oct-2016 11:58:17"
"19-Nov-2016 09:36:29"
"12-Dec-2016 10:09:06"

t = datetime(str,'InputFormat','dd-MMM-yyyy HH:mm:ss')

t =

3×1 datetime array

24-Oct-2016 11:58:17
19-Nov-2016 09:36:29
12-Dec-2016 10:09:06

Convert a datetime value to a string.

t = datetime('25-Dec-2016 06:12:34');
str = string(t)

str =

"25-Dec-2016 06:12:34"

Convert Between Datetime and Date Vectors


A date vector is a 1-by-6 vector of double-precision numbers. Elements of a date vector are integer-
valued, except for the seconds element, which can be fractional. Time values are expressed in 24-
hour notation. There is no AM or PM setting.

A date vector is arranged in the following order:

year month day hour minute second

The following date vector represents 10:45:07 AM on October 24, 2012:

[2012 10 24 10 45 07]

Convert one or more date vectors to a datetime array using the datetime function:

t = datetime([2012 10 24 10 45 07])

7-44
Convert Between Datetime Arrays, Numbers, and Text

t =

datetime

24-Oct-2012 10:45:07

Instead of using datevec to extract components of datetime values, use functions such as year,
month, and day instead:

y = year(t)

y =

2012

Alternatively, access the corresponding property, such as [Link] for year values:

y = [Link]

y =

2012

Convert Serial Date Numbers to Datetime


A serial date number represents a calendar date as the number of days that has passed since a fixed
base date. In MATLAB, serial date number 1 is January 1, 0000.

Serial time can represent fractions of days beginning at midnight; for example, 6 p.m. equals 0.75
serial days. So the character vector '31-Oct-2003, 6:00 PM' in MATLAB is date number
731885.75.

Convert one or more serial date numbers to a datetime array using the datetime function. Specify
the type of date number that is being converted:

t = datetime(731885.75,'ConvertFrom','datenum')

t =

datetime

31-Oct-2003 18:00:00

Convert Datetime Arrays to Numeric Values


Some MATLAB functions accept numeric data types but not datetime values as inputs. To apply these
functions to your date and time data, convert datetime values to meaningful numeric values. Then,
call the function. For example, the log function accepts double inputs, but not datetime inputs.
Suppose that you have a datetime array of dates spanning the course of a research study or
experiment.

t = datetime(2014,6,18) + calmonths(1:4)

t =

1×4 datetime array

7-45
7 Dates and Time

18-Jul-2014 18-Aug-2014 18-Sep-2014 18-Oct-2014

Subtract the origin value. For example, the origin value might be the starting day of an experiment.

dt = t - datetime(2014,7,1)

dt =

1×4 duration array

408:00:00 1152:00:00 1896:00:00 2616:00:00

dt is a duration array. Convert dt to a double array of values in units of years, days, hours,
minutes, or seconds using the years, days, hours, minutes, or seconds function, respectively.

x = hours(dt)

x =

408 1152 1896 2616

Pass the double array as the input to the log function.

y = log(x)

y =

6.0113 7.0493 7.5475 7.8694

See Also
cellstr | char | datenum | datetime | datevec | duration | string

More About
• “Represent Dates and Times in MATLAB” on page 7-2
• “Extract or Assign Date and Time Components of Datetime Array” on page 7-23
• Proleptic Gregorian Calendar

7-46
Carryover in Date Vectors and Strings

Carryover in Date Vectors and Strings


If an element falls outside the conventional range, MATLAB adjusts both that date vector element and
the previous element. For example, if the minutes element is 70, MATLAB adjusts the hours element
by 1 and sets the minutes element to 10. If the minutes element is -15, then MATLAB decreases the
hours element by 1 and sets the minutes element to 45. Month values are an exception. MATLAB sets
month values less than 1 to 1.

In the following example, the month element has a value of 22. MATLAB increments the year value to
2010 and sets the month to October.

datestr([2009 22 03 00 00 00])

ans =
03-Oct-2010

The carrying forward of values also applies to time and day values in text representing dates and
times. For example, October 3, 2010 and September 33, 2010 are interpreted to be the same date,
and correspond to the same serial date number.

datenum('03-Oct-2010')

ans =
734414

datenum('33-Sep-2010')

ans =
734414

The following example takes the input month (07, or July), finds the last day of the previous month
(June 30), and subtracts the number of days in the field specifier (5 days) from that date to yield a
return date of June 25, 2010.

datestr([2010 07 -05 00 00 00])

ans =
25-Jun-2010

7-47
7 Dates and Time

Converting Date Vector Returns Unexpected Output


Because a date vector is a 1-by-6 vector of numbers, datestr might interpret your input date vectors
as vectors of serial date numbers, or vice versa, and return unexpected output.

Consider a date vector that includes the year 3000. This year is outside the range of years that
datestr interprets as elements of date vectors. Therefore, the input is interpreted as a 1-by-6 vector
of serial date numbers:
datestr([3000 11 05 10 32 56])

ans =

18-Mar-0008
11-Jan-0000
05-Jan-0000
10-Jan-0000
01-Feb-0000
25-Feb-0000

Here datestr interprets 3000 as a serial date number, and converts it to the date string '18-
Mar-0008'. Also, datestr converts the next five elements to date strings.

When converting such a date vector to a character vector, first convert it to a serial date number
using datenum. Then, convert the date number to a character vector using datestr:
dn = datenum([3000 11 05 10 32 56]);
ds = datestr(dn)

ds =

05-Nov-3000 10:32:56

When converting dates to character vectors, datestr interprets input as either date vectors or serial
date numbers using a heuristic rule. Consider an m-by-6 matrix. datestr interprets the matrix as m
date vectors when:

• The first five columns contain integers.


• The absolute value of the sum of each row is in the range 1500–2500.

If either condition is false, for any row, then datestr interprets the m-by-6 matrix as m-by-6 serial
date numbers.

Usually, dates with years in the range 1700–2300 are interpreted as date vectors. However, datestr
might interpret rows with month, day, hour, minute, or second values outside their normal ranges as
serial date numbers. For example, datestr correctly interprets the following date vector for the year
2014:
datestr([2014 06 21 10 51 00])

ans =

21-Jun-2014 10:51:00

But given a day value outside the typical range (1–31), datestr returns a date for each element of
the vector:

7-48
Converting Date Vector Returns Unexpected Output

datestr([2014 06 2110 10 51 00])

ans =

06-Jul-0005
06-Jan-0000
10-Oct-0005
10-Jan-0000
20-Feb-0000
00-Jan-0000

When you have a matrix of date vectors that datestr might interpret incorrectly as serial date
numbers, first convert the matrix to serial date numbers using datenum. Then, use datestr to
convert the date numbers.

When you have a matrix of serial date numbers that datestr might interpret as date vectors, first
convert the matrix to a column vector. Then, use datestr to convert the column vector.

7-49
8

Categorical Arrays

• “Create Categorical Arrays” on page 8-2


• “Convert Text in Table Variables to Categorical” on page 8-6
• “Plot Categorical Data” on page 8-10
• “Compare Categorical Array Elements” on page 8-16
• “Combine Categorical Arrays” on page 8-19
• “Combine Categorical Arrays Using Multiplication” on page 8-22
• “Access Data Using Categorical Arrays” on page 8-24
• “Work with Protected Categorical Arrays” on page 8-30
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36
• “Core Functions Supporting Categorical Arrays” on page 8-39
8 Categorical Arrays

Create Categorical Arrays


This example shows how to create a categorical array. categorical is a data type for storing data
with values from a finite set of discrete categories. These categories can have a natural order, but it is
not required. A categorical array provides efficient storage and convenient manipulation of data,
while also maintaining meaningful names for the values. Categorical arrays are often used in a table
to define groups of rows.

By default, categorical arrays contain categories that have no mathematical ordering. For example,
the discrete set of pet categories {'dog' 'cat' 'bird'} has no meaningful mathematical
ordering, so MATLAB® uses the alphabetical ordering {'bird' 'cat' 'dog'}. Ordinal categorical
arrays contain categories that have a meaningful mathematical ordering. For example, the discrete
set of size categories {'small', 'medium', 'large'} has the mathematical ordering small <
medium < large.

When you create categorical arrays from cell arrays of character vectors or string arrays, leading and
trailing spaces are removed. For example, if you specify the text {' cat' 'dog '} as categories, then
when you convert them to categories they become {'cat' 'dog'}.

Create Categorical Array from Cell Array of Character Vectors

You can use the categorical function to create a categorical array from a numeric array, logical
array, string array, cell array of character vectors, or an existing categorical array.

Create a 1-by-11 cell array of character vectors containing state names from New England.

state = {'MA','ME','CT','VT','ME','NH','VT','MA','NH','CT','RI'};

Convert the cell array, state, to a categorical array that has no mathematical order.

state = categorical(state)

state = 1x11 categorical


Columns 1 through 9

MA ME CT VT ME NH VT MA NH

Columns 10 through 11

CT RI

class(state)

ans =
'categorical'

List the discrete categories in the variable state.

categories(state)

ans = 6x1 cell


{'CT'}
{'MA'}
{'ME'}
{'NH'}

8-2
Create Categorical Arrays

{'RI'}
{'VT'}

The categories are listed in alphabetical order.

Create Ordinal Categorical Array from Cell Array of Character Vectors

Create a 1-by-8 cell array of character vectors containing the sizes of eight objects.
AllSizes = {'medium','large','small','small','medium',...
'large','medium','small'};

The cell array, AllSizes, has three distinct values: 'large', 'medium', and 'small'. With the cell
array of character vectors, there is no convenient way to indicate that small < medium < large.

Convert the cell array, AllSizes, to an ordinal categorical array. Use valueset to specify the values
small, medium, and large, which define the categories. For an ordinal categorical array, the first
category specified is the smallest and the last category is the largest.
valueset = {'small','medium','large'};
sizeOrd = categorical(AllSizes,valueset,'Ordinal',true)

sizeOrd = 1x8 categorical


Columns 1 through 6

medium large small small medium large

Columns 7 through 8

medium small

class(sizeOrd)

ans =
'categorical'

The order of the values in the categorical array, sizeOrd, remains unchanged.

List the discrete categories in the categorical variable, sizeOrd.


categories(sizeOrd)

ans = 3x1 cell


{'small' }
{'medium'}
{'large' }

The categories are listed in the specified order to match the mathematical ordering small <
medium < large.

Create Ordinal Categorical Array by Binning Numeric Data

Create a vector of 100 random numbers between zero and 50.


x = rand(100,1)*50;

8-3
8 Categorical Arrays

Use the discretize function to create a categorical array by binning the values of x. Put all values
between zero and 15 in the first bin, all the values between 15 and 35 in the second bin, and all the
values between 35 and 50 in the third bin. Each bin includes the left endpoint, but does not include
the right endpoint.

catnames = {'small','medium','large'};
binnedData = discretize(x,[0 15 35 50],'categorical',catnames);

binnedData is a 100-by-1 ordinal categorical array with three categories, such that small <
medium < large.

Use the summary function to print the number of elements in each category.

summary(binnedData)

small 30
medium 35
large 35

Create Categorical Array from String Array

Starting in R2016b, you can create string arrays with the string function and convert them to
categorical array.

Create a string array that contains names of planets.

str = string({'Earth','Jupiter','Neptune','Jupiter','Mars','Earth'})

str = 1x6 string


"Earth" "Jupiter" "Neptune" "Jupiter" "Mars" "Earth"

Convert str to a categorical array.

planets = categorical(str)

planets = 1x6 categorical


Earth Jupiter Neptune Jupiter Mars Earth

Add missing elements to str and convert it to a categorical array. Where str has missing values,
planets has undefined values.

str(8) = 'Mars'

str = 1x8 string


Columns 1 through 6

"Earth" "Jupiter" "Neptune" "Jupiter" "Mars" "Earth"

Columns 7 through 8

<missing> "Mars"

planets = categorical(str)

planets = 1x8 categorical


Columns 1 through 6

8-4
Create Categorical Arrays

Earth Jupiter Neptune Jupiter Mars Earth

Columns 7 through 8

<undefined> Mars

See Also
categorical | categories | discretize | summary

Related Examples
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Access Data Using Categorical Arrays” on page 8-24
• “Compare Categorical Array Elements” on page 8-16

More About
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36

8-5
8 Categorical Arrays

Convert Text in Table Variables to Categorical


This example shows how to convert a variable in a table from a cell array of character vectors to a
categorical array.

Load Sample Data and Create a Table

Load sample data gathered from 100 patients.

load patients

whos

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 11412 cell
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 11540 cell
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

Store the patient data from Age, Gender, Height, Weight, SelfAssessedHealthStatus, and
Location in a table. Use the unique identifiers in the variable LastName as row names.

T = table(Age,Gender,Height,Weight,...
SelfAssessedHealthStatus,Location,...
'RowNames',LastName);

Convert Table Variables from Cell Arrays of Character Vectors to Categorical Arrays

The cell arrays of character vectors, Gender and Location, contain discrete sets of unique values.

Convert Gender and Location to categorical arrays.

[Link] = categorical([Link]);
[Link] = categorical([Link]);

The variable, SelfAssessedHealthStatus, contains four unique values: Excellent, Fair, Good,
and Poor.

Convert SelfAssessedHealthStatus to an ordinal categorical array, such that the categories have
the mathematical ordering Poor < Fair < Good < Excellent.

[Link] = categorical([Link],...
{'Poor','Fair','Good','Excellent'},'Ordinal',true);

Print a Summary

View the data type, description, units, and other descriptive statistics for each variable by using
summary to summarize the table.

8-6
Convert Text in Table Variables to Categorical

format compact

summary(T)

Variables:
Age: 100x1 double
Values:
Min 25
Median 39
Max 50
Gender: 100x1 categorical
Values:
Female 53
Male 47
Height: 100x1 double
Values:
Min 60
Median 67
Max 72
Weight: 100x1 double
Values:
Min 111
Median 142.5
Max 202
SelfAssessedHealthStatus: 100x1 ordinal categorical
Values:
Poor 11
Fair 15
Good 40
Excellent 34
Location: 100x1 categorical
Values:
County General Hospital 39
St. Mary s Medical Center 24
VA Hospital 37

The table variables Gender, SelfAssessedHealthStatus, and Location are categorical arrays.
The summary contains the counts of the number of elements in each category. For example, the
summary indicates that 53 of the 100 patients are female and 47 are male.

Select Data Based on Categories

Create a subtable, T1, containing the age, height, and weight of all female patients who were
observed at County General Hospital. You can easily create a logical vector based on the values in the
categorical arrays Gender and Location.

rows = [Link]=='County General Hospital' & [Link]=='Female';

rows is a 100-by-1 logical vector with logical true (1) for the table rows where the gender is female
and the location is County General Hospital.

Define the subset of variables.

vars = {'Age','Height','Weight'};

Use parentheses to create the subtable, T1.

T1 = T(rows,vars)

8-7
8 Categorical Arrays

T1=19×3 table
Age Height Weight
___ ______ ______
Brown 49 64 119
Taylor 31 66 132
Anderson 45 68 128
Lee 44 66 146
Walker 28 65 123
Young 25 63 114
Campbell 37 65 135
Evans 39 62 121
Morris 43 64 135
Rivera 29 63 130
Richardson 30 67 141
Cox 28 66 111
Torres 45 70 137
Peterson 32 60 136
Ramirez 48 64 137
Bennett 35 64 131

A is a 19-by-3 table.

Since ordinal categorical arrays have a mathematical ordering for their categories, you can perform
element-wise comparisons of them with relational operations, such as greater than and less than.

Create a subtable, T2, of the gender, age, height, and weight of all patients who assessed their health
status as poor or fair.

First, define the subset of rows to include in table T2.

rows = [Link]<='Fair';

Then, define the subset of variables to include in table T2.

vars = {'Gender','Age','Height','Weight'};

Use parentheses to create the subtable T2.

T2 = T(rows,vars)

T2=26×4 table
Gender Age Height Weight
______ ___ ______ ______
Johnson Male 43 69 163
Jones Female 40 67 133
Thomas Female 42 66 137
Jackson Male 25 71 174
Garcia Female 27 69 131
Rodriguez Female 39 64 117
Lewis Female 41 62 137
Lee Female 44 66 146
Hall Male 25 70 189
Hernandez Male 36 68 166
Lopez Female 40 66 137
Gonzalez Female 35 66 118
Mitchell Male 39 71 164

8-8
Convert Text in Table Variables to Categorical

Campbell Female 37 65 135


Parker Male 30 68 182
Stewart Male 49 68 170

T2 is a 26-by-4 table.

See Also

Related Examples
• “Create and Work with Tables” on page 9-2
• “Create Categorical Arrays” on page 8-2
• “Access Data in Tables” on page 9-34
• “Access Data Using Categorical Arrays” on page 8-24

More About
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36

8-9
8 Categorical Arrays

Plot Categorical Data


This example shows how to plot data from a categorical array.

Load Sample Data

Load sample data gathered from 100 patients.

load patients

whos

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 11412 cell
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 11540 cell
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

Create Categorical Arrays from Cell Arrays of Character Vectors

The workspace variable, Location, is a cell array of character vectors that contains the three unique
medical facilities where patients were observed.

To access and compare data more easily, convert Location to a categorical array.

Location = categorical(Location);

Summarize the categorical array.

summary(Location)

County General Hospital 39


St. Mary's Medical Center 24
VA Hospital 37

39 patients were observed at County General Hospital, 24 at St. Mary's Medical Center, and 37 at the
VA Hospital.

The workspace variable, SelfAssessedHealthStatus, contains four unique values, Excellent,


Fair, Good, and Poor.

Convert SelfAssessedHealthStatus to an ordinal categorical array, such that the categories have
the mathematical ordering Poor < Fair < Good < Excellent.

SelfAssessedHealthStatus = categorical(SelfAssessedHealthStatus,...
{'Poor' 'Fair' 'Good' 'Excellent'},'Ordinal',true);

Summarize the categorical array, SelfAssessedHealthStatus.

summary(SelfAssessedHealthStatus)

8-10
Plot Categorical Data

Poor 11
Fair 15
Good 40
Excellent 34

Plot Histogram

Create a histogram bar plot directly from a categorical array.

figure
histogram(SelfAssessedHealthStatus)
title('Self Assessed Health Status From 100 Patients')

The function histogram accepts the categorical array, SelfAssessedHealthStatus, and plots the
category counts for each of the four categories.

Create a histogram of the hospital location for only the patients who assessed their health as Fair or
Poor.

figure
histogram(Location(SelfAssessedHealthStatus<='Fair'))
title('Location of Patients in Fair or Poor Health')

8-11
8 Categorical Arrays

Create Pie Chart

Create a pie chart directly from a categorical array.

figure
pie(SelfAssessedHealthStatus);
title('Self Assessed Health Status From 100 Patients')

8-12
Plot Categorical Data

The function pie accepts the categorical array, SelfAssessedHealthStatus, and plots a pie chart
of the four categories.

Create Pareto Chart

Create a Pareto chart from the category counts for each of the four categories of
SelfAssessedHealthStatus.

figure
A = countcats(SelfAssessedHealthStatus);
C = categories(SelfAssessedHealthStatus);
pareto(A,C);
title('Self Assessed Health Status From 100 Patients')

8-13
8 Categorical Arrays

The first input argument to pareto must be a vector. If a categorical array is a matrix or
multidimensional array, reshape it into a vector before calling countcats and pareto.

Create Scatter Plot

Convert the cell array of character vectors to a categorical array.

Gender = categorical(Gender);

Summarize the categorical array, Gender.

summary(Gender)

Female 53
Male 47

Gender is a 100-by-1 categorical array with two categories, Female and Male.

Use the categorical array, Gender, to access Weight and Height data for each gender separately.

X1 = Weight(Gender=='Female');
Y1 = Height(Gender=='Female');

X2 = Weight(Gender=='Male');
Y2 = Height(Gender=='Male');

X1 and Y1 are 53-by-1 numeric arrays containing data from the female patients.

8-14
Plot Categorical Data

X2 and Y2 are 47-by-1 numeric arrays containing data from the male patients.

Create a scatter plot of height vs. weight. Indicate data from the female patients with a circle and
data from the male patients with a cross.

figure
h1 = scatter(X1,Y1,'o');
hold on
h2 = scatter(X2,Y2,'x');

title('Height vs. Weight')


xlabel('Weight (lbs)')
ylabel('Height (in)')

See Also
bar | categorical | countcats | histogram | pie | rose | scatter | summary

Related Examples
• “Access Data Using Categorical Arrays” on page 8-24

8-15
8 Categorical Arrays

Compare Categorical Array Elements


This example shows how to use relational operations with a categorical array.

Create Categorical Array from Cell Array of Character Vectors

Create a 2-by-4 cell array of character vectors.

C = {'blue' 'red' 'green' 'blue';...


'blue' 'green' 'green' 'blue'};

colors = categorical(C)

colors = 2x4 categorical


blue red green blue
blue green green blue

colors is a 2-by-4 categorical array.

List the categories of the categorical array.

categories(colors)

ans = 3x1 cell


{'blue' }
{'green'}
{'red' }

Determine If Elements Are Equal

Use the relational operator, eq (==), to compare the first and second rows of colors.

colors(1,:) == colors(2,:)

ans = 1x4 logical array

1 0 1 1

Only the values in the second column differ between the rows.

Compare Entire Array to Character Vector

Compare the entire categorical array, colors, to the character vector 'blue' to find the location of
all blue values.

colors == 'blue'

ans = 2x4 logical array

1 0 0 1
1 0 0 1

There are four blue entries in colors, one in each corner of the array.

8-16
Compare Categorical Array Elements

Convert to an Ordinal Categorical Array

Add a mathematical ordering to the categories in colors. Specify the category order that represents
the ordering of color spectrum, red < green < blue.

colors = categorical(colors,{'red','green' 'blue'},'Ordinal',true)

colors = 2x4 categorical


blue red green blue
blue green green blue

The elements in the categorical array remain the same.

List the discrete categories in colors.

categories(colors)

ans = 3x1 cell


{'red' }
{'green'}
{'blue' }

Compare Elements Based on Order

Determine if elements in the first column of colors are greater than the elements in the second
column.

colors(:,1) > colors(:,2)

ans = 2x1 logical array

1
1

Both values in the first column, blue, are greater than the corresponding values in the second
column, red and green.

Find all the elements in colors that are less than 'blue'.

colors < 'blue'

ans = 2x4 logical array

0 1 1 0
0 1 1 0

The function lt (<) indicates the location of all green and red values with 1.

See Also
categorical | categories

8-17
8 Categorical Arrays

Related Examples
• “Access Data Using Categorical Arrays” on page 8-24

More About
• “Relational Operations”
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36

8-18
Combine Categorical Arrays

Combine Categorical Arrays


This example shows how to combine two categorical arrays.

Create Categorical Arrays

Create a categorical array, A, containing the preferred lunchtime beverage of 25 students in


classroom A.

rng('default')
A = randi(3,[25,1]);
A = categorical(A,1:3,{'milk' 'water' 'juice'});

A is a 25-by-1 categorical array with three distinct categories: milk, water, and juice.

Summarize the categorical array, A.

summary(A)

milk 6
water 5
juice 14

Six students in classroom A prefer milk, five prefer water, and fourteen prefer juice.

Create another categorical array, B, containing the preferences of 28 students in classroom B.

B = randi(3,[28,1]);
B = categorical(B,1:3,{'milk' 'water' 'juice'});

B is a 28-by-1 categorical array containing the same categories as A.

Summarize the categorical array, B.

summary(B)

milk 9
water 8
juice 11

Nine students in classroom B prefer milk, eight prefer water, and eleven prefer juice.

Concatenate Categorical Arrays

Concatenate the data from classrooms A and B into a single categorical array, Group1.

Group1 = [A;B];

Summarize the categorical array, Group1

summary(Group1)

milk 15
water 13
juice 25

Group1 is a 53-by-1 categorical array with three categories: milk, water, and juice.

8-19
8 Categorical Arrays

Create Categorical Array with Different Categories

Create a categorical array, Group2, containing data from 50 students who were given the additional
beverage option of soda.

Group2 = randi(4,[50,1]);
Group2 = categorical(Group2,1:4,{'juice' 'milk' 'soda' 'water'});

Summarize the categorical array, Group2.

summary(Group2)

juice 12
milk 14
soda 10
water 14

Group2 is a 50-by-1 categorical array with four categories: juice, milk, soda, and water.

Concatenate Arrays with Different Categories

Concatenate the data from Group1 and Group2.

students = [Group1;Group2];

Summarize the resulting categorical array, students.

summary(students)

milk 29
water 27
juice 37
soda 10

Concatenation appends the categories exclusive to the second input, soda, to the end of the list of
categories from the first input, milk, water, juice, soda.

Use reordercats to change the order of the categories in the categorical array, students.

students = reordercats(students,{'juice','milk','water','soda'});

categories(students)

ans = 4x1 cell


{'juice'}
{'milk' }
{'water'}
{'soda' }

Union of Categorical Arrays

Use the function union to find the unique responses from Group1 and Group2.

C = union(Group1,Group2)

C = 4x1 categorical
milk
water

8-20
Combine Categorical Arrays

juice
soda

union returns the combined values from Group1 and Group2 with no repetitions. In this case, C is
equivalent to the categories of the concatenation, students.

All of the categorical arrays in this example were nonordinal. To combine ordinal categorical arrays,
they must have the same sets of categories including their order.

See Also
cat | categorical | categories | horzcat | summary | union | vertcat

Related Examples
• “Create Categorical Arrays” on page 8-2
• “Combine Categorical Arrays Using Multiplication” on page 8-22
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Access Data Using Categorical Arrays” on page 8-24

More About
• “Ordinal Categorical Arrays” on page 8-36

8-21
8 Categorical Arrays

Combine Categorical Arrays Using Multiplication


This example shows how to use the times function to combine categorical arrays, including ordinal
categorical arrays and arrays with undefined elements. When you call times on two categorical
arrays, the output is a categorical array with new categories. The set of new categories is the set of
all the ordered pairs created from the categories of the input arrays, or the Cartesian product. times
forms each element of the output array as the ordered pair of the corresponding elements of the
input arrays. The output array has the same size as the input arrays.

Combine Two Categorical Arrays

Combine two categorical arrays using times. The input arrays must have the same number of
elements, but can have different numbers of categories.

A = categorical({'blue','red','green'});
B = categorical({'+','-','+'});
C = A.*B

C = 1x3 categorical
blue + red - green +

Cartesian Product of Categories

Show the categories of C. The categories are all the ordered pairs that can be created from the
categories of A and B, also known as the Cartesian product.

categories(C)

ans = 6x1 cell


{'blue +' }
{'blue -' }
{'green +'}
{'green -'}
{'red +' }
{'red -' }

As a consequence, A.*B does not equal B.*A.

D = B.*A

D = 1x3 categorical
+ blue - red + green

categories(D)

ans = 6x1 cell


{'+ blue' }
{'+ green'}
{'+ red' }
{'- blue' }
{'- green'}
{'- red' }

8-22
Combine Categorical Arrays Using Multiplication

Multiplication with Undefined Elements

Combine two categorical arrays. If either A or B have an undefined element, the corresponding
element of C is undefined.

A = categorical({'blue','red','green','black'});
B = categorical({'+','-','+','-'});
A = removecats(A,{'black'});
C = A.*B

C = 1x4 categorical
blue + red - green + <undefined>

Cartesian Product of Ordinal Categorical Arrays

Combine two ordinal categorical arrays. C is an ordinal categorical array only if A and B are both
ordinal. The ordering of the categories of C follows from the orderings of the input categorical arrays.

A = categorical({'blue','red','green'},{'green','red','blue'},'Ordinal',true);
B = categorical({'+','-','+'},'Ordinal',true);
C = A.*B;
categories(C)

ans = 6x1 cell


{'green +'}
{'green -'}
{'red +' }
{'red -' }
{'blue +' }
{'blue -' }

See Also
categorical | categories | summary | times

Related Examples
• “Create Categorical Arrays” on page 8-2
• “Combine Categorical Arrays” on page 8-19
• “Access Data Using Categorical Arrays” on page 8-24

More About
• “Ordinal Categorical Arrays” on page 8-36

8-23
8 Categorical Arrays

Access Data Using Categorical Arrays

In this section...
“Select Data By Category” on page 8-24
“Common Ways to Access Data Using Categorical Arrays” on page 8-24

Select Data By Category


Selecting data based on its values is often useful. This type of data selection can involve creating a
logical vector based on values in one variable, and then using that logical vector to select a subset of
values in other variables. You can create a logical vector for selecting data by finding values in a
numeric array that fall within a certain range. Additionally, you can create the logical vector by
finding specific discrete values. When using categorical arrays, you can easily:

• Select elements from particular categories. For categorical arrays, use the logical operators
== or ~= to select data that is in, or not in, a particular category. To select data in a particular
group of categories, use the ismember function.

For ordinal categorical arrays, use inequalities >, >=, <, or <= to find data in categories above or
below a particular category.
• Delete data that is in a particular category. Use logical operators to include or exclude data
from particular categories.
• Find elements that are not in a defined category. Categorical arrays indicate which elements
do not belong to a defined category by <undefined>. Use the isundefined function to find
observations without a defined value.

Common Ways to Access Data Using Categorical Arrays


This example shows how to index and search using categorical arrays. You can access data using
categorical arrays stored within a table in a similar manner.

Load Sample Data

Load sample data gathered from 100 patients.

load patients
whos

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 11412 cell
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 11540 cell
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

8-24
Access Data Using Categorical Arrays

Create Categorical Arrays from Cell Arrays of Character Vectors

Gender and Location contain data that belong in categories. Each cell array contains character
vectors taken from a small set of unique values (indicating two genders and three locations
respectively). Convert Gender and Location to categorical arrays.

Gender = categorical(Gender);
Location = categorical(Location);

Search for Members of a Single Category

For categorical arrays, you can use the logical operators == and ~= to find the data that is in, or not
in, a particular category.

Determine if there are any patients observed at the location, 'Rampart General Hospital'.

any(Location=='Rampart General Hospital')

ans = logical
0

There are no patients observed at Rampart General Hospital.

Search for Members of a Group of Categories

You can use ismember to find data in a particular group of categories. Create a logical vector for the
patients observed at County General Hospital or VA Hospital.

VA_CountyGenIndex = ...
ismember(Location,{'County General Hospital','VA Hospital'});

VA_CountyGenIndex is a 100-by-1 logical array containing logical true (1) for each element in the
categorical array Location that is a member of the category County General Hospital or VA
Hospital. The output, VA_CountyGenIndex contains 76 nonzero elements.

Use the logical vector, VA_CountyGenIndex to select the LastName of the patients observed at
either County General Hospital or VA Hospital.

VA_CountyGenPatients = LastName(VA_CountyGenIndex);

VA_CountyGenPatients is a 76-by-1 cell array of character vectors.

Select Elements in a Particular Category to Plot

Use the summary function to print a summary containing the category names and the number of
elements in each category.

summary(Location)

County General Hospital 39


St. Mary's Medical Center 24
VA Hospital 37

Location is a 100-by-1 categorical array with three categories. County General Hospital
occurs in 39 elements, St. Mary s Medical Center in 24 elements, and VA Hospital in 37
elements.

8-25
8 Categorical Arrays

Use the summary function to print a summary of Gender.


summary(Gender)

Female 53
Male 47

Gender is a 100-by-1 categorical array with two categories. Female occurs in 53 elements and Male
occurs in 47 elements.

Use logical operator == to access the age of only the female patients. Then plot a histogram of this
data.
figure()
histogram(Age(Gender=='Female'))
title('Age of Female Patients')

histogram(Age(Gender=='Female')) plots the age data for the 53 female patients.

Delete Data from a Particular Category

You can use logical operators to include or exclude data from particular categories. Delete all patients
observed at VA Hospital from the workspace variables, Age and Location.
Age = Age(Location~='VA Hospital');
Location = Location(Location~='VA Hospital');

Now, Age is a 63-by-1 numeric array, and Location is a 63-by-1 categorical array.

8-26
Access Data Using Categorical Arrays

List the categories of Location, as well as the number of elements in each category.

summary(Location)

County General Hospital 39


St. Mary's Medical Center 24
VA Hospital 0

The patients observed at VA Hospital are deleted from Location, but VA Hospital is still a
category.

Use the removecats function to remove VA Hospital from the categories of Location.

Location = removecats(Location,'VA Hospital');

Verify that the category, VA Hospital, was removed.

categories(Location)

ans = 2x1 cell


{'County General Hospital' }
{'St. Mary's Medical Center'}

Location is a 63-by-1 categorical array that has two categories.

Delete Element

You can delete elements by indexing. For example, you can remove the first element of Location by
selecting the rest of the elements with Location(2:end). However, an easier way to delete
elements is to use [].

Location(1) = [];
summary(Location)

County General Hospital 38


St. Mary's Medical Center 24

Location is a 62-by-1 categorical array that has two categories. Deleting the first element has no
effect on other elements from the same category and does not delete the category itself.

Check for Undefined Data

Remove the category County General Hospital from Location.

Location = removecats(Location,'County General Hospital');

Display the first eight elements of the categorical array, Location.

Location(1:8)

ans = 8x1 categorical


St. Mary's Medical Center
<undefined>
St. Mary's Medical Center
St. Mary's Medical Center
<undefined>
<undefined>
St. Mary's Medical Center

8-27
8 Categorical Arrays

St. Mary's Medical Center

After removing the category, County General Hospital, elements that previously belonged to
that category no longer belong to any category defined for Location. Categorical arrays denote
these elements as undefined.

Use the function isundefined to find observations that do not belong to any category.

undefinedIndex = isundefined(Location);

undefinedIndex is a 62-by-1 categorical array containing logical true (1) for all undefined
elements in Location.

Set Undefined Elements

Use the summary function to print the number of undefined elements in Location.

summary(Location)

St. Mary's Medical Center 24


<undefined> 38

The first element of Location belongs to the category, St. Mary's Medical Center. Set the first
element to be undefined so that it no longer belongs to any category.

Location(1) = '<undefined>';
summary(Location)

St. Mary's Medical Center 23


<undefined> 39

You can make selected elements undefined without removing a category or changing the categories
of other elements. Set elements to be undefined to indicate elements with values that are unknown.

Preallocate Categorical Arrays with Undefined Elements

You can use undefined elements to preallocate the size of a categorical array for better performance.
Create a categorical array that has elements with known locations only.

definedIndex = ~isundefined(Location);
newLocation = Location(definedIndex);
summary(newLocation)

St. Mary's Medical Center 23

Expand the size of newLocation so that it is a 200-by-1 categorical array. Set the last new element
to be undefined. All of the other new elements also are set to be undefined. The 23 original
elements keep the values they had.

newLocation(200) = '<undefined>';
summary(newLocation)

St. Mary's Medical Center 23


<undefined> 177

8-28
Access Data Using Categorical Arrays

newLocation has room for values you plan to store in the array later.

See Also
any | categorical | categories | histogram | isundefined | removecats | summary

Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Plot Categorical Data” on page 8-10
• “Compare Categorical Array Elements” on page 8-16
• “Work with Protected Categorical Arrays” on page 8-30

More About
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36

8-29
8 Categorical Arrays

Work with Protected Categorical Arrays


This example shows how to work with a categorical array with protected categories.

When you create a categorical array with the categorical function, you have the option of
specifying whether or not the categories are protected. Ordinal categorical arrays always have
protected categories, but you also can create a nonordinal categorical array that is protected using
the 'Protected',true name-value pair argument.

When you assign values that are not in the array's list of categories, the array updates automatically
so that its list of categories includes the new values. Similarly, you can combine (nonordinal)
categorical arrays that have different categories. The categories in the result include the categories
from both arrays.

When you assign new values to a protected categorical array, the values must belong to one of the
existing categories. Similarly, you can only combine protected arrays that have the same categories.

• If you want to combine two nonordinal categorical arrays that have protected categories, they
must have the same categories, but the order does not matter. The resulting categorical array
uses the category order from the first array.
• If you want to combine two ordinal categorical array (that always have protected categories), they
must have the same categories, including their order.

To add new categories to the array, you must use the function addcats.

Create Ordinal Categorical Array

Create a categorical array containing the sizes of 10 objects. Use the names small, medium, and
large for the values 'S', 'M', and 'L'.
A = categorical({'M';'L';'S';'S';'M';'L';'M';'L';'M';'S'},...
{'S','M','L'},{'small','medium','large'},'Ordinal',true)

A = 10x1 categorical
medium
large
small
small
medium
large
medium
large
medium
small

A is a 10-by-1 categorical array.

Display the categories of A.


categories(A)

ans = 3x1 cell


{'small' }
{'medium'}
{'large' }

8-30
Work with Protected Categorical Arrays

Verify That Categories Are Protected

When you create an ordinal categorical array, the categories are always protected.

Use the isprotected function to verify that the categories of A are protected.

tf = isprotected(A)

tf = logical
1

The categories of A are protected.

Assign Value in New Category

If you try to assign a new value that does not belong to one of the existing categories, then MATLAB®
returns an error. For example, you cannot assign the value 'xlarge' to the categorical array, as in
the expression A(2) = 'xlarge', because xlarge is not a category of A. Instead, MATLAB®
returns the error:

Error using categorical/subsasgn (line 68)

Cannot add a new category 'xlarge' to this categorical array

because its categories are protected. Use ADDCATS to

add the new category.

To add a new category for xlarge, use the addcats function. Since A is ordinal you must specify the
order for the new category.

A = addcats(A,'xlarge','After','large');

Now, assign a value for 'xlarge', since it has an existing category.

A(2) = 'xlarge'

A = 10x1 categorical
medium
xlarge
small
small
medium
large
medium
large
medium
small

A is now a 10-by-1 categorical array with four categories, such that small < medium < large <
xlarge.

Combine Two Ordinal Categorical Arrays

Create another ordinal categorical array, B, containing the sizes of five items.

8-31
8 Categorical Arrays

B = categorical([2;1;1;2;2],1:2,{'xsmall','small'},'Ordinal',true)

B = 5x1 categorical
small
xsmall
xsmall
small
small

B is a 5-by-1 categorical array with two categories such that xsmall < small.

To combine two ordinal categorical arrays (which always have protected categories), they must have
the same categories and the categories must be in the same order.

Add the category 'xsmall' to A before the category 'small'.

A = addcats(A,'xsmall','Before','small');

categories(A)

ans = 5x1 cell


{'xsmall'}
{'small' }
{'medium'}
{'large' }
{'xlarge'}

Add the categories {'medium','large','xlarge'} to B after the category 'small'.

B = addcats(B,{'medium','large','xlarge'},'After','small');

categories(B)

ans = 5x1 cell


{'xsmall'}
{'small' }
{'medium'}
{'large' }
{'xlarge'}

The categories of A and B are now the same including their order.

Vertically concatenate A and B.

C = [A;B]

C = 15x1 categorical
medium
xlarge
small
small
medium
large
medium
large
medium

8-32
Work with Protected Categorical Arrays

small
small
xsmall
xsmall
small
small

The values from B are appended to the values from A.

List the categories of C.

categories(C)

ans = 5x1 cell


{'xsmall'}
{'small' }
{'medium'}
{'large' }
{'xlarge'}

C is a 16-by-1 ordinal categorical array with five categories, such that xsmall < small < medium
< large < xlarge.

See Also
addcats | categorical | categories | isordinal | isprotected | summary

Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Access Data Using Categorical Arrays” on page 8-24
• “Combine Categorical Arrays” on page 8-19
• “Combine Categorical Arrays Using Multiplication” on page 8-22

More About
• “Ordinal Categorical Arrays” on page 8-36

8-33
8 Categorical Arrays

Advantages of Using Categorical Arrays

In this section...
“Natural Representation of Categorical Data” on page 8-34
“Mathematical Ordering for Character Vectors” on page 8-34
“Reduce Memory Requirements” on page 8-34

Natural Representation of Categorical Data


categorical is a data type to store data with values from a finite set of discrete categories. One
common alternative to using categorical arrays is to use character arrays or cell arrays of character
vectors. To compare values in character arrays and cell arrays of character vectors, you must use
strcmp which can be cumbersome. With categorical arrays, you can use the logical operator eq (==)
to compare elements in the same way that you compare numeric arrays. The other common
alternative to using categorical arrays is to store categorical data using integers in numeric arrays.
Using numeric arrays loses all the useful descriptive information from the category names, and also
tends to suggest that the integer values have their usual numeric meaning, which, for categorical
data, they do not.

Mathematical Ordering for Character Vectors


Categorical arrays are convenient and memory efficient containers for nonnumeric data with values
from a finite set of discrete categories. They are especially useful when the categories have a
meaningful mathematical ordering, such as an array with entries from the discrete set of categories
{'small','medium','large'} where small < medium < large.

An ordering other than alphabetical order is not possible with character arrays or cell arrays of
character vectors. Thus, inequality comparisons, such as greater and less than, are not possible. With
categorical arrays, you can use relational operations to test for equality and perform element-wise
comparisons that have a meaningful mathematical ordering.

Reduce Memory Requirements


This example shows how to compare the memory required to store data as a cell array of character
vectors versus a categorical array. Categorical arrays have categories that are defined as character
vectors, which can be costly to store and manipulate in a cell array of character vectors or char
array. Categorical arrays store only one copy of each category name, often reducing the amount of
memory required to store the array.

Create a sample cell array of character vectors.

state = [repmat({'MA'},25,1);repmat({'NY'},25,1);...
repmat({'CA'},50,1);...
repmat({'MA'},25,1);repmat({'NY'},25,1)];

Display information about the variable state.

whos state

8-34
Advantages of Using Categorical Arrays

Name Size Bytes Class Attributes

state 150x1 16200 cell

The variable state is a cell array of character vectors requiring 17,400 bytes of memory.

Convert state to a categorical array.

state = categorical(state);

Display the discrete categories in the variable state.

categories(state)

ans = 3x1 cell


{'CA'}
{'MA'}
{'NY'}

state contains 150 elements, but only three distinct categories.

Display information about the variable state.

whos state

Name Size Bytes Class Attributes

state 150x1 476 categorical

There is a significant reduction in the memory required to store the variable.

See Also
categorical | categories

Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Compare Categorical Array Elements” on page 8-16
• “Access Data Using Categorical Arrays” on page 8-24

More About
• “Ordinal Categorical Arrays” on page 8-36

8-35
8 Categorical Arrays

Ordinal Categorical Arrays


In this section...
“Order of Categories” on page 8-36
“How to Create Ordinal Categorical Arrays” on page 8-36
“Working with Ordinal Categorical Arrays” on page 8-38

Order of Categories
categorical is a data type to store data with values from a finite set of discrete categories, which
can have a natural order. You can specify and rearrange the order of categories in all categorical
arrays. However, you only can treat ordinal categorical arrays as having a mathematical ordering to
their categories. Use an ordinal categorical array if you want to use the functions min, max, or
relational operations, such as greater than and less than.

The discrete set of pet categories {'dog' 'cat' 'bird'} has no meaningful mathematical
ordering. You are free to use any category order and the meaning of the associated data does not
change. For example, pets = categorical({'bird','cat','dog','dog','cat'}) creates a
categorical array and the categories are listed in alphabetical order, {'bird' 'cat' 'dog'}. You
can choose to specify or change the order of the categories to {'dog' 'cat' 'bird'} and the
meaning of the data does not change.

ordinal categorical arrays contain categories that have a meaningful mathematical ordering. For
example, the discrete set of size categories {'small', 'medium', 'large'} has the
mathematical ordering small < medium < large. The first category listed is the smallest and the
last category is the largest. The order of the categories in an ordinal categorical array affects the
result from relational comparisons of ordinal categorical arrays.

How to Create Ordinal Categorical Arrays


This example shows how to create an ordinal categorical array using the categorical function with
the 'Ordinal',true name-value pair argument.

Ordinal Categorical Array from a Cell Array of Character Vectors

Create an ordinal categorical array, sizes, from a cell array of character vectors, A. Use valueset,
specified as a vector of unique values, to define the categories for sizes.

A = {'medium' 'large';'small' 'medium'; 'large' 'small'};


valueset = {'small', 'medium', 'large'};

sizes = categorical(A,valueset,'Ordinal',true)

sizes = 3x2 categorical


medium large
small medium
large small

sizes is 3-by-2 ordinal categorical array with three categories such that small < medium <
large. The order of the values in valueset becomes the order of the categories of sizes.

8-36
Ordinal Categorical Arrays

Ordinal Categorical Array from Integers

Create an equivalent categorical array from an array of integers. Use the values 1, 2, and 3 to define
the categories small, medium, and large, respectively.

A2 = [2 3; 1 2; 3 1];
valueset = 1:3;
catnames = {'small','medium','large'};

sizes2 = categorical(A2,valueset,catnames,'Ordinal',true)

sizes2 = 3x2 categorical


medium large
small medium
large small

Compare sizes and sizes2

isequal(sizes,sizes2)

ans = logical
1

sizes and sizes2 are equivalent categorical arrays with the same ordering of categories.

Convert a Categorical Array from Nonordinal to Ordinal

Create a nonordinal categorical array from the cell array of character vectors, A.

sizes3 = categorical(A)

sizes3 = 3x2 categorical


medium large
small medium
large small

Determine if the categorical array is ordinal.

isordinal(sizes3)

ans = logical
0

sizes3 is a nonordinal categorical array with three categories, {'large','medium','small'}.


The categories of sizes3 are the sorted unique values from A. You must use the input argument,
valueset, to specify a different category order.

Convert sizes3 to an ordinal categorical array, such that small < medium < large.

sizes3 = categorical(sizes3,{'small','medium','large'},'Ordinal',true);

8-37
8 Categorical Arrays

sizes3 is now a 3-by-2 ordinal categorical array equivalent to sizes and sizes2.

Working with Ordinal Categorical Arrays


In order to combine or compare two categorical arrays, the sets of categories for both input arrays
must be identical, including their order. Furthermore, ordinal categorical arrays are always
protected. Therefore, when you assign values to an ordinal categorical array, the values must belong
to one of the existing categories. For more information see “Work with Protected Categorical Arrays”
on page 8-30.

See Also
categorical | categories | isequal | isordinal

Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Compare Categorical Array Elements” on page 8-16
• “Access Data Using Categorical Arrays” on page 8-24

More About
• “Advantages of Using Categorical Arrays” on page 8-34

8-38
Core Functions Supporting Categorical Arrays

Core Functions Supporting Categorical Arrays


Many functions in MATLAB operate on categorical arrays in much the same way that they operate on
other arrays. A few of these functions might exhibit special behavior when operating on a categorical
array. If multiple input arguments are ordinal categorical arrays, the function often requires that they
have the same set of categories, including order. Furthermore, a few functions, such as max and gt,
require that the input categorical arrays are ordinal.

The following table lists notable MATLAB functions that operate on categorical arrays in addition to
other arrays.

size isequal intersect plot double


length isequaln ismember plot3 single
ndims setdiff scatter int8
numel eq setxor scatter3 int16
ne unique bar int32
isrow lt union barh int64
iscolumn le histogram uint8
ge times uint16
cat gt pie uint32
horzcat sort rose uint64
vertcat min sortrows stem char
max issorted stairs string
median area cellstr
mode permute mesh
reshape surf
transpose surface
ctranspose
semilogx
semilogy
fill
fill3
line
text

8-39
9

Tables

• “Create and Work with Tables” on page 9-2


• “Add and Delete Table Rows” on page 9-11
• “Add, Delete, and Rearrange Table Variables” on page 9-14
• “Clean Messy and Missing Data in Tables” on page 9-21
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26
• “Add Custom Properties to Tables and Timetables” on page 9-29
• “Access Data in Tables” on page 9-34
• “Calculations on Tables” on page 9-47
• “Split Data into Groups and Calculate Statistics” on page 9-50
• “Split Table Data Variables and Apply Functions” on page 9-53
• “Advantages of Using Tables” on page 9-57
• “Grouping Variables To Split Data” on page 9-62
• “Changes to DimensionNames Property in R2016b” on page 9-65
9 Tables

Create and Work with Tables


This example shows how to create a table from workspace variables, work with table data, and write
tables to files for later use. table is a data type for collecting heterogeneous data and metadata
properties such as variable names, row names, descriptions, and variable units, in a single container.

Tables are suitable for column-oriented or tabular data that are often stored as columns in a text file
or in a spreadsheet. Each variable in a table can have a different data type, but must have the same
number of rows. However, variables in a table are not restricted to column vectors. For example, a
table variable can contain a matrix with multiple columns as long as it has the same number of rows
as the other table variables. A typical use for a table is to store experimental data, where rows
represent different observations and columns represent different measured variables.

Tables are convenient containers for collecting and organizing related data variables and for viewing
and summarizing data. For example, you can extract variables to perform calculations and
conveniently add the results as new table variables. When you finish your calculations, write the table
to a file to save your results.

Create and View Table

Create a table from workspace variables and view it. Alternatively, use the Import Tool or the
readtable function to create a table from a spreadsheet or a text file. When you import data from a
file using these functions, each column becomes a table variable.

Load sample data for 100 patients from the patients MAT-file to workspace variables.

load patients
whos

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 11412 cell
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 11540 cell
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

Populate a table with column-oriented variables that contain patient data. You can access and assign
table variables by name. When you assign a table variable from a workspace variable, you can assign
the table variable a different name.

Create a table and populate it with the Gender, Smoker, Height, and Weight workspace variables.
Display the first five rows.

T = table(Gender,Smoker,Height,Weight);
T(1:5,:)

ans=5×4 table
Gender Smoker Height Weight
__________ ______ ______ ______

9-2
Create and Work with Tables

{'Male' } true 71 176


{'Male' } false 69 163
{'Female'} false 64 131
{'Female'} false 67 133
{'Female'} false 64 119

As an alternative, use the readtable function to read the patient data from a comma-delimited file.
readtable reads all the columns that are in a file.

Create a table by reading all columns from the file, [Link].

T2 = readtable('[Link]');
T2(1:5,:)

ans=5×10 table
LastName Gender Age Location Height Weight Smo
____________ __________ ___ _____________________________ ______ ______ ___

{'Smith' } {'Male' } 38 {'County General Hospital' } 71 176 1


{'Johnson' } {'Male' } 43 {'VA Hospital' } 69 163 0
{'Williams'} {'Female'} 38 {'St. Mary's Medical Center'} 64 131 0
{'Jones' } {'Female'} 40 {'VA Hospital' } 67 133 0
{'Brown' } {'Female'} 49 {'County General Hospital' } 64 119 0

You can assign more column-oriented table variables using dot notation, [Link], where T is the
table and varname is the desired variable name. Create identifiers that are random numbers. Then
assign them to a table variable, and name the table variable ID. All the variables you assign to a table
must have the same number of rows. Display the first five rows of T.

[Link] = randi(1e4,100,1);
T(1:5,:)

ans=5×5 table
Gender Smoker Height Weight ID
__________ ______ ______ ______ ____

{'Male' } true 71 176 8148


{'Male' } false 69 163 9058
{'Female'} false 64 131 1270
{'Female'} false 67 133 9134
{'Female'} false 64 119 6324

All the variables you assign to a table must have the same number of rows.

View the data type, description, units, and other descriptive statistics for each variable by creating a
table summary using the summary function.

summary(T)

Variables:

Gender: 100x1 cell array of character vectors

Smoker: 100x1 logical

9-3
9 Tables

Values:

True 34
False 66

Height: 100x1 double

Values:

Min 60
Median 67
Max 72

Weight: 100x1 double

Values:

Min 111
Median 142.5
Max 202

ID: 100x1 double

Values:

Min 120
Median 5485.5
Max 9706

Return the size of the table.


size(T)

ans = 1×2

100 5

T contains 100 rows and 5 variables.

Create a new, smaller table containing the first five rows of T and display it. You can use numeric
indexing within parentheses to specify rows and variables. This method is similar to indexing into
numeric arrays to create subarrays. Tnew is a 5-by-5 table.
Tnew = T(1:5,:)

Tnew=5×5 table
Gender Smoker Height Weight ID
__________ ______ ______ ______ ____

{'Male' } true 71 176 8148


{'Male' } false 69 163 9058
{'Female'} false 64 131 1270
{'Female'} false 67 133 9134
{'Female'} false 64 119 6324

Create a smaller table containing all rows of Tnew and the variables from the second to the last. Use
the end keyword to indicate the last variable or the last row of a table. Tnew is a 5-by-4 table.

9-4
Create and Work with Tables

Tnew = Tnew(:,2:end)

Tnew=5×4 table
Smoker Height Weight ID
______ ______ ______ ____

true 71 176 8148


false 69 163 9058
false 64 131 1270
false 67 133 9134
false 64 119 6324

Access Data by Row and Variable Names

Add row names to T and index into the table using row and variable names instead of numeric
indices. Add row names by assigning the LastName workspace variable to the RowNames property of
T.

[Link] = LastName;

Display the first five rows of T with row names.

T(1:5,:)

ans=5×5 table
Gender Smoker Height Weight ID
__________ ______ ______ ______ ____

Smith {'Male' } true 71 176 8148


Johnson {'Male' } false 69 163 9058
Williams {'Female'} false 64 131 1270
Jones {'Female'} false 67 133 9134
Brown {'Female'} false 64 119 6324

Return the size of T. The size does not change because row and variable names are not included
when calculating the size of a table.

size(T)

ans = 1×2

100 5

Select all the data for the patients with the last names 'Smith' and 'Johnson'. In this case, it is
simpler to use the row names than to use numeric indices. Tnew is a 2-by-5 table.

Tnew = T({'Smith','Johnson'},:)

Tnew=2×5 table
Gender Smoker Height Weight ID
________ ______ ______ ______ ____

Smith {'Male'} true 71 176 8148


Johnson {'Male'} false 69 163 9058

9-5
9 Tables

Select the height and weight of the patient named 'Johnson' by indexing on variable names. Tnew
is a 1-by-2 table.
Tnew = T('Johnson',{'Height','Weight'})

Tnew=1×2 table
Height Weight
______ ______

Johnson 69 163

You can access table variables either with dot syntax, as in [Link], or by named indexing, as in
T(:,'Height').

Calculate and Add Result as Table Variable

You can access the contents of table variables, and then perform calculations on them using
MATLAB® functions. Calculate body-mass-index (BMI) based on data in the existing table variables
and add it as a new variable. Plot the relationship of BMI to a patient's status as a smoker or a
nonsmoker. Add blood-pressure readings to the table, and plot the relationship of blood pressure to
BMI.

Calculate BMI using the table variables, Weight and Height. You can extract Weight and Height
for the calculation while conveniently keeping Weight, Height, and BMI in the table with the rest of
the patient data. Display the first five rows of T.
[Link] = ([Link]*0.453592)./([Link]*0.0254).^2;

T(1:5,:)

ans=5×6 table
Gender Smoker Height Weight ID BMI
__________ ______ ______ ______ ____ ______

Smith {'Male' } true 71 176 8148 24.547


Johnson {'Male' } false 69 163 9058 24.071
Williams {'Female'} false 64 131 1270 22.486
Jones {'Female'} false 67 133 9134 20.831
Brown {'Female'} false 64 119 6324 20.426

Populate the variable units and variable descriptions properties for BMI. You can add metadata to any
table variable to describe further the data contained in the variable.
[Link]{'BMI'} = 'kg/m^2';
[Link]{'BMI'} = 'Body Mass Index';

Create a histogram to explore whether there is a relationship between smoking and body-mass-index
in this group of patients. You can index into BMI with the logical values from the Smoker table
variable, because each row contains BMI and Smoker values for the same patient.
tf = ([Link] == false);
h1 = histogram([Link](tf),'BinMethod','integers');
hold on
tf = ([Link] == true);
h2 = histogram([Link](tf),'BinMethod','integers');
xlabel('BMI (kg/m^2)');

9-6
Create and Work with Tables

ylabel('Number of Patients');
legend('Nonsmokers','Smokers');
title('BMI Distributions for Smokers and Nonsmokers');
hold off

Add blood pressure readings for the patients from the workspace variables Systolic and
Diastolic. Each row contains Systolic, Diastolic, and BMI values for the same patient.

[Link] = Systolic;
[Link] = Diastolic;

Create a histogram to show whether there is a relationship between high values of Diastolic and
BMI.

tf = ([Link] <= 25);


h1 = histogram([Link](tf),'BinMethod','integers');
hold on
tf = ([Link] > 25);
h2 = histogram([Link](tf),'BinMethod','integers');
xlabel('Diastolic Reading (mm Hg)');
ylabel('Number of Patients');
legend('BMI <= 25','BMI > 25');
title('Diastolic Readings for Low and High BMI');
hold off

9-7
9 Tables

Reorder Table Variables and Rows for Output

To prepare the table for output, reorder the table rows by name, and table variables by position or
name. Display the final arrangement of the table.

Sort the table by row names so that patients are listed in alphabetical order.

T = sortrows(T,'RowNames');

T(1:5,:)

ans=5×8 table
Gender Smoker Height Weight ID BMI Systolic Diasto
__________ ______ ______ ______ ____ ______ ________ ______

Adams {'Female'} false 66 137 8235 22.112 127 83


Alexander {'Male' } true 69 171 1300 25.252 128 99
Allen {'Female'} false 63 143 7432 25.331 113 80
Anderson {'Female'} false 68 128 1577 19.462 114 77
Bailey {'Female'} false 68 130 2239 19.766 113 81

Create a BloodPressure variable to hold blood pressure readings in a 100-by-2 table variable.

[Link] = [[Link] [Link]];

Delete Systolic and Diastolic from the table since they are redundant.

9-8
Create and Work with Tables

[Link] = [];
[Link] = [];

T(1:5,:)

ans=5×7 table
Gender Smoker Height Weight ID BMI BloodPressure
__________ ______ ______ ______ ____ ______ _____________

Adams {'Female'} false 66 137 8235 22.112 127 83


Alexander {'Male' } true 69 171 1300 25.252 128 99
Allen {'Female'} false 63 143 7432 25.331 113 80
Anderson {'Female'} false 68 128 1577 19.462 114 77
Bailey {'Female'} false 68 130 2239 19.766 113 81

To put ID as the first column, reorder the table variables by position.

T = T(:,[5 1:4 6 7]);

T(1:5,:)

ans=5×7 table
ID Gender Smoker Height Weight BMI BloodPressure
____ __________ ______ ______ ______ ______ _____________

Adams 8235 {'Female'} false 66 137 22.112 127 83


Alexander 1300 {'Male' } true 69 171 25.252 128 99
Allen 7432 {'Female'} false 63 143 25.331 113 80
Anderson 1577 {'Female'} false 68 128 19.462 114 77
Bailey 2239 {'Female'} false 68 130 19.766 113 81

You also can reorder table variables by name. To reorder the table variables so that Gender is last:

1 Find 'Gender' in the VariableNames property of the table.


2 Move 'Gender' to the end of a cell array of variable names.
3 Use the cell array of names to reorder the table variables.

varnames = [Link];
others = ~strcmp('Gender',varnames);
varnames = [varnames(others) 'Gender'];
T = T(:,varnames);

Display the first five rows of the reordered table.

T(1:5,:)

ans=5×7 table
ID Smoker Height Weight BMI BloodPressure Gender
____ ______ ______ ______ ______ _____________ __________

Adams 8235 false 66 137 22.112 127 83 {'Female'}


Alexander 1300 true 69 171 25.252 128 99 {'Male' }
Allen 7432 false 63 143 25.331 113 80 {'Female'}
Anderson 1577 false 68 128 19.462 114 77 {'Female'}
Bailey 2239 false 68 130 19.766 113 81 {'Female'}

9-9
9 Tables

Write Table to File

You can write the entire table to a file, or create a subtable to write a selected portion of the original
table to a separate file.

Write T to a file with the writetable function.

writetable(T,'[Link]');

You can use the readtable function to read the data in [Link] into a new table.

Create a subtable and write the subtable to a separate file. Delete the rows that contain data on
patients who are smokers. Then remove the Smoker variable. nonsmokers contains data only for the
patients who are not smokers.

nonsmokers = T;
toDelete = ([Link] == true);
nonsmokers(toDelete,:) = [];
[Link] = [];

Write nonsmokers to a file.

writetable(nonsmokers,'[Link]');

See Also
Import Tool | array2table | cell2table | readtable | sortrows | struct2table | summary |
table | writetable

Related Examples
• “Clean Messy and Missing Data in Tables” on page 9-21
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26
• “Access Data in Tables” on page 9-34

More About
• “Advantages of Using Tables” on page 9-57

9-10
Add and Delete Table Rows

Add and Delete Table Rows


This example shows how to add and delete rows in a table. You can also edit tables using the
Variables Editor.

Load Sample Data

Load the sample patients data and create a table, T.

load patients
T = table(LastName,Gender,Age,Height,Weight,Smoker,Systolic,Diastolic);
size(T)

ans = 1×2

100 8

The table, T, has 100 rows and eight variables (columns).

Add Rows by Concatenation

Read data on more patients from a comma-delimited file, [Link], into a table, T2. Then,
append the rows from T2 to the end of the table, T.

T2 = readtable('[Link]');
Tnew = [T;T2];
size(Tnew)

ans = 1×2

104 8

The table Tnew has 104 rows. In order to vertically concatenate two tables, both tables must have the
same number of variables, with the same variable names. If the variable names are different, you can
directly assign new rows in a table to rows from another table. For example, T(end+1:end+4,:) =
T2.

Add Rows from Cell Array

To append new rows stored in a cell array, vertically concatenate the cell array onto the end of the
table. You can concatenate directly from a cell array when it has the right number of columns and the
contents of its cells can be concatenated onto the corresponding table variables.

cellPatients = {'Edwards','Male',42,70,158,0,116,83;
'Falk','Female',28,62,125,1,120,71};
Tnew = [Tnew;cellPatients];
size(Tnew)

ans = 1×2

106 8

You also can convert a cell array to a table using the cell2table function.

9-11
9 Tables

Add Rows from Structure

You also can append new rows stored in a structure. Convert the structure to a table, and then
concatenate the tables.

structPatients(1,1).LastName = 'George';
structPatients(1,1).Gender = 'Male';
structPatients(1,1).Age = 45;
structPatients(1,1).Height = 76;
structPatients(1,1).Weight = 182;
structPatients(1,1).Smoker = 1;
structPatients(1,1).Systolic = 132;
structPatients(1,1).Diastolic = 85;

structPatients(2,1).LastName = 'Hadley';
structPatients(2,1).Gender = 'Female';
structPatients(2,1).Age = 29;
structPatients(2,1).Height = 58;
structPatients(2,1).Weight = 120;
structPatients(2,1).Smoker = 0;
structPatients(2,1).Systolic = 112;
structPatients(2,1).Diastolic = 70;

Tnew = [Tnew;struct2table(structPatients)];
size(Tnew)

ans = 1×2

108 8

Omit Duplicate Rows

To omit any rows in a table that are duplicated, use the unique function.

Tnew = unique(Tnew);
size(Tnew)

ans = 1×2

106 8

unique deleted two duplicate rows.

Delete Rows by Row Number

Delete rows 18, 20, and 21 from the table.

Tnew([18,20,21],:) = [];
size(Tnew)

ans = 1×2

103 8

The table contains information on 103 patients now.

9-12
Add and Delete Table Rows

Delete Rows by Row Name

First, specify the variable of identifiers, LastName, as row names. Then, delete the variable,
LastName, from Tnew. Finally, use the row name to index and delete rows.

[Link] = [Link];
[Link] = [];
Tnew('Smith',:) = [];
size(Tnew)

ans = 1×2

102 7

The table now has one less row and one less variable.

Search for Rows to Delete

You also can search for observations in the table. For example, delete rows for any patients under the
age of 30.

toDelete = [Link] < 30;


Tnew(toDelete,:) = [];
size(Tnew)

ans = 1×2

85 7

The table now has 17 fewer rows.

See Also
array2table | cell2table | readtable | struct2table | table

Related Examples
• “Add, Delete, and Rearrange Table Variables” on page 9-14
• “Clean Messy and Missing Data in Tables” on page 9-21

9-13
9 Tables

Add, Delete, and Rearrange Table Variables


This example shows how to add, delete, and rearrange column-oriented variables in a table. You can
add, move, and delete table variables using the addvars, movevars, and removevars functions. As
alternatives, you also can modify table variables using dot syntax or by indexing into the table. Use
the splitvars and mergevars functions to split multicolumn variables and combine multiple
variables into one. Finally, you can reorient a table so that the rows of the table become variables of
an output table, using the rows2vars function.

You also can modify table variables using the Variables Editor.

Load Sample Data and Create Tables

Load arrays of sample data from the patients MAT-file. Display the names and sizes of the variables
loaded into the workspace.

load patients
whos -file patients

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 11412 cell
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 11540 cell
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

Create two tables. Create one table, T, with information collected from a patient questionnaire and
create another table, T2, with data measured from patients. Each table has 100 rows.

T = table(Age,Gender,Smoker);
T2 = table(Height,Weight,Systolic,Diastolic);

Display the first five rows of each table.

head(T,5)

ans=5×3 table
Age Gender Smoker
___ __________ ______

38 {'Male' } true
43 {'Male' } false
38 {'Female'} false
40 {'Female'} false
49 {'Female'} false

head(T2,5)

ans=5×4 table
Height Weight Systolic Diastolic

9-14
Add, Delete, and Rearrange Table Variables

______ ______ ________ _________

71 176 124 93
69 163 109 77
64 131 125 83
67 133 117 75
64 119 122 80

Add Variables Concatenated from Another Table

Add variables to the table T by horizontally concatenating it with T2.


T = [T T2];

Display the first five rows of T.


head(T,5)

ans=5×7 table
Age Gender Smoker Height Weight Systolic Diastolic
___ __________ ______ ______ ______ ________ _________

38 {'Male' } true 71 176 124 93


43 {'Male' } false 69 163 109 77
38 {'Female'} false 64 131 125 83
40 {'Female'} false 67 133 117 75
49 {'Female'} false 64 119 122 80

The table T now has 7 variables and 100 rows.

If the tables that you are horizontally concatenating have row names, horzcat concatenates the
tables by matching the row names. Therefore, the tables must use the same row names, but the row
order does not matter.

Add Variable from Workspace to Table

Add the names of patients from the workspace variable LastName before the first table variable in T.
You can specify any location in the table using the name of a variable near the new location. Use
quotation marks to refer to the names of table variables. However, do not use quotation marks for
input arguments that are workspace variables.
T = addvars(T,LastName,'Before','Age');
head(T,5)

ans=5×8 table
LastName Age Gender Smoker Height Weight Systolic Diastolic
____________ ___ __________ ______ ______ ______ ________ _________

{'Smith' } 38 {'Male' } true 71 176 124 93


{'Johnson' } 43 {'Male' } false 69 163 109 77
{'Williams'} 38 {'Female'} false 64 131 125 83
{'Jones' } 40 {'Female'} false 67 133 117 75
{'Brown' } 49 {'Female'} false 64 119 122 80

You also can specify locations in a table using numbers. For example, the equivalent syntax using a
number to specify location is T = addvars(T,LastName,'Before',1).

9-15
9 Tables

Add Variables Using Dot Syntax

An alternative way to add new table variables is to use dot syntax. When you use dot syntax, you
always add the new variable as the last table variable. You can add a variable that has any data type,
as long as it has the same number of rows as the table.

Create a new variable for blood pressure as a horizontal concatenation of the two variables
Systolic and Diastolic. Add it to T.

[Link] = [Systolic Diastolic];


head(T,5)

ans=5×9 table
LastName Age Gender Smoker Height Weight Systolic Diastolic B
____________ ___ __________ ______ ______ ______ ________ _________ _

{'Smith' } 38 {'Male' } true 71 176 124 93


{'Johnson' } 43 {'Male' } false 69 163 109 77
{'Williams'} 38 {'Female'} false 64 131 125 83
{'Jones' } 40 {'Female'} false 67 133 117 75
{'Brown' } 49 {'Female'} false 64 119 122 80

T now has 9 variables and 100 rows. A table variable can have multiple columns. So although
BloodPressure has two columns, it is one table variable.

Add a new variable, BMI, in the table T, that contains the body mass index for each patient. BMI is a
function of height and weight. When you calculate BMI, you can refer to the Weight and Height
variables that are in T.

[Link] = ([Link]*0.453592)./([Link]*0.0254).^2;

The operators ./ and .^ in the calculation of BMI indicate element-wise division and exponentiation,
respectively.

Display the first five rows of the table T.

head(T,5)

ans=5×10 table
LastName Age Gender Smoker Height Weight Systolic Diastolic B
____________ ___ __________ ______ ______ ______ ________ _________ _

{'Smith' } 38 {'Male' } true 71 176 124 93


{'Johnson' } 43 {'Male' } false 69 163 109 77
{'Williams'} 38 {'Female'} false 64 131 125 83
{'Jones' } 40 {'Female'} false 67 133 117 75
{'Brown' } 49 {'Female'} false 64 119 122 80

Move Variable in Table

Move the table variable BMI using the movevars function, so that it is after the variable Weight.
When you specify table variables by name, use quotation marks.

T = movevars(T,'BMI','After','Weight');
head(T,5)

9-16
Add, Delete, and Rearrange Table Variables

ans=5×10 table
LastName Age Gender Smoker Height Weight BMI Systolic Dias
____________ ___ __________ ______ ______ ______ ______ ________ ____

{'Smith' } 38 {'Male' } true 71 176 24.547 124 9


{'Johnson' } 43 {'Male' } false 69 163 24.071 109 7
{'Williams'} 38 {'Female'} false 64 131 22.486 125 8
{'Jones' } 40 {'Female'} false 67 133 20.831 117 7
{'Brown' } 49 {'Female'} false 64 119 20.426 122 8

You also can specify locations in a table using numbers. For example, the equivalent syntax using a
number to specify location is T = movevars(T,'BMI,'After',6). It is often more convenient to
refer to variables by name.

Move Table Variable Using Indexing

As an alternative, you can move table variables by indexing. You can index into a table using the same
syntax you use for indexing into a matrix.

Move BloodPressure so that it is next to BMI.

T = T(:,[1:7 10 8 9]);
head(T,5)

ans=5×10 table
LastName Age Gender Smoker Height Weight BMI BloodPressure
____________ ___ __________ ______ ______ ______ ______ _____________

{'Smith' } 38 {'Male' } true 71 176 24.547 124 93


{'Johnson' } 43 {'Male' } false 69 163 24.071 109 77
{'Williams'} 38 {'Female'} false 64 131 22.486 125 83
{'Jones' } 40 {'Female'} false 67 133 20.831 117 75
{'Brown' } 49 {'Female'} false 64 119 20.426 122 80

In a table with many variables, it is often more convenient to use the movevars function.

Delete Variables

To delete table variables, use the removevars function. Delete the Systolic and Diastolic table
variables.

T = removevars(T,{'Systolic','Diastolic'});
head(T,5)

ans=5×8 table
LastName Age Gender Smoker Height Weight BMI BloodPressure
____________ ___ __________ ______ ______ ______ ______ _____________

{'Smith' } 38 {'Male' } true 71 176 24.547 124 93


{'Johnson' } 43 {'Male' } false 69 163 24.071 109 77
{'Williams'} 38 {'Female'} false 64 131 22.486 125 83
{'Jones' } 40 {'Female'} false 67 133 20.831 117 75
{'Brown' } 49 {'Female'} false 64 119 20.426 122 80

9-17
9 Tables

Delete Variable Using Dot Syntax

As an alternative, you can delete variables using dot syntax and the empty matrix, []. Remove the
Age variable from the table.
[Link] = [];
head(T,5)

ans=5×7 table
LastName Gender Smoker Height Weight BMI BloodPressure
____________ __________ ______ ______ ______ ______ _____________

{'Smith' } {'Male' } true 71 176 24.547 124 93


{'Johnson' } {'Male' } false 69 163 24.071 109 77
{'Williams'} {'Female'} false 64 131 22.486 125 83
{'Jones' } {'Female'} false 67 133 20.831 117 75
{'Brown' } {'Female'} false 64 119 20.426 122 80

Delete Variable Using Indexing

You also can delete variables using indexing and the empty matrix, []. Remove the Gender variable
from the table.
T(:,'Gender') = [];
head(T,5)

ans=5×6 table
LastName Smoker Height Weight BMI BloodPressure
____________ ______ ______ ______ ______ _____________

{'Smith' } true 71 176 24.547 124 93


{'Johnson' } false 69 163 24.071 109 77
{'Williams'} false 64 131 22.486 125 83
{'Jones' } false 67 133 20.831 117 75
{'Brown' } false 64 119 20.426 122 80

Split and Merge Table Variables

To split multicolumn table variables into variables that each have one column, use the splitvars
functions. Split the variable BloodPressure into two variables.
T = splitvars(T,'BloodPressure','NewVariableNames',{'Systolic','Diastolic'});
head(T,5)

ans=5×7 table
LastName Smoker Height Weight BMI Systolic Diastolic
____________ ______ ______ ______ ______ ________ _________

{'Smith' } true 71 176 24.547 124 93


{'Johnson' } false 69 163 24.071 109 77
{'Williams'} false 64 131 22.486 125 83
{'Jones' } false 67 133 20.831 117 75
{'Brown' } false 64 119 20.426 122 80

Similarly, you can group related table variables together in one variable, using the mergevars
function. Combine Systolic and Diastolic back into one variable, and name it BP.

9-18
Add, Delete, and Rearrange Table Variables

T = mergevars(T,{'Systolic','Diastolic'},'NewVariableName','BP');
head(T,5)

ans=5×6 table
LastName Smoker Height Weight BMI BP
____________ ______ ______ ______ ______ __________

{'Smith' } true 71 176 24.547 124 93


{'Johnson' } false 69 163 24.071 109 77
{'Williams'} false 64 131 22.486 125 83
{'Jones' } false 67 133 20.831 117 75
{'Brown' } false 64 119 20.426 122 80

Reorient Rows To Become Variables

You can reorient the rows of a table or timetable, so that they become the variables in the output
table, using the rows2vars function. However, if the table has multicolumn variables, then you must
split them before you can call rows2vars.

Reorient the rows of T. Specify that the names of the patients in T are the names of table variables in
the output table. The first variable of T3 contains the names of the variables of T. Each remaining
variable of T3 contains the data from the corresponding row of T.
T = splitvars(T,'BP','NewVariableNames',{'Systolic','Diastolic'});
T3 = rows2vars(T,'VariableNamesSource','LastName');
T3(:,1:5)

ans=6×5 table
OriginalVariableNames Smith Johnson Williams Jones
_____________________ ______ _______ ________ ______

{'Smoker' } 1 0 0 0
{'Height' } 71 69 64 67
{'Weight' } 176 163 131 133
{'BMI' } 24.547 24.071 22.486 20.831
{'Systolic' } 124 109 125 117
{'Diastolic'} 93 77 83 75

You can use dot syntax with T3 to access patient data as an array. However, if the row values of an
input table cannot be concatenated, then the variables of the output table are cell arrays.
[Link]

ans = 6×1

1.0000
71.0000
176.0000
24.5467
124.0000
93.0000

See Also
addvars | inner2outer | mergevars | movevars | removevars | rows2vars | splitvars |
table

9-19
9 Tables

Related Examples
• “Add and Delete Table Rows” on page 9-11
• “Clean Messy and Missing Data in Tables” on page 9-21
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26

9-20
Clean Messy and Missing Data in Tables

Clean Messy and Missing Data in Tables


This example shows how to find, clean, and delete table rows with missing data.

Load Sample Data

Load sample data from a comma-separated text file, [Link]. The file contains many different
missing data indicators:

• Empty character vector ('')


• period (.)
• NA
• NaN
• -99

To specify the character vectors to treat as empty values, use the 'TreatAsEmpty' name-value pair
argument with the readtable function. (Use the disp function to display all 21 rows, even when
running this example as a live script.)
T = readtable('[Link]','TreatAsEmpty',{'.','NA'});
disp(T)

A B C D E
________ ____ __________ ____ ____

{'afe1'} 3 {'yes' } 3 3
{'egh3'} NaN {'no' } 7 7
{'wth4'} 3 {'yes' } 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes' } 5 5
{'jre3'} 34.6 {'yes' } 34.6 34.6
{'wen9'} 234 {'yes' } 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes' } 5 5
{'wnk3'} 245 {'yes' } 245 245
{'abk6'} 563 {0x0 char} 563 563
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes' } 23 23
{'wba3'} NaN {'yes' } NaN 14
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'poj2'} -99 {'yes' } -99 -99
{'bas8'} 23 {'no' } 23 23
{'gry5'} NaN {'yes' } NaN 21

T is a table with 21 rows and five variables. 'TreatAsEmpty' only applies to numeric columns in the
file and cannot handle numeric values specified as text, such as '-99'.

Summarize Table

View the data type, description, units, and other descriptive statistics for each variable by creating a
table summary using the summary function.
summary(T)

9-21
9 Tables

Variables:

A: 21x1 cell array of character vectors

B: 21x1 double

Values:

Min -99
Median 14
Max 563
NumMissing 3

C: 21x1 cell array of character vectors

D: 21x1 double

Values:

Min -99
Median 7
Max 563
NumMissing 2

E: 21x1 double

Values:

Min -99
Median 14
Max 563

When you import data from a file, the default is for readtable to read any variables with
nonnumeric elements as a cell array of character vectors.

Find Rows with Missing Values

Display the subset of rows from the table, T, that have at least one missing value.

TF = ismissing(T,{'' '.' 'NA' NaN -99});


rowsWithMissing = T(any(TF,2),:);
disp(rowsWithMissing)

A B C D E
________ ___ __________ ___ ___

{'egh3'} NaN {'no' } 7 7


{'abk6'} 563 {0x0 char} 563 563
{'wba3'} NaN {'yes' } NaN 14
{'poj2'} -99 {'yes' } -99 -99
{'gry5'} NaN {'yes' } NaN 21

readtable replaced '.' and 'NA' with NaN in the numeric variables, B, D, and E.

Replace Missing Value Indicators

Clean the data so that the missing values indicated by code -99 have the standard MATLAB®
numeric missing value indicator, NaN.

9-22
Clean Messy and Missing Data in Tables

T = standardizeMissing(T,-99);
disp(T)

A B C D E
________ ____ __________ ____ ____

{'afe1'} 3 {'yes' } 3 3
{'egh3'} NaN {'no' } 7 7
{'wth4'} 3 {'yes' } 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes' } 5 5
{'jre3'} 34.6 {'yes' } 34.6 34.6
{'wen9'} 234 {'yes' } 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes' } 5 5
{'wnk3'} 245 {'yes' } 245 245
{'abk6'} 563 {0x0 char} 563 563
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes' } 23 23
{'wba3'} NaN {'yes' } NaN 14
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'poj2'} NaN {'yes' } NaN NaN
{'bas8'} 23 {'no' } 23 23
{'gry5'} NaN {'yes' } NaN 21

standardizeMissing replaces three instances of -99 with NaN.

Create a new table, T2, and replace missing values with values from previous rows of the table.
fillmissing provides a number of ways to fill in missing values.

T2 = fillmissing(T,'previous');
disp(T2)

A B C D E
________ ____ _______ ____ ____

{'afe1'} 3 {'yes'} 3 3
{'egh3'} 3 {'no' } 7 7
{'wth4'} 3 {'yes'} 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes'} 5 5
{'jre3'} 34.6 {'yes'} 34.6 34.6
{'wen9'} 234 {'yes'} 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes'} 5 5
{'wnk3'} 245 {'yes'} 245 245
{'abk6'} 563 {'yes'} 563 563
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes'} 23 23
{'wba3'} 23 {'yes'} 23 14
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'poj2'} 22 {'yes'} 22 22

9-23
9 Tables

{'bas8'} 23 {'no' } 23 23
{'gry5'} 23 {'yes'} 23 21

Remove Rows with Missing Values

Create a new table, T3, that contains only the rows from T without missing values. T3 has only 16
rows.
T3 = rmmissing(T);
disp(T3)

A B C D E
________ ____ _______ ____ ____

{'afe1'} 3 {'yes'} 3 3
{'wth4'} 3 {'yes'} 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes'} 5 5
{'jre3'} 34.6 {'yes'} 34.6 34.6
{'wen9'} 234 {'yes'} 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes'} 5 5
{'wnk3'} 245 {'yes'} 245 245
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes'} 23 23
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'bas8'} 23 {'no' } 23 23

T3 contains 16 rows and five variables.

Organize Data

Sort the rows of T3 in descending order by C, and then sort in ascending order by A.
T3 = sortrows(T2,{'C','A'},{'descend','ascend'});
disp(T3)

A B C D E
________ ____ _______ ____ ____

{'abk6'} 563 {'yes'} 563 563


{'afe1'} 3 {'yes'} 3 3
{'arg1'} 5 {'yes'} 5 5
{'gry5'} 23 {'yes'} 23 21
{'jre3'} 34.6 {'yes'} 34.6 34.6
{'oii4'} 5 {'yes'} 5 5
{'oks9'} 23 {'yes'} 23 23
{'poj2'} 22 {'yes'} 22 22
{'wba3'} 23 {'yes'} 23 14
{'wen9'} 234 {'yes'} 234 234
{'wnk3'} 245 {'yes'} 245 245
{'wth4'} 3 {'yes'} 3 3
{'adw3'} 22 {'no' } 22 22
{'atn2'} 23 {'no' } 23 23
{'bas8'} 23 {'no' } 23 23
{'dbo8'} 5 {'no' } 5 5

9-24
Clean Messy and Missing Data in Tables

{'egh3'} 3 {'no' } 7 7
{'pkn4'} 2 {'no' } 2 2
{'ple2'} 2 {'no' } 2 2
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6

In C, the rows are grouped first by 'yes', followed by 'no'. Then in A, the rows are listed
alphabetically.

Reorder the table so that A and C are next to each other.

T3 = T3(:,{'A','C','B','D','E'});
disp(T3)

A C B D E
________ _______ ____ ____ ____

{'abk6'} {'yes'} 563 563 563


{'afe1'} {'yes'} 3 3 3
{'arg1'} {'yes'} 5 5 5
{'gry5'} {'yes'} 23 23 21
{'jre3'} {'yes'} 34.6 34.6 34.6
{'oii4'} {'yes'} 5 5 5
{'oks9'} {'yes'} 23 23 23
{'poj2'} {'yes'} 22 22 22
{'wba3'} {'yes'} 23 23 14
{'wen9'} {'yes'} 234 234 234
{'wnk3'} {'yes'} 245 245 245
{'wth4'} {'yes'} 3 3 3
{'adw3'} {'no' } 22 22 22
{'atn2'} {'no' } 23 23 23
{'bas8'} {'no' } 23 23 23
{'dbo8'} {'no' } 5 5 5
{'egh3'} {'no' } 3 7 7
{'pkn4'} {'no' } 2 2 2
{'ple2'} {'no' } 2 2 2
{'pnj5'} {'no' } 463 463 463
{'wnn3'} {'no' } 6 6 6

See Also
fillmissing | ismissing | readtable | rmmissing | sortrows | standardizeMissing |
summary

Related Examples
• “Add and Delete Table Rows” on page 9-11
• “Add, Delete, and Rearrange Table Variables” on page 9-14
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26
• “Access Data in Tables” on page 9-34
• “Missing Data in MATLAB”

9-25
9 Tables

Modify Units, Descriptions, and Table Variable Names


This example shows how to access and modify table properties for variable units, descriptions and
names. You also can edit these property values using the Variables Editor.

Load Sample Data

Load the sample patients data and create a table.

load patients
BloodPressure = [Systolic Diastolic];

T = table(Gender,Age,Height,Weight,Smoker,BloodPressure);

Display the first five rows of the table, T.

T(1:5,:)

ans=5×6 table
Gender Age Height Weight Smoker BloodPressure
__________ ___ ______ ______ ______ _____________

{'Male' } 38 71 176 true 124 93


{'Male' } 43 69 163 false 109 77
{'Female'} 38 64 131 false 125 83
{'Female'} 40 67 133 false 117 75
{'Female'} 49 64 119 false 122 80

T has 100 rows and 6 variables.

Add Variable Units

Specify units for each variable in the table by modifying the table property, VariableUnits. Specify
the variable units as a cell array of character vectors.

[Link] = {'' 'Yrs' 'In' 'Lbs' '' ''};

An individual empty character vector within the cell array indicates that the corresponding variable
does not have units.

Add a Variable Description for a Single Variable

Add a variable description for the variable, BloodPressure. Assign a single character vector to the
element of the cell array containing the description for BloodPressure.

[Link]{'BloodPressure'} = 'Systolic/Diastolic';

You can use the variable name, 'BloodPressure', or the numeric index of the variable, 6, to index
into the cell array of character vectors containing the variable descriptions.

Summarize the Table

View the data type, description, units, and other descriptive statistics for each variable by using
summary to summarize the table.

summary(T)

9-26
Modify Units, Descriptions, and Table Variable Names

Variables:

Gender: 100x1 cell array of character vectors

Age: 100x1 double

Properties:
Units: Yrs
Values:

Min 25
Median 39
Max 50

Height: 100x1 double

Properties:
Units: In
Values:

Min 60
Median 67
Max 72

Weight: 100x1 double

Properties:
Units: Lbs
Values:

Min 111
Median 142.5
Max 202

Smoker: 100x1 logical

Values:

True 34
False 66

BloodPressure: 100x2 double

Properties:
Description: Systolic/Diastolic
Values:
Column 1 Column 2
________ ________

Min 109 68
Median 122 81.5
Max 138 99

The BloodPressure variable has a description and the Age, Height, Weight, and BloodPressure
variables have units.

9-27
9 Tables

Change a Variable Name

Change the variable name for the first variable from Gender to Sex.

[Link]{'Gender'} = 'Sex';

Display the first five rows of the table, T.

T(1:5,:)

ans=5×6 table
Sex Age Height Weight Smoker BloodPressure
__________ ___ ______ ______ ______ _____________

{'Male' } 38 71 176 true 124 93


{'Male' } 43 69 163 false 109 77
{'Female'} 38 64 131 false 125 83
{'Female'} 40 67 133 false 117 75
{'Female'} 49 64 119 false 122 80

In addition to properties for variable units, descriptions and names, there are table properties for row
and dimension names, a table description, and user data.

See Also
array2table | cell2table | readtable | struct2table | summary | table

Related Examples
• “Add, Delete, and Rearrange Table Variables” on page 9-14
• “Access Data in Tables” on page 9-34

9-28
Add Custom Properties to Tables and Timetables

Add Custom Properties to Tables and Timetables


This example shows how to add custom properties to tables and timetables, set and access their
values, and remove them.

All tables and timetables have properties that contain metadata about them or their variables. You
can access these properties through the [Link] object, where T is the name of the table or
timetable. For example, [Link] returns a cell array containing the names
of the variables of T.

The properties you access through [Link] are part of the definitions of the table and
timetable data types. You cannot add or remove these predefined properties. But starting in
R2018b, you can add and remove your own custom properties, by modifying the
[Link] object of a table or timetable.

Add Properties

Read power outage data into a table. Sort it using the first variable that contains dates and times,
OutageTime. Then display the first three rows.
T = readtable('[Link]');
T = sortrows(T,'OutageTime');
head(T,3)

ans=3×6 table
Region OutageTime Loss Customers RestorationTime Cause
_____________ ________________ ______ __________ ________________ ____________

{'SouthWest'} 2002-02-01 12:18 458.98 1.8202e+06 2002-02-07 16:50 {'winter sto


{'MidWest' } 2002-03-05 17:53 96.563 2.8666e+05 2002-03-10 14:41 {'wind'
{'MidWest' } 2002-03-16 06:18 186.44 2.1275e+05 2002-03-18 23:23 {'severe sto

Display its properties. These are the properties that all tables have in common. Note that there is also
a CustomProperties object, but that by default it has no properties.
[Link]

ans =
TableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x6 cell}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowNames: {}
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.

To add custom properties, use the addprop function. Specify the names of the properties. For each
property, also specify whether it has metadata for the whole table (similar to the Description
property) or for its variables (similar to the VariableNames property). If the property has variable
metadata, then its value must be a vector whose length is equal to the number of variables.

9-29
9 Tables

Add custom properties that contain an output file name, file type, and indicators of which variables to
plot. Best practice is to assign the input table as the output argument of addprop, so that the custom
properties are part of the same table. Specify that the output file name and file type are table
metadata using the 'table' option. Specify that the plot indicators are variable metadata using the
'variable' option.
T = addprop(T,{'OutputFileName','OutputFileType','ToPlot'}, ...
{'table','table','variable'});
[Link]

ans =
TableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x6 cell}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowNames: {}

Custom Properties (access using [Link].<name>):


OutputFileName: []
OutputFileType: []
ToPlot: []

Set and Access Values of Custom Properties

When you add custom properties using addprop, their values are empty arrays by default. You can
set and access the values of the custom properties using dot syntax.

Set the output file name and type. These properties contain metadata for the table. Then assign a
logical array to the ToPlot property. This property contains metadata for the variables. In this
example, the elements of the value of the ToPlot property are true for each variable to be included
in a plot, and false for each variable to be excluded.
[Link] = 'outageResults';
[Link] = '.mat';
[Link] = [false false true true true false];
[Link]

ans =
TableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x6 cell}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowNames: {}

Custom Properties (access using [Link].<name>):


OutputFileName: 'outageResults'
OutputFileType: '.mat'

9-30
Add Custom Properties to Tables and Timetables

ToPlot: [0 0 1 1 1 0]

Plot variables from T in a stacked plot using the stackedplot function. To plot only the Loss,
Customers, and RestorationTime values, use the ToPlot custom property as the second input
argument.

stackedplot(T,[Link]);

When you move or delete table variables, both the predefined and custom properties are reordered so
that their values correspond to the same variables. In this example, the values of the ToPlot custom
property stay aligned with the variables marked for plotting, just as the values of the
VariableNames predefined property stay aligned.

Remove the Customers variable and display the properties.

[Link] = [];
[Link]

ans =
TableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x5 cell}
VariableDescriptions: {}

9-31
9 Tables

VariableUnits: {}
VariableContinuity: []
RowNames: {}

Custom Properties (access using [Link].<name>):


OutputFileName: 'outageResults'
OutputFileType: '.mat'
ToPlot: [0 0 1 1 0]

Convert the table to a timetable, using the outage times as row times. Move Region to the end of the
table, and RestorationTime before the first variable, using the movevars function. Note that the
properties are reordered appropriately. The RestorationTime and Loss variables still have
indicators for inclusion in a plot.

T = table2timetable(T);
T = movevars(T,'Region','After','Cause');
T = movevars(T,'RestorationTime','Before',1);
[Link]

ans =
TimetableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'OutageTime' 'Variables'}
VariableNames: {'RestorationTime' 'Loss' 'Cause' 'Region'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [1468x1 datetime]
StartTime: 2002-02-01 12:18
SampleRate: NaN
TimeStep: NaN

Custom Properties (access using [Link].<name>):


OutputFileName: 'outageResults'
OutputFileType: '.mat'
ToPlot: [1 1 0 0]

Remove Properties

You can remove any or all of the custom properties of a table using the rmprop function. However,
you cannot use it to remove predefined properties from [Link], because those properties are
part of the definition of the table data type.

Remove the OutputFileName and OutputFileType custom properties. Display the remaining table
properties.

T = rmprop(T,{'OutputFileName','OutputFileType'});
[Link]

ans =
TimetableProperties with properties:

Description: ''
UserData: []

9-32
Add Custom Properties to Tables and Timetables

DimensionNames: {'OutageTime' 'Variables'}


VariableNames: {'RestorationTime' 'Loss' 'Cause' 'Region'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [1468x1 datetime]
StartTime: 2002-02-01 12:18
SampleRate: NaN
TimeStep: NaN

Custom Properties (access using [Link].<name>):


ToPlot: [1 1 0 0]

See Also
addprop | head | movevars | readtable | rmprop | sortrows | stackedplot | table |
table2timetable

Related Examples
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26
• “Access Data in Tables” on page 9-34
• “Add, Delete, and Rearrange Table Variables” on page 9-14

9-33
9 Tables

Access Data in Tables


In this section...
“Summary of Table Indexing Syntaxes” on page 9-34
“Tables Containing Specified Rows and Variables” on page 9-37
“Extract Data Using Dot Notation and Logical Values” on page 9-40
“Dot Notation with Any Variable Name or Expression” on page 9-42
“Extract Data from Specified Rows and Variables” on page 9-44

A table is a container that stores column-oriented data in variables. Table variables can have different
data types and sizes as long as all variables have the same number of rows. Table variables have
names, just as the fields of a structure have names. The rows of a table can have names, but row
names are not required. To access table data, index into the rows and variables using either their
names or numeric indices.

Typical reasons for indexing into tables include:

• Reordering or removing rows and variables.


• Adding arrays as new rows or variables.
• Extracting arrays of data to use as input arguments to functions.

Summary of Table Indexing Syntaxes


Depending on the type of indexing you use, you can access either a subtable or an array extracted
from the table. Indexing with:

• Smooth parentheses, (), returns a table that has selected rows and variables.
• Dot notation returns the contents of a variable as an array.
• Curly braces, {}, returns an array concatenated from the contents of selected rows and
variables.

You can specify rows and variables by name, numeric index, or data type. Starting in R2019b,
variable names and row names can include any characters, including spaces and non-ASCII
characters. Also, they can start with any characters, not just letters. Variable and row names do not
have to be valid MATLAB identifiers (as determined by the isvarname function).

9-34
Access Data in Tables

Type of Output Syntax Rows Variables Examples


Table, containing T(rows,vars) Specified as: Specified as: • T(1:5,[1 4
specified rows 5])
and variables • Row numbers • Variable
(between 1 and numbers Table having
m) (between 1 and the first five
• Names, if T has n) rows and the
row names • Names first, fourth,
and fifth
• Times, if T is a • Colon (:), variables of T
timetable meaning all
variables • T(:,
• Colon (:), {'A','B'})
meaning all
rows Table having all
rows and the
variables
named 'A' and
'B' from T
Table, containing S = Specified as: Specified as a data • S =
variables that vartype(type); type, such as vartype('num
have specified • Row numbers 'numeric', eric');
data type T(rows,S) (between 1 and 'categorical',
m) or 'datetime' T(1:5,S)
• Names, if T has
Table having
row names
the first five
• Times, if T is a rows and the
timetable numeric
• Colon (:), variables of T
meaning all
rows
Array, extracting [Link] Not specified Specified as: • [Link]
data from one
variable T.(expression) • A variable Array extracted
name (without from table
quotation variable named
marks) 'Date'
• An expression • T.
inside ('2019/06/30
parentheses ')
that returns a
variable name Array extracted
or number from table
variable named
'2019/06/30'
• T.(1)

Array extracted
from the first
table variable

9-35
9 Tables

Type of Output Syntax Rows Variables Examples


Array, extracting [Link](rows) Specified as Specified as: • [Link](1:5)
data from one numeric or logical
variable and T.(expression) indices of the array • A variable First five rows
specified rows (rows) name (without of array
quotation extracted from
marks) table variable
• An expression named 'Date'
inside • T.
parentheses ('2019/06/30
that returns a ')(1:5)
variable name
or number First five rows
of array
extracted from
table variable
named
'2019/06/30'
• T.(1)(1:5)

First five rows


of array
extracted from
the first table
variable
Array, T{rows,vars} Specified as: Specified as: • T{1:5,[1 4
concatenating 5]}
data from • Row numbers • Variable
specified rows (between 1 and numbers Array
and variables m) (between 1 and concatenated
• Names, if T has n) from the first
row names • Names five rows and
the first, fourth,
• Times, if T is a • Colon (:), and fifth
timetable meaning all variables of T
• Colon (:), variables
• T{:,
meaning all {'A','B'}}
rows
Array
concatenated
from all rows
and the
variables
named 'A' and
'B' from T

9-36
Access Data in Tables

Type of Output Syntax Rows Variables Examples


Array, S = Specified as: Specified as a data • S =
concatenating vartype(type); type, such as vartype('num
data from • Row numbers 'numeric', eric');
specified rows T{rows,S} (between 1 and 'categorical',
and variables m) or 'datetime' T{1:5,S}
with specified • Names, if T has
data type Array
row names
concatenated
• Times, if T is a from the first
timetable five rows and
• Colon (:), the numeric
meaning all variables of T
rows
Array, [Link] Not specified Not specified • [Link]
concatenating
data from all Identical to
rows and array returned
variables by T{:,:}

Tables Containing Specified Rows and Variables


Load sample data for 100 patients from the patients MAT-file to workspace variables.

load patients
whos

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 11412 cell
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 11540 cell
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

Create a table and populate it with the Age, Gender, Height, Weight, and Smoker workspace
variables. Use the unique identifiers in LastName as row names. T is a 100-by-5 table. (When you
specify row names, they do not count as a table variable).

T = table(Age,Gender,Height,Weight,Smoker,...
'RowNames',LastName)

T=100×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______

Smith 38 {'Male' } 71 176 true


Johnson 43 {'Male' } 69 163 false
Williams 38 {'Female'} 64 131 false

9-37
9 Tables

Jones 40 {'Female'} 67 133 false


Brown 49 {'Female'} 64 119 false
Davis 46 {'Female'} 68 142 false
Miller 33 {'Female'} 64 142 true
Wilson 40 {'Male' } 68 180 false
Moore 28 {'Male' } 68 183 false
Taylor 31 {'Female'} 66 132 false
Anderson 45 {'Female'} 68 128 false
Thomas 42 {'Female'} 66 137 false
Jackson 25 {'Male' } 71 174 false
White 39 {'Male' } 72 202 true
Harris 36 {'Female'} 65 129 false
Martin 48 {'Male' } 71 181 true

Index Using Numeric Indices

Create a subtable containing the first five rows and all the variables from T. To specify the desired
rows and variables, use numeric indices within parentheses. This type of indexing is similar to
indexing into numeric arrays.
T1 = T(1:5,:)

T1=5×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______

Smith 38 {'Male' } 71 176 true


Johnson 43 {'Male' } 69 163 false
Williams 38 {'Female'} 64 131 false
Jones 40 {'Female'} 67 133 false
Brown 49 {'Female'} 64 119 false

T1 is a 5-by-5 table.

In addition to numeric indices, you can use row or variable names inside the parentheses. (In this
case, using row indices and a colon is more compact than using row or variable names.)

Index Using Names

Select all the data for the patients with the last names 'Williams' and 'Brown'. Since T has row
names that are the last names of patients, index into T using row names.
T2 = T({'Williams','Brown'},:)

T2=2×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______

Williams 38 {'Female'} 64 131 false


Brown 49 {'Female'} 64 119 false

T2 is a 2-by-5 table.

You also can select variables by name. Create a table that has only the first five rows of T and the
Height and Weight variables. Display it.

9-38
Access Data in Tables

T3 = T(1:5,{'Height','Weight'})

T3=5×2 table
Height Weight
______ ______

Smith 71 176
Johnson 69 163
Williams 64 131
Jones 67 133
Brown 64 119

Table variable names do not have to be valid MATLAB identifiers. They can include spaces and non-
ASCII characters, and can start with any character.

Add a variable name with spaces and a dash to T. Then index into T using variable names.
T = addvars(T,SelfAssessedHealthStatus,'NewVariableNames','Self-Assessed Health Status');
T(1:5,{'Age','Smoker','Self-Assessed Health Status'})

ans=5×3 table
Age Smoker Self-Assessed Health Status
___ ______ ___________________________

Smith 38 true {'Excellent'}


Johnson 43 false {'Fair' }
Williams 38 false {'Good' }
Jones 40 false {'Fair' }
Brown 49 false {'Good' }

Specify Data Type Subscript

Instead of specifying variables using names or numbers, you can create a data type subscript that
matches all variables having the same data type.

First, create a data type subscript to match numeric table variables.


S = vartype('numeric')

S =
table vartype subscript:

Select table variables matching the type 'numeric'

See Access Data in a Table.

Create a table that has only the numeric variables, and only the first five rows, from T.
T4 = T(1:5,S)

T4=5×3 table
Age Height Weight
___ ______ ______

Smith 38 71 176
Johnson 43 69 163

9-39
9 Tables

Williams 38 64 131
Jones 40 67 133
Brown 49 64 119

Extract Data Using Dot Notation and Logical Values


Create a table from the patients MAT-file. Then use dot notation to extract data from table
variables. You can also index using logical indices generated from values in a table variable that meet
a condition.

load patients

T = table(Age,Gender,Height,Weight,Smoker,...
'RowNames',LastName);

Extract Data from Variable

To extract data from one variable, use dot notation. Extract numeric values from the variable Weight.
Then plot a histogram of those values.

histogram([Link])
title('Patient Weight')

[Link] is a double-precision column vector with 100 rows.

9-40
Access Data in Tables

Select Rows with Logical Indexing

You can index into an array or a table using an array of logical indices. Typically, you use a logical
expression that determines which values in a table variable meet a condition. The result of the
expression is an array of logical indices.

For example, create logical indices matching patients whose age is less than 40.

rows = [Link] < 40

rows = 100x1 logical array

1
0
1
0
0
0
1
0
1
1

To extract heights for patients whose age is less than 40, index into the Height variable using rows.
There are 56 patients younger than 40.

[Link](rows)

ans = 56×1

71
64
64
68
66
71
72
65
69
69

You can index into a table with logical indices. Display the rows of T for the patients who are younger
than 40.

T(rows,:)

ans=56×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______

Smith 38 {'Male' } 71 176 true


Williams 38 {'Female'} 64 131 false
Miller 33 {'Female'} 64 142 true
Moore 28 {'Male' } 68 183 false

9-41
9 Tables

Taylor 31 {'Female'} 66 132 false


Jackson 25 {'Male' } 71 174 false
White 39 {'Male' } 72 202 true
Harris 36 {'Female'} 65 129 false
Thompson 32 {'Male' } 69 191 true
Garcia 27 {'Female'} 69 131 true
Martinez 37 {'Male' } 70 179 false
Rodriguez 39 {'Female'} 64 117 false
Walker 28 {'Female'} 65 123 true
Hall 25 {'Male' } 70 189 false
Allen 39 {'Female'} 63 143 false
Young 25 {'Female'} 63 114 false

You can match multiple conditions with one logical expression. Display the rows for smoking patients
younger than 40.

rows = ([Link]==true & [Link]<40);


T(rows,:)

ans=18×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______

Smith 38 {'Male' } 71 176 true


Miller 33 {'Female'} 64 142 true
White 39 {'Male' } 72 202 true
Thompson 32 {'Male' } 69 191 true
Garcia 27 {'Female'} 69 131 true
Walker 28 {'Female'} 65 123 true
King 30 {'Male' } 67 186 true
Nelson 33 {'Male' } 66 180 true
Mitchell 39 {'Male' } 71 164 true
Turner 37 {'Male' } 70 194 true
Sanders 33 {'Female'} 67 115 true
Price 31 {'Male' } 72 178 true
Jenkins 28 {'Male' } 69 189 true
Long 39 {'Male' } 68 182 true
Patterson 37 {'Female'} 65 120 true
Flores 31 {'Female'} 66 141 true

Dot Notation with Any Variable Name or Expression


When you index using dot notation, there are two ways to specify a variable.

• By name, without quotation marks. For example, [Link] specifies a variable named 'Date'.
• By an expression, where the expression is enclosed by parentheses after the dot. For example, T.
('Start Date') specifies a variable named 'Start Date'.

Use the first syntax when a table variable name also happens to be a valid MATLAB® identifier. (A
valid identifier starts with a letter and includes only letters, digits, and underscores.)

Use the second syntax when you specify:

9-42
Access Data in Tables

• A number that indicates the position of the variable in the table.


• A variable name that isn't a valid MATLAB identifier.
• A function whose output is the name of a variable in the table, or a variable you add to the table.
The output of the function must be a character vector or a string scalar.

For example, create a table from the patients MAT-file. Then use dot notation to access the
contents of table variables.

load patients

T = table(Age,Gender,Height,Weight,Smoker,...
'RowNames',LastName);

To specify a variable by position in the table, use a number. Age is the first variable in T, so use the
number 1 to specify its position.

T.(1)

ans = 100×1

38
43
38
40
49
46
33
40
28
31

To specify a variable by name, you can enclose it in quotation marks. Since 'Age' is a valid identifier,
you can specify it using either [Link] or T.('Age').

T.('Age')

ans = 100×1

38
43
38
40
49
46
33
40
28
31

You can specify table variable names that are not valid MATLAB identifiers. Variable names can
include spaces and non-ASCII characters, and can start with any character. However, when you use
dot notation to access a table variable with such a name, you must specify it using parentheses.

9-43
9 Tables

Add a variable name with spaces and a hyphen to T.

T = addvars(T,SelfAssessedHealthStatus,'NewVariableNames','Self-Assessed Health Status');


T(1:5,:)

ans=5×6 table
Age Gender Height Weight Smoker Self-Assessed Health Status
___ __________ ______ ______ ______ ___________________________

Smith 38 {'Male' } 71 176 true {'Excellent'}


Johnson 43 {'Male' } 69 163 false {'Fair' }
Williams 38 {'Female'} 64 131 false {'Good' }
Jones 40 {'Female'} 67 133 false {'Fair' }
Brown 49 {'Female'} 64 119 false {'Good' }

Access the new table variable using dot notation. Display the first five elements.

C = T.('Self-Assessed Health Status');


C(1:5)

ans = 5x1 cell


{'Excellent'}
{'Fair' }
{'Good' }
{'Fair' }
{'Good' }

You also can use the output of a function as a variable name. Delete the T.('Self-Assessed
Health Status') variable. Then replace it with a variable whose name includes today's date.

T.('Self-Assessed Health Status') = [];


T.(string(datetime('today')) + ' Self Report') = SelfAssessedHealthStatus;
T(1:5,:)

ans=5×6 table
Age Gender Height Weight Smoker 09-Nov-2020 Self Report
___ __________ ______ ______ ______ _______________________

Smith 38 {'Male' } 71 176 true {'Excellent'}


Johnson 43 {'Male' } 69 163 false {'Fair' }
Williams 38 {'Female'} 64 131 false {'Good' }
Jones 40 {'Female'} 67 133 false {'Fair' }
Brown 49 {'Female'} 64 119 false {'Good' }

Extract Data from Specified Rows and Variables


Indexing with curly braces extracts data from a table and results in an array, not a subtable. But
other than that difference, you can specify rows and variables using numbers, names, and data type
subscripts, just as you can when you index using smooth parentheses. To extract values from a table,
use curly braces. If you extract values from multiple table variables, then the variables must have
data types that allow them to be concatenated together.

9-44
Access Data in Tables

Specify Rows and Variables

Create a table from numeric and logical arrays from the patients file.

load patients

T = table(Age,Height,Weight,Smoker,...
'RowNames',LastName);

Extract data from multiple variables in T. Unlike dot notation, indexing with curly braces can extract
values from multiple table variables and concatenate them into one array.

Extract the height and weight for the first five patients. Use numeric indices to select the first five
rows, and variable names to select the variables Height and Weight.

A = T{1:5,{'Height','Weight'}}

A = 5×2

71 176
69 163
64 131
67 133
64 119

A is a 5-by-2 numeric array, not a table.

If you specify one variable name, then curly brace indexing results in the same array you can get with
dot notation. However, you must specify both rows and variables when you use curly brace indexing.
For example, this syntaxes [Link] and T{:,'Height'} return the same array.

Extract Data from All Rows and Variables

If all the table variables have data types that allow them to be concatenated together, then you can
use the [Link] syntax to put all the table data into an array. This syntax is equivalent to
T{:,:} where the colons indicate all rows and all variables.

A2 = [Link]

A2 = 100×4

38 71 176 1
43 69 163 0
38 64 131 0
40 67 133 0
49 64 119 0
46 68 142 0
33 64 142 1
40 68 180 0
28 68 183 0
31 66 132 0

See Also
addvars | histogram | table | vartype

9-45
9 Tables

Related Examples
• “Advantages of Using Tables” on page 9-57
• “Create and Work with Tables” on page 9-2
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26
• “Calculations on Tables” on page 9-47
• “Find Array Elements That Meet a Condition” on page 5-2

9-46
Calculations on Tables

Calculations on Tables
This example shows how to perform calculations on tables.

The functions rowfun and varfun each apply a specified function to a table, yet many other
functions require numeric or homogeneous arrays as input arguments. You can extract data from
individual variables using dot indexing or from one or more variables using curly braces. The
extracted data is then an array that you can use as input to other functions.

Read Sample Data into Table

Read data from a comma-separated text file, [Link], into a table using the readtable
function. [Link] contains test scores for several students. Use the student names in the
first column of the text file as row names in the table.

T = readtable('[Link]','ReadRowNames',true)

T=10×4 table
Gender Test1 Test2 Test3
__________ _____ _____ _____

HOWARD {'male' } 90 87 93
WARD {'male' } 87 85 83
TORRES {'male' } 86 85 88
PETERSON {'female'} 75 80 72
GRAY {'female'} 89 86 87
RAMIREZ {'female'} 96 92 98
JAMES {'male' } 78 75 77
WATSON {'female'} 91 94 92
BROOKS {'female'} 86 83 85
KELLY {'male' } 79 76 82

T is a table with 10 rows and four variables.

Summarize the Table

View the data type, description, units, and other descriptive statistics for each variable by using the
summary function to summarize the table.

summary(T)

Variables:

Gender: 10x1 cell array of character vectors

Test1: 10x1 double

Values:

Min 75
Median 86.5
Max 96

Test2: 10x1 double

Values:

9-47
9 Tables

Min 75
Median 85
Max 94

Test3: 10x1 double

Values:

Min 72
Median 86
Max 98

The summary contains the minimum, median, and maximum score for each test.

Find the Average Across Each Row

Extract the data from the second, third, and fourth variables using curly braces, {}, find the average
of each row, and store it in a new variable, TestAvg.

[Link] = mean(T{:,2:end},2)

T=10×5 table
Gender Test1 Test2 Test3 TestAvg
__________ _____ _____ _____ _______

HOWARD {'male' } 90 87 93 90
WARD {'male' } 87 85 83 85
TORRES {'male' } 86 85 88 86.333
PETERSON {'female'} 75 80 72 75.667
GRAY {'female'} 89 86 87 87.333
RAMIREZ {'female'} 96 92 98 95.333
JAMES {'male' } 78 75 77 76.667
WATSON {'female'} 91 94 92 92.333
BROOKS {'female'} 86 83 85 84.667
KELLY {'male' } 79 76 82 79

Alternatively, you can use the variable names, T{:,{'Test1','Test2','Test3'}} or the variable
indices, T{:,2:4} to select the subset of data.

Compute Statistics Using Grouping Variable

Compute the mean and maximum of TestAvg by gender of the students.

varfun(@mean,T,'InputVariables','TestAvg',...
'GroupingVariables','Gender')

ans=2×3 table
Gender GroupCount mean_TestAvg
__________ __________ ____________

{'female'} 5 87.067
{'male' } 5 83.4

9-48
Calculations on Tables

Replace Data Values

The maximum score for each test is 100. Use curly braces to extract the data from the table and
convert the test scores to a 25 point scale.

T{:,2:end} = T{:,2:end}*25/100

T=10×5 table
Gender Test1 Test2 Test3 TestAvg
__________ _____ _____ _____ _______

HOWARD {'male' } 22.5 21.75 23.25 22.5


WARD {'male' } 21.75 21.25 20.75 21.25
TORRES {'male' } 21.5 21.25 22 21.583
PETERSON {'female'} 18.75 20 18 18.917
GRAY {'female'} 22.25 21.5 21.75 21.833
RAMIREZ {'female'} 24 23 24.5 23.833
JAMES {'male' } 19.5 18.75 19.25 19.167
WATSON {'female'} 22.75 23.5 23 23.083
BROOKS {'female'} 21.5 20.75 21.25 21.167
KELLY {'male' } 19.75 19 20.5 19.75

Change Variable Name

Change the variable name from TestAvg to Final.

[Link]{end} = 'Final'

T=10×5 table
Gender Test1 Test2 Test3 Final
__________ _____ _____ _____ ______

HOWARD {'male' } 22.5 21.75 23.25 22.5


WARD {'male' } 21.75 21.25 20.75 21.25
TORRES {'male' } 21.5 21.25 22 21.583
PETERSON {'female'} 18.75 20 18 18.917
GRAY {'female'} 22.25 21.5 21.75 21.833
RAMIREZ {'female'} 24 23 24.5 23.833
JAMES {'male' } 19.5 18.75 19.25 19.167
WATSON {'female'} 22.75 23.5 23 23.083
BROOKS {'female'} 21.5 20.75 21.25 21.167
KELLY {'male' } 19.75 19 20.5 19.75

See Also
findgroups | rowfun | splitapply | summary | table | varfun

Related Examples
• “Access Data in Tables” on page 9-34
• “Split Table Data Variables and Apply Functions” on page 9-53

9-49
9 Tables

Split Data into Groups and Calculate Statistics


This example shows how to split data from the [Link] data file into groups. Then it shows
how to calculate mean weights and body mass indices, and variances in blood pressure readings, for
the groups of patients. It also shows how to summarize the results in a table.

Load Patient Data

Load sample data gathered from 100 patients.


load patients

Convert Gender and SelfAssessedHealthStatus to categorical arrays.


Gender = categorical(Gender);
SelfAssessedHealthStatus = categorical(SelfAssessedHealthStatus);
whos

Name Size Bytes Class Attributes

Age 100x1 800 double


Diastolic 100x1 800 double
Gender 100x1 330 categorical
Height 100x1 800 double
LastName 100x1 11616 cell
Location 100x1 14208 cell
SelfAssessedHealthStatus 100x1 560 categorical
Smoker 100x1 100 logical
Systolic 100x1 800 double
Weight 100x1 800 double

Calculate Mean Weights

Split the patients into nonsmokers and smokers using the Smoker variable. Calculate the mean
weight for each group.
[G,smoker] = findgroups(Smoker);
meanWeight = splitapply(@mean,Weight,G)

meanWeight = 2×1

149.9091
161.9412

The findgroups function returns G, a vector of group numbers created from Smoker. The
splitapply function uses G to split Weight into two groups. splitapply applies the mean function
to each group and concatenates the mean weights into a vector.

findgroups returns a vector of group identifiers as the second output argument. The group
identifiers are logical values because Smoker contains logical values. The patients in the first group
are nonsmokers, and the patients in the second group are smokers.
smoker

smoker = 2x1 logical array

9-50
Split Data into Groups and Calculate Statistics

Split the patient weights by both gender and status as a smoker and calculate the mean weights.

G = findgroups(Gender,Smoker);
meanWeight = splitapply(@mean,Weight,G)

meanWeight = 4×1

130.3250
130.9231
180.0385
181.1429

The unique combinations across Gender and Smoker identify four groups of patients: female
nonsmokers, female smokers, male nonsmokers, and male smokers. Summarize the four groups and
their mean weights in a table.

[G,gender,smoker] = findgroups(Gender,Smoker);
T = table(gender,smoker,meanWeight)

T=4×3 table
gender smoker meanWeight
______ ______ __________

Female false 130.32


Female true 130.92
Male false 180.04
Male true 181.14

[Link] contains categorical values, and [Link] contains logical values. The data types of these
table variables match the data types of Gender and Smoker respectively.

Calculate body mass index (BMI) for the four groups of patients. Define a function that takes Height
and Weight as its two input arguments, and that calculates BMI.

meanBMIfcn = @(h,w)mean((w ./ (h.^2)) * 703);


BMI = splitapply(meanBMIfcn,Height,Weight,G)

BMI = 4×1

21.6721
21.6686
26.5775
26.4584

Group Patients Based on Self-Reports

Calculate the fraction of patients who report their health as either Poor or Fair. First, use
splitapply to count the number of patients in each group: female nonsmokers, female smokers,
male nonsmokers, and male smokers. Then, count only those patients who report their health as
either Poor or Fair, using logical indexing on S and G. From these two sets of counts, calculate the
fraction for each group.

9-51
9 Tables

[G,gender,smoker] = findgroups(Gender,Smoker);
S = SelfAssessedHealthStatus;
I = ismember(S,{'Poor','Fair'});
numPatients = splitapply(@numel,S,G);
numPF = splitapply(@numel,S(I),G(I));
numPF./numPatients

ans = 4×1

0.2500
0.3846
0.3077
0.1429

Compare the standard deviation in Diastolic readings of those patients who report Poor or Fair
health, and those patients who report Good or Excellent health.

stdDiastolicPF = splitapply(@std,Diastolic(I),G(I));
stdDiastolicGE = splitapply(@std,Diastolic(~I),G(~I));

Collect results in a table. For these patients, the female nonsmokers who report Poor or Fair health
show the widest variation in blood pressure readings.

T = table(gender,smoker,numPatients,numPF,stdDiastolicPF,stdDiastolicGE,BMI)

T=4×7 table
gender smoker numPatients numPF stdDiastolicPF stdDiastolicGE BMI
______ ______ ___________ _____ ______________ ______________ ______

Female false 40 10 6.8872 3.9012 21.672


Female true 13 5 5.4129 5.0409 21.669
Male false 26 8 4.2678 4.8159 26.578
Male true 21 3 5.6862 5.258 26.458

See Also
findgroups | splitapply

Related Examples
• “Split Table Data Variables and Apply Functions” on page 9-53

More About
• “Grouping Variables To Split Data” on page 9-62

9-52
Split Table Data Variables and Apply Functions

Split Table Data Variables and Apply Functions


This example shows how to split power outage data from a table into groups by region and cause of
the power outages. Then it shows how to apply functions to calculate statistics for each group and
collect the results in a table.

Load Power Outage Data

The sample file, [Link], contains data representing electric utility outages in the United
States. The file contains six columns: Region, OutageTime, Loss, Customers, RestorationTime,
and Cause. Read [Link] into a table.

T = readtable('[Link]');

Convert Region and Cause to categorical arrays, and OutageTime and RestorationTime to
datetime arrays. Display the first five rows.

[Link] = categorical([Link]);
[Link] = categorical([Link]);
[Link] = datetime([Link]);
[Link] = datetime([Link]);
T(1:5,:)

ans=5×6 table
Region OutageTime Loss Customers RestorationTime Cause
_________ ________________ ______ __________ ________________ _______________

SouthWest 2002-02-01 12:18 458.98 1.8202e+06 2002-02-07 16:50 winter storm


SouthEast 2003-01-23 00:49 530.14 2.1204e+05 NaT winter storm
SouthEast 2003-02-07 21:15 289.4 1.4294e+05 2003-02-17 08:14 winter storm
West 2004-04-06 05:44 434.81 3.4037e+05 2004-04-06 06:10 equipment fault
MidWest 2002-03-16 06:18 186.44 2.1275e+05 2002-03-18 23:23 severe storm

Calculate Maximum Power Loss

Determine the greatest power loss due to a power outage in each region. The findgroups function
returns G, a vector of group numbers created from [Link]. The splitapply function uses G to
split [Link] into five groups, corresponding to the five regions. splitapply applies the max
function to each group and concatenates the maximum power losses into a vector.

G = findgroups([Link]);
maxLoss = splitapply(@max,[Link],G)

maxLoss = 5×1
104 ×

2.3141
2.3418
0.8767
0.2796
1.6659

Calculate the maximum power loss due to a power outage by cause. To specify that Cause is the
grouping variable, use table indexing. Create a table that contains the maximum power losses and
their causes.

9-53
9 Tables

T1 = T(:,'Cause');
[G,powerLosses] = findgroups(T1);
[Link] = splitapply(@max,[Link],G)

powerLosses=10×2 table
Cause maxLoss
________________ _______

attack 582.63
earthquake 258.18
energy emergency 11638
equipment fault 16659
fire 872.96
severe storm 8767.3
thunder storm 23418
unknown 23141
wind 2796
winter storm 2883.7

powerLosses is a table because T1 is a table. You can append the maximum losses as another table
variable.

Calculate the maximum power loss by cause in each region. To specify that Region and Cause are
the grouping variables, use table indexing. Create a table that contains the maximum power losses
and display the first 15 rows.

T1 = T(:,{'Region','Cause'});
[G,powerLosses] = findgroups(T1);
[Link] = splitapply(@max,[Link],G);
powerLosses(1:15,:)

ans=15×3 table
Region Cause maxLoss
_________ ________________ _______

MidWest attack 0
MidWest energy emergency 2378.7
MidWest equipment fault 903.28
MidWest severe storm 6808.7
MidWest thunder storm 15128
MidWest unknown 23141
MidWest wind 2053.8
MidWest winter storm 669.25
NorthEast attack 405.62
NorthEast earthquake 0
NorthEast energy emergency 11638
NorthEast equipment fault 794.36
NorthEast fire 872.96
NorthEast severe storm 6002.4
NorthEast thunder storm 23418

Calculate Number of Customers Impacted

Determine power-outage impact on customers by cause and region. Because [Link] contains NaN
values, wrap sum in an anonymous function to use the 'omitnan' input argument.

9-54
Split Table Data Variables and Apply Functions

osumFcn = @(x)(sum(x,'omitnan'));
[Link] = splitapply(osumFcn,[Link],G);
powerLosses(1:15,:)

ans=15×4 table
Region Cause maxLoss totalCustomers
_________ ________________ _______ ______________

MidWest attack 0 0
MidWest energy emergency 2378.7 6.3363e+05
MidWest equipment fault 903.28 1.7822e+05
MidWest severe storm 6808.7 1.3511e+07
MidWest thunder storm 15128 4.2563e+06
MidWest unknown 23141 3.9505e+06
MidWest wind 2053.8 1.8796e+06
MidWest winter storm 669.25 4.8887e+06
NorthEast attack 405.62 2181.8
NorthEast earthquake 0 0
NorthEast energy emergency 11638 1.4391e+05
NorthEast equipment fault 794.36 3.9961e+05
NorthEast fire 872.96 6.1292e+05
NorthEast severe storm 6002.4 2.7905e+07
NorthEast thunder storm 23418 2.1885e+07

Calculate Mean Durations of Power Outages

Determine the mean durations of all U.S. power outages in hours. Add the mean durations of power
outages to powerLosses. Because [Link] has NaT values, omit the resulting NaN
values when calculating the mean durations.

D = [Link] - [Link];
H = hours(D);
omeanFcn = @(x)(mean(x,'omitnan'));
[Link] = splitapply(omeanFcn,H,G);
powerLosses(1:15,:)

ans=15×5 table
Region Cause maxLoss totalCustomers meanOutage
_________ ________________ _______ ______________ __________

MidWest attack 0 0 335.02


MidWest energy emergency 2378.7 6.3363e+05 5339.3
MidWest equipment fault 903.28 1.7822e+05 17.863
MidWest severe storm 6808.7 1.3511e+07 78.906
MidWest thunder storm 15128 4.2563e+06 51.245
MidWest unknown 23141 3.9505e+06 30.892
MidWest wind 2053.8 1.8796e+06 73.761
MidWest winter storm 669.25 4.8887e+06 127.58
NorthEast attack 405.62 2181.8 5.5117
NorthEast earthquake 0 0 0
NorthEast energy emergency 11638 1.4391e+05 77.345
NorthEast equipment fault 794.36 3.9961e+05 87.204
NorthEast fire 872.96 6.1292e+05 4.0267
NorthEast severe storm 6002.4 2.7905e+07 2163.5

9-55
9 Tables

NorthEast thunder storm 23418 2.1885e+07 46.098

See Also
findgroups | rowfun | splitapply | varfun

Related Examples
• “Access Data in Tables” on page 9-34
• “Calculations on Tables” on page 9-47
• “Split Data into Groups and Calculate Statistics” on page 9-50

More About
• “Grouping Variables To Split Data” on page 9-62

9-56
Advantages of Using Tables

Advantages of Using Tables


Conveniently Store Mixed-Type Data in Single Container

You can use the table data type to collect mixed-type data and metadata properties, such as variable
name, row names, descriptions, and variable units, in a single container. Tables are suitable for
column-oriented or tabular data that is often stored as columns in a text file or in a spreadsheet. For
example, you can use a table to store experimental data, with rows representing different
observations and columns representing different measured variables.

Tables consist of rows and column-oriented variables. Each variable in a table can have a different
data type and a different size, but each variable must have the same number of rows.

For example, load sample patients data.


load patients

Then, combine the workspace variables, Systolic and Diastolic into a single BloodPressure
variable and convert the workspace variable, Gender, from a cell array of character vectors to a
categorical array.
BloodPressure = [Systolic Diastolic];
Gender = categorical(Gender);

whos('Gender','Age','Smoker','BloodPressure')

Name Size Bytes Class Attributes

Age 100x1 800 double


BloodPressure 100x2 1600 double
Gender 100x1 330 categorical
Smoker 100x1 100 logical

The variables Age, BloodPressure, Gender, and Smoker have varying data types and are
candidates to store in a table since they all have the same number of rows, 100.

Now, create a table from the variables and display the first five rows.
T = table(Gender,Age,Smoker,BloodPressure);
T(1:5,:)

ans=5×4 table
Gender Age Smoker BloodPressure
______ ___ ______ _____________

Male 38 true 124 93


Male 43 false 109 77
Female 38 false 125 83
Female 40 false 117 75
Female 49 false 122 80

The table displays in a tabular format with the variable names at the top.

Each variable in a table is a single data type. If you add a new row to the table, MATLAB® forces
consistency of the data type between the new data and the corresponding table variables. For
example, if you try to add information for a new patient where the first column contains the patient's

9-57
9 Tables

age instead of gender, as in the expression T(end+1,:) = {37,{'Female'},true,[130 84]},


then you receive the error:

Invalid RHS for assignment to a categorical array.

The error occurs because MATLAB® cannot assign numeric data, 37, to the categorical array,
Gender.

For comparison of tables with structures, consider the structure array, StructArray, that is
equivalent to the table, T.
StructArray = table2struct(T)

StructArray=100×1 struct array with fields:


Gender
Age
Smoker
BloodPressure

Structure arrays organize records using named fields. Each field's value can have a different data
type or size. Now, display the named fields for the first element of StructArray.
StructArray(1)

ans = struct with fields:


Gender: Male
Age: 38
Smoker: 1
BloodPressure: [124 93]

Fields in a structure array are analogous to variables in a table. However, unlike with tables, you
cannot enforce homogeneity within a field. For example, you can have some values of [Link] that
are categorical array elements, Male or Female, others that are character vectors, 'Male' or
'Female', and others that are integers, 0 or 1.

Now consider the same data stored in a scalar structure, with four fields each containing one variable
from the table.
ScalarStruct = struct(...
'Gender',{Gender},...
'Age',Age,...
'Smoker',Smoker,...
'BloodPressure',BloodPressure)

ScalarStruct = struct with fields:


Gender: [100x1 categorical]
Age: [100x1 double]
Smoker: [100x1 logical]
BloodPressure: [100x2 double]

Unlike with tables, you cannot enforce that the data is rectangular. For example, the field
[Link] can be a different length than the other fields.

A table allows you to maintain the rectangular structure (like a structure array) and enforce
homogeneity of variables (like fields in a scalar structure). Although cell arrays do not have named

9-58
Advantages of Using Tables

fields, they have many of the same disadvantages as structure arrays and scalar structures. If you
have rectangular data that is homogeneous in each variable, consider using a table. Then you can use
numeric or named indexing, and you can use table properties to store metadata.

Access Data Using Numeric or Named Indexing

You can index into a table using parentheses, curly braces, or dot indexing. Parentheses allow you to
select a subset of the data in a table and preserve the table container. Curly braces and dot indexing
allow you to extract data from a table. Within each table indexing method, you can specify the rows
or variables to access by name or by numeric index.

Consider the sample table from above. Each row in the table, T, represents a different patient. The
workspace variable, LastName, contains unique identifiers for the 100 rows. Add row names to the
table by setting the RowNames property to LastName and display the first five rows of the updated
table.
[Link] = LastName;
T(1:5,:)

ans=5×4 table
Gender Age Smoker BloodPressure
______ ___ ______ _____________

Smith Male 38 true 124 93


Johnson Male 43 false 109 77
Williams Female 38 false 125 83
Jones Female 40 false 117 75
Brown Female 49 false 122 80

In addition to labeling the data, you can use row and variable names to access data in the table. For
example, use named indexing to display the age and blood pressure of the patients Williams and
Brown.
T({'Williams','Brown'},{'Age','BloodPressure'})

ans=2×2 table
Age BloodPressure
___ _____________

Williams 38 125 83
Brown 49 122 80

Now, use numeric indexing to return an equivalent subtable. Return the third and fifth row from the
second and fourth variables.
T(3:2:5,2:2:4)

ans=2×2 table
Age BloodPressure
___ _____________

Williams 38 125 83
Brown 49 122 80

With cell arrays or structures, you do not have the same flexibility to use named or numeric indexing.

9-59
9 Tables

• With a cell array, you must use strcmp to find desired named data, and then you can index into
the array.
• With a scalar structure or structure array, it is not possible to refer to a field by number.
Furthermore, with a scalar structure, you cannot easily select a subset of variables or a subset of
observations. With a structure array, you can select a subset of observations, but you cannot select
a subset of variables.
• With a table, you can access data by named index or by numeric index. Furthermore, you can
easily select a subset of variables and a subset of rows.

For more information on table indexing, see “Access Data in Tables” on page 9-34.

Use Table Properties to Store Metadata

In addition to storing data, tables have properties to store metadata, such as variable names, row
names, descriptions, and variable units. You can access a property using [Link],
where T is the name of the table and PropName is one of the table properties.

For example, add a table description, variable descriptions, and variable units for Age.

[Link] = 'Simulated Patient Data';

[Link] = ...
{'Male or Female' ...
'' ...
'true or false' ...
'Systolic/Diastolic'};

[Link]{'Age'} = 'Yrs';

Individual empty character vectors within the cell array for VariableDescriptions indicate that
the corresponding variable does not have a description. For more information, see the Properties
section of table.

To print a table summary, use the summary function.

summary(T)

Description: Simulated Patient Data

Variables:

Gender: 100x1 categorical

Properties:
Description: Male or Female
Values:

Female 53
Male 47

Age: 100x1 double

Properties:
Units: Yrs
Values:

9-60
Advantages of Using Tables

Min 25
Median 39
Max 50

Smoker: 100x1 logical

Properties:
Description: true or false
Values:

True 34
False 66

BloodPressure: 100x2 double

Properties:
Description: Systolic/Diastolic
Values:
Column 1 Column 2
________ ________

Min 109 68
Median 122 81.5
Max 138 99

Structures and cell arrays do not have properties for storing metadata.

See Also
summary | table

Related Examples
• “Create and Work with Tables” on page 9-2
• “Modify Units, Descriptions, and Table Variable Names” on page 9-26
• “Access Data in Tables” on page 9-34

9-61
9 Tables

Grouping Variables To Split Data


You can use grouping variables to split data variables into groups. Typically, selecting grouping
variables is the first step in the Split-Apply-Combine workflow. You can split data into groups, apply a
function to each group, and combine the results. You also can denote missing values in grouping
variables, so that corresponding values in data variables are ignored.

Grouping Variables
Grouping variables are variables used to group, or categorize, observations—that is, data values in
other variables. A grouping variable can be any of these data types:

• Numeric, logical, categorical, datetime, or duration vector


• Cell array of character vectors
• Table, with table variables of any data type in this list

Data variables are the variables that contain observations. A grouping variable must have a value
corresponding to each value in the data variables. Data values belong to the same group when the
corresponding values in the grouping variable are the same.

This table shows examples of data variables, grouping variables, and the groups that you can create
when you split the data variables using the grouping variables.

Data Variable Grouping Variable Groups of Data


[5 10 15 20 25 30] [0 0 0 0 1 1] [5 10 15 20] [25 30]
[10 20 30 40 50 60] [1 3 3 1 2 1] [10 40 60] [50] [20 30]
[64 72 67 69 64 68] {'F','M','F','M','F','F'} [64 67 64 68] [72 69]

You can give groups of data meaningful names when you use cell arrays of character vectors or
categorical arrays as grouping variables. A categorical array is an efficient and flexible choice of
grouping variable.

Group Definition
Typically, there are as many groups as there are unique values in the grouping variable. (A
categorical array also can include categories that are not represented in the data.) The groups and
the order of the groups depend on the data type of the grouping variable.

• For numeric, logical, datetime, or duration vectors, or cell arrays of character vectors, the
groups correspond to the unique values sorted in ascending order.
• For categorical arrays, the groups correspond to the unique values observed in the array, sorted in
the order returned by the categories function.

The findgroups function can accept multiple grouping variables, for example G =
findgroups(A1,A2). You also can include multiple grouping variables in a table, for example T =
table(A1,A2); G = findgroups(T). The findgroups function defines groups by the unique
combinations of values across corresponding elements of the grouping variables. findgroups
decides the order by the order of the first grouping variable, and then by the order of the second
grouping variable, and so on. For example, if A1 = {'a','a','b','b'} and A2 = [0 1 0 0],

9-62
Grouping Variables To Split Data

then the unique values across the grouping variables are 'a' 0, 'a' 1, and 'b' 0, defining three
groups.

The Split-Apply-Combine Workflow


After you select grouping variables and split data variables into groups, you can apply functions to
the groups and combine the results. This workflow is called the Split-Apply-Combine workflow. You
can use the findgroups and splitapply functions together to analyze groups of data in this
workflow. This diagram shows a simple example using the grouping variable Gender and the data
variable Height to calculate the mean height by gender.

The findgroups function returns a vector of group numbers that define groups based on the unique
values in the grouping variables. splitapply uses the group numbers to split the data into groups
efficiently before applying a function.

Missing Group Values


Grouping variables can have missing values. This table shows the missing value indicator for each
data type. If a grouping variable has missing values, then findgroups assigns NaN as the group
number, and splitapply ignores the corresponding values in the data variables.

Grouping Variable Data Type Missing Value Indicator


Numeric NaN
Logical (Cannot be missing)
Categorical <undefined>
datetime NaT
duration NaN
Cell array of character vectors ''
String <missing>

See Also
findgroups | rowfun | splitapply | varfun

9-63
9 Tables

Related Examples
• “Access Data in Tables” on page 9-34
• “Split Table Data Variables and Apply Functions” on page 9-53
• “Split Data into Groups and Calculate Statistics” on page 9-50

9-64
Changes to DimensionNames Property in R2016b

Changes to DimensionNames Property in R2016b


The table data type is suitable for collecting column-oriented, heterogeneous data in a single
container. Tables also contain metadata properties such as variable names, row names, dimension
names, descriptions, and variable units. Starting in R2016b, you can use the dimension names to
access table data and metadata using dot subscripting. To support that, the dimension names must
satisfy the same requirements as the variable names. For backwards compatibility, tables enforce
those restrictions by automatically modifying dimension names when needed.

Create a table that has row names and variable names.


Number = [8; 21; 13; 20; 11];
Name = {'Van Buren'; 'Arthur'; 'Fillmore'; 'Garfield'; 'Polk'};
Party = categorical({'Democratic'; 'Republican'; 'Whig'; 'Republican'; 'Republican'});
T = table(Number,Party,'RowNames',Name)

T =

Number Party
______ __________

Van Buren 8 Democratic


Arthur 21 Republican
Fillmore 13 Whig
Garfield 20 Republican
Polk 11 Republican

Display its properties, including the dimension names. The default values of the dimension names are
'Row' and 'Variables'.
[Link]

ans =

struct with fields:

Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {'Number' 'Party'}
VariableDescriptions: {}
VariableUnits: {}
RowNames: {5×1 cell}

Starting in R2016b, you can assign new names to the dimension names, and use them to access table
data. Dimension names must be valid MATLAB identifiers, and must not be one of the reserved
names, 'Properties', 'RowNames', or 'VariableNames'.

Assign a new name to the first dimension name, and use it to access the row names of the table.
[Link]{1} = 'Name';
[Link]

ans =

5×1 cell array

'Van Buren'
'Arthur'

9-65
9 Tables

'Fillmore'
'Garfield'
'Polk'

Create a new table variable called Name. When you create the variable, the table modifies its first
dimension name to prevent a conflict. The updated dimension name becomes Name_1.

T{:,'Name'} = {'Martin'; 'Chester'; 'Millard'; 'James'; 'James'}


Warning: DimensionNames property was modified to avoid conflicting dimension and variable names:
'Name'. See Compatibility Considerations for Using Tables for more details. This will become an
error in a future release.

T =

Number Party Name


______ __________ _________

Van Buren 8 Democratic 'Martin'


Arthur 21 Republican 'Chester'
Fillmore 13 Whig 'Millard'
Garfield 20 Republican 'James'
Polk 11 Republican 'James'

[Link]

ans =

1×2 cell array

'Name_1' 'Data'

Similarly, if you assign a dimension name that is not a valid MATLAB identifier, the name is modified.

[Link]{1} = 'Last Name';


[Link]
Warning: DimensionNames property was modified to make the name 'Last Name' a valid MATLAB
identifier. See Compatibility Considerations for Using Tables for more details. This will
become an error in a future release.

ans =

1×2 cell array

'LastName' 'Data'

In R2016b, tables raise warnings when dimension names are not valid identifiers, or conflict with
variable names or reserved names, so that you can continue to work with code and tables created
with previous releases. If you encounter these warnings, it is recommended that you update your
code to avoid them.

9-66
10

Timetables

• “Create Timetables” on page 10-2


• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Timetable Data by Row Time and Variable Type” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25
• “Using Row Labels in Table and Timetable Operations” on page 10-33
• “Loma Prieta Earthquake Analysis” on page 10-38
• “Preprocess and Explore Time-stamped Data Using timetable” on page 10-48
10 Timetables

Create Timetables
This example shows how to create a timetable, combine timetables, and adjust the data from multiple
timetables to a common time vector. The common time vector can contain the times from either or
both timetables, or it can be an entirely new time vector that you specify. The example shows how to
compute and display a daily mean for weather measurements contained in different timetables.

A timetable is a type of table that associates a time with each row. A timetable can store column-
oriented data variables that have different data types and sizes, so long as each variable has the same
number of rows. In addition, timetables provide time-specific functions to combine, subscript into,
and adjust their data.

Import Timetables from Files

Load air quality data and weather measurements into two different timetables. The dates of the
measurements range from November 15, 2015, to November 19, 2015. The air quality data come
from a sensor inside a building, while the weather measurements come from sensors outside.

Read the air quality data from a table with the readtimetable function. The output is a timetable.

indoors = readtimetable('[Link]');

You also can create a timetable from an M-by-N array with the array2timetable function, or from
workspace variables with the timetable function.

Display the first five rows of indoors. Each row of the timetable has a time that labels that row of
data.

indoors(1:5,:)

ans=5×2 timetable
Time Humidity AirQuality
___________________ ________ __________

2015-11-15 00:00:24 36 80
2015-11-15 01:13:35 36 80
2015-11-15 02:26:47 37 79
2015-11-15 03:39:59 37 82
2015-11-15 04:53:11 36 80

Load the timetable with weather measurements. Display the first five rows of outdoors.

load outdoors
outdoors(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

2015-11-15 00:00:24 49 51.3 29.61


2015-11-15 01:30:24 48.9 51.5 29.61
2015-11-15 03:00:24 48.9 51.5 29.61
2015-11-15 04:30:24 48.8 51.5 29.61
2015-11-15 06:00:24 48.7 51.5 29.6

10-2
Create Timetables

Synchronize Timetables

The timetables, indoors and outdoors, contain different measurements taken inside and outside a
building at different times. Combine all the data into one timetable with the synchronize function.

tt = synchronize(indoors,outdoors);
tt(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:24 36 80 49 51.3


2015-11-15 01:13:35 36 80 NaN NaN
2015-11-15 01:30:24 NaN NaN 48.9 51.5
2015-11-15 02:26:47 37 79 NaN NaN
2015-11-15 03:00:24 NaN NaN 48.9 51.5

The output timetable, tt contains all the times from both timetables. synchronize puts a missing
data indicator where there are no data values to place in tt. When both input timetables have a
variable with the same name, such as Humidity, synchronize renames both variables and adds
both to the output timetable.

Synchronize the timetables again, and this time fill in missing data values with linear interpolation.

ttLinear = synchronize(indoors,outdoors,'union','linear');
ttLinear(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:24 36 80 49 51.3


2015-11-15 01:13:35 36 80 48.919 51.463
2015-11-15 01:30:24 36.23 79.77 48.9 51.5
2015-11-15 02:26:47 37 79 48.9 51.5
2015-11-15 03:00:24 37 80.378 48.9 51.5

Adjust Data in One Timetable

You also can adjust the data in a single timetable to a new time vector. Calculate the means of the
variables in ttLinear over six-hour intervals with the retime function. If any rows have NaN values
after you adjust the data, remove them with the rmmissing function.

tv = [datetime(2015,11,15):hours(6):datetime(2015,11,18)];
ttHourly = retime(ttLinear,tv,'mean');
ttHourly = rmmissing(ttHourly);

Plot Timetable Data

Normalize the data in ttHourly to the mean for each variable in the timetable. Plot the mean daily
values of these measurements. You can use the Variables property of a timetable to access the
variables. [Link] returns the same variables as ttHourly{:,:}.

ttMeanVars = [Link]./mean([Link]);
plot([Link],ttMeanVars);

10-3
10 Timetables

legend([Link],'Interpreter','none');
xlabel('Time');
ylabel('Normalized Weather Measurements');
title('Mean Daily Weather Trends');

See Also
retime | rmmissing | synchronize | table2timetable | timerange | timetable

Related Examples
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Timetable Data by Row Time and Variable Type” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25

10-4
Resample and Aggregate Data in Timetable

Resample and Aggregate Data in Timetable


This example shows how to resample and aggregate data in a timetable. A timetable is a type of table
that associates a time with each row. A timetable can store column-oriented data variables that have
different data types and sizes, provided that each variable has the same number of rows. With the
retime function, you can resample timetable data, or aggregate timetable data into time bins you
specify.

Import Timetable

Load a timetable containing weather measurements taken from November 15, 2015, to November 19,
2015. The timetable contains humidity, temperature, and pressure readings taken over this time
period.
load outdoors
outdoors(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

2015-11-15 00:00:24 49 51.3 29.61


2015-11-15 01:30:24 48.9 51.5 29.61
2015-11-15 03:00:24 48.9 51.5 29.61
2015-11-15 04:30:24 48.8 51.5 29.61
2015-11-15 06:00:24 48.7 51.5 29.6

Determine if the timetable is regular. A regular timetable is one in which the differences between all
consecutive row times are the same. outdoors is not a regular timetable.
TF = isregular(outdoors)

TF = logical
0

Find the differences in the time steps. They vary between half a minute and an hour and a half.
dt = unique(diff([Link]))

dt = 3x1 duration
00:00:24
01:29:36
01:30:00

Resample Timetable with Interpolation

Adjust the data in the timetable with the retime function. Specify an hourly time vector. Interpolate
the timetable data to the new row times.
TT = retime(outdoors,'hourly','spline');
TT(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

10-5
10 Timetables

2015-11-15 00:00:00 49.001 51.298 29.61


2015-11-15 01:00:00 48.909 51.467 29.61
2015-11-15 02:00:00 48.902 51.51 29.61
2015-11-15 03:00:00 48.9 51.5 29.61
2015-11-15 04:00:00 48.844 51.498 29.611

Resample Timetable with Nearest Neighbor Values

Specify an hourly time vector for TT. For each row in TT, copy values from the corresponding row in
outdoors whose row time is nearest.
TT = retime(outdoors,'hourly','nearest');
TT(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

2015-11-15 00:00:00 49 51.3 29.61


2015-11-15 01:00:00 48.9 51.5 29.61
2015-11-15 02:00:00 48.9 51.5 29.61
2015-11-15 03:00:00 48.9 51.5 29.61
2015-11-15 04:00:00 48.8 51.5 29.61

Aggregate Timetable Data and Calculate Daily Mean

The retime function provides aggregation methods, such as mean. Calculate the daily means for the
data in outdoors.
TT = retime(outdoors,'daily','mean');
TT

TT=4×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

2015-11-15 00:00:00 48.931 51.394 29.607


2015-11-16 00:00:00 47.924 51.571 29.611
2015-11-17 00:00:00 48.45 51.238 29.613
2015-11-18 00:00:00 49.5 50.8 29.61

Adjust Timetable Data to Regular Times

Calculate the means over six-hour time intervals. Specify a regular time step using the 'regular'
input argument and the 'TimeStep' name-value pair argument.
TT = retime(outdoors,'regular','mean','TimeStep',hours(6));
TT(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

2015-11-15 00:00:00 48.9 51.45 29.61


2015-11-15 06:00:00 48.9 51.45 29.6

10-6
Resample and Aggregate Data in Timetable

2015-11-15 12:00:00 49.025 51.45 29.61


2015-11-15 18:00:00 48.9 51.225 29.607
2015-11-16 00:00:00 48.5 51.4 29.61

As an alternative, you can specify a time vector that has the same six-hour time intervals. Specify a
format for the time vector to display both date and time when you display the timetable.

tv = datetime(2015,11,15):hours(6):datetime(2015,11,18);
[Link] = 'dd-MMM-yyyy HH:mm:ss';
TT = retime(outdoors,tv,'mean');
TT(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
____________________ ________ ____________ __________

15-Nov-2015 00:00:00 48.9 51.45 29.61


15-Nov-2015 06:00:00 48.9 51.45 29.6
15-Nov-2015 12:00:00 49.025 51.45 29.61
15-Nov-2015 18:00:00 48.9 51.225 29.607
16-Nov-2015 00:00:00 48.5 51.4 29.61

See Also
retime | synchronize | table2timetable | timetable

Related Examples
• “Create Timetables” on page 10-2
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Timetable Data by Row Time and Variable Type” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25

10-7
10 Timetables

Combine Timetables and Synchronize Their Data


You can combine timetables and synchronize their data in a variety of ways. You can concatenate
timetables vertically or horizontally, but only when they contain the same row times or timetable
variables. Use the synchronize function to combine timetables with different row times and
timetable variables. synchronize creates a timetable that contains all variables from all input
timetables. It then synchronizes the data from the input timetables to the row times of the output
timetable. synchronize can fill in missing elements of the output timetable with missing data
indicators, with values copied from their nearest neighbors, or with interpolated values.
synchronize also can aggregate timetable data over time bins you specify.

Concatenate Timetables Vertically

Load timetables from openPricesSmall and concatenate them vertically. The timetables are
opWeek1 and opWeek2. They contain opening prices for some stocks during the first and second
weeks of January 2016.

load openPricesSmall

Display the two timetables.

opWeek1

opWeek1=5×2 timetable
Time AAPL FB
____________________ ______ ______

08-Jan-2016 09:00:00 98.55 99.88


07-Jan-2016 09:00:00 98.68 100.5
06-Jan-2016 09:00:00 100.56 101.13
05-Jan-2016 09:00:00 105.75 102.89
04-Jan-2016 09:00:00 102.61 101.95

opWeek2

opWeek2=5×2 timetable
Time AAPL FB
____________________ ______ ______

14-Jan-2016 09:00:00 97.96 95.85


13-Jan-2016 09:00:00 100.32 100.58
12-Jan-2016 09:00:00 100.55 99
11-Jan-2016 09:00:00 98.97 97.91
08-Jan-2016 09:00:00 98.55 99.88

Concatenate the timetables. You can concatenate timetables vertically when they have the same
variables. The row times label the rows and are not contained in a timetable variable. Note that the
row times of a timetable can be out of order and do not need to be regularly spaced. For example, op
does not include days that fall on weekends. A timetable also can contain duplicate times. op contains
two rows for 08-Jan-2016 09:00:00.

op = [opWeek2;opWeek1]

op=10×2 timetable
Time AAPL FB

10-8
Combine Timetables and Synchronize Their Data

____________________ ______ ______

14-Jan-2016 09:00:00 97.96 95.85


13-Jan-2016 09:00:00 100.32 100.58
12-Jan-2016 09:00:00 100.55 99
11-Jan-2016 09:00:00 98.97 97.91
08-Jan-2016 09:00:00 98.55 99.88
08-Jan-2016 09:00:00 98.55 99.88
07-Jan-2016 09:00:00 98.68 100.5
06-Jan-2016 09:00:00 100.56 101.13
05-Jan-2016 09:00:00 105.75 102.89
04-Jan-2016 09:00:00 102.61 101.95

Concatenate Timetables Horizontally

You also can concatenate timetables horizontally. The timetables must have the same row times and
different variables.

Display the timetable opOtherStocks. The timetable has the same row times as opWeek1, but
variables for different stocks.

opOtherStocks

opOtherStocks=5×2 timetable
Time MSFT TWTR
____________________ _____ _____

08-Jan-2016 09:00:00 52.37 20.51


07-Jan-2016 09:00:00 52.7 21
06-Jan-2016 09:00:00 54.32 21.62
05-Jan-2016 09:00:00 54.93 22.79
04-Jan-2016 09:00:00 54.32 22.64

Concatenate opWeek1 and opOtherStock. The output timetable has one set of row times and the
variables from both timetables.

op = [opWeek1 opOtherStocks]

op=5×4 timetable
Time AAPL FB MSFT TWTR
____________________ ______ ______ _____ _____

08-Jan-2016 09:00:00 98.55 99.88 52.37 20.51


07-Jan-2016 09:00:00 98.68 100.5 52.7 21
06-Jan-2016 09:00:00 100.56 101.13 54.32 21.62
05-Jan-2016 09:00:00 105.75 102.89 54.93 22.79
04-Jan-2016 09:00:00 102.61 101.95 54.32 22.64

Synchronize Timetables and Indicate Missing Data

Load air quality data and weather measurements from two different timetables and synchronize
them. The dates of the measurements range from November 15, 2015, to November 19, 2015. The air
quality data come from a sensor inside a building, while the weather measurements come from
sensors outside.

10-9
10 Timetables

load indoors
load outdoors

Display the first five lines of each timetable. They contain measurements of different quantities taken
at different times.
indoors(1:5,:)

ans=5×2 timetable
Time Humidity AirQuality
___________________ ________ __________

2015-11-15 00:00:24 36 80
2015-11-15 01:13:35 36 80
2015-11-15 02:26:47 37 79
2015-11-15 03:39:59 37 82
2015-11-15 04:53:11 36 80

outdoors(1:5,:)

ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________

2015-11-15 00:00:24 49 51.3 29.61


2015-11-15 01:30:24 48.9 51.5 29.61
2015-11-15 03:00:24 48.9 51.5 29.61
2015-11-15 04:30:24 48.8 51.5 29.61
2015-11-15 06:00:24 48.7 51.5 29.6

Synchronize the timetables. The output timetable tt contains all the times from both timetables.
synchronize puts a missing data indicator where there are no data values to place in tt. When both
input timetables have a variable with the same name, such as Humidity, synchronize renames
both variables and adds both to the output timetable.
tt = synchronize(indoors,outdoors);
tt(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:24 36 80 49 51.3


2015-11-15 01:13:35 36 80 NaN NaN
2015-11-15 01:30:24 NaN NaN 48.9 51.5
2015-11-15 02:26:47 37 79 NaN NaN
2015-11-15 03:00:24 NaN NaN 48.9 51.5

Synchronize and Interpolate Data Values

Synchronize the timetables, and fill in missing timetable elements with linear interpolation. To
synchronize on a time vector that includes all times from both timetables, specify 'union' for the
output times.
ttLinear = synchronize(indoors,outdoors,'union','linear');
ttLinear(1:5,:)

10-10
Combine Timetables and Synchronize Their Data

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:24 36 80 49 51.3


2015-11-15 01:13:35 36 80 48.919 51.463
2015-11-15 01:30:24 36.23 79.77 48.9 51.5
2015-11-15 02:26:47 37 79 48.9 51.5
2015-11-15 03:00:24 37 80.378 48.9 51.5

Synchronize to Regular Times

Synchronize the timetables to an hourly time vector. The input timetables had irregular row times.
The output timetable has regular row times with one hour as the time step.
ttHourly = synchronize(indoors,outdoors,'hourly','linear');
ttHourly(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:00 36 80 49 51.299


2015-11-15 01:00:00 36 80 48.934 51.432
2015-11-15 02:00:00 36.634 79.366 48.9 51.5
2015-11-15 03:00:00 37 80.361 48.9 51.5
2015-11-15 04:00:00 36.727 81.453 48.834 51.5

Synchronize the timetables to a 30-minute time step. Specify a regular time step using the
'regular' input argument and the 'TimeStep' name-value pair argument.
ttHalfHour = synchronize(indoors,outdoors,'regular','linear','TimeStep',minutes(30));
ttHalfHour(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:00 36 80 49 51.299


2015-11-15 00:30:00 36 80 48.967 51.366
2015-11-15 01:00:00 36 80 48.934 51.432
2015-11-15 01:30:00 36.224 79.776 48.9 51.499
2015-11-15 02:00:00 36.634 79.366 48.9 51.5

As an alternative, you can synchronize the timetables to a time vector that specifies half-hour
intervals.
tv = [datetime(2015,11,15):minutes(30):datetime(2015,11,18)];
[Link] = [Link];
ttHalfHour = synchronize(indoors,outdoors,tv,'linear');
ttHalfHour(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

10-11
10 Timetables

2015-11-15 00:00:00 36 80 49 51.299


2015-11-15 00:30:00 36 80 48.967 51.366
2015-11-15 01:00:00 36 80 48.934 51.432
2015-11-15 01:30:00 36.224 79.776 48.9 51.499
2015-11-15 02:00:00 36.634 79.366 48.9 51.5

Synchronize and Aggregate Data Values

Synchronize the timetables and calculate the daily means for all variables in the output timetable.

ttDaily = synchronize(indoors,outdoors,'daily','mean');
ttDaily

ttDaily=4×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:00 36.5 80.05 48.931 51.394


2015-11-16 00:00:00 36.85 80.35 47.924 51.571
2015-11-17 00:00:00 36.85 79.45 48.45 51.238
2015-11-18 00:00:00 NaN NaN 49.5 50.8

Synchronize the timetables to six-hour time intervals and calculate a mean for each interval.

tt6Hours = synchronize(indoors,outdoors,'regular','mean','TimeStep',hours(6));
tt6Hours(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:00 36.4 80.2 48.9 51.45


2015-11-15 06:00:00 36.4 79.8 48.9 51.45
2015-11-15 12:00:00 36.6 80.4 49.025 51.45
2015-11-15 18:00:00 36.6 79.8 48.9 51.225
2015-11-16 00:00:00 36.6 80.2 48.5 51.4

As an alternative, specify a time vector that has the same six-hour time intervals.

tv = [datetime(2015,11,15):hours(6):datetime(2015,11,18)];
[Link] = [Link];
tt6Hours = synchronize(indoors,outdoors,tv,'mean');
tt6Hours(1:5,:)

ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________

2015-11-15 00:00:00 36.4 80.2 48.9 51.45


2015-11-15 06:00:00 36.4 79.8 48.9 51.45
2015-11-15 12:00:00 36.6 80.4 49.025 51.45
2015-11-15 18:00:00 36.6 79.8 48.9 51.225

10-12
Combine Timetables and Synchronize Their Data

2015-11-16 00:00:00 36.6 80.2 48.5 51.4

See Also
retime | synchronize | table2timetable | timetable

Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Timetable Data by Row Time and Variable Type” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25

10-13
10 Timetables

Retime and Synchronize Timetable Variables Using Different


Methods
This example shows how to fill in gaps in timetable variables, using different methods for different
variables. You can specify whether each timetable variable contains continuous or discrete data using
the VariableContinuity property of the timetable. When you resample the timetable using the
retime function, retime either interpolates, fills in with previous values, or fills in with missing data
indicators, depending on the values in the VariableContinuity property. Similarly, the
synchronize function interpolates or fills in values based on the VariableContinuity property of
the input timetables.

Create Timetable

Create a timetable that has simulated weather measurements for several days in May 2017. The
timetable variables Tmax and Tmin contain maximum and minimum temperature readings for each
day, and PrecipTotal contains total precipitation for the day. WXEvent is a categorical array,
recording whether certain kinds of weather events, such as thunder or hail, happened on any given
day. The timetable has simulated data from May 4 to May 10, 2017, but is missing data for two days,
May 6th and May 7th.
Date = [datetime(2017,5,4) datetime(2017,5,5) datetime(2017,5,8:10)]';
Tmax = [60 62 56 59 60]';
Tmin = [44 45 40 42 45]';
PrecipTotal = [0.2 0 0 0.15 0]';
WXEvent = [2 0 0 1 0]';
WXEvent = categorical(WXEvent,[0 1 2 3 4],{'None','Thunder','Hail','Fog','Tornado'});
Station1 = timetable(Date,Tmax,Tmin,PrecipTotal,WXEvent)

Station1=5×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ____ ___________ _______

04-May-2017 60 44 0.2 Hail


05-May-2017 62 45 0 None
08-May-2017 56 40 0 None
09-May-2017 59 42 0.15 Thunder
10-May-2017 60 45 0 None

Resample Continuous and Discrete Timetable Variables

One way to fill in data for the two missing days is to use the retime function. If you call retime
without specifying a method, then retime fills in gaps with missing data indicators. For instance,
retime fills gaps in numeric variables with NaN values, and gaps in the categorical variable with
undefined elements.
Station1Daily = retime(Station1,'daily')

Station1Daily=7×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ____ ___________ ___________

04-May-2017 60 44 0.2 Hail


05-May-2017 62 45 0 None
06-May-2017 NaN NaN NaN <undefined>
07-May-2017 NaN NaN NaN <undefined>

10-14
Retime and Synchronize Timetable Variables Using Different Methods

08-May-2017 56 40 0 None
09-May-2017 59 42 0.15 Thunder
10-May-2017 60 45 0 None

If you specify a method when you call retime, it uses the same method to fill gaps in every variable.
To apply different methods to different variables, you can call retime multiple times, each time
indexing into the timetable to access a different subset of variables.

However, you also can apply different methods by specifying the VariableContinuity property of
the timetable. You can specify whether each variable contains continuous or discrete data. Then the
retime function applies a different method to each timetable variable, depending on the
corresponding VariableContinuity value.

If you specify VariableContinuity, then the retime function fills in the output timetable variables
using the following methods:

• 'unset' — Fill in values using the missing data indicator for that type (such as NaN for numeric
variables).
• 'continuous' — Fill in values using linear interpolation.
• 'step' — Fill in values using previous value.
• 'event' — Fill in values using the missing data indicator for that type.

Specify that the temperature data in Station1 is continuous, that PrecipTotal is step data, and
that WXEvent is event data.

[Link] = {'continuous','continuous','step','event'};
[Link]

ans =
TimetableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Date' 'Variables'}
VariableNames: {'Tmax' 'Tmin' 'PrecipTotal' 'WXEvent'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: [continuous continuous step event]
RowTimes: [5x1 datetime]
StartTime: 04-May-2017
SampleRate: NaN
TimeStep: NaN
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.

Resample the data in Station1. Given the values assigned to VariableContinuity, the retime
function interpolates the temperature data, fills in the previous day's values in PrecipTotal, and
fills in WXEvent with undefined elements.

Station1Daily = retime(Station1,'daily')

Station1Daily=7×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ______ ___________ ___________

10-15
10 Timetables

04-May-2017 60 44 0.2 Hail


05-May-2017 62 45 0 None
06-May-2017 60 43.333 0 <undefined>
07-May-2017 58 41.667 0 <undefined>
08-May-2017 56 40 0 None
09-May-2017 59 42 0.15 Thunder
10-May-2017 60 45 0 None

If you specify a method, then retime applies that method to all variables, overriding the values in
VariableContinuity.

Station1Missing = retime(Station1,'daily','fillwithmissing')

Station1Missing=7×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ____ ___________ ___________

04-May-2017 60 44 0.2 Hail


05-May-2017 62 45 0 None
06-May-2017 NaN NaN NaN <undefined>
07-May-2017 NaN NaN NaN <undefined>
08-May-2017 56 40 0 None
09-May-2017 59 42 0.15 Thunder
10-May-2017 60 45 0 None

Synchronize Timetables That Contain Continuous and Discrete Data

The synchronize function also fills in output timetable variables using different methods, depending
on the values specified in the VariableContinuity property of each input timetable.

Create a second timetable that contains pressure readings in millibars from a second weather station.
The timetable has simulated readings from May 4 to May 8, 2017.

Date = datetime(2017,5,4:8)';
Pressure = [995 1003 1013 1018 1006]';
Station2 = timetable(Date,Pressure)

Station2=5×1 timetable
Date Pressure
___________ ________

04-May-2017 995
05-May-2017 1003
06-May-2017 1013
07-May-2017 1018
08-May-2017 1006

Synchronize the data from the two stations using the synchronize function. synchronize fills in
values for variables from Station1 according to the values in the VariableContinuity property
of Station1. However, since the VariableContinuity property of Station2 is empty,
synchronize fills in Pressure with NaN values.

BothStations = synchronize(Station1,Station2)

10-16
Retime and Synchronize Timetable Variables Using Different Methods

BothStations=7×5 timetable
Date Tmax Tmin PrecipTotal WXEvent Pressure
___________ ____ ______ ___________ ___________ ________

04-May-2017 60 44 0.2 Hail 995


05-May-2017 62 45 0 None 1003
06-May-2017 60 43.333 0 <undefined> 1013
07-May-2017 58 41.667 0 <undefined> 1018
08-May-2017 56 40 0 None 1006
09-May-2017 59 42 0.15 Thunder NaN
10-May-2017 60 45 0 None NaN

To indicate that [Link] contains continuous data, specify the VariableContinuity


property of Station2. Though Station2 contains only one variable, you must specify
VariableContinuity using a cell array, not a character vector.

[Link] = {'continuous'};
[Link]

ans =
TimetableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Date' 'Variables'}
VariableNames: {'Pressure'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: continuous
RowTimes: [5x1 datetime]
StartTime: 04-May-2017
SampleRate: NaN
TimeStep: 1d
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.

Synchronize the data from the two stations. synchronize fills in values in
[Link] because [Link] has continuous data.

BothStations = synchronize(Station1,Station2)

BothStations=7×5 timetable
Date Tmax Tmin PrecipTotal WXEvent Pressure
___________ ____ ______ ___________ ___________ ________

04-May-2017 60 44 0.2 Hail 995


05-May-2017 62 45 0 None 1003
06-May-2017 60 43.333 0 <undefined> 1013
07-May-2017 58 41.667 0 <undefined> 1018
08-May-2017 56 40 0 None 1006
09-May-2017 59 42 0.15 Thunder 994
10-May-2017 60 45 0 None 982

10-17
10 Timetables

If you specify a method as an input argument to synchronize, then synchronize applies that
method to all variables, just as the retime function does.

See Also
retime | synchronize | timetable

Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Select Timetable Data by Row Time and Variable Type” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25

10-18
Select Timetable Data by Row Time and Variable Type

Select Timetable Data by Row Time and Variable Type


A timetable is a type of table that associates a time with each row. You can subscript into a timetable
to select subsets of its data in a number of different ways. To select timetable rows with row times
that fall within a given time range, specify the time range using the timerange function. Since a
timetable is a table, you can index on rows and variables using either smooth parentheses or curly
braces. You can index on specific row times, or select rows with row times that match specified times
within a tolerance you set using the withtol function. You can also subscript into a table or
timetable to select all the variables that match a type you specify with the vartype function. Finally,
extract data from a timetable into a matrix using the Variables property.

Create Timetable from File

Create a timetable from the sample file [Link], containing data representing electric utility
outages in the United States. Read the table from the file with the readtable function. Convert
[Link] and [Link] into categorical arrays. Then convert the table to a timetable using the
table2timetable function. Display the first five rows of the timetable. TT is a timetable containing
outage data from February 2002 to January 2014.
T = readtable('[Link]');
[Link] = categorical([Link]);
[Link] = categorical([Link]);
TT = table2timetable(T);
TT(1:5,:)

ans=5×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _________ ______ __________ ________________ _______________

2002-02-01 12:18 SouthWest 458.98 1.8202e+06 2002-02-07 16:50 winter storm


2003-01-23 00:49 SouthEast 530.14 2.1204e+05 NaT winter storm
2003-02-07 21:15 SouthEast 289.4 1.4294e+05 2003-02-17 08:14 winter storm
2004-04-06 05:44 West 434.81 3.4037e+05 2004-04-06 06:10 equipment fault
2002-03-16 06:18 MidWest 186.44 2.1275e+05 2002-03-18 23:23 severe storm

Summarize Timetable and Access Row Times

Display a summary of TT. It is a timetable that contains 1468 rows and five variables.
summary(TT)

RowTimes:

OutageTime: 1468x1 datetime


Values:
Min 2002-02-01 12:18
Median 2010-03-18 21:05
Max 2014-01-15 02:41

Variables:

Region: 1468x1 categorical

Values:

MidWest 142

10-19
10 Timetables

NorthEast 557
SouthEast 389
SouthWest 26
West 354

Loss: 1468x1 double

Values:

Min 0
Median 180.26
Max 23418
NumMissing 604

Customers: 1468x1 double

Values:

Min 0
Median 75765
Max 5.9689e+06
NumMissing 328

RestorationTime: 1468x1 datetime

Values:

Min 2002-02-07 16:50


Median 2010-03-31 10:54
Max 2042-09-18 23:31
NumMissing 29

Cause: 1468x1 categorical

Values:

attack 294
earthquake 2
energy emergency 188
equipment fault 156
fire 25
severe storm 338
thunder storm 201
unknown 24
wind 95
winter storm 145

Access the row times. The row times are not in a variable. Instead, the vector of row times is a
property of the timetable. However, you can access the row times with dot syntax. [Link] is
a 1468-by-1 vector of datetime values. Display the first five rows of [Link].

[Link](1:5)

ans = 5x1 datetime


2002-02-01 12:18
2003-01-23 00:49
2003-02-07 21:15
2004-04-06 05:44

10-20
Select Timetable Data by Row Time and Variable Type

2002-03-16 06:18

Subscript on Time Range

To select all timetable rows that fall in a time range, create a subscript as a helper, using the
timerange function. The start and end times you specify do not have to match any of the row times
in the timetable.

Select all rows with outages that occurred between January 2002 and December 2003. Display the
first five rows of TT2.
TR = timerange('2002-01-01','2003-12-31');
TT2 = TT(TR,:);
TT2(1:5,:)

ans=5×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _________ ______ __________ ________________ ____________

2002-02-01 12:18 SouthWest 458.98 1.8202e+06 2002-02-07 16:50 winter storm


2003-01-23 00:49 SouthEast 530.14 2.1204e+05 NaT winter storm
2003-02-07 21:15 SouthEast 289.4 1.4294e+05 2003-02-17 08:14 winter storm
2002-03-16 06:18 MidWest 186.44 2.1275e+05 2002-03-18 23:23 severe storm
2003-06-18 02:49 West 0 0 2003-06-18 10:54 attack

Display the last five rows of TT2.


TT2(end-4:end,:)

ans=5×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _________ ______ __________ ________________ ________________

2003-09-02 19:46 SouthEast 0 0 2003-09-16 22:25 severe storm


2003-09-15 14:56 MidWest 418.7 61045 2003-09-22 04:21 thunder storm
2003-09-24 22:43 SouthWest 2576.9 9.4873e+05 2003-09-25 14:46 severe storm
2003-09-18 10:40 SouthWest 301.8 2.3973e+05 2003-09-27 08:17 severe storm
2003-10-11 19:36 SouthEast 309.8 93582 2003-10-11 19:49 energy emergency

TT2 is a timetable with only 98 rows, containing outage data only from 2002 and 2003.

Index on Specified Times

You can index into TT with datetime values or character vectors representing specific times in
[Link]. But when you do so, the times you specify must have exact matches in the time
vector, and only those times are selected. Index into TT on times for the first and third rows of TT.
TT({'2002-02-01 12:18:00','2003-02-07 21:15:00'},:)

ans=2×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _________ ______ __________ ________________ ____________

2002-02-01 12:18 SouthWest 458.98 1.8202e+06 2002-02-07 16:50 winter storm


2003-02-07 21:15 SouthEast 289.4 1.4294e+05 2003-02-17 08:14 winter storm

10-21
10 Timetables

Index on Specified Times with Tolerances

Specify a tolerance when indexing on times. You can use the withtol function to create a subscript
as a helper. With the output of withtol, you can select row times that match within the specified
tolerance.

Index into TT on specified dates. Specify a tolerance of one day to return rows with row times that
are within one day of the specified dates. The times must be in a datetime or duration vector, or in a
cell array of character vectors that can be converted to datetime or duration values. The tolerance
must be specified as a duration, using a function such as seconds, minutes, hours, or days.
rowTimes = {'2002-02-01','2003-02-07'};
S = withtol(rowTimes,days(1));
TT(S,:)

ans=2×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _________ ______ __________ ________________ ____________

2002-02-01 12:18 SouthWest 458.98 1.8202e+06 2002-02-07 16:50 winter storm


2003-02-07 21:15 SouthEast 289.4 1.4294e+05 2003-02-17 08:14 winter storm

Subscript by Variable Type

To select all timetable variables that are of a given type, create a subscript as a helper, using the
vartype function. You can specify variable types without having to specify their names or positions
in the timetable.

Select all variables that contain numeric data. TT2 contains only the variables Loss and Customers.
The other three variables of TT are either categorical or datetime variables. Display the first five rows
of TT2.
S = vartype('numeric');
TT2 = TT(:,S);
TT2(1:5,:)

ans=5×2 timetable
OutageTime Loss Customers
________________ ______ __________

2002-02-01 12:18 458.98 1.8202e+06


2003-01-23 00:49 530.14 2.1204e+05
2003-02-07 21:15 289.4 1.4294e+05
2004-04-06 05:44 434.81 3.4037e+05
2002-03-16 06:18 186.44 2.1275e+05

Subscript both on a time range and by variable type.


TR = timerange('2002-01-01','2003-12-31');
TT2 = TT(TR,S);
TT2(1:5,:)

ans=5×2 timetable
OutageTime Loss Customers
________________ ______ __________

10-22
Select Timetable Data by Row Time and Variable Type

2002-02-01 12:18 458.98 1.8202e+06


2003-01-23 00:49 530.14 2.1204e+05
2003-02-07 21:15 289.4 1.4294e+05
2002-03-16 06:18 186.44 2.1275e+05
2003-06-18 02:49 0 0

Extract Data with Variables Property

Tables and timetables have a property, Variables, that you can use to extract data from variables
into a matrix, as long as the variables can be concatenated together.

Extract the numeric data from TT2 using the Variables property. A is a 1468-by-2 matrix of doubles.
When you extract data from a timetable into an array, the row times are not included.

A = [Link];
A(1:5,:)

ans = 5×2
106 ×

0.0005 1.8202
0.0005 0.2120
0.0003 0.1429
0.0002 0.2128
0 0

The result of [Link] is the same as the result of using curly braces to extract data, using
the TT2{:,:} syntax.

You can concatenate the variables in TT2 into an array of doubles. However, TT contains numeric,
categorical, and datetime variables that cannot be concatenated. The Variables property returns an
error when variables cannot be concatenated. To avoid such an error, you can subscript by variable
type before using the Variables property.

Subscript into TT to select numeric variables and extract them into a matrix.

A = TT(:,vartype('numeric')).Variables;
A(1:5,:)

ans = 5×2
106 ×

0.0005 1.8202
0.0005 0.2120
0.0003 0.1429
0.0004 0.3404
0.0002 0.2128

See Also
retime | synchronize | table2timetable | timerange | timetable | vartype | withtol

10-23
10 Timetables

Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25

10-24
Clean Timetable with Missing, Duplicate, or Nonuniform Times

Clean Timetable with Missing, Duplicate, or Nonuniform Times


This example shows how to create a regular timetable from one that has missing, duplicate, or
nonuniform times. A timetable is a type of table that associates a time-stamp, or row time, with each
row of data. In a regular timetable, the row times are sorted and unique, and differ by the same
regular time step. The example also shows how to export the data from a timetable for use with other
functions.

Timetables can be irregular. They can contain rows that are not sorted by their row times. Timetables
can contain multiple rows with the same row time, though the rows can have different data values.
Even when row times are sorted and unique, they can differ by time steps of different sizes.
Timetables can even contain NaT or NaN values to indicate missing row times.

Timetables provide a number of different ways to resolve missing, duplicate, or nonuniform times,
and to resample or aggregate data to regular row times.

• To find missing row times, use ismissing.


• To remove missing times and data, use rmmissing.
• To sort a timetable by its row times, use sortrows.
• To make a timetable with unique and sorted row times, use unique and retime.
• To remove duplicate times, specify a unique time vector and use retime.
• To make a regular timetable, specify a regular time vector and use retime.

10-25
10 Timetables

Load Timetable

Load a sample timetable from the MAT-file badTimes that contains weather measurements taken
over several hours on June 9, 2016. The timetable includes temperature, rainfall, and wind speed
measurements taken at irregular times during that day.
load badTimes
TT

TT=12×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 06:01:04 73 0.01 2.3


09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
NaT 56 0 0
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 05:03:11 66.2 0.05 3
09-Jun-2016 08:49:10 67.2 0.01 2.7
09-Jun-2016 04:12:00 58.8 NaN NaN

Remove Rows with Missing Times

Remove rows that have NaT, or a missing value, as the row time. To find missing values in the vector
of row times, use the ismissing function. ismissing returns a logical vector that contains 1
wherever [Link] has a missing value. Index back into the timetable to keep only those rows that do
not have missing values as row times. Assign those rows to TT2.
TF = ismissing([Link]);
TT2 = TT(~TF,:);
TT2

TT2=11×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 06:01:04 73 0.01 2.3


09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 05:03:11 66.2 0.05 3
09-Jun-2016 08:49:10 67.2 0.01 2.7
09-Jun-2016 04:12:00 58.8 NaN NaN

This method removes only the rows that have missing row times. The table variables might still have
missing data values. For example, the last row of TT2 has NaN values for the Rain and Windspeed
variables.

10-26
Clean Timetable with Missing, Duplicate, or Nonuniform Times

Remove Rows with Missing Times or Missing Data

You can remove missing row times and missing data values using the rmmissing function.
rmmissing removes any timetable row that has a missing row time, missing data values, or both.

Display the missing row time and missing data values of TT. Then remove all missing values from TT.
TT

TT=12×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 06:01:04 73 0.01 2.3


09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
NaT 56 0 0
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 05:03:11 66.2 0.05 3
09-Jun-2016 08:49:10 67.2 0.01 2.7
09-Jun-2016 04:12:00 58.8 NaN NaN

TT = rmmissing(TT)

TT=10×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 06:01:04 73 0.01 2.3


09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 05:03:11 66.2 0.05 3
09-Jun-2016 08:49:10 67.2 0.01 2.7

Sort Timetable and Determine Whether It Is Regular

Determine whether TT is sorted. Then, sort the timetable on its row times using the sortrows
function.
TF = issorted(TT)

TF = logical
0

TT = sortrows(TT)

TT=10×3 timetable
Time Temp Rain WindSpeed

10-27
10 Timetables

____________________ ____ ____ _________

09-Jun-2016 05:03:11 66.2 0.05 3


09-Jun-2016 06:01:04 73 0.01 2.3
09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 08:49:10 67.2 0.01 2.7
09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4

Determine whether TT is regular. A regular timetable has the same time interval between consecutive
row times. Even a sorted timetable can have time steps that are not uniform.
TF = isregular(TT)

TF = logical
0

Display the differences between row times.


diff([Link])

ans = 9x1 duration


00:57:53
01:58:19
00:49:47
00:00:00
00:00:00
00:00:00
01:04:47
00:00:00
00:00:00

Remove Duplicate Rows

Timetables can have duplicate rows. Timetable rows are duplicates if they have the same row times
and the same data values. In this example, the last two rows of TT are duplicates.

To remove the duplicate rows, use the unique function. unique returns the unique rows and sorts
them by their row times.
TT = unique(TT)

TT=9×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 05:03:11 66.2 0.05 3


09-Jun-2016 06:01:04 73 0.01 2.3
09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 08:49:10 67.2 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7

10-28
Clean Timetable with Missing, Duplicate, or Nonuniform Times

09-Jun-2016 08:49:10 82 0.01 2.7


09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4

Find Rows with Duplicate Times and Different Data

Timetables can have rows with duplicate row times but different data values. In this example, TT has
several rows with the same row times but different values.

Find the rows that have duplicate row times. First, sort the row times and find consecutive times that
have no difference between them. Times with no difference between them are the duplicates. Index
back into the vector of row times and return a unique set of times that identify the duplicate row
times in TT.

dupTimes = sort([Link]);
TF = (diff(dupTimes) == 0);
dupTimes = dupTimes(TF);
dupTimes = unique(dupTimes)

dupTimes = 2x1 datetime


09-Jun-2016 08:49:10
09-Jun-2016 09:53:57

Index into the timetable to display the rows with duplicate row times. When you index on times, the
output timetable contains all rows with matching row times.

TT(dupTimes,:)

ans=6×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 08:49:10 62 0.01 2.7


09-Jun-2016 08:49:10 67.2 0.01 2.7
09-Jun-2016 08:49:10 75.8 0.01 2.7
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 09:53:57 59 0.03 3.4
09-Jun-2016 09:53:57 67 0.03 3.4

Select First and Last Rows with Duplicate Times

Select either the first and the last of the rows with duplicate row times using the unique and retime
functions.

First, create a vector of unique row times from TT using the unique function.

uniqueTimes = unique([Link]);

Select the first row from each set of rows that have duplicate times.

TT2 = retime(TT,uniqueTimes)

TT2=5×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

10-29
10 Timetables

09-Jun-2016 05:03:11 66.2 0.05 3


09-Jun-2016 06:01:04 73 0.01 2.3
09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 08:49:10 62 0.01 2.7
09-Jun-2016 09:53:57 59 0.03 3.4

Select the last rows from each set of rows that have duplicate times. Specify the 'previous' method
of retime to copy data from the last row. When you specify 'previous', then retime starts at the
end of the vector of row times and stops when it encounters a duplicate row time. Then it copies the
data from that row.

TT2 = retime(TT,uniqueTimes,'previous')

TT2=5×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________

09-Jun-2016 05:03:11 66.2 0.05 3


09-Jun-2016 06:01:04 73 0.01 2.3
09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 08:49:10 82 0.01 2.7
09-Jun-2016 09:53:57 67 0.03 3.4

Aggregate Data from All Rows with Duplicate Times

Aggregate data from rows that have duplicate row times. For example, you can calculate the means
of several measurements of the same quantity taken at the same time.

Calculate the mean temperature, rainfall, and wind speed for rows with duplicate row times using the
retime function.

TT = retime(TT,uniqueTimes,'mean')

TT=5×3 timetable
Time Temp Rain WindSpeed
____________________ _____ ____ _________

09-Jun-2016 05:03:11 66.2 0.05 3


09-Jun-2016 06:01:04 73 0.01 2.3
09-Jun-2016 07:59:23 59 0.08 0.9
09-Jun-2016 08:49:10 71.75 0.01 2.7
09-Jun-2016 09:53:57 63 0.03 3.4

Make Timetable Regular

Create a regular timetable using retime. Interpolate the data onto a regular hourly time vector. To
use linear interpolation, specify 'linear'. Each row time in TT begins on the hour, and there is a
one-hour interval between consecutive row times.

TT = retime(TT,'hourly','linear')

TT=6×3 timetable
Time Temp Rain WindSpeed
____________________ ______ ________ _________

10-30
Clean Timetable with Missing, Duplicate, or Nonuniform Times

09-Jun-2016 05:00:00 65.826 0.0522 3.0385


09-Jun-2016 06:00:00 72.875 0.010737 2.3129
09-Jun-2016 07:00:00 66.027 0.044867 1.6027
09-Jun-2016 08:00:00 59.158 0.079133 0.9223
09-Jun-2016 09:00:00 70.287 0.013344 2.8171
09-Jun-2016 10:00:00 62.183 0.031868 3.4654

Instead of using a predefined time step such as 'hourly', you can specify a time step of your own.
To specify a time step of 30 minutes, use the 'regular' input argument and the 'TimeStep' name-
value pair argument. You can specify a time step of any size as a duration or calendar duration value.
TT = retime(TT,'regular','linear','TimeStep',minutes(30))

TT=11×3 timetable
Time Temp Rain WindSpeed
____________________ ______ ________ _________

09-Jun-2016 05:00:00 65.826 0.0522 3.0385


09-Jun-2016 05:30:00 69.35 0.031468 2.6757
09-Jun-2016 06:00:00 72.875 0.010737 2.3129
09-Jun-2016 06:30:00 69.451 0.027802 1.9578
09-Jun-2016 07:00:00 66.027 0.044867 1.6027
09-Jun-2016 07:30:00 62.592 0.062 1.2625
09-Jun-2016 08:00:00 59.158 0.079133 0.9223
09-Jun-2016 08:30:00 64.722 0.046239 1.8697
09-Jun-2016 09:00:00 70.287 0.013344 2.8171
09-Jun-2016 09:30:00 66.235 0.022606 3.1412
09-Jun-2016 10:00:00 62.183 0.031868 3.4654

Extract Regular Timetable Data

You can export the timetable data for use with functions to analyze data that is regularly spaced in
time. For example, the Econometrics Toolbox™ and the Signal Processing Toolbox™ have functions
you can use for further analysis on regularly spaced data.

Extract the timetable data as an array. You can use the Variables property to return the data as an
array when the table variables can be concatenated.
A = [Link]

A = 11×3

65.8260 0.0522 3.0385


69.3504 0.0315 2.6757
72.8747 0.0107 2.3129
69.4507 0.0278 1.9578
66.0266 0.0449 1.6027
62.5923 0.0620 1.2625
59.1579 0.0791 0.9223
64.7224 0.0462 1.8697
70.2868 0.0133 2.8171
66.2348 0.0226 3.1412

[Link] is equivalent to using curly brace syntax, TT{:,:}, to access all variables.

10-31
10 Timetables

A2 = TT{:,:}

A2 = 11×3

65.8260 0.0522 3.0385


69.3504 0.0315 2.6757
72.8747 0.0107 2.3129
69.4507 0.0278 1.9578
66.0266 0.0449 1.6027
62.5923 0.0620 1.2625
59.1579 0.0791 0.9223
64.7224 0.0462 1.8697
70.2868 0.0133 2.8171
66.2348 0.0226 3.1412

See Also
diff | fillmissing | isregular | issorted | retime | rmmissing | sortrows |
table2timetable | timetable | unique

Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Timetable Data by Row Time and Variable Type” on page 10-19

10-32
Using Row Labels in Table and Timetable Operations

Using Row Labels in Table and Timetable Operations


Tables and timetables provide ways to label the rows in your data. In tables, you can label the rows
with names. In timetables, you must label the rows with dates, times, or both. Row names are
optional for tables, but row times are required for timetables. These row labels are part of the
metadata in a table or timetable. In some functions you also can use row labels as key variables,
grouping variables, and so on, just as you can use the data variables in a table or timetable. These
functions are sortrows, join, innerjoin, outerjoin, varfun, rowfun, stack, and unstack.
There are some limitations on using these table functions and on using row labels as key variables.

Sort on Row Labels

For example, you can sort a timetable on its row times, on one or more of its data variables, or on row
times and data variables together.

Create a timetable using the timetable function. A timetable has row times along its first
dimension, labeling the rows. The row times are a property of the timetable, not a timetable variable.

Date = datetime(2016,7,[10;10;11;11;10;10;11;11]);
X = [1;1;1;1;2;2;2;2];
Y = {'a';'b';'a';'b';'a';'b';'a';'b'};
Z = [1;2;3;4;5;6;7;8];
TT = timetable(X,Y,Z,'RowTimes',Date)

TT=8×3 timetable
Time X Y Z
___________ _ _____ _

10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
10-Jul-2016 2 {'a'} 5
10-Jul-2016 2 {'b'} 6
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8

Rename the first dimension. By default, the name of the first dimension of a timetable is Time. You
can access the [Link] property to rename a dimension.

[Link]{1} = 'Date';
[Link]

ans = 1x2 cell


{'Date'} {'Variables'}

As an alternative, you can specify the row times as the first input argument to timetable, without
specifying 'RowTimes'. The timetable function names the row times, or the first dimension, after
the first input argument, just as it names the timetable variables after the other input arguments.

TT = timetable(Date,X,Y,Z)

TT=8×3 timetable
Date X Y Z
___________ _ _____ _

10-33
10 Timetables

10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
10-Jul-2016 2 {'a'} 5
10-Jul-2016 2 {'b'} 6
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8

Sort the timetable by row times. To sort on row times, refer to the first dimension of the timetable by
name.
sortrows(TT,'Date')

ans=8×3 timetable
Date X Y Z
___________ _ _____ _

10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
10-Jul-2016 2 {'a'} 5
10-Jul-2016 2 {'b'} 6
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8

Sort by the data variables X and Y. sortrows sorts on X first, then on Y.


sortrows(TT,{'X' 'Y'})

ans=8×3 timetable
Date X Y Z
___________ _ _____ _

10-Jul-2016 1 {'a'} 1
11-Jul-2016 1 {'a'} 3
10-Jul-2016 1 {'b'} 2
11-Jul-2016 1 {'b'} 4
10-Jul-2016 2 {'a'} 5
11-Jul-2016 2 {'a'} 7
10-Jul-2016 2 {'b'} 6
11-Jul-2016 2 {'b'} 8

Sort by row times and X together.


sortrows(TT,{'Date' 'X'})

ans=8×3 timetable
Date X Y Z
___________ _ _____ _

10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
10-Jul-2016 2 {'a'} 5

10-34
Using Row Labels in Table and Timetable Operations

10-Jul-2016 2 {'b'} 6
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8

Use Row Labels as Grouping or Key Variables

When you group rows together using the rowfun, varfun, stack, and unstack functions, you can
specify row labels as grouping variables. When you join tables or timetable together using the join,
innerjoin, and outerjoin functions, you can specify row labels as key variables.

For example, you can perform an inner join two tables together, using row names and a table variable
together as key variables. An inner join keeps only those table rows that match with respect to the
key variables.

Create two tables of patient data. A table can have row names along its first dimension, labeling the
rows, but is not required to have them. Specify the last names of patients as the row names of the
tables. Add the first names of the patients as table variables.

A = table({'Michael';'Louis';'Alice';'Rosemary';'Julie'},[38;43;45;40;49],...
'VariableNames',{'FirstName' 'Age'},...
'RowNames',{'Garcia' 'Johnson' 'Wu' 'Jones' 'Picard'})

A=5×2 table
FirstName Age
____________ ___

Garcia {'Michael' } 38
Johnson {'Louis' } 43
Wu {'Alice' } 45
Jones {'Rosemary'} 40
Picard {'Julie' } 49

B = table({'Michael';'Beverly';'Alice'},...
[64;69;67],...
[119;163;133],...
[122 80; 109 77; 117 75],...
'VariableNames',{'FirstName' 'Height' 'Weight' 'BloodPressure'},...
'RowNames',{'Garcia' 'Johnson' 'Wu'})

B=3×4 table
FirstName Height Weight BloodPressure
___________ ______ ______ _____________

Garcia {'Michael'} 64 119 122 80


Johnson {'Beverly'} 69 163 109 77
Wu {'Alice' } 67 133 117 75

If a table has row names, then you can index into it by row name. Indexing by row names is a
convenient way to select rows of a table. Index into B by a patient's last name to retrieve information
about the patient.

B('Garcia',:)

10-35
10 Timetables

ans=1×4 table
FirstName Height Weight BloodPressure
___________ ______ ______ _____________

Garcia {'Michael'} 64 119 122 80

Perform an inner join on the two tables. Both tables use the last names of patients as row names, and
contain the first names as a table variable. Some patients in the two tables have matching last names
but different first names. To ensure that both last and first names match, use the row names and
FirstName as key variables. To specify the row names as a key or grouping variable, use the name of
the first dimension of the table. By default, the name of the first dimension is 'Row'.

C = innerjoin(A,B,'Keys',{'Row','FirstName'})

C=2×5 table
FirstName Age Height Weight BloodPressure
___________ ___ ______ ______ _____________

Garcia {'Michael'} 38 64 119 122 80


Wu {'Alice' } 45 67 133 117 75

If you rename the first dimension of a table, then you can refer to the row names by that name
instead of using 'Row'. Perform the same inner join as above but use a different name to refer to the
row names.

Show the dimension names of A by accessing its [Link] property.

[Link]

ans = 1x2 cell


{'Row'} {'Variables'}

Change the name of the first dimension of the table by using its [Link]
property. Then use the new name as a key variable.

[Link]{1} = 'LastName';
[Link]

ans = 1x2 cell


{'LastName'} {'Variables'}

Perform an inner join on A and B using LastName and FirstName as key variables.

[Link]{1} = 'LastName';
D = innerjoin(A,B,'Keys',{'LastName','FirstName'})

D=2×5 table
FirstName Age Height Weight BloodPressure
___________ ___ ______ ______ _____________

Garcia {'Michael'} 38 64 119 122 80


Wu {'Alice' } 45 67 133 117 75

10-36
Using Row Labels in Table and Timetable Operations

Notes on Use of Table Functions and Row Labels

• You cannot stack or unstack row labels using the stack and unstack functions. However, you can
use row labels as grouping variables.
• You cannot perform a join using the join, innerjoin, or outerjoin functions when the first
argument is a table and the second argument is a timetable. However, you can perform a join
when both arguments are tables, both are timetables, or the first argument is a timetable and the
second is a table.
• The output of a join operation can have row labels if you specify row labels as key variables. For
more details on row labels from a join operation, see the documentation on the 'Keys',
'LeftKeys', and 'RightKeys' arguments of the join, innerjoin, and outerjoin functions.

See Also
innerjoin | join | outerjoin | rowfun | sortrows | stack | unstack | varfun

10-37
10 Timetables

Loma Prieta Earthquake Analysis


This example shows how to analyze and visualize earthquake data.

Load Earthquake Data

The file [Link] contains 200Hz data from the October 17, 1989 Loma Prieta earthquake in the
Santa Cruz Mountains. The data are courtesy of Joel Yellin at the Charles F. Richter Seismological
Laboratory, University of California, Santa Cruz.

Start by loading the data.


load quake
whos e n v

Name Size Bytes Class Attributes

e 10001x1 80008 double


n 10001x1 80008 double
v 10001x1 80008 double

In the workspace there are three variables, containing time traces from an accelerometer located in
the Natural Sciences building at UC Santa Cruz. The accelerometer recorded the main shock
amplitude of the earthquake wave. The variables n, e, v refer to the three directional components
measured by the instrument, which was aligned parallel to the fault, with its N direction pointing in
the direction of Sacramento. The data are uncorrected for the response of the instrument.

Create a variable, Time, containing the timestamps sampled at 200Hz with the same length as the
other vectors. Represent the correct units with the seconds function and multiplication to achieve
the Hz (s−1) sampling rate. This results in a duration variable which is useful for representing
elapsed time.
Time = (1/200)*seconds(1:length(e))';
whos Time

Name Size Bytes Class Attributes

Time 10001x1 80010 duration

Organize Data in Timetable

Separate variables can be organized in a table or timetable for more convenience. A timetable
provides flexibility and functionality for working with time-stamped data. Create a timetable with
the time and three acceleration variables and supply more meaningful variable names. Display the
first eight rows using the head function.
varNames = {'EastWest', 'NorthSouth', 'Vertical'};
quakeData = timetable(Time, e, n, v, 'VariableNames', varNames);
head(quakeData)

ans=8×3 timetable
Time EastWest NorthSouth Vertical
_________ ________ __________ ________

0.005 sec 5 3 0
0.01 sec 5 3 0
0.015 sec 5 2 0

10-38
Loma Prieta Earthquake Analysis

0.02 sec 5 2 0
0.025 sec 5 2 0
0.03 sec 5 2 0
0.035 sec 5 1 0
0.04 sec 5 1 0

Explore the data by accessing the variables in the timetable with dot subscripting. (For more
information on dot subscripting, see Access Data in a Table.) We chose "East-West" amplitude and
plot it as function of the duration.

plot([Link],[Link])
title('East-West Acceleration')

Scale Data

Scale the data by the gravitational acceleration, or multiply each variable in the table by the constant.
Since the variables are all of the same type (double), you can access all variables using the
dimension name, Variables. Note that [Link] provides a direct way to modify the
numerical values within the timetable.

[Link] = 0.098*[Link];

Select Subset of Data for Exploration

We are interested in the time region where the amplitude of the shockwave starts to increase from
near zero to maximum levels. Visual inspection of the above plot shows that the time interval from 8

10-39
10 Timetables

to 15 seconds is of interest. For better visualization we draw black lines at the selected time spots to
draw attention to that interval. All subsequent calculations will involve this interval.
t1 = seconds(8)*[1;1];
t2 = seconds(15)*[1;1];
hold on
plot([t1 t2],ylim,'k','LineWidth',2)
hold off

Store Data of Interest

Create another timetable with data in this interval. Use timerange to select the rows of interest.
tr = timerange(seconds(8),seconds(15));
dataOfInterest = quakeData(tr,:);
head(dataOfInterest)

ans=8×3 timetable
Time EastWest NorthSouth Vertical
_________ ________ __________ ________

8 sec -0.098 2.254 5.88


8.005 sec 0 2.254 3.332
8.01 sec -2.058 2.352 -0.392
8.015 sec -4.018 2.352 -4.116
8.02 sec -6.076 2.45 -7.742
8.025 sec -8.036 2.548 -11.466
8.03 sec -10.094 2.548 -9.8

10-40
Loma Prieta Earthquake Analysis

8.035 sec -8.232 2.646 -8.134

Visualize the three acceleration variables on three separate axes.

figure
subplot(3,1,1)
plot([Link],[Link])
ylabel('East-West')
title('Acceleration')
subplot(3,1,2)
plot([Link],[Link])
ylabel('North-South')
subplot(3,1,3)
plot([Link],[Link])
ylabel('Vertical')

Calculate Summary Statistics

To display statistical information about the data we use the summary function.

summary(dataOfInterest)

RowTimes:

Time: 1400x1 duration


Values:
Min 8 sec

10-41
10 Timetables

Median 11.498 sec


Max 14.995 sec
TimeStep 0.005 sec

Variables:

EastWest: 1400x1 double

Values:

Min -255.09
Median -0.098
Max 244.51

NorthSouth: 1400x1 double

Values:

Min -198.55
Median 1.078
Max 204.33

Vertical: 1400x1 double

Values:

Min -157.88
Median 0.98
Max 134.46

Additional statistical information about the data can be calculated using [Link] is useful for
applying functions to each variable in a table or timetable. The function to apply is passed to varfun
as a function handle. Below we apply the mean function to all three variables and output the result in
format of a table, since the time is not meaningful after computing the temporal means.

mn = varfun(@mean,dataOfInterest,'OutputFormat','table')

mn=1×3 table
mean_EastWest mean_NorthSouth mean_Vertical
_____________ _______________ _____________

0.9338 -0.10276 -0.52542

Calculate Velocity and Position

To identify the speed of propagation of the shockwave, we integrate the accelerations once. We use
cumulative sums along the time variable to get the velocity of the wave front.

edot = (1/200)*cumsum([Link]);
edot = edot - mean(edot);

Below we perform the integration on all three variables to calculate the velocity. It is convenient to
create a function and apply it to the variables in the timetable with varfun. In this example, we
included the function at the end of this file and named it velFun.

vel = varfun(@velFun,dataOfInterest);
head(vel)

10-42
Loma Prieta Earthquake Analysis

ans=8×3 timetable
Time velFun_EastWest velFun_NorthSouth velFun_Vertical
_________ _______________ _________________ _______________

8 sec -0.56831 0.44642 1.8173


8.005 sec -0.56831 0.45769 1.834
8.01 sec -0.5786 0.46945 1.832
8.015 sec -0.59869 0.48121 1.8114
8.02 sec -0.62907 0.49346 1.7727
8.025 sec -0.66925 0.5062 1.7154
8.03 sec -0.71972 0.51894 1.6664
8.035 sec -0.76088 0.53217 1.6257

Apply the same function velFun to the velocities to determine the position.

pos = varfun(@velFun,vel);
head(pos)

ans=8×3 timetable
Time velFun_velFun_EastWest velFun_velFun_NorthSouth velFun_velFun_Vertical
_________ ______________________ ________________________ ______________________

8 sec 2.1189 -2.1793 -3.0821


8.005 sec 2.1161 -2.177 -3.0729
8.01 sec 2.1132 -2.1746 -3.0638
8.015 sec 2.1102 -2.1722 -3.0547
8.02 sec 2.107 -2.1698 -3.0458
8.025 sec 2.1037 -2.1672 -3.0373
8.03 sec 2.1001 -2.1646 -3.0289
8.035 sec 2.0963 -2.162 -3.0208

Notice how the variable names in the timetable created by varfun include the name of the function
used. It is useful to track the operations that have been performed on the original data. Adjust the
variable names back to their original values using dot notation.

[Link] = varNames;

Below we plot the 3 components of the velocity and position for the time interval of interest.

figure
subplot(2,1,1)
plot([Link],[Link])
legend([Link],'Location','NorthWest')
title('Velocity')
subplot(2,1,2)
plot([Link],[Link])
legend([Link],'Location','NorthWest')
title('Position')

10-43
10 Timetables

Visualize Trajectories

The trajectories can be plotted in 2D or 3D by using the component value. In the following we will
show different ways of visualizing this data.

Begin with 2-dimensional projections. Here is the first with a few values of time annotated.

figure
plot([Link],[Link])
xlabel('North-South')
ylabel('Vertical')
% Select locations and label
nt = ceil((max([Link]) - min([Link]))/6);
idx = find(fix([Link]/nt) == ([Link]/nt))';
text([Link](idx),[Link](idx),char([Link](idx)))

10-44
Loma Prieta Earthquake Analysis

Use plotmatrix to visualize a grid of scatter plots of all variables against one another and
histograms of each variable on the diagonal. The output variable Ax, represents each axes in the grid
and can be used to identify which axes to label using xlabel and ylabel.

figure
[S,Ax] = plotmatrix([Link]);

for ii = 1:length(varNames)
xlabel(Ax(end,ii),varNames{ii})
ylabel(Ax(ii,1),varNames{ii})
end

10-45
10 Timetables

Plot a 3-D view of the trajectory and plot a dot at every tenth position point. The spacing between
dots indicates the velocity.

step = 10;
figure
plot3([Link],[Link],[Link],'r')
hold on
plot3([Link](1:step:end),[Link](1:step:end),[Link](1:step:end),'.')
hold off
box on
axis tight
xlabel('North-South')
ylabel('East-West')
zlabel('Vertical')
title('Position')

10-46
Loma Prieta Earthquake Analysis

Supporting Functions

Functions are defined below.

function y = velFun(x)
y = (1/200)*cumsum(x);
y = y - mean(y);
end

See Also
duration | head | seconds | summary | timerange | timetable | varfun

Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Create Timetables” on page 10-2
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25
• “Select Timetable Data by Row Time and Variable Type” on page 10-19
• “Access Data in Tables” on page 9-34

10-47
10 Timetables

Preprocess and Explore Time-stamped Data Using timetable


This example shows how to analyze bicycle traffic patterns from sensor data using the timetable
data container to organize and preprocess time-stamped data. The data come from sensors on
Broadway Street in Cambridge, MA. The City of Cambridge provides public access to the full data set
at the Cambridge Open Data site.

This example shows how to perform a variety of data cleaning, munging, and preprocessing tasks
such as removing missing values and synchronizing time-stamped data with different timesteps. In
addition, data exploration is highlighted including visualizations and grouped calculations using the
timetable data container to:

• Explore daily bicycle traffic


• Compare bicycle traffic to local weather conditions
• Analyze bicycle traffic on various days of the week and times of day

Import Bicycle Traffic Data into Timetable

Import a sample of the bicycle traffic data from a comma-separated text file. The readtable function
returns the data in a table. Display the first eight rows using the head function.

bikeTbl = readtable('[Link]');
head(bikeTbl)

ans=8×5 table
Timestamp Day Total Westbound Eastbound
___________________ _____________ _____ _________ _________

2015-06-24 00:00:00 {'Wednesday'} 13 9 4


2015-06-24 01:00:00 {'Wednesday'} 3 3 0
2015-06-24 02:00:00 {'Wednesday'} 1 1 0
2015-06-24 03:00:00 {'Wednesday'} 1 1 0
2015-06-24 04:00:00 {'Wednesday'} 1 1 0
2015-06-24 05:00:00 {'Wednesday'} 7 3 4
2015-06-24 06:00:00 {'Wednesday'} 36 6 30
2015-06-24 07:00:00 {'Wednesday'} 141 13 128

The data have timestamps, so it is convenient to use a timetable to store and analyze the data. A
timetable is similar to a table, but includes timestamps that are associated with the rows of data. The
timestamps, or row times, are represented by datetime or duration values. datetime and
duration are the recommended data types for representing points in time or elapsed times,
respectively.

Convert bikeTbl into a timetable using the table2timetable function. You must use a conversion
function because readtable returns a table. table2timetable converts the first datetime or
duration variable in the table into the row times of a timetable. The row times are metadata that
label the rows. However, when you display a timetable, the row times and timetable variables are
displayed in a similar fashion. Note that the table has five variables whereas the timetable has four.

bikeData = table2timetable(bikeTbl);
head(bikeData)

ans=8×4 timetable
Timestamp Day Total Westbound Eastbound

10-48
Preprocess and Explore Time-stamped Data Using timetable

___________________ _____________ _____ _________ _________

2015-06-24 00:00:00 {'Wednesday'} 13 9 4


2015-06-24 01:00:00 {'Wednesday'} 3 3 0
2015-06-24 02:00:00 {'Wednesday'} 1 1 0
2015-06-24 03:00:00 {'Wednesday'} 1 1 0
2015-06-24 04:00:00 {'Wednesday'} 1 1 0
2015-06-24 05:00:00 {'Wednesday'} 7 3 4
2015-06-24 06:00:00 {'Wednesday'} 36 6 30
2015-06-24 07:00:00 {'Wednesday'} 141 13 128

whos bikeTbl bikeData

Name Size Bytes Class Attributes

bikeData 9387x4 1412426 timetable


bikeTbl 9387x5 1487736 table

Access Times and Data

Convert the Day variable to categorical. The categorical data type is designed for data that consists
of a finite set of discrete values, such as the names of the days of the week. List the categories so
they display in day order. Use dot subscripting to access variables by name.

[Link] = categorical([Link],{'Sunday','Monday','Tuesday',...
'Wednesday','Thursday','Friday','Saturday'});

In a timetable, the times are treated separately from the data variables. Access the Properties of
the timetable to show that the row times are the first dimension of the timetable, and the variables
are the second dimension. The DimensionNames property shows the names of the two dimensions,
while the VariableNames property shows the names of the variables along the second dimension.

[Link]

ans =
TimetableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Timestamp' 'Variables'}
VariableNames: {'Day' 'Total' 'Westbound' 'Eastbound'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [9387x1 datetime]
StartTime: 2015-06-24 00:00:00
SampleRate: NaN
TimeStep: NaN
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.

By default, table2timetable assigned Timestamp as the first dimension name when it converted
the table to a timetable, since this was the variable name from the original table. You can change the
names of the dimensions, and other timetable metadata, through the Properties.

Change the names of the dimensions to Time and Data.

10-49
10 Timetables

[Link] = {'Time' 'Data'};


[Link]

ans =
TimetableProperties with properties:

Description: ''
UserData: []
DimensionNames: {'Time' 'Data'}
VariableNames: {'Day' 'Total' 'Westbound' 'Eastbound'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [9387x1 datetime]
StartTime: 2015-06-24 00:00:00
SampleRate: NaN
TimeStep: NaN
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.

Display the first eight rows of the timetable.


head(bikeData)

ans=8×4 timetable
Time Day Total Westbound Eastbound
___________________ _________ _____ _________ _________

2015-06-24 00:00:00 Wednesday 13 9 4


2015-06-24 01:00:00 Wednesday 3 3 0
2015-06-24 02:00:00 Wednesday 1 1 0
2015-06-24 03:00:00 Wednesday 1 1 0
2015-06-24 04:00:00 Wednesday 1 1 0
2015-06-24 05:00:00 Wednesday 7 3 4
2015-06-24 06:00:00 Wednesday 36 6 30
2015-06-24 07:00:00 Wednesday 141 13 128

Determine the number of days that elapsed between the latest and earliest row times. The variables
can be accessed by dot notation when referencing variables one at a time.
elapsedTime = max([Link]) - min([Link])

elapsedTime = duration
9383:30:00

[Link] = 'd'

elapsedTime = duration
390.98 days

To examine the typical bicycle counts on a given day, calculate the means for the total number of
bikes, and the numbers travelling westbound and eastbound.

Return the numeric data as a matrix by indexing into the contents of bikeData using curly braces.
Display the first eight rows. Use standard table subscripting to access multiple variables.

10-50
Preprocess and Explore Time-stamped Data Using timetable

counts = bikeData{:,2:end};
counts(1:8,:)

ans = 8×3

13 9 4
3 3 0
1 1 0
1 1 0
1 1 0
7 3 4
36 6 30
141 13 128

Since the mean is appropriate for only the numeric data, you can use the vartype function to select
the numeric variables. vartype can be more convenient than manually indexing into a table or
timetable to select variables. Calculate the means and omit NaN values.

counts = bikeData{:,vartype('numeric')};
mean(counts,'omitnan')

ans = 1×3

49.8860 24.2002 25.6857

Select Data by Date and Time of Day

To determine how many people bicycle during a holiday, examine the data on the 4th of July holiday.
Index into the timetable by row times for July 4, 2015. When you index on row times, you must match
times exactly. You can specify the time indices as datetime or duration values, or as character
vectors that can be converted to dates and times. You can specify multiple times as an array.

Index into bikeData with specific dates and times to extract data for July 4, 2015. If you specify the
date only, then the time is assumed to be midnight, or 00:00:00.

bikeData('2015-07-04',:)

ans=1×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________

2015-07-04 00:00:00 Saturday 8 7 1

d = {'2015-07-04 08:00:00','2015-07-04 09:00:00'};


bikeData(d,:)

ans=2×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________

2015-07-04 08:00:00 Saturday 15 3 12


2015-07-04 09:00:00 Saturday 21 4 17

10-51
10 Timetables

It would be tedious to use this strategy to extract the entire day. You can also specify ranges of time
without indexing on specific times. To create a time range subscript as a helper, use the timerange
function.

Subscript into the timetable using a time range for the entire day of July 4, 2015. Specify the start
time as midnight on July 4, and the end time as midnight on July 5. By default, timerange covers all
times starting with the start time and up to, but not including, the end time. Plot the bicycle counts
over the course of the day.

tr = timerange('2015-07-04','2015-07-05');
jul4 = bikeData(tr,'Total');
head(jul4)

ans=8×1 timetable
Time Total
___________________ _____

2015-07-04 00:00:00 8
2015-07-04 01:00:00 13
2015-07-04 02:00:00 4
2015-07-04 03:00:00 1
2015-07-04 04:00:00 0
2015-07-04 05:00:00 1
2015-07-04 06:00:00 8
2015-07-04 07:00:00 16

bar([Link],[Link])
ylabel('Bicycle Counts')
title('Bicycle Counts on July 4, 2015')

10-52
Preprocess and Explore Time-stamped Data Using timetable

From the plot, there is more volume throughout the day, leveling off in the afternoon. Because many
businesses are closed, the plot does not show typical traffic during commute hours. Spikes later in
the evening can be attributed to celebrations with fireworks, which occur after dark. To examine
these trends more closely, the data should be compared to data for typical days.

Compare the data for July 4 to data for the rest of the month of July.

jul = bikeData(timerange('2015-07-01','2015-08-01'),:);
plot([Link],[Link])
hold on
plot([Link],[Link])
ylabel('Total Count')
title('Bicycle Counts in July')
hold off
legend('Bicycle Count','July 4 Bicycle Count')

10-53
10 Timetables

The plot shows variations that can be attributed to traffic differences between weekdays and
weekends. The traffic patterns for July 4 and 5 are consistent with the pattern for weekend traffic.
July 5 is a Monday but is often observed as a holiday. These trends can be examined more closely with
further preprocessing and analysis.

Preprocess Times and Data Using timetable

Time-stamped data sets are often messy and may contain anomalies or errors. Timetables are well
suited for resolving anomalies and errors.

A timetable does not have to have its row times in any particular order. It can contain rows that are
not sorted by their row times. A timetable can also contain multiple rows with the same row time,
though the rows can have different data values. Even when row times are sorted and unique, they can
differ by time steps of different sizes. A timetable can even contain NaT or NaN values to indicate
missing row times.

The timetable data type provides a number of different ways to resolve missing, duplicate, or
nonuniform times. You can also resample or aggregate data to create a regular timetable. When a
timetable is regular, it has row times that are sorted and unique, and have a uniform or evenly spaced
time step between them.

• To find missing row times, use ismissing.


• To remove missing times and data, use rmmissing.
• To sort a timetable by its row times, use sortrows.

10-54
Preprocess and Explore Time-stamped Data Using timetable

• To make a timetable with unique and sorted row times, use unique and retime.
• To make a regular timetable, specify a uniformly spaced time vector and use retime.

Sort in Time Order

Determine if the timetable is sorted. A timetable is sorted if its row times are listed in ascending
order.
issorted(bikeData)

ans = logical
0

Sort the timetable. The sortrows function sorts the rows by their row times, from earliest to latest
time. If there are rows with duplicate row times, then sortrows copies all the duplicates to the
output.
bikeData = sortrows(bikeData);
issorted(bikeData)

ans = logical
1

Identify and Remove Missing Times and Data

A timetable can have missing data indicators in its variables or its row times. For example, you can
indicate missing numeric values as NaNs, and missing datetime values as NaTs. You can assign, find,

10-55
10 Timetables

remove, and fill missing values with the standardizeMissing, ismissing, rmmissing, and
fillmissing functions, respectively.

Find and count the missing values in the timetable variables. In this example, missing values indicate
circumstances when no data were collected.

missData = ismissing(bikeData);
sum(missData)

ans = 1×4

1 3 3 3

The output from ismissing is a logical matrix, the same size as the table, identifying missing data
values as true. Display any rows which have missing data indicators.

idx = any(missData,2);
bikeData(idx,:)

ans=3×4 timetable
Time Day Total Westbound Eastbound
___________________ ___________ _____ _________ _________

2015-08-03 00:00:00 Monday NaN NaN NaN


2015-08-03 01:00:00 Monday NaN NaN NaN
NaT <undefined> NaN NaN NaN

ismissing(bikeData) finds missing data in the timetable variables only, not the times. To find
missing row times, call ismissing on the row times.

missTimes = ismissing([Link]);
bikeData(missTimes,:)

ans=2×4 timetable
Time Day Total Westbound Eastbound
____ ___________ _____ _________ _________

NaT <undefined> NaN NaN NaN


NaT Friday 6 3 3

In this example, missing times or data values indicate measurement errors and can be excluded.
Remove rows of the table containing missing data values and missing row times using rmmissing.

bikeData = rmmissing(bikeData);
sum(ismissing(bikeData))

ans = 1×4

0 0 0 0

sum(ismissing([Link]))

ans = 0

10-56
Preprocess and Explore Time-stamped Data Using timetable

Remove Duplicate Times and Data

Determine if there are duplicate times and/or duplicate rows of data. You might want to exclude exact
duplicates, as these can also be considered measurement errors. Identify duplicate times by finding
where the difference between the sorted times is exactly zero.

idx = diff([Link]) == 0;
dup = [Link](idx)

dup = 3x1 datetime


2015-08-21 00:00:00
2015-11-19 23:00:00
2015-11-19 23:00:00

Three times are repeated and November 19, 2015 is repeated twice. Examine the data associated
with the repeated times.

bikeData(dup(1),:)

ans=2×4 timetable
Time Day Total Westbound Eastbound
___________________ ______ _____ _________ _________

2015-08-21 00:00:00 Friday 14 9 5


2015-08-21 00:00:00 Friday 11 7 4

bikeData(dup(2),:)

ans=3×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________

2015-11-19 23:00:00 Thursday 17 15 2


2015-11-19 23:00:00 Thursday 17 15 2
2015-11-19 23:00:00 Thursday 17 15 2

The first has duplicated times but non-duplicate data, whereas the others are entirely duplicated.
Timetable rows are considered duplicates when they contain identical row times and identical data
values across the rows. You can use unique to remove duplicate rows in the timetable. The unique
function also sorts the rows by their row times.

bikeData = unique(bikeData);

The rows with duplicate times but non-duplicate data require some interpretation. Examine the data
around those times.

d = dup(1) + hours(-2:2);
bikeData(d,:)

ans=5×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________

2015-08-20 22:00:00 Thursday 40 30 10


2015-08-20 23:00:00 Thursday 25 18 7

10-57
10 Timetables

2015-08-21 00:00:00 Friday 11 7 4


2015-08-21 00:00:00 Friday 14 9 5
2015-08-21 02:00:00 Friday 6 5 1

In this case, the duplicate time may have been mistaken since the data and surrounding times are
consistent. Though it appears to represent 01:00:00, it is uncertain what time this should have been.
The data can be accumulated to account for the data at both time points.

sum(bikeData{dup(1),2:end})

ans = 1×3

25 16 9

This is only one case which can be done manually. However, for many rows, the retime function can
perform this calculation. Accumulate the data for the unique times using the sum function to
aggregate. The sum is appropriate for numeric data but not the categorical data in the timetable. Use
vartype to identify the numeric variables.

vt = vartype('numeric');
t = unique([Link]);
numData = retime(bikeData(:,vt),t,'sum');
head(numData)

ans=8×3 timetable
Time Total Westbound Eastbound
___________________ _____ _________ _________

2015-06-24 00:00:00 13 9 4
2015-06-24 01:00:00 3 3 0
2015-06-24 02:00:00 1 1 0
2015-06-24 03:00:00 1 1 0
2015-06-24 04:00:00 1 1 0
2015-06-24 05:00:00 7 3 4
2015-06-24 06:00:00 36 6 30
2015-06-24 07:00:00 141 13 128

You cannot sum the categorical data, but since one label represents the whole day, take the first value
on each day. You can perform the retime operation again with the same time vector and concatenate
the timetables together.

vc = vartype('categorical');
catData = retime(bikeData(:,vc),t,'firstvalue');
bikeData = [catData,numData];
bikeData(d,:)

ans=4×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________

2015-08-20 22:00:00 Thursday 40 30 10


2015-08-20 23:00:00 Thursday 25 18 7
2015-08-21 00:00:00 Friday 25 16 9
2015-08-21 02:00:00 Friday 6 5 1

10-58
Preprocess and Explore Time-stamped Data Using timetable

Examine Uniformity of Time Interval

The data appear to have a uniform time step of one hour. To determine if this is true for all the row
times in the timetable, use the isregular function. isregular returns true for sorted, evenly-
spaced times (monotonically increasing), with no duplicate or missing times (NaT or NaN).

isregular(bikeData)

ans = logical
0

The output of 0, or false, indicates that the times in the timetable are not evenly spaced. Explore
the time interval in more detail.

dt = diff([Link]);
[min(dt); max(dt)]

ans = 2x1 duration


00:30:00
03:00:00

To put the timetable on a regular time interval, use retime or synchronize and specify the time
interval of interest.

Determine Daily Bicycle Volume

Determine the counts per day using the retime function. Accumulate the count data for each day
using the sum method. This is appropriate for numeric data but not the categorical data in the
timetable. Use vartype to identify the variables by data type.

dayCountNum = retime(bikeData(:,vt),'daily','sum');
head(dayCountNum)

ans=8×3 timetable
Time Total Westbound Eastbound
___________________ _____ _________ _________

2015-06-24 00:00:00 2141 1141 1000


2015-06-25 00:00:00 2106 1123 983
2015-06-26 00:00:00 1748 970 778
2015-06-27 00:00:00 695 346 349
2015-06-28 00:00:00 153 83 70
2015-06-29 00:00:00 1841 978 863
2015-06-30 00:00:00 2170 1145 1025
2015-07-01 00:00:00 997 544 453

As above, you can perform the retime operation again to represent the categorical data using an
appropriate method and concatenate the timetables together.

dayCountCat = retime(bikeData(:,vc),'daily','firstvalue');
dayCount = [dayCountCat,dayCountNum];
head(dayCount)

ans=8×4 timetable
Time Day Total Westbound Eastbound

10-59
10 Timetables

___________________ _________ _____ _________ _________

2015-06-24 00:00:00 Wednesday 2141 1141 1000


2015-06-25 00:00:00 Thursday 2106 1123 983
2015-06-26 00:00:00 Friday 1748 970 778
2015-06-27 00:00:00 Saturday 695 346 349
2015-06-28 00:00:00 Sunday 153 83 70
2015-06-29 00:00:00 Monday 1841 978 863
2015-06-30 00:00:00 Tuesday 2170 1145 1025
2015-07-01 00:00:00 Wednesday 997 544 453

Synchronize Bicycle Count and Weather Data

Examine the effect of weather on cycling behavior by comparing the bicycle count with weather data.
Load the weather timetable which includes historical weather data from Boston, MA including storm
events.

load BostonWeatherData
head(weatherData)

ans=8×3 timetable
Time TemperatureF Humidity Events
___________ ____________ ________ ____________

01-Jul-2015 72 78 Thunderstorm
02-Jul-2015 72 60 None
03-Jul-2015 70 56 None
04-Jul-2015 67 75 None
05-Jul-2015 72 67 None
06-Jul-2015 74 69 None
07-Jul-2015 75 77 Rain
08-Jul-2015 79 68 Rain

To summarize the times and variables in the timetable, use the summary function.

summary(weatherData)

RowTimes:

Time: 383x1 datetime


Values:
Min 01-Jul-2015
Median 08-Jan-2016
Max 17-Jul-2016
TimeStep 24:00:00

Variables:

TemperatureF: 383x1 double

Values:

Min 2
Median 55
Max 85

10-60
Preprocess and Explore Time-stamped Data Using timetable

Humidity: 383x1 double

Values:

Min 29
Median 64
Max 97

Events: 383x1 categorical

Values:

Fog 7
Hail 1
Rain 108
Rain-Snow 4
Snow 18
Thunderstorm 12
None 233

Combine the bicycle data with the weather data to a common time vector using synchronize. You
can resample or aggregate timetable data using any of the methods documented on the reference
page for the synchronize function.

Synchronize the data from both timetables to a common time vector, constructed from the
intersection of their individual daily time vectors.

data = synchronize(dayCount,weatherData,'intersection');
head(data)

ans=8×7 timetable
Time Day Total Westbound Eastbound TemperatureF Humidi
___________________ _________ _____ _________ _________ ____________ ______

2015-07-01 00:00:00 Wednesday 997 544 453 72 78


2015-07-02 00:00:00 Thursday 1943 1033 910 72 60
2015-07-03 00:00:00 Friday 870 454 416 70 56
2015-07-04 00:00:00 Saturday 669 328 341 67 75
2015-07-05 00:00:00 Sunday 702 407 295 72 67
2015-07-06 00:00:00 Monday 1900 1029 871 74 69
2015-07-07 00:00:00 Tuesday 2106 1140 966 75 77
2015-07-08 00:00:00 Wednesday 1855 984 871 79 68

Compare bicycle traffic counts and outdoor temperature on separate y axes to examine the trends.
Remove the weekends from the data for visualization.

idx = ~isweekend([Link]);
weekdayData = data(idx,{'TemperatureF','Total'});
figure
yyaxis left
plot([Link], [Link])
ylabel('Bicycle Count')
yyaxis right
plot([Link],[Link])
ylabel('Temperature (\circ F)')
title('Bicycle Counts and Temperature Over Time')
xlim([min([Link]) max([Link])])

10-61
10 Timetables

The plot shows that the traffic and weather data might follow similar trends. Zoom in on the plot.

xlim([datetime('2015-11-01'),datetime('2016-05-01')])

10-62
Preprocess and Explore Time-stamped Data Using timetable

The trends are similar, indicating that fewer people cycle on colder days.

Analyze by Day of Week and Time of Day

Examine the data based on different intervals such as day of the week and time of day. Determine the
total counts per day using varfun to perform grouped calculations on variables. Specify the sum
function with a function handle and the grouping variable and preferred output type using name-
value pairs.
byDay = varfun(@sum,bikeData,'GroupingVariables','Day',...
'OutputFormat','table')

byDay=7×5 table
Day GroupCount sum_Total sum_Westbound sum_Eastbound
_________ __________ _________ _____________ _____________

Sunday 1344 25315 12471 12844


Monday 1343 79991 39219 40772
Tuesday 1320 81480 39695 41785
Wednesday 1344 86853 41726 45127
Thursday 1344 87516 42682 44834
Friday 1342 76643 36926 39717
Saturday 1343 30292 14343 15949

figure
bar(byDay{:,{'sum_Westbound','sum_Eastbound'}})
legend({'Westbound','Eastbound'},'Location','eastoutside')

10-63
10 Timetables

xticklabels({'Sun','Mon','Tue','Wed','Thu','Fri','Sat'})
title('Bicycle Count by Day of Week')

The bar plot indicates that traffic is heavier on weekdays. Also, there is a difference in the Eastbound
and Westbound directions. This might indicate that people tend to take different routes when
entering and leaving the city. Another possibility is that some people enter on one day and return on
another day.

Determine the hour of day and use varfun for calculations by group.
[Link] = hour([Link]);
byHr = varfun(@mean,bikeData(:,{'Westbound','Eastbound','HrOfDay'}),...
'GroupingVariables','HrOfDay','OutputFormat','table');
head(byHr)

ans=8×4 table
HrOfDay GroupCount mean_Westbound mean_Eastbound
_______ __________ ______________ ______________

0 389 5.4396 1.7686


1 389 2.7712 0.87147
2 391 1.8696 0.58312
3 391 0.7468 0.289
4 391 0.52685 1.0026
5 391 0.70588 4.7494
6 391 3.1228 22.097
7 391 9.1176 63.54

10-64
Preprocess and Explore Time-stamped Data Using timetable

bar(byHr{:,{'mean_Westbound','mean_Eastbound'}})
legend('Westbound','Eastbound','Location','eastoutside')
xlabel('Hour of Day')
ylabel('Bicycle Count')
title('Mean Bicycle Count by Hour of Day')

There are traffic spikes at the typical commute hours, around 9:00 a.m. and 5:00 p.m. Also, the trends
between the Eastbound and Westbound directions are different. In general, the Westbound direction
is toward residential areas surrounding the Cambridge area and toward the Universities. The
Eastbound direction is toward Boston.

The traffic is heavier later in the day in the Westbound direction compared to the Eastbound
direction. This might indicate university schedules and traffic due to restaurants in the area. Examine
the trend by day of week as well as hour of day.

byHrDay = varfun(@sum,bikeData,'GroupingVariables',{'HrOfDay','Day'},...
'OutputFormat','table');
head(byHrDay)

ans=8×6 table
HrOfDay Day GroupCount sum_Total sum_Westbound sum_Eastbound
_______ _________ __________ _________ _____________ _____________

0 Sunday 56 473 345 128


0 Monday 55 202 145 57
0 Tuesday 55 297 213 84
0 Wednesday 56 374 286 88

10-65
10 Timetables

0 Thursday 56 436 324 112


0 Friday 55 442 348 94
0 Saturday 56 580 455 125
1 Sunday 56 333 259 74

To arrange the timetable so that the days of the week are the variables, use the unstack function.

hrAndDayWeek = unstack(byHrDay(:,{'HrOfDay','Day','sum_Total'}),'sum_Total','Day');
head(hrAndDayWeek)

ans=8×8 table
HrOfDay Sunday Monday Tuesday Wednesday Thursday Friday Saturday
_______ ______ ______ _______ _________ ________ ______ ________

0 473 202 297 374 436 442 580


1 333 81 147 168 173 183 332
2 198 77 68 93 128 141 254
3 86 41 43 44 50 61 80
4 51 81 117 101 108 80 60
5 105 353 407 419 381 340 128
6 275 1750 1867 2066 1927 1625 351
7 553 5355 5515 5818 5731 4733 704

ribbon([Link],hrAndDayWeek{:,2:end})
ylim([0 24])
xlim([0 8])
xticks(1:7)
xticklabels({'Sun','Mon','Tue','Wed','Thu','Fri','Sat'})
ylabel('Hour')
title('Bicycle Count by Hour and Day of Week')

10-66
Preprocess and Explore Time-stamped Data Using timetable

There are similar trends for the regular work days of Monday through Friday, with peaks at rush hour
and traffic tapering off in the evening. Friday has less volume, though the overall trend is similar to
the other work days. The trends for Saturday and Sunday are similar to each other, without rush hour
peaks and with more volume later in the day. The late evening trends are also similar for Monday
through Friday, with less volume on Friday.

Analyze Traffic During Rush Hour

To examine the overall time of day trends, split up the data by rush hour times. It is possible to use
different times of day or units of time using the discretize function. For example, separate the data
into groups for AM, AMRush, Day, PMRush, PM. Then use varfun to calculate the mean by group.

[Link] = discretize([Link],[0,6,10,15,19,24],'categorical',...
{'AM','RushAM','Day','RushPM','PM'});
byHrBin = varfun(@mean,bikeData(:,{'Total','HrLabel'}),'GroupingVariables','HrLabel',...
'OutputFormat','table')

byHrBin=5×3 table
HrLabel GroupCount mean_Total
_______ __________ __________

AM 2342 3.5508
RushAM 1564 94.893
Day 1955 45.612
RushPM 1564 98.066
PM 1955 35.198

10-67
10 Timetables

bar(byHrBin.mean_Total)
cats = categories([Link]);
xticklabels(cats)
title('Mean Bicycle Count During Rush Hours')

In general, there is about twice as much traffic in this area during the evening and morning rush
hours compared to other times of the day. There is very little traffic in this area in the early morning,
but there is still significant traffic in the evening and late evening, comparable to the day outside of
the morning and evening rush hours.

See Also
datetime | head | retime | rmmissing | sortrows | summary | table2timetable | timerange |
timetable | unstack | varfun

Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-25
• “Select Timetable Data by Row Time and Variable Type” on page 10-19

10-68
11

Structures

• “Create Structure Array” on page 11-2


• “Access Data in Structure Array” on page 11-5
• “Concatenate Structures” on page 11-9
• “Generate Field Names from Variables” on page 11-11
• “Access Data in Nested Structures” on page 11-12
• “Access Elements of a Nonscalar Struct Array” on page 11-14
• “Ways to Organize Data in Structure Arrays” on page 11-16
• “Memory Requirements for Structure Array” on page 11-19
11 Structures

Create Structure Array


This example shows how to create a structure array. A structure is a data type that groups related
data using data containers called fields. Each field can contain data of any type or size.

Store a patient record in a scalar structure with fields name, billing, and test.

patient(1).name = 'John Doe';


patient(1).billing = 127.00;
patient(1).test = [79, 75, 73; 180, 178, 177.5; 220, 210, 205];
patient

patient = struct with fields:


name: 'John Doe'
billing: 127
test: [3x3 double]

Add records for other patients to the array by including subscripts after the array name.

11-2
Create Structure Array

patient(2).name = 'Ann Lane';


patient(2).billing = 28.50;
patient(2).test = [68, 70, 68; 118, 118, 119; 172, 170, 169];
patient

patient=1×2 struct array with fields:


name
billing
test

Each patient record in the array is a structure of class struct. An array of structures is often
referred to as a struct array. Like other MATLAB arrays, a struct array can have any dimensions.

A struct array has the following properties:

• All structs in the array have the same number of fields.


• All structs have the same field names.
• Fields of the same name in different structs can contain different types or sizes of data.

Any unspecified fields for new structs in the array contain empty arrays.

patient(3).name = 'New Name';


patient(3)

ans = struct with fields:


name: 'New Name'
billing: []
test: []

Access data in the structure array to find how much the first patient owes, and to create a bar graph
of his test results.

amount_due = patient(1).billing

11-3
11 Structures

amount_due = 127

bar(patient(1).test)
title(['Test Results for ', patient(1).name])

See Also

Related Examples
• “Access Data in Structure Array” on page 11-5
• “Create Cell Array” on page 12-3
• “Create and Work with Tables” on page 9-2

More About
• “Cell vs. Structure Arrays” on page 12-16
• “Advantages of Using Tables” on page 9-57

11-4
Access Data in Structure Array

Access Data in Structure Array


This example shows how to access the contents of a structure array. To run the code in this example,
load several variables into a structure named S.

Access Data in Scalar Structure


First, load data from [Link] into the scalar structure S. The file [Link] contains an
image of a simulation of an astrophysical jet experiencing turbulence.

S = load('[Link]')

S = struct with fields:


X: [400x300 double]
map: [64x3 double]
caption: [2x32 char]

The variables from the file (X, caption, and map) are now fields in the structure.

Access the data using dot notation of the form [Link]. For example, pass the
numeric data in field X to the image function:

image(S.X)
colormap([Link])

11-5
11 Structures

To access part of a field, add indices as appropriate for the size and type of data in the field. For
example, pass the center left section of X to the image function.
centerLeft = S.X(150:250,1:50);
image(centerLeft)

If a field contains a cell array, use curly braces to access the data, such as
[Link]{1:50,1:80}.

Access Data by Indexing into Structure Array


Create a nonscalar array by loading data from the file [Link] into a second element of array S.
The file [Link] contains an image of Cape Cod, Massachusetts.

Each element of a structure array must have the same fields. Both [Link] and [Link]
contain variables X, map, and caption. S is a 1-by-2 array.
S(2) = load('[Link]')

S=1×2 struct array with fields:


X
map
caption

For nonscalar structures, the syntax for accessing a field is structName(indices).fieldName.


Display the image of Cape Cod, specifying 2 as the index into S.

11-6
Access Data in Structure Array

image(S(2).X)
colormap(S(2).map)

Add indices to select and display a small section of S(2).X.

capeSection = S(2).X(200:300,150:250);
image(capeSection)

11-7
11 Structures

Note You can index into part of a field only when you refer to a single element of a structure array.
MATLAB does not support statements such as S(1:2).X(1:50,1:80), which attempt to index into a
field for multiple elements of the structure.

See Also

Related Examples
• “Access Data in Nested Structures” on page 11-12
• “Access Elements of a Nonscalar Struct Array” on page 11-14
• “Generate Field Names from Variables” on page 11-11

11-8
Concatenate Structures

Concatenate Structures
This example shows how to concatenate structure arrays using the [] operator. To concatenate
structures, they must have the same set of fields, but the fields do not need to contain the same sizes
or types of data.

Create scalar (1-by-1) structure arrays struct1 and struct2, each with fields a and b:
struct1.a = 'first';
struct1.b = [1,2,3];
struct2.a = 'second';
struct2.b = rand(5);
struct1,struct2

struct1 = struct with fields:


a: 'first'
b: [1 2 3]

struct2 = struct with fields:


a: 'second'
b: [5x5 double]

Just as concatenating two scalar values such as [1,2] creates a 1-by-2 numeric array, concatenating
struct1 and struct2 creates a 1-by-2 structure array.
combined = [struct1,struct2]

combined=1×2 struct array with fields:


a
b

When you want to access the contents of a particular field, specify the index of the structure in the
array. For example, access field a of the first structure.
combined(1).a

ans =
'first'

Concatenation also applies to nonscalar structure arrays. For example, create a 2-by-2 structure
array named new. Because the 1-by-2 structure combined and the 2-by-2 structure new both have
two columns, you can concatenate them vertically with a semicolon separator.
new(1,1).a = 1;
new(1,1).b = 10;
new(1,2).a = 2;
new(1,2).b = 20;
new(2,1).a = 3;
new(2,1).b = 30;
new(2,2).a = 4;
new(2,2).b = 40;

larger = [combined; new]

larger=3×2 struct array with fields:


a

11-9
11 Structures

Access field a of the structure larger(2,1). It contains the same value as new(1,1).a.

larger(2,1).a

ans = 1

See Also

Related Examples
• “Creating, Concatenating, and Expanding Matrices”
• “Access Data in Structure Array” on page 11-5
• “Access Elements of a Nonscalar Struct Array” on page 11-14

11-10
Generate Field Names from Variables

Generate Field Names from Variables


This example shows how to derive a structure field name at run time from a variable or expression.
The general syntax is

structName.(dynamicExpression)

where dynamicExpression is a variable or expression that, when evaluated, returns a character


vector or, starting in R2017b, a string scalar. Field names that you reference with expressions are
called dynamic fieldnames, or sometimes dynamic field names.

For example, create a field name from the current date:

currentDate = datestr(now,'mmmdd');
myStruct.(currentDate) = [1,2,3]

If the current date reported by your system is February 29, then this code assigns data to a field
named Feb29:

myStruct =
Feb29: [1 2 3]

The dynamic fieldname can return either a character vector or a string scalar. For example, you can
specify the field Feb29 using either single or, starting in R2017b, double quotes.

myStruct.('Feb29')

ans =
1 2 3

myStruct.("Feb29")

ans =
1 2 3

Field names, like variable names, must begin with a letter, can contain letters, digits, or underscore
characters, and are case sensitive. To avoid potential conflicts, do not use the names of existing
variables or functions as field names.

See Also
fieldnames | getfield | setfield | struct

Related Examples
• “Variable Names” on page 1-4
• “Create Structure Array” on page 11-2
• “Access Data in Structure Array” on page 11-5

11-11
11 Structures

Access Data in Nested Structures


This example shows how to index into a structure that is nested within another structure. The general
syntax for accessing data in a particular field is

structName(index).nestedStructName(index).fieldName(indices)

When a structure is scalar (1-by-1), you do not need to include the indices to refer to the single
element. For example, create a scalar structure s, where field n is a nested scalar structure with
fields a, b, and c:

s.n.a = ones(3);
s.n.b = eye(4);
s.n.c = magic(5);

Access the third row of field b:

third_row_b = s.n.b(3,:)

Variable third_row_b contains the third row of eye(4).

third_row_b =
0 0 1 0

Expand s so that both s and n are nonscalar (1-by-2):

s(1).n(2).a = 2*ones(3);
s(1).n(2).b = 2*eye(4);
s(1).n(2).c = 2*magic(5);

s(2).n(1).a = '1a';
s(2).n(2).a = '2a';
s(2).n(1).b = '1b';
s(2).n(2).b = '2b';
s(2).n(1).c = '1c';
s(2).n(2).c = '2c';

Structure s now contains the data shown in the following figure.

Access part of the array in field b of the second element in n within the first element of s:

part_two_eye = s(1).n(2).b(1:2,1:2)

This returns the 2-by-2 upper left corner of 2*eye(4):

part_two_eye =
2 0
0 2

See Also
getfield | setfield | struct

11-12
Access Data in Nested Structures

Related Examples
• “Create Structure Array” on page 11-2
• “Access Data in Structure Array” on page 11-5
• “Ways to Organize Data in Structure Arrays” on page 11-16

11-13
11 Structures

Access Elements of a Nonscalar Struct Array


This example shows how to access and process data from multiple elements of a nonscalar structure
array:

Create a 1-by-3 structure s with field f:


s(1).f = 1;
s(2).f = 'two';
s(3).f = 3 * ones(3);

Although each structure in the array must have the same number of fields and the same field names,
the contents of the fields can be different types and sizes. When you refer to field f for multiple
elements of the structure array, such as
s(1:3).f

or
s.f

MATLAB returns the data from the elements in a comma-separated list, which displays as follows:
ans =
1

ans =
two

ans =
3 3 3
3 3 3
3 3 3

You cannot assign the list to a single variable with the syntax v = s.f because the fields can contain
different types of data. However, you can assign the list items to the same number of variables, such
as
[v1, v2, v3] = s.f;

or assign to elements of a cell array, such as


c = {s.f};

If all of the fields contain the same type of data and can form a hyperrectangle, you can concatenate
the list items. For example, create a structure nums with scalar numeric values in field f, and
concatenate the data from the fields:
nums(1).f = 1;
nums(2).f = 2;
nums(3).f = 3;

allNums = [nums.f]

This code returns


allNums =
1 2 3

11-14
Access Elements of a Nonscalar Struct Array

If you want to process each element of an array with the same operation, use the arrayfun function.
For example, count the number of elements in field f of each struct in array s:

numElements = arrayfun(@(x) numel(x.f), s)

The syntax @(x) creates an anonymous function. This code calls the numel function for each element
of array s, such as numel(s(1).f), and returns

numElements =
1 3 9

For related information, see:

• “Comma-Separated Lists” on page 2-79


• “Anonymous Functions” on page 20-20

11-15
11 Structures

Ways to Organize Data in Structure Arrays


There are at least two ways you can organize data in a structure array: plane organization and
element-by-element organization. The method that best fits your data depends on how you plan to
access the data, and, for very large data sets, whether you have system memory constraints.

Plane organization allows easier access to all values within a field. Element-by-element organization
allows easier access to all information related to a single element or record. The following sections
include an example of each type of organization:

• “Plane Organization” on page 11-16


• “Element-by-Element Organization” on page 11-17

When you create a structure array, MATLAB stores information about each element and field in the
array header. As a result, structures with more elements and fields require more memory than
simpler structures that contain the same data.

Plane Organization
Consider an RGB image with three arrays corresponding to color intensity values.

If you have arrays RED, GREEN, and BLUE in your workspace, then these commands create a scalar
structure named img that uses plane organization:
[Link] = RED;
[Link] = GREEN;
[Link] = BLUE;

Plane organization allows you to easily extract entire image planes for display, filtering, or other
processing. For example, multiply the red intensity values by 0.9:

11-16
Ways to Organize Data in Structure Arrays

adjustedRed = .9 * [Link];

If you have multiple images, you can add them to the img structure, so that each element
img(1),...,img(n) contains an entire image. For an example that adds elements to a structure,
see the following section.

Element-by-Element Organization
Consider a database with patient information. Each record contains data for the patient’s name, test
results, and billing amount.

These statements create an element in a structure array named patient:


patient(1).name = 'John Doe';
patient(1).billing = 127.00;
patient(1).test = [79, 75, 73; 180, 178, 177.5; 220, 210, 205];

Additional patients correspond to new elements in the structure. For example, add an element for a
second patient:
patient(2).name = 'Ann Lane';
patient(2).billing = 28.50;
patient(2).test = [68, 70, 68; 118, 118, 119; 172, 170, 169];

Element-by-element organization supports simple indexing to access data for a particular patient. For
example, find the average of the first patient’s test results, calculating by rows (dimension 2) rather
than by columns:
aveResultsDoe = mean(patient(1).test,2)

This code returns


aveResultsDoe =
75.6667
178.5000
212.0000

See Also
struct

11-17
11 Structures

More About
• “Access Data in Structure Array” on page 11-5
• “Access Elements of a Nonscalar Struct Array” on page 11-14
• “Memory Requirements for Structure Array” on page 11-19

11-18
Memory Requirements for Structure Array

Memory Requirements for Structure Array


Structure arrays do not require completely contiguous memory. However, each field requires
contiguous memory, as does the header that MATLAB creates to describe the array. For very large
arrays, incrementally increasing the number of fields or the number of elements in a field results in
Out of Memory errors.

Preallocate memory for the contents by assigning initial values with the struct function, such as

newStruct(1:25,1:50) = struct('a',ones(20),'b',zeros(30),'c',rand(40));

This code creates and populates a 25-by-50 structure array S with fields a, b, and c.

If you prefer not to assign initial values, you can initialize a structure array by assigning empty arrays
to each field of the last element in the structure array, such as

newStruct(25,50).a = [];
newStruct(25,50).b = [];
newStruct(25,50).c = [];

or, equivalently,

newStruct(25,50) = struct('a',[],'b',[],'c',[]);

However, in this case, MATLAB only allocates memory for the header, and not for the contents of the
array.

For more information, see:

• “Reshaping and Rearranging Arrays”


• “How MATLAB Allocates Memory” on page 30-10

11-19
12

Cell Arrays

• “What Is a Cell Array?” on page 12-2


• “Create Cell Array” on page 12-3
• “Access Data in Cell Array” on page 12-5
• “Add Cells to Cell Array” on page 12-8
• “Delete Data from Cell Array” on page 12-9
• “Combine Cell Arrays” on page 12-10
• “Pass Contents of Cell Arrays to Functions” on page 12-11
• “Preallocate Memory for Cell Array” on page 12-15
• “Cell vs. Structure Arrays” on page 12-16
• “Multilevel Indexing to Access Parts of Cells” on page 12-20
12 Cell Arrays

What Is a Cell Array?


A cell array is a data type with indexed data containers called cells. Each cell can contain any type of
data. Cell arrays commonly contain pieces of text, combinations of text and numbers from
spreadsheets or text files, or numeric arrays of different sizes.

There are two ways to refer to the elements of a cell array. Enclose indices in smooth parentheses,
(), to refer to sets of cells — for example, to define a subset of the array. Enclose indices in curly
braces, {}, to refer to the text, numbers, or other data within individual cells.

For more information, see:

• “Create Cell Array” on page 12-3


• “Access Data in Cell Array” on page 12-5

12-2
Create Cell Array

Create Cell Array


This example shows how to create a cell array using the {} operator or the cell function.

When you have data to put into a cell array, create the array using the cell array construction
operator, {}.

myCell = {1, 2, 3;
'text', rand(5,10,2), {11; 22; 33}}

myCell=2×3 cell array


{[ 1]} {[ 2]} {[ 3]}
{'text'} {5x10x2 double} {3x1 cell}

Like all MATLAB® arrays, cell arrays are rectangular, with the same number of cells in each row.
myCell is a 2-by-3 cell array.

You also can use the {} operator to create an empty 0-by-0 cell array.

C = {}

C =

0x0 empty cell array

To add values to a cell array over time or in a loop, create an empty N-dimensional array using the
cell function.

emptyCell = cell(3,4,2)

emptyCell = 3x4x2 cell array


emptyCell(:,:,1) =

{0x0 double} {0x0 double} {0x0 double} {0x0 double}


{0x0 double} {0x0 double} {0x0 double} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {0x0 double}

emptyCell(:,:,2) =

{0x0 double} {0x0 double} {0x0 double} {0x0 double}


{0x0 double} {0x0 double} {0x0 double} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {0x0 double}

emptyCell is a 3-by-4-by-2 cell array, where each cell contains an empty array, [].

See Also
cell

Related Examples
• “Access Data in Cell Array” on page 12-5

12-3
12 Cell Arrays

• “Create Structure Array” on page 11-2


• “Create and Work with Tables” on page 9-2
• “Cell vs. Structure Arrays” on page 12-16
• “Advantages of Using Tables” on page 9-57

12-4
Access Data in Cell Array

Access Data in Cell Array


This example shows how to read and write data to and from a cell array.

Create a 2-by-3 cell array of text and numeric data.

C = {'one', 'two', 'three';


1, 2, 3}

C=2×3 cell array


{'one'} {'two'} {'three'}
{[ 1]} {[ 2]} {[ 3]}

There are two ways to refer to the elements of a cell array. Enclose indices in smooth parentheses,
(), to refer to sets of cells--for example, to define a subset of the array. Enclose indices in curly
braces, {}, to refer to the text, numbers, or other data within individual cells.

Cell Indexing with Smooth Parentheses, ()

Cell array indices in smooth parentheses refer to sets of cells. For example, to create a 2-by-2 cell
array that is a subset of C, use smooth parentheses.

upperLeft = C(1:2,1:2)

upperLeft=2×2 cell array


{'one'} {'two'}
{[ 1]} {[ 2]}

Update sets of cells by replacing them with the same number of cells. For example, replace cells in
the first row of C with an equivalent-sized (1-by-3) cell array.

C(1,1:3) = {'first','second','third'}

C=2×3 cell array


{'first'} {'second'} {'third'}
{[ 1]} {[ 2]} {[ 3]}

If cells in your array contain numeric data, you can convert the cells to a numeric array using the
cell2mat function.

numericCells = C(2,1:3)

numericCells=1×3 cell array


{[1]} {[2]} {[3]}

numericVector = cell2mat(numericCells)

numericVector = 1×3

1 2 3

numericCells is a 1-by-3 cell array, but numericVector is a 1-by-3 array of type double.

12-5
12 Cell Arrays

Content Indexing with Curly Braces, {}

Access the contents of cells--the numbers, text, or other data within the cells--by indexing with curly
braces. For example, to access the contents of the last cell of C, use curly braces.

last = C{2,3}

last = 3

last is a numeric variable of type double, because the cell contains a double value.

Similarly, you can index with curly braces to replace the contents of a cell.

C{2,3} = 300

C=2×3 cell array


{'first'} {'second'} {'third'}
{[ 1]} {[ 2]} {[ 300]}

You can access the contents of multiple cells by indexing with curly braces. MATLAB® returns the
contents of the cells as a comma-separated list. Because each cell can contain a different type of data,
you cannot assign this list to a single variable. However, you can assign the list to the same number of
variables as cells. MATLAB® assigns to the variables in column order.

Assign contents of four cells of C to four variables.

[r1c1, r2c1, r1c2, r2c2] = C{1:2,1:2}

r1c1 =
'first'

r2c1 = 1

r1c2 =
'second'

r2c2 = 2

If each cell contains the same type of data, you can create a single variable by applying the array
concatenation operator, [], to the comma-separated list.

Concatenate the contents of the second row into a numeric array.

nums = [C{2,:}]

nums = 1×3

1 2 300

See Also
cell | cell2mat

Related Examples
• “Create Cell Array” on page 12-3

12-6
Access Data in Cell Array

• “Multilevel Indexing to Access Parts of Cells” on page 12-20


• “Comma-Separated Lists” on page 2-79

12-7
12 Cell Arrays

Add Cells to Cell Array


This example shows how to add cells to a cell array.

Create a 1-by-3 cell array.

C = {1, 2, 3}

C=1×3 cell array


{[1]} {[2]} {[3]}

Assign data to a cell outside the current dimensions. MATLAB® expands the cell array to a rectangle
that includes the specified subscripts. Any intervening cells contain empty arrays.

C{4,4} = 44

C=4×4 cell array


{[ 1]} {[ 2]} {[ 3]} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {[ 44]}

Add cells without specifying a value by assigning an empty array as the contents of a cell. C is now a
5-by-5 cell array.

C{5,5} = []

C=5×5 cell array


Columns 1 through 4

{[ 1]} {[ 2]} {[ 3]} {0x0 double}


{0x0 double} {0x0 double} {0x0 double} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {0x0 double}
{0x0 double} {0x0 double} {0x0 double} {[ 44]}
{0x0 double} {0x0 double} {0x0 double} {0x0 double}

Column 5

{0x0 double}
{0x0 double}
{0x0 double}
{0x0 double}
{0x0 double}

See Also

Related Examples
• “Access Data in Cell Array” on page 12-5
• “Combine Cell Arrays” on page 12-10
• “Delete Data from Cell Array” on page 12-9

12-8
Delete Data from Cell Array

Delete Data from Cell Array


This example shows how to remove data from individual cells, and how to delete entire cells from a
cell array.

Create a 3-by-3 cell array

C = {1, 2, 3; 4, 5, 6; 7, 8, 9}

C=3×3 cell array


{[1]} {[2]} {[3]}
{[4]} {[5]} {[6]}
{[7]} {[8]} {[9]}

Delete the contents of a particular cell by assigning an empty array to the cell, using curly braces for
content indexing, {}.

C{2,2} = []

C=3×3 cell array


{[1]} {[ 2]} {[3]}
{[4]} {0x0 double} {[6]}
{[7]} {[ 8]} {[9]}

Delete sets of cells using standard array indexing with smooth parentheses, (). For example, remove
the second row of C.

C(2,:) = []

C=2×3 cell array


{[1]} {[2]} {[3]}
{[7]} {[8]} {[9]}

See Also

Related Examples
• “Add Cells to Cell Array” on page 12-8
• “Access Data in Cell Array” on page 12-5

12-9
12 Cell Arrays

Combine Cell Arrays


This example shows how to combine cell arrays by concatenation or nesting. To run the code in this
example, create several cell arrays with the same number of columns:

C1 = {1, 2, 3};
C2 = {'A', 'B', 'C'};
C3 = {10, 20, 30};

Concatenate cell arrays with the array concatenation operator, []. In this example, vertically
concatenate the cell arrays by separating them with semicolons:

C4 = [C1; C2; C3]

C4 is a 3-by-3 cell array:

C4 =
[ 1] [ 2] [ 3]
'A' 'B' 'C'
[10] [20] [30]

Create a nested cell array with the cell array construction operator, {}:

C5 = {C1; C2; C3}

C5 is a 3-by-1 cell array, where each cell contains a cell array:

C5 =
{1x3 cell}
{1x3 cell}
{1x3 cell}

To combine cell arrays of character vectors into one character vector, use the strjoin function.

See Also
strjoin

Related Examples
• “Creating, Concatenating, and Expanding Matrices”

12-10
Pass Contents of Cell Arrays to Functions

Pass Contents of Cell Arrays to Functions


These examples show several ways to pass data from a cell array to a MATLAB® function that does
not recognize cell arrays as inputs.

Pass the contents of a single cell by indexing with curly braces, {}.

This example creates a cell array that contains text and a 20-by-2 array of random numbers.

randCell = {'Random Data', rand(20,2)};


plot(randCell{1,2})
title(randCell{1,1})

Plot only the first column of data by indexing further into the content (multilevel indexing).

figure
plot(randCell{1,2}(:,1))
title('First Column of Data')

12-11
12 Cell Arrays

Combine numeric data from multiple cells using the cell2mat function.

This example creates a 5-by-2 cell array that stores temperature data for three cities, and plots the
temperatures for each city by date.

temperature(1,:) = {'01-Jan-2010', [45, 49, 0]};


temperature(2,:) = {'03-Apr-2010', [54, 68, 21]};
temperature(3,:) = {'20-Jun-2010', [72, 85, 53]};
temperature(4,:) = {'15-Sep-2010', [63, 81, 56]};
temperature(5,:) = {'31-Dec-2010', [38, 54, 18]};

allTemps = cell2mat(temperature(:,2));
dates = datenum(temperature(:,1), 'dd-mmm-yyyy');

plot(dates, allTemps)
datetick('x','mmm')

12-12
Pass Contents of Cell Arrays to Functions

Pass the contents of multiple cells as a comma-separated list to functions that accept
multiple inputs.

This example plots X against Y , and applies line styles from a 2-by-3 cell array C.

X = -pi:pi/10:pi;
Y = tan(sin(X)) - sin(tan(X));

C(:,1) = {'LineWidth'; 2};


C(:,2) = {'MarkerEdgeColor'; 'k'};
C(:,3) = {'MarkerFaceColor'; 'g'};

plot(X, Y, '--rs', C{:})

12-13
12 Cell Arrays

See Also

More About
• “Access Data in Cell Array” on page 12-5
• “Multilevel Indexing to Access Parts of Cells” on page 12-20
• “Comma-Separated Lists” on page 2-79

12-14
Preallocate Memory for Cell Array

Preallocate Memory for Cell Array


This example shows how to initialize and allocate memory for a cell array.

Cell arrays do not require completely contiguous memory. However, each cell requires contiguous
memory, as does the cell array header that MATLAB creates to describe the array. For very large
arrays, incrementally increasing the number of cells or the number of elements in a cell results in
Out of Memory errors.

Initialize a cell array by calling the cell function, or by assigning to the last element. For example,
these statements are equivalent:

C = cell(25,50);
C{25,50} = [];

MATLAB creates the header for a 25-by-50 cell array. However, MATLAB does not allocate any
memory for the contents of each cell.

See Also
cell

Related Examples
• “Reshaping and Rearranging Arrays”
• “How MATLAB Allocates Memory” on page 30-10

12-15
12 Cell Arrays

Cell vs. Structure Arrays


This example compares cell and structure arrays, and shows how to store data in each type of array.
Both cell and structure arrays allow you to store data of different types and sizes.

Structure Arrays

Structure arrays contain data in fields that you access by name.

For example, store patient records in a structure array.

patient(1).name = 'John Doe';


patient(1).billing = 127.00;
patient(1).test = [79, 75, 73; 180, 178, 177.5; 220, 210, 205];

patient(2).name = 'Ann Lane';


patient(2).billing = 28.50;
patient(2).test = [68, 70, 68; 118, 118, 119; 172, 170, 169];

patient

patient=1×2 struct array with fields:


name
billing
test

Create a bar graph of the test results for each patient.

numPatients = numel(patient);
for p = 1:numPatients
figure
bar(patient(p).test)
title(patient(p).name)
xlabel('Test')
ylabel('Result')
end

12-16
Cell vs. Structure Arrays

12-17
12 Cell Arrays

Cell Arrays

Cell arrays contain data in cells that you access by numeric indexing. Common applications of cell
arrays include storing separate pieces of text and storing heterogeneous data from spreadsheets.

For example, store temperature data for three cities over time in a cell array.
temperature(1,:) = {'2009-12-31', [45, 49, 0]};
temperature(2,:) = {'2010-04-03', [54, 68, 21]};
temperature(3,:) = {'2010-06-20', [72, 85, 53]};
temperature(4,:) = {'2010-09-15', [63, 81, 56]};
temperature(5,:) = {'2010-12-09', [38, 54, 18]};

temperature

temperature=5×2 cell array


{'2009-12-31'} {1x3 double}
{'2010-04-03'} {1x3 double}
{'2010-06-20'} {1x3 double}
{'2010-09-15'} {1x3 double}
{'2010-12-09'} {1x3 double}

Plot the temperatures for each city by date.


allTemps = cell2mat(temperature(:,2));
dates = datetime(temperature(:,1));

12-18
Cell vs. Structure Arrays

plot(dates,allTemps)
title('Temperature Trends for Different Locations')
xlabel('Date')
ylabel('Degrees (Fahrenheit)')

Other Container Arrays

Struct and cell arrays are the most commonly used containers for storing heterogeneous data. Tables
are convenient for storing heterogeneous column-oriented or tabular data. Alternatively, use map
containers, or create your own class.

See Also
cell | cell2mat | [Link] | datetime | plot | struct | table

Related Examples
• “Access Data in Cell Array” on page 12-5
• “Access Data in Structure Array” on page 11-5
• “Access Data in Tables” on page 9-34

More About
• “Advantages of Using Tables” on page 9-57

12-19
12 Cell Arrays

Multilevel Indexing to Access Parts of Cells


This example shows techniques for accessing data in arrays stored within cells of cell arrays.

Create a sample cell array.


myNum = [1, 2, 3];
myCell = {'one', 'two'};
myStruct.Field1 = ones(3);
myStruct.Field2 = 5*ones(5);

C = {myNum, 100*myNum;
myCell, myStruct}

C=2×2 cell array


{1x3 double} {1x3 double}
{1x2 cell } {1x1 struct}

Access the complete contents of a particular cell using curly braces, {}. For example, return a
numeric vector from the cell that contains it.
C{1,2}

ans = 1×3

100 200 300

Access part of the contents of a cell by appending indices, using syntax that matches the data type of
the contents.

Enclose numeric indices in smooth parentheses. For example, C{1,1} returns the 1-by-3 numeric
vector, [1 2 3]. Access the second element of that vector using smooth parentheses.
C{1,1}(1,2)

ans = 2

Enclose cell array indices in curly braces. For example, C{2,1} returns the cell array,
{'one','two'}. Access the contents of the second cell within that cell array using curly braces.
C{2,1}{1,2}

ans =
'two'

Refer to fields of a struct array with dot notation, and index into the array as described for numeric
and cell arrays. For example, C{2,2} returns a structure array, where Field2 contains a 5-by-5
numeric array of fives. Access the element in the fifth row and first column of that field using dot
notation and smooth parentheses.
C{2,2}.Field2(5,1)

ans = 5

You can nest any number of cell and structure arrays. For example, add nested cells and structures to
C.

12-20
Multilevel Indexing to Access Parts of Cells

C{2,1}{2,2} = {pi, eps};


C{2,2}.Field3 = struct('NestedField1', rand(3), ...
'NestedField2', magic(4), ...
'NestedField3', {{'text'; 'more text'}} );

Access parts of the new data using curly braces, smooth parentheses, or dot notation.

copy_pi = C{2,1}{2,2}{1,1}

copy_pi = 3.1416

part_magic = C{2,2}.Field3.NestedField2(1:2,1:2)

part_magic = 2×2

16 2
5 11

nested_cell = C{2,2}.Field3.NestedField3{2,1}

nested_cell =
'more text'

See Also

Related Examples
• “Access Data in Cell Array” on page 12-5

12-21
13

Function Handles

• “Create Function Handle” on page 13-2


• “Pass Function to Another Function” on page 13-5
• “Call Local Functions Using Function Handles” on page 13-6
• “Compare Function Handles” on page 13-8
13 Function Handles

Create Function Handle


In this section...
“What Is a Function Handle?” on page 13-2
“Creating Function Handles” on page 13-2
“Anonymous Functions” on page 13-3
“Arrays of Function Handles” on page 13-4
“Saving and Loading Function Handles” on page 13-4

You can create function handles to named and anonymous functions. You can store multiple function
handles in an array, and save and load them, as you would any other variable.

What Is a Function Handle?


A function handle is a MATLAB data type that stores an association to a function. Indirectly calling a
function enables you to invoke the function regardless of where you call it from. Typical uses of
function handles include:

• Passing a function to another function (often called function functions). For example, passing a
function to integration and optimization functions, such as integral and fzero.
• Specifying callback functions (for example, a callback that responds to a UI event or interacts with
data acquisition hardware).
• Constructing handles to functions defined inline instead of stored in a program file (anonymous
functions).
• Calling local functions from outside the main function.

You can see if a variable, h, is a function handle using isa(h,'function_handle').

Creating Function Handles


To create a handle for a function, precede the function name with an @ sign. For example, if you have
a function called myfunction, create a handle named f as follows:
f = @myfunction;

You call a function using a handle the same way you call the function directly. For example, suppose
that you have a function named computeSquare, defined as:
function y = computeSquare(x)
y = x.^2;
end

Create a handle and call the function to compute the square of four.
f = @computeSquare;
a = 4;
b = f(a)

b =

16

13-2
Create Function Handle

If the function does not require any inputs, then you can call the function with empty parentheses,
such as

h = @ones;
a = h()

a =

Without the parentheses, the assignment creates another function handle.

a = h

a =

@ones

Function handles are variables that you can pass to other functions. For example, calculate the
integral of x2 on the range [0,1].

q = integral(f,0,1);

Function handles store their absolute path, so when you have a valid handle, you can invoke the
function from any location. You do not have to specify the path to the function when creating the
handle, only the function name.

Keep the following in mind when creating handles to functions:

• Name length — Each part of the function name (including package and class names) must be less
than the number specified by namelengthmax. Otherwise, MATLAB truncates the latter part of
the name.
• Scope — The function must be in scope at the time you create the handle. Therefore, the function
must be on the MATLAB path or in the current folder. Or, for handles to local or nested functions,
the function must be in the current file.
• Precedence — When there are multiple functions with the same name, MATLAB uses the same
precedence rules to define function handles as it does to call functions. For more information, see
“Function Precedence Order” on page 20-35.
• Overloading — If the function you specify overloads a function in a class that is not a fundamental
MATLAB class, the function is not associated with the function handle at the time it is constructed.
Instead, MATLAB considers the input arguments and determines which implementation to call at
the time of evaluation.

Anonymous Functions
You can create handles to anonymous functions. An anonymous function is a one-line expression-
based MATLAB function that does not require a program file. Construct a handle to an anonymous
function by defining the body of the function, anonymous_function, and a comma-separated list of
input arguments to the anonymous function, arglist. The syntax is:

h = @(arglist)anonymous_function

For example, create a handle, sqr, to an anonymous function that computes the square of a number,
and call the anonymous function using its handle.

13-3
13 Function Handles

sqr = @(n) n.^2;


x = sqr(3)

x =

For more information, see “Anonymous Functions” on page 20-20.

Arrays of Function Handles


You can create an array of function handles by collecting them into a cell or structure array. For
example, use a cell array:

C = {@sin, @cos, @tan};


C{2}(pi)

ans =

-1

Or use a structure array:

S.a = @sin; S.b = @cos; S.c = @tan;


S.a(pi/2)

ans =

Saving and Loading Function Handles


You can save and load function handles in MATLAB, as you would any other variable. In other words,
use the save and load functions. If you save a function handle, MATLAB does not save the path
information. If you load a function handle, and the function file no longer exists on the path, the
handle is invalid. An invalid handle occurs if the file location or file name has changed since you
created the handle. If a handle is invalid, MATLAB might display a warning when you load the file.
When you invoke an invalid handle, MATLAB issues an error.

See Also
func2str | function_handle | functions | isa | str2func

Related Examples
• “Pass Function to Another Function” on page 13-5

More About
• “Anonymous Functions” on page 20-20

13-4
Pass Function to Another Function

Pass Function to Another Function


You can use function handles as input arguments to other functions, which are called function
functions . These functions evaluate mathematical expressions over a range of values. Typical
function functions include integral, quad2d, fzero, and fminbnd.

For example, to find the integral of the natural log from 0 through 5, pass a handle to the log
function to integral.

a = 0;
b = 5;
q1 = integral(@log,a,b)

q1 = 3.0472

Similarly, to find the integral of the sin function and the exp function, pass handles to those
functions to integral.

q2 = integral(@sin,a,b)

q2 = 0.7163

q3 = integral(@exp,a,b)

q3 = 147.4132

Also, you can pass a handle to an anonymous function to function functions. An anonymous function is
a one-line expression-based MATLAB® function that does not require a program file. For example,
evaluate the integral of x/(ex − 1) on the range [0,Inf]:

fun = @(x)x./(exp(x)-1);
q4 = integral(fun,0,Inf)

q4 = 1.6449

Functions that take a function as an input (called function functions) expect that the function
associated with the function handle has a certain number of input variables. For example, if you call
integral or fzero, the function associated with the function handle must have exactly one input
variable. If you call integral3, the function associated with the function handle must have three
input variables. For information on calling function functions with more variables, see
“Parameterizing Functions”.

See Also

Related Examples
• “Create Function Handle” on page 13-2
• “Parameterizing Functions”

More About
• “Anonymous Functions” on page 20-20

13-5
13 Function Handles

Call Local Functions Using Function Handles


This example shows how to create handles to local functions. If a function returns handles to local
functions, you can call the local functions outside of the main function. This approach allows you to
have multiple, callable functions in a single file.

Create the following function in a file, ellipseVals.m, in your working folder. The function returns
a struct with handles to the local functions.

% Copyright 2015 The MathWorks, Inc.

function fh = ellipseVals
[Link] = @computeFocus;
[Link] = @computeEccentricity;
[Link] = @computeArea;
end

function f = computeFocus(a,b)
f = sqrt(a^2-b^2);
end

function e = computeEccentricity(a,b)
f = computeFocus(a,b);
e = f/a;
end

function ae = computeArea(a,b)
ae = pi*a*b;
end

Invoke the function to get a struct of handles to the local functions.

h = ellipseVals

h =

struct with fields:

focus: @computeFocus
eccentricity: @computeEccentricity
area: @computeArea

Call a local function using its handle to compute the area of an ellipse.

[Link](3,1)

ans =

9.4248

13-6
Call Local Functions Using Function Handles

Alternatively, you can use the localfunctions function to create a cell array of function handles
from all local functions automatically. This approach is convenient if you expect to add, remove, or
modify names of the local functions.

See Also
localfunctions

Related Examples
• “Create Function Handle” on page 13-2

More About
• “Local Functions” on page 20-25

13-7
13 Function Handles

Compare Function Handles


Compare Handles Constructed from Named Function

MATLAB® considers function handles that you construct from the same named function to be equal.
The isequal function returns a value of true when comparing these types of handles.

fun1 = @sin;
fun2 = @sin;
isequal(fun1,fun2)

ans =

logical

If you save these handles to a MAT-file, and then load them back into the workspace, they are still
equal.

Compare Handles to Anonymous Functions

Unlike handles to named functions, function handles that represent the same anonymous function are
not equal. They are considered unequal because MATLAB cannot guarantee that the frozen values of
nonargument variables are the same. For example, in this case, A is a nonargument variable.

A = 5;
h1 = @(x)A * x.^2;
h2 = @(x)A * x.^2;
isequal(h1,h2)

ans =

logical

If you make a copy of an anonymous function handle, the copy and the original are equal.

h1 = @(x)A * x.^2;
h2 = h1;
isequal(h1,h2)

ans =

logical

13-8
Compare Function Handles

Compare Handles to Nested Functions

MATLAB considers function handles to the same nested function to be equal only if your code
constructs these handles on the same call to the function containing the nested function. This
function constructs two handles to the same nested function.

function [h1,h2] = test_eq(a,b,c)


h1 = @findZ;
h2 = @findZ;

function z = findZ
z = a.^3 + b.^2 + c';
end
end

Function handles constructed from the same nested function and on the same call to the parent
function are considered equal.

[h1,h2] = test_eq(4,19,-7);
isequal(h1,h2)

ans =

logical

Function handles constructed from different calls are not considered equal.

[q1,q2] = test_eq(4,19,-7);
isequal(h1,q1)

ans =

logical

See Also
isequal

Related Examples
• “Create Function Handle” on page 13-2

13-9
14

Map Containers

• “Overview of Map Data Structure” on page 14-2


• “Description of Map Class” on page 14-4
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
• “Read and Write Using Key Index” on page 14-9
• “Modify Keys and Values in Map” on page 14-13
• “Map to Different Value Types” on page 14-15
14 Map Containers

Overview of Map Data Structure


A Map is a type of fast key lookup data structure that offers a flexible means of indexing into its
individual elements. Unlike most array data structures in the MATLAB software that only allow access
to the elements by means of integer indices, the indices for a Map can be nearly any scalar numeric
value or a character vector.

Indices into the elements of a Map are called keys. These keys, along with the data values associated
with them, are stored within the Map. Each entry of a Map contains exactly one unique key and its
corresponding value. Indexing into the Map of rainfall statistics shown below with a character vector
representing the month of August yields the value internally associated with that month, 37.3.

Mean monthly rainfall statistics (mm)

Keys are not restricted to integers as they are with other arrays. Specifically, a key may be any of the
following types:

• 1-by-N character array


• Scalar real double or single
• Signed or unsigned scalar integer

The values stored in a Map can be of any type. This includes arrays of numeric values, structures,
cells, character arrays, objects, or other Maps.

Note A Map is most memory efficient when the data stored in it is a scalar number or a character
array.

See Also
[Link] | keys | values

14-2
Overview of Map Data Structure

Related Examples
• “Description of Map Class” on page 14-4
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8

14-3
14 Map Containers

Description of Map Class


A Map is actually an object, or instance, of a MATLAB class called Map. It is also a handle object and,
as such, it behaves like any other MATLAB handle object. This section gives a brief overview of the
Map class. For more details, see the [Link] reference page.

Properties of Map Class


All objects of the Map class have three properties. You cannot write directly to any of these
properties; you can change them only by means of the methods of the Map class.

Property Description Default


Count Unsigned 64-bit integer that represents the total number of key/ 0
value pairs contained in the Map object.
KeyType Character vector that indicates the type of all keys contained in the char
Map object. KeyType can be any of the following: double, single,
char, and signed or unsigned 32-bit or 64-bit integer. If you attempt
to add keys of an unsupported type, int8 for example, MATLAB
makes them double.
ValueType Character vector that indicates the type of values contained in the any
Map object. If the values in a Map are all scalar numbers of the
same type, ValueType is set to that type. If the values are all
character arrays, ValueType is 'char'. Otherwise, ValueType is
'any'.

To examine one of these properties, follow the name of the Map object with a dot and then the
property name. For example, to see what type of keys are used in Map mapObj, use

[Link]

A Map is a handle object. As such, if you make a copy of the object, MATLAB does not create a new
Map; it creates a new handle for the existing Map that you specify. If you alter the Map's contents in
reference to this new handle, MATLAB applies the changes you make to the original Map as well. You
can, however, delete the new handle without affecting the original Map.

Methods of Map Class


The Map class implements the following methods. Their use is explained in the later sections of this
documentation and also in the function reference pages.

Method Description
isKey Check if Map contains specified key
keys Names of all keys in Map
length Length of Map
remove Remove key and its value from Map
size Dimensions of Map
values Values contained in Map

14-4
Description of Map Class

See Also
[Link] | isKey | keys | length | remove | size | values

Related Examples
• “Overview of Map Data Structure” on page 14-2
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8

14-5
14 Map Containers

Create Map Object


A Map is an object of the Map class. It is defined within a MATLAB package called containers. As
with any class, you use its constructor function to create any new instances of it. You must include the
package name when calling the constructor:

newMap = [Link](optional_keys_and_values)

Construct Empty Map Object


When you call the Map constructor with no input arguments, MATLAB constructs an empty Map
object. When you do not end the command with a semicolon, MATLAB displays the following
information about the object you have constructed:

newMap = [Link]

newMap =

Map with properties:

Count: 0
KeyType: char
ValueType: any

The properties of an empty Map object are set to their default values:

• Count = 0
• KeyType = 'char'
• ValueType = 'any'

Once you construct the empty Map object, you can use the keys and values methods to populate it.
For a summary of MATLAB functions you can use with a Map object, see “Methods of Map Class” on
page 14-4

Construct Initialized Map Object


Most of the time, you will want to initialize the Map with at least some keys and values at the time
you construct it. You can enter one or more sets of keys and values using the syntax shown here. The
brace operators ({}) are not required if you enter only one key/value pair:

mapObj = [Link]({key1, key2, ...}, {val1, val2, ...});

For those keys and values that are character vectors, be sure that you specify them enclosed within
single quotation marks. For example, when constructing a Map that has character vectors as keys,
use

mapObj = [Link](...
{'keystr1', 'keystr2', ...}, {val1, val2, ...});

As an example of constructing an initialized Map object, create a new Map for the following key/value
pairs taken from the monthly rainfall map shown earlier in this section.

14-6
Create Map Object

k = {'Jan', 'Feb', 'Mar', 'Apr', 'May', 'Jun', ...


'Jul', 'Aug', 'Sep', 'Oct', 'Nov', 'Dec', 'Annual'};

v = {327.2, 368.2, 197.6, 178.4, 100.0, 69.9, ...


32.3, 37.3, 19.0, 37.0, 73.2, 110.9, 1551.0};

rainfallMap = [Link](k, v)

rainfallMap =

Map with properties:

Count: 13
KeyType: char
ValueType: double

The Count property is now set to the number of key/value pairs in the Map, 13, the KeyType is
char, and the ValueType is double.

Combine Map Objects


You can combine Map objects vertically using concatenation. However, the result is not a vector of
Maps, but rather a single Map object containing all key/value pairs of the contributing Maps.
Horizontal vectors of Maps are not allowed. See “Build Map with Concatenation” on page 14-10,
below.

See Also
[Link] | keys | values

Related Examples
• “Overview of Map Data Structure” on page 14-2
• “Description of Map Class” on page 14-4
• “Examine Contents of Map” on page 14-8

14-7
14 Map Containers

Examine Contents of Map


Each entry in a Map consists of two parts: a unique key and its corresponding value. To find all the
keys in a Map, use the keys method. To find all of the values, use the values method.

Create a new Map called ticketMap that maps airline ticket numbers to the holders of those tickets.
Construct the Map with four key/value pairs:

ticketMap = [Link](...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});

Use the keys method to display all keys in the Map. MATLAB lists keys of type char in alphabetical
order, and keys of any numeric type in numerical order:

keys(ticketMap)

ans =

'2R175' 'A479GY' 'B7398' 'NZ1452'

Next, display the values that are associated with those keys in the Map. The order of the values is
determined by the order of the keys associated with them.

This table shows the keys listed in alphabetical order:

keys values
2R175 James Enright
A479GY Sarah Latham
B7398 Carl Haynes
NZ1452 Bradley Reid

The values method uses the same ordering of values:

values(ticketMap)

ans =

'James Enright' 'Sarah Latham' 'Carl Haynes' 'Bradley Reid'

See Also
[Link] | isKey | keys | length | remove | size | values

Related Examples
• “Create Map Object” on page 14-6
• “Read and Write Using Key Index” on page 14-9
• “Modify Keys and Values in Map” on page 14-13
• “Map to Different Value Types” on page 14-15

14-8
Read and Write Using Key Index

Read and Write Using Key Index


When reading from the Map, use the same keys that you have defined and associated with particular
values. Writing new entries to the Map requires that you supply the values to store with a key for
each one.

Note For a large Map, the keys and value methods use a lot of memory as their outputs are cell
arrays.

Read From Map


After you have constructed and populated your Map, you can begin to use it to store and retrieve
data. You use a Map in the same manner that you would an array, except that you are not restricted to
using integer indices. The general syntax for looking up a value (valueN) for a given key (keyN) is
shown here. If the key is a character vector, enclose it in single quotation marks:

valueN = mapObj(keyN);

Start with the Map ticketMap :

ticketMap = [Link](...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});

You can find any single value by indexing into the Map with the appropriate key:

passenger = ticketMap('2R175')

passenger =

James Enright

Find the person who holds ticket A479GY:

sprintf(' Would passenger %s please come to the desk?\n', ...


ticketMap('A479GY'))

ans =

Would passenger Sarah Latham please come to the desk?

To access the values of multiple keys, use the values method, specifying the keys in a cell array:

values(ticketMap, {'2R175', 'B7398'})

ans =

'James Enright' 'Carl Haynes'

Map containers support scalar indexing only. You cannot use the colon operator to access a range of
keys as you can with other MATLAB classes. For example, the following statements throw an error:

ticketMap('2R175':'B7398')
ticketMap(:)

14-9
14 Map Containers

Add Key/Value Pairs


Unlike other array types, each entry in a Map consists of two items: the value and its key. When you
write a new value to a Map, you must supply its key as well. This key must be consistent in type with
any other keys in the Map.

Use the following syntax to insert additional elements into a Map:


existingMapObj(newKeyName) = newValue;

Start with the Map ticketMap :


ticketMap = [Link](...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});

Add two more entries to the ticketMap Map. Verify that ticketMap now has six key/value pairs:
ticketMap('947F4') = 'Susan Spera';
ticketMap('417R93') = 'Patricia Hughes';

[Link]

ans =

List all of the keys and values in ticketMap:


keys(ticketMap), values(ticketMap)

ans =

'2R175' '417R93' '947F4' 'A479GY' 'B7398' 'NZ1452'

ans =

'James Enright' 'Patricia Hughes' 'Susan Spera' 'Sarah Latham' 'Carl Haynes' 'Bradley Reid'

Build Map with Concatenation


You can add key/value pairs to a Map in groups using concatenation. The concatenation of Map
objects is different from other classes. Instead of building a vector of Map objects, MATLAB returns a
single Map containing the key/value pairs from each of the contributing Map objects.

Rules for the concatenation of Map objects are:

• Only vertical vectors of Map objects are allowed. You cannot create an m-by-n array or a
horizontal vector of Map objects. For this reason, vertcat is supported for Map objects, but not
horzcat.
• All keys in each Map being concatenated must be of the same class.
• You can combine Maps with different numbers of key/value pairs. The result is a single Map object
containing key/value pairs from each of the contributing Map objects:
tMap1 = [Link]({'2R175', 'B7398', 'A479GY'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham'});

14-10
Read and Write Using Key Index

tMap2 = [Link]({'417R93', 'NZ1452', '947F4'}, ...


{'Patricia Hughes', 'Bradley Reid', 'Susan Spera'});

% Concatenate the two maps:


ticketMap = [tMap1; tMap2];

The result of this concatenation is the same 6-element Map that was constructed in the previous
section:
[Link]

ans =

keys(ticketMap), values(ticketMap)

ans =

'2R175' '417R93' '947F4' 'A479GY' 'B7398' 'NZ1452'

ans =

'James Enright' 'Patricia Hughes' 'Susan Spera' 'Sarah Latham' 'Carl Haynes' 'Bradley Reid'

• Concatenation does not include duplicate keys or their values in the resulting Map object.

In the following example, both objects m1 and m2 use a key of 8. In Map m1, 8 is a key to value C;
in m2, it is a key to value X:

m1 = [Link]({1, 5, 8}, {'A', 'B', 'C'});


m2 = [Link]({8, 9, 6}, {'X', 'Y', 'Z'});

Combine m1 and m2 to form a new Map object, m:

m = [m1; m2];

The resulting Map object m has only five key/value pairs. The value C was dropped from the
concatenation because its key was not unique:

keys(m), values(m)

ans =

[1] [5] [6] [8] [9]

ans =

'A' 'B' 'Z' 'X' 'Y'

See Also
[Link] | isKey | keys | values

Related Examples
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
• “Modify Keys and Values in Map” on page 14-13

14-11
14 Map Containers

• “Map to Different Value Types” on page 14-15

14-12
Modify Keys and Values in Map

Modify Keys and Values in Map

Note Keep in mind that if you have more than one handle to a Map, modifying the handle also makes
changes to the original Map. See “Modify Copy of Map” on page 14-14, below.

Remove Keys and Values from Map


Use the remove method to delete any entries from a Map. When calling this method, specify the Map
object name and the key name to remove. MATLAB deletes the key and its associated value from the
Map.

The syntax for the remove method is

remove(mapName, 'keyname');

Start with the Map ticketMap :

ticketMap = [Link](...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});

Remove one entry (the specified key and its value) from the Map object:

remove(ticketMap, 'NZ1452');
values(ticketMap)

ans =

'James Enright' 'Sarah Latham' 'Carl Haynes'

Modify Values
You can modify any value in a Map simply by overwriting the current value. The passenger holding
ticket A479GY is identified as Sarah Latham:

ticketMap('A479GY')

ans =

Sarah Latham

Change the passenger's first name to Anna Latham by overwriting the original value for the A479GY
key:

ticketMap('A479GY') = 'Anna Latham';

Verify the change:

ticketMap('A479GY')

ans =

Anna Latham

14-13
14 Map Containers

Modify Keys
To modify an existing key while keeping the value the same, first remove both the key and its value
from the Map. Then create a new entry, this time with the corrected key name.

Modify the ticket number belonging to passenger James Enright:

remove(ticketMap, '2R175');
ticketMap('2S185') = 'James Enright';

k = keys(ticketMap); v = values(ticketMap);
str1 = ' ''%s'' has been assigned a new\n';
str2 = ' ticket number: %s.\n';

fprintf(str1, v{1})
fprintf(str2, k{1})

'James Enright' has been assigned a new


ticket number: 2S185.

Modify Copy of Map


Because ticketMap is a handle object, you need to be careful when making copies of the Map. Keep
in mind that by copying a Map object, you are really just creating another handle to the same object.
Any changes you make to this handle are also applied to the original Map.

Make a copy of the ticketMap Map. Write to this copy, and notice that the change is applied to the
original Map object itself:

copiedMap = ticketMap;

copiedMap('AZ12345') = 'unidentified person';


ticketMap('AZ12345')

ans =

unidentified person

Clean up:

remove(ticketMap, 'AZ12345');
clear copiedMap;

See Also
[Link] | isKey | keys | length | remove | size | values

Related Examples
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
• “Read and Write Using Key Index” on page 14-9
• “Map to Different Value Types” on page 14-15

14-14
Map to Different Value Types

Map to Different Value Types


It is fairly common to store other classes, such as structures or cell arrays, in a Map structure.
However, Maps are most memory efficient when the data stored in them belongs to one of the basic
MATLAB types such as double, char, integers, and logicals.

Map to Structure Array


The following example maps airline seat numbers to structures that contain ticket numbers and
destinations. Start with the Map ticketMap, which maps ticket numbers to passengers:

ticketMap = [Link](...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});

Then create the following structure array, containing ticket numbers and destinations:

[Link] = '2S185'; [Link] = 'Barbados';


[Link] = '06-May-2008'; [Link] = 'La Guardia';
[Link] = '947F4'; [Link] = 'St. John';
[Link] = '14-Apr-2008'; [Link] = 'Oakland';
[Link] = 'A479GY'; [Link] = 'St. Lucia';
[Link] = '28-Mar-2008'; [Link] = 'JFK';
[Link] = 'B7398'; [Link] = 'Granada';
[Link] = '30-Apr-2008'; [Link] = 'JFK';
[Link] = 'NZ1452'; [Link] = 'Aruba';
[Link] = '01-May-2008'; [Link] = 'Denver';

Map five seats to these structures:

seatingMap = [Link]( ...


{'23F', '15C', '15B', '09C', '12D'}, ...
{s5, s1, s3, s4, s2});

Using this Map object, find information about the passenger who has reserved seat 09C:

seatingMap('09C')

ans =

ticketNum: 'B7398'
destination: 'Granada'
reserved: '30-Apr-2008'
origin: 'JFK'

Using ticketMap and seatingMap together, you can find the name of the person who has reserved
seat 15B:

ticket = seatingMap('15B').ticketNum;
passenger = ticketMap(ticket)

passenger =

Sarah Latham

14-15
14 Map Containers

Map to Cell Array


As with structures, you can also map to a cell array in a Map object. Continuing with the airline
example of the previous sections, some of the passengers on the flight have “frequent flyer” accounts
with the airline. Map the names of these passengers to records of the number of miles they have used
and the number of miles they still have available:

accountMap = [Link]( ...


{'Susan Spera','Carl Haynes','Anna Latham'}, ...
{{247.5, 56.1}, {0, 1342.9}, {24.6, 314.7}});

Use the Map to retrieve account information on the passengers:

name = 'Carl Haynes';


acct = accountMap(name);

fprintf('%s has used %.1f miles on his/her account,\n', ...


name, acct{1})
fprintf(' and has %.1f miles remaining.\n', acct{2})

Carl Haynes has used 0.0 miles on his/her account,


and has 1342.9 miles remaining.

See Also
cell | [Link] | isKey | keys | struct | values

Related Examples
• “Create Map Object” on page 14-6
• “Create Structure Array” on page 11-2
• “Create Cell Array” on page 12-3
• “Examine Contents of Map” on page 14-8
• “Read and Write Using Key Index” on page 14-9
• “Modify Keys and Values in Map” on page 14-13

14-16
15

Combining Unlike Classes

• “Valid Combinations of Unlike Classes” on page 15-2


• “Combining Unlike Integer Types” on page 15-3
• “Combining Integer and Noninteger Data” on page 15-5
• “Combining Cell Arrays with Non-Cell Arrays” on page 15-6
• “Empty Matrices” on page 15-7
• “Concatenation Examples” on page 15-8
15 Combining Unlike Classes

Valid Combinations of Unlike Classes


Matrices and arrays can be composed of elements of almost any MATLAB data type as long as all
elements in the matrix are of the same type. If you do include elements of unlike classes when
constructing a matrix, MATLAB converts some elements so that all elements of the resulting matrix
are of the same type.

Data type conversion is done with respect to a preset precedence of classes. The following table
shows the five classes you can concatenate with an unlike type without generating an error (that is,
with the exception of character and logical).

TYPE character integer single double logical


character character character character character invalid
integer character integer integer integer integer
single character integer single single single
double character integer single double double
logical invalid integer single double logical

For example, concatenating a double and single matrix always yields a matrix of type single.
MATLAB converts the double element to single to accomplish this.

See Also

More About
• “Combining Unlike Integer Types” on page 15-3
• “Combining Integer and Noninteger Data” on page 15-5
• “Combining Cell Arrays with Non-Cell Arrays” on page 15-6
• “Concatenation Examples” on page 15-8
• “Concatenating Objects of Different Classes”

15-2
Combining Unlike Integer Types

Combining Unlike Integer Types


In this section...
“Overview” on page 15-3
“Example of Combining Unlike Integer Sizes” on page 15-3
“Example of Combining Signed with Unsigned” on page 15-4

Overview
If you combine different integer types in a matrix (e.g., signed with unsigned, or 8-bit integers with
16-bit integers), MATLAB returns a matrix in which all elements are of one common type. MATLAB
sets all elements of the resulting matrix to the data type of the leftmost element in the input matrix.
For example, the result of the following concatenation is a vector of three 16-bit signed integers:

A = [int16(450) uint8(250) int32(1000000)]

A =

1×3 int16 row vector

450 250 32767

Example of Combining Unlike Integer Sizes


Concatenate the following two numbers once, and then switch their order. The return value depends
on the order in which the integers are concatenated. The leftmost type determines the data type for
all elements in the vector:

A = [int16(5000) int8(50)]

A =

1×2 int16 row vector

5000 50

B = [int8(50) int16(5000)]

B =

1×2 int8 row vector

50 127

The first operation returns a vector of 16-bit integers. The second returns a vector of 8-bit integers.
The element int16(5000) is set to 127, the maximum value for an 8-bit signed integer.

The same rules apply to vertical concatenation:

C = [int8(50); int16(5000)]

C =

2×1 int8 column vector

15-3
15 Combining Unlike Classes

50
127

Note You can find the maximum or minimum values for any MATLAB integer type using the intmax
and intmin functions. For floating-point types, use realmax and realmin.

Example of Combining Signed with Unsigned


Now do the same exercise with signed and unsigned integers. Again, the leftmost element determines
the data type for all elements in the resulting matrix:

A = [int8(-100) uint8(100)]

A =

1×2 int8 row vector

-100 100

B = [uint8(100) int8(-100)]

B =

1×2 uint8 row vector

100 0

The element int8(-100) is set to zero because it is no longer signed.

MATLAB evaluates each element prior to concatenating them into a combined array. In other words,
the following statement evaluates to an 8-bit signed integer (equal to 50) and an 8-bit unsigned
integer (unsigned -50 is set to zero) before the two elements are combined. Following the
concatenation, the second element retains its zero value but takes on the unsigned int8 type:

A = [int8(50), uint8(-50)]

A =

1×2 int8 row vector

50 0

See Also

More About
• “Integers” on page 4-2
• “Integer Arithmetic” on page 4-19

15-4
Combining Integer and Noninteger Data

Combining Integer and Noninteger Data


If you combine integers with double, single, or logical classes, all elements of the resulting
matrix are given the data type of the left-most integer. For example, all elements of the following
vector are set to int32:

A = [true pi int32(1000000) single(17.32) uint8(250)]

15-5
15 Combining Unlike Classes

Combining Cell Arrays with Non-Cell Arrays


Combining a number of arrays in which one or more is a cell array returns a new cell array. Each of
the original arrays occupies a cell in the new array:

A = [100, {uint8(200), 300}, 'MATLAB'];


whos A

Name Size Bytes Class Attributes

A 1x4 477 cell

Each element of the combined array maintains its original class:

fprintf('Classes: %s %s %s %s\n',...
class(A{1}),class(A{2}),class(A{3}),class(A{4}))

Classes: double uint8 double char

15-6
Empty Matrices

Empty Matrices
If you construct a matrix using empty matrix elements, the empty matrices are ignored in the
resulting matrix:

A = [5.36; 7.01; []; 9.44]


A =
5.3600
7.0100
9.4400

15-7
15 Combining Unlike Classes

Concatenation Examples
In this section...
“Combining Single and Double Types” on page 15-8
“Combining Integer and Double Types” on page 15-8
“Combining Character and Double Types” on page 15-8
“Combining Logical and Double Types” on page 15-8

Combining Single and Double Types


Combining single values with double values yields a single matrix. Note that 5.73*10^300 is
too big to be stored as a single, thus the conversion from double to single sets it to infinity. (The
class function used in this example returns the data type for the input value).
x = [single(4.5) single(-2.8) pi 5.73*10^300]
x =
4.5000 -2.8000 3.1416 Inf

class(x) % Display the data type of x


ans =
single

Combining Integer and Double Types


Combining integer values with double values yields an integer matrix. Note that the fractional part
of pi is rounded to the nearest integer. (The int8 function used in this example converts its numeric
argument to an 8-bit integer).
x = [int8(21) int8(-22) int8(23) pi 45/6]
x =
21 -22 23 3 8
class(x)
ans =
int8

Combining Character and Double Types


Combining character values with double values yields a character matrix. MATLAB converts the
double elements in this example to their character equivalents:
x = ['A' 'B' 'C' 68 69 70]
x =
ABCDEF

class(x)
ans =
char

Combining Logical and Double Types


Combining logical values with double values yields a double matrix. MATLAB converts the
logical true and false elements in this example to double:

15-8
Concatenation Examples

x = [true false false pi sqrt(7)]


x =
1.0000 0 0 3.1416 2.6458

class(x)
ans =
double

15-9
16

Using Objects
16 Using Objects

Object Behavior

In this section...
“Two Copy Behaviors” on page 16-2
“Handle Object Copy” on page 16-2
“Value Object Copy Behavior” on page 16-2
“Handle Object Copy Behavior” on page 16-3
“Testing for Handle or Value Class” on page 16-5

Two Copy Behaviors


There are two fundamental kinds of MATLAB objects — handles and values.

Value objects behave like MATLAB fundamental types with respect to copy operations. Copies are
independent values. Operations that you perform on one object do not affect copies of that object.

Handle objects are referenced by their handle variable. Copies of the handle variable refer to the
same object. Operations that you perform on a handle object are visible from all handle variables that
reference that object.

Handle Object Copy


If you are defining classes and want to support handle object copy, see “Implement Copy for Handle
Classes”.

Value Object Copy Behavior


MATLAB numeric variables are value objects. For example, when you copy a to the variable b, both
variables are independent of each other. Changing the value of a does not change the value of b:

a = 8;
b = a;

Now reassign a. b is unchanged:

a = 6;
b

b =
8

Clearing a does not affect b:

clear a
b

b =
8

16-2
Object Behavior

Value Object Properties

The copy behavior of values stored as properties in value objects is the same as numeric variables.
For example, suppose vobj1 is a value object with property a:

vobj1.a = 8;

If you copy vobj1 to vobj2, and then change the value of vobj1 property a, the value of the copied
object's property, vobj2.a, is unaffected:

vobj2 =vobj1;
vobj1.a = 5;
vobj2.a

ans =
8

Handle Object Copy Behavior


Here is a handle class called HdClass that defines a property called Data.

classdef HdClass < handle


properties
Data
end
methods
function obj = HdClass(val)
if nargin > 0
[Link] = val;
end
end
end
end

Create an object of this class:

hobj1 = HdClass(8)

Because this statement is not terminated with a semicolon, MATLAB displays information about the
object:

hobj1 =

HdClass with properties:

Data: 8

The variable hobj1 is a handle that references the object created. Copying hobj1 to hobj2 results in
another handle referring to the same object:

hobj2 = hobj1

hobj2 =

HdClass with properties:

Data: 8

16-3
16 Using Objects

Because handles reference the object, copying a handle copies the handle to a new variable name,
but the handle still refers to the same object. For example, given that hobj1 is a handle object with
property Data:

[Link]

ans =

Change the value of hobj1's Data property and the value of the copied object's Data property also
changes:

[Link] = 5;
[Link]

ans =

Because hobj2 and hobj1 are handles to the same object, changing the copy, hobj2, also changes
the data you access through handle hobj1:

[Link] = 17;
[Link]

ans =

17

Reassigning Handle Variables

Reassigning a handle variable produces the same result as reassigning any MATLAB variable. When
you create an object and assign it to hobj1:

hobj1 = HdClass(3.14);

hobj1 references the new object, not the same object referenced previously (and still referenced by
hobj2).

Clearing Handle Variables

When you clear a handle from the workspace, MATLAB removes the variable, but does not remove
the object referenced by the other handle. However, if there are no references to an object, MATLAB
destroys the object.

Given hobj1 and hobj2, which both reference the same object, you can clear either handle without
affecting the object:

[Link] = 2^8;
clear hobj1
hobj2

hobj2 =

HdClass with properties:

Data: 256

16-4
Object Behavior

If you clear both hobj1 and hobj2, then there are no references to the object. MATLAB destroys the
object and frees the memory used by that object.

Deleting Handle Objects

To remove an object referenced by any number of handles, use delete. Given hobj1 and hobj2,
which both refer to the same object, delete either handle. MATLAB deletes the object:
hobj1 = HdClass(8);
hobj2 = hobj1;
delete(hobj1)
hobj2

hobj2 =

handle to deleted HdClass

Use clear to remove the variable from the workspace.

Modifying Objects

When you pass an object to a function, MATLAB passes a copy of the object into the function
workspace. If the function modifies the object, MATLAB modifies only the copy of the object that is in
the function workspace. The differences in copy behavior between handle and value classes are
important in such cases:

• Value object — The function must return the modified copy of the object. To modify the object in
the caller’s workspace, assign the function output to a variable of the same name
• Handle object — The copy in the function workspace refers to the same object. Therefore, the
function does not have to return the modified copy.

Testing for Handle or Value Class


To determine if an object is a handle object, use the isa function. If obj is an object of some class,
this statement determines if obj is a handle:
isa(obj,'handle')

For example, the [Link] class creates a handle object:


hobj = [Link]({'Red Sox','Yankees'},{'Boston','New York'});
isa(hobj,'handle')

ans =

hobj is also a [Link] object:


isa(hobj,'[Link]')

ans =

Querying the class of hobj shows that it is a [Link] object:


class(hobj)

16-5
16 Using Objects

ans =

[Link]

The class function returns the specific class of an object.

See Also

Related Examples
• “Implement Copy for Handle Classes”

16-6
17

Defining Your Own Classes

All MATLAB data types are implemented as object-oriented classes. You can add data types of your
own to your MATLAB environment by creating additional classes. These user-defined classes define
the structure of your new data type, and the functions, or methods, that you write for each class
define the behavior for that data type.

These methods can also define the way various MATLAB operators, including arithmetic operations,
subscript referencing, and concatenation, apply to the new data types. For example, a class called
polynomial might redefine the addition operator (+) so that it correctly performs the operation of
addition on polynomials.

With MATLAB classes you can

• Create methods that overload existing MATLAB functionality


• Restrict the operations that are allowed on an object of a class
• Enforce common behavior among related classes by inheriting from the same parent class
• Significantly increase the reuse of your code

For more information, see “Role of Classes in MATLAB”.


Scripts and Functions

3
18

Scripts

• “Create Scripts” on page 18-2


• “Add Comments to Programs” on page 18-3
• “Code Sections” on page 18-5
• “Scripts vs. Functions” on page 18-12
• “Add Functions to Scripts” on page 18-14
18 Scripts

Create Scripts
Scripts are the simplest kind of program file because they have no input or output arguments. They
are useful for automating series of MATLAB commands, such as computations that you have to
perform repeatedly from the command line or series of commands you have to reference.

You can create a new script in the following ways:

• Highlight commands from the Command History, right-click, and select Create Script.

Click the New Script button on the Home tab.
• Use the edit function. For example, edit new_file_name creates (if the file does not exist) and
opens the file new_file_name. If new_file_name is unspecified, MATLAB opens a new file
called Untitled.

After you create a script, you can add code to the script and save it. For example, you can save this
code that generates random numbers from 0 through 100 as a script called numGenerator.m.

columns = 10000;
rows = 1;
bins = columns/100;

rng(now);
list = 100*rand(rows,columns);
histogram(list,bins)

Save your script and run the code using either of these methods:

• Type the script name on the command line and press Enter. For example, to run the
numGenerator.m script, type numGenerator.

Click the Run button on the Editor tab

You also can run the code from a second program file. To do this, add a line of code with the script
name to the second program file. For example, to run the numGenerator.m script from a second
program file, add the line numGenerator; to the file. MATLAB runs the code in numGenerator.m
when you run the second file.

When execution of the script completes, the variables remain in the MATLAB workspace. In the
numGenerator.m example, the variables columns, rows, bins, and list remain in the workspace.
To see a list of variables, type whos at the command prompt. Scripts share the base workspace with
your interactive MATLAB session and with other scripts.

See Also

More About
• “Code Sections” on page 18-5
• “Scripts vs. Functions” on page 18-12
• “Base and Function Workspaces” on page 20-9
• “Create Live Scripts in the Live Editor” on page 19-6

18-2
Add Comments to Programs

Add Comments to Programs


When you write code, it is a good practice to add comments that describe the code. Comments allow
others to understand your code and can refresh your memory when you return to it later. During
program development and testing, you also can use comments to comment out any code that does not
need to run.

In the Live Editor, you can insert lines of text before and after code to describe a process or code.
Text lines provide additional flexibility such as standard formatting options, and the insertion of
images, hyperlinks, and equations. For more information, see “Create Live Scripts in the Live Editor”
on page 19-6.

Note When you have a MATLAB code file (.m) containing text that has characters in a different
encoding than that of your platform, when you save or publish your file, MATLAB displays those
characters as garbled text. Live scripts and functions (.mlx) support storing and displaying
characters across all locales.

To add comments to MATLAB code, use the percent (%) symbol. Comment lines can appear anywhere
in a program file, and you can append comments to the end of a line of code.

For example:
% Add up all the vector elements.
y = sum(x) % Use the sum function.

To comment out multiple lines of code, use the block comment operators, %{ and %}. The %{ and %}
operators must appear alone on the lines that immediately precede and follow the block of help text.
Do not include any other text on these lines.

For example:
a = magic(3);
%{
sum(a)
diag(a)
sum(diag(a))
%}
sum(diag(fliplr(a)))

To comment out a selection, select the lines of code, go to the Editor or Live Editor tab, and press
the button. You also can type Ctrl+R. To uncomment the selected lines code, press the button
or type Ctrl+T.

To comment out part of a statement that spans multiple lines, use an ellipsis (...) instead of a
percent sign. For example:
header = ['Last Name, ', ...
'First Name, ', ...
... 'Middle Initial, ', ...
'Title']

The Editor and Live Editor include tools and context menu items to help you add, remove, or change
the format of comments for MATLAB, Java, and C/C++ code. For example, suppose that you have this
lengthy text into a commented line.

18-3
18 Scripts

% This is a program that has a comment that is a little more than 75 columns wide.
disp('Hello, world')

With the cursor on the line, go to Editor or Live Editor tab, and press the button. The comment
wraps to the next line:
% This is a program that has a comment that is a little more than 75
% columns wide.
disp('Hello, world')

By default, as you type comments in the Editor and Live Editor, the text wraps when it reaches a
column width of 75. To change the column where the comment text wraps or to disable automatic
comment wrapping, go to the Home tab and in the Environment section, click Preferences.
Select MATLAB > Editor/Debugger > Language, and adjust the Comment formatting
preferences. To adjust Comment formatting preferences in MATLAB Online, select Editor/
Debugger > MATLAB Language.

The Editor and Live Editor do not wrap comments with:

• Code section titles (comments that begin with %%)


• Long contiguous text, such as URLs
• Bulleted list items (text that begins with * or #) onto the preceding line

See Also

Related Examples
• “Add Help for Your Program” on page 20-5
• “Create Scripts” on page 18-2
• “Create Live Scripts in the Live Editor” on page 19-6
• “Editor/Debugger Preferences”

18-4
Code Sections

Code Sections
In this section...
“Divide Your File into Code Sections” on page 18-5
“Evaluate Code Sections” on page 18-5
“Navigate Among Code Sections in a File” on page 18-6
“Example of Evaluating Code Sections” on page 18-6
“Change the Appearance of Code Sections” on page 18-9
“Use Code Sections with Control Statements and Functions” on page 18-9

Divide Your File into Code Sections


MATLAB files often consist of many commands. You typically focus efforts on a single part of your
program at a time, working with the code in chunks. Similarly, when explaining your files to others,
often you describe your program in chunks. To facilitate these processes, use code sections, also
known as code cells or cell mode. A code section contains contiguous lines of code that you want to
evaluate as a group in a MATLAB script, beginning with two comment characters (%%).

To define code section boundaries explicitly, insert section breaks using these methods:


On the Editor tab, in the Edit section, in the Insert button group, click .
• Enter two percent signs (%%) at the start of the line where you want to begin the new code section.

The text on the same line as %% is called the section title. Including section titles is optional, however,
it improves the readability of the file and appears as a heading if you publish your code.

Evaluate Code Sections


As you develop a MATLAB file, you can use the Editor section features to evaluate the file section-by-
section. This method helps you to experiment with and fine-tune your program. You can navigate
among sections, and evaluate each section individually. To evaluate a section, it must contain all the
values it requires, or the values must exist in the MATLAB workspace.

The section evaluation features run the section code currently highlighted in yellow. MATLAB does
not automatically save your file when evaluating individual code sections. The file does not have to be
on your search path.

This table provides instructions on evaluating code sections.

Operation Instructions
Run the code in the current • Place the cursor in the code section.
section. •
On the Editor tab, in the Run section, click Run Section.
Run the code in the current • Place the cursor in the code section.
section, and then move to the •
next section. On the Editor tab, in the Run section, click Run and
Advance.

18-5
18 Scripts

Operation Instructions
Run all the code in the file. • Type the saved script name in the Command Window.

On the Editor tab, in the Run section, click Run.

Increment Values in Code Sections

You can increment numbers within a section, rerunning that section after every change. This helps
you fine-tune and experiment with your code.

To increment or decrement a number in a section:

1 Highlight or place your cursor next to the number.


2 Right-click to open the context menu.
3 Select Increment Value and Run Section. A small dialog box appears.

4
Input appropriate values in the / text box or / text box.
5
Click the , , , or button to add to, subtract from, multiply, or divide the selected
number in your section.

MATLAB runs the section after every click.

Note MATLAB software does not automatically save changes you make to the numbers in your script.

Navigate Among Code Sections in a File


You can navigate among sections in a file without evaluating the code within those sections. This
facilitates jumping quickly from section to section within a file. You might do this, for example, to find
specific code in a large file.

Operation Instructions
Move to the next section. •
On the Editor tab, in the Run section, click Advance.
Move to the previous section. • Press Ctrl + Up arrow.
Move to a specific section. •
On the Editor tab, in the Navigate section, use the Go To to
move the cursor to a selected section.

Example of Evaluating Code Sections


This example defines two code sections in a file called sine_wave.m and then increments a
parameter to adjust the created plot. To open this file in your Editor, run the following command, and
then save the file to a local folder:

18-6
Code Sections

edit(fullfile(matlabroot,'help','techdoc','matlab_env',...
'examples','sine_wave.m'))

After the file is open in your Editor:

1 Insert a section break and the following title on the first line of the file.

%% Calculate and Plot Sine Wave


2 Insert a blank line and a second section break after plot(x,y). Add a section title, Modify
Plot Properties, so that the entire file contains this code:

%% Calculate and Plot Sine Wave


% Define the range for x.
% Calculate and plot y = sin(x).
x = 0:1:6*pi;
y = sin(x);
plot(x,y)

%% Modify Plot Properties


title('Sine Wave')
xlabel('x')
ylabel('sin(x)')
fig = gcf;
[Link] = 'none';
3 Save the file.
4 Place your cursor in the section titled Calculate and Plot Sine Wave. On the Editor tab, in

the Run section, click Run Section.

A figure displaying a course plot of sin(x) appears.

5 Smooth the sine plot.

1 Highlight 1 in the statement: x = 0:1:6*pi; .


2 Right-click and select Increment Value and Run Section. A small dialog box appears.

18-7
18 Scripts

3
Type 2 in the / text box.
4
Click the button several times.

The sine plot becomes smoother after each subsequent click.

5 Close the Figure and save the file.


6 Run the entire sine_wave.m file. A smooth sine plot with titles appears in a new Figure.

18-8
Code Sections

Change the Appearance of Code Sections


You can change how code sections appear within the MATLAB Editor. MATLAB highlights code
sections in yellow, by default, and divides them with horizontal lines. When the cursor is positioned in
any line within a section, the Editor highlights the entire section.

To change how code sections appear:

1
On the Home tab, in the Environment section, click Preferences.

The Preference dialog box appears.


2 In the left pane, select MATLAB > Colors > Programming Tools.
3 Under Section display options, select the appearance of your code sections.

You can choose whether to highlight the sections, the color of the highlighting, and whether
dividing lines appear between code sections.

Use Code Sections with Control Statements and Functions


Unexpected results can appear when using code sections within control statements and functions
because MATLAB automatically inserts section breaks that do not appear in the Editor unless you
insert section breaks explicitly. This is especially true when nested code is involved. Nested code
occurs wherever you place a control statement or function within the scope of another control
statement or function.

MATLAB automatically defines section boundaries in a code block, according to this criteria:

• MATLAB inserts a section break at the top and bottom of a file, creating a code section that
encompasses the entire file. However, the Editor does not highlight the resulting section, which
encloses the entire file, unless you add one or more explicit code sections to the file.
• If you define a section break within a control flow statement (such as an if or while statement),
MATLAB automatically inserts section breaks at the lines containing the start and end of the
statement.
• If you define a section break within a function, MATLAB inserts section breaks at the function
declaration and at the function end statement. If you do not end the function with an end
statement, MATLAB behaves as if the end of the function occurs immediately before the start of
the next function.

If an automatic break occurs on the same line as a break you insert, they collapse into one section
break.

Nested Code Section Breaks

The following code illustrates the concept of nested code sections:

t = 0:.1:pi*4;
y = sin(t);

18-9
18 Scripts

for k = 3:2:9
%%
y = y + sin(k*t)/k;
if ~mod(k,3)
%%
display(sprintf('When k = %.1f',k));
plot(t,y)
end
end

If you copy and paste this code into a MATLAB Editor, you see that the two section breaks create
three nested levels:

• At the outermost level of nesting, one section spans the entire file.

MATLAB only defines section in a code block if you specify section breaks at the same level within
the code block. Therefore, MATLAB considers the cursor to be within the section that
encompasses the entire file.
• At the second level of nesting, a section exists within the for loop.

• At the third-level of nesting, one section exists within the if statement.

18-10
Code Sections

See Also

More About
• “Create Scripts” on page 18-2
• “Create Live Scripts in the Live Editor” on page 19-6
• “Scripts vs. Functions” on page 18-12

18-11
18 Scripts

Scripts vs. Functions


This topic discusses the differences between scripts and functions, and shows how to convert a script
to a function.

Both scripts and functions allow you to reuse sequences of commands by storing them in program
files. Scripts are the simplest type of program, since they store commands exactly as you would type
them at the command line. However, functions are more flexible and more easily extensible.

Create a script in a file named triarea.m that computes the area of a triangle:

b = 5;
h = 3;
a = 0.5*(b.*h)

After you save the file, you can call the script from the command line:

triarea

a =
7.5000

To calculate the area of another triangle using the same script, you could update the values of b and
h in the script and rerun it. Each time you run it, the script stores the result in a variable named a
that is in the base workspace.

However, instead of manually updating the script each time, you can make your program more
flexible by converting it to a function. Replace the statements that assign values to b and h with a
function declaration statement. The declaration includes the function keyword, the names of input
and output arguments, and the name of the function.

function a = triarea(b,h)
a = 0.5*(b.*h);
end

After you save the file, you can call the function with different base and height values from the
command line without modifying the script:

a1 = triarea(1,5)
a2 = triarea(2,10)
a3 = triarea(3,6)

a1 =
2.5000
a2 =
10
a3 =
9

Functions have their own workspace, separate from the base workspace. Therefore, none of the calls
to the function triarea overwrite the value of a in the base workspace. Instead, the function assigns
the results to variables a1, a2, and a3.

18-12
Scripts vs. Functions

See Also

More About
• “Create Scripts” on page 18-2
• “Create Functions in Files” on page 20-2
• “Add Functions to Scripts” on page 18-14
• “Base and Function Workspaces” on page 20-9

18-13
18 Scripts

Add Functions to Scripts


Starting in R2016b, MATLAB scripts, including live scripts, can contain code to define functions.
These functions are called local functions. Local functions are useful if you want to reuse code within
a script. By adding local functions, you can avoid creating and managing separate function files. They
are also useful for experimenting with functions, which can be added, modified, and deleted easily as
needed.

Create a Script with Local Functions


To create a script or live script with local functions, go to the Home tab and select New > Script or
New > Live Script. Then, add code to the script. Add all local functions at end of the file, after the
script code. Include at least one line of script code before the local functions. Each local function
must begin with its own function definition statement and end with the end keyword. The functions
can appear in any order.

For example, create a script called mystats.m.


edit mystats

In the file, include two local functions, mymean and mymedian. The script mystats declares an array,
determines the length of the array, and then uses the local functions mymean and mymedian to
calculate the average and median of the array.
x = 1:10;
n = length(x);
avg = mymean(x,n);
med = mymedian(x,n);

function a = mymean(v,n)
% MYMEAN Local function that calculates mean of array.

a = sum(v)/n;
end

function m = mymedian(v,n)
% MYMEDIAN Local function that calculates median of array.

w = sort(v);
if rem(n,2) == 1
m = w((n + 1)/2);
else
m = (w(n/2) + w(n/2 + 1))/2;
end
end

When you add local functions to a live script, MATLAB automatically adds a section break before the
first local function definition and removes all section breaks after it. This is because live scripts do
not support individual sections within local functions.

Run Scripts with Local Functions


To run a script or live script that includes local functions, in the Editor or Live Editor tab, click the

Run button. You also can type the saved script name in the Command Window.

18-14
Add Functions to Scripts

To run an individual section, place the cursor inside the section and use the Run Section button
(requires R2017b or later for .m files). In .mlx files, you can run sections only when they are before
the local function definitions.

Restrictions for Local Functions and Variables


Local functions are only visible within the file where they are defined. They are not visible to
functions in other files, and cannot be called from the Command Window.

Local functions in the current file have precedence over functions in other files. That is, when you call
a function within a script, MATLAB checks whether the function is a local function before looking for
the function in other locations. This allows you to create an alternate version of a particular function
while retaining the original in another file.

Scripts create and access variables in the base workspace. Local functions, like all other functions,
have their own workspaces that are separate from the base workspace. Local functions cannot access
variables in the workspace of other functions or in the base workspace, unless you pass them as
arguments.

Access Help for Local Functions


Although you cannot call a local function from the command line or from functions in other files, you
can access its help using the help command. Specify the names of both the script and the local
function, separating them with a > character.

For example:

help mystats>mymean

mymean Local function that calculates mean of array.

See Also

More About
• “Create Functions in Files” on page 20-2
• “Function Precedence Order” on page 20-35
• “Base and Function Workspaces” on page 20-9

18-15
19

Live Scripts and Functions


19 Live Scripts and Functions

What Is a Live Script or Function?


MATLAB live scripts and live functions are interactive documents that combine MATLAB code with
formatted text, equations, and images in a single environment called the Live Editor. In addition, live
scripts store and display output alongside the code that creates it.

Use live scripts and functions to:

Visually explore and analyze problems

• Write, execute, and test code in a single interactive environment.


• Run blocks of code individually or as a whole file, and view the results and graphics with the code
that produced them.

Share richly formatted, executable narratives

• Add titles, headings, and formatted text to describe a process and include equations, images, and
hyperlinks as supporting material.
• Save your narratives as richly formatted, executable documents and share them with colleagues
or the MATLAB community, or convert them to HTML, PDF, Microsoft Word, or LaTeX documents
for publication.

19-2
What Is a Live Script or Function?

Create interactive lectures for teaching

• Combine code and results with formatted text and mathematical equations.
• Create step-by-step lectures and evaluate them incrementally to illustrate a topic.
• Modify code on the fly to answer questions or explore related topics.
• Share lectures with students as interactive documents or in hard copy format, and distribute
partially completed files as assignments.

Differences with Plain Code Scripts and Functions


Live scripts and live functions differ from plain code scripts and functions in several ways. This table
summarizes the main differences.

19-3
19 Live Scripts and Functions

Live Scripts and Functions Plain Code Scripts and Functions


File Format Live Code file format. For more information, Plain Text file format
see “Live Code File Format (.mlx)” on page
19-65
File .mlx .m
Extension
Output With code in the Live Editor (live scripts only) In Command Window
Display
Text Add and view formatted text in the Live Use publishing markup to add
Formatting Editor formatted text, publish to view
Visual
Representati
on

Requirements
• MATLAB R2016a — MATLAB supports live scripts in versions R2016a and above, and live
functions in versions R2018a and above.
• Operating System — Starting in R2019b, MATLAB supports the Live Editor in all operating
systems supported by MATLAB. For more information, see System Requirements.

For MATLAB versions R2016a through R2019a, the Live Editor is not supported in several
operating systems supported by MATLAB.

Unsupported operating systems include:

• Red Hat Enterprise Linux 6.


• Red Hat Enterprise Linux 7.
• SUSE Linux Enterprise Desktop versions 13.0 and earlier.
• Debian 7.6 and earlier.

In addition, some operating systems require additional configuration to run the Live Editor in
MATLAB versions R2016a through R2019a. If you are unable to run the Live Editor on your
system, Contact Technical Support for information on how to configure your system.

19-4
What Is a Live Script or Function?

Unsupported Features
Some MATLAB features are unsupported in the Live Editor:

• Classes — Classes are not supported in the Live Editor. Create classes as plain code files (.m)
instead. You then can use the classes in your live scripts or functions.
• MATLAB preferences — The Live Editor ignores some MATLAB preferences, including custom
keyboard shortcuts and Emacs-style keyboard shortcuts.

See Also

Related Examples
• “Create Live Scripts in the Live Editor” on page 19-6
• “Live Code File Format (.mlx)” on page 19-65
• MATLAB Live Script Gallery

19-5
19 Live Scripts and Functions

Create Live Scripts in the Live Editor


Live scripts are program files that contain your code, output, and formatted text together in a single
interactive environment called the Live Editor. In live scripts, you can write your code and view the
generated output and graphics along with the code that produced it. Add formatted text, images,
hyperlinks, and equations to create an interactive narrative that you can share with others.

Create Live Script

To create a live script in the Live Editor, go to the Home tab and click New Live Script . You also
can use the edit function in the Command Window. For example, type edit [Link] to open or
create the file [Link]. To ensure that a live script is created, specify a .mlx extension. If an
extension is not specified, MATLAB defaults to a file with .m extension, which only supports plain
code.

Open Existing Script as Live Script

If you have an existing script, you can open it as a live script in the Live Editor. Opening a script as a
live script creates a copy of the file and leaves the original file untouched. MATLAB converts
publishing markup from the original script to formatted content in the new live script.

To open an existing script (.m) as a live script (.mlx) from the Editor, right-click the document tab,
and select Open scriptName as Live Script from the context menu. Alternatively, go to the Editor
tab, click Save , and select Save As. Then, set the Save as type: to MATLAB Live Code Files
(*.mlx) and click Save.

Note You must use one of the described conversion methods to convert your script to a live script.
Simply renaming the script with a .mlx extension does not work and can corrupt the file.

Add Code
After you create a live script, you can add code and run it. For example, add this code that plots a
vector of random data and draws a horizontal line on the plot at the mean.

19-6
Create Live Scripts in the Live Editor

n = 50;
r = rand(n,1);
plot(r)

m = mean(r);
hold on
plot([0,n],[m,m])
hold off
title('Mean of Random Uniform Data')

By default, MATLAB autocompletes block endings, parentheses, and quotes when entering code in
the Live Editor. For example, type if and then press Enter. MATLAB automatically adds the end
statement.

MATLAB also autocompletes comments, character vectors, strings, and parentheses when split across

two lines. To escape out of an autocompletion, press Ctrl+Z or the Undo button.
Autocompletions are enabled by default. To disable them, see “Editor/Debugger Autocoding
Preferences”.

When adding or editing code, you can select and edit a rectangular area of code (also known as
column selection or block edit). This is useful if you want to copy or delete several columns of data (as
opposed to rows), or if you want to edit multiple lines at one time. To select a rectangular area, press
the Alt key while making a selection.

For example, select the second column of data in A.

Type 0 to set all the selected values to 0.

19-7
19 Live Scripts and Functions

Run Code
To run the code, click the vertical striped bar to the left of the code. Alternatively, go to the Live
Editor tab and click Run. While your program is running, a status indicator appears at the top
left of the Editor window. A gray blinking bar to the left of a line of code indicates the line that
MATLAB is evaluating. To navigate to the line MATLAB is evaluating, click the status indicator.

If an error occurs while MATLAB is running your program or if MATLAB detects a significant issue in
your code, the status indicator becomes an error icon . To navigate to the error, click the icon. An
error icon to the right of the line of code indicates the error. The corresponding error message is
displayed as an output.

You do not need to save your live script to run it. When you do save your live script, MATLAB

automatically saves it with a .mlx extension. For example, go the Live Editor tab, click Save,
and enter the name plotRand. MATLAB saves the live script as [Link].

Display Output
By default, MATLAB displays output to the right of the code. Each output is displayed with the line
that creates it, like in the Command Window.

You can change the size of the output display panel by dragging left or right on the resizer bar
between the code and output.

To clear an output, right-click the output or the code line that created it, and select Clear Output. To
clear all output, right-click anywhere in the script and select Clear All Output. Alternatively, go to
the View tab and in the Output section, click the Clear all Output button.

When scrolling, MATLAB aligns the output to the code that generates it. To disable the alignment of
output to code, right-click the output section and select Disable Synchronous Scrolling.

19-8
Create Live Scripts in the Live Editor

To move the output in line with the code, click the output inline button to the right of the live

script. You also can go to the View tab and in the View section, click the Output Inline button.

To only display output, controls, and formatted text and hide the code, click the hide code button.

To show the code again, click the output inline button or the output on right button.

To modify figures in the output, use the tools in the upper-right corner of the figure axes or in the
Figure toolstrip. You can use the tools to explore the data in a figure and add formatting and
annotations. For more information, see “Modify Figures in Live Scripts” on page 19-22.

To open individual outputs, such as variables and figures, in a separate window, click the button in
the upper right corner of the output. Variables open in the Variables editor, and figures open in a new
figure window. Changes made to variables or figures outside of a live script do not apply to the output
displayed in the live script.

Format Text
You can add formatted text, hyperlinks, images, and equations to your live scripts to create a
presentable document to share with others. For example, add a title and some introductory text to
[Link]:

1
Place your cursor at the top of the live script and, in the Live Editor tab, select Text. A new
text line appears above the code.
2
Click and select Title.
3 Add the text Plot Random Data.

19-9
19 Live Scripts and Functions

4
With your cursor still in the line, click the button to center the text.
5 Press Enter to move to the next line.
6 Type the text This script plots a vector of random data and draws a
horizontal line on the plot at the mean.

For more information including a list of all available formatting options, see “Format Files in the Live
Editor” on page 19-31.

To adjust the displayed font size in the Live Editor, use the Ctrl + Mouse Scroll keyboard shortcut.
The change in the displayed font size is not honored when exporting the live script to PDF, Microsoft
Word, HTML, or LaTeX.

Save Live Scripts as Plain Code


To save a live script as a plain code file (.m):

1 On the Live Editor tab, in the File section, select Save > Save As....
2 In the dialog box that appears, select MATLAB Code files (UTF-8) (*.m) as the Save as
type.
3 Click Save.

When saving, MATLAB converts all formatted content to publish markup.

19-10
Create Live Scripts in the Live Editor

See Also

More About
• “Format Files in the Live Editor” on page 19-31
• “Run Sections in Live Scripts” on page 19-12
• “Modify Figures in Live Scripts” on page 19-22
• MATLAB Live Script Gallery

19-11
19 Live Scripts and Functions

Run Sections in Live Scripts

Divide Your File Into Sections


Live scripts often contain many commands and lines of text. You typically focus efforts on a single
part of your program at a time, working with the code, and related text in pieces. For easier
document management and navigation, divide your file into sections. Code, output, and related text
can all appear together, in a single section.

To insert a section break into your live script, go to the Live Editor tab and in the Section section,
click the Section Break button. The new section is highlighted in blue, indicating that it is selected.
A vertical striped bar to the left of the section indicates that the section is stale. A stale section is a
section that has not yet been run, or that has been modified since it was last run.

This image shows a new blank section in a live script.

To delete a section break, click the beginning of the line directly after the section break and press
Backspace. You also can click the end of the line directly before the section break and press Delete.

Evaluate Sections
Run your live script either by evaluating each section individually or by running all the code at once.
To evaluate a section individually, it must contain all the values it requires, or the values must exist in
the MATLAB workspace. Section evaluation runs the currently selected section, highlighted in blue. If
there is only one section in your program file, the section is not highlighted, as it is always selected.

This table describes different ways to run your code.

Operation Instructions
Run the code in the selected Click the blue bar to the left of the section.
section.

OR

On the Live Editor tab, in the Section section, click Run


Section.
Run the code in the selected
section, and then move to the On the Live Editor tab, in the Section section, select Run and
next section. Advance.

19-12
Run Sections in Live Scripts

Operation Instructions
Run the code in the selected
section, and then run all the On the Live Editor tab, in the Section section, select Run to
code after the selected End.
section.
Run all the code in the file.
On the Live Editor tab, in the Run section, click Run.

See Also

Related Examples
• “Modify Figures in Live Scripts” on page 19-22
• “Debug Code in the Live Editor” on page 19-14

19-13
19 Live Scripts and Functions

Debug Code in the Live Editor


To diagnose problems in your live scripts or functions, debug your code in the Live Editor. There are
several ways to debug in the Live Editor:

• Show output by removing semicolons.


• Run to a specific line of code and pause using the Run to Here button.

Step into functions and scripts while paused by using the Step In button.
• Add breakpoints to your file to enable pausing at specific lines when you run.

Show Output
A simple way to determine where a problem occurs in your live script or function is to show output.
To show the output for a line, remove the semi-colon from the end of that line. The Live Editor
displays each output with the line of code that creates it, making it easy to determine where a
problem occurs.

For example, suppose that you have a script called [Link] that plots a vector of random data
and draws a horizontal line on the plot at the mean.

To display the output of the rand function at line 2, remove the semi-colon at the end of the line. To
display line numbers in the Live Editor if they are not visible, go to the View tab and press the
Line Numbers button. MATLAB displays the value of r.

19-14
Debug Code in the Live Editor

Debug Using Run to Here


Showing output is useful if you want to display the state of a single variable. To explore the state of
all variables in the workspace, run your live script and then pause before running the specified line of
code.

To run to a specified line of code and then pause, click the run to here button to the left of the line.
If the selected line cannot be reached, MATLAB continues running until the end of the file is reached
or a breakpoint is encountered. The run to here button is only available in live functions when
debugging.

For example, click the button to the left of line 2 in [Link]. MATLAB runs [Link]
starting at line 1 and pauses before running line 2.

19-15
19 Live Scripts and Functions

When MATLAB pauses, the Run button in the Live Editor tab changes to a Continue button.
The Live Editor indicates the line at which MATLAB is paused by highlighting the line in green. The
highlighted line does not run until after MATLAB resumes running.

Tip It is a good practice to avoid modifying a file while MATLAB is paused. Changes that are made
while MATLAB is paused do not run until after MATLAB finished running the code and the code is
rerun.

To continue running the code, click the Continue button. MATLAB continues running the file until
it reaches the end of the file or a breakpoint. You also can click the button to the left of the line of
code you want to continue running to.

To continue running the code line-by-line, on the Live Editor tab, click Step. MATLAB executes
the current line at which it is paused and the pauses at the next line.

You also can run up to the line with the cursor by going to the Live Editor tab, selecting Step
and then selecting Run to Cursor.

19-16
Debug Code in the Live Editor

View Variable Value While Debugging


To view the value of a variable while MATLAB is paused, hover the mouse pointer over the variable.
The current value of the variable appears in a data tip. The data tip stays in view until you move the
pointer. To disable data tips, go to the View tab and press the Datatips button.

You also can view the value of a variable by typing the variable name in the Command Window. For
example, to see the value of the variable n, type n and press Enter. The Command Window displays
the variable name and its value. To view all the variables in the current workspace, use the
Workspace browser.

Pause a Running File

To pause a program while it is running, go to the Live Editor tab and click the Pause button.
MATLAB pauses at the next executable line, and the Pause button changes to a Continue
button. To continue running, press the Continue button.

Pausing is useful if you want to check on the progress of a long running program to ensure that it is
running as expected.

Note Clicking the pause button can cause MATLAB to pause in a file outside your own program file.
Pressing the Continue button resumes running without changing the results of the file.

End Debugging Session


After you identify a problem, end the debugging session by going to the Live Editor tab and clicking

Stop. To avoid confusion, make sure to end your debugging session every time you are done
debugging. The Live Editor automatically ends the debugging session when you save.

19-17
19 Live Scripts and Functions

Step Into Functions


While debugging, you can step into called files, pausing at points where you want to examine values.

To step into a file, click the button directly to the left of the function you want to step into. You
also can use the F11 key to step into a function. The Live Editor only displays the button if the line
contains a call to another function.

By default, the button only shows for user-defined functions and scripts. To show the button for
MathWorks functions as well, on the Home tab, in the Environment section, click Preferences.
Then, select MATLAB > Editor/Debugger, and in the Debugging in the Live Editor section, clear
Only show Step in button for user-defined functions.

After stepping in, click the button at the top of the file to run the rest of the called function, leave
the called function, and then pause. You also can use Shift+F11 to step out of a function.

You also can step in and out of functions by going to the Live Editor tab, selecting Step and then

selecting Step In or Step Out. These buttons do not honor the Only show Step in button
for user-defined functions preference and always step in and out of both user-defined and
MathWorks functions.

Examine Variables in the Workspace

When you step into a called function or file, the Live Editor displays the list of the functions MATLAB
executed before pausing at the current line. The list is shown at the top of the file and displays the
functions in order, starting on the left with the first called script or function, and ending on the right
with the current script or function in which MATLAB is paused. This list is called the function call
stack.

For each function in the function call stack, there is a corresponding workspace. Workspaces contain
variables that you create within MATLAB or import from data files or other programs. Variables that
you assign through the Command Window or create using scripts belong to the base workspace.
Variables that you create in a function belong to their own function workspace.

To examine a variable during debugging, you must first select its workspace. The selected function in
the function call stack indicates the current workspace. To select or change the workspace, click the
function in the function call stack. MATLAB opens the function in the Live Editor and changes the
current workspace to the workspace of the function.

Once the workspace is selected, you can view the values of the variables in it using the Workspace
browser or as a data tip in the Live Editor.

Add Breakpoints and Run


If there are lines of code in your file that you want to pause at every time you run, add breakpoints at
those lines. To add a breakpoint in the Live Editor, click the gray area to the left on an executable line
where you want to set the breakpoint. For example, click the area next to line 3 in this code to add a
breakpoint at that line. You also can use the F12 key to set a breakpoint.

19-18
Debug Code in the Live Editor

When you run the file, MATLAB pauses at the line of code indicated by the breakpoint.

Clear Breakpoints

When you close and reopen a file, breakpoints are saved.

To clear a breakpoint, right-click the breakpoint and select Clear Breakpoint from the context
menu. You also can use the F12 key to clear the breakpoint.

To clear all breakpoints in the file, select Clear All in File. To clear all breakpoints in all files, select
Clear All.

Breakpoints clear automatically when you end a MATLAB session.

Disable Breakpoints

You can disable selected breakpoints so that your program temporarily ignores them and runs
uninterrupted. For example, you might disable a breakpoint after you identify and correct a problem.

To disable a breakpoint, right-click it and select Disable Breakpoint from the context menu. The
breakpoint becomes gray to indicate that it is disabled.

19-19
19 Live Scripts and Functions

To reenable a breakpoint, right-click it and select Enable Breakpoint. To enable or disable all
breakpoints in the file, select Enable All Breakpoints in File or Disable All Breakpoints in File.
These options are only available if there is at least one breakpoint to enable or disable.

Add Conditional Breakpoints

You can add a condition to a breakpoint that tells MATLAB when to pause at the specified line. To add
a condition, right-click the breakpoint and select Set/Modify Condition. When the Editor dialog
box opens, enter a condition and click OK. A condition is any valid MATLAB expression that returns a
logical scalar value. MATLAB evaluates the condition before running the line.

For example, suppose that you only want to pause in [Link] if the random generated data
contains a 0.

Add a breakpoint with the following condition at line 3:


any(r == 0)

A yellow conditional breakpoint appears at that line.

19-20
Debug Code in the Live Editor

When you run the file, MATLAB pauses at the specified line when the condition is met. For example,
in the plotRand example, MATLAB pauses before running line 3 if any of the values in r are equal to
0.

Add Breakpoints in Anonymous Functions

You can add multiple breakpoints in a line of MATLAB code that contains anonymous functions. You
can set a breakpoint for the line itself and for each anonymous function in the line.

To add a breakpoint, click the gray area to the left on an executable line to add a breakpoint for the
line. MATLAB adds a breakpoint for the line, and a disabled breakpoint for each anonymous function
in the line. To enable a breakpoint for an anonymous function, right-click it and select Enable
Breakpoint.

To view information about all the breakpoints on a line, hover your pointer on the breakpoint icon. A
tooltip appears with available information. For example, in this code, line 5 contains two anonymous
functions, with a breakpoint at each one.

When you set a breakpoint in an anonymous function, MATLAB pauses when the anonymous function
is called. The line highlighted in green is where the code defines the anonymous function. The line
highlighted in gray is where the code calls the anonymous functions. For example, in this code,
MATLAB pauses the program at a breakpoint set for the anonymous function g, defined at line 5, and
called at line 6.

See Also

More About
• “Run Sections in Live Scripts” on page 19-12

19-21
19 Live Scripts and Functions

Modify Figures in Live Scripts


You can modify figures interactively in the Live Editor. Use the provided tools to explore data and add
formatting, annotations, or additional axes to your figures. Then, update your code to reflect changes
using the generated code.

Explore Data
You can pan, zoom, and rotate a figure in your script using the tools that appear in the upper-right
corner of the figure axes when you hover over the figure.

• — Add data tips to display data values.


• — Rotate the plot (3-D plots only).
• — Pan the plot.
• , — Zoom in and out of the plot.

— Undo all pan, zoom, and rotate actions and restore the original view of the plot.

To undo or redo an action, click or at the upper right corner of the toolstrip.

Note


When you open a saved live script, appears next to each output figure, indicating that the
interactive tools are not available yet. To make these tools available, run the live script.
• The interactive tools are not available for invisible axes.

Suppose that you want to explore the health information for 100 different patients. Create a live
script called [Link] and add code that loads the data and adds a scatter plot that shows the
height versus weight of two groups of patients, female and male. Run the code by going to the Live
Editor tab and clicking Run.

load patients

figure
Gender = categorical(Gender);
scatter(Height(Gender=='Female'),Weight(Gender=='Female'));
hold on
scatter(Height(Gender=='Male'),Weight(Gender=='Male'));
hold off

19-22
Modify Figures in Live Scripts

Explore the points where the patient height is 64 inches. Select the button and click one of the data
points where height is 64. MATLAB zooms into the figure.

19-23
19 Live Scripts and Functions

Update Code with Figure Changes


When modifying output figures in live scripts, changes to the figure are not automatically added to
the script. With each interaction, MATLAB generates the code needed to reproduce the interactions
and displays this code either underneath or to the right of the figure. Use the Update Code button to
add the generated code to your script. This ensures that the interactions are reproduced the next
time you run the live script.

For example, in the live script [Link], after zooming in on patients with a height of 64, click
the Update Code button. MATLAB adds the generated code after the line containing the code for
creating the plot.
xlim([61.31 69.31])
ylim([116.7 183.3])

If MATLAB is unable to determine where to place the generated code, the Update Code button is
disabled. This occurs, for example, if you modify the code without running the script again. In this
case, use the Copy button to copy the generated code into the clipboard. You then can paste the code
into your script at the appropriate location.

Add Formatting and Annotations


In addition to exploring the data, you can format and annotate your figures interactively by adding
titles, labels, legends, grid lines, arrows, and lines. To add an item, first select the desired figure.
Then, go to the Figure tab and, in the Annotations section, select one of the available options. Use
the down arrow on the right side of the section to display all available annotations. To add a
formatting or annotation option to your favorites, click the star at the top right of the desired

annotation button. To undo or redo a formatting or annotation action, click or at the upper
right corner of the toolstrip.

Annotation options include:


Title — Add a title to the axes. To modify an existing title, click the existing title and enter
the modified text.

X-Label, Y-Label — Add a label to the axes. To modify an existing label, click the
existing label and enter the modified text.

Legend — Add a legend to the figure. To modify the existing legend descriptions, click the
existing descriptions and enter the modified text. Select Remove Legend from the Annotations
section to remove the legend from the axes.

Colorbar — Add a color bar legend to the figure. Select Remove Colorbar from the
Annotations section to remove the color bar legend from the axes.

Grid, X-Grid, Y-Grid — Add grid lines to the figure. Select Remove Grid from
the Annotations section to remove all the grid lines from the axes.

Line, Arrow, Text Arrow, Double Arrow — Add a line or arrow
annotation to the figure. Draw the arrow from tail to head. To move an existing annotation, click

19-24
Modify Figures in Live Scripts

the annotation to select it and drag it to the desired location. Press the Delete key to delete the
selected annotation.

Note Adding formatting and annotations using the Figure tab is not supported for invisible axes.

For example, suppose that you want to add formatting and annotations to the figure in
[Link].

1
Add a title — In the Annotations section, select Title. A blue rectangle appears
prompting you to enter text. Type the text Weight vs. Height and press Enter.
2
Add X and Y Labels — In the Annotations section, select X-Label. A blue rectangle

appears prompting you to enter text. Type the text Height and press Enter. Select Y-
Label. A blue rectangle appears prompting you to enter text. Type the text Weight and press
Enter.
3
Add a legend — In the Annotations section, select Legend. A legend appears at the top
right corner of the axes. Click the data1 description in the legend and replace the text with
Female. Click the data2 description in the legend and replace the text with Male. Press Enter.
4
Add grid lines — In the Annotations section, select Grid. Grid lines appear in the axes.
5
Add an arrow annotation — In the Annotations section, select Text Arrow. Drawing
the arrow from tail to head, position the arrow on the scatter plot pointing to the lightest patient.
Enter the text Lightest Patient and press Enter
6 Update the code — In the selected figure, click the Update Code button. The live script now
contains the code needed to reproduce the figure changes.
grid on
legend({'Female','Male'})
title('Weight vs Height')
xlabel('Height')
ylabel('Weight')
annotation('textarrow',[0.455 0.3979],[0.3393 0.13],'String','Lightest Patient');

19-25
19 Live Scripts and Functions

Add and Modify Multiple Subplots


You can combine multiple plots by creating subplots in a figure. To add multiple subplots to your
figure, use the Subplot button to divide the figure into a grid of subplots. First, select the desired
figure. Then, go to the Figure tab and choose a subplot layout using the Subplot button. You only
can add additional subplots to a figure if the figure contains one subplot. If a figure contains multiple
subplots, the Subplot button is disabled.

For example, suppose that you want to compare the blood pressure of smoking and non-smoking
patients. Create a live script called patients_smoking.mlx and add code that loads the health
information for 100 different patients.

load patients

Run the code by going to the Live Editor tab and clicking Run.

Add a scatter plot that shows the systolic blood pressure of patients that smoke versus the systolic
blood pressure of patients that do not smoke. Run the code.

figure
scatter(Age(Smoker==1),Systolic(Smoker==1));
hold on

19-26
Modify Figures in Live Scripts

scatter(Age(Smoker==0),Systolic(Smoker==0));
hold off

In the Figure tab, select Subplot and choose the layout for two horizontal graphs.

In the newly created figure, click the Update Code button. The live script now contains the code
needed to reproduce the two subplots.

subplot(2,1,1,gca)
subplot(2,1,2)

Add a scatter plot that shows the diastolic blood pressure of patients that smoke versus the diastolic
blood pressure of patients that do not smoke. Run the code.

scatter(Age(Smoker==1),Diastolic(Smoker==1));
hold on
scatter(Age(Smoker==0),Diastolic(Smoker==0));
hold off

Add formatting:

1
Add titles to each subplot — In the Annotations section, select Title. A blue rectangle
appears in each subplot prompting you to enter text. Type the text Systolic Blood Pressure
of Smokers vs Non-Smokers in the first subplot and Diastolic Blood Pressure of
Smokers vs Non-Smokers in the second subplot and press Enter.

19-27
19 Live Scripts and Functions

2
Add grid lines to each subplot — In the Annotations section, select Grid. An Add Grid
button appears on each subplot. Click the Add Grid button on each subplot. Grid lines appear in
both subplots.

19-28
Modify Figures in Live Scripts

3 Update the code — In the selected figure, click the Update Code button. The live script now
contains the code needed to reproduce the figure changes.

subplot(2,1,1)
grid on
title('Systolic Blood Pressure of Smokers vs Non-Smokers')
subplot(2,1,2)
grid on
title('Diastolic Blood Pressure of Smokers vs Non-Smokers')

19-29
19 Live Scripts and Functions

Save and Print Figure


At any point during figure modification, you can choose to save or print the figure for future use.

1
Click the button in the upper-right corner of the output. This opens the figure in a separate
figure window.
2 a To save the figure — Select File > Save As. For more information on saving figures, see
“Save Plot as Image or Vector Graphics File” or “Save Figure to Reopen in MATLAB Later”.
b To print the figure — Select File > Print. For more information on printing figures, see
“Print Figure from File Menu”.

Note Any changes made to the figure in the separate figure window are not reflected in the live
script. Similarly, any changes made to the figure in the live script are not reflected in the open figure
window.

See Also

Related Examples
• “Format Files in the Live Editor” on page 19-31
• “Run Sections in Live Scripts” on page 19-12

19-30
Format Files in the Live Editor

Format Files in the Live Editor


You can add formatted text, hyperlinks, images, and equations to your live scripts and functions to
create a presentable document to share with others.

To insert a new item, go to the Insert tab and select from the available options:

Option Description Additional Details


Insert a blank You can insert a code line before, after, or between text lines.
Code line of code.
Insert a section You can insert a section break to divide your live script or function
Section break. into manageable sections to evaluate individually. A section can
Break consist of code, text, and output. For more information, see “Run
Sections in Live Scripts” on page 19-12.
Insert a blank A text line can contain formatted text, hyperlinks, images, or
Text line of text. equations. You can insert a text line before, after, or between code
lines.
Insert a table of The table of contents contains a list of all the titles and headings in
Table of
contents. the document. Only the title of the table of contents is editable.
Contents
You can insert a table of contents only in text lines. If you insert a
table of contents into a code line, MATLAB places it directly above
the current code section.
Insert a A code example is sample code that appears as indented and
Code
formatted code monospaced text.
Example
example.
• Select Plain to insert sample code as unhighlighted text.
• Select MATLAB to insert sample code as text highlighted
according to MATLAB syntax.

19-31
19 Live Scripts and Functions

Option Description Additional Details


Insert an image. You can insert images only in text lines. If you insert an image into
Image
a code line, MATLAB places the image in a new text line directly
under the selected code line.

To change the alternate text, alignment, and size of an image after


inserting it, right-click the image and select Edit Image... from
the context menu.

• Alt Text — Add text to the edit field to specify alternative text
for the image.
• Alignment — Select from the available options to specify how
the image aligns with the other items in the row.
• Size — To specify a size relative to the original image size,
select Relative (%) and specify the width and height of the
image as a percentage of the original image. To specify an
absolute size, select Absolute (px) and specify the width and
height of the image in pixels. Select Keep Aspect Ratio to
maintain the aspect ratio while resizing.

To return to the original image size, right-click the image and


select Reset Image.

Hyperlink Insert a You can insert hyperlinks only in text lines. If you insert a
hyperlink. hyperlink into a code line, MATLAB places the hyperlink in a new
text line directly under the selected code line.

• Select Web page to insert a hyperlink to an external web page.


Then, enter the URL of the web page.
• Select Location in document to insert a hyperlink that points
to an existing location within the document. When prompted,
click the desired location within the document to select it as the
target. You also can use the Alt + Up Arrow and Alt + Down
Arrow keyboard shortcuts. Location can be a code section, text
paragraph, title, or heading. Linking to individual lines of text
or code is not supported.
• Select Existing file to insert a hyperlink to a file. Then, enter
the file path.
Equation Insert an You insert add equations only in text lines. If you insert an
equation. equation into a code line, MATLAB places the equation in a new
text line directly under the selected code line. For more
information, see “Insert Equations into the Live Editor” on page
19-36.

To format existing text, use any of the options included in the Live Editor tab Text section:

19-32
Format Files in the Live Editor

Format Type Options


Text Style
Normal

Heading 1

Heading 2

Heading 3

Title
Text Alignment Left

Center

Right
Lists Numbered list

Bulleted list
Standard
Bold
Formatting

Italic

Underline

Monospace

To change the case of selected text or code from all uppercase to lowercase, or vice versa, select the
text, right-click, and select Change Case. You also can press Ctrl+Shift+A. If the text contains both
uppercase and lowercase text, MATLAB changes the case to all uppercase.

To adjust the displayed font size in the Live Editor, use the Ctrl + Mouse Scroll keyboard shortcut.
The change in the displayed font size is not honored when exporting the live script to PDF, Microsoft
Word, HTML, or LaTeX.

Autoformatting
For quick formatting in live scripts and functions, you can use a combination of keyboard shortcuts
and character sequences. Formatting appears after you enter the final character in a sequence.

This table shows a list of formatting styles and their available keyboard shortcuts and autoformatting
sequences.

19-33
19 Live Scripts and Functions

Formatting Autoformattin Keyboard Shortcut


Style g Sequence
Title # text + Ctrl + Alt + L
Enter
Heading 1 ## text + Ctrl + Shift + 1
Enter
Heading 2 ### text + Ctrl + Shift + 2
Enter
Heading 3 #### text + Ctrl + Shift + 3
Enter
Section break %% text + With cursor at beginning of line with text:
with heading 1 Enter
Ctrl + Shift + 1, then Ctrl + Alt + Enter
Section break %% + Enter Ctrl + Alt + Enter

--- + Enter

*** + Enter
Bulleted list * text Ctrl + Alt + U

- text

+ text
Numbered list number. text Ctrl + Alt + O
Italic *text* Ctrl + I

_text_
Bold **text** Ctrl + B

__text__
Bold and italic ***text*** Ctrl + B, then Ctrl + I

___text___
Monospace `text` Ctrl + M

|text|
Underline None Ctrl + U
LaTeX equation $LaTeX$ Ctrl + Shift + L
Hyperlink URL + Space or Ctrl + K
Enter

<URL>

[Label](URL)

19-34
Format Files in the Live Editor

Formatting Autoformattin Keyboard Shortcut


Style g Sequence
Trademark, (TM) None
service mark,
and copyright (SM)
symbols (™, ℠,
®, and ©) (R)

(C)

Note Title, heading, section break, and list sequences must be entered at the beginning of a line.

Sometimes you want an autoformatting sequence such as *** to appear literally. To display the
characters in the sequence, escape out of the autoformatting by pressing the Backspace key or by

clicking Undo . For example, if you type ## text + Enter, a heading in the Heading 1 style with
the word text appears. To undo the formatting style and simply display ## text, press the
Backspace key. You only can escape out of a sequence directly after completing it. After you enter
another character or move the cursor, escaping is no longer possible.

To revert the autoformatting for LaTeX equations and hyperlinks, use the Backspace key at any
point.

To force formatting to reappear after escaping out of a sequence, click the Redo button. You only
can redo an action directly after escaping it. After you enter another character or move the cursor,
the redo action is no longer possible. In this case, to force the formatting to reappear, delete the last
character in the sequence and type it again.

To disable all or certain autoformatting sequences, you can adjust the “Editor/Debugger
Autoformatting Preferences”.

See Also

More About
• “Insert Equations into the Live Editor” on page 19-36
• “Share Live Scripts and Functions” on page 19-63

19-35
19 Live Scripts and Functions

Insert Equations into the Live Editor


To describe a mathematical process or method used in your code, insert equations into your live
script or function. Only text lines can contain equations. If you insert an equation into a code line,
MATLAB places the equation into a new text line directly under the selected code line.

There are two ways to insert an equation into a live script or function.

• Insert an equation interactively — You can build an equation interactively by selecting from a
graphical display of symbols and structures.
• Insert a LaTeX equation — You can enter LaTeX commands and the Live Editor inserts the
corresponding equation.

Insert Equation Interactively


To insert an equation interactively:
1 Go to the Insert tab and click Equation.

A blank equation appears.

2 Build your equation by selecting symbols, structures, and matrices from the options displayed in
the Equation tab. View additional options by clicking the to the right of each section.

When adding or editing a matrix, a context menu appears, which you can use to delete and insert
rows and columns. You also can use the context menu to change or remove matrix delimiters.

19-36
Insert Equations into the Live Editor

3 Format your equation using the options available in the Text section. Formatting is only available
for text within the equation. Numbers and symbols cannot be formatted. The formatting option is
disabled unless the cursor is placed within text that can be formatted.

Keyboard Shortcuts for Equation Editing

The equation editor provides a few shortcuts for adding elements to your equation:

• To insert symbols, structures, and matrices, type a backslash followed by the name of the symbol.
For example, type \pi to insert a π symbol into the equation. To discover the name of a symbol or
structure, hover over the corresponding button in the Equation tab. You can also type backslash
in the equation editor to bring up a completion menu of all supported names.

Note Although the \name syntax closely resembles LaTeX command syntax, entering full LaTeX
expressions is not supported when inserting equations interactively.
• To insert subscripts, superscripts, and fractions, use the symbols ‘_’, ‘^’ or ‘/’. For example:

• Type x_2 to insert x2 into the equation.


• Type x^2 to insert x2 into the equation.
• x
Type x/2 to insert into the equation.
2
• To insert a new column into a matrix, type a ‘,’ at the end of the last cell in a matrix row. To insert
a new row, type a semicolon ‘;’ at the end of the last cell in a matrix column.
• To insert the common symbols listed in this table, type a combination of other symbols.

Keyboard Symbol Keyboard Symbol Keyboard Symbol


Input Input Input
|| ∥ => ⇒ != ≠
|= ⊧ <--> !< ≮
|– ⊢ <-> !> ≯
–| ⊣ <= ≤ !<= ≰
-> → >= ≥ !>= ≱

19-37
19 Live Scripts and Functions

Keyboard Symbol Keyboard Symbol Keyboard Symbol


Input Input Input
<- ← <> ≠
<-- ~= ≠

Insert LaTeX Equation


To insert a LaTeX equation:

1 Go to the Insert tab, click Equation , and select LaTeX Equation.


2 Enter a LaTeX expression in the dialog box that appears. For example, you can enter \sin(x) =
\sum_{n=0}^{\infty}{\frac{(-1)^n x^{2n+1}}{(2n+1)!}}.

The preview pane shows a preview of equation as it would appear in the live script.

3 To include a description of the LaTeX equation when exporting the live script to HTML, add text
to the Alt Text field. For example, you can enter the text Maclaurin series for sin(x).

The description specifies alternative text for the equation and is saved as an alt attribute in the
HTML document. It is used to provide additional information for the equation if, for example, a
user is using a screen reader.
4 Press OK to insert the equation into your live script.

LaTeX expressions describe a wide range of equations. This table shows several examples of LaTeX
expressions and their appearance when inserted into a live script.

LaTeX Expression Equation in Live Script


a^2 + b^2 = c^2 a2 + b = c2
2

\int_{0}^{2} x^2\sin(x) dx
∫ x sin(x)dx
2
2
0

19-38
Insert Equations into the Live Editor

LaTeX Expression Equation in Live Script


\sin(x) = \sum_{n=0}^{\infty}{\frac{(-1)^n x^{2n ∞ n
( − 1) x2n + 1
+1}}{(2n+1)!}} sin(x) = ∑ (2n + 1)!
n=0

{a,b,c} \neq \{a,b,c\} a, b, c ≠ a, b, c


x^{2} \geq 0\qquad \text{for all}x\in\mathbf{R} x2 ≥ 0 for all x ∈ R
\matrix{a & b \cr c & d} a b
c d

Supported LaTeX Commands

MATLAB supports most standard LaTeX math mode commands. These tables show a list of supported
LaTeX commands.

Greek/Hebrew Letters

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


α alpha ν nu ξ xi
β beta ω omega ζ zeta
χ chi о omicron ɛ vare
δ delta ϕ phi φ varp
ε epsilon π pi ϖ varp
η eta ψ psi ϱ varr
v gamma ρ rho ς vars
ι iota σ sigma ϑ vart
κ kappa τ tau ‫א‬ alep
λ lambda θ theta
μ mu υ upsilon

Δ Delta Φ Phi Θ Thet


Γ Gamma Π Pi ϒ Upsi
Λ Lambda Ψ Psi Ξ Xi
Ω Omega Σ Sigma

Operator Symbols

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


* ast ± pm ∩ cap
☆ star ∓ mp ∪ cup
· cdot ∐ amalg ⊎ uplu
○ circ ⊙ odot ⊓ sqca
• bullet ⊖ ominus ⊔ sqcu

19-39
19 Live Scripts and Functions

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


⋄ diamond ⊕ oplus ∧ wedg
∖ setminus ⊘ oslash ∨ vee,
× times ⊗ otimes ◁ tria
÷ div † dagger ▷ tria
⊥ bot, perp ‡ ddagger △ bigt
⊤ top ≀ wr ▽ bigt
∑ sum ∏ prod ∫ int,
⊎ biguplus ⊕ bigoplus ∨ bigv
∩ bigcap ⊗ bigotimes ∧ bigw
∪ bigcup ⊙ bigodot ⊔ bigs

Relation Symbols

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


≡ equiv < lt > gt
≅ cong ≤ le, leq ≥ ge, g
≠ neq, ne, not= ≮ not< ≯ not>
∼ sim ≺ prec ≻ succ
≃ simeq ≼ preceq ≽ succ
≈ approx ≪ ll ≫ gg
≍ asymp ⊂ subset ⊃ sups
≐ doteq ⊆ subseteq ⊇ sups
∝ propto ⊑ sqsubseteq ⊒ sqsu
⊧ models ∣ mid ∊ in
⋈ bowtie ∥ parallel ∉ noti
⊢ vdash ⇔ iff ∍ ni, o
⊣ dashv

Note The leq, geq, equiv, approx, cong, sim, simeq, models, ni, succ, succeq, prec, preceq,
parallel, subset, supset, subseteq, and supseteq commands can be combined with the not
command to create the negated version of the symbol. For example, \not\leq creates the symbol ≰.

Arrows

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


← leftarrow → rightarrow ↑ upar
⇐ Leftarrow ⇒ Rightarrow ⇑ Upar
longleftarrow longrightarrow ↓ down
Longleftarrow Longrightarrow ⇓ Down

19-40
Insert Equations into the Live Editor

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


↩ hookleftarrow ↪ hookrightarrow updo
↽ leftharpoondown ⇁ rightharpoondow Updo
n
↼ leftharpoonup ⇀ rightharpoonup left
↙ swarrow ↗ nearrow Left
↖ nwarrow ↘ searrow long
row
↦ mapsto longmapsto Long
row

Brackets

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


{ lbrace } rbrace | vert
[ lbrack ] rbrack ‖ Vert
〈 langle 〉 rangle \ back
⌈ lceil ⌉ rceil
⌊ lfloor ⌋ rfloor

Sample LaTeX Command Sample LaTeX Command


big, bigl, bigr, abc brace
bigm
Big, Bigl, Bigr, abc brack
Bigm
bigg, biggl, abc choose
biggr, biggm

Bigg, Biggl,
Biggr, Biggm

Misc Symbols

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


∞ infty ∀ forall ℘ wp
∇ nabla ∃ exists ∠ angl
∂ partial ∅ emptyset △ tria
ℑ Im i ħ hbar

ℜ Re j ′ prim

ℓ ell imath ¬ lnot

… dots, ldots jmath surd

19-41
19 Live Scripts and Functions

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


⋯ cdots : colon ← gets
⋱ ddots ⋅ cdotp → to
⋮ vdots . ldotp

Note The exists command can be combined with the not command to create the negated version
of the symbol. For example, \not\exists creates the symbol ∄.

Accents

Symbol LaTeX Command Symbol LaTeX Command Symbol LaTe


á acute ä ddot a tild
a bar ȧ dot a vec

a breve à grave
ˇ check a hat
a

Functions

Sample LaTeX Command Sample LaTeX Command Sample LaTe


arccos arccos det det ln ln
arcsin arcsin dim dim log log
arctan arctan exp exp max max
arg arg gcd gcd min min
cos cos hom hom Pr Pr
cosh cosh ker ker sec sec
cot cot lg lg sin sin
coth coth lim lim sinh sinh
csc csc liminf liminf sup sup
deg deg limsup limsup tan tan

Math Constructs

Sample LaTeX Command Sample LaTeX Command Sample LaTe


abc frac a over a stac
xyz b b over
abc sqrt a overwithdelims b unde
b a

mod a bmod overleftarrow a b pmat


abc
c d
moda pmod overrightarrow a b matr
abc
c d

19-42
Insert Equations into the Live Editor

Sample LaTeX Command Sample LaTeX Command Sample LaTe


abc widehat overleftrightar a b begi
abc
row c d
abc widetilde b limits a b begi


a
c d

left right ab hlin


cd

Note To create a matrix using the matrix and pmatrix commands, use the & symbol to separate
columns, and \cr to separate rows. For example, to create a 2–by–2 matrix, use the expression
\matrix{a & b \cr c & d}.

White Space

Sample LaTeX Command Sample LaTeX Command Sample LaTe


negthinspace abc mathord a[b math

ab thinspace a∑ b mathop a]b math

ab enspace a+b mathbin a b math


a b quad a=b mathrel a b kern
a b qquad a, b mathpunct

Text Styling

Sample LaTeX Command Sample LaTeX Command Sample LaTe


displaystyle ABCDE text, textnormal ABCDE text

textstyle ABCDE bf, textbf, ABCDE text


mathbf
scriptstyle ABCDE it, textit, AℬCDℰ cal,
mathit
scriptscriptsty ABCDE rm, textrm, ABCDE hbox
le mathrm

See Also

Related Examples
• “Share Live Scripts and Functions” on page 19-63

19-43
19 Live Scripts and Functions

External Websites
• [Link]

19-44
Add Interactive Controls to a Live Script

Add Interactive Controls to a Live Script


You can add sliders, drop-downs, check boxes, edit fields, and buttons to your live scripts to control
variable values interactively. Adding interactive controls to a script is useful when you want to share
the script with others. Use interactive controls to set and change the values of variables in your live
script using familiar user interface components.

Insert Controls
To insert a control into a live script, go to the Live Editor tab, and in the Code section, click
Control. Then, select from the available options. To replace an existing value with a control, select
the value and then insert the control. The Control menu only shows options available for the selected
value.

The table below shows the list of available controls:

Control Description Configuration Details


Numeric Slider Use numeric sliders to interactively In the Values section, specify a Min,
change the value of a variable by Max, and Step value.
moving the slider thumb to the desired
numeric value.

The value to the left of the slider is its


current value.
Drop-Down List Use drop-down lists to interactively In the Items section, in the Item
change the value of a variable by Labels field, specify the text that you
selecting from a list of values. want to display for each item in the
drop-down list.
Hover over the text displayed in the
drop-down list to see its current value. In the Item Values field, specify the
values for each item in the drop-down
line. Make sure to enclose text values
in quotes or double quotes, because the
Live Editor interprets each item in the
list as code.
Check Box Use check boxes to interactively set the N/A
value of a variable to either the logical
value 1 (true) or the logical value 0
(false).

The displayed state of the check box


(checked or not checked) determines
its current value.
Edit Field Use edit fields to interactively set the In the Type section, in the Data type
value of a variable to any typed input. field, select from the available options
to specify the data type of the text in
The text displayed in the edit field and the edit field.
the selected data type determines its
current value.

19-45
19 Live Scripts and Functions

Control Description Configuration Details


Button Use button controls to interactively run To change the label displayed on the
code on button click. button, in the Label section, enter a
label name.
When using button controls, consider
setting the Run field for all other
controls in the live script to None.
Then, the code only runs when the user
clicks the button control. This can be
useful when the live script requires
multiple control values to be set before
running the code.

Modify Control Execution


You can modify when and what code runs when the value of a control changes. By default, when the
value of a control changes, the Live Editor runs the code in the current section. To configure this
behavior, right-click the control and select Configure Control. Then, in the Execution section,
modify the values of the fields described in the table below. Press Tab or Enter, or click outside of
the control configuration menu to return to the live script.

Field Options
Run On (slider control only) Select one of these options to specify when the
code runs:

• Value changing — Run the code while the


value of the slider is changing.
• Value changed — Run the code after the
slider value is done changing (user has
released the slider thumb).

19-46
Add Interactive Controls to a Live Script

Field Options
Run Select one of these options to specify what code
runs when the value of the control changes:

• Current section (Default) — Run the section


that includes the control.
• Current section and modified or not yet
run sections above — Run the current
section and any stale code above it when the
control value changes. If the live script has
not yet been run, changing the control value
will run the current section and all sections
before it.
• Current section to end — Run the section
that includes the control and any sections that
follow.
• All Sections — Run all sections in the live
script.
• Nothing — Do not run any code.

Tip When using a button control in a live script,


consider setting the Run field for all other
controls in the live script to Nothing. Then, the
code only runs when the user clicks the button
control. This can be useful when the live script
requires multiple control values to be set before
running the code.

Modify Control Labels


You can hide the code in a live script and only display labeled controls, output, and formatted text.
Hiding the code is useful when sharing and exporting live scripts. To hide the code, click the hide
code button to the right of the live script. You also can go to the View tab, and in the View section,

click Hide Code. To show the code again, click the output inline button or the output on
right button.

When the code is hidden, labels display next to the control. To modify the label for a control, right-
click the control and select Configure Control. Then, in the Label section, enter a label name. This
is also the text that displays on button controls in all views. Press Tab or Enter, or click outside of
the control configuration menu to return to the live script.

Create Live Script with Multiple Interactive Controls


This example shows how you can use interactive controls to visualize and investigate patient data in
MATLAB®. The example plots the height versus the weight of either male or female patients, and
highlights the patients over a specified height and weight.

19-47
19 Live Scripts and Functions

Use the interactive controls to specify the gender of the patients to plot, as well as the threshold
height and weight. To view and interact with the controls, open this example in your browser or in
MATLAB.

load patients

thresholdHeight = ;

thresholdWeight = ;

selectedGender = ;

overThresholdWeights = Weight(Gender==selectedGender & Weight>=thresholdWeight & Height>=threshol


overThresholdHeights = Height(Gender==selectedGender & Weight>=thresholdWeight & Height>=threshol

sp1 = scatter(Height(Gender==selectedGender),Weight(Gender==selectedGender),'blue');
hold on

sp2 = scatter(overThresholdHeights, overThresholdWeights,'red');


hold off

title('Height vs. Weight of ' + selectedGender + ' Patients')

legendText = sprintf('Patients over %d inches and %d pounds.',thresholdHeight,thresholdWeight);


legend(sp2,legendText,'Location','southoutside')

19-48
Add Interactive Controls to a Live Script

Share Live Script


When the live script is complete, share it with others. Users can open the live script in MATLAB and
experiment with using the controls interactively.

If you share the live script itself as an interactive document, consider hiding the code in the live
script before sharing it. When the code is hidden, the Live Editor only displays labeled controls,
output, and formatted text. To hide the code, click the hide code button to the right of the live
script. You also can go to the View tab, and in the View section, click Hide Code.

If you share the live script as a static PDF, Microsoft Word, HTML, or LaTeX document, the Live
Editor saves the control as code. For example, in the live script shown here, the Live Editor replaces
the slider controls with their current value (68 and 132) and replaces the drop-down control with the
current value of the drop-down ("Female").

See Also

More About
• “Add Interactive Tasks to a Live Script” on page 19-50
• “Share Live Scripts and Functions” on page 19-63

19-49
19 Live Scripts and Functions

Add Interactive Tasks to a Live Script

What Are Live Editor Tasks?


Live Editor tasks are apps that can be added to a live script to perform a specific set of operations.
You can add tasks to live scripts to explore parameters and automatically generate code. Use tasks to
reduce development time, errors, and time spent plotting.

Tasks represent a series of MATLAB commands. You can display their output either inline or on the
right. To see the MATLAB commands that the task runs, show the generated code.

Insert Tasks

To add a task to a live script, go to the Live Editor tab, click Task , and select from the
available tasks. You also can type the name of the task in a live script code block. As you type, the
Live Editor displays possible matches, and you can select and insert the desired task. For example,
create a live script that creates a vector of data containing an outlier.

A = [57 59 60 100 59 58 57 58 300 61 62 60 62 58 57];


plot(1:15,A)

19-50
Add Interactive Tasks to a Live Script

Add the Clean Outlier Data task to your live script to smooth the noisy data and avoid skewed
results. To add the task, start typing the word clean in the live script and select Clean Outlier
Data from the suggested command completions. In the task, set Input data to A. The task identifies
and fills two outliers in the data and creates the variable cleanedData in the MATLAB workspace
with the stored results. You also can see the results in the output plot for the task. Continue
modifying additional parameters until you are satisfied with the results.

19-51
19 Live Scripts and Functions

Restore Default Parameters

To restore all parameter values back to their defaults, click the options button at the top-right of
the task and select Restore Default Values.

Collapse Tasks for Improved Readability

When you are done modifying parameters, you can collapse the task to help with readability. To
collapse the task, click the arrow at the top-left of the task.

19-52
Add Interactive Tasks to a Live Script

The task displays as a single, user-readable line of pseudocode with output.

Delete Tasks

To delete a task, click the task and then press Delete or Backspace. You also can place your cursor
directly before or after the task and use the Delete or Backspace key, respectively.

Run Tasks and Surrounding Code


By default, as you modify the value of parameters in the task, the task and current section (including
other tasks in the section) run automatically. This ensures that the results and surrounding code in
the section remain up to date. For example, in the live script [Link], the entire section
including the code that creates the vector of noisy data reruns every time you modify the value of a
parameter in the Clean Outlier Data task. To run only the task, add section breaks before and after
the task. For more information about sections and how to add section breaks, see “Run Sections in
Live Scripts” on page 19-12.

A green circular icon at the top-right of the task indicates that the task runs automatically when you
modify the task parameters.

To disable running the section automatically, click the autorun icon. The icon updates to display the

disabled state. To run the task and current section, on the Live Editor tab, click the Run
Section button.

19-53
19 Live Scripts and Functions

Some tasks do not run automatically by default. This default setting ensures optimal performance for
those tasks.

Modify Output Argument Name


To modify the name of the output argument, click the text box containing the argument name and
enter a new name.

You can use the resulting output argument in subsequent code, including as inputs to additional Live
Editor tasks.

View and Edit Generated Code


To see the MATLAB commands that the task runs, click the options button at the top-right of the
task and select either Controls and Code or Code Only. You also can use the down arrow at the
bottom of the task to show and hide the generated code. The generated code is read-only.

To edit the generated code, click the options button and select Convert Task to Editable Code.
This option removes the task and replaces it with the generated code, which you then can edit.

19-54
Add Interactive Tasks to a Live Script

See Also

More About
• “Add Interactive Controls to a Live Script” on page 19-45
• “Clean Messy Data and Locate Extrema Using Live Editor Tasks”
• MATLAB Live Script Gallery

19-55
19 Live Scripts and Functions

Create Live Functions


Live functions are program files that contain code and formatted text together in a single interactive
environment called the Live Editor. Similar to live scripts, live functions allow you to reuse sequences
of commands by storing them in program files. Live functions provide more flexibility, though,
primarily because you can pass them input values and receive output values.

Create Live Function


To create a live function, go to the Home tab and select New > Live Function.

Open Existing Function as Live Function

If you have an existing function, you can open it as a live function in the Live Editor. Opening a
function as a live function creates a copy of the file and leaves the original file untouched. MATLAB
converts publishing markup from the original script to formatted content in the new live function.

To open an existing function (.m) as a live function (.mlx) from the Editor, right-click the document
tab and select Open functionName as Live Function from the context menu.

Alternatively, go to the Editor tab, click Save , and select Save As. Then, set the Save as type: to
MATLAB Live Code Files (*.mlx) and click Save.

Note You must use one of the described conversion methods to convert your function to a live
function. Simply renaming the function with a .mlx extension does not work and can corrupt the file.

Create Live Function from Selected Code

If you have an existing large live script or function, you can break it into smaller pieces by
automatically converting selected areas of code into functions or local functions. This is called code
refactoring.

To refactor a selected area of code, select one or more lines of code and on the Live Editor tab, in
the Code section, click Refactor. Then, select from the available options. MATLAB creates a
function with the selected code and replaces the original code with a call to the newly created
function.

Add Code
After you create the live function, add code to the function and save it. For example, add this code
and save it as a function called [Link]. The mymean function calculates the average of the
input list and returns the results.

function a = mymean(v,n)
a = sum(v)/n;
end

19-56
Create Live Functions

Add Help
To document the function, add formatted help text above the function definition. For example, add a
title and some text to describe the functionality. For more information about adding help text to
functions, see “Add Help for Live Functions” on page 19-59.

Run Live Function


You can run live functions using several methods, including calling them from the Command Window
or calling them from a live script.

To run a live function from the Command Window, enter the name of the function in the Command
Window. For example, use [Link] to calculate the mean of 10 sequential numbers from 1 to 10.

mymean(1:10, 10)

ans =
5.5000

You also can call the live function from a live script. For example, create a live script called
[Link]. Add this code that declares an array, determines the length of the array, and passes
both values to the function mymean.

x = 1:10;
n = length(x);
avg = mymean(x,n);
disp(['Average = ', num2str(avg)])

Run the live script. The Live Editor displays the output.

If a live function displays text or returns values, the Live Editor displays the output in the calling live
script, in line with the call to the live function. For example, add a line to mymean that displays the
calculated mean before returning the value:

function a = mymean(v,n)
a = sum(v)/n;

19-57
19 Live Scripts and Functions

disp(['a = ', num2str(a)])


end

When you run mystats, the Live Editor displays the output for mymean with the output from
mystats.

Save Live Functions as Plain Code


To save a live function as a plain code file (.m):

1 On the Live Editor tab, in the File section, select Save > Save As....
2 In the dialog box that appears, select MATLAB Code files (UTF-8) (*.m) as the Save as
type.
3 Click Save.

When saving, MATLAB converts all formatted content to publish markup.

See Also

More About
• “Add Help for Live Functions” on page 19-59

19-58
Add Help for Live Functions

Add Help for Live Functions


You can provide help for the live functions you write. Help text appears in the Command Window
when you use the help command. You also can use the doc command to display the help text in a
separate browser.

Create help text by inserting text at the beginning of the file, immediately before the function
definition line (the line with the function keyword).

For example, create a live function called [Link] with this code:

function c = addme(a,b)

switch nargin
case 2
c = a + b;
case 1
c = a + a;
otherwise
c = 0;
end

Add help text to describe the function.

When you type help addme in the Command Window, the help text displays.

19-59
19 Live Scripts and Functions

The first line of help text, often called the H1 line, typically contains a brief description of the
function. When displaying help for a function, MATLAB first displays the name of the function
followed by the H1 line. Then, MATLAB displays the syntax of the function. Finally, MATLAB displays
any remaining help text.

To add "See also" links, add a text line at the end of the help text that begins with the words See
also followed by a list of function names. If the functions exist on the search path or in the current
folder, the help command displays each of these function names as a hyperlink to its help. Otherwise,
help prints the function names as they appear in the help text.

Note When multiple programs have the same name, the help command determines which help text
to display by applying the rules described in “Function Precedence Order” on page 20-35. However,
if a program has the same name as a built-in function, the Help on Selection option in context
menus always displays documentation for the built-in function.

To enhance the documentation displayed in the Help browser further, you can format the text and add
hyperlinks, images, equations, and example code. For example, in the addme function, select the H1
line and in the Live Editor tab, change the Normal text style to Title. Then, position your cursor at
the end of the second syntax description, go to the Insert tab, and select Equation. Enter the
equation c = a + b and press Esc. Finally, in the Insert tab, select Code Example > MATLAB and
add two examples. For more information about formatting files in the Live Editor, see “Format Files in
the Live Editor” on page 19-31.

19-60
Add Help for Live Functions

Use the doc command to display the help text in a separate browser.

You also can add help to live functions by inserting comments at the beginning of the file. Comments
at the beginning of the file display as help text when you use the help and doc commands, similar to
how text at the beginning of the file displays. For more information about adding help using
comments, see “Add Help for Your Program” on page 20-5.

19-61
19 Live Scripts and Functions

See Also

More About
• “Create Live Functions” on page 19-56
• “Format Files in the Live Editor” on page 19-31
• “Share Live Scripts and Functions” on page 19-63

19-62
Share Live Scripts and Functions

Share Live Scripts and Functions


You can share live scripts and functions with others for teaching or demonstration purposes, or to
provide readable, external documentation of your code. You can share the files with other MATLAB
users, or you can share static PDF, Microsoft Word, HTML, and LaTeX versions of the files for viewing
outside of MATLAB.

This table shows the different ways to share live scripts and functions.

Ways to Share Instructions


As an interactive document Distribute the live code file (.mlx). Recipients of
the file can open and view the file in MATLAB in
the same state that you last saved it in. This
includes generated output.

MATLAB supports live scripts in Versions R2016a


and above, and live functions in Versions R2018a
and above.
As a full screen presentation Open the live script or function, go to the View
tab and click the Full Screen button. MATLAB
opens the file in full screen mode.

To exit out of full screen mode, move the mouse


to the top of the screen to display the View tab
and click the Full Screen button again.
With users of previous MATLAB versions Save the live script or function as a plain code file
(.m) and distribute it. Recipients of the file can
open and view the file in MATLAB. MATLAB
converts formatted content from the live script or
function to publish markup in the new script or
function.

For more information, see “Save Live Scripts as


Plain Code” on page 19-10.

19-63
19 Live Scripts and Functions

Ways to Share Instructions


As a static document capable of being viewed Export the script or function to a standard
outside of MATLAB format. Available formats include PDF, Microsoft
Word, HTML, and LaTeX.

To export your live script or function to one of


these formats, on the Live Editor tab, select
Save > Export to PDF, Save > Export to Word,
Save > Export to HTML, or Save > Export to
LaTeX. The saved file closely resembles the
appearance of the live script or function when
viewed in the Live Editor with output inline.

To export all of the live scripts and live functions


in a folder, on the Live Editor tab, select Save >
Export Folder....

When exporting to LaTeX, MATLAB creates a


separate [Link] file in the same folder as
the output document, if one does not exist
already. .sty files, also known as LaTeX Style
Documents, give you more control over the
appearance of the output document.

To customize the format of figures as well as the


document paper size, orientation, and margins
before exporting, use settings. For more
information, see [Link] Settings.

Hide Code Before Sharing


Consider hiding the code in the live script before sharing it as an interactive or static document.
When the code is hidden, the Live Editor only displays labeled controls, output, and formatted text.

To hide the code, click the hide code button to the right of the live script. You also can go to the

View tab, and in the View section, click Hide Code. To show the code again, click the output
inline button or the output on right button.

See Also

Related Examples
• “Create Live Scripts in the Live Editor” on page 19-6
• “Format Files in the Live Editor” on page 19-31
• MATLAB Live Script Gallery

19-64
Live Code File Format (.mlx)

Live Code File Format (.mlx)


MATLAB stores live scripts and functions using the Live Code file format in a file with a .mlx
extension. The Live Code file format uses Open Packaging Conventions technology, which is an
extension of the zip file format. Code and formatted content are stored in an XML document separate
from the output using the Office Open XML (ECMA-376) format.

Benefits of Live Code File Format


• Interoperable Across Locales — Live code files support storing and displaying characters
across all locales, facilitating sharing files internationally. For example, if you create a live script
with a Japanese locale setting, and open the live script with a Russian locale setting, the
characters in the live script display correctly.
• Extensible — Live code files can be extended through the ECMA-376 format, which supports the
range of formatting options offered by Microsoft Word. The ECMA-376 format also accommodates
arbitrary name-value pairs, should there be a need to extend the format beyond what the standard
offers.
• Forward Compatible — Future versions of live code files are compatible with previous versions
of MATLAB by implementing the ECMA-376 standard's forward compatibility strategy.
• Backward Compatible — Future versions of MATLAB can support live code files created by a
previous version of MATLAB.

Source Control
To determine and display code differences between live scripts or functions, use the MATLAB
Comparison Tool.

If you use source control, register the .mlx extension as binary. For more information, see “Register
Binary Files with SVN” on page 33-14 or “Register Binary Files with Git” on page 33-24.

See Also

More About
• “What Is a Live Script or Function?” on page 19-2
• “Create Live Scripts in the Live Editor” on page 19-6

External Websites
• Open Packaging Conventions Fundamentals
• Office Open XML File Formats (ECMA-376)

19-65
19 Live Scripts and Functions

Introduction to the Live Editor


This example is an introduction to the Live Editor. In the Live Editor, you can create live scripts that
show output together with the code that produced it. Add formatted text, equations, images, and
hyperlinks to enhance your narrative, and share the live script with others as an interactive
document.

Create a live script in the Live Editor. To create a live script, on the Home tab, click New Live
Script.

Add the Census Data

Divide your live script into sections. Sections can contain text, code, and output. MATLAB code
appears with a gray background and output appears with a white background. To create a new
section, go to the Live Editor tab and click the Section Break button.

Add the US Census data for 1900 to 2000.

years = (1900:10:2000); % Time interval


pop = [75.995 91.972 105.711 123.203 131.669 ... % Population Data
150.697 179.323 213.212 228.505 250.633 265.422]

pop = 1×11

75.9950 91.9720 105.7110 123.2030 131.6690 150.6970 179.3230 213.2120 228.5050 250.6

Visualize the Population Change Over Time

Sections can be run independently. To run the code in a section, go to the Live Editor tab and click
the Run Section button. You can also click the blue bar that appears when you move the mouse to
the left of the section. When you run a section, output and figures appear together with the code that
produced them.

Plot the population data against the year.

plot(years,pop,'bo'); % Plot the population data


axis([1900 2020 0 400]);
title('Population of the U.S. 1900-2000');
ylabel('Millions');
xlabel('Year')
ylim([50 300])

19-66
Introduction to the Live Editor

Can we predict the US population in the year 2010?

Fitting the Data

Add supporting information to the text, including equations, images, and hyperlinks.

Let's try fitting the data with polynomials. We'll use the MATLAB polyfit function to get the
coefficients.

The fit equations are:

y = ax + b linear
y= ax2 + bx + c quadratic
y = ax3 + bx2 + cx + d . cubic
x = (years-1900)/50;
coef1 = polyfit(x,pop,1)

coef1 = 1×2

98.9924 66.1296

coef2 = polyfit(x,pop,2)

coef2 = 1×3

19-67
19 Live Scripts and Functions

15.1014 68.7896 75.1904

coef3 = polyfit(x,pop,3)

coef3 = 1×4

-17.1908 66.6739 29.4569 80.1414

Plotting the Curves

Create sections with any number of text and code lines.

We can plot the linear, quadratic, and cubic curves fitted to the data. We'll use the polyval function
to evaluate the fitted polynomials at the points in x.

pred1 = polyval(coef1,x);
pred2 = polyval(coef2,x);
pred3 = polyval(coef3,x);
[pred1; pred2; pred3]

ans = 3×11

66.1296 85.9281 105.7266 125.5250 145.3235 165.1220 184.9205 204.7190 224.5174 244.3
75.1904 89.5524 105.1225 121.9007 139.8870 159.0814 179.4840 201.0946 223.9134 247.9
80.1414 88.5622 101.4918 118.1050 137.5766 159.0814 181.7944 204.8904 227.5441 248.9

Now let's plot the predicted values for each polynomial.

hold on
plot(years,pred1)
plot(years,pred2)
plot(years,pred3)
ylim([50 300])
legend({'Data' 'Linear' 'Quadratic' 'Cubic'},'Location', 'NorthWest')
hold off

19-68
Introduction to the Live Editor

Predicting the Population

You can share your live script with other MATLAB users so that they can reproduce your results. You
also can publish your results as PDF, Microsoft® Word, or HTML documents. Add controls to your
live scripts to show users how important parameters affect the analysis. To add controls, go to the
Live Editor tab, click the Control button, and select from the available options.

We can now calculate the predicted population of a given year using our three equations.

year = ;
xyear = (year-1900)/50;
pred1 = polyval(coef1,xyear);
pred2 = polyval(coef2,xyear);
pred3 = polyval(coef3,xyear);
[pred1 pred2 pred3]

ans = 1×3

299.7517 321.6427 295.0462

19-69
19 Live Scripts and Functions

For the year 2010 for example, the linear and cubic fits predict similar values of about 284 million
people, while the quadratic fit predicts a much higher value of about 300 million people.

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery

19-70
Accelerate Exploratory Programming Using the Live Editor

Accelerate Exploratory Programming Using the Live Editor


The following is an example of how to use the Live Editor to accelerate exploratory programming.
This example demonstrates how you can use the Live Editor to:

• See output together with the code that produced it.


• Divide your program into sections to evaluate blocks of code individually.
• Include visualizations.
• Experiment with parameter values using controls.
• Summarize and share your findings.

Load Highway Fatality Data

The Live Editor displays output together with the code that produced it. To run a section, go to the
Live Editor tab and select the Run Section button. You can also click the blue bar that appears
when you move your mouse to the left edge of a section.

In this example, we explore some highway fatality data. Start by loading the data. The variables are
shown as the column headers of the table.

load fatalities
fatalities(1:10,:)

ans=10×8 table
longitude latitude deaths drivers vehicles vehicleMile
_________ ________ ______ _______ ________ ___________

Wyoming -107.56 43.033 164 380.18 671.53 9261


District_of_Columbia -77.027 38.892 43 349.12 240.4 3742
Vermont -72.556 44.043 98 550.46 551.52 7855
North_Dakota -99.5 47.469 100 461.78 721.84 7594
South_Dakota -99.679 44.272 197 563.3 882.77 8784
Delaware -75.494 39.107 134 533.94 728.52 9301
Montana -110.58 46.867 229 712.88 1056.7 11207
Rhode_Island -71.434 41.589 83 741.84 834.5 8473
New_Hampshire -71.559 43.908 171 985.77 1244.6 13216
Maine -69.081 44.886 194 984.83 1106.8 14948

Calculate Fatality Rates

The Live Editor allows you to divide your program into sections containing text, code, and output. To
create a new section, go to the Live Editor tab and click the Section Break button. The code in a
section can be run independently, which makes it easy to explore ideas as you write your program.

Calculate the fatality rate per one million vehicle miles. From these values we can find the states with
the lowest and highest fatality rates.

states = [Link];
rate = [Link]./[Link];
[~, minIdx] = min(rate); % Minimum accident rate
[~, maxIdx] = max(rate); % Maximum accident rate
disp([states{minIdx} ' has the lowest fatality rate at ' num2str(rate(minIdx))])

Massachusetts has the lowest fatality rate at 0.0086907

19-71
19 Live Scripts and Functions

disp([states{maxIdx} ' has the highest fatality rate at ' num2str(rate(maxIdx))])

Mississippi has the highest fatality rate at 0.022825

Distribution of Fatalities

You can include visualizations in your program. Like output, plots and figures appear together with
the code that produced them.

We can use a bar chart to see the distribution of fatality rates among the states. There are 11 states
that have a fatality rate greater than 0.02 per million vehicle miles.
histogram(rate,10)
xlabel('Fatalities per Million Vehicle Miles')
ylabel('Number of States')

Find Correlations in the Data

You can explore your data quickly in the Live Editor by experimenting with parameter values to see
how your results will change. Add controls to change parameter values interactively. To add controls,
go to the Live Editor tab, click the Control button, and select from the available options.

19-72
Accelerate Exploratory Programming Using the Live Editor

We can experiment with the data to see if any of the variables in the table are correlated with
highway fatalities. For example, it appears that highway fatality rates are lower in states with a
higher percentage urban population.

dataToPlot = ;
close % Close any open figures
scatter(fatalities.(dataToPlot),rate) % Plot fatalities vs. selected variable
xlabel(dataToPlot)
ylabel('Percent Fatalities per Million Vehicle Miles')

hold on
xmin = min(fatalities.(dataToPlot));
xmax = max(fatalities.(dataToPlot));
p = polyfit(fatalities.(dataToPlot),rate,1); % Calculate & plot least squares line
plot([xmin xmax], polyval(p,[xmin xmax]))

19-73
19 Live Scripts and Functions

Plot Fatalities and Urbanization on a US Map

Summarize your results and share your live script with your colleagues. Using your live script, they
can recreate and extend your analysis. You can also save your analysis as HTML, Microsoft® Word, or
PDF documents for publication.

Based on this analysis, we can summarize our findings using a plot of fatality rates and urban
population on a map of the continental United States.

load [Link]
figure
geoplot([[Link]], [[Link]], 'black')
geobasemap darkwater
hold on
geoscatter([Link],[Link],2000*rate,[Link],'filled'
c = colorbar;
title(c,'Percent Urban')

19-74
Accelerate Exploratory Programming Using the Live Editor

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery

19-75
19 Live Scripts and Functions

Create an Interactive Narrative with the Live Editor


The following is an example of how to create an interactive narrative in the Live Editor. An interactive
narrative ties together the computations that you use to solve a problem. This example shows how to:

• Describe your approach using formatted text


• Show output together with your MATLAB code.
• Describe the underlying mathematics with equations.
• Illustrate important points with images.
• Links to background material.
• Modify parameters and re-run the analysis with controls.
• Plot data for visualization.
• Invite colleagues to extend your analysis.

Overall Approach

Include formatted text as part of the interactive narrative. Use bold, italic, and underlined text to
highlight important words. Use bullets or numbers to format lists.

Estimate the power output from a typical solar panel installation on a specific date, time, and location
by calculating the following:

• Solar time
• Solar declination and solar elevation
• Air mass and the solar radiation reaching the earth's surface
• Radiation on a solar panel given its position, tilt, and efficiency
• Power generated in a day and over the entire year

Use the results of these calculations to plot solar and panel radiation for the example day and
location. Then, plot the expected panel power generation over the course of a year. To streamline the
analysis, use two MATLAB functions created for this example: solarCorrection and
panelRadiation.

Solar Time

Show output together with the code that produced it. To run a section of code, go to the Live Editor
tab and click the Run Section button.

Power generation in a solar panel depends on how much solar radiation reaches the panel. This in
turn depends on the sun's position relative to the panel as the sun moves across the sky. For example,
suppose that you want to calculate power output for a solar panel on June 1st at 12 noon in Boston,
Massachusetts.

lambda = ; % longitude

phi = ; % latitude

UTCoff = ; % UTC offset


january1 = datetime(2019,1,1); % January 1st
localTime = datetime(2019,6,1,12,0,0) % Noon on June 1

19-76
Create an Interactive Narrative with the Live Editor

localTime = datetime
01-Jun-2019 12:00:00

To calculate the sun's position for a given date and time, use solar time. Twelve noon solar time is the
time when the sun is highest in the sky. To calculate solar time, apply a correction to local time. That
correction has two parts:

• A term which corrects for the difference between the observer's location and the local meridian.
• An orbital term related to the earth's orbital eccentricity and axial tilt.

Calculate solar time using the solarCorrection function.


d = caldays(between(january1,localTime,'Day')); % Day of year
solarCorr = solarCorrection(d,lambda,str2double(UTCoff)); % Correction to local time
solarTime = localTime + minutes(solarCorr)

solarTime = datetime
01-Jun-2019 12:18:15

Solar Declination and Elevation

Include equations to describe the underlying mathematics. Create equations using LaTeX commands.
To add a new equation, go to the Insert tab and click the Equation button. Double-click an equation
to edit it in the Equation Editor.

The solar declination (δ) is the angle of the sun relative to the earth's equatorial plane. The solar
∘ ∘
declination is 0 at the vernal and autumnal equinoxes, and rises to a maximum of 23 . 45 at the
summer solstice. Calculate the solar declination for a given day of the year (d) using the equation

−1 360
δ = sin sin(23 . 45)sin (d − 81)
365

Then, use the declination (δ), the latitude (ϕ), and the hour angle (ω) to calculate the sun's elevation
(α) at the current time. The hour angle is the number of degrees of rotation of the earth between the
current solar time and solar noon.

−1
α = sin sinδsinϕ + cosδcosϕcosω

delta = asind(sind(23.45)*sind(360*(d - 81)/365)); % Declination


omega = 15*([Link] + [Link]/60 - 12); % Hour angle
alpha = asind(sind(delta)*sind(phi) + ... % Elevation
cosd(delta)*cosd(phi)*cosd(omega));
disp(['Solar Declination = ' num2str(delta) ' Solar Elevation = ' num2str(alpha)])

Solar Declination = 21.8155 Solar Elevation = 69.113

Calculate the time of sunrise and sunset in Standard Time using the sun's declination and the local
latitude.

cos−1 − tanϕtanδ TC cos−1 − tanϕtanδ TC


sunrise = 12 − − sunset = 12 + −
15 ∘ 60 15 ∘ 60

midnight = dateshift(localTime,'start','day');
sr = 12 - acosd(-tand(phi)*tand(delta))/15 - solarCorr/60;

19-77
19 Live Scripts and Functions

sunrise = timeofday(midnight + hours(sr));


ss = 12 + acosd(-tand(phi)*tand(delta))/15 - solarCorr/60;
sunset = timeofday(midnight + hours(ss));
disp(['Sunrise = ', datestr(sunrise,'HH:MM:SS'), ' Sunset = ', datestr(sunset,'HH:MM:ss')])

Sunrise = 04:16:06 Sunset = 19:07:22

Air Mass and Solar Radiation

Include images to illustrate important points in your story. To include an image, copy and paste an
image from another source or go to the Insert tab and click the Image button.

As light from the sun passes through the earth's atmosphere, some of the solar radiation is absorbed.
Air mass is the length of the path of light through the atmosphere (Y) relative to the shortest possible
path (X) when the sun's elevation is 90∘, as shown in the diagram below. It is a function of solar
elevation (α).

The larger the air mass, the less radiation reaches the ground. Calculate the air mass using the
equation

1
AM = −1 . 6364
cos(90 − α) + 0 . 5057(6 . 0799 + α) .

Then, calculate the solar radiation reaching the ground (in kilowatts per square meter) using the
empirical equation

0 . 678
sRad = 1 . 353 * 0 . 7 AM .

AM = 1/(cosd(90-alpha) + 0.50572*(6.07955+alpha)^-1.6354);
solarRad = 1.353*0.7^(AM^0.678); % kW/m^2
disp(['Air Mass = ' num2str(AM) ' Solar Radiation = ' num2str(solarRad) ' kW/m^2'])

Air Mass = 1.0698 Solar Radiation = 0.93141 kW/m^2

19-78
Create an Interactive Narrative with the Live Editor

Solar Radiation on Fixed Panels

Use hyperlinks to reference supporting information from other sources. To add a hyperlink, go to the
Insert tab and click the Hyperlink button.

Panels installed with a solar tracker can move with the sun and receive 100% of the sun's radiation as
the sun moves across the sky. However, most solar cell installations have panels set at a fixed azimuth
and tilt. Therefore, the actual radiation reaching the panel also depends on the solar azimuth. The
solar azimuth (γ) is the compass direction of the sun's position in the sky. At solar noon in the

Northern hemisphere the solar azimuth is180 corresponding to the direction south. Calculate the
solar azimuth using the equation

sinδcosϕ − cosδsinϕcosω
cos−1 for solar time  ≤ 12
cosα
γ=
∘ sinδcosϕ − cosδsinϕcosω
360 − cos−1 for solar time  > 12
cosα

gamma = acosd((sind(delta)*cosd(phi) - cosd(delta)*sind(phi)*cosd(omega))/cosd(alpha));


if (hour(solarTime) >= 12) && (omega >= 0)
gamma = 360 - gamma;
end
disp(['Solar Azimuth = ' num2str(gamma)])

Solar Azimuth = 191.7888

In the northern hemisphere, a typical solar panel installation has panels oriented toward the south
∘ ∘
with a panel azimuth (β) of 180 . At northern latitudes, a typical tilt angle (τ) is 35 . Calculate the
panel radiation for fixed panels from the total solar radiation using the equation

pRad = sRad cos(α)sin(τ)cos(β − γ) + sin(α)cos(τ) .

beta = 180; % Panel azimuth


tau = 35; % Panel tilt
panelRad = solarRad*max(0,(cosd(alpha)*sind(tau)*cosd(beta-gamma) + sind(alpha)*cosd(tau)));
disp(['Panel Radiation = ' num2str(panelRad) ' kW/m^2'])

Panel Radiation = 0.89928 kW/m^2

Panel Radiation and Power Generation For a Single Day

Modify parameters using interactive controls. Display plots together with the code that produced
them.

Panel Radiation

For a given day of the year, calculate the total solar radiation and the radiation on the panel. To
simplify the analysis, use the panelRadiation function. Try different dates to see how the solar and
panel radiation change depending on the time of year.

selectedMonth = ;

selectedDay = ;
selectedDate = datetime(2019,selectedMonth,selectedDay);
[times,solarRad,panelRad] = panelRadiation(selectedDate,lambda,phi,UTCoff,tau,beta) ;

19-79
19 Live Scripts and Functions

plot(times,solarRad,times,panelRad)
title(['Solar and Panel Radiation for ' datestr(selectedDate,'mmmm dd yyyy')])
xlabel('Hour of Day');
ylabel('Radiation, kW/m^2')
legend('Available Solar Radiation','Solar Radiation on Panel', 'Location','South')

Power Generation

So far, the calculations assume that all of the radiation reaching the panel is available to generate
power. However, solar panels do not convert 100% of available solar radiation into electricity. The
efficiency of a solar panel is the fraction of the available radiation that is converted. The efficiency of
a solar panel depends on the design and materials of the cell.

Typically, a residential installation includes 20m2 of solar panels with an efficiency of 25%. Modify the
parameters below to see how efficiency and size affect panel power generation.

eff = ; % Panel efficiency

pSize = ; % Panel size in m^2


radiation = sum(panelRad(1:end-1)+panelRad(2:end))/2;
dayPower = eff*pSize*radiation; % Panel electric output in kW
disp(['Expected daily electical output for ' datestr(selectedDate) ' = ' num2str(dayPower) ' kW-h

Expected daily electical output for 01-Jun-2019 = 33.4223 kW-hrs

19-80
Create an Interactive Narrative with the Live Editor

Power Generation for the Whole Year

Hover over a plot to interact with it. Interacting with a plot in the Live Editor will generate code that
you can then add to your script.

Repeat the calculation to estimate power generation for each day of the year.

yearDates = datetime(2019,1,1:365); % Create a vector of days in the year


dailyPower = zeros(1,365);
for i = 1:365
[times,solarRad,panelRad] = panelRadiation(yearDates(i),lambda,phi,UTCoff,tau,beta) ;
radiation = sum(panelRad(1:end-1)+panelRad(2:end))/2;
dailyPower(i) = eff*pSize*radiation;
end

plot(yearDates,dailyPower)
title('Yearly Power Generation')
xlabel('Date');
ylabel('Power Generation, kW-hrs')

yearlyPower = sum(dailyPower);
disp(['Expected annual power output = ' num2str(yearlyPower) ' kW-hrs'])

Expected annual power output = 9954.3272 kW-hrs

19-81
19 Live Scripts and Functions

Panel Tilt and Latitude

Use a heatmap to determine how panel tilt affects power generation. The heatmap below shows that
the optimal panel tilt for any location is about 5∘ less than the latitude.

load [Link]
heatmap(powerTbl,'Tilt','Latitude',...
'ColorVariable','Power');
xlabel('Panel Tilt')
ylabel('Latitude')
title('Normalized Power Output')

Extend the Analysis

Share your analysis with colleagues. Invite them to reproduce or extend your analysis. Work
collaboratively using the Live Editor.

In reality, true power output from a solar installation is significantly affected by local weather
conditions. An interesting extension of this analysis would be to see how cloud cover affects the
results. In the US, you can use data from these government websites.

• Use historical local weather data from the National Weather Service website.

19-82
Create an Interactive Narrative with the Live Editor

• Use measured solar radiation data from the National Solar Radiation Database.

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• “Format Files in the Live Editor” on page 19-31
• MATLAB Live Script Gallery

19-83
19 Live Scripts and Functions

Create Interactive Course Materials Using the Live Editor


The following is an example of how to use live scripts in the classroom. This example shows how to:

• Add equations to explain the underlying mathematics.


• Execute individual sections of MATLAB code.
• Include plots for visualization.
• Use links and images to provide supporting information.
• Experiment with MATLAB code interactively.
• Reinforce concepts with other examples.
• Use live scripts for assignments.

What does it mean to find the nth root of 1?

Add equations to explain the underlying mathematics for concepts that you want to teach. To add an
equation, go to the Insert tab and click the Equation button. Then, select from the symbols and
structures in the Equation tab.

Today we're going to talk about finding the roots of 1. What does it mean to find the nth root of 1?
The nth roots of 1 are the solutions to the equation xn − 1 = 0.

For square roots, this is easy. The values are x = ± 1 = ± 1. For higher-order roots, it gets a bit
more difficult. To find the cube roots of 1 we need to solve the equation x3 − 1 = 0. We can factor this
equation to get

x − 1 x2 + x + 1 = 0 .

So the first cube root is 1. Now we can use the quadratic formula to get the second and third cube
roots.

2
−b ± b − 4ac
x=
2a

Calculate the Cube Roots

To execute individual sections of MATLAB code, go to the Live Editor tab and click the Run Section
button. Output appears together with the code that created it. Create sections using the Section
Break button.

In our case a, b, and c are all equal to 1. The other two roots are calculated from these formulas:

a = 1 ; b = 1 ; c = 1;
roots = [];
roots(1) = 1;
roots(2) = (-b + sqrt(b^2 - 4*a*c))/(2*a); % Use the quadratic formula
roots(3) = (-b - sqrt(b^2 - 4*a*c))/(2*a);

So the full set of cube roots of 1 are:

disp(roots')

19-84
Create Interactive Course Materials Using the Live Editor

1.0000 + 0.0000i
-0.5000 - 0.8660i
-0.5000 + 0.8660i

Displaying Roots in the Complex Plane

Include plots in the Live Editor so students can visualize important concepts.

We can visualize the roots in the complex plane to see their location.
range = 0:0.01:2*pi;
plot(cos(range),sin(range),'k') % Plot the unit circle
axis square; box off
ax = gca;
[Link] = 'origin';
[Link] = 'origin';
hold on
plot(real(roots), imag(roots), 'ro') % Plot the roots

Finding Higher Order Roots

To add supporting information, go to the Insert tab and click the Hyperlink and Image buttons.
Students can use supporting information to explore lecture topics outside of the classroom.

Once you get past n = 3, things get even trickier. For 4th roots we could use the quartic formula
discovered by Lodovico Ferrari in 1540. But this formula is long and unwieldy, and doesn't help us
find roots higher than 4. Luckily, there is a better way, thanks to a 17th century French
mathematician named Abraham de Moivre.

19-85
19 Live Scripts and Functions

Abraham de Moivre was born in Vitry in Champagne on May 26, 1667. He was a contemporary and
friend of Isaac Newton, Edmund Halley, and James Stirling. [Link]
Abraham_de_Moivre

He is best known for de Moivre's theorem that links complex numbers and trigonometry, and for his
work on the normal distribution and probability theory. De Moivre wrote a book on probability theory,
The Doctrine of Chances, said to have been prized by gamblers. De Moivre first discovered Binet's
formula, the closed-form expression for Fibonacci numbers linking the nth power of the golden ratio
φ to the nth Fibonacci number. He was also the first to postulate the Central Limit Theorem, a
cornerstone of probability theory.

de Moivre's theorem states that for any real x and any integer n,

n
cos x + i sin x = cos nx + i sin nx .

How does that help us solve our problem? We also know that for any integer k,

1 = cos 2kπ + i sin 2kπ .

So by de Moivre's theorem we get

1/n 1/n 2kπ 2kπ


1 = cos 2kπ + i sin 2kπ = cos + i sin .
n n

Calculating the nth Roots of 1

Use the Live Editor to experiment with MATLAB code interactively. Add controls to show students
how important parameters affect the analysis. To add controls, go to the Live Editor tab, click the
Control button, and select from the available options.

We can use this last equation to find the nth roots of 1. For example, for any value of n, we can use
the formula above with values of k = 0…n − 1. We can use this MATLAB code to experiment with
different values of n:

n = ;
roots = zeros(1, n);
for k = 0:n-1
roots(k+1) = cos(2*k*pi/n) + 1i*sin(2*k*pi/n); % Calculate the roots

19-86
Create Interactive Course Materials Using the Live Editor

end
disp(roots')

1.0000 + 0.0000i
0.5000 - 0.8660i
-0.5000 - 0.8660i
-1.0000 - 0.0000i
-0.5000 + 0.8660i
0.5000 + 0.8660i

Plotting the roots in the complex plane shows that the roots are equally spaced around the unit circle
at intervals of 2π/n.

cla
plot(cos(range),sin(range),'k') % Plot the unit circle
hold on
plot(real(roots),imag(roots),'ro') % Plot the roots

Finding the nth roots of -1, i, and -i

Use additional examples to reinforce important concepts. Modify code during the lecture to answer
questions or explore ideas in more depth.

We can find the roots of -1, i, and -i just by using extensions of the approach described above. If we
look at the unit circle we see that the values of 1, i, -1, -i appear at angles 0, π/2, π, and 3π/2
respectively.

19-87
19 Live Scripts and Functions

r = ones(1,4);
theta = [0 pi/2 pi 3*pi/2];
[x,y] = pol2cart(theta,r);
cla
plot(cos(range),sin(range),'k') % Plot the unit circle
hold on
plot(x, y, 'ro') % Plot the values of 1, i, -1, and -i
text(x(1)+0.05,y(1),'1') % Add text labels
text(x(2),y(2)+0.1,'i')
text(x(3)-0.1,y(3),'-1')
text(x(4)-0.02,y(4)-0.1,'-i')

Knowing this, we can write the following expression for i:

i = cos 2k + 1/2 π + i sin 2k + 1/2 π .

Taking the nth root of both sides gives

1/n 1/n
i = cos 2k + 1/2 π + i sin 2k + 1/2 π

and by de Moivre's theorem we get

1/n 1/n 2k + 1/2 π 2k + 1/2 π


i = cos 2k + 1/2 π + i sin 2k + 1/2 π = cos + i sin .
n n

19-88
Create Interactive Course Materials Using the Live Editor

Homework

Use live scripts as the basis for assignments. Give students the live script used in the lecture and
have them complete exercises that test their understanding of the material.

Use the techniques described above to complete the following exercises:

Exercise 1: Write MATLAB code to calculate the 3 cube roots of i.

% Put your code here

Exercise 2: Write MATLAB code to calculate the 5 fifth roots of -1.

% Put your code here

Exercise 3: Describe the mathematical approach you would use to calculate the nth roots of an
arbitrary complex number. Include the equations you used in your approach.

(Describe your approach here)

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery

19-89
19 Live Scripts and Functions

Create Examples Using the Live Editor


This example shows how to use the Live Editor to document or create an example for your code. The
example uses formatted text, equations, and runnable code to document the sample function
estimatePanelOutput. It also uses sliders and text fields to allow users to experiment with
different function inputs.

To view and interact with the controls, open this example in MATLAB®.

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• “Add Help for Live Functions” on page 19-59
• “Display Custom Documentation” on page 31-21
• MATLAB Live Script Gallery

19-90
Create an Interactive Form Using the Live Editor

Create an Interactive Form Using the Live Editor


This example shows how to use the Live Editor to create an interactive form that completes a
calculation based on input provided by a user. The example uses drop-down menus and sliders to
prompt the user for input, and then uses a button to run a calculation using the provided input. The
example hides the code to only show the controls and results to the user.

To view and interact with the example, open it in MATLAB®. To view the code for this example in
MATLAB, go to the View tab and click Output Inline or Output on Right.

19-91
19 Live Scripts and Functions

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
19-92
Create an Interactive Form Using the Live Editor

• MATLAB Live Script Gallery

19-93
19 Live Scripts and Functions

Create a Real-time Dashboard Using the Live Editor


This example shows how to use the Live Editor to create a dashboard for displaying and analyzing
real-time data. The example uses a button and a check-box to get and display real-time data on
demand. The example hides the code to only show the controls and results to the user.

To view and interact with the example, open it in MATLAB®. To view the code for this example in
MATLAB, go to the View tab and click Output Inline or Output on Right.

See Also

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery

19-94
20

Function Basics

• “Create Functions in Files” on page 20-2


• “Add Help for Your Program” on page 20-5
• “Configure the Run Button for Functions” on page 20-7
• “Base and Function Workspaces” on page 20-9
• “Share Data Between Workspaces” on page 20-10
• “Check Variable Scope in Editor” on page 20-14
• “Types of Functions” on page 20-17
• “Anonymous Functions” on page 20-20
• “Local Functions” on page 20-25
• “Nested Functions” on page 20-27
• “Variables in Nested and Anonymous Functions” on page 20-33
• “Private Functions” on page 20-34
• “Function Precedence Order” on page 20-35
• “Update Code for R2019b Changes to Function Precedence Order” on page 20-38
• “Indexing into Function Call Results” on page 20-44
20 Function Basics

Create Functions in Files


Both scripts and functions allow you to reuse sequences of commands by storing them in program
files. Scripts are the simplest type of program, since they store commands exactly as you would type
them at the command line. Functions provide more flexibility, primarily because you can pass input
values and return output values. For example, this function named fact computes the factorial of a
number (n) and returns the result (f).

function f = fact(n)
f = prod(1:n);
end

This type of function must be defined within a file, not at the command line. Often, you store a
function in its own file. In that case, the best practice is to use the same name for the function and
the file (in this example, fact.m), since MATLAB associates the program with the file name. Save the
file either in the current folder or in a folder on the MATLAB search path.

You can call the function from the command line, using the same syntax rules that apply to functions
installed with MATLAB. For instances, calculate the factorial of 5.

x = 5;
y = fact(5)

y =

120

Starting in R2016b, another option for storing functions is to include them at the end of a script file.
For instance, create a file named mystats.m with a few commands and two functions, fact and
perm. The script calculates the permutation of (3,2).

x = 3;
y = 2;
z = perm(x,y)

function p = perm(n,r)
p = fact(n)*fact(n-r);
end

function f = fact(n)
f = prod(1:n);
end

Call the script from the command line.

mystats

z =

Syntax for Function Definition


The first line of every function is the definition statement, which includes the following elements.

20-2
Create Functions in Files

function keyword Use lowercase characters for the keyword.


(required)
Output arguments (optional) If your function returns one output, you can specify the output name
after the function keyword.

function myOutput = myFunction(x)

If your function returns more than one output, enclose the output
names in square brackets.

function [one,two,three] = myFunction(x)

If there is no output, you can omit it.

function myFunction(x)

Or you can use empty square brackets.

function [] = myFunction(x)
Function name (required) Valid function names follow the same rules as variable names. They
must start with a letter, and can contain letters, digits, or
underscores.

Note To avoid confusion, use the same name for both the function file
and the first function within the file. MATLAB associates your
program with the file name, not the function name. Script files cannot
have the same name as a function in the file.
Input arguments (optional) If your function accepts any inputs, enclose their names in
parentheses after the function name. Separate inputs with commas.

function y = myFunction(one,two,three)

If there are no inputs, you can omit the parentheses.

Tip When you define a function with multiple input or output arguments, list any required arguments
first. This ordering allows you to call your function without specifying optional arguments.

Contents of Functions and Files


The body of a function can include valid MATLAB expressions, control flow statements, comments,
blank lines, and nested functions. Any variables that you create within a function are stored within a
workspace specific to that function, which is separate from the base workspace.

Program files can contain multiple functions. If the file contains only function definitions, the first
function is the main function, and is the function that MATLAB associates with the file name.
Functions that follow the main function or script code are called local functions. Local functions are
only available within the file.

20-3
20 Function Basics

End Statements
Functions end with either an end statement, the end of the file, or the definition line for a local
function, whichever comes first. The end statement is required if:

• Any function in the file contains a nested function (a function completely contained within its
parent).
• The function is a local function within a function file, and any local function in the file uses the end
keyword.
• The function is a local function within a script file.

Although it is sometimes optional, use end for better code readability.

See Also
function

More About
• “Files and Folders that MATLAB Accesses”
• “Base and Function Workspaces” on page 20-9
• “Types of Functions” on page 20-17
• “Add Functions to Scripts” on page 18-14

20-4
Add Help for Your Program

Add Help for Your Program


This example shows how to provide help for the programs you write. Help text appears in the
Command Window when you use the help function.

Create help text by inserting comments at the beginning of your program. If your program includes a
function, position the help text immediately below the function definition line (the line with the
function keyword). If the function contains an arguments block, you also can position the help text
immediately below the arguments block.

For example, create a function in a file named addme.m that includes help text:

function c = addme(a,b)
% ADDME Add two values together.
% C = ADDME(A) adds A to itself.
%
% C = ADDME(A,B) adds A and B together.
%
% See also SUM, PLUS.

switch nargin
case 2
c = a + b;
case 1
c = a + a;
otherwise
c = 0;
end

When you type help addme at the command line, the help text displays in the Command Window:

addme Add two values together.


C = addme(A) adds A to itself.

C = addme(A,B) adds A and B together.

See also sum, plus.

The first help text line, often called the H1 line, typically includes the program name and a brief
description. The Current Folder browser and the help and lookfor functions use the H1 line to
display information about the program.

Create See also links by including function names at the end of your help text on a line that begins
with % See also. If the function exists on the search path or in the current folder, the help
command displays each of these function names as a hyperlink to its help. Otherwise, help prints the
function names as they appear in the help text.

You can include hyperlinks (in the form of URLs) to Web sites in your help text. Create hyperlinks by
including an HTML <a></a> anchor element. Within the anchor, use a matlab: statement to
execute a web command. For example:

% For more information, see <a href="matlab:


% web('[Link] MathWorks Web site</a>.

End your help text with a blank line (without a %). The help system ignores any comment lines that
appear after the help text block.

20-5
20 Function Basics

Note When multiple programs have the same name, the help command determines which help text
to display by applying the rules described in “Function Precedence Order” on page 20-35. However,
if a program has the same name as a MathWorks function, the Help on Selection option in context
menus always displays documentation for the MathWorks function.

See Also
help | lookfor

Related Examples
• “Add Comments to Programs” on page 18-3
• “Create Help for Classes” on page 31-2
• “Create Help Summary Files — Contents.m” on page 31-10
• “Check Which Programs Have Help” on page 31-8
• “Display Custom Documentation” on page 31-21
• “Use Help Files with MEX Functions”

20-6
Configure the Run Button for Functions

Configure the Run Button for Functions


Functions are program files that accept inputs and return outputs. To run functions that require input
argument values or any other additional setup from the Editor, configure the Run button.

To configure the Run button in the Editor, click Run and add one or more run commands.

For example:

1 Create the function myfunction.m that performs a calculation using the inputs x and y and
stores the results in z.
function z = myfunction(x,y)
z = x.^2 + y;
2 Go to the Editor tab and click Run . MATLAB displays the list of commands available for
running the function.

3 Click the last item in the list and replace the text type code to run with a call to the function
including the required input arguments. For example, enter the text result =
myfunction(1:10,5) to run myfunction with the input arguments 1:10 and 5, and store the
results in the variable result. MATLAB replaces the default command with the newly added
command.

To run multiple commands at once, enter the commands on the same line. For example, enter the
text a = 1:10; b = 5; result = myfunction(a,b) to create the variables a and b and
then call myfunction with a and b as the input arguments.

Note If you define a run command that creates a variable with the same name as a variable in
the base workspace, the run command variable overwrites the base workspace variable when you
run that run command.
4
Click the Run button. MATLAB runs the function using the first run command in the list. For
example, click Run to run myfunction using the command result =
myfunction(1:10,5). MATLAB displays the result in the Command Window.

20-7
20 Function Basics

result =

6 9 14 21 30 41 54 69 86

To run the function using a different run command from the list, click Run and select the
desired command. When you select a run command from the list, it becomes the default for the
Run button.

To edit or delete an existing run command, click Run , right-click the command, and then select
Edit or Delete.

Note Running live functions using the Run button is not supported in the Live Editor. To run a
live function, call it from the Command Window or from a script or live script.

See Also

More About
• “Calling Functions”
• “Create Functions in Files” on page 20-2
• “Create Live Functions” on page 19-56

20-8
Base and Function Workspaces

Base and Function Workspaces


This topic explains the differences between the base workspace and function workspaces, including
workspaces for local functions, nested functions, and scripts.

The base workspace stores variables that you create at the command line. This includes any variables
that scripts create, assuming that you run the script from the command line or from the Editor.
Variables in the base workspace exist until you clear them or end your MATLAB session.

Functions do not use the base workspace. Every function has its own function workspace. Each
function workspace is separate from the base workspace and all other workspaces to protect the
integrity of the data. Even local functions in a common file have their own workspaces. Variables
specific to a function workspace are called local variables. Typically, local variables do not remain in
memory from one function call to the next.

When you call a script from a function, the script uses the function workspace.

Like local functions, nested functions have their own workspaces. However, these workspaces are
unique in two significant ways:

• Nested functions can access and modify variables in the workspaces of the functions that contain
them.
• All of the variables in nested functions or the functions that contain them must be explicitly
defined. That is, you cannot call a function or script that assigns values to variables unless those
variables already exist in the function workspace.

See Also

Related Examples
• “Share Data Between Workspaces” on page 20-10

More About
• “Nested Functions” on page 20-27

20-9
20 Function Basics

Share Data Between Workspaces


In this section...
“Introduction” on page 20-10
“Best Practice: Passing Arguments” on page 20-10
“Nested Functions” on page 20-10
“Persistent Variables” on page 20-11
“Global Variables” on page 20-12
“Evaluating in Another Workspace” on page 20-12

Introduction
This topic shows how to share variables between workspaces or allow them to persist between
function executions.

In most cases, variables created within a function are local variables known only within that function.
Local variables are not available at the command line or to any other function. However, there are
several ways to share data between functions or workspaces.

Best Practice: Passing Arguments


The most secure way to extend the scope of a function variable is to use function input and output
arguments, which allow you to pass values of variables.

For example, create two functions, update1 and update2, that share and modify an input value.
update2 can be a local function in the file update1.m, or can be a function in its own file,
update2.m.

function y1 = update1(x1)
y1 = 1 + update2(x1);

function y2 = update2(x2)
y2 = 2 * x2;

Call the update1 function from the command line and assign to variable Y in the base workspace:

X = [1,2,3];
Y = update1(X)

Y =
3 5 7

Nested Functions
A nested function has access to the workspaces of all functions in which it is nested. So, for example,
a nested function can use a variable (in this case, x) that is defined in its parent function:

function primaryFx
x = 1;
nestedFx

20-10
Share Data Between Workspaces

function nestedFx
x = x + 1;
end
end

When parent functions do not use a given variable, the variable remains local to the nested function.
For example, in this version of primaryFx, the two nested functions have their own versions of x that
cannot interact with each other.

function primaryFx
nestedFx1
nestedFx2

function nestedFx1
x = 1;
end

function nestedFx2
x = 2;
end
end

For more information, see “Nested Functions” on page 20-27.

Persistent Variables
When you declare a variable within a function as persistent, the variable retains its value from one
function call to the next. Other local variables retain their value only during the current execution of
a function. Persistent variables are equivalent to static variables in other programming languages.

Declare variables using the persistent keyword before you use them. MATLAB initializes persistent
variables to an empty matrix, [].

For example, define a function in a file named findSum.m that initializes a sum to 0, and then adds to
the value on each iteration.

function findSum(inputvalue)
persistent SUM_X

if isempty(SUM_X)
SUM_X = 0;
end
SUM_X = SUM_X + inputvalue;

When you call the function, the value of SUM_X persists between subsequent executions.

These operations clear the persistent variables for a function:

• clear all
• clear functionname
• Editing the function file

To prevent clearing persistent variables, lock the function file using mlock.

20-11
20 Function Basics

Global Variables
Global variables are variables that you can access from functions or from the command line. They
have their own workspace, which is separate from the base and function workspaces.

However, global variables carry notable risks. For example:

• Any function can access and update a global variable. Other functions that use the variable might
return unexpected results.
• If you unintentionally give a “new” global variable the same name as an existing global variable,
one function can overwrite the values expected by another. This error is difficult to diagnose.

Use global variables sparingly, if at all.

If you use global variables, declare them using the global keyword before you access them within
any particular location (function or command line). For example, create a function in a file called
falling.m:
function h = falling(t)
global GRAVITY
h = 1/2*GRAVITY*t.^2;

Then, enter these commands at the prompt:


global GRAVITY
GRAVITY = 32;
y = falling((0:.1:5)');

The two global statements make the value assigned to GRAVITY at the command prompt available
inside the function. However, as a more robust alternative, redefine the function to accept the value
as an input:
function h = falling(t,gravity)
h = 1/2*gravity*t.^2;

Then, enter these commands at the prompt:


GRAVITY = 32;
y = falling((0:.1:5)',GRAVITY);

Evaluating in Another Workspace


The evalin and assignin functions allow you to evaluate commands or variable names from
character vectors and specify whether to use the current or base workspace.

Like global variables, these functions carry risks of overwriting existing data. Use them sparingly.

evalin and assignin are sometimes useful for callback functions in graphical user interfaces to
evaluate against the base workspace. For example, create a list box of variable names from the base
workspace:
function listBox
figure
lb = uicontrol('Style','listbox','Position',[10 10 100 100],...
'Callback',@update_listBox);
update_listBox(lb)

20-12
Share Data Between Workspaces

function update_listBox(src,~)
vars = evalin('base','who');
[Link] = vars;

For other programming applications, consider argument passing and the techniques described in
“Alternatives to the eval Function” on page 2-86.

See Also

More About
• “Base and Function Workspaces” on page 20-9

20-13
20 Function Basics

Check Variable Scope in Editor


In this section...
“Use Automatic Function and Variable Highlighting” on page 20-14
“Example of Using Automatic Function and Variable Highlighting” on page 20-14

Scoping issues can be the source of some coding problems. For instance, if you are unaware that
nested functions share a particular variable, the results of running your code might not be as you
expect. Similarly, mistakes in usage of local, global, and persistent variables can cause unexpected
results.

The Code Analyzer does not always indicate scoping issues because sharing a variable across
functions is not an error—it may be your intent. Use MATLAB function and variable highlighting
features to identify when and where your code uses functions and variables. If you have an active
Internet connection, you can watch the Variable and Function Highlighting video for an overview of
the major features.

For conceptual information on nested functions and the various types of MATLAB variables, see
“Sharing Variables Between Parent and Nested Functions” on page 20-28 and “Share Data Between
Workspaces” on page 20-10.

Use Automatic Function and Variable Highlighting


By default, the Editor indicates functions, local variables, and variables with shared scope in various
shades of blue. Variables with shared scope include: global variables on page 20-12, persistent
variables on page 20-11, and variables within nested functions. (For more information, see “Nested
Functions” on page 20-10.)

To enable and disable highlighting or to change the colors, click Preferences and select
MATLAB > Colors > Programming tools. In MATLAB Online, highlighting is enabled by default
and changing the preferences for highlighting is not available.

By default, the Editor:

• Highlights all instances of a given function or local variable in sky blue when you place the cursor
within a function or variable name. For instance:

• Displays a variable with shared scope in teal blue, regardless of the cursor location. For instance:

Example of Using Automatic Function and Variable Highlighting


Consider the code for a function rowsum:
function rowTotals = rowsum
% Add the values in each row and
% store them in a new array

x = ones(2,10);

20-14
Check Variable Scope in Editor

[n, m] = size(x);
rowTotals = zeros(1,n);
for i = 1:n
rowTotals(i) = addToSum;
end

function colsum = addToSum


colsum = 0;
thisrow = x(i,:);
for i = 1:m
colsum = colsum + thisrow(i);
end
end

end

When you run this code, instead of returning the sum of the values in each row and displaying:

ans =

10 10

MATLAB displays:

ans =

0 0 0 0 0 0 0 0 0 10

Examine the code by following these steps:

1
On the Home tab in the Environment section, click Preferences and select MATLAB >
Colors > Programming tools. Ensure that Automatically highlight and Variables with
shared scope are selected.
2 Copy the rowsum code into the Editor.

Notice the variable appears in teal blue, which indicates i is not a local variable. Both the
rowTotals function and the addToSum functions set and use the variable i.

The variable n, at line 6 appears in black, indicating that it does not span multiple functions.

20-15
20 Function Basics

3 Hover the mouse pointer over an instance of variable i.

A tooltip appears: The scope of variable 'i' spans multiple functions.


4 Click the tooltip link for information about variables whose scope span multiple functions.
5 Click an instance of i.

Every reference to i highlights in sky blue and markers appear in the indicator bar on the right
side of the Editor.

6 Hover over one of the indicator bar markers.

A tooltip appears and displays the name of the function or variable and the line of code
represented by the marker.
7 Click a marker to navigate to the line indicated in tooltip for that marker.

This is particularly useful when your file contains more code than you can view at one time in the
Editor.

Fix the code by changing the instance of i at line 15 to y.

You can see similar highlighting effects when you click on a function reference. For instance, click on
addToSum.

20-16
Types of Functions

Types of Functions
In this section...
“Local and Nested Functions in a File” on page 20-17
“Private Functions in a Subfolder” on page 20-18
“Anonymous Functions Without a File” on page 20-18

Local and Nested Functions in a File


Program files can contain multiple functions. Local and nested functions are useful for dividing
programs into smaller tasks, making it easier to read and maintain your code.

Local functions are subroutines that are available within the same file. Local functions are the most
common way to break up programmatic tasks. In a function file, which contains only function
definitions, local functions can appear in the file in any order after the main function in the file. In a
script file, which contains commands and function definitions, local function must be at the end of the
file. (Functions in scripts are supported in R2016b or later.)

For example, create a function file named myfunction.m that contains a main function,
myfunction, and two local functions, squareMe and doubleMe:

function b = myfunction(a)
b = squareMe(a)+doubleMe(a);
end
function y = squareMe(x)
y = x.^2;
end
function y = doubleMe(x)
y = x.*2;
end

You can call the main function from the command line or another program file, although the local
functions are only available to myfunction:

myfunction(pi)

ans =
16.1528

Nested functions are completely contained within another function. The primary difference between
nested functions and local functions is that nested functions can use variables defined in parent
functions without explicitly passing those variables as arguments.

Nested functions are useful when subroutines share data, such as applications that pass data
between components. For example, create a function that allows you to set a value between 0 and 1
using either a slider or an editable text box. If you use nested functions for the callbacks, the slider
and text box can share the value and each other’s handles without explicitly passing them:

function myslider
value = 0;
f = figure;
s = uicontrol(f,'Style','slider','Callback',@slider);
e = uicontrol(f,'Style','edit','Callback',@edittext,...

20-17
20 Function Basics

'Position',[100,20,100,20]);

function slider(obj,~)
value = [Link];
[Link] = num2str(value);
end
function edittext(obj,~)
value = str2double([Link]);
[Link] = value;
end

end

Private Functions in a Subfolder


Like local or nested functions, private functions are accessible only to functions in a specific location.
However, private functions are not in the same file as the functions that can call them. Instead, they
are in a subfolder named private. Private functions are available only to functions in the folder
immediately above the private folder. Use private functions to separate code into different files, or
to share code between multiple, related functions.

Anonymous Functions Without a File


Anonymous functions allow you to define a function without creating a program file, as long as the
function consists of a single statement. A common application of anonymous functions is to define a
mathematical expression, and then evaluate that expression over a range of values using a MATLAB®
function function, i.e., a function that accepts a function handle as an input.

For example, this statement creates a function handle named s for an anonymous function:

s = @(x) sin(1./x);

This function has a single input, x. The @ operator creates the function handle.

You can use the function handle to evaluate the function for particular values, such as

y = s(pi)

y = 0.3130

Or, you can pass the function handle to a function that evaluates over a range of values, such as
fplot:

range = [0.01,0.1];
fplot(s,range)

20-18
Types of Functions

See Also

More About
• “Local Functions” on page 20-25
• “Nested Functions” on page 20-27
• “Private Functions” on page 20-34
• “Anonymous Functions” on page 20-20

20-19
20 Function Basics

Anonymous Functions

In this section...
“What Are Anonymous Functions?” on page 20-20
“Variables in the Expression” on page 20-21
“Multiple Anonymous Functions” on page 20-21
“Functions with No Inputs” on page 20-22
“Functions with Multiple Inputs or Outputs” on page 20-22
“Arrays of Anonymous Functions” on page 20-23

What Are Anonymous Functions?


An anonymous function is a function that is not stored in a program file, but is associated with a
variable whose data type is function_handle. Anonymous functions can accept multiple inputs and
return one output. They can contain only a single executable statement.

For example, create a handle to an anonymous function that finds the square of a number:

sqr = @(x) x.^2;

Variable sqr is a function handle. The @ operator creates the handle, and the parentheses ()
immediately after the @ operator include the function input arguments. This anonymous function
accepts a single input x, and implicitly returns a single output, an array the same size as x that
contains the squared values.

Find the square of a particular value (5) by passing the value to the function handle, just as you
would pass an input argument to a standard function.

a = sqr(5)

a =
25

Many MATLAB functions accept function handles as inputs so that you can evaluate functions over a
range of values. You can create handles either for anonymous functions or for functions in program
files. The benefit of using anonymous functions is that you do not have to edit and maintain a file for a
function that requires only a brief definition.

For example, find the integral of the sqr function from 0 to 1 by passing the function handle to the
integral function:

q = integral(sqr,0,1);

You do not need to create a variable in the workspace to store an anonymous function. Instead, you
can create a temporary function handle within an expression, such as this call to the integral
function:

q = integral(@(x) x.^2,0,1);

20-20
Anonymous Functions

Variables in the Expression


Function handles can store not only an expression, but also variables that the expression requires for
evaluation.

For example, create a handle to an anonymous function that requires coefficients a, b, and c.

a = 1.3;
b = .2;
c = 30;
parabola = @(x) a*x.^2 + b*x + c;

Because a, b, and c are available at the time you create parabola, the function handle includes
those values. The values persist within the function handle even if you clear the variables:

clear a b c
x = 1;
y = parabola(x)

y =
31.5000

To supply different values for the coefficients, you must create a new function handle:

a = -3.9;
b = 52;
c = 0;
parabola = @(x) a*x.^2 + b*x + c;

x = 1;
y = parabola(1)

y =
48.1000

You can save function handles and their associated values in a MAT-file and load them in a subsequent
MATLAB session using the save and load functions, such as

save [Link] parabola

Use only explicit variables when constructing anonymous functions. If an anonymous function
accesses any variable or nested function that is not explicitly referenced in the argument list or body,
MATLAB throws an error when you invoke the function. Implicit variables and function calls are often
encountered in the functions such as eval, evalin, assignin, and load. Avoid using these
functions in the body of anonymous functions.

Multiple Anonymous Functions


The expression in an anonymous function can include another anonymous function. This is useful for
passing different parameters to a function that you are evaluating over a range of values. For
example, you can solve the equation

20-21
20 Function Basics

for varying values of c by combining two anonymous functions:

g = @(c) (integral(@(x) (x.^2 + c*x + 1),0,1));

Here is how to derive this statement:

1 Write the integrand as an anonymous function,

@(x) (x.^2 + c*x + 1)


2 Evaluate the function from zero to one by passing the function handle to integral,

integral(@(x) (x.^2 + c*x + 1),0,1)


3 Supply the value for c by constructing an anonymous function for the entire equation,

g = @(c) (integral(@(x) (x.^2 + c*x + 1),0,1));

The final function allows you to solve the equation for any value of c. For example:

g(2)

ans =
2.3333

Functions with No Inputs


If your function does not require any inputs, use empty parentheses when you define and call the
anonymous function. For example:

t = @() datestr(now);
d = t()

d =
26-Jan-2012 15:11:47

Omitting the parentheses in the assignment statement creates another function handle, and does not
execute the function:

d = t

d =
@() datestr(now)

Functions with Multiple Inputs or Outputs


Anonymous functions require that you explicitly specify the input arguments as you would for a
standard function, separating multiple inputs with commas. For example, this function accepts two
inputs, x and y:

myfunction = @(x,y) (x^2 + y^2 + x*y);

x = 1;
y = 10;
z = myfunction(x,y)

z = 111

20-22
Anonymous Functions

However, an anonymous function returns only one output. If the expression in the function returns
multiple outputs, then you can request them when you invoke the function handle.

For example, the ndgrid function can return as many outputs as the number of input vectors. This
anonymous function that calls ndgrid returns only one output (mygrid). Invoke mygrid to access
the outputs returned by the ndgrid function.

c = 10;
mygrid = @(x,y) ndgrid((-x:x/c:x),(-y:y/c:y));
[x,y] = mygrid(pi,2*pi);

You can use the output from mygrid to create a mesh or surface plot:

z = sin(x) + cos(y);
mesh(x,y,z)

Arrays of Anonymous Functions


Although most MATLAB fundamental data types support multidimensional arrays, function handles
must be scalars (single elements). However, you can store multiple function handles using a cell array
or structure array. The most common approach is to use a cell array, such as

f = {@(x)x.^2;
@(y)y+10;
@(x,y)x.^2+y+10};

20-23
20 Function Basics

When you create the cell array, keep in mind that MATLAB interprets spaces as column separators.
Either omit spaces from expressions, as shown in the previous code, or enclose expressions in
parentheses, such as

f = {@(x) (x.^2);
@(y) (y + 10);
@(x,y) (x.^2 + y + 10)};

Access the contents of a cell using curly braces. For example, f{1} returns the first function handle.
To execute the function, pass input values in parentheses after the curly braces:

x = 1;
y = 10;

f{1}(x)
f{2}(y)
f{3}(x,y)

ans =
1

ans =
20

ans =
21

See Also

More About
• “Create Function Handle” on page 13-2
• “Types of Functions” on page 20-17

20-24
Local Functions

Local Functions
This topic explains the term local function, and shows how to create and use local functions.

MATLAB program files can contain code for more than one function. In a function file, the first
function in the file is called the main function. This function is visible to functions in other files, or
you can call it from the command line. Additional functions within the file are called local functions,
and they can occur in any order after the main function. Local functions are only visible to other
functions in the same file. They are equivalent to subroutines in other programming languages, and
are sometimes called subfunctions.

As of R2016b, you can also create local functions in a script file, as long as they all appear after the
last line of script code. For more information, see “Add Functions to Scripts” on page 18-14.

For example, create a function file named mystats.m that contains a main function, mystats, and
two local functions, mymean and mymedian.

function [avg, med] = mystats(x)


n = length(x);
avg = mymean(x,n);
med = mymedian(x,n);
end

function a = mymean(v,n)
% MYMEAN Example of a local function.

a = sum(v)/n;
end

function m = mymedian(v,n)
% MYMEDIAN Another example of a local function.

w = sort(v);
if rem(n,2) == 1
m = w((n + 1)/2);
else
m = (w(n/2) + w(n/2 + 1))/2;
end
end

The local functions mymean and mymedian calculate the average and median of the input list. The
main function mystats determines the length of the list n and passes it to the local functions.

Although you cannot call a local function from the command line or from functions in other files, you
can access its help using the help function. Specify names of both the file and the local function,
separating them with a > character:

help mystats>mymean

mymean Example of a local function.

Local functions in the current file have precedence over functions in other files. That is, when you call
a function within a program file, MATLAB checks whether the function is a local function before
looking for other main functions. Therefore, you can create an alternate version of a particular
function while retaining the original in another file.

20-25
20 Function Basics

All functions, including local functions, have their own workspaces that are separate from the base
workspace. Local functions cannot access variables used by other functions unless you pass them as
arguments. In contrast, nested functions (functions completely contained within another function)
can access variables used by the functions that contain them.

See Also
localfunctions

More About
• “Nested Functions” on page 20-27
• “Function Precedence Order” on page 20-35
• “Types of Functions” on page 20-17

20-26
Nested Functions

Nested Functions

In this section...
“What Are Nested Functions?” on page 20-27
“Requirements for Nested Functions” on page 20-27
“Sharing Variables Between Parent and Nested Functions” on page 20-28
“Using Handles to Store Function Parameters” on page 20-29
“Visibility of Nested Functions” on page 20-31

What Are Nested Functions?


A nested function is a function that is completely contained within a parent function. Any function in
a program file can include a nested function.

For example, this function named parent contains a nested function named nestedfx:

function parent
disp('This is the parent function')
nestedfx

function nestedfx
disp('This is the nested function')
end

end

The primary difference between nested functions and other types of functions is that they can access
and modify variables that are defined in their parent functions. As a result:

• Nested functions can use variables that are not explicitly passed as input arguments.
• In a parent function, you can create a handle to a nested function that contains the data necessary
to run the nested function.

Requirements for Nested Functions


• Typically, functions do not require an end statement. However, to nest any function in a program
file, all functions in that file must use an end statement.
• You cannot define a nested function inside any of the MATLAB program control statements, such
as if/elseif/else, switch/case, for, while, or try/catch.
• You must call a nested function either directly by name (without using feval), or using a function
handle that you created using the @ operator (and not str2func).
• All of the variables in nested functions or the functions that contain them must be explicitly
defined. That is, you cannot call a function or script that assigns values to variables unless those
variables already exist in the function workspace. (For more information, see “Variables in Nested
and Anonymous Functions” on page 20-33.)

20-27
20 Function Basics

Sharing Variables Between Parent and Nested Functions


In general, variables in one function workspace are not available to other functions. However, nested
functions can access and modify variables in the workspaces of the functions that contain them.

This means that both a nested function and a function that contains it can modify the same variable
without passing that variable as an argument. For example, in each of these functions, main1 and
main2, both the main function and the nested function can access variable x:

function main1 function main2


x = 5; nestfun2
nestfun1
function nestfun2
function nestfun1 x = 5;
x = x + 1; end
end
x = x + 1;
end end

When parent functions do not use a given variable, the variable remains local to the nested function.
For example, in this function named main, the two nested functions have their own versions of x that
cannot interact with each other:

function main
nestedfun1
nestedfun2

function nestedfun1
x = 1;
end

function nestedfun2
x = 2;
end
end

Functions that return output arguments have variables for the outputs in their workspace. However,
parent functions only have variables for the output of nested functions if they explicitly request them.
For example, this function parentfun does not have variable y in its workspace:

function parentfun
x = 5;
nestfun;

function y = nestfun
y = x + 1;
end

end

If you modify the code as follows, variable z is in the workspace of parentfun:

function parentfun
x = 5;
z = nestfun;

function y = nestfun

20-28
Nested Functions

y = x + 1;
end

end

Using Handles to Store Function Parameters


Nested functions can use variables from three sources:

• Input arguments
• Variables defined within the nested function
• Variables defined in a parent function, also called externally scoped variables

When you create a function handle for a nested function, that handle stores not only the name of the
function, but also the values of externally scoped variables.

For example, create a function in a file named makeParabola.m. This function accepts several
polynomial coefficients, and returns a handle to a nested function that calculates the value of that
polynomial.

function p = makeParabola(a,b,c)
p = @parabola;

function y = parabola(x)
y = a*x.^2 + b*x + c;
end

end

The makeParabola function returns a handle to the parabola function that includes values for
coefficients a, b, and c.

At the command line, call the makeParabola function with coefficient values of 1.3, .2, and 30. Use
the returned function handle p to evaluate the polynomial at a particular point:

p = makeParabola(1.3,.2,30);

X = 25;
Y = p(X)

Y =
847.5000

Many MATLAB functions accept function handle inputs to evaluate functions over a range of values.
For example, plot the parabolic equation from -25 to +25:

fplot(p,[-25,25])

20-29
20 Function Basics

You can create multiple handles to the parabola function that each use different polynomial
coefficients:

firstp = makeParabola(0.8,1.6,32);
secondp = makeParabola(3,4,50);
range = [-25,25];

figure
hold on
fplot(firstp,range)
fplot(secondp,range,'r:')
hold off

20-30
Nested Functions

Visibility of Nested Functions


Every function has a certain scope, that is, a set of other functions to which it is visible. A nested
function is available:

• From the level immediately above it. (In the following code, function A can call B or D, but not C or
E.)
• From a function nested at the same level within the same parent function. (Function B can call D,
and D can call B.)
• From a function at any lower level. (Function C can call B or D, but not E.)
function A(x, y) % Main function
B(x,y)
D(y)

function B(x,y) % Nested in A


C(x)
D(y)

function C(x) % Nested in B


D(x)
end
end

function D(x) % Nested in A


E(x)

20-31
20 Function Basics

function E(x) % Nested in D


disp(x)
end
end
end

The easiest way to extend the scope of a nested function is to create a function handle and return it
as an output argument, as shown in “Using Handles to Store Function Parameters” on page 20-29.
Only functions that can call a nested function can create a handle to it.

See Also

More About
• “Variables in Nested and Anonymous Functions” on page 20-33
• “Create Function Handle” on page 13-2
• “Argument Checking in Nested Functions” on page 21-8
• “Types of Functions” on page 20-17

20-32
Variables in Nested and Anonymous Functions

Variables in Nested and Anonymous Functions


The scoping rules for nested and anonymous functions require that all variables used within the
function be present in the text of the code.

If you attempt to dynamically add a variable to the workspace of an anonymous function, a nested
function, or a function that contains a nested function, then MATLAB issues an error of the form

Attempt to add variable to a static workspace.

This table describes typical operations that attempt dynamic assignment, and the recommended ways
to avoid it.

Type of Operation Best Practice to Avoid Dynamic Assignment


load Specify the variable name as an input to the load
function. Or, assign the output from the load function
to a structure array.
eval, evalin, or assignin If possible, avoid using these functions altogether. See
“Alternatives to the eval Function” on page 2-86.
Calling a MATLAB script that creates a Convert the script to a function and pass the variable
variable using arguments. This approach also clarifies the code.
Assigning to a variable in the MATLAB Assign the variable into the base workspace, such as
debugger
K>> assignin('base','X',myvalue)

Another way to avoid dynamic assignment is to explicitly declare the variable within the function. For
example, suppose a script named makeX.m assigns a value to variable X. A function that calls makeX
and explicitly declares X avoids the dynamic assignment error because X is in the function workspace.
A common way to declare a variable is to initialize its value to an empty array:

function noerror
X = [];
nestedfx

function nestedfx
makeX
end
end

See Also

More About
• “Base and Function Workspaces” on page 20-9

20-33
20 Function Basics

Private Functions
This topic explains the term private function, and shows how to create and use private functions.

Private functions are useful when you want to limit the scope of a function. You designate a function
as private by storing it in a subfolder with the name private. Then, the function is available only to
functions and scripts in the folder immediately above the private subfolder.

For example, within a folder that is on the MATLAB search path, create a subfolder named private.
Do not add private to the path. Within the private folder, create a function in a file named
findme.m:

function findme
% FINDME An example of a private function.

disp('You found the private function.')

Change to the folder that contains the private folder and create a file named visible.m.

function visible
findme

Change your current folder to any location and call the visible function.

visible

You found the private function.

Although you cannot call the private function from the command line or from functions outside the
parent of the private folder, you can access its help:

help private/findme

findme An example of a private function.

Private functions have precedence over standard functions, so MATLAB finds a private function
named test.m before a nonprivate program file named test.m. This allows you to create an
alternate version of a particular function while retaining the original in another folder.

See Also

More About
• “Function Precedence Order” on page 20-35
• “Types of Functions” on page 20-17

20-34
Function Precedence Order

Function Precedence Order


This topic explains how MATLAB determines which function to call when multiple functions in the
current scope have the same name. The current scope includes the current file, an optional private
subfolder relative to the currently running function, the current folder, and the MATLAB path.

MATLAB uses this precedence order:


1 Variables

Before assuming that a name matches a function, MATLAB checks for a variable with that name
in the current workspace.

Note If you create a variable with the same name as a function, MATLAB cannot run that
function until you clear the variable from memory.
2 Function or class whose name matches an explicitly imported name

The import function allows functions with compound names (names comprised of several parts
joined by dots) to be called using only the final part of the compound name. When a function
name matches an explicit (non-wildcard) imported function, MATLAB uses the imported
compound name and gives it precedence over all other functions with the same name.
3 Nested functions within the current function
4 Local functions within the current file
5 Function or class whose name matches a wildcard-based imported name

When a function name matches a wildcard-based imported function, MATLAB uses the imported
compound name and gives it precedence over all other functions with the same name, except for
nested and local functions.
6 Private functions

Private functions are functions in a subfolder named private that is immediately below the
folder of the currently running file.
7 Object functions

An object function accepts a particular class of object in its input argument list. When there are
multiple object functions with the same name, MATLAB checks the classes of the input
arguments to determine which function to use.
8 Class constructors in @ folders

MATLAB uses class constructors to create a variety of objects (such as timeseries or


audioplayer), and you can define your own classes using object-oriented programming. For
example, if you create a class folder @polynom and a constructor function @polynom/
polynom.m, the constructor takes precedence over other functions named polynom.m anywhere
on the path.
9 Loaded Simulink® models
10 Functions in the current folder
11 Functions elsewhere on the path, in order of appearance

When determining the precedence of functions within the same folder, MATLAB considers the file
type, in this order:

20-35
20 Function Basics

1 Built-in function
2 MEX-function
3 Simulink model files that are not loaded, with file types in this order:

a SLX file
b MDL file
4 Stateflow® chart with a .sfx extension
5 App file (.mlapp) created using MATLAB App Designer
6 Program file with a .mlx extension
7 P-file (that is, an encoded program file with a .p extension)
8 Program file with a .m extension

For example, if MATLAB finds a .m file and a P-file with the same name in the same folder, it uses the
P-file. Because P-files are not automatically regenerated, make sure that you regenerate the P-file
whenever you edit the program file.

To determine the function MATLAB calls for a particular input, include the function name and the
input in a call to the which function.

Change in Rules For Function Precedence Order


Starting in R2019b, MATLAB changes the rules for name resolution, impacting the precedence order
of variables, nested functions, local functions, and external functions. For information about the
changes and tips for updating your code, see “Update Code for R2019b Changes to Function
Precedence Order” on page 20-38.

• Identifiers cannot be used for two purposes inside a function


• Identifiers without explicit declarations might not be treated as variables
• Variables cannot be implicitly shared between parent and nested functions
• Change in precedence of compound name resolution
• Anonymous functions can include resolved and unresolved identifiers

The behavior of the import function has changed.

• Change in precedence of wildcard-based imports


• Fully qualified import functions cannot have the same name as nested functions
• Fully qualified imports shadow outer scope definitions of the same name
• Error handling when import not found
• Nested functions inherit import statements from parent functions

See Also
import

More About
• “What Is the MATLAB Search Path?”

20-36
Function Precedence Order

• Variables on page 1-4


• “Types of Functions” on page 20-17
• “Class Precedence and MATLAB Path”

20-37
20 Function Basics

Update Code for R2019b Changes to Function Precedence


Order
Starting in R2019b, MATLAB changes the rules for name resolution, impacting the precedence order
of variables, nested functions, local functions, and external functions. The new rules simplify and
standardize name resolution. For more information, see “Function Precedence Order” on page 20-35.

These changes impact the behavior of the import function. You should analyze and possibly update
your code. To start, search your code for import statements. For example, use “Find Files and
Folders” to search for .m and .mlx files containing text import. Refer to these search results when
evaluating the effects of the following changes.

Identifiers cannot be used for two purposes inside a function


Starting in R2019b, an error results if you use an identifier, first as a local or imported function, and
then as a variable. In previous releases, an identifier could be used for different purposes within the
scope of a function, which resulted in ambiguous code.

If this behavior change impacts your code, rename either the variable or the function so that they
have different names.

Starting in R2019b Updated Code R2019a and Earlier


The name local is used as the Rename the function local to This code displays 1 then 2.
local function and then a localFcn.
variable. This code errors. function myfunc
function myfunc local(1); % local is a function
function myfunc localFcn(1); local = 2;
local = 2;
% local is an undefined variable disp(local);
local(1); % Errors disp(local); end
local = 2; end
disp(local); function local(x)
end function localFcn(x) disp(x)
disp(x) end
function local(x) end
disp(x)
end

Identifiers without explicit declarations might not be treated as


variables
Starting in R2019b, MATLAB does not use indexing operators to identify the variables in your
program. Previously, an identifier without an explicit declaration was treated as a variable when it
was indexed with a colon, end, or curly braces. For example, x was treated as a variable in
x(a,b,:), x(end), and x{a}.

Consider the following code. MATLAB used to treat x as a variable because of colon-indexing.
Starting in R2019b, if a function of the same name exists on the path, MATLAB treats x as a function.

function myfunc
load [Link]; % [Link] contains variable x
disp(x(:))
end

20-38
Update Code for R2019b Changes to Function Precedence Order

If you intend to use x as a variable from [Link] instead of a function, explicitly declare it.
Similarly, to use an identifier x as a variable obtained from a script, declare it before invoking the
script. This new behavior also applies if the variable is implicitly introduced by the functions sim,
eval, evalc, and assignin.

This table shows some examples of how you can update your code.

Before After
function myfunc function myfunc
load [Link]; load [Link] x;
disp(x(:)) disp(x(:))
end end
function myfunc2 function myfunc2
myscript; % Contains variable x x = [];
disp(x(:)) myscript;
end disp(x(:))
end

Variables cannot be implicitly shared between parent and nested


functions
Starting in R2019b, sharing an identifier as a variable between a nested function on page 20-28 and
its parent function is possible only if the identifier is explicitly declared as a variable in the parent
function.

For example, in the following code, identifier x in myfunc is different from variable x in the nested
function. If x is a function on the path, MATLAB treats x in myfunc as a function and the code runs.
Otherwise, MATLAB throws an error.

function myfunc
nested;
x(3) % x is not a shared variable
function nested
x = [1 2 3];
end
end

In previous releases, if x was a function on the path, MATLAB treated it as a function in myfunc and
as a variable in nested. If x was not a function on the path, MATLAB treated it as a variable shared
between myfunc and nested. This resulted in code whose output was dependent on the state of the
path.

To use an identifier as a variable shared between parent and nested functions, you might need to
update your code. For example, you can initialize the identifier to an empty array in the parent
function.

20-39
20 Function Basics

Before After
function myfunc function myfunc
nested; x = [];
x(3) nested;
function nested x(3)
x = [1 2 3]; function nested
end x = [1 2 3];
end end
end

Change in precedence of wildcard-based imports


Starting in R2019b, imported functions from wildcard-based imports have lower precedence than
variables, nested functions, and local functions. In R2019a and earlier, imports in a function
shadowed local functions and nested functions.

For example, in this code, the statement local() calls myfunc/local instead of [Link] in the
wildcard-based import. The statement nest() calls myfunc/nest instead of [Link].

Starting in R2019b R2019a and Earlier


function myfunc function myfunc
% Import includes functions local and nest % Import includes functions local and nest
import pkg1.* import pkg1.*
local() % Calls myfunc/local local() % Calls [Link] and
% displays warning since R2018a
function nest
end function nest
end
nest(); % Calls myfunc/nest
end nest(); % Calls [Link]
end
function local
end function local
end

In the search results for import, look for statements that include the wildcard character (*).

Fully qualified import functions cannot have the same name as nested
functions
Starting in R2019b, fully qualified imports that share a name with a nested function in the same
scope throw an error.

Starting in R2019b Updated Code R2019a and Earlier


This function errors because it To call function nest from the This function calls function
shares a name with a nested import statement, rename local nest from the import
function in the same scope. function myfunc/nest. statement.

function myfunc function myfunc function myfunc


import [Link] % Errors import [Link] import [Link]
nest(); nest(); nest(); % Calls [Link]

function nest function newNest function nest


end end end
end end end

20-40
Update Code for R2019b Changes to Function Precedence Order

Starting in R2019b Updated Code R2019a and Earlier


This function errors because Rename variable nest. This function modifies variable
declaring a variable with the nest.
same name as the imported function myvarfunc
import [Link] % Errors function myvarfunc
function nest is not supported.
thisNest = 1 import [Link]
function myvarfunc end nest = 1 % Modifies variable nest and
import [Link] % Errors % displays warning since R201
nest = 1 end
end

Fully qualified imports shadow outer scope definitions of the same


name
Starting in R2019b, fully qualified imports always shadow outer scope definitions of the same name.
In R2019a and earlier, a fully qualified import was ignored when it shadowed an identifier in the
outer scope.

Starting in R2019b Updated Code R2019a and Earlier


Local function nest calls To use variable x in local In this code, function nest
function x from imported function nest, pass the variable ignores imported function x.
package. as an argument.
function myfunc
function myfunc function myfunc x = 1;
x = 1; x = 1;
nest(x) function nest
function nest % Import function x
% Import function x function nest(x1) import pkg1.x
import pkg1.x % Import function x % x is a variable
% Calls pkg1.x import pkg1.x x()
x() % Calls pkg1.x with end
end % variable x1 end
end x(x1)
end
end

Error handling when import not found


Starting in R2019b, fully qualified imports that cannot be resolved throw an error with or without
Java. In R2019a and earlier, MATLAB behaved differently depending on whether you started MATLAB
with the -nojvm option. Do not use functions like javachk and usejava to customize error
messages.

20-41
20 Function Basics

Starting in R2019b Updated Code R2019a and Earlier


This code throws an error when Remove call to usejava. This code displays a message
starting MATLAB with the - when starting MATLAB with the
nojvm option. function myfunc -nojvm option.
import [Link] % Errors
function myfunc % Do something with java String class myfunc
function
end
import [Link] % Errors import [Link]

if ~usejava('jvm') if ~usejava('jvm')
% Statement never executes % Display message
disp('This function requires Java'); disp('This function requires Java')
else else
% Do something with Java String class % Do something with Java String cla
end end
end end

Nested functions inherit import statements from parent functions


Starting in R2019b, nested functions inherit import statements from the parent function. In R2019a
and earlier, nested functions did not inherit import statements from their parent functions.

Starting in R2019b R2019a and Earlier


function myfunc function myfunc

% Package p1 has functions plot and bar % Package p1 has functions plot and bar
import [Link] import [Link]
import p1.* import p1.*
nest nest

function nest function nest


plot % Calls [Link] plot % Calls plot function on path
bar % Calls [Link] bar % Calls bar function on path
end end
end end

Change in precedence of compound name resolution


Starting in R2019b, MATLAB resolves compound names differently. A compound name is comprised
of several parts joined by a dot (for example, a.b.c), which can be used to reference package
members. With R2019b, MATLAB resolves compound names by giving precedence to the longest
matching prefix. In previous releases, the precedence order followed a more complex set of rules.

For example, suppose a package pkg contains a class foo with a static method bar and also a
subpackage foo with a function bar.

+pkg/@foo/bar.m % bar is a static method of class foo


+pkg/+foo/bar.m % bar is a function in subpackage foo

In R2019b, a call to which [Link] returns the path to the package function.

which [Link]

+pkg/+foo/bar.m

Previously, a static method took precedence over a package function in cases where a package and a
class had the same name.

20-42
Update Code for R2019b Changes to Function Precedence Order

Anonymous functions can include resolved and unresolved identifiers


Starting in R2019b, anonymous functions can include both resolved and unresolved identifiers. In
previous releases, if any identifiers in an anonymous function were not resolved at creation time, all
identifiers in that anonymous function were unresolved.

Starting in R2019b R2019a and Earlier


To evaluate the anonymous function, MATLAB MATLAB considers lf as an unresolved identifier
calls the local function lf with x defined in along with x, and used x to index into the
myscript because lf in the anonymous function variable lf from myscript.
resolves to the local function.
function myfun
function myfun myscript; % Includes x = 1 and lf = 10
myscript; % Includes x = 1 and lf = 10 f = @()lf(x);
f = @()lf(x); f() % Displays 10
f() % Displays 'Inside lf' end
end
% Local function to myfun
% Local function to myfun function lf(y)
function lf(y) disp('Inside lf');
disp('Inside lf'); end
end

See Also
import

More About
• “Import Classes”

20-43
20 Function Basics

Indexing into Function Call Results


This topic describes how to dot index into temporary variables created by function calls. A temporary
variable is created when the result of a function call is used as an intermediate variable in a larger
expression. The result of the function call in the expression is temporary because the variable it
creates exists only briefly, and is not stored in the MATLAB workspace after execution. An example is
the expression myFunction(x).prop, which calls myFunction with the argument x, and then
returns the prop property of the result. You can invoke any type of function (anonymous, local,
nested, or private) in this way.

Example
Consider the function:
function y = myStruct(x)
y = struct("Afield",x);
end

This function creates a structure with one field, named Afield, and assigns a value to the field. You
can invoke the function and create a structure with a field containing the value 1 with the command:
myStruct(1)

ans =

struct with fields:

Afield: 1

However, if you want to return the field value directly, you can index into the function call result with
the command:
myStruct(1).Afield

ans =

After this command executes, the temporary structure created by the command myStruct(1) no
longer exists, and MATLAB returns only the field value. Conceptually, this usage is the same as
creating the structure, indexing into it, and then deleting it:
S = struct("Afield",1);
[Link]
clear S

Supported Syntaxes
MATLAB supports dot indexing into function call results, as in foo(arg).prop. Other forms of
indexing into function call results (with parentheses such as foo(arg)(2) or with curly braces such
as foo(arg){2}) are not supported. Successful commands must meet the criteria:

• The function is invoked with parentheses, as in foo(arg1,arg2,...).


• The function returns a variable for which dot indexing is defined, such as a structure, table, or
object.

20-44
Indexing into Function Call Results

• The dot indexing subscript is valid.

MATLAB always attempts to apply the dot indexing operation to the temporary variable, even if the
function returns a variable for which dot indexing is not defined. For example, if you try to index into
the matrix created by magic(3), then you get an error.

magic(3).field

Dot indexing is not supported for variables of this type.

You can add more indexing commands onto the end of an expression as long as the temporary
variables can continue to be indexed. For example, consider the expression:

table(rand(10,2)).Var1(3,:)

In this expression, you index into a table to get the matrix it contains, and then index into the matrix
to get the third row:

• table(rand(10,2)) creates a table with one variable named Var1. The variable contains a 10-
by-2 matrix.
• table(rand(10,2)).Var1 returns the 10-by-2 matrix contained in Var1.
• table(rand(10,2)).Var1(3,:) returns the third row in the matrix contained in Var1.

See Also
function | subsref

More About
• “Types of Functions” on page 20-17
• “Array Indexing”
• “Access Data in Tables” on page 9-34

20-45
21

Function Arguments

• “Find Number of Function Arguments” on page 21-2


• “Support Variable Number of Inputs” on page 21-4
• “Support Variable Number of Outputs” on page 21-5
• “Validate Number of Function Arguments” on page 21-6
• “Argument Checking in Nested Functions” on page 21-8
• “Ignore Function Inputs” on page 21-10
• “Check Function Inputs with validateattributes” on page 21-11
• “Parse Function Inputs” on page 21-13
• “Input Parser Validation Functions” on page 21-16
21 Function Arguments

Find Number of Function Arguments


This example shows how to determine how many input or output arguments your function receives
using nargin and nargout.

Input Arguments

Create a function in a file named addme.m that accepts up to two inputs. Identify the number of
inputs with nargin.
function c = addme(a,b)

switch nargin
case 2
c = a + b;
case 1
c = a + a;
otherwise
c = 0;
end

Call addme with one, two, or zero input arguments.


addme(42)

ans =
84

addme(2,4000)

ans =
4002

addme

ans =
0

Output Arguments

Create a new function in a file named addme2.m that can return one or two outputs (a result and its
absolute value). Identify the number of requested outputs with nargout.
function [result,absResult] = addme2(a,b)

switch nargin
case 2
result = a + b;
case 1
result = a + a;
otherwise
result = 0;
end

if nargout > 1
absResult = abs(result);
end

Call addme2 with one or two output arguments.

21-2
Find Number of Function Arguments

value = addme2(11,-22)

value =
-11

[value,absValue] = addme2(11,-22)

value =
-11

absValue =
11

Functions return outputs in the order they are declared in the function definition.

See Also
nargin | narginchk | nargout | nargoutchk

21-3
21 Function Arguments

Support Variable Number of Inputs


This example shows how to define a function that accepts a variable number of input arguments using
varargin. The varargin argument is a cell array that contains the function inputs, where each
input is in its own cell.

Create a function in a file named plotWithTitle.m that accepts a variable number of paired (x,y)
inputs for the plot function and an optional title. If the function receives an odd number of inputs, it
assumes that the last input is a title.

function plotWithTitle(varargin)
if rem(nargin,2) ~= 0
myTitle = varargin{nargin};
numPlotInputs = nargin - 1;
else
myTitle = 'Default Title';
numPlotInputs = nargin;
end

plot(varargin{1:numPlotInputs})
title(myTitle)

Because varargin is a cell array, you access the contents of each cell using curly braces, {}. The
syntax varargin{1:numPlotInputs} creates a comma-separated list of inputs to the plot
function.

Call plotWithTitle with two sets of (x,y) inputs and a title.

x = [1:.1:10];
y1 = sin(x);
y2 = cos(x);
plotWithTitle(x,y1,x,y2,'Sine and Cosine')

You can use varargin alone in an input argument list, or at the end of the list of inputs, such as

function myfunction(a,b,varargin)

In this case, varargin{1} corresponds to the third input passed to the function, and nargin returns
length(varargin) + 2.

See Also
nargin | varargin

Related Examples
• “Access Data in Cell Array” on page 12-5

More About
• “Argument Checking in Nested Functions” on page 21-8
• “Comma-Separated Lists” on page 2-79

21-4
Support Variable Number of Outputs

Support Variable Number of Outputs


This example shows how to define a function that returns a variable number of output arguments
using varargout. Output varargout is a cell array that contains the function outputs, where each
output is in its own cell.

Create a function in a file named magicfill.m that assigns a magic square to each requested
output.

function varargout = magicfill


nOutputs = nargout;
varargout = cell(1,nOutputs);

for k = 1:nOutputs
varargout{k} = magic(k);
end

Indexing with curly braces {} updates the contents of a cell.

Call magicfill and request three outputs.

[first,second,third] = magicfill

first =
1

second =
1 3
4 2

third =
8 1 6
3 5 7
4 9 2

MATLAB assigns values to the outputs according to their order in the varargout array. For example,
first == varargout{1}.

You can use varargout alone in an output argument list, or at the end of the list of outputs, such as

function [x,y,varargout] = myfunction(a,b)

In this case, varargout{1} corresponds to the third output that the function returns, and nargout
returns length(varargout) + 2.

See Also
nargout | varargout

Related Examples
• “Access Data in Cell Array” on page 12-5

More About
• “Argument Checking in Nested Functions” on page 21-8

21-5
21 Function Arguments

Validate Number of Function Arguments


This example shows how to check whether your custom function receives a valid number of input or
output arguments. MATLAB performs some argument checks automatically. For other cases, you can
use narginchk or nargoutchk.

Automatic Argument Checks

MATLAB checks whether your function receives more arguments than expected when it can
determine the number from the function definition. For example, this function accepts up to two
outputs and three inputs:

function [x,y] = myFunction(a,b,c)

If you pass too many inputs to myFunction, MATLAB issues an error. You do not need to call
narginchk to check for this case.

[X,Y] = myFunction(1,2,3,4)

Error using myFunction


Too many input arguments.

Use the narginchk and nargoutchk functions to verify that your function receives:

• A minimum number of required arguments.


• No more than a maximum number of arguments, when your function uses varargin or
varargout.

Input Checks with narginchk

Define a function in a file named testValues.m that requires at least two inputs. The first input is a
threshold value to compare against the other inputs.

function testValues(threshold,varargin)
minInputs = 2;
maxInputs = Inf;
narginchk(minInputs,maxInputs)

for k = 1:(nargin-1)
if (varargin{k} > threshold)
fprintf('Test value %d exceeds %d\n',k,threshold);
end
end

Call testValues with too few inputs.

testValues(10)

Error using testValues (line 4)


Not enough input arguments.

Call testValues with enough inputs.

testValues(10,1,11,111)

Test value 2 exceeds 10


Test value 3 exceeds 10

21-6
Validate Number of Function Arguments

Output Checks with nargoutchk

Define a function in a file named mysize.m that returns the dimensions of the input array in a vector
(from the size function), and optionally returns scalar values corresponding to the sizes of each
dimension. Use nargoutchk to verify that the number of requested individual sizes does not exceed
the number of available dimensions.

function [sizeVector,varargout] = mysize(x)


minOutputs = 0;
maxOutputs = ndims(x) + 1;
nargoutchk(minOutputs,maxOutputs)

sizeVector = size(x);

varargout = cell(1,nargout-1);
for k = 1:length(varargout)
varargout{k} = sizeVector(k);
end

Call mysize with a valid number of outputs.

A = rand(3,4,2);
[fullsize,nrows,ncols,npages] = mysize(A)

fullsize =
3 4 2

nrows =
3

ncols =
4

npages =
2

Call mysize with too many outputs.

A = 1;
[fullsize,nrows,ncols,npages] = mysize(A)

Error using mysize (line 4)


Too many output arguments.

See Also
narginchk | nargoutchk

Related Examples
• “Support Variable Number of Inputs” on page 21-4
• “Support Variable Number of Outputs” on page 21-5

21-7
21 Function Arguments

Argument Checking in Nested Functions


This topic explains special considerations for using varargin, varargout, nargin, and nargout
with nested functions.

varargin and varargout allow you to create functions that accept variable numbers of input or
output arguments. Although varargin and varargout look like function names, they refer to
variables, not functions. This is significant because nested functions share the workspaces of the
functions that contain them.

If you do not use varargin or varargout in the declaration of a nested function, then varargin or
varargout within the nested function refers to the arguments of an outer function.

For example, create a function in a file named showArgs.m that uses varargin and has two nested
functions, one that uses varargin and one that does not.
function showArgs(varargin)
nested1(3,4)
nested2(5,6,7)

function nested1(a,b)
disp('nested1: Contents of varargin{1}')
disp(varargin{1})
end

function nested2(varargin)
disp('nested2: Contents of varargin{1}')
disp(varargin{1})
end

end

Call the function and compare the contents of varargin{1} in the two nested functions.
showArgs(0,1,2)

nested1: Contents of varargin{1}


0

nested2: Contents of varargin{1}


5

On the other hand, nargin and nargout are functions. Within any function, including nested
functions, calls to nargin or nargout return the number of arguments for that function. If a nested
function requires the value of nargin or nargout from an outer function, pass the value to the
nested function.

For example, create a function in a file named showNumArgs.m that passes the number of input
arguments from the primary (parent) function to a nested function.
function showNumArgs(varargin)

disp(['Number of inputs to showNumArgs: ',int2str(nargin)]);


nestedFx(nargin,2,3,4)

function nestedFx(n,varargin)
disp(['Number of inputs to nestedFx: ',int2str(nargin)]);

21-8
Argument Checking in Nested Functions

disp(['Number of inputs to its parent: ',int2str(n)]);


end

end

Call showNumArgs and compare the output of nargin in the parent and nested functions.

showNumArgs(0,1)

Number of inputs to showNumArgs: 2


Number of inputs to nestedFx: 4
Number of inputs to its parent: 2

See Also
nargin | nargout | varargin | varargout

21-9
21 Function Arguments

Ignore Function Inputs


This example shows how to ignore inputs in your function definition using the tilde (~) operator. Use
this operator when your function must accept a predefined set of inputs, but your function does not
use all of the inputs. Common applications include defining callback functions.

In a file named colorButton.m, define a callback for a push button that does not use the
eventdata input. Add a tilde to the input argument list so that the function ignores eventdata.
function colorButton
figure;
uicontrol('Style','pushbutton','String','Click me','Callback',@btnCallback)

function btnCallback(h,~)
set(h,'BackgroundColor',rand(3,1))

The function declaration for btnCallback is effectively the same as the following:

function btnCallback(h,eventdata)

However, using the tilde prevents the addition of eventdata to the function workspace and makes it
clearer that the function does not use eventdata.

You can ignore any number of inputs in your function definition, in any position in the argument list.
Separate consecutive tildes with a comma. For example:

function myFunction(myInput,~,~)

See Also

More About
• “Ignore Function Outputs” on page 1-3

21-10
Check Function Inputs with validateattributes

Check Function Inputs with validateattributes


Verify that the inputs to your function conform to a set of requirements using the
validateattributes function.

validateattributes requires that you pass the variable to check and the supported data types for
that variable. Optionally, pass a set of attributes that describe the valid dimensions or values.

Check Data Type and Other Attributes

Define a function in a file named checkme.m that accepts up to three inputs: a, b, and c. Check
whether:

• a is a two-dimensional array of positive double-precision values.


• b contains 100 numeric values in an array with 10 columns.
• c is a nonempty character vector or cell array.

function checkme(a,b,c)

validateattributes(a,{'double'},{'positive','2d'})
validateattributes(b,{'numeric'},{'numel',100,'ncols',10})
validateattributes(c,{'char','cell'},{'nonempty'})

disp('All inputs are ok.')

The curly braces {} indicate that the set of data types and the set of additional attributes are in cell
arrays. Cell arrays allow you to store combinations of text and numeric data, or character vectors of
different lengths, in a single variable.

Call checkme with valid inputs.

checkme(pi,rand(5,10,2),'text')

All inputs are ok.

The scalar value pi is two-dimensional because size(pi) = [1,1].

Call checkme with invalid inputs. The validateattributes function issues an error for the first
input that fails validation, and checkme stops processing.

checkme(-4)

Error using checkme (line 3)


Expected input to be positive.

checkme(pi,rand(3,4,2))

Error using checkme (line 4)


Expected input to be an array with number of elements equal to 100.

checkme(pi,rand(5,10,2),struct)

Error using checkme (line 5)


Expected input to be one of these types:

char, cell

21-11
21 Function Arguments

Instead its type was struct.

The default error messages use the generic term input to refer to the argument that failed
validation. When you use the default error message, the only way to determine which input failed is
to view the specified line of code in checkme.

Add Input Name and Position to Errors

Define a function in a file named checkdetails.m that performs the same validation as checkme,
but adds details about the input name and position to the error messages.

function checkdetails(a,b,c)

validateattributes(a,{'double'},{'positive','2d'},'','First',1)
validateattributes(b,{'numeric'},{'numel',100,'ncols',10},'','Second',2)
validateattributes(c,{'char'},{'nonempty'},'','Third',3)

disp('All inputs are ok.')

The empty character vector '' for the fourth input to validateattributes is a placeholder for an
optional function name. You do not need to specify a function name because it already appears in the
error message. Specify the function name when you want to include it in the error identifier for
additional error handling.

Call checkdetails with invalid inputs.

checkdetails(-4)

Error using checkdetails (line 3)


Expected input number 1, First, to be positive.

checkdetails(pi,rand(3,4,2))

Error using checkdetails (line 4)


Expected input number 2, Second, to be an array with
number of elements equal to 100.

See Also
validateattributes | validatestring

21-12
Parse Function Inputs

Parse Function Inputs


This example shows how to define required and optional inputs, assign defaults to optional inputs,
and validate all inputs to a custom function using the Input Parser.

The Input Parser provides a consistent way to validate and assign defaults to inputs, improving the
robustness and maintainability of your code. To validate the inputs, you can take advantage of
existing MATLAB functions or write your own validation routines.

Step 1. Define your function.

Create a function in a file named printPhoto.m. The printPhoto function has one required input
for the file name, and optional inputs for the finish (glossy or matte), color space (RGB or CMYK),
width, and height.

function printPhoto(filename,varargin)

In your function declaration statement, specify required inputs first. Use varargin to support
optional inputs.

Step 2. Create an InputParser object.

Within your function, call inputParser to create a parser object.

p = inputParser;

Step 3. Add inputs to the scheme.

Add inputs to the parsing scheme in your function using addRequired, addOptional, or
addParameter. For optional inputs, specify default values.

For each input, you can specify a handle to a validation function that checks the input and returns a
scalar logical (true or false) or errors. The validation function can be an existing MATLAB function
(such as ischar or isnumeric) or a function that you create (such as an anonymous function or a
local function).

In the printPhoto function, filename is a required input. Define finish and color as optional
inputs, and width and height as optional parameter value pairs.

defaultFinish = 'glossy';
validFinishes = {'glossy','matte'};
checkFinish = @(x) any(validatestring(x,validFinishes));

defaultColor = 'RGB';
validColors = {'RGB','CMYK'};
checkColor = @(x) any(validatestring(x,validColors));

defaultWidth = 6;
defaultHeight = 4;

addRequired(p,'filename',@ischar);
addOptional(p,'finish',defaultFinish,checkFinish)
addOptional(p,'color',defaultColor,checkColor)
addParameter(p,'width',defaultWidth,@isnumeric)
addParameter(p,'height',defaultHeight,@isnumeric)

21-13
21 Function Arguments

Inputs that you add with addRequired or addOptional are positional arguments. When you call a
function with positional inputs, specify those values in the order they are added to the parsing
scheme.

Inputs added with addParameter are not positional, so you can pass values for height before or
after values for width. However, parameter value inputs require that you pass the input name
('height' or 'width') along with the value of the input.

If your function accepts optional input strings or character vectors and parameter name and value
pairs, specify validation functions for the optional inputs. Otherwise, the Input Parser interprets the
optional strings or character vectors as parameter names. For example, the checkFinish validation
function ensures that printPhoto interprets 'glossy' as a value for finish and not as an invalid
parameter name.

Step 4. Set properties to adjust parsing (optional).

By default, the Input Parser makes assumptions about case sensitivity, function names, structure
array inputs, and whether to allow additional parameter names and values that are not in the scheme.
Properties allow you to explicitly define the behavior. Set properties using dot notation, similar to
assigning values to a structure array.

Allow printPhoto to accept additional parameter value inputs that do not match the input scheme
by setting the KeepUnmatched property of the Input Parser.
[Link] = true;

If KeepUnmatched is false (default), the Input Parser issues an error when inputs do not match the
scheme.

Step 5. Parse the inputs.

Within your function, call the parse method. Pass the values of all of the function inputs.
parse(p,filename,varargin{:})

Step 6. Use the inputs in your function.

Access parsed inputs using these properties of the inputParser object:

• Results — Structure array with names and values of all inputs in the scheme.
• Unmatched — Structure array with parameter names and values that are passed to the function,
but are not in the scheme (when KeepUnmatched is true).
• UsingDefaults — Cell array with names of optional inputs that are assigned their default values
because they are not passed to the function.

Within the printPhoto function, display the values for some of the inputs:
disp(['File name: ',[Link]])
disp(['Finish: ', [Link]])

if ~isempty(fieldnames([Link]))
disp('Extra inputs:')
disp([Link])
end
if ~isempty([Link])
disp('Using defaults: ')

21-14
Parse Function Inputs

disp([Link])
end

Step 7. Call your function.

The Input Parser expects to receive inputs as follows:

• Required inputs first, in the order they are added to the parsing scheme with addRequired.
• Optional positional inputs in the order they are added to the scheme with addOptional.
• Positional inputs before parameter name and value pair inputs.
• Parameter names and values in the form Name1,Value1,...,NameN,ValueN.

Pass several combinations of inputs to printPhoto, some valid and some invalid:

printPhoto('[Link]')

File name: [Link]


Finish: glossy
Using defaults:
'finish' 'color' 'width' 'height'

printPhoto(100)

Error using printPhoto (line 23)


The value of 'filename' is invalid. It must satisfy the function: ischar.

printPhoto('[Link]','satin')

Error using printPhoto (line 23)


The value of 'finish' is invalid. Expected input to match one of these strings:

'glossy', 'matte'

The input, 'satin', did not match any of the valid strings.

printPhoto('[Link]','height',10,'width',8)

File name: [Link]


Finish: glossy
Using defaults:
'finish' 'color'

To pass a value for the nth positional input, either specify values for the previous (n – 1) inputs or
pass the input as a parameter name and value pair. For example, these function calls assign the same
values to finish (default 'glossy') and color:

printPhoto('[Link]','glossy','CMYK') % positional

printPhoto('[Link]','color','CMYK') % name and value

See Also
inputParser | varargin

More About
• “Input Parser Validation Functions” on page 21-16

21-15
21 Function Arguments

Input Parser Validation Functions


This topic shows ways to define validation functions that you pass to the Input Parser to check custom
function inputs.

The Input Parser methods addRequired, addOptional, and addParameter each accept an
optional handle to a validation function. Designate function handles with an at (@) symbol.

Validation functions must accept a single input argument, and they must either return a scalar logical
value (true or false) or error. If the validation function returns false, the Input Parser issues an
error and your function stops processing.

There are several ways to define validation functions:

• Use an existing MATLAB function such as ischar or isnumeric. For example, check that a
required input named num is numeric:

p = inputParser;
checknum = @isnumeric;
addRequired(p,'num',checknum)

parse(p,'text')

The value of 'num' is invalid. It must satisfy the function: isnumeric.

• Create an anonymous function. For example, check that input num is a numeric scalar greater
than zero:

p = inputParser;
checknum = @(x) isnumeric(x) && isscalar(x) && (x > 0);
addRequired(p,'num',checknum)

parse(p,rand(3))
The value of 'num' is invalid. It must satisfy the function: @(x) isnumeric(x) && isscalar(x)
&& (x>0).

• Define your own function, typically a local function in the same file as your primary function. For
example, in a file named usenum.m, define a local function named checknum that issues custom
error messages when the input num to usenum is not a numeric scalar greater than zero:

function usenum(num)
p = inputParser;
addRequired(p,'num',@checknum);
parse(p,num);

function TF = checknum(x)
TF = false;
if ~isscalar(x)
error('Input is not scalar');
elseif ~isnumeric(x)
error('Input is not numeric');
elseif (x <= 0)
error('Input must be > 0');
else
TF = true;
end

Call the function with an invalid input:

21-16
Input Parser Validation Functions

usenum(-1)

Error using usenum (line 4)


The value of 'num' is invalid. Input must be > 0

See Also
inputParser | is* | validateattributes

Related Examples
• “Parse Function Inputs” on page 21-13
• “Create Function Handle” on page 13-2

More About
• “Anonymous Functions” on page 20-20

21-17
22

Debugging MATLAB Code

• “Debug a MATLAB Program” on page 22-2


• “Set Breakpoints” on page 22-7
• “Examine Values While Debugging” on page 22-12
22 Debugging MATLAB Code

Debug a MATLAB Program


To debug your MATLAB program graphically, use the Editor/Debugger. Alternatively, you can use
debugging functions in the Command Window. Both methods are interchangeable.

Before you begin debugging, make sure that your program is saved and that the program and any
files it calls exist on your search path or in the current folder.

• If you run a file with unsaved changes from within the Editor, then the file is automatically saved
before it runs.
• If you run a file with unsaved changes from the Command Window, then MATLAB software runs
the saved version of the file. Therefore, you do not see the results of your changes.

Set Breakpoint
Set breakpoints to pause the execution of a MATLAB file so you can examine the value or variables
where you think a problem could be. You can set breakpoints using the Editor, using functions in the
Command Window, or both.

There are three different types of breakpoints: standard, conditional, and error. To add a standard
breakpoint in the Editor, click the breakpoint alley at an executable line where you want to set the
breakpoint. The breakpoint alley is the narrow column on the left side of the Editor, to the right of the
line number. You also can use the F12 key to set the breakpoint.

Executable lines are indicated by a dash ( — ) in the breakpoint alley. For example, click the
breakpoint alley next to line 2 in the code below to add a breakpoint at that line.

If an executable statement spans multiple lines, you can set a breakpoint at each line in that
statement, even though the additional lines do not have a — (dash) in the breakpoint alley. For
example, in this code. you can set a breakpoint at all four lines:

For more information on the different types of breakpoints, see “Set Breakpoints” on page 22-7.

22-2
Debug a MATLAB Program

Run File
After setting breakpoints, run the file from the Command Window or the Editor. Running the file
produces these results:


The Run button changes to a Pause button.
• The prompt in the Command Window changes to K>> indicating that MATLAB is in debug mode
and that the keyboard is in control.
• MATLAB pauses at the first breakpoint in the program. In the Editor, a green arrow just to the
right of the breakpoint indicates the pause. The program does not execute the line where the
pause occurs until it resumes running. For example, here the debugger pauses before the program
executes x = ones(1,10);.

• MATLAB displays the current workspace in the Function Call Stack, on the Editor tab in the
Debug section.

If you use debugging functions from the Command Window, use dbstack to view the Function
Call Stack.

For more information on using the Function Call Stack, see “Select Workspace” on page 22-12

Pause a Running File

To pause the execution of a program while it is running, go to the Editor tab and click the Pause
button. MATLAB pauses execution at the next executable line, and the Pause button changes to a
Continue button. To continue execution, press the Continue button.

Pausing is useful if you want to check on the progress of a long running program to ensure that it is
running as expected.

Note Clicking the pause button can cause MATLAB to pause in a file outside your own program file.
Pressing the Continue button resumes normal execution without changing the results of the file.

Find and Fix a Problem


While your code is paused, you can view or change the values of variables, or you can modify the
code.

22-3
22 Debugging MATLAB Code

View or Change Variable While Debugging

View the value of a variable while debugging to see whether a line of code has produced the expected
result or not. To do this, position your mouse pointer to the left of the variable. The current value of
the variable appears in a data tip.

The data tip stays in view until you move the pointer. If you have trouble getting the data tip to
appear, click the line containing the variable, and then move the pointer next to the variable. For
more information, see “Examine Values While Debugging” on page 22-12.

You can change the value of a variable while debugging to see if the new value produces expected
results. With the program paused, assign a new value to the variable in the Command Window,
Workspace browser, or Variables Editor. Then, continue running or stepping through the program.

For example, here MATLAB is paused inside a for loop where n = 2:

• Type n = 7; in the command line to change the current value of n from 2 to 7.



Press Continue to run the next line of code.

MATLAB runs the code line x(n) = 2 * x(n-1); with n = 7.

Modify Section of Code While Debugging

You can modify a section of code while debugging to test possible fixes without having to save your
changes. Usually, it is a good practice to modify a MATLAB file after you quit debugging, and then
save the modification and run the file. Otherwise, you might get unexpected results. However, there
are situations where you want to experiment during debugging.

To modify a program while debugging:

1 While your code is paused, modify a part of the file that has not yet run.

22-4
Debug a MATLAB Program

Breakpoints turn gray, indicating they are invalid.


2 Select all the code after the line at which MATLAB is paused, right-click, and then select
Evaluate Selection from the context menu.

After the code evaluation is complete, stop debugging and save or undo any changes made before
continuing the debugging process.

Step Through File


While debugging, you can step through a MATLAB file, pausing at points where you want to examine
values.

This table describes available debugging actions and the different methods you can use to execute
them.

Description Toolbar Button Function Alternative


Continue execution of file until the line where the None
cursor is positioned. Also available on the context Run to Cursor
menu.
Execute the current line of the file. dbstep
Step
Execute the current line of the file and, if the line dbstep in
Step In
is a call to another function, step into that
function.
Resume execution of file until completion or until dbcont
Continue
another breakpoint is encountered.
After stepping in, run the rest of the called dbstep out
Step Out
function or local function, leave the called
function, and pause.
Pause debug mode. None
Pause

22-5
22 Debugging MATLAB Code

Description Toolbar Button Function Alternative


Exit debug mode. dbquit
Quit Debugging

End Debugging Session


After you identify a problem, end the debugging session by going to the Editor tab and clicking Quit

Debugging . You must end a debugging session if you want to change and save a file, or if you
want to run other programs in MATLAB.

After you quit debugging, pause indicators in the Editor display no longer appear, and the normal >>
prompt reappears in the Command Window in place of the K>>. You no longer can access the call
stack.

If MATLAB software becomes nonresponsive when it pauses at a breakpoint, press Ctrl+c to return
to the MATLAB prompt.

See Also

Related Examples
• “Set Breakpoints” on page 22-7
• “Examine Values While Debugging” on page 22-12

22-6
Set Breakpoints

Set Breakpoints

In this section...
“Standard Breakpoints” on page 22-7
“Conditional Breakpoints” on page 22-8
“Error Breakpoints” on page 22-9
“Breakpoints in Anonymous Functions” on page 22-10
“Invalid Breakpoints” on page 22-10
“Disable Breakpoints” on page 22-10
“Clear Breakpoints” on page 22-11

Setting breakpoints pauses the execution of your MATLAB program so that you can examine values
where you think a problem might be. You can set breakpoints using the Editor or by using functions
in the Command Window.

There are three types of breakpoints:

• Standard breakpoints
• Conditional breakpoints
• Error breakpoints

You can set breakpoints only at executable lines in saved files that are in the current folder or in
folders on the search path. You can set breakpoints at any time, whether MATLAB is idle or busy
running a file.

By default, MATLAB automatically opens files when it reaches a breakpoint. To disable this option:

1
From the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.


2 Select MATLAB > Editor/Debugger.
3 Clear the Automatically open file when MATLAB reaches a breakpoint option and click OK.

Standard Breakpoints
A standard breakpoint pauses at a specified line in a file.

To set a standard breakpoint click the breakpoint alley at an executable line where you want to set
the breakpoint. The breakpoint alley is the narrow column on the left side of the Editor, to the right of
the line number. You also can use the F12 key to set the breakpoint.

Executable lines are indicated by a — (dash) in the breakpoint alley. If an executable statement spans
multiple lines, you can set a breakpoint at each line in that statement, even though the additional
lines do not have a — (dash) in the breakpoint alley. For example, in this code, you can set a
breakpoint at all four lines:

22-7
22 Debugging MATLAB Code

If you attempt to set a breakpoint at a line that is not executable, such as a comment or a blank line,
MATLAB sets it at the next executable line.

To set a standard breakpoint programmatically, use the dbstop function. For example, to add a
breakpoint at line 2 in a file named myprogram.m, type:

dbstop in myprogram at 2

MATLAB adds a breakpoint at line 2 in the function myprogram.

To examine values at increments in a for loop, set the breakpoint within the loop, rather than at the
start of the loop. If you set the breakpoint at the start of the for loop, and then step through the file,
MATLAB pauses at the for statement only once. However, if you place the breakpoint within the
loop, MATLAB pauses at each pass through the loop.

Conditional Breakpoints
A conditional breakpoint causes MATLAB to pause at a specified line in a file only when the specified
condition is met. Use conditional breakpoints when you want to examine results after some iterations
in a loop.

To set a conditional breakpoint, right-click the breakpoint alley at an executable line where you want
to set the breakpoint and select Set/Modify Condition.

When the Editor dialog box opens, enter a condition and click OK. A condition is any valid MATLAB
expression that returns a logical scalar value.

As noted in the dialog box, MATLAB evaluates the condition before running the line. For example,
suppose that you have a file called myprogram.m.

22-8
Set Breakpoints

Add a breakpoint with the following condition at line 6:

n >= 4

A yellow, conditional breakpoint icon appears in the breakpoint alley at that line.

You also can set a conditional breakpoint programmatically using the dbstop function. For example,
to add a conditional breakpoint in myprogram.m at line 6 type:

dbstop in myprogram at 6 if n>=4

When you run the file, MATLAB enters debug mode and pauses at the line when the condition is met.
In the myprogram example, MATLAB runs through the for loop twice and pauses on the third
iteration at line 6 when n is 4. If you continue executing, MATLAB pauses again at line 6 on the fourth
iteration when n is 5.

Error Breakpoints
An error breakpoint causes MATLAB to pause program execution and enter debug mode if MATLAB
encounters a problem. Unlike standard and conditional breakpoints, you do not set these breakpoints
at a specific line in a specific file. When you set an error breakpoint, MATLAB pauses at any line in
any file if the error condition specified occurs. MATLAB then enters debug mode and opens the file
containing the error, with the execution arrow at the line containing the error.

To set an error breakpoint, on the Editor tab, click Run and select from these options:

• Pause on Errors to pause on all errors.


• Pause on Warnings to pause on all warnings.
• Pause on NaN or Inf to pause on NaN (not-a-number) or Inf (infinite) values.

You also can set a breakpoint programmatically by using the dbstop function with a specified
condition. For example, to pause execution on all errors, type

dbstop if error

To pause execution at the first run-time error within the try portion of a try/catch block that has a
message ID of MATLAB:ls:InputsMustBeStrings, type

dbstop if caught error MATLAB:ls:InputsMustBeStrings

22-9
22 Debugging MATLAB Code

Breakpoints in Anonymous Functions


You can set multiple breakpoints in a line of MATLAB code that contains anonymous functions. For
example, you can set a breakpoint for the line itself, where MATLAB software pauses at the start of
the line. Or, alternatively, you can set a breakpoint for each anonymous function in the line.

When you add a breakpoint to a line containing an anonymous function, the Editor asks where in the
line you want to add the breakpoint. If there is more than one breakpoint in a line, the breakpoint
icon is blue, regardless of the status of any of the breakpoints on that line.

To view information about all the breakpoints on a line, hover your pointer on the breakpoint icon. A
tooltip appears with available information. For example, in this code, line 5 contains two anonymous
functions, with a breakpoint at each one. The tooltip tells us that both breakpoints are enabled.

When you set a breakpoint in an anonymous function, MATLAB pauses when the anonymous function
is called. A green arrow shows where the code defines the anonymous function. A white arrow shows
where the code calls the anonymous functions. For example, in this code, MATLAB pauses the
program at a breakpoint set for the anonymous function sqr, at line 2 in a file called
myanonymous.m. The white arrow indicates that the sqr function is called from line 3.

Invalid Breakpoints
A gray breakpoint indicates an invalid breakpoint.

Breakpoints are invalid for these reasons:

• There are unsaved changes in the file. To make breakpoints valid, save the file. The gray
breakpoints become red, indicating that they are now valid.
• There is a syntax error in the file. When you set a breakpoint, an error message appears indicating
where the syntax error is. To make the breakpoint valid, fix the syntax error and save the file.

Disable Breakpoints
You can disable selected breakpoints so that your program temporarily ignores them and runs
uninterrupted. For example, you might disable a breakpoint after you think you identified and
corrected a problem, or if you are using conditional breakpoints.

22-10
Set Breakpoints

To disable a breakpoint, right-click the breakpoint icon, and select Disable Breakpoint from the
context menu.

An X appears through the breakpoint icon to indicate that it is disabled.

To reenable a breakpoint, right-click the breakpoint icon and select Enable Breakpoint from the
context menu.

The X no longer appears on the breakpoint icon and program execution pauses at that line.

To enable or disable all breakpoints in the file, select Enable All in File or Disable All in File.
These options are only available if there is at least one breakpoint to enable or disable.

Clear Breakpoints
All breakpoints remain in a file until you clear (remove) them or until they are cleared automatically
at the end of your MATLAB session.

To clear a breakpoint, right-click the breakpoint icon and select Clear Breakpoint from the context
menu. You also can use the F12 key to clear the breakpoint.

To clear a breakpoint programmatically, use the dbclear function. For example, to clear the
breakpoint at line 6 in a file called myprogram.m, type

dbclear in myprogram at 6

To clear all breakpoints in the file, right-click the breakpoint alley and select Clear All in File. You
can also use the dbclear all command. For example, to clear all the breakpoints in a file called
myprogram.m, type

dbclear all in myprogram

To clear all breakpoints in all files, including error breakpoints, right-click the breakpoint alley and
select Clear All. You also can use the dbclear all command.

Breakpoints clear automatically when you end a MATLAB session. To save your breakpoints for future
sessions, see the dbstatus function.

See Also

Related Examples
• “Debug a MATLAB Program” on page 22-2
• “Examine Values While Debugging” on page 22-12

22-11
22 Debugging MATLAB Code

Examine Values While Debugging


While your program is paused, you can view the value of any variable currently in the workspace.
Examine values when you want to see whether a line of code produces the expected result or not. If
the result is as expected, continue running or step to the next line. If the result is not as you expect,
then that line, or a previous line, might contain an error.

Select Workspace
To examine a variable during debugging, you must first select its workspace. Variables that you
assign through the Command Window or create using scripts belong to the base workspace. Variables
that you create in a function belong to their own function workspace. To view the current workspace,
select the Editor tab. The Function Call Stack field shows the current workspace. Alternatively, you
can use the dbstack function in the Command Window.

To select or change the workspace for the variable you want to view, use either of these methods:

• From the Editor tab, in the Debug section, choose a workspace from the Function Call Stack
menu list.

• From the Command Window, use the dbup and dbdown functions to select the previous or next
workspace in the Function Call Stack.

To list the variables in the current workspace, use who or whos.

View Variable Value


There are several ways to view the value of a variable while debugging a program:

• View variable values in the Workspace browser and Variables Editor.

The Workspace browser displays all variables in the current workspace. The Value column of the
Workspace browser shows the current value of the variable. To see more details, double-click the
variable. The Variables Editor opens, displaying the content for that variable. You also can use the
openvar function to open a variable in the Variables Editor.

22-12
Examine Values While Debugging

• View variable values in the MATLAB Editor.

Use your mouse to select the variable or equation. Right-click and select Evaluate Selection
from the context menu. The Command Window displays the value of the variable or equation.

Note You cannot evaluate a selection while MATLAB is busy, for example, running a file.
• View variable values as a data tip in the MATLAB Editor.

To do this, position your mouse pointer over the variable. The current value of the variable
appears in a data tip. The data tip stays in view until you move the pointer. If you have trouble
getting the data tip to appear, click the line containing the variable, and then move the pointer
next to the variable.

Data tips are always enabled when debugging a file in the Editor. To view data tips when editing a
file in the Editor, enable them in your MATLAB preferences.

1
On the Home tab, in the Environment section, click Preferences. Then select MATLAB
> Editor/Debugger > Display.
2 Under General display options, select Enable datatips in edit mode.
• View variable values in the Command Window.

To see all the variables currently in the workspace, call the who function. To view the current
value of a variable, type the variable name in the Command Window. For the example, to see the
value of a variable n, type n and press Enter. The Command Window displays the variable name
and its value.

When you set a breakpoint in a function and attempt to view the value of a variable in a parent
workspace, the value of that variable might not be available. This error occurs when you attempt to
access a variable while MATLAB is in the process of overwriting it. In such cases, MATLAB returns
the following message, where x represents the variable whose value you are trying to examine.

22-13
22 Debugging MATLAB Code

K>> x
Reference to a called function result under construction x.

The error occurs whether you select the parent workspace by using the dbup command or by using
Function Call Stack field in the Debug section of the Editor tab.

See Also

Related Examples
• “Debug a MATLAB Program” on page 22-2
• “Set Breakpoints” on page 22-7

22-14
23

Presenting MATLAB Code

MATLAB software enables you to present your MATLAB code in various ways. You can share your
code and results with others, even if they do not have MATLAB software. You can save MATLAB
output in various formats, including HTML, XML, and LaTeX. If Microsoft Word or Microsoft
PowerPoint applications are on your Microsoft Windows system, you can publish to their formats as
well.

• “Publish and Share MATLAB Code” on page 23-2


• “Publishing Markup” on page 23-5
• “Output Preferences for Publishing” on page 23-20
23 Presenting MATLAB Code

Publish and Share MATLAB Code


MATLAB provides options for presenting your code to others, including using publishing and creating
live scripts and functions in the Live Editor.

Create and Share Live Scripts in the Live Editor


The easiest way to create cohesive, sharable documents that include executable MATLAB code,
embedded output, and formatted text is to use the Live Editor. Supported output formats include:
MLX, PDF, Microsoft Word, HTML, and LaTeX. For details, see “Create Live Scripts in the Live
Editor” on page 19-6.

Publish MATLAB Code


Publishing a MATLAB Code file (.m) creates a formatted document that includes your code,
comments, and output. Common reasons to publish code are to share the documents with others for
teaching or demonstration, or to generate readable, external documentation of your code.

This code demonstrates the Fourier series expansion for a square wave.

23-2
Publish and Share MATLAB Code

MATLAB Code with Markup Published Document

To publish your code:

1 Create a MATLAB script or function. Divide the code into steps or sections by inserting two
percent signs (%%) at the beginning of each section.
2 Document the code by adding explanatory comments at the beginning of the file and within each
section.

Within the comments at the top of each section, you can add markup that enhances the
readability of the output. For example, the code in the preceding table includes the following
markup.

Titles %% Square Waves from Sine Waves

%% Add an Odd Harmonic and Plot It

%% Note About Gibbs Phenomenon


Variable name in italics % As _k_ increases, ...
LaTeX equation % $$ y = y + \frac{sin(k*t)}{k} $$

Note When you have a file containing text that has characters in a different encoding than that
of your platform, when you save or publish your file, MATLAB displays those characters as
garbled text.
3 Publish the code. On the Publish tab, click Publish.

By default, MATLAB creates a subfolder named html, which contains an HTML file and files for
each graphic that your code creates. The HTML file includes the code, formatted comments, and
output. Alternatively, you can publish to other formats, such as PDF files or Microsoft PowerPoint
presentations. For more information on publishing to other formats, see “Specify Output File” on
page 23-21.

23-3
23 Presenting MATLAB Code

In MATLAB Online, MATLAB publishes to either HTML or PDF, and stores the output and
supporting files in your Published folder. To allow MATLAB to open the output automatically,
enable pop-up windows in your Web browser. Results are available publicly using a URL of the
form [Link]
[Link] (for HTML) or [Link]
foldername/[Link] (for PDF).

The sample code that appears in the previous figure is part of the installed documentation. You can
view the code in the Editor by running this command:

edit(fullfile(matlabroot,'help','techdoc','matlab_env', ...
'examples','fourier_demo2.m'))

Add Help and Create Documentation


You can add help to your code by inserting comments at the start of a MATLAB code file. MATLAB
displays the help comments when you type help file_name in the Command Window. For more
information, see “Add Help for Your Program” on page 20-5.

You also can create your own MATLAB documentation topics for viewing from the MATLAB Help
browser or the web. For more information, see “Display Custom Documentation” on page 31-21

See Also
publish

More About
• “Create Live Scripts in the Live Editor” on page 19-6
• “Publishing Markup” on page 23-5
• “Output Preferences for Publishing” on page 23-20

External Websites
• Publishing MATLAB Code from the Editor video

23-4
Publishing Markup

Publishing Markup
In this section...
“Markup Overview” on page 23-5
“Sections and Section Titles” on page 23-7
“Text Formatting” on page 23-8
“Bulleted and Numbered Lists” on page 23-9
“Text and Code Blocks” on page 23-9
“External File Content” on page 23-10
“External Graphics” on page 23-11
“Image Snapshot” on page 23-13
“LaTeX Equations” on page 23-13
“Hyperlinks” on page 23-15
“HTML Markup” on page 23-17
“LaTeX Markup” on page 23-18

Markup Overview
To insert markup, you can:

• Use the formatting buttons and drop-down menus on the Publish tab to format the file. This
method automatically inserts the text markup for you.
• Select markup from the Insert Text Markup list in the right click menu.
• Type the markup directly in the comments.

The following table provides a summary of the text markup options. Refer to this table if you are not
using the MATLAB Editor, or if you do not want to use the Publish tab to apply the markup.

Note When working with markup:

• Spaces following the comment symbols (%) often determine the format of the text that follows.
• Starting new markup often requires preceding blank comment lines, as shown in examples.
• Markup only works in comments that immediately follow a section break.

Result in Output Example of Corresponding File Markup


“Sections and Section Titles” on page %% SECTION TITLE
23-7 % DESCRIPTIVE TEXT

%%% SECTION TITLE WITHOUT SECTION BREAK


% DESCRIPTIVE TEXT

23-5
23 Presenting MATLAB Code

Result in Output Example of Corresponding File Markup


“Text Formatting” on page 23-8 % _ITALIC TEXT_

% *BOLD TEXT*

% |MONOSPACED TEXT|

% Trademarks:
% TEXT(TM)

% TEXT(R)
“Bulleted and Numbered Lists” on %% Bulleted List
page 23-9 %
% * BULLETED ITEM 1
% * BULLETED ITEM 2
%

%% Numbered List
%
% # NUMBERED ITEM 1
% # NUMBERED ITEM 2
%
“Text and Code Blocks” on page 23-9 %%
%
% PREFORMATTED
% TEXT
%

%% MATLAB(R) Code
%
% for i = 1:10
% disp x
% end
%
“External File Content” on page 23-10 %
% <include>filename.m</include>
%
“External Graphics” on page 23-11 %
% <<[Link]>>
%
“Image Snapshot” on page 23-13 snapnow;
“LaTeX Equations” on page 23-13 %% Inline Expression
% $x^2+e^{\pi i}$

%% Block Equation
%
% $$e^{\pi i} + 1 = 0$$
%
“Hyperlinks” on page 23-15 % <[Link] MathWorks>

% <matlab:FUNCTION DISPLAYED_TEXT>

23-6
Publishing Markup

Result in Output Example of Corresponding File Markup


“HTML Markup” on page 23-17 %
% <html>
% <table border=1><tr>
% <td>one</td>
% <td>two</td></tr></table>
% </html>
%
“LaTeX Markup” on page 23-18 %% LaTeX Markup Example
% <latex>
% \begin{tabular}{|r|r|}
% \hline $n$&$n!$\\
% \hline 1&1\\ 2&2\\ 3&6\\
% \hline
% \end{tabular}
% </latex>
%

Sections and Section Titles


Code sections allow you to organize, add comments, and execute portions of your code. Code sections
begin with double percent signs (%%) followed by an optional section title. The section title displays as
a top-level heading (h1 in HTML), using a larger, bold font.

Note You can add comments in the lines immediately following the title. However, if you want an
overall document title, you cannot add any MATLAB code before the start of the next section (a line
starting with %%).

For instance, this code produces a polished result when published.

%% Vector Operations
% You can perform a number of binary operations on vectors.
%%
A = 1:3;
B = 4:6;
%% Dot Product
% A dot product of two vectors yields a scalar.
% MATLAB has a simple command for dot products.
s = dot(A,B);
%% Cross Product
% A cross product of two vectors yields a third
% vector perpendicular to both original vectors.
% Again, MATLAB has a simple command for cross products.
v = cross(A,B);

By saving the code in an Editor and clicking the Publish button on the Publish tab, MATLAB
produces the output as shown in this figure. Notice that MATLAB automatically inserts a Contents
menu from the section titles in the MATLAB file.

23-7
23 Presenting MATLAB Code

Text Formatting
You can mark selected text in the MATLAB comments so that they display in italic, bold, or
monospaced text when you publish the file. Simply surround the text with _, *, or | for italic, bold, or
monospaced text, respectively.

For instance, these lines display each of the text formatting syntaxes if published.

%% Calculate and Plot Sine Wave


% _Define_ the *range* for |x|

Trademark Symbols

If the comments in your MATLAB file include trademarked terms, you can include text to produce a
trademark symbol (™) or registered trademark symbol (®) in the output. Simply add (R) or (TM)
directly after the term in question, without any space in between.

For example, suppose that you enter these lines in a file.

%% Basic Matrix Operations in MATLAB(R)


% This is a demonstration of some aspects of MATLAB(R)
% and the Symbolic Math Toolbox(TM).

If you publish the file to HTML, it appears in the MATLAB web browser.

23-8
Publishing Markup

Bulleted and Numbered Lists


MATLAB allows bulleted and numbered lists in the comments. You can use this syntax to produce
bulleted and numbered lists.

%% Two Lists
%
% * ITEM1
% * ITEM2
%
% # ITEM1
% # ITEM2
%

Publishing the example code produces this output.

Text and Code Blocks


Preformatted Text

Preformatted text appears in monospace font, maintains white space, and does not wrap long lines.
Two spaces must appear between the comment symbol and the text of the first line of the
preformatted text.

Publishing this code produces a preformatted paragraph.

%%
% Many people find monospaced texts easier to read:
%
% A dot product of two vectors yields a scalar.
% MATLAB has a simple command for dot products.

23-9
23 Presenting MATLAB Code

Syntax Highlighted Sample Code

Executable code appears with syntax highlighting in published documents. You also can highlight
sample code. Sample code is code that appears within comments.

To indicate sample code, you must put three spaces between the comment symbol and the start of the
first line of code. For example, clicking the Code button on the Publish tab inserts the following
sample code in your Editor.

%%
%
% for i = 1:10
% disp(x)
% end
%

Publishing this code to HTML produces output in the MATLAB web browser.

External File Content


To add external file content into MATLAB published code, use the <include> markup. Specify the
external file path relative to the location of the published file. Included MATLAB code files publish as
syntax highlighted code. Any other files publish as plain text.

For example, this code inserts the contents of sine_wave.m into your published output:

%% External File Content Example


% This example includes the file contents of sine_wave.m into published
% output.
%
% <include>sine_wave.m</include>
%
% The file content above is properly syntax highlighted

Publish the file to HTML.

23-10
Publishing Markup

External Graphics
To publish an image that the MATLAB code does not generate, use text markup. By default, MATLAB
already includes code-generated graphics.

This code inserts a generic image called [Link] into your published output.

%%
%
% <<[Link]>>
%

MATLAB requires that [Link] be a relative path from the output location to your external
image or a fully qualified URL. Good practice is to save your image in the same folder that MATLAB
publishes its output. For example, MATLAB publishes HTML documents to a subfolder html. Save
your image file in the same subfolder. You can change the output folder by changing the publish
configuration settings. In MATLAB Online, save your image file to your Published folder, which is
located in your root folder.

External Graphics Example Using surf(peaks)

This example shows how to insert [Link] into a MATLAB file for publishing.

To create the [Link], run this code in the Command Window.

saveas(surf(peaks),'[Link]');

To produce an HTML file containing [Link] from a MATLAB file:

1 Create a subfolder called html in your current folder.


2 Create [Link] by running this code in the Command Window.

saveas(surf(peaks),'html/[Link]');
3 Publish this MATLAB code to HTML.

%% Image Example
% This is a graphic:
%
% <<[Link]>>
%

23-11
23 Presenting MATLAB Code

Valid Image Types for Output File Formats

The type of images you can include when you publish depends on the output type of that document as
indicated in this table. For greatest compatibility, best practice is to use the default image format for
each output type.

Output File Format Default Image Format Types of Images You Can Include
doc png Any format that your installed version of
Microsoft Office supports.
html png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
latex png or epsc2 All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
pdf bmp bmp and jpg.
ppt png Any format that your installed version of
Microsoft Office supports.
xml png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.

23-12
Publishing Markup

Image Snapshot
You can insert code that captures a snapshot of your MATLAB output. This is useful, for example, if
you have a for loop that modifies a figure that you want to capture after each iteration.

The following code runs a for loop three times and produces output after every iteration. The
snapnow command captures all three images produced by the code.

%% Scale magic Data and Display as Image

for i=1:3
imagesc(magic(i))
snapnow;
end

If you publish the file to HTML, it resembles the following output. By default, the images in the HTML
are larger than shown in the figure. To resize images generated by MATLAB code, use the Max
image width and Max image height fields in the Publish settings pane, as described in “Output
Preferences for Publishing” on page 23-20.

LaTeX Equations
Inline LaTeX Expression

MATLAB enables you to include an inline LaTeX expression in any code that you intend to publish. To
insert an inline expression, surround your LaTeX markup with dollar sign characters ($). The $ must
immediately precede the first word of the inline expression, and immediately follow the last word of
the inline expression, without any space in between.

Note

• All publishing output types support LaTeX expressions, except Microsoft PowerPoint.

23-13
23 Presenting MATLAB Code

• MATLAB publishing supports standard LaTeX math mode directives. Text mode directives or
directives that require additional packages are not supported.

This code contains a LaTeX expression:

%% LaTeX Inline Expression Example


%
% This is an equation: $x^2+e^{\pi i}$. It is
% inline with the text.

If you publish the sample text markup to HTML, this is the resulting output.

LaTeX Display Equation

MATLAB enables you to insert LaTeX symbols in blocks that are offset from the main comment text.
Two dollar sign characters ($$) on each side of an equation denote a block LaTeX equation.
Publishing equations in separate blocks requires a blank line in between blocks.

This code is a sample text markup.

%% LaTeX Equation Example


%
% This is an equation:
%
% $$e^{\pi i} + 1 = 0$$
%
% It is not in line with the text.

If you publish to HTML, the expression appears as shown here.

23-14
Publishing Markup

Hyperlinks
Static Hyperlinks

You can insert static hyperlinks within a MATLAB comment, and then publish the file to HTML, XML,
or Microsoft Word. When specifying a static hyperlink to a web location, include a complete URL
within the code. This is useful when you want to point the reader to a web location. You can display or
hide the URL in the published text. Consider excluding the URL, when you are confident that readers
are viewing your output online and can click the hyperlink.

Enclose URLs and any replacement text in angled brackets.

%%
% For more information, see our web site:
% <[Link] MathWorks>

Publishing the code to HTML produces this output.

Eliminating the text MathWorks after the URL produces this modified output.

Note If your code produces hyperlinked text in the MATLAB Command Window, the output shows the
HTML code rather than the hyperlink.

Dynamic Hyperlinks

You can insert dynamic hyperlinks, which MATLAB evaluates at the time a reader clicks that link.
Dynamic hyperlinks enable you to point the reader to MATLAB code or documentation, or enable the
reader to run code. You implement these links using matlab: syntax. If the code that follows the
matlab: declaration has spaces in it, replace them with %20.

Note Dynamic links only work when viewing HTML in the MATLAB web browser.

Diverse uses of dynamic links include:

• “Dynamic Link to Run Code” on page 23-16


• “Dynamic Link to a File” on page 23-16
• “Dynamic Link to a MATLAB Function Reference Page” on page 23-16

23-15
23 Presenting MATLAB Code

Dynamic Link to Run Code

You can specify a dynamic hyperlink to run code when a user clicks the hyperlink. For example, this
matlab: syntax creates hyperlinks in the output, which when clicked either enable or disable
recycling:

%% Recycling Preference
% Click the preference you want:
%
% <matlab:recycle('off') Disable recycling>
%
% <matlab:recycle('on') Enable recycling>

The published result resembles this HTML output.

When you click one of the hyperlinks, MATLAB sets the recycle command accordingly. After clicking
a hyperlink, run recycle in the Command Window to confirm that the setting is as you expect.
Dynamic Link to a File

You can specify a link to a file that you know is in the matlabroot of your reader. You do not need to
know where each reader installed MATLAB. For example, link to the function code for publish.
%%
% See the
% <matlab:edit(fullfile(matlabroot,'toolbox','matlab','codetools','publish.m')) code>
% for the publish function.

Next, publish the file to HTML.

When you click the code link, the MATLAB Editor opens and displays the code for the publish
function. On the reader's system, MATLAB issues the command (although the command does not
appear in the reader's Command Window).
Dynamic Link to a MATLAB Function Reference Page

You can specify a link to a MATLAB function reference page using matlab: syntax. For example,
suppose that your reader has MATLAB installed and running. Provide a link to the publish reference
page.

23-16
Publishing Markup

%%
% See the help for the <matlab:doc('publish') publish> function.

Publish the file to HTML.

When you click the publish hyperlink, the MATLAB Help browser opens and displays the reference
page for the publish function. On the reader's system, MATLAB issues the command, although the
command does not appear in the Command Window.

HTML Markup
You can insert HTML markup into your MATLAB file. You must type the HTML markup since no
button on the Publish tab generates it.

Note When you insert text markup for HTML code, the HTML code publishes only when the
specified output file format is HTML.

This code includes HTML tagging.

%% HTML Markup Example


% This is a table:
%
% <html>
% <table border=1><tr><td>one</td><td>two</td></tr>
% <tr><td>three</td><td>four</td></tr></table>
% </html>
%

If you publish the code to HTML, MATLAB creates a single-row table with two columns. The table
contains the values one, two, three, and four.

If a section produces command-window output that starts with <html> and ends with </html>,
MATLAB includes the source HTML in the published output. For example, MATLAB displays the disp
command and makes a table from the HTML code if you publish this code:

23-17
23 Presenting MATLAB Code

disp('<html><table><tr><td>1</td><td>2</td></tr></table></html>')

LaTeX Markup
You can insert LaTeX markup into your MATLAB file. You must type all LaTeX markup since no button
on the Publish tab generates it.

Note When you insert text markup for LaTeX code, that code publishes only when the specified
output file format is LaTeX.

This code is an example of LaTeX markup.

%% LaTeX Markup Example


% This is a table:
%
% <latex>
% \begin{tabular}{|c|c|} \hline
% $n$ & $n!$ \\ \hline
% 1 & 1 \\
% 2 & 2 \\
% 3 & 6 \\ \hline
% \end{tabular}
% </latex>

If you publish the file to LaTeX, then the Editor opens a new .tex file containing the LaTeX markup.

% This LaTeX was auto-generated from MATLAB code.


% To make changes, update the MATLAB code and republish this document.

\documentclass{article}
\usepackage{graphicx}
\usepackage{color}

\sloppy
\definecolor{lightgray}{gray}{0.5}
\setlength{\parindent}{0pt}

\begin{document}

\section*{LaTeX Markup Example}

23-18
Publishing Markup

\begin{par}
This is a table:
\end{par} \vspace{1em}
\begin{par}

\begin{tabular}{|c|c|} \hline
$n$ & $n!$ \\ \hline
1 & 1 \\
2 & 2 \\
3 & 6 \\ \hline
\end{tabular}

\end{par} \vspace{1em}

\end{document}

MATLAB includes any additional markup necessary to compile this file with a LaTeX program.

See Also

More About
• “Publish and Share MATLAB Code” on page 23-2
• “Output Preferences for Publishing” on page 23-20

23-19
23 Presenting MATLAB Code

Output Preferences for Publishing


In this section...
“How to Edit Publishing Options” on page 23-20
“Specify Output File” on page 23-21
“Run Code During Publishing” on page 23-21
“Manipulate Graphics in Publishing Output” on page 23-23
“Save a Publish Setting” on page 23-26
“Manage a Publish Configuration” on page 23-27

How to Edit Publishing Options


Use the default publishing preferences if your code requires no input arguments and you want to
publish to HTML. However, if your code requires input arguments, or if you want to specify output
settings, code execution, or figure formats, then specify a custom configuration.

1 Locate the Publish tab and click the Publish button arrow .

2 Select Edit Publishing Options.

The Edit Configurations dialog box opens. Specify output preferences.

23-20
Output Preferences for Publishing

The MATLAB expression pane specifies the code that executes during publishing. The Publish
settings pane contains output, figure, and code execution options. Together, they make what
MATLAB refers to as a publish configuration. MATLAB associates each publish configuration with
an .m file. The name of the publish configuration appears in the top left pane.

Specify Output File


You specify the output format and location on the Publish settings pane.

MATLAB publishes to these formats.

Format Notes
html Publishes to an HTML document. You can use an Extensible Stylesheet
Language (XSL) file.
xml Publishes to XML document. You can use an Extensible Stylesheet Language
(XSL) file.
latex Publishes to LaTeX document. Does not preserve syntax highlighting. You can
use an Extensible Stylesheet Language (XSL) file.
doc Publishes to a Microsoft Word document. Does not preserve syntax
highlighting. This format is only available on Windows platforms.
ppt Publishes to a Microsoft PowerPoint document. Does not preserve syntax
highlighting. This format is only available on Windows platforms.
pdf Publishes to a PDF document.

Note XSL files allow you more control over the appearance of the output document. For more
details, see [Link]

Run Code During Publishing


• “Specifying Code” on page 23-21
• “Evaluating Code” on page 23-22
• “Including Code” on page 23-22
• “Catching Errors” on page 23-22
• “Limiting the Amount of Output” on page 23-23

Specifying Code

By default, MATLAB executes the .m file that you are publishing. However, you can specify any valid
MATLAB code in the MATLAB expression pane. For example, if you want to publish a function that
requires input, then run the command function(input). Additional code, whose output you want
to publish, appears after the functions call. If you clear the MATLAB expression area, then MATLAB
publishes the file without evaluating any code.

Note Publish configurations use the base MATLAB workspace. Therefore, a variable in the MATLAB
expression pane overwrites the value for an existing variable in the base workspace.

23-21
23 Presenting MATLAB Code

Evaluating Code

Another way to affect what MATLAB executes during publishing is to set the Evaluate code option in
the Publish setting pane. This option indicates whether MATLAB evaluates the code in the .m file
that is publishing. If set to true, MATLAB executes the code and includes the results in the output
document.

Because MATLAB does not evaluate the code nor include code results when you set the Evaluate
code option to false, there can be invalid code in the file. Therefore, consider first running the file
with this option set to true.

For example, suppose that you include comment text, Label the plot, in a file, but forget to
preface it with the comment character. If you publish the document to HTML, and set the Evaluate
code option to true, the output includes an error.

Use the false option to publish the file that contains the publish function. Otherwise, MATLAB
attempts to publish the file recursively.

Including Code

You can specify whether to display MATLAB code in the final output. If you set the Include code
option to true, then MATLAB includes the code in the published output document. If set to false,
MATLAB excludes the code from all output file formats, except HTML.

If the output file format is HTML, MATLAB inserts the code as an HTML comment that is not visible
in the web browser. If you want to extract the code from the output HTML file, use the MATLAB
grabcode function.

For example, suppose that you publish H:/my_matlabfiles/my_mfiles/sine_wave.m to HTML


using a publish configuration with the Include code option set to false. If you share the output with
colleagues, they can view it in a web browser. To see the MATLAB code that generated the output,
they can issue the following command from the folder containing sine_wave.html:
grabcode('sine_wave.html')

MATLAB opens the file that created sine_wave.html in the Editor.

Catching Errors

You can catch and publish any errors that occur during publishing. Setting the Catch error option to
true includes any error messages in the output document. If you set Catch error to false, MATLAB

23-22
Output Preferences for Publishing

terminates the publish operation if an error occurs during code evaluation. However, this option has
no effect if you set the Evaluate code property to false.

Limiting the Amount of Output

You can limit the number of lines of code output that is included in the output document by specifying
the Max # of output lines option in the Publish settings pane. Setting this option is useful if a
smaller, representative sample of the code output suffices.

For example, the following loop generates 100 lines in a published output unless Max # of output
lines is set to a lower value.
for n = 1:100
disp(x)
end;

Manipulate Graphics in Publishing Output


• “Choosing an Image Format” on page 23-23
• “Setting an Image Size” on page 23-23
• “Capturing Figures” on page 23-24
• “Specifying a Custom Figure Window” on page 23-24
• “Creating a Thumbnail” on page 23-25

Choosing an Image Format

When publishing, you can choose the image format that MATLAB uses to store any graphics
generated during code execution. The available image formats in the drop-down list depend on the
setting of the Figure capture method option. For greatest compatibility, select the default as
specified in this table.

Output File Format Default Image Format Types of Images You Can Include
doc png Any format that your installed version of
Microsoft Office supports.
html png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
latex png or epsc2 All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
pdf bmp bmp and jpg.
ppt png Any format that your installed version of
Microsoft Office supports.
xml png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.

Setting an Image Size

You set the size of MATLAB generated images in the Publish settings pane on the Edit
Configurations dialog window. You specify the image size in pixels to restrict the width and height of

23-23
23 Presenting MATLAB Code

images in the output. The pixel values act as a maximum size value because MATLAB maintains an
image’s aspect ratio. MATLAB ignores the size setting for the following cases:

• When working with external graphics as described in “External Graphics” on page 23-11
• When using vector formats, such as .eps
• When publishing to .pdf

Capturing Figures

You can capture different aspects of the Figure window by setting the Figure capture method
option. This option determines the window decorations (title bar, toolbar, menu bar, and window
border) and plot backgrounds for the Figure window.

This table summarizes the effects of the various Figure capture methods.

Use This Figure Capture To Get Figure Captures with These Appearance Details
Method
Window Decorations Plot Backgrounds
entireGUIWindow Included for dialog boxes; Excluded for Set to white for figures; matches the
figures screen for dialog boxes
print Excluded for dialog boxes and figures Set to white
getframe Excluded for dialog boxes and figures Matches the screen plot background
entireFigureWindow Included for dialog boxes and figures Matches the screen plot background

Note Typically, MATLAB figures have the HandleVisibility property set to on. Dialog boxes are
figures with the HandleVisibility property set to off or callback. If your results are different
from the results listed in the preceding table, the HandleVisibility property of your figures or
dialog boxes might be atypical. For more information, see HandleVisibility.

Specifying a Custom Figure Window

MATLAB allows you to specify custom appearance for figures it creates. If the Use new figure option
in the Publish settings pane is set to true, then in the published output, MATLAB uses a Figure
window at the default size and with a white background. If the Use new figure option is set to
false, then MATLAB uses the properties from an open Figure window to determine the appearance
of code-generated figures. This preference does not apply to figures included using the syntax in
“External Graphics” on page 23-11.

Use the following code as a template to produce Figure windows that meet your needs.
% Create figure
figure1 = figure('Name','purple_background',...
'Color',[0.4784 0.06275 0.8941]);
colormap('hsv');

% Create subplot
subplot(1,1,1,'Parent',figure1);
box('on');

% Create axis labels


xlabel('x-axis');

23-24
Output Preferences for Publishing

ylabel({'y-axis'})

% Create title
title({'Title'});

% Enable printed output to match colors on screen


set(figure1,'InvertHardcopy','off')

By publishing your file with this window open and the Use new figure option set to false, any code-
generated figure takes the properties of the open Figure window.

Note You must set the Figure capture method option to entireFigureWindow for the final
published figure to display all the properties of the open Figure window.

Creating a Thumbnail

You can save the first code-generated graphic as a thumbnail image. You can use this thumbnail to
represent your file on HTML pages. To create a thumbnail, follow these steps:

1 On the Publish tab, click the Publish button drop-down arrow and select Edit Publishing
Options. The Edit Configurations dialog box opens.
2 Set the Image Format option to a bitmap format, such as .png or .jpg. MATLAB creates
thumbnail images in bitmap formats.
3 Set the Create thumbnail option to true.

23-25
23 Presenting MATLAB Code

MATLAB saves the thumbnail image in the folder specified by the Output folder option in the
Publish settings pane.

Save a Publish Setting


You can save your publish settings, which allows you to reproduce output easily. It can be useful to
save your commonly used publish settings.

When the Publish settings options are set, you can follow these steps to save the settings:

1 Click Save As when the options are set in the manner you want.

The Save Publish Settings As dialog box opens and displays the names of all the currently
defined publish settings. By default the following publish settings install with MATLAB:

• Factory Default

You cannot overwrite the Factory Default and can restore them by selecting Factory
Default from the Publish settings list.
• User Default

Initially, User Default settings are identical to the Factory Default settings. You can
overwrite the User Default settings.
2 In the Settings Name field, enter a meaningful name for the settings. Then click Save.

You can now use the publish settings with other MATLAB files.

You also can overwrite the publishing properties saved under an existing name. Select the name
from the Publish settings list, and then click Overwrite.

23-26
Output Preferences for Publishing

Manage a Publish Configuration


• “Running an Existing Publish Configuration” on page 23-27
• “Creating Multiple Publish Configurations for a File” on page 23-27
• “Reassociating and Renaming Publish Configurations” on page 23-28
• “Using Publish Configurations Across Different Systems” on page 23-28

Together, the code in the MATLAB expression pane and the settings in the Publish settings pane
make a publish configuration that is associated with one file. These configurations provide a simple
way to refer to publish preferences for individual files.

To create a publish configuration, click the Publish button drop-down arrow on the Publish tab,
and select Edit Publishing Options. The Edit Configurations dialog box opens, containing the
default publish preferences. In the Publish configuration name field, type a name for the publish
configuration, or accept the default name. The publish configuration saves automatically.

Running an Existing Publish Configuration

After saving a publish configuration, you can run it without opening the Edit Configurations dialog
box:

1 Click the Publish button drop-down arrow If you position your mouse pointer on a publish
configuration name, MATLAB displays a tooltip showing the MATLAB expression associated with
the specific configuration.
2 Select a configuration name to use for the publish configuration. MATLAB publishes the file using
the code and publish settings associated with the configuration.

Creating Multiple Publish Configurations for a File

You can create multiple publish configurations for a given file. You might do this to publish the file
with different values for input arguments, with different publish setting property values, or both.
Create a named configuration for each purpose, all associated with the same file. Later you can run
whichever particular publish configuration you want.

Use the following steps as a guide to create new publish configurations.

1 Open a file in your Editor.


2 Click the Publish button drop-down arrow, and select Edit Publishing Options. The Edit
Configurations dialog box opens.
3
Click the Add button located on the left pane.

A new name appears on the configurations list, filename_n, where the value of n depends on
the existing configuration names.

23-27
23 Presenting MATLAB Code

4 If you modify settings in the MATLAB expression or Publish setting pane, MATLAB
automatically saves the changes.

Reassociating and Renaming Publish Configurations

Each publish configuration is associated with a specific file. If you move or rename a file, redefine its
association. If you delete a file, consider deleting the associated configurations, or associating them
with a different file.

When MATLAB cannot associate a configuration with a file, the Edit Configurations dialog box
displays the file name in red and a File Not Found message. To reassociate a configuration with
another file, perform the following steps.

1
Click the Clear search button on the left pane of the Edit Configurations dialog box.
2 Select the file for which you want to reassociate publish configurations.
3 In the right pane of the Edit Configurations dialog box, click Choose.... In the Open dialog box,
navigate to and select the file with which you want to reassociate the configurations.

You can rename the configurations at any time by selecting a configuration from the list in the left
pane. In the right pane, edit the value for the Publish configuration name.

Note To run correctly after a file name change, you might need to change the code statements in the
MATLAB expression pane. For example, change a function call to reflect the new file name for that
function.

Using Publish Configurations Across Different Systems

Each time you create or save a publish configuration using the Edit Configurations dialog box, the
Editor updates the publish_configurations.m file in your preferences folder. (This is the folder
that MATLAB returns when you run the MATLAB prefdir function.)

Although you can port this file from the preferences folder on one system to another, only one
publish_configurations.m file can exist on a system. Therefore, only move the file to another
system if you have not created any publish configurations on the second system. In addition, because

23-28
Output Preferences for Publishing

the publish_configurations.m file might contain references to file paths, be sure that the
specified files and paths exist on the second system.

MathWorks recommends that you not update publish_configurations.m in the MATLAB Editor
or a text editor. Changes that you make using tools other than the Edit Configurations dialog box
might be overwritten later.

See Also

More About
• “Publish and Share MATLAB Code” on page 23-2
• “Publishing Markup” on page 23-5

23-29
24

Coding and Productivity Tips

• “Open and Save Files in the Editor” on page 24-2


• “Check Code for Errors and Warnings” on page 24-5
• “Improve Code Readability” on page 24-16
• “Find and Replace Text in Files” on page 24-22
• “Add Reminders to Files” on page 24-29
• “MATLAB Code Analyzer Report” on page 24-31
• “MATLAB Code Compatibility Report” on page 24-34
24 Coding and Productivity Tips

Open and Save Files in the Editor


In this section...
“Open Existing Files” on page 24-2
“Save Files” on page 24-3

Open Existing Files


To open an existing file or files in the Editor, choose the option that achieves your goals, as described
in this table.

Goal Steps Additional Information


Open with associated tool On the Editor, Live Editor, or Home tab, in For example, this option opens a
file with a .m or .mlx extension
Open a file using the the File section, click . in the Editor and loads a MAT-file
appropriate MATLAB tool for into the Workspace browser.
the file type. You also can double-click the file in the
Current Folder browser.
Open as text file On the Editor tab, in the File section, click This is useful, for example, if you
Open , and select Open as Text. have imported a tab-delimited
Open a file in the Editor as a data file (.dat) into the
text file, even if the file type is workspace and you find you want
associated with another to add a data point. Open the file
application or tool. as text in the Editor, make your
addition, and then save the file.
Open function from within Position the cursor on the name within the You also can use this method to
file open file, and then right-click and select open a variable or Simulink
Open file-name from the context menu. model.
Open a local function or
function file from within a file For details, see “Open a File or
in the Editor. Variable from Within a File” on
page 24-28.
Reopen file At the bottom of the Open drop-down list, To change the number of files on
select a file under Recent Files.
Reopen a recently used file. the list, click Preferences,
and then select MATLAB and
Editor/Debugger. Under Most
recently used file list, change
the value for Number of
entries.
Reopen files at startup On the Home tab, in the Environment

At startup, automatically open section, click Preferences and select


the files that were open when MATLAB and Editor/Debugger. Then,
the previous MATLAB session select On restart reopen files from
ended. previous MATLAB session.

24-2
Open and Save Files in the Editor

Goal Steps Additional Information


Open file displaying in Drag the file from the other tool into the For example, drag files from the
another tool Editor. Current Folder browser or from
Windows Explorer.
Open a file name displaying in
another MATLAB desktop tool
or Microsoft tool.
Open file using a function Use the edit or open function. For example, type the following
to open collatz.m:

edit collatz.m

If collatz.m is not on the


search path or in the current
folder, use the relative or
absolute path for the file.

For special considerations on the Macintosh platform, see “Navigating Within the MATLAB Root
Folder on macOS Platforms”.

Some options for opening files are not available in MATLAB Online.

Save Files

After you modify a file in the Editor, an asterisk (*) follows the file name. This asterisk indicates that
there are unsaved changes to the file.

You can perform four different types of save operations, which have various effects, as described in
this table.

Save Option Steps


Save file to disk and keep file open in the On the Editor or Live Editor tab, in the File
Editor.
section, click .
Rename file, save it to disk, and make it the 1 On the Editor or Live Editor tab, in the File
active Editor document. Original file remains section, click Save and select Save As.
unchanged on disk. 2 Specify a new name, type, or both for the file,
and then click Save.
Save file to disk under new name. Original file 1 On the Editor tab, in the File section, click
remains open and unsaved. Save and select Save Copy As.

MATLAB opens the Select File for Backup dialog


box.
2 Specify a name and type for the backup file, and
then click Save.
Save changes to all open files using current On the Editor tab, in the File section, click Save
file names. and select Save All.

All files remain open.

24-3
24 Coding and Productivity Tips

Some options for saving files are not available in MATLAB Online.

Recommendations on Saving Files

MathWorks recommends that you save files you create and files from MathWorks that you edit to a
folder that is not in the matlabroot folder tree, where matlabroot is the folder returned when you
type matlabroot in the Command Window. If you keep your files in matlabroot folders, they can
be overwritten when you install a new version of MATLAB software.

At the beginning of each MATLAB session, MATLAB loads and caches in memory the locations of files
in the matlabroot folder tree. Therefore, if you:

• Save files to matlabroot folders using an external editor, run rehash toolbox before you use
the files in the current session.
• Add or remove files from matlabroot folders using file system operations, run rehash
toolbox before you use the files in the current session.
• Modify existing files in matlabroot folders using an external editor, run clear function-name
before you use these files in the current session.

For more information, see rehash or “Toolbox Path Caching in MATLAB”.

Backing Up Files

When you modify a file in the Editor, the Editor saves a copy of the file using the same file name but
with an .asv extension every 5 minutes. The backup version is useful if you have system problems
and lose changes you made to your file. In that event, you can open the backup version,
[Link], and then save it as filename.m to use the last good version of filename.

Note The Live Editor and MATLAB Online do not automatically save copies of files.

To select preferences, click Preferences, and then select MATLAB > Editor/Debugger >
Backup Files on the Home tab, in the Environment section. You can then:

• Turn the backup feature on or off.


• Automatically delete backup files when you close the corresponding source file.

By default, MATLAB automatically deletes backup files when you close the Editor. It is best to
keep backup-to-file relationships clear and current. Therefore, when you rename or remove a file,
consider deleting or renaming the corresponding backup file.
• Specify the number of minutes between backup saves.
• Specify the file extension for backup files.
• Specify a location for backup files

If you edit a file in a read-only folder and the back up Location preference is Source file
directories, then the Editor does not create a backup copy of the file.

24-4
Check Code for Errors and Warnings

Check Code for Errors and Warnings


MATLAB Code Analyzer can automatically check your code for coding problems.

Automatically Check Code in the Editor and Live Editor — Code


Analyzer
You can view warning and error messages about your code, and modify your file based on the
messages. The messages update automatically and continuously so you can see if your changes
addressed the issues noted in the messages. Some messages offer additional information, automatic
code correction, or both.

Enable Continuous Code Checking

To enable continuous code checking in a MATLAB code file in the Editor and Live Editor:

1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Code Analyzer, and then select the Enable integrated warning and error
messages check box.
3 Set the Underlining option to Underline warnings and errors, and then click OK.

Use Continuous Code Checking

You can use continuous code checking in MATLAB code files in the Editor and Live Editor:

1 Open a MATLAB code file in the Editor or Live Editor. This example uses the sample file
lengthofline.m that ships with the MATLAB software:

a Open the example file:

open(fullfile(matlabroot,'help','techdoc','matlab_env',...
'examples','lengthofline.m'))
b Save the example file to a folder to which you have write access. For the example,
lengthofline.m is saved to C:\my_MATLAB_files.
2 Examine the message indicator at the top of the message bar to see the Code Analyzer messages
reported for the file:

• Red indicates that syntax errors or other significant issues were detected.
• Orange indicates warnings or opportunities for improvement, but no errors, were detected.
• Green indicates no errors, warnings, or opportunities for improvement were detected.

In this example, the indicator is red, meaning that there is at least one error in the file.

24-5
24 Coding and Productivity Tips

3 Click the message indicator to go to the next code fragment containing a message. The next code
fragment is relative to the current cursor position, viewable in the status bar.

In the lengthofline example, the first message is at line 21. The cursor moves to the
beginning of line 21.

The code fragment for which there is a message is underlined in either red for errors or orange
for warnings and improvement opportunities.
4 View the message by moving the mouse pointer within the underlined code fragment.

The message opens in a tooltip and contains a Details button that provides access to additional
information by extending the message. Not all messages have additional information.

5 Click the Details button.

The window expands to display an explanation and user action.


6 Modify your code, if needed.

The message indicator and underlining automatically update to reflect changes you make, even if
you do not save the file.
7 On line 27, hover over prod.

The code is underlined because there is a warning message, and it is highlighted because an
automatic fix is available. When you view the message, it provides a button to apply the
automatic fix.

24-6
Check Code for Errors and Warnings

8 Fix the problem by doing one of the following:

• If you know what the fix is (from previous experience), click Fix.
• If you are unfamiliar with the fix, view, and then apply it as follows:

a Right-click the highlighted code (for a single-button mouse, press Ctrl+ click), and then
view the first item in the context menu.
b Click the fix.

MATLAB automatically corrects the code.

In this example, MATLAB replaces prod(size(hline)) with numel(hline).


9 Go to a different message by doing one of the following:

• To go to the next message, click the message indicator or the next underlined code fragment.
• To go to a line that a marker represents, click a red or orange line in the indicator bar.

To see the first error in lengthofline, click the first red marker in the message bar. The
cursor moves to the first suspect code fragment in line 47. The Details and Fix buttons are
dimmed (or not visible if in MATLAB Online), indicating that there is no more information
about this message and there is no automatic fix.

Multiple messages can represent a single problem or multiple problems. Addressing one
might address all of them, or after addressing one, the other messages might change or what
you need to do might become clearer.
10 Modify the code to address the problem noted in the message—the message indicators update
automatically.

On line 47, the message suggests a delimiter imbalance. To investigate this message, in the
Editor or Live Editor, move the arrow key over each of the delimiters to see if MATLAB indicates
a mismatch. For instructions on how to enable delimiter matching on arrow, see “Set Keyboard
Preferences”.

24-7
24 Coding and Productivity Tips

It might appear that there are no mismatched delimiters. However, code analysis detects the
semicolon in parentheses: data{3}(;), and interprets it as the end of a statement. The message
reports that the two statements on line 47 each have a delimiter imbalance.

To fix the problem, in line 47, change data{3}(;) to data{3}(:). Now, the underline no longer
appears in line 47. The single change addresses the issues in both of the messages for line 47.
Because the change removed the only error in the file, the message indicator at the top of the bar
changes from red to orange, indicating that only warnings and potential improvements remain.

After modifying the code to address all the messages, or disabling designated messages, the message
indicator becomes green. The example file with all messages addressed has been saved as
lengthofline2.m. Open the corrected example file with the command:
open(fullfile(matlabroot,'help','techdoc',...
'matlab_env', 'examples','lengthofline2.m'))

Create a Code Analyzer Message Report


You can create a report of messages for an individual file, or for all files in a folder using one of these
methods:

• Run a report for an individual MATLAB code file:


1 On the Editor window, click and select Show Code Analyzer Report.

A Code Analyzer Report appears in the MATLAB Web Browser.


2 Modify your file based on the messages in the report.
3 Save the file.
4 Rerun the report to see if your changes addressed the issues noted in the messages.

Creating a report for an individual file in the Live Editor is not supported.
• Run a report for all files in a folder:
1 On the Current Folder browser, click .
2 Select Reports > Code Analyzer Report.
3 Modify your files based on the messages in the report.

For details, see “MATLAB Code Analyzer Report” on page 24-31.


4 Save the modified file(s).
5 Rerun the report to see if your changes addressed the issues noted in the messages.

Adjust Code Analyzer Message Indicators and Messages


Depending on the stage at which you are in completing a MATLAB file, you might want to restrict the
code underlining. You can do this by using the Code Analyzer preference referred to in step 1, in
“Check Code for Errors and Warnings” on page 24-5. For example, when first coding, you might
prefer to underline only errors because warnings would be distracting.

Code analysis does not provide perfect information about every situation and sometimes, you might
not want to change the code based on a message. If you do not want to change the code, and you do
not want to see the indicator and message for that line, suppress them. For the lengthofline

24-8
Check Code for Errors and Warnings

example, in line 48, the first message is Terminate statement with semicolon to suppress
output (in functions). Adding a semicolon to the end of a statement suppresses output and is a
common practice. Code analysis alerts you to lines that produce output, but lack the terminating
semicolon. If you want to view output from line 48, do not add the semicolon as the message
suggests.

There are a few different ways to suppress (turn off) the indicators for warning and error messages:

• “Suppress an Instance of a Message in the Current File” on page 24-9


• “Suppress All Instances of a Message in the Current File” on page 24-9
• “Suppress All Instances of a Message in All Files” on page 24-10
• “Save and Reuse Code Analyzer Message Settings” on page 24-10

You cannot suppress error messages such as syntax errors. Therefore, instructions on suppressing
messages do not apply to those types of messages.

Suppress an Instance of a Message in the Current File

You can suppress a specific instance of a Code Analyzer message in the current file. For example,
using the code presented in “Check Code for Errors and Warnings” on page 24-5 , follow these steps:
1 In line 48, right-click at the first underline (for a single-button mouse, press Ctrl+click).
2 From the context menu, select Suppress 'Terminate statement with semicolon...' > On This
Line.

The comment %#ok<NOPRT> appears at the end of the line, which instructs MATLAB to suppress
the Terminate statement with semicolon to suppress output (in functions)
Code Analyzer message for that line. The underline and mark in the indicator bar for that
message disappear.
3 If there are two messages on a line that you do not want to display, right-click separately at each
underline and select the appropriate entry from the context menu.

The %#ok syntax expands. For the example, in the code presented in “Check Code for Errors and
Warnings” on page 24-5, ignoring both messages for line 48 adds the comment
%#ok<NBRAK,NOPRT> at the end of the line.

Even if Code Analyzer preferences are set to enable this message, the specific instance of the
message suppressed in this way does not appear because the %#ok takes precedence over the
preference setting. If you later decide you want to show the Terminate statement with
semicolon to suppress output (in functions) Code Analyzer message for that line,
delete %#ok<NOPRT> from the line.

Suppress All Instances of a Message in the Current File

You can suppress all instances of a specific Code Analyzer message in the current file. For example,
using the code presented in “Check Code for Errors and Warnings” on page 24-5, follow these steps:
1 In line 48, right-click at the first underline (for a single-button mouse, press Ctrl+click).
2 From the context menu, select Suppress 'Terminate statement with semicolon...' > In This
File.

The comment %#ok<*NOPRT> appears at the end of the line, which instructs MATLAB to suppress all
instances of the Terminate statement with semicolon to suppress output (in

24-9
24 Coding and Productivity Tips

functions) Code Analyzer message in the current file. All underlines and marks in the message
indicator bar that correspond to this message disappear.

If there are two messages on a line that you do not want to display anywhere in the current file, right-
click separately at each underline, and then select the appropriate entry from the context menu. The
%#ok syntax expands. For the example, in the code presented in “Check Code for Errors and
Warnings” on page 24-5, ignoring both messages for line 48 adds the comment
%#ok<*NBRAK,*NOPRT>.

Even if Code Analyzer preferences are set to enable this message, the message does not appear
because the %#ok takes precedence over the preference setting. If you later decide you want to show
all instances of the Terminate statement with semicolon to suppress output (in
functions) Code Analyzer message in the current file, delete %#ok<*NOPRT> from the line.

Suppress All Instances of a Message in All Files

You can disable all instances of a Code Analyzer message in all files. For example, using the code
presented in “Check Code for Errors and Warnings” on page 24-5, follow these steps:

1 In line 48, right-click at the first underline (for a single-button mouse, press Ctrl+click).
2 Select Suppress 'Terminate statement with semicolon...' > In All Files.

This modifies the Code Analyzer preference setting.

If you know which message or messages that you want to suppress, you can disable them directly
using Code Analyzer preferences, as follows:

1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Code Analyzer.
3 Search the messages to find the ones you want to suppress.
4 Clear the check box associated with each message you want to suppress in all files.
5 Click OK.

Save and Reuse Code Analyzer Message Settings

You can specify that you want certain Code Analyzer messages enabled or disabled, and then save
those settings to a file. When you want to use a settings file with a particular file, you select it from
the Code Analyzer preferences pane. That setting file remains in effect until you select another
settings file. Typically, you change the settings file when you have a subset of files for which you want
to use a particular settings file.

Follow these steps:

1
On the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.


2 Select MATLAB > Code Analyzer.
3 Enable or disable specific messages, or categories of messages.
4 Click the Actions button , select Save as, and then save the settings to a txt file.
5 Click OK.

24-10
Check Code for Errors and Warnings

You can reuse these settings for any MATLAB file, or provide the settings file to another user.

To use the saved settings:

1
On the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.


2 Select MATLAB > Code Analyzer.
3 Use the Active Settings drop-down list to select Browse....

The Open dialog box appears.


4 Choose from any of your settings files.

The settings you choose are in effect for all MATLAB files until you select another set of Code
Analyzer settings.

Understand Code Containing Suppressed Messages


If you receive code that contains suppressed messages, you might want to review those messages
without the need to unsuppress them first. A message might be in a suppressed state for any of the
following reasons:

• One or more %#ok<message-ID> directives are on a line of code that elicits a message specified
by <message-ID>.
• One or more %#ok<*message-ID> directives are in a file that elicits a message specified by
<message-ID>.
• It is cleared in the Code Analyzer preferences pane.
• It is disabled by default.

To determine the reasons why some messages are suppressed:

1 Search the file for the %#ok directive and create a list of all the message IDs associated with that
directive.
2
On the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.


3 Select MATLAB > Code Analyzer.
4 In the search field, type msgid: followed by one of the message IDs, if any, you found in step 1.

The message list now contains only the message that corresponds to that ID. If the message is a
hyperlink, click it to see an explanation and suggested action for the message. This can provide
insight into why the message is suppressed or disabled. The following image shows how the
Preferences dialog box appears when you enter msgid:CPROP in the search field.

24-11
24 Coding and Productivity Tips

5
Click the button to clear the search field, and then repeat step 4 for each message ID you
found in step 1.
6 Display messages that are disabled by default and disabled in the Preferences pane by clicking
the down arrow to the right of the search field. Then, click Show Disabled Messages.
7 Review the message associated with each message ID to understand why it is suppressed in the
code or disabled in Preferences.

Understand the Limitations of Code Analysis


Code analysis is a valuable tool, but there are some limitations:

• Sometimes, it fails to produce Code Analyzer messages where you expect them.

By design, code analysis attempts to minimize the number of incorrect messages it returns, even if
this behavior allows some issues to go undetected.
• Sometimes, it produces messages that do not apply to your situation.

When provided with message, click the Detail button for additional information, which can help
you to make this determination. Error messages are almost always problems. However, many
warnings are suggestions to look at something in the code that is unusual and therefore suspect,
but might be correct in your case.

Suppress a warning message if you are certain that the message does not apply to your situation.
If your reason for suppressing a message is subtle or obscure, include a comment giving the
rationale. That way, those who read your code are aware of the situation.

For details, see “Adjust Code Analyzer Message Indicators and Messages” on page 24-8.

These sections describe code analysis limitations regarding the following:

• “Distinguish Function Names from Variable Names” on page 24-13


• “Distinguish Structures from Handle Objects” on page 24-13
• “Distinguish Built-In Functions from Overloaded Functions” on page 24-14
• “Determine the Size or Shape of Variables” on page 24-14
• “Analyze Class Definitions with Superclasses” on page 24-14

24-12
Check Code for Errors and Warnings

• “Analyze Class Methods” on page 24-14

Distinguish Function Names from Variable Names

Code analysis cannot always distinguish function names from variable names. For the following code,
if the Code Analyzer message is enabled, code analysis returns the message, Code Analyzer
cannot determine whether xyz is a variable or a function, and assumes it is a
function. Code analysis cannot make a determination because xyz has no obvious value assigned to
it. However, the program might have placed the value in the workspace in a way that code analysis
cannot detect.

function y=foo(x)
.
.
.
y = xyz(x);
end

For example, in the following code, xyz can be a function, or can be a variable loaded from the MAT-
file. Code analysis has no way of making a determination.

function y=foo(x)
load [Link]
y = xyz(x);
end

Variables might also be undetected by code analysis when you use the eval, evalc, evalin, or
assignin functions.

If code analysis mistakes a variable for a function, do one of the following:

• Initialize the variable so that code analysis does not treat it as a function.
• For the load function, specify the variable name explicitly in the load command line. For
example:

function y=foo(x)
load [Link] xyz
y = xyz(x);
end

Distinguish Structures from Handle Objects

Code analysis cannot always distinguish structures from handle objects. In the following code, if x is
a structure, you might expect a Code Analyzer message indicating that the code never uses the
updated value of the structure. If x is a handle object, however, then this code can be correct.

function foo(x)
x.a = 3;
end

Code analysis cannot determine whether x is a structure or a handle object. To minimize the number
of incorrect messages, code analysis returns no message for the previous code, even though it might
contain a subtle and serious bug.

24-13
24 Coding and Productivity Tips

Distinguish Built-In Functions from Overloaded Functions

If some built-in functions are overloaded in a class or on the path, Code Analyzer messages might
apply to the built-in function, but not to the overloaded function you are calling. In this case, suppress
the message on the line where it appears or suppress it for the entire file.

For information on suppressing messages, see “Adjust Code Analyzer Message Indicators and
Messages” on page 24-8.

Determine the Size or Shape of Variables

Code analysis has a limited ability to determine the type of variables and the shape of matrices. Code
analysis might produce messages that are appropriate for the most common case, such as for vectors.
However, these messages might be inappropriate for less common cases, such as for matrices.

Analyze Class Definitions with Superclasses

Code Analyzer has limited capabilities to check class definitions with superclasses. For example, Code
Analyzer cannot always determine if the class is a handle class, but it can sometimes validate custom
attributes used in a class if the attributes are inherited from a superclass. When analyzing class
definitions, Code Analyzer tries to use information from the superclasses but often cannot get enough
information to make a certain determination.

Analyze Class Methods

Most class methods must contain at least one argument that is an object of the same class as the
method. But it does not always have to be the first argument. When it is, code analysis can determine
that an argument is an object of the class you are defining, and it can do various checks. For example,
it can check that the property and method names exist and are spelled correctly. However, when code
analysis cannot determine that an object is an argument of the class you are defining, then it cannot
provide these checks.

Enable MATLAB Compiler Deployment Messages


You can switch between showing or hiding Compiler deployment messages when you work on a file
by changing the Code Analyzer preference for this message category. Your choice likely depends on
whether you are working on a file to be deployed. When you change the preference, it also changes
the setting in the Editor. The converse is also true— when you change the setting from the Editor, it
effectively changes this preference. However, if the dialog box is open at the time you modify the
setting in the Editor, you will not see the changes reflected in the Preferences dialog box. Whether
you change the setting from the Editor or from the Preferences dialog box, it applies to the Editor
and to the Code Analyzer Report.

To enable MATLAB Compiler™ deployment messages:

1
On the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.


2 Select MATLAB > Code Analyzer.
3 Click the down arrow next to the search field, and then select Show Messages in Category >
MATLAB Compiler (Deployment) Messages.
4 Click the Enable Category button.

24-14
Check Code for Errors and Warnings

5 Clear individual messages that you do not want to display for your code (if any).
6 Decide if you want to save these settings, so you can reuse them next time you work on a file to
be deployed.

The settings txt file, which you can create as described in “Save and Reuse Code Analyzer Message
Settings” on page 24-10, includes the status of this setting.

24-15
24 Coding and Productivity Tips

Improve Code Readability


In this section...
“Indenting Code” on page 24-16
“Right-Side Text Limit Indicator” on page 24-17
“Code Folding — Expand and Collapse Code Constructs” on page 24-18
“Code Refactoring — Automatically convert selected code to a function” on page 24-21

Indenting Code
Indenting code makes reading statements such as while loops easier. To set and apply indenting
preferences to code in the Editor and Live Editor:

1
On the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.


2 Select MATLAB > Editor/Debugger > Language.
3 Choose a computer language from the Language drop-down list.
4 In the Indenting section, select or clear Apply smart indenting while typing, depending on
whether you want indenting applied automatically, as you type.

If you clear this option, you can manually apply indenting by selecting the lines in the Editor and
Live Editor to indent, right-clicking, and then selecting Smart Indent from the context menu.
5 Do one of the following:

• If you chose any language other than MATLAB in step 2, click OK.
• If you chose MATLAB in step 2, select a Function indenting format, and then click OK.
Function indent formats are:

• Classic — The Editor and Live Editor align the function code with the function
declaration.
• Indent nested functions — The Editor and Live Editor indent the function code
within a nested function.
• Indent all functions — The Editor and Live Editor indent the function code for both
main and nested functions.

This image illustrates the function indenting formats.

24-16
Improve Code Readability

Note Indenting preferences are not supported for TLC, VHDL, or Verilog.

In MATLAB Online, indenting preferences are located under MATLAB > Editor/Debugger >
MATLAB Language and MATLAB > Editor/Debugger > Other Languages.

Regardless of whether you apply indenting automatically or manually, you can move selected lines
further to the left or right, by doing one of the following:


On the Editor tab, in the Edit section, click , , or . For live scripts and functions, this
functionality is available on the Live Editor tab, in the Code section.
• Pressing the Tab key or the Shift+Tab key, respectively.

This works differently if you select the Editor/Debugger Tab preference for Emacs-style Tab key
smart indenting — when you position the cursor in any line or select a group of lines and press
Tab, the lines indent according to smart indenting practices.

Right-Side Text Limit Indicator


By default, a light gray vertical line (rule) appears at column 75 in the Editor, indicating where a line
exceeds 75 characters. You can set this text limit indicator to another value, which is useful, for
example, if you want to view the code in another text editor that has a different line width limit. The
right-side text limit indicator is not supported in the Live Editor.

To hide, or change the appearance of the vertical line:


1
On the Home tab, in the Environment section, click Preferences.

The Preferences dialog box opens.

24-17
24 Coding and Productivity Tips

2 Select MATLAB > Editor/Debugger > Display.


3 Adjust the settings in the Right-hand text limit section.

Note This limit is a visual cue only and does not prevent text from exceeding the limit. To wrap
comment text at a specified column number automatically, go to the Home tab and in the
Environment section, click Preferences. Select MATLAB > Editor/Debugger > Language, and
adjust the Comment formatting preferences. To adjust Comment formatting preferences in
MATLAB Online, select Editor/Debugger > MATLAB Language.

Code Folding — Expand and Collapse Code Constructs


Code folding is the ability to expand and collapse certain MATLAB programming constructs. This
improves readability when a file contains numerous functions or other blocks of code that you want to
hide when you are not currently working with that part of the file. MATLAB programming constructs
include:

• Code sections for running and publishing code


• Class code
• for and parfor blocks
• Function and class help
• Function code

To see the entire list of constructs, go to the Home tab, and in the Environment section, click
Preferences. Then, select Editor/Debugger > Code Folding.

To expand or collapse code, click the plus or minus sign that appears to the left of the construct
in the Editor. You also use the Ctrl+Shift+. (period) and Ctrl+. (period) keyboard shortcuts, or use
the code folding buttons in the View tab.

To expand or collapse all of the code in a file, place your cursor anywhere within the file, right-click,
and then select Code Folding > Expand All or Code Folding > Fold All from the context menu.
You also can use the Ctrl+Shift+, (comma) and Ctrl+, (comma) keyboard shortcuts, or the code
folding buttons in the View tab.

Note Code folding is not supported in the Live Editor

View Folded Code in a Tooltip

You can view code that is currently folded by positioning the pointer over its ellipsis . The code
appears in a tooltip. Viewing folded code in a tooltip is not supported in MATLAB Online.

The following image shows the tooltip that appears when you place the pointer over the ellipsis on
line 23 of lenghtofline.m when a for loop is folded.

24-18
Improve Code Readability

Print Files with Collapsed Code

If you print a file with one or more collapsed constructs, those constructs are expanded in the printed
version of the file.

Code Folding Behavior for Functions that Have No Explicit End Statement

If you enable code folding for functions and a function in your code does not end with an explicit end
statement, you see the following behavior:

• If a line containing only comments appears at the end of such a function, then the Editor does not
include that line when folding the function. This is because MATLAB does not include trailing
white space and comments in a function definition that has no explicit end statement. In MATLAB
Online, the Editor does include the line when folding the function.

“Code Folding Enabled for Function Code Only” on page 24-20 illustrates this behavior. Line 13
is excluded from the fold for the foo function.
• If a fold for a code section overlaps the function code, then the Editor does not show the fold for
the overlapping section.

The three figures that follow illustrate this behavior. The first two figures, “Code Folding Enabled
for Function Code Only” on page 24-20 and “Code Folding Enabled for Sections Only” on page
24-20 illustrate how the code folding appears when you enable it for function code only and then
section only, respectively. The last figure, “Code Folding Enabled for Both Functions and Sections”
on page 24-21, illustrates the effects when code folding is enabled for both. Because the fold for
section 3 (lines 11–13) overlaps the fold for function foo (lines 4–12), the Editor does not display
the fold for section 3.

24-19
24 Coding and Productivity Tips

Code Folding Enabled for Function Code Only

Code Folding Enabled for Sections Only

24-20
Improve Code Readability

Code Folding Enabled for Both Functions and Sections

Code Refactoring — Automatically convert selected code to a function


In the Live Editor, you can break large live scripts or functions into smaller pieces by automatically
converting selected areas of code into functions or local functions. This is called code refactoring.

To refactor a selected area of code:

1 Select one or more lines of code.


2
On the Live Editor tab, in the Code section, click Refactor and select from the available
options.
3 Enter a name for the new function. MATLAB creates a function with the selected code and
replaces the original code with a call to the newly created function.

Refactoring is also available in the Editor in MATLAB Online. To refactor a selected area of code in
the MATLAB Online Editor, on the Editor tab, in the Edit section, click the code refactoring
button . Then, select from the available options.

24-21
24 Coding and Productivity Tips

Find and Replace Text in Files


In this section...
“Find Any Text in the Current File” on page 24-22
“Find and Replace Functions or Variables in the Current File” on page 24-22
“Automatically Rename All Functions or Variables in a File” on page 24-23
“Find and Replace Any Text” on page 24-24
“Find Text in Multiple File Names or Files” on page 24-25
“Function Alternative for Finding Text” on page 24-25
“Perform an Incremental Search in the Editor” on page 24-25
“Go To Location in File” on page 24-25

Find Any Text in the Current File


You can search for text in your files using the Find & Replace tool.

1 Within the current file, select the text you want to find.
2
On the Editor or Live Editor tab, in the Navigate section, click Find , and then select
Find....

A Find & Replace dialog box opens.


3 Click Find Next to continue finding more occurrences of the text.

To find the previous occurrence of selected text (find backwards) in the current file, click Find
Previous on the Find & Replace dialog box.

Find and Replace Functions or Variables in the Current File


To search for references to a particular function or variable, use the automatic highlighting feature
for variables and functions. This feature is more efficient than using the text finding tools. Function
and variable highlighting indicates only references to a particular function or variable, not other
occurrences. For instance, it does not find instances of the function or variable name in comments.
Furthermore, variable highlighting only includes references to the same variable. That is, if two
variables use the same name, but are in different scopes on page 20-10, highlighting one does not
cause the other to highlight.

Find references to a function or variable using automatic highlighting by following these steps:

1 In a file open in the Editor, click an instance of the variable you want to find throughout the file.
MATLAB indicates all occurrences of that variable within the file by:

• Highlighting them in teal blue (by default) throughout the file


• Adding a marker for each in the indicator bar

If a code analyzer indicator and a variable indicator appear on the same line in a file, the
marker for the variable takes precedence.
2 Hover over a marker in the indicator bar to see the line it represents.

24-22
Find and Replace Text in Files

3 Click a marker in the indicator bar to navigate to that occurrence of the variable.
4 Replace an instance of a function or variable by editing the occurrence at a line to which you
have navigated.

This image shows an example of how the Editor looks with variable highlighting enabled. In the
image, the variable i appears highlighted in sky blue, and the indicator bar contains three variable
markers.

To disable automatic highlighting, go to the Home tab and in the Environment section, click
Preferences. In MATLAB > Colors > Programming Tools, clear the Automatically highlight
option.

Automatically Rename All Functions or Variables in a File


To help prevent typographical errors, MATLAB provides a feature that helps rename multiple
references to a function or variable within a file when you manually change any of the following:

Function or Variable Renamed Example


Function name in a function declaration Rename foo in:

function foo(m)
Input or output variable name in a function Rename y or m in:
declaration
function y = foo(m)
Variable name on the left side of assignment Rename y in:
statement
y = 1

As you rename such a function or variable, a tooltip opens if there is more than one reference to that
variable or function in the file. The tooltip indicates that MATLAB will rename all instances of the
function or variable in the file when you press Shift + Enter.

24-23
24 Coding and Productivity Tips

Typically, multiple references to a function appear when you use nested functions or local functions.

Note MATLAB does not prompt you when you change:

• The name of a global variable.


• The function input and output arguments, varargin and varargout.

To undo automatic name changes, click once.

Automatic variable and function renaming is enabled by default. To disable it:

1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Editor/Debugger > Language.
3 In the Language field, select MATLAB.
4 Clear Enable automatic variable and function renaming.

In MATLAB Online, variable and function renaming preferences are located under MATLAB >
Editor/Debugger > MATLAB Language.

Find and Replace Any Text


You can search for, and optionally replace specified text within a file. On the Editor or Live Editor

tab, in the Navigate section, click Find to open and use the Find & Replace dialog box.

24-24
Find and Replace Text in Files

Find Text in Multiple File Names or Files


You can find folders and file names that include specified text, or whose contents contain specified

text. On the Editor or Live Editor tab, in the File section, click Find Files to open the Find Files
dialog box. For details, see “Find Files and Folders”.

Function Alternative for Finding Text


Use lookfor to search for the specified text in the first line of help for all files with the .m extension
on the search path.

Perform an Incremental Search in the Editor


When you perform an incremental search, the cursor moves to the next or previous occurrence of the
specified text in the current file. It is similar to the Emacs search feature. In the Editor, incremental
search uses the same controls as incremental search in the Command Window. For details, see
“Search Using Keyboard Shortcuts”.

Go To Location in File
You can go to a specific location in a file, such as a line number or function definition, set bookmarks,
navigate backward and forward within the file, and open a file or variable from within a file.

Navigate to a Specific Location

This table summarizes the steps for navigating to a specific location within a file open in the Editor
and Live Editor.

Go To Steps Notes
Line Number 1 On the Editor or Live Editor tab, in None

the Navigate section, click Go To

2 Select Go to Line...
3 Specify the line to which you want to
navigate.
1 On the Editor or Live Editor tab, in Includes local functions and nested
functions.
the Navigate section, click Go To
. For both class and function files, the
Function definition
2 Under the heading Function, select the functions list in alphabetical order—except
local function or nested function to that in function files, the name of the main
which you want to navigate. function always appears at the top of the
list.

24-25
24 Coding and Productivity Tips

Go To Steps Notes
1 In the Current Folder browser, click the Functions list in order of appearance within
name of the file open in the Editor. your file.
2 Click the up arrow at the bottom of
Current Folder browser to open the
Details panel.
3 In the Details panel, double-click the

function icon corresponding to the


title of the function or local function to
which you want to navigate.
1 On the Editor or Live Editor tab, in For more information, see “Divide Your File
into Code Sections” on page 18-5.
the Navigate section, click Go To
.
2 Under Sections, select the title of the
code section to which you want to
navigate.
1 In the Current Folder browser, click the
name of the file that is open in the
Code Section
Editor.
2 Click the up arrow at the bottom of
Current Folder browser to open the
Details panel.
3 In the Details panel, double-click the

section icon corresponding to the


title of the section to which you want to
navigate.
Property 1 In the Current Folder browser, click the For more information, see “Ways to Use
name of the file that is open in the Properties”.
Editor.
2 Click the up arrow at the bottom of
Current Folder browser to open the
Details panel.
3 On the Details panel, double-click the

property icon corresponding to the


name of the property to which you
want to navigate.

24-26
Find and Replace Text in Files

Go To Steps Notes
Method 1 In the Current Folder browser, click the For more information, see “Methods in
name of the file that is open in the Class Design”.
Editor.
2 Click the up arrow at the bottom of
Current Folder browser to open the
Details panel.
3 In the Details panel, double-click the

icon corresponding to the name of


the method to which you want to
navigate.
Bookmark 1 On the Editor tab, in the Navigate For information on setting and clearing
bookmarks, see “Set Bookmarks” on page
section, click Go To . 24-27.
2 Under Bookmarks, select the
bookmark to which you want to
navigate.

Note The Details panel does not display details for live scripts or live functions and is not available in
MATLAB Online. In addition, bookmarks are not available in the Live Editor or in MATLAB Online.

Set Bookmarks

You can set a bookmark at any line in a file in the Editor so you can quickly navigate to the
bookmarked line. This is particularly useful in long files. For example, suppose while working on a
line, you want to look at another part of the file, and then return. Set a bookmark at the current line,
go to the other part of the file, and then use the bookmark to return.

Bookmarks are not available in the Live Editor or in MATLAB Online.

To set a bookmark:
1 Position the cursor anywhere on the line.
2
On the Editor tab, in the Navigate section, click Go To .
3 Under Bookmarks, select Set/Clear

A bookmark icon appears to the left of the line.

To clear a bookmark, position the cursor anywhere on the line. Click Go To and select Set/
Clear under Bookmarks.

MATLAB does not maintain bookmarks after you close a file.

Navigate Backward and Forward in Files

To access lines in a file in the same sequence that you previously navigated or edited them, use

and .

24-27
24 Coding and Productivity Tips

Backward and forward navigation is not supported in the Live Editor or in MATLAB Online.

The back and forward sequence is interrupted if you:

1
Click .
2
Click .
3 Edit a line or navigate to another line using the list of features described in “Navigate to a
Specific Location” on page 24-25.

You can still go to the lines preceding the interruption point in the sequence, but you cannot go to any
lines after that point. Any lines you edit or navigate to after interrupting the sequence are added to
the sequence after the interruption point.

For example:

1 Open a file.
2 Edit line 2, line 4, and line 6.
3
Click to return to line 4, and then to return to line 2.
4
Click to return to lines 4 and 6.
5
Click to return to line 1.
6 Edit at 3.

This interrupts the sequence. You can no longer use to return to lines 4 and 6. You can,

however, click to return to line 1.

Open a File or Variable from Within a File

You can open a function, file, variable, or Simulink model from within a file in the Editor. Position the
cursor on the name, and then right-click and select Open selection from the context menu. Based on
what the selection is, the Editor performs a different action, as described in this table.

Item Action
Local function Navigates to the local function within the current file, if that file is a
MATLAB code file. If no function by that name exists in the current file,
the Editor runs the open function on the selection, which opens the
selection in the appropriate tool.
Text file Opens in the Editor.
Figure file (.fig) Opens in a figure window.
MATLAB variable that is in Opens in the Variables Editor.
the current workspace
Model Opens in Simulink.
Other If the selection is some other type, Open selection looks for a
matching file in a private folder in the current folder and performs the
appropriate action.

24-28
Add Reminders to Files

Add Reminders to Files


Annotating a file makes it easier to find areas of your code that you intend to improve, complete, or
update later. To annotate a file, add comments with the text TODO, FIXME, or any text of your
choosing. After you annotate several files, run the TODO/FIXME Report, to identify all the MATLAB
code files within a given folder that you have annotated.

This sample TODO/FIXME Report shows a file containing the text TODO, FIXME, and NOTE. The
search is case insensitive.

Working with TODO/FIXME Reports


1 Use the Current Folder browser to navigate to the folder containing the files for which you want
to produce a TODO/FIXME report.

Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that
is, a path that starts with \\. Instead, use an actual hard drive on your system, or a mapped
network drive.
2 On the Current Folder browser, click , and then select Reports > TODO/FIXME Report.

The TODO/FIXME Report opens in the MATLAB Web Browser.


3 In the TODO/FIXME Report window, select one or more of the following to specify the lines that
you want the report to include:

• TODO
• FIXME
• The text field check box

You can then enter any text in this field, including a regular expression on page 2-51. For
example, you can enter NOTE, tbd, or re.*check.

Specifying custom text or which lines to search for is not supported in MATLAB Online.
4 Run the report on the files in the current folder, by clicking Rerun This Report.

The window refreshes and lists all lines in the MATLAB files within the specified folder that
contain the text you selected in step 1. Matches are not case sensitive.

If you want to run the report on a folder other than the one currently specified in the report
window, change the current folder. Then, click Run Report on Current Folder.

To open a file in the Editor at a specific line, click the line number in the report. Then you can change
the file, as needed.

24-29
24 Coding and Productivity Tips

Suppose you have a file, area.m, in the current folder. The code for area.m appears in the image
that follows.

When you run the TODO/FIXME report on the folder containing area.m, with the text TODO and
FIXME selected and the text NOTE specified and selected, the report lists:
9 and rectangle. (todo)
14 Fixme: Is the area of hemisphere as below?
17 fIXME
21 NOTE: Find out from the manager if we need to include

Notice the report includes the following:

• Line 9 as a match for the text TODO. The report includes lines that have the selected text
regardless of its placement within a comment.
• Lines 14 and 17 as a match for the text FIXME. The report matches selected text in the file
regardless of their casing.
• Line 21 as a match for the text NOTE. The report includes lines that have text as specified in the
text field, assuming that you select the text field.

24-30
MATLAB Code Analyzer Report

MATLAB Code Analyzer Report


In this section...
“Running the Code Analyzer Report” on page 24-31
“Changing Code Based on Code Analyzer Messages” on page 24-32
“Other Ways to Access Code Analyzer Messages” on page 24-32

Running the Code Analyzer Report


The Code Analyzer Report displays potential errors and problems, as well as opportunities for
improvement in your code through messages. For example, a common message indicates that a
variable foo might be unused.

To run the Code Analyzer Report:

1 In the Current Folder browser, navigate to the folder that contains the files you want to check.

To use the lengthofline.m example shown in this documentation, save the file to the current
folder, or to a folder for which you have write access. This example saves the file to the current
folder, C:\my_MATLAB_files.
copyfile(fullfile(matlabroot,'help','techdoc','matlab_env','examples','lengthofline.m'))
2 In the Current Folder browser, click , and then select Reports > Code Analyzer Report.

The report displays in the MATLAB Web Browser, showing those files identified as having
potential problems or opportunities for improvement.

3 For each message in the report, review the suggestion and your code. Click the line number to
open the file in the Editor at that line, and change the file based on the message. Use the
following general advice:

• If you are unsure what a message means or what to change in the code, click the link in the
message if one appears. For details, see “Check Code for Errors and Warnings” on page 24-5.

24-31
24 Coding and Productivity Tips

• If the message does not contain a link, and you are unsure what a message means or what to
do, search for related topics in the Help browser. For examples of messages and what to do
about them, including specific changes to make for the example, lengthofline.m, see
“Changing Code Based on Code Analyzer Messages” on page 24-32.
• The messages do not provide perfect information about every situation and in some cases, you
might not want to change anything based on the message. For details, see “Understand the
Limitations of Code Analysis” on page 24-12.
• If there are certain messages or types of messages you do not want to see, you can suppress
them. For details, see “Adjust Code Analyzer Message Indicators and Messages” on page 24-8.
4 After modifying the file, save it. Consider saving the file to a different name if you made
significant changes that might introduce errors. Then you can refer to the original file, if needed,

to resolve problems with the updated file. Use the Compare button on the Editor or Live
Editor tab to help you identify the changes you made to the file. For more information, see
“Compare Text Files”.
5 Run and debug the file or files again to be sure that you have not introduced any inadvertent
errors.
6 If the report is displaying, click Rerun This Report to update the report based on the changes
you made to the file. Ensure that the messages are gone, based on the changes you made to the
files. To rerun the report in MATLAB Online, in the Current Folder browser, click , and then
select Reports > Code Analyzer Report.

Changing Code Based on Code Analyzer Messages


For information on how to correct the potential problems presented in Code Analyzer messages, use
the following resources:

• Open the file in the Editor and click the Details button in the tooltip, as shown in the image
following this list. An extended message opens. However, not all messages have extended
messages.
• Use the Help browser Search pane to find documentation about terms presented in the messages.

The following image shows a tooltip with a Details button. The orange line under the equals (=) sign
indicates a tooltip displays if you hover over the equals sign. The orange highlighting indicates that
an automatic fix is available.

Other Ways to Access Code Analyzer Messages


You can get Code Analyzer messages using any of the following methods. Each provides the same
messages, but in a different format:

24-32
MATLAB Code Analyzer Report

• Access the Code Analyzer Report for a file from the Profiler detail report.
• Run the checkcode function, which analyzes the specified file and displays messages in the
Command Window.
• Run the mlintrpt function, which runs checkcode and displays the messages in the Web
Browser.
• Use automatic code checking while you work on a file in the Editor. See “Automatically Check
Code in the Editor and Live Editor — Code Analyzer” on page 24-5.

24-33
24 Coding and Productivity Tips

MATLAB Code Compatibility Report


The Code Compatibility Report is a convenient tool that analyzes your code, lists the entire set of
compatibility issues in tabular format, and provides you with instructions on how to address these
compatibility issues. The report enables you to:

• Identify the compatibility issues that you must address for your code to run properly in the current
MATLAB release.
• Estimate the effort required to update your code when you upgrade to a newer MATLAB release.
• Improve your code by replacing functionality that is not recommended.

The Code Compatibility Report displays the locations in your code that are affected by compatibility
issues and provides links to the documentation for more information on how to make the necessary
changes at each location.

Generate the Code Compatibility Report


To run the Code Compatibility Report:

1 In the Current Folder browser, navigate to and open the folder that contains the code files you
want to analyze.
2 In the Current Folder browser that lists the files you want to analyze, either click or right-click
in the white space of the browser. Both options open a menu. Select Reports > Code
Compatibility Report. Alternatively, you can run codeCompatibilityReport at the command
prompt to generate the report.

The report displays in the MATLAB Web Browser, showing potential compatibility issues. For
example:

24-34
MATLAB Code Compatibility Report

3 Update your code to resolve the syntax errors for each file listed in the Syntax Errors section.
Syntax errors result in code that does not run. While most likely the code did not run properly in
previous releases, syntax errors impact compatibility analysis. For example, Parse error at '}':
usage might be invalid MATLAB syntax.
4 For each functionality listed in the report, review the issue description and your code. Messages
include the line numbers to help locate the issue in your code. To open the file in the Editor at
that line, click the line number. Then change the file based on the message. If you are unsure
what a message means or what to change in the code, click the Documentation link associated
with the message.

Each functionality listed in the report displays a recommended action. You also can use the
following general advice:

• Functionality that has been removed — Update your code to avoid compatibility errors in
the current release.
• Functionality that has changed behavior — Confirm that the change in behavior is
acceptable, and if not, update your code for the current release.
• Unsupported functionality that might cause errors — Files listed here use functionality
that is unsupported, undocumented, and not intended for customer use. Update your code to
use documented functionality to avoid errors and unexpected behavior changes.
• Functionality that will be removed — Update your code now or in a later release. Updating
your code now makes future upgrades easier.
• Functionality that will change behavior — Investigate these changes now to make future
upgrades easier.
• New functionality that might improve code — Consider updating your code. Current code
is expected to continue working in future releases but newer functionality is recommended.

24-35
24 Coding and Productivity Tips

The Code Compatibility Report also includes information about the checks performed on your
code and the list of files that MATLAB analyzed for code compatibility.

Programmatic Use
When you generate a Code Compatibility Report through the current folder browser, MATLAB
analyzes code in the current working folder and subfolders. However, if you generate a report
programmatically, you can specify particular files to analyze or to exclude subfolders from analysis.
To generate a report programmatically, use one of the following methods.

• To generate a report that opens in the MATLAB® Web Browser programmatically, use the
codeCompatibilityReport function.
• To return a CodeCompatibilityAnalysis object that contains the report information, use the
analyzeCodeCompatibility function. You can then display a report for the stored object using
the codeCompatibilityReport function.

Unsupported Functionality
The Code Compatibility Report checks for functionality that is unsupported, undocumented, and not
intended for use. Such features are subject to change or removal without notice and can cause future
errors. In some cases there is documented replacement functionality, but there might be no simple
replacement. Contact MathWorks Support to describe your usage and request supported
replacement.

See Also
CodeCompatibilityAnalysis | analyzeCodeCompatibility | codeCompatibilityReport

24-36
25

Programming Utilities

• “Identify Program Dependencies” on page 25-2


• “Protect Your Source Code” on page 25-6
• “Create Hyperlinks that Run Functions” on page 25-8
• “Create and Share Toolboxes” on page 25-11
25 Programming Utilities

Identify Program Dependencies


If you need to know what other functions and scripts your program is dependent upon, use one of the
techniques described below.

Simple Display of Program File Dependencies


For a simple display of all program files referenced by a particular function, follow these steps:

1 Type clear functions to clear all functions from memory (see Note below).

Note clear functions does not clear functions locked by mlock. If you have locked functions
(which you can check using inmem) unlock them with munlock, and then repeat step 1.
2 Execute the function you want to check. Note that the function arguments you choose to use in
this step are important, because you can get different results when calling the same function
with different arguments.
3 Type inmem to display all program files that were used when the function ran. If you want to see
what MEX-files were used as well, specify an additional output:

[mfiles, mexfiles] = inmem

Detailed Display of Program File Dependencies


For a more detailed display of dependent function information, use the
[Link] function. In addition to program files,
[Link] shows which MathWorks products a particular
function depends on. If you have a function, myFun, that calls to the edge function in the Image
Processing Toolbox™:

[fList,pList] = [Link]('myFun.m');
fList

fList =

'C:\work\myFun.m'

The only required program file, is the function file itself, myFun.

{[Link]}'

ans =

'MATLAB'
'Image Processing Toolbox'

The file, myFun.m, requires both MATLAB and the Image Processing Toolbox.

Dependencies Within a Folder


The Dependency Report shows dependencies among MATLAB code files in a folder. Use this report to
determine:

25-2
Identify Program Dependencies

• Which files in the folder are required by other files in the folder
• If any files in the current folder will fail if you delete a file
• If any called files are missing from the current folder

The report does not list:

• Files in the toolbox/matlab folder because every MATLAB user has those files.

Therefore, if you use a function file that shadows a built-in function file, MATLAB excludes both
files from the list.
• Files called from anonymous functions.
• The superclass for a class file.
• Files called from eval, evalc, run, load, function handles, and callbacks.

MATLAB does not resolve these files until run time, and therefore the Dependency Report cannot
discover them.
• Some method files.

The Dependency Report finds class constructors that you call in a MATLAB file. However, any
methods you execute on the resulting object are unknown to the report. These methods can exist
in the classdef file, as separate method files, or files belonging to superclass or superclasses of
a method file.

To provide meaningful results, the Dependency Report requires the following:

• The search path when you run the report is the same as when you run the files in the folder. (That
is, the current folder is at the top of the search path.)
• The files in the folder for which you are running the report do not change the search path or
otherwise manipulate it.
• The files in the folder do not load variables, or otherwise create name clashes that result in
different program elements with the same name.

Note Do not use the Dependency Report to determine which MATLAB code files someone else needs
to run a particular file. Instead use the [Link]
function.

Creating Dependency Reports

1 Use the Current Folder pane to navigate to the folder containing the files for which you want to
produce a Dependency Report.

Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that
is, a path that starts with \\. Instead, use an actual hard drive on your system, or a mapped
network drive.
2 On the Current Folder pane, click , and then select Reports > Dependency Report.

The Dependency Report opens in the MATLAB Web Browser.


3 If you want, select one or more options within the report, as follows:

25-3
25 Programming Utilities

• To see a list of all MATLAB code files (children) called by each file in the folder (parent), select
Show child functions.

The report indicates where each child function resides, for example, in a specified toolbox. If
the report specifies that the location of a child function is unknown, it can be because:

• The child function is not on the search path.


• The child function is not in the current folder.
• The file was moved or deleted.
• To list the files that call each MATLAB code file, select Show parent functions.

The report limits the parent (calling) functions to functions in the current folder.
• To include local functions in the report, select Show subfunctions. The report lists local
functions directly after the main function and highlights them in gray.
4 Click Run Report on Current Folder.

Reading and Working with Dependency Reports

The following image shows a Dependency Report. It indicates that chirpy.m calls two files in Signal
Processing Toolbox™ and one in Image Processing Toolbox. It also shows that go.m calls mobius.m,
which is in the current folder.

The Dependency Report includes the following:

• MATLAB File List

The list of files in the folder on which you ran the Dependency Report. Click a link in this column
to open the file in the Editor.

• Children

25-4
Identify Program Dependencies

The function or functions called by the MATLAB file.

Click a link in this column to open the MATLAB file listed in the same row, and go to the first
reference to the called function. For instance, suppose your Dependency Report appears as shown
in the previous image. Clicking \images\images\erode.m opens chirpy.m and places the cursor
at the first line that references erode. In other words, it does not open erode.m.
• Multiple class methods

Because the report is a static analysis, it cannot determine run-time data types and, therefore,
cannot identify the particular class methods required by a file. If multiple class methods match a
referenced method, the Dependency Report inserts a question mark link next to the file name. The
question mark appears in the following image.

Click the question mark link to list the class methods with the specified name that MATLAB might
use. MATLAB lists almost all the method files on the search path that match the specified method
file (in this case, freqresp.m). Do not be concerned if the list includes methods of classes and
MATLAB built-in functions that are unfamiliar to you.

It is not necessary for you to determine which file MATLAB will use. MATLAB determines which
method to use depending on the object that the program calls at run time.

25-5
25 Programming Utilities

Protect Your Source Code


Although MATLAB source code (.m) is executable by itself, the contents of MATLAB source files are
easily accessed, revealing design and implementation details. If you do not want to distribute your
proprietary application code in this format, you can use one of these options instead:

• Deploy as P-code on page 25-6 — Convert some or all of your source code files to a content-
obscured form called a P-code file (from its .p file extension), and distribute your application code
in this format. When MATLAB P-codes a file, the file is obfuscated not encrypted. While the
content in a .p file is difficult to understand, it should not be considered secure. It is not
recommended that you P-code files to protect your intellectual property.

MATLAB does not support converting live scripts or live functions to P-code files.
• Compile into binary format on page 25-7 — Compile your source code files using the MATLAB
Compiler to produce a standalone application. Distribute the latter to end users of your
application.

Building a Content Obscured Format with P-Code


A P-code file behaves the same as the MATLAB source from which it was produced. The P-code file
also runs at the same speed as the source file. P-code files are purposely obfuscated. They are not
encrypted. While the content in a .p file is difficult to understand, it should not be considered secure.
It is not recommended that you P-code files to protect your intellectual property.

Note Because users of P-code files cannot view the MATLAB code, consider providing diagnostics to
enable a user to proceed in the event of an error.

Building the P-Code File

To generate a P-code file, enter the following command in the MATLAB Command Window:

pcode file1 file2, ...

The command produces the files, file1.p, file2.p, and so on. To convert all .m source files
residing in your current folder to P-code files, use the command:

pcode *.m

See the pcode function reference page for a description of all syntaxes for generating P-code files.

Invoking the P-Code File

You invoke the resulting P-code file in the same way you invoke the MATLAB .m source file from
which it was derived. For example, to invoke file myfun.p, type

[out, out2, ...] = myfun(in1, in2, ...);

To invoke script myscript.p, type

myscript;

25-6
Protect Your Source Code

When you call a P-code file, MATLAB gives it execution precedence over its corresponding .m source
file. This is true even if you happen to change the source code at some point after generating the P-
code file. Remember to remove the .m source file before distributing your code.

Running Older P-Code Files on Later Versions of MATLAB

P-code files are designed to be independent of the release under which they were created and the
release in which they are used (backward and forward compatibility). New and deprecated MATLAB
features can be a problem, but it is the same problem that would exist if you used the original
MATLAB input file. To fix errors of this kind in a P-code file, fix the corresponding MATLAB input file
and create a new P-code file.

P-code files built using MATLAB Version 7.4 and earlier have a different format than those built with
more recent versions of MATLAB. These older P-code files do not run in MATLAB 8.6 (R2015b) or
later. Rebuild any P-code files that were built with MATLAB 7.4 or earlier using a more recent version
of MATLAB, and then redistribute them as necessary.

Building a Standalone Executable


Another way to protect your source code is to build it into a standalone executable and distribute the
executable, along with any other necessary files, to external customers. You must have the MATLAB
Compiler and a supported C or C++ compiler installed to prepare files for deployment. The end user,
however, does not need MATLAB.

To build a standalone application for your MATLAB application, develop and debug your application
following the usual procedure for MATLAB program files. Then, generate the executable file or files
following the instructions in “Create Standalone Application from MATLAB” (MATLAB Compiler).

25-7
25 Programming Utilities

Create Hyperlinks that Run Functions


The special keyword matlab: lets you embed commands in other functions. Most commonly, the
functions that contain it display hyperlinks, which execute the commands when you click the
hyperlink text. Functions that support matlab: syntax include disp, error, fprintf, help, and
warning.

Use matlab: syntax to create a hyperlink in the Command Window that runs one or more functions.
For example, you can use disp to display the word Hypotenuse as an executable hyperlink as follows:

disp('<a href="matlab:a=3; b=4;c=hypot(a,b)">Hypotenuse</a>')

Clicking the hyperlink executes the three commands following matlab:, resulting in

c =
5

Executing the link creates or redefines the variables a, b, and c in the base workspace.

The argument to disp is an <a href> HTML hyperlink. Include the full hypertext text, from '<a
href= to </a>' within a single line, that is, do not continue long text on a new line. No spaces are
allowed after the opening < and before the closing >. A single space is required between a and href.

You cannot directly execute matlab: syntax. That is, if you type

matlab:a=3; b=4;c=hypot(a,b)

you receive an error, because MATLAB interprets the colon as an array operator in an illegal context:

??? matlab:a=3; b=4;c=hypot(a,b)


|
Error: The expression to the left of the equals sign
is not a valid target for an assignment.

You do not need to use matlab: to display a live hyperlink to the Web. For example, if you want to
link to an external Web page, you can use disp, as follows:

disp('<a href="[Link]

The result in the Command Window looks the same as the previous example, but instead opens a
page at [Link]:

Hypotenuse

Using matlab:, you can:

• “Run a Single Function” on page 25-8


• “Run Multiple Functions” on page 25-9
• “Provide Command Options” on page 25-9
• “Include Special Characters” on page 25-9

Run a Single Function


Use matlab: to run a specified statement when you click a hyperlink in the Command Window. For
example, run this command:

25-8
Create Hyperlinks that Run Functions

disp('<a href="matlab:magic(4)">Generate magic square</a>')

It displays this link in the Command Window:

When you click the link, MATLAB runs magic(4).

Run Multiple Functions


You can run multiple functions with a single link. For example, run this command:

disp('<a href="matlab: x=0:1:8;y=sin(x);plot(x,y)">Plot x,y</a>')

It displays this link in the Command Window:

When you click the link, MATLAB runs this code:

x = 0:1:8;
y = sin(x);
plot(x,y)

Redefine x in the base workspace:

x = -2*pi:pi/16:2*pi;

Click the hyperlink, Plot x,y again and it changes the current value of x back to 0:1:8. The code
that matlab: runs when you click the Plot x,y defines x in the base workspace.

Provide Command Options


Use multiple matlab: statements in a file to present options, such as

disp('<a href = "matlab:state = 0">Disable feature</a>')


disp('<a href = "matlab:state = 1">Enable feature</a>')

The Command Window displays the links that follow. Depending on which link you click, MATLAB sets
state to 0 or 1.

Include Special Characters


MATLAB correctly interprets most text that includes special characters, such as a greater than
symbol (>). For example, the following statement includes a greater than symbol (>).

disp('<a href="matlab:str = ''Value > 0''">Positive</a>')

and generates the following hyperlink.

25-9
25 Programming Utilities

Some symbols might not be interpreted correctly and you might need to use the ASCII value for the
symbol. For example, an alternative way to run the previous statement is to use ASCII 62 instead of
the greater than symbol:
disp('<a href="matlab:str=[''Value '' char(62) '' 0'']">Positive</a>')

25-10
Create and Share Toolboxes

Create and Share Toolboxes


In this section...
“Create Toolbox” on page 25-11
“Share Toolbox” on page 25-15

You can package MATLAB files to create a toolbox to share with others. These files can include
MATLAB code, data, apps, examples, and documentation. When you create a toolbox, MATLAB
generates a single installation file (.mltbx) that enables you or others to install your toolbox.

Create Toolbox
To create a toolbox installation file:

1
In the Environment section of the Home tab, select Package Toolbox from the Add-Ons
menu.
2
In the Package a Toolbox dialog box, click the button and select your toolbox folder. It is good
practice to create the toolbox package from the folder level above your toolbox folder.
The .mltbx toolbox file contains information about the path settings for your toolbox files and
folders. By default, any of the included folders and files that are on your path when you create
the toolbox appear on their paths after the end users install the toolbox.
3 In the dialog box, add the following information about your toolbox.

Toolbox Description
Information
Field
Toolbox Enter the toolbox name, if necessary. By default, the toolbox name is the
Name name of the toolbox folder. The Toolbox Name becomes the .mltbx file
name.
Version Enter the toolbox version number in the [Link] format.
Bug and Build are optional.
Author Enter contact information for the toolbox author. To save the contact
Name, Email, information, click Set as default contact.
and Company
Toolbox To select an image that represents your toolbox, click Select toolbox
Image image.
Summary and Enter the toolbox summary and description. It is good practice to keep the
Description Summary text brief and to add detail to the Description text.
4 To ensure MATLAB detects the expected components, review the toolbox contents. The following
sections of the Package a Toolbox dialog box appear after you select a toolbox folder.

25-11
25 Programming Utilities

Package a Description
Toolbox
Dialog Box
Section
Toolbox List of the folders and files contained in your toolbox. The listed files and
Files and folders are only those files that are located in the top level of the toolbox
Folders folder. You cannot navigate through the folders in the Toolbox Packaging
dialog box.

By default, if your toolbox contains a P-code file and a MATLAB code file (.m)
with the same name in the same folder, MATLAB excludes the .m file from the
toolbox. To include both the .p and .m files, clear the Exclude MATLAB
script or function files with matching P-files option.

To exclude other files or folders from the toolbox, register them in the text file
that is displayed when you click Exclude files and folders. It is good
practice to exclude any source control files related to your toolbox.
Requiremen Add-ons — List of add-ons required for your toolbox. Selected add-ons are
ts downloaded and installed when the toolbox is installed. MATLAB auto-
populates this list with the add-ons it thinks the toolbox requires and selects
them all by default. You can choose to omit any add-ons you do not want to
install with your toolbox.

If MATLAB is unable to find the installation information for an add-on in the


list, you must enter a download URL. The download URL is the location where
MATLAB can download and install the add-on. When the toolbox is installed,
MATLAB installs the add-on using the specified URL.
External Files — List of the files required for your toolbox that are located
outside the toolbox folder. MATLAB auto-populates this list with the files it
thinks the toolbox requires and selects them all by default. You can choose to
omit any files you do not want in your toolbox.
Install MATLAB Path — List of folders that are added to the user’s MATLAB path
Actions when they install a toolbox. By default, the list includes any of the toolbox
folders that are on your path when you create the toolbox. You can exclude
folders from being added to the user’s path by clearing them from the list. To
manage the path for when a toolbox is installed, click Manage the current
MATLAB path. To reset the list to the default list, click Reset to the
current MATLAB path.
Java Class Path — List of Java files that are added to the user’s Java class path
when they install a toolbox. Upon toolbox installation, the JAR files are added
to the dynamic path for the duration of the MATLAB session. When the
toolbox user restarts MATLAB, the JAR files are added to the static path.

25-12
Create and Share Toolboxes

Package a Description
Toolbox
Dialog Box
Section
Installation of Additional Software — List of additional software ZIP files that
are installed on the user's system when they install a toolbox.

Specify these fields:

• Display Name — The name to display to the user when they install a
toolbox.
• License URL — The URL of the additional software license agreement to
display to the user when they install a toolbox. The user is prompted to
review and agree to the license agreement during installation. You must
specify a valid URL to the license agreement.
• Download URL — The URL to the ZIP file that contains the additional
software. To specify different download URLs for different platforms,
select a platform name from the drop-down menu to the left of the
download URL. Then, click Add Platform to add a download URL for
additional platforms.

When the user installs a toolbox, MATLAB installs all additional software in
the addons\Toolboxes\AdditionalSoftware folder, where addons is the
add-ons default installation folder. For more information about the location of
the add-ons default installation folder, see “Get and Manage Add-Ons”.

If your toolbox contains code that refers to the installation folder of the
specified additional software, make these references portable to other
computers. Replace the references with calls to the generated function
toolboxname\[Link], where toolboxname is
the name of your toolbox. For example, if you are creating a toolbox called
mytoolbox and want to reference the install location for additional software
called mysoftware, replace this code

mysoftwarelocation = 'C:\InstalledSoftware\mysoftware\'

with this code:

mysoftwarelocation = [Link]('mysoftware')

To enable testing of the toolbox on your computer before packaging the


toolbox, click the toolboxname\[Link] link at
the bottom of the Installation of Additional Software section and enter the
installed location of each additional piece of software on your computer.
Toolbox MATLAB uses the information in the Toolbox Portability section when the
Portability user installs the toolbox. If the compatibility check fails because the user has
an unsupported platform or MATLAB version, MATLAB displays a warning.
However, the user still can install the toolbox.

25-13
25 Programming Utilities

Package a Description
Toolbox
Dialog Box
Section
Platform Compatibility—List of platforms that support the toolbox. Consider if
your toolbox has third-party software or hardware requirements that are
platform specific. MATLAB Online cannot interact with hardware, including
devices used for image acquisition and instrument control.
Release Compatibility—List of MATLAB releases that support the toolbox.
Products—List of MathWorks products required by your toolbox. Create this
list manually.
Examples, Examples—Published MATLAB examples associated with your toolbox. To
Apps, and include .m and .mlx files as examples, click the Add examples button, select
Documentat your code file, and click Publish HTML. MATLAB publishes the code to
ion HTML and places the output files in the html folder.

Alternatively, you can manually publish code files to HTML in MATLAB and
then include the code files and the HTML files in your toolbox folder.

• For a live script (.mlx) example, export it to HTML. On the Live Editor
tab, select Save > Export to HTML and save it in a folder named html.
• For a script (.m) example, publish it to HTML with the publish function.
Do not specify an output folder when publishing your examples. For the
Package a Toolbox tool to recognize the examples, the output folder must
be the default folder (html).

To create different categories for your examples, place the examples in


different subfolders within your toolbox folder. When you add your toolbox
folder to the Package a Toolbox dialog box, MATLAB creates a [Link] file
to describe your examples, and takes the example subfolder name as the
example category name. Alternatively, you can create your own [Link]
file. The [Link] file allows recipients to access your examples through
the Supplemental Software link at the bottom of the Help browser home
page. For more information, see “Display Custom Examples” on page 31-29.
Apps—Published MATLAB installable apps associated with your toolbox. The
Package a Toolbox tool recognizes apps (.mlapp files) and app installer files
(.mlappinstall files) and includes them in your toolbox.

• To specify which apps (.mlapp files) are also installed and registered in
the user's MATLAB Apps Gallery, select the apps.
• All .mlappinstall files in your toolbox folder are installed and
registered in the user's MATLAB Apps Gallery.

25-14
Create and Share Toolboxes

Package a Description
Toolbox
Dialog Box
Section
Getting Started Guide—Quick start guide for your toolbox. For the Package a
Toolbox tool to recognize a Getting Started Guide, include the guide as a live
script named [Link] in a doc subfolder within your toolbox
folder.

Alternatively, you can generate and edit [Link] from the


Package a Toolbox dialog box.

Users of your toolbox can view the Getting Started Guide through the Options
menu for the toolbox in the Add-On Manager. For more information, see “Get
and Manage Add-Ons”.
Help Browser Integration—Custom documentation associated with your
toolbox. For the Package a Toolbox tool to recognize custom documentation,
include an [Link] file to identify your documentation files. If you use the
builddocsearchdb function to build the documentation database before
packaging your toolbox, you can include the generated helpsearch
subfolder in your toolbox. The [Link] file and the helpsearch folder
allow recipients to access your documentation through the Supplemental
Software link at the bottom of the Help browser home page. For more
information, see “Display Custom Documentation” on page 31-21.

Alternatively, you can generate [Link] and [Link] template files


from the Package a Toolbox dialog box. To access your documentation
through the Help browser, complete the documentation templates and include
[Link] on the MATLAB path.
5 Package your toolbox.

• To save your toolbox, click Package at the top of the Package a Toolbox dialog box. Packaging
your toolbox generates a .mltbx file in your current MATLAB folder.
• To save your toolbox and share it on MATLAB Central File Exchange, select Package and
Share from the Package menu at the top of the Package a Toolbox dialog box. This option
generates a .mltbx file in your current MATLAB folder and opens a web page for your
toolbox submission to File Exchange. MATLAB populates the File Exchange submission form
with information about the toolbox. Review and submit the form to share your toolbox on File
Exchange.

When you create a toolbox, MATLAB generates a .prj file that contains information about the
toolbox and saves it frequently. It is good practice to save this associated .prj file so that you
can quickly create future revisions of your toolbox.

Share Toolbox
To share your toolbox with others, give them the .mltbx file. All files you added when you packaged
the toolbox are included in the .mltbx file. When the end users install your toolbox, they do not need
to be concerned with the MATLAB path or other installation details. The .mltbx file manages these
details for end users.

25-15
25 Programming Utilities

For information on installing, uninstalling, and viewing information about toolboxes, see “Get and
Manage Add-Ons”.

You can share your toolbox with others by attaching the .mltbx file to an email message, or using
any other method you typically use to share files—such as uploading to MATLAB Central File
Exchange. If you upload your toolbox to File Exchange, your users can download the toolbox from
within MATLAB. For more information, see “Get and Manage Add-Ons”.

Alternatively, you can upload your toolbox to File Exchange when you package it. Select Package
and Share from the Package menu at the top of the Package a Toolbox dialog box.

Note While .mltbx files can contain any files you specify, MATLAB Central File Exchange places
additional limitations on submissions. If your toolbox contains any of the following, it cannot be
submitted to File Exchange:

• MEX-files.
• Other binary executable files, such as DLLs or ActiveX® controls. (Data and image files are
typically acceptable.)

See Also
[Link] | [Link]
| [Link] | [Link] |
[Link] | publish

Related Examples
• “Get and Manage Add-Ons”
• “Display Custom Examples” on page 31-29
• “Package Apps From the MATLAB Toolstrip”
• “Display Custom Documentation” on page 31-21

25-16
26

Function Argument Validation


26 Function Argument Validation

Function Argument Validation

Introduction to Argument Validation


Function argument validation is a way to declare specific restrictions on function input arguments.
Using argument validation you can constrain the class, size, and other aspects of function input
values without writing code in the body of the function to perform these tests.

Function argument validation is declarative, which enables MATLAB desktop tools to extract
information about a function by inspection of specific code blocks. By declaring requirements for
input arguments, you can eliminate cumbersome argument-checking code and improve the
readability, robustness, and maintainability of your code.

The function argument validation syntax simplifies the process of defining optional, repeating, and
name-value arguments. The syntax also enables you to define default values in a consistent way.

Where to Use Argument Validation


The use of function argument validation is optional in function definitions. Argument validation is
most useful in functions that can be called by any code and where validity of the inputs must be
determined before executing the function code. Functions that are designed for use by others can
benefit from the appropriate level of restriction on argument inputs and the opportunity to return
specific error messages based on the inputs to the functions.

Where Validation Is Not Needed

In local and private functions, and in private or protected methods, the caller is aware of input
requirements, so these types of functions can be called with valid arguments.

Where Validation Is Not Allowed

You cannot use argument validation syntax in nested functions, abstract methods, or handle class
destructor methods. For more information on argument validation in methods, see “Argument
Validation in Class Methods” on page 26-14.

arguments Block Syntax


Functions define argument validation in code blocks that are delimited by the keywords arguments
and end. If used, an arguments block must start before the first executable line of the function.

You can use multiple arguments blocks in a function, but all blocks must occur before any code that
is not part of an arguments block.

The highlighted area in the following code shows the syntax for argument validation.

26-2
Function Argument Validation

The function argument declaration can include any of these kinds of restrictions:

• Size — The length of each dimension, enclosed in parentheses


• Class — The name of a single MATLAB class
• Functions — A comma-separated list of validation functions, enclosed in braces

You can also define a default value for the input argument in the function validation declaration for
that argument. The default value must satisfy the declared restrictions for that argument.

Size

Validation size is the dimensions of the input argument, specified with nonnegative integer numbers
or colons (:). A colon indicates that any length is allowed in that dimension. You cannot use
expressions for dimensions. The value assigned to the argument in the function call must be
compatible with the specified size, or MATLAB throws an error.

MATLAB indexed assignment rules apply to size specifications. For example, a 1-by-1 value is
compatible with the size specified as (5,3) because MATLAB applies scalar expansion. Also,
MATLAB row-column conversion applies so that a size specified as (1,:) can accept a size of 1-by-n
and n-by-1.

Here are some examples:

• (1,1) — The input must be exactly 1-by-1.


• (3,:) — The first dimension must be 3, and second dimension can be any value.

If you do not specify a size, then any size is allowed unless restricted by validation functions.

Class

Validation class is the name of a single class. The value assigned to the function input must be of the
specified class or convertible to the specified class. Use any MATLAB class or externally defined class
that is supported by MATLAB, except Java, COM classes, and MATLAB class definitions that do not
use the classdef keyword (classes defined before MATLAB software Version 7.6).

Here are some examples:

• char — Input must be of class char, or a value that MATLAB can convert to a char, such as
string.

26-3
26 Function Argument Validation

• double — Input can be a numeric value of any precision.


• cell — Input must be a cell array.
• A user-defined class, such as an enumeration class, can restrict inputs to more specific values and
enables you to control what conversions are supported.

If you do not specify a class, then any class is allowed unless restricted by validation functions.

Validation Functions

A validation function is a MATLAB function that throws an error if certain requirements are not
satisfied by the argument value. Validation functions do not return values and, unlike class and size,
cannot change the value of the arguments they are validating.

During the validation process, MATLAB passes the argument value to each validation function listed
for that argument. The value passed to the validation functions is the result of any conversion made
by the class and size specifications. MATLAB calls each function from left to right and throws the first
error encountered.

For a table of predefined validation functions, see “Argument Validation Functions” on page 26-21.

Default Value

An argument default value can be any constant or expression that satisfies the size, class, and
validation function requirements. Specifying a default value in an argument declaration makes the
argument optional. MATLAB uses the default value when the argument is not included in the function
call. Default value expressions are evaluated each time the default is used.

Note Because MATLAB validates the default value only when the function is called without a value
for the argument, an invalid default value causes an error only when the function is called without
that argument.

Optional arguments must be positioned after required arguments in the function signature and in the
arguments block. For more information on optional arguments, see “Required and Optional
Positional Arguments” on page 26-6.

Validation Sequence

Arguments are validated from top to bottom in the arguments block. MATLAB validates each part of
an argument declaration in a specific order. First the class is validated, then the size. The result of
the class and size validations is passed to the validation functions. Each step is optional depending on
whether class, size, and validation functions are in the argument declaration.

For more information, see “Order of Argument Validation” on page 26-15.

Conversion to Declared Class and Size

Both class validation and size validation can change the value of an input argument because of
standard MATLAB conversion rules. Therefore, the validated value in the function body can be
different from the value passed when calling the function. The conversion rules are derived from the
rules that MATLAB applies for indexed assignment of the form:

A(indices) = value

26-4
Function Argument Validation

MATLAB can determine that the left side value has requirements for class and size and, in certain
cases, can convert the right side value to be of the required class and size.

For related information, see “Avoiding Class and Size Conversions” on page 26-15.

Examples of Argument Validation


This arguments block specifies the size and class of the three inputs.
function out = myFunction(A, B, C)
arguments
A (1,1) string
B (1,:) double
C (2,2) cell
end

% Function code
...
end

In this function, the variables must meet these validation requirements:

• A is a string scalar.
• B is a 1-by-any length vector of doubles.
• C is a 2-by-2 cell array.

Value Conversion

The following function illustrates how inputs can be converted to match the classes specified in the
arguments block. The SpeedEnum class is an enumeration class created to define the values allowed
for the third input argument.
function forwardSpeed(a,b,c)
arguments
a double
b char
c SpeedEnum
end

% Function code
disp(class(a))
disp(class(b))
disp(class(c))
end

Here is the enumeration class.


classdef SpeedEnum < int32
enumeration
Full (100)
Half (50)
Stop (0)
end
end

This call to the function uses input values that MATLAB can convert to the declared types. The actual
argument types within the function are displayed as output.

26-5
26 Function Argument Validation

forwardSpeed(int8(4),"A string",'full')

double
char
SpeedEnum

Specific Restrictions Using Validation Functions

Validation functions can restrict input arguments in more specific ways. You can use predefined
validation functions for many common kinds of validation, and you can define your own validation
function to satisfy specific requirements.

For example, this function specifies the following validations using mustBeNumeric, mustBeReal,
mustBeMember, and the local function mustBeEqualSize.

• Input x must be a real, numeric row vector of any length.


• Input v must be a real, numeric row vector the same size as x.
• Input method must be a character vector that is one of the three allowed choices. Because
method specifies a default value, this argument is optional.
function myInterp(x,v,method)
arguments
x (1,:) {mustBeNumeric,mustBeReal}
v (1,:) {mustBeNumeric,mustBeReal,mustBeEqualSize(v,x)}
method (1,:) char {mustBeMember(method,{'linear','cubic','spline'})} = 'linear'
end
% Function code
....
end

% Custom validation function


function mustBeEqualSize(a,b)
% Test for equal size
if ~isequal(size(a),size(b))
eid = 'Size:notEqual';
msg = 'Size of first input must equal size of second input.';
throwAsCaller(MException(eid,msg))
end
end

Avoid using function argument validation within custom validation functions. For more information
about defining validation functions and a list of predefined validation functions, see “Argument
Validation Functions” on page 26-21.

Kinds of Arguments
Function argument validation can declare four kinds of arguments. Functions can define any of these
kinds of arguments, but the arguments must be defined in the following order:
1 Required positional arguments
2 Optional positional arguments
3 Repeating positional arguments
4 Optional name-value arguments

Required and Optional Positional Arguments


Positional arguments must be passed to a function in a specific order. The position of the value passed
in the argument list must correspond to the order that the argument is declared in the arguments
block. All argument names in the arguments block must be unique.

26-6
Function Argument Validation

Positional arguments in the arguments block are required when calling the function, unless the
argument defines a default value. Specifying a default value in the argument declaration makes a
positional argument optional because MATLAB can use the default value when no value is passed in
the function call.

The default value can be a constant or an expression that produces a result that satisfies the
argument declaration. The expression can refer to the arguments that are declared before it in the
arguments block, but not arguments that are declared after it.

MATLAB evaluates the default value expression only when the argument is not included in the
function call.

All optional arguments must be positioned after all required arguments in the arguments block. For
example, in this argument block, maxval and minval have default values and are therefore optional.
function myFunction(x,y,maxval,minval)
arguments
x (1,:) double
y (1,:) double
maxval (1,1) double = max(max(x),max(y))
minval (1,1) double = min(min(x),min(y))
end

% Function code
....
end

You can call this function with any of these syntaxes:


myFunction(x,y,maxval,minval)
myFunction(x,y,maxval)
myFunction(x,y)

An optional positional argument becomes required when its position must be filled in the function call
to identify arguments that come after it. That is, if you want to specify a value for minval, you must
specify a value for maxval.

Ignored Positional Arguments

MATLAB lets you ignore input arguments by passing a tilde character (~) in place of the argument.
You can define a function that ignores unused positional arguments by adding a tilde character (~) in
the arguments block corresponding to the position of the argument in the function signature. Add a
tilde character (~) for each ignored argument in the function signature.

Ignored arguments cannot have default values or specify class, size, or validation functions.

The tilde character (~) is treated as an optional input argument unless it is followed by a required
positional argument. For example, in this function the tilde character (~) represents an optional
argument.
function c = f(~)
arguments
~
end

% Function code
end

26-7
26 Function Argument Validation

You can call this function with no arguments.


c = f

Or you can call this function with one argument.


c = f(2)

In the following function, the tilde character (~) represents a required argument.
function c = f(~,x)
arguments
~
x
end

% Function code
...
end

Calls to this function must include both arguments.


c = f(2,3)

For more information on calling functions with ignored inputs, see “Ignore Function Inputs” on page
21-10.

Repeating Arguments
Repeating arguments are positional arguments that can be specified repeatedly as input arguments.
Declare repeating arguments in an arguments block that includes the Repeating attribute.
arguments (Repeating)
arg1
arg2
...
end

Functions can have only one Repeating arguments block, which can contain one or more repeating
arguments.

A function that defines a Repeating arguments block can be called with zero or more occurrences
of all the arguments in the block. If a call to a function includes repeating arguments, then all
arguments in the Repeating arguments block must be included for each repetition.

For example, if a Repeating arguments block defines arguments x and y, then each repetition must
contain both x and y.

Repeating arguments cannot specify default values and therefore cannot be optional. However, you
can call the function without including any repeating arguments.

Functions must declare repeating arguments after positional arguments and before name-value
arguments. You cannot specify name-value arguments within a Repeating block. For information on
name-value arguments, see “Name-Value Arguments” on page 26-10.

In the function, each repeating argument becomes a cell array with the number of elements equal to
the number of repeats passed in the function call. The validation is applied to each element of the cell

26-8
Function Argument Validation

array. If the function is called with zero occurrences of this argument, the cell array has a size of 1-
by-0. That is, it is empty.

For example, this function declares a block of three repeating arguments, x, y, and option.
function [xCell,yCell,optionCell] = fRepeat(x,y,option)
arguments (Repeating)
x double
y double
option {mustBeMember(option,["linear","cubic"])}
end

% Function code
% Return cell arrays
xCell = x;
yCell = y;
optionCell = option;
end

You can call the function with no inputs or multiples of three inputs. MATLAB creates a cell array for
each argument containing all the values passes for that argument. This call to fRepeat passes two
sets of the three repeating arguments.
[xCell,yCell,optionCell] = fRepeat(1,2,"linear",3,4,"cubic")

xCell =

1×2 cell array

{[1]} {[3]}

yCell =

1×2 cell array

{[2]} {[4]}

optionCell =

1×2 cell array

{["linear"]} {["cubic"]}

The following function accepts repeating arguments for x and y inputs in a Repeating arguments
block. In the body of the function, the values specified as repeating arguments are available in the
cell arrays x and y. This example interleaves the values of x and y to match the required input to the
plot function: plot(x1,y1,…).
function myPlotRepeating(x,y)
arguments (Repeating)
x (1,:) double
y (1,:) double
end

% Function code
% Interleave x and y

26-9
26 Function Argument Validation

z = reshape([x;y],1,[]);

% Call plot function


if ~isempty(z)
plot(z{:});
end
end

Call this function with repeating pairs of input arguments.

x1 = 1:10;
y1 = sin(x1);
x2 = 0:5;
y2 = sin(x2);
myPlotRepeating(x1,y1,x2,y2)

Avoid Using varargin for Repeating Arguments

Using varargin with functions that use argument validation is not recommended. If varargin is
restricted in size or class in the repeating arguments block, then the restrictions apply to all values in
varargin.

If you use varargin to support legacy code, it must be the only argument in a Repeating
arguments block.

For example, this function defines two required positional arguments and varargin as the repeating
argument.

function f(a, b, varargin)


arguments
a uint32
b uint32
end
arguments (Repeating)
varargin
end

% Function code
...
end

Name-Value Arguments
Name-value arguments associate a name with a value that is passed to the function. Name-value
arguments:

• Can be passed to the function in any order


• Are always optional
• Must be declared after all positional and repeating arguments
• Cannot appear in an arguments block that uses the Repeating attribute
• Must use unique names even when using multiple name-value structures
• Cannot use names that are also used for positional arguments

26-10
Function Argument Validation

Declare name-value arguments in an arguments block using dot notation to define the fields of a
structure. For example, the structure named NameValueArgs defines two name-value arguments,
Name1 and Name2. You can use any valid MATLAB identifier as the structure name.
arguments
NameValueArgs.Name1
NameValueArgs.Name2
end

The structure name must appear in the function signature.


function myFunction(NameValueArgs)

Call the function using the field names in the name-value structure, passed as a string or character
vector.
myFunction('Name1',value1,'Name2',value2)

The name of the structure used in the function signature is the name of the structure in the function
workspace that contains the names and values passed to the function.
function result = myFunction(NameValueArgs)
arguments
NameValueArgs.Name1
NameValueArgs.Name2
end

% Function code
result = NameValueArgs.Name1 * NameValueArgs.Name2;
end

r = myFunction('Name1',3,'Name2',7)

r =

21

Default Values for Name-Value Arguments

You can specify a default value for each name. If you do not specify a default value and the function is
called without that name-value argument, then that field is not present in the name-value structure. If
no name-value arguments are passed to the function, MATLAB creates the structure, but it has no
fields.

To determine what name-value arguments have been passed in the function call, use the isfield
function.

For example, the following function defines two required positional arguments (width and height)
and two name-value arguments (LineStyle and LineWidth). In this example, the options
structure has two fields (LineStyle and LineWidth) containing either the default values or values
specified as name-value arguments when the function is called.
function myRectangle(width,height,options)
arguments
width double
height double
[Link] (1,1) string = "-"
[Link] (1,1) {mustBeNumeric} = 1

26-11
26 Function Argument Validation

end

% Function code
...
end

All of the following are valid ways to call this function.

myRectangle(4,5)
myRectangle(4,5,"LineStyle",":","LineWidth",2)
myRectangle(4,5,"LineWidth",2,"LineStyle",":")
myRectangle(4,5,"LineStyle",":")
myRectangle(4,5,"LineWidth",2)

Using Repeating and Name-Value Arguments

If the function defines repeating arguments, then you must declare the name-value arguments in a
separate arguments block that follows the repeating arguments block. For example, this function
accepts two repeating arguments, x and y. After specifying all repeats of x and y, you can specify a
name-value pair that assigns the value lin or log to the PlotType name.

To determine if the function call includes the PlotType argument, use the isfield function to
check for the PlotType field in the scale structure.

function linLog(x,y,scale)
arguments(Repeating)
x (1,:) double
y (1,:) double
end
arguments
[Link] (1,1) string
end
z = reshape([x;y],1,[]);
if isfield(scale,"PlotType")
if [Link] == "lin"
plot(z{:})
elseif [Link] =="log"
loglog(z{:})
end
end
end

Call this function with or without the name-value argument.

myLinLog(1:5,1:5)
myLinLog(1:5,1:5,1:10,1:100:1000)
myLinLog(1:5,1:5,1:10,1:100:1000,"PlotType","log")

Multiple Name-Value Structures

Function argument blocks can contain multiple name-value structures. However, the field names
must be unique among all structures. This function has two name-value structures: lineOptions
and fillOptions. These structures cannot have the same field names.

The arguments in the myRectangle function are:

• width and height are required positional arguments of type double.

26-12
Function Argument Validation

• [Link] is a scalar string with a default value of "-".


• [Link] is a scalar numeric with a default value of 1.
• [Link] is a string.
• [Link] has no restrictions on its value.
function myRectangle(width,height,lineOptions,fillOptions)
arguments
width double
height double
[Link] (1,1) string = "-"
[Link] (1,1) {mustBeNumeric} = 1
[Link] string
[Link]
end

% Function Code
...
end

Name-Value Arguments from Class Properties


A useful function syntax in MATLAB uses the public properties of a class for the names of name-value
arguments. To specify name-value arguments for all settable properties defined by a class (that is, all
properties with public SetAccess), use this syntax in an arguments block:
structName.?ClassName

A function can use the "structName.? ClassName" syntax only once. Therefore, a function can
define only one name-value structure that gets its field names from a class, even if using different
classes and structure names.

If the class places restrictions on values that you can assign to the property by using property
validation, then the function applies the validation to the individual name-value arguments. For
information on property validation, see “Validate Property Values”.

For example, this function has two required arguments, x and y and accepts any public property
name and value for the [Link] class.
function myBar(x,y,propArgs)
arguments
x (:,:) double
y (:,:) double
propArgs.?[Link]
end
propertyCell = namedargs2cell(propArgs);
bar(x,y,propertyCell{:})
end

Call the function with the required inputs and any settable property name-value pairs.
x = [1,2,3;4,5,6];
y = x.^2;
myBar(x,y)
myBar(x,y,'FaceColor','magenta','BarLayout','grouped')

Override Specific Properties

You can override the class property validation by redefining the property name with a specific name-
value argument in the arguments block.

26-13
26 Function Argument Validation

structName.?ClassName
[Link] (dim1,dim2,...) ClassName {fcn1,fcn2,...}

The specific name-value argument validation overrides the validation defined by class for the
individually specified property name.

For example, the following function defines name-value arguments as the properties of the
[Link] class. The function also overrides the property name
FaceColor to allow only these specific values: red or blue.

The [Link] class has a default value for FaceColor that is not
one of the restricted values (red or blue). Therefore, the overriding declaration must assign a
default value that satisfies the restriction placed by the mustBeMember validation function. That is,
the default value must be red or blue.

This function converts the name-value structure to a cell array containing interleaved names and
values using the namedargs2cell function.
function myBar(x,y,propArgs)
arguments
x (:,:) double
y (:,:) double
propArgs.?[Link]
[Link] {mustBeMember([Link],{'red','blue'})} = "blue"
end
propertyCell = namedargs2cell(propArgs);
bar(x,y,propertyCell{:})
end

Call the function using the two required arguments, x and y. Optionally pass any name-value pairs
supported by the bar function and a value for FaceColor that can be either red or blue. Other
values for FaceColor are not allowed.

x = [1,2,3;4,5,6];
y = x.^2;
myBar(x,y)
myBar(x,y,'FaceColor','red','BarLayout','grouped')

Argument Validation in Class Methods


Validating method input arguments is useful in public methods because calls to the method might not
originate in class code. You can use function argument validation in concrete class methods, including
concrete methods defined in abstract classes. However, abstract methods (methods not implemented
by the class) cannot define arguments blocks. For information on class methods, see “Methods” and
“Abstract Classes and Class Members”.

If a classdef file includes method prototypes for methods defined in separate files, include the
arguments blocks in the separate files defining the method. For more information on defining
methods in separate files, see “Methods in Separate Files”.

Subclass methods do not inherit function argument validation. In subclass methods that override
superclass methods, you can add the same argument validation to the subclass method as is used in
the superclass method.

Handle class destructor methods cannot use argument validation. A method named delete in a
handle subclass that includes an arguments block is not treated as a destructor. (In other words, it is
not called by MATLAB when the object is destroyed). For more information on class destructor
methods, see “Handle Class Destructor”.

26-14
Function Argument Validation

Order of Argument Validation


When a function is called, MATLAB validates the input arguments in the order they are declared in
the arguments block, from top to bottom. Each argument is fully validated before the next argument
is validated. Therefore, any reference to a previously declared argument uses values that have been
validated. Functions throw an error as a result of the first validation failure.

Validated values can be different from the original values passed as inputs when the function is
called. For example, this function declares the inputs as class uint32 values. The third input
declaration assigns a default value equal to the product of the first two inputs.

function c = f(a, b,c)


arguments
a uint32
b uint32
c uint32 = a .* b
end

% Function code
...
end

Calling the function with inputs that are a different numeric class (for example, double) results in a
conversion to uint32.

c = f(1.8,1.5)

Because the optional input argument c is not specified in the function call, MATLAB evaluates the
default value and assigns it to c after converting a and b to uint32 values. In this case, the
conversion results in a value of 2 for both inputs. Therefore, the product of a times b is four.

c =

uint32

If you specify a value for the third input, then the function assigns a value to c and does not evaluate
the default value expression.

c = f(1.8,1.5,25)

c =

uint32

25

Avoiding Class and Size Conversions


During the validation process, MATLAB applies class and then size validation before calling any
validation functions. If a default value is used for an optional input that is omitted in the function call,
this value is assigned to the argument before applying any steps in the validation process.

26-15
26 Function Argument Validation

When an argument value that is passed to a function does not match the class and size required by
the validation, MATLAB converts the value to the declared class and size when conversion is possible.
However, conversion might not be the desired behavior.

Here are some examples of conversions that MATLAB can perform.

To satisfy numeric class restriction:

• A char value can be converted to its Unicode numeric value.


• A string can be converted to a number or NaN if the string is not a representation of a single
number.

To satisfy size restriction:

• Scalar expansion can change size from scalar to nonscalar.


• A column vector can be converted to a row vector.

To eliminate the standard conversions performed by MATLAB from input argument validation, use
validation functions instead of class and size restrictions. Calls to validation functions do not return
values and cannot change the value of the input argument.

For example, this function restricts the first input to a two-dimensional array of any size that is of
class double. The second input must be a 5-by-3 array of any class.
function f(a, b)
arguments
a (:,:) double
b (5,3)
end

% Function code
...
end

Because of standard MATLAB type conversion and scalar expansion, you can call this function with
the following inputs and not receive a validation error.
f('character vector',144)

By default, MATLAB converts the elements of the character vector to their equivalent numeric value
and applies scalar expansion to create a 5-by-3 array from the scalar value 144.

Using specialized validation functions can provide more specific input argument validation. For
example, this function defines specialized validation functions that it uses in place of the class and
size specifications for the first and second arguments. These local functions enable you to avoid input
value conversions.

• mustBeOfClass restricts the input to a specific class without allowing conversion or subclasses.
For a related function, see mustBeA.
• mustBeEqualSize restricts two inputs to be of equal size without allowing scalar expansion. For
a related function, see mustBeScalarOrEmpty.
• mustBeDims restricts the input to be of a specified dimension without allowing transposing or
scalar expansion. For a related function, see mustBeVector.
function fCustomValidators(a, b)
arguments

26-16
Function Argument Validation

a {mustBeOfClass(a,'double'), mustBeDims(a,2)}
b {mustBeEqualSize(b,a)}
end

% Function code
...
end

% Custom validator functions


function mustBeOfClass(input,className)
% Test for specific class name
cname = class(input);
if ~strcmp(cname,className)
eid = 'Class:notCorrectClass';
msg = ['Input must be of class ', cname];
throwAsCaller(MException(eid,msg))
end
end

function mustBeEqualSize(a,b)
% Test for equal size
if ~isequal(size(a),size(b))
eid = 'Size:notEqual';
msg = 'Inputs must have equal size.';
throwAsCaller(MException(eid,msg))
end
end

function mustBeDims(input,numDims)
% Test for number of dimensions
if ~isequal(length(size(input)),numDims)
eid = 'Size:wrongDimensions';
msg = ['Input must have dimensions: ',num2str(numDims)];
throwAsCaller(MException(eid,msg))
end
end

The mustBeOfClass function enforces strict class matching by requiring a match with the name of
the class. A more general approach could use the isa function to also match subclasses of the
specified class.

The mustBeEqualSize and mustBeDims functions enforce the strict declarations for the input
arguments.
fCustomValidators('character vector',144)

Invalid input argument at position 1. Input must be of class double

In this call, the number of dimensions of the first input is wrong, so the validation function returns a
custom error message.
fCustomValidators(ones(2,2,4),144)

Invalid input argument at position 1. Input must have 2 dimensions

The mustBeEqualSize validator function restricts the second input to a specific dimension, which is
provided in the error message.
fCustomValidators(ones(2,2),144)

26-17
26 Function Argument Validation

Invalid input argument at position 2. Input must be of size [5 3]

For related predefined validation functions, see mustBeA, mustBeFloat, and mustBeVector.

nargin in Argument Validation


The nargin function returns the number of function input arguments given in the call to the
currently executing function. When using function argument validation, the value returned by
nargin within a function is the number of positional arguments provided when the function is called.

Repeating arguments are positional arguments and therefore the number of repeating arguments
passed to the function when called is included in the value returned by nargin.

The value that nargin returns does not include optional arguments that are not included in the
function call. Also, nargin does not count any name-value arguments.

Use nargin to determine if optional positional arguments are passed to the function when called. For
example, this function declares three positional arguments and a name-value argument. Here is how
the function determines what arguments are passed when it is called.

• nargin determines if the optional positional argument c is passed to the function with a switch
block.
• isfield determines if the name-value argument for Format is passed to the function.

function result = fNargin(a, b, c, namedargs)


arguments
a (1,1) double
b (1,1) double
c (1,1) double = 1
[Link] (1,:) char
end

% Function code
switch nargin
case 2
result = a + b;
case 3
result = a^c + b^c;
end
if isfield(namedargs,'Format')
format([Link]);
end
end

In this function call, the value of nargin is 2:

result = fNargin(3,4)

result =

In this function call, the value of nargin is 3:

result = fNargin(3,4,7.62)

26-18
Function Argument Validation

result =

4.3021e+04

In this function call, the value of nargin is 3:

result = fNargin(3,4,7.62,'Format','bank')

result =

43020.56

Restrictions on Variable and Function Access


arguments blocks exist in the function's workspace. Any packages, classes, or functions added to the
scope of the function using the import command are added to the scope of the arguments block.

The only variables visible to validator functions and default value expressions are the input variables
already declared. In this function, the default value of c is derived from a and b.

function c = f(a,b,c)
arguments
a uint32
b uint32
c uint32 = a * b
end

% Function code
...
end

However, you cannot refer to input variables not yet declared in an arguments block. For example,
using this declaration for argument a in the previous function is not valid because b and c have not
been declared yet.

arguments
a uint32 = b * c
b uint32
c uint32
end

Argument validation expressions can reference only previously declared, and therefore validated,
arguments. Validation functions and default values for name-value arguments cannot access other
name-value arguments.

Limitations on Functions in arguments Block

Any references to previously declared arguments must be visible in the text of validation functions
and default values. To ensure code transparency, do not use functions that interact with the function
workspace. Specifically, do not use nested functions or any of the functions listed in the following
table in the arguments block.

assignin builtin clear


dbstack eval evalc
evalin exist feval

26-19
26 Function Argument Validation

input inputname load


nargin narginchk nargoutchk
save whos who

These restrictions apply only within the arguments block and do not apply to variables or functions
in the body of the function.

See Also
arguments | namedargs2cell

Related Examples
• “Input and Output Arguments”
• “Argument Validation Functions” on page 26-21
• “Validate Property Values”

26-20
Argument Validation Functions

Argument Validation Functions


MATLAB defines functions for use in argument validation. These functions support common use
patterns for validation and provide descriptive error messages. The following tables categorize the
MATLAB validation functions and describe their use.

Numeric Value Attributes


Name Meaning Functions Called
on Inputs
mustBePositive(value) value > 0 gt, isreal,
isnumeric,
islogical
mustBeNonpositive(valu value <= 0 ge, isreal,
e) isnumeric,
islogical
mustBeNonnegative(valu value >= 0 ge, isreal,
e) isnumeric,
islogical
mustBeNegative(value) value < 0 lt, isreal,
isnumeric,
islogical
mustBeFinite(value) value has no NaN and isfinite
no Inf elements.
mustBeNonNan(value) value has no NaN isnan
elements.
mustBeNonzero(value) value ~= 0 eq, isnumeric,
islogical
mustBeNonsparse(value) value has no sparse issparse
elements.
mustBeReal(value) value has no isreal
imaginary part.
mustBeInteger(value) value == isreal,
floor(value) isfinite, floor,
isnumeric,
islogical
mustBeNonmissing(value value cannot contain ismissing
) missing values.

26-21
26 Function Argument Validation

Comparison with Other Values


Name Meaning Functions Called
on Inputs
mustBeGreaterThan(valu value > c gt, isscalar,
e,c) isreal,
isnumeric,
islogical
mustBeLessThan(value,c value < c lt, isreal,
) isnumeric,
islogical
mustBeGreaterThanOrEqu value >= c ge, isreal,
al(value,c) isnumeric,
islogical
mustBeLessThanOrEqual( value <= c le, isreal,
value,c) isnumeric,
islogical

Data Types
Name Meaning Functions Called
on Inputs
mustBeA(value,classnam value must be of Uses class
es) specific class. definition
relationships
mustBeNumeric(value) value must be isnumeric
numeric.
mustBeNumericOrLogical value must be isnumeric,
(value) numeric or logical. islogical
mustBeFloat(value) value must be isfloat
floating-point array.
mustBeUnderlyingType(v value must have isUnderlyingTyp
alue,typename) specified underlying e
type.

Size
Name Meaning Functions Called
on Inputs
mustBeNonempty(value) value is not empty. isempty
mustBeScalarOrEmpty(va value must be a isscalar,
lue) scalar or be empty. isempty
mustBeVector(value) value must be a isvector
vector.

26-22
Argument Validation Functions

Membership and Range


Name Meaning Functions Called
on Inputs
mustBeMember(value,S) value is an exact ismember
match for a member of
S.
mustBeInRange(value,lo value must be within gt, ge, lt, le
wer,upper,boundflags) range.

Text
Name Meaning Functions Called
on Inputs
mustBeFile(path) path must refer to a isfile
file.
mustBeFolder(folder) path must refer to a isfolder
folder.
mustBeNonzeroLengthTex value must be a piece Not applicable
t(value) of text with nonzero
length.
mustBeText(value) value must be a Not applicable
string array, character
vector, or cell array of
character vectors.
mustBeTextScalar(value value must be a Not applicable
) single piece of text.
mustBeValidVariableNam varname must be a isvarname
e(varname) valid variable name.

Define Validation Functions


Validation functions are MATLAB functions that check requirements on values entering functions or
properties. Validation functions determine when to throw errors and what error messages to display.

Functions used for validation have these design elements:

• Validation functions do not return outputs or modify program state. The only purpose is to check
the validity of the input value.
• Validation functions must accept the value being validated as an input argument. If the function
accepts more than one input argument, the first input is the value to be validated.
• Validation functions rely only on the inputs. No other values are available to the function.
• Validation functions throw an error if the validation fails. Using throwAsCaller to throw
exceptions avoids showing the validation function itself in the displayed error message.

Creating your own validation function is useful when you want to provide specific validation that is
not available using the MATLAB validation functions. You can create a validation function as a local

26-23
26 Function Argument Validation

function within the function file or place it on the MATLAB path. To avoid a confluence of error
messages, do not use function argument validation within user-defined validation functions.

For example, the mustBeRealUpperTriangular function restricts the input to real-valued, upper
triangular matrices. The validation function uses the istriu and isreal functions.
function mustBeRealUpperTriangular(a)
if ~(istriu(a) && isreal(a))
eidType = 'mustBeRealUpperTriangular:notRealUpperTriangular';
msgType = 'Input must be a real-valued, upper triangular matrix.';
throwAsCaller(MException(eidType,msgType))
end
end

If the input argument is not of the correct type, the function throws an error.

a = [1 2 3+2i; 0 2 3; 0 0 1];
mustBeRealUpperTriangular(a)
Input must be a real-valued, upper triangular matrix.

See Also

More About
• “Function Argument Validation” on page 26-2

26-24
Ways to Parse Function Inputs

Ways to Parse Function Inputs


MATLAB is dynamically typed, which means that variables do not have a declared type and can hold
different types of values. However, values always belong to a specific type, and a program can always
query the class and size of a variable’s current value.

Function input arguments are variables in the function workspace whose values come from the
calling code or command-line users. When a function is widely used by others, it should determine if
the input values match the values expected by the code in the function.

Argument checking allows the function to provide more useful information when input values are
unexpected and the function is unable to perform as intended. MATLAB provides several ways to
simplify the process of checking and processing function inputs.

Function Argument Validation


Many functions in MATLAB use one of these patterns for input arguments:

• One or more required input arguments


• One or more required input arguments followed by one or more optional input arguments
• One of the previous patterns followed by name-value pairs

An effective way to implement these common patterns is to declare the arguments using a function
arguments block, as described in “Function Argument Validation” on page 26-2. This syntax is new
for release R2019b and does not work in earlier releases.

Function argument validation is a way to declare specific restrictions on function input arguments. It
enables you to constrain the class, size, and other aspects of function input values without writing
code in the body of the function to perform these tests.

validateattributes
The validateattributes function enables you to verify that the inputs to a function conform to a
set of requirements. Call validateattributes for each input argument with parameters specifying
argument requirements.

inputParser
For complex function signatures, use an inputParser object to express input argument
requirements programmatically. An inputParser object parses and validates a set of inputs.

See Also
arguments | inputParser | validateattributes

More About
• “Function Argument Validation” on page 26-2
• “Check Function Inputs with validateattributes” on page 21-11
• “Parse Function Inputs” on page 21-13

26-25
26 Function Argument Validation

Transparency in MATLAB Code


Code has transparent variable access if MATLAB can identify every variable access by scanning the
code while ignoring comments, character vectors, and string literals. Variable access includes
reading, adding, removing, or modifying workspace variables.

In these coding contexts, MATLAB requires transparent variable access:

• Function argument validation blocks. For more information, see “Restrictions on Variable and
Function Access” on page 26-19
• The body of a parfor loop or spmd block. For more information, see “Ensure Transparency in
parfor-Loops or spmd Statements” (Parallel Computing Toolbox).

In these contexts, nontransparent variable access results in run-time errors.

Writing Transparent Code


Transparent code refers to variable names explicitly. For example, in this code, MATLAB can identify
X and ii as variables.
X = zeros(1,10);
for ii = 1:10
X(ii) = randi(9,1);
end

However, in the following call to the eval function, MATLAB cannot recognize the variables in the
statement that is passed to eval because the input is a character string.
X = zeros(1,10);
for ii = 1:10
eval('X(ii) = randi(9,1);')
end

Before executing this code, MATLAB sees a call to the eval function with one argument, which is the
character vector 'X(ii) = randi(9,1);'.

To be transparent, code must refer to variable names explicitly so that MATLAB can identify the
variables by inspection or static analysis. Using the eval function with the character vector 'X(ii)
= randi(9,1);' means that MATLAB must execute the code to identify X and ii as variables.

Here is a partial list of functions and coding that you cannot use with transparent variable access:

• eval, evalc, evalin, or assignin


• Scripts
• MEX functions that access the workspace variables dynamically, for example by using
mexGetVariable
• Introspective functions such as who and whos
• The save and load commands, except when the result from load is assigned explicitly
• Any dynamic name reference

Passing a variable to a function using the command form is not transparent because it is equivalent to
passing the argument as a character string. For example, these calls to the clear function are both
nontransparent.

26-26
Transparency in MATLAB Code

clear X
clear('X')

If code creates workspace variables, but MATLAB can identify these new variables only after
executing the code, then this code does not have transparent variable access. For example, MATLAB
cannot determine what variables are loaded from a MAT file, so this statement is nontransparent.

load [Link]

However, code that explicitly assigns the loaded variable to a name is transparent because MATLAB
can recognize that the name on the left-hand side refers to a workspace variable. For example, this
statement loads the variable X from the MAT file into the workspace in a variable named X.

X = load('[Link]','X');

Access to variables must be transparent within the workspace. For example, code cannot use the
evalin or assignin functions in a workspace that requires transparency to create variables in
another workspace.

See Also

More About
• “Function Argument Validation” on page 26-2
• “Scope Variables and Generate Names”

26-27
Software Development

29
27

Error Handling

• “Exception Handling in a MATLAB Application” on page 27-2


• “Throw an Exception” on page 27-4
• “Respond to an Exception” on page 27-6
• “Clean Up When Functions Complete” on page 27-9
• “Issue Warnings and Errors” on page 27-13
• “Suppress Warnings” on page 27-16
• “Restore Warnings” on page 27-18
• “Change How Warnings Display” on page 27-20
• “Use try/catch to Handle Errors” on page 27-21
27 Error Handling

Exception Handling in a MATLAB Application


In this section...
“Overview” on page 27-2
“Getting an Exception at the Command Line” on page 27-2
“Getting an Exception in Your Program Code” on page 27-3
“Generating a New Exception” on page 27-3

Overview
No matter how carefully you plan and test the programs you write, they may not always run as
smoothly as expected when executed under different conditions. It is always a good idea to include
error checking in programs to ensure reliable operation under all conditions.

In the MATLAB software, you can decide how your programs respond to different types of errors. You
may want to prompt the user for more input, display extended error or warning information, or
perhaps repeat a calculation using default values. The error-handling capabilities in MATLAB help
your programs check for particular error conditions and execute the appropriate code depending on
the situation.

When MATLAB detects a severe fault in the command or program it is running, it collects information
about what was happening at the time of the error, displays a message to help the user understand
what went wrong, and terminates the command or program. This is called throwing an exception. You
can get an exception while entering commands at the MATLAB command prompt or while executing
your program code.

Getting an Exception at the Command Line


If you get an exception at the MATLAB prompt, you have several options on how to deal with it as
described below.

Determine the Fault from the Error Message

Evaluate the error message MATLAB has displayed. Most error messages attempt to explain at least
the immediate cause of the program failure. There is often sufficient information to determine the
cause and what you need to do to remedy the situation.

Review the Failing Code

If the function in which the error occurred is implemented as a MATLAB program file, the error
message should include a line that looks something like this:

surf

Error using surf (line 49)


Not enough input arguments.

The text includes the name of the function that threw the error (surf, in this case) and shows the
failing line number within that function's program file. Click the line number; MATLAB opens the file
and positions the cursor at the location in the file where the error originated. You may be able to
determine the cause of the error by examining this line and the code that precedes it.

27-2
Exception Handling in a MATLAB Application

Step Through the Code in the Debugger

You can use the MATLAB Debugger to step through the failing code. Click the underlined error text to
open the file in the MATLAB Editor at or near the point of the error. Next, click the hyphen at the
beginning of that line to set a breakpoint at that location. When you rerun your program, MATLAB
pauses execution at the breakpoint and enables you to step through the program code. The command
dbstop on error is also helpful in finding the point of error.

See the documentation on “Debug a MATLAB Program” on page 22-2 for more information.

Getting an Exception in Your Program Code


When you are writing your own program in a program file, you can catch exceptions and attempt to
handle or resolve them instead of allowing your program to terminate. When you catch an exception,
you interrupt the normal termination process and enter a block of code that deals with the faulty
situation. This block of code is called a catch block.

Some of the things you might want to do in the catch block are:

• Examine information that has been captured about the error.


• Gather further information to report to the user.
• Try to accomplish the task at hand in some other way.
• Clean up any unwanted side effects of the error.

When you reach the end of the catch block, you can either continue executing the program, if
possible, or terminate it.

Use an MException object to access information about the exception in your program. For more
information, see “Respond to an Exception” on page 27-6.

Generating a New Exception


When your program code detects a condition that will either make the program fail or yield
unacceptable results, it should throw an exception. This procedure

• Saves information about what went wrong and what code was executing at the time of the error.
• Gathers any other pertinent information about the error.
• Instructs MATLAB to throw the exception.

Use an MException object to capture information about the error. For more information, see “Throw
an Exception” on page 27-4.

27-3
27 Error Handling

Throw an Exception
When your program detects a fault that will keep it from completing as expected or will generate
erroneous results, you should halt further execution and report the error by throwing an exception.
The basic steps to take are:
1 Detect the error. This is often done with some type of conditional statement, such as an if or
try/catch statement that checks the output of the current operation.
2 Construct an MException object to represent the error. Add an error identifier and error
message to the object when calling the constructor.
3 If there are other exceptions that may have contributed to the current error, you can store the
MException object for each in the cause field of a single MException that you intend to throw.
Use the addCause function for this.
4 If there is fix that can be suggested for the current error, you can add it to the Correction field
of the MException that you intend to throw. Use the addCorrection function for this.
5 Use the throw or throwAsCaller function to have MATLAB issue the exception. At this point,
MATLAB stores call stack information in the stack field of the MException, exits the currently
running function, and returns control to either the keyboard or an enclosing catch block in a
calling function.

Suggestions on How to Throw an Exception


This example illustrates throwing an exception using the steps just described.

Create a function, indexIntoArray, that indexes into a specified array using a specified index. The
function catches any errors that MATLAB throws and creates an exception that provides general
information about the error. When it catches an error, it detects whether the error involves the
number of inputs or the specified index. If it does, the function adds additional exceptions with more
detailed information about the source of the failure, and suggests corrections when possible.
function indexIntoArray(A,idx)

% 1) Detect the error.


try
A(idx)
catch

% 2) Construct an MException object to represent the error.


errID = 'MYFUN:BadIndex';
msg = 'Unable to index into array.';
baseException = MException(errID,msg);

% 3) Store any information contributing to the error.


if nargin < 2
causeException = MException('MATLAB:notEnoughInputs','Not enough input arguments.');
baseException = addCause(baseException,causeException);

% 4) Suggest a correction, if possible.


if(nargin > 1)
exceptionCorrection = [Link]('1');
baseException = [Link](exceptionCorrection);
end

throw(baseException);
end

try
assert(isnumeric(idx),'MYFUN:notNumeric', ...
'Indexing array is not numeric.')
catch causeException
baseException = addCause(baseException,causeException);
end

27-4
Throw an Exception

if any(size(idx) > size(A))


errID = 'MYFUN:incorrectSize';
msg = 'Indexing array is too large.';
causeException2 = MException(errID,msg);
baseException = addCause(baseException,causeException2);
end

% 5) Throw the exception to stop execution and display an error


% message.
throw(baseException)
end
end

If you call the function without specifying an index, the function throws a detailed error and suggests
a correction:

A = [13 42; 7 20];


indexIntoArray(A)

Error using indexIntoArray (line 21)


Unable to index into array.

Caused by:
Not enough input arguments.

Did you mean:


>> indexIntoArray(A, 1)

If you call the function with a nonnumeric index array that is too large, the function throws a detailed
error.

A = [13 42; 7 20];


idx = ['a' 'b' 'c'];
indexIntoArray(A, idx)

Error using indexIntoArray (line 41)


Unable to index into array.

Caused by:
Error using indexIntoArray (line 25)
Indexing array is not numeric.
Indexing array is too large.

27-5
27 Error Handling

Respond to an Exception
In this section...
“Overview” on page 27-6
“The try/catch Statement” on page 27-6
“Suggestions on How to Handle an Exception” on page 27-7

Overview
The MATLAB software, by default, terminates the currently running program when an exception is
thrown. If you catch the exception in your program, however, you can capture information about what
went wrong and deal with the situation in a way that is appropriate for the particular condition. This
requires a try/catch statement.

The try/catch Statement


When you have statements in your code that could generate undesirable results, put those statements
into a try/catch block that catches any errors and handles them appropriately.

A try/catch statement looks something like the following pseudocode. It consists of two parts:

• A try block that includes all lines between the try and catch statements.
• A catch block that includes all lines of code between the catch and end statements.

try
Perform one ...
or more operations
A catch ME
Examine error info in exception object ME
Attempt to figure out what went wrong
Either attempt to recover, or clean up and abort
end

B Program continues

The program executes the statements in the try block. If it encounters an error, it skips any
remaining statements in the try block and jumps to the start of the catch block (shown here as
point A). If all operations in the try block succeed, then execution skips the catch block entirely and
goes to the first line following the end statement (point B).

Specifying the try, catch, and end commands and also the code of the try and catch blocks on
separate lines is recommended. If you combine any of these components on the same line, separate
them with commas:

try, surf, catch ME, [Link], end


ans =
file: 'matlabroot\toolbox\matlab\graph3d\surf.m'
name: 'surf'
line: 49

Note You cannot define nested functions within a try or catch block.

27-6
Respond to an Exception

The Try Block

On execution, your code enters the try block and executes each statement as if it were part of the
regular program. If no errors are encountered, MATLAB skips the catch block entirely and continues
execution following the end statement. If any of the try statements fail, MATLAB immediately exits
the try block, leaving any remaining statements in that block unexecuted, and enters the catch
block.

The Catch Block

The catch command marks the start of a catch block and provides access to a data structure that
contains information about what caused the exception. This is shown as the variable ME in the
preceding pseudocode. ME is an MException object. When an exception occurs, MATLAB creates an
MException object and returns it in the catch statement that handles that error.

You are not required to specify any argument with the catch statement. If you do not need any of the
information or methods provided by the MException object, just specify the catch keyword alone.

The MException object is constructed by internal code in the program that fails. The object has
properties that contain information about the error that can be useful in determining what happened
and how to proceed. The MException object also provides access to methods that enable you to
respond to the exception.

Having entered the catch block, MATLAB executes the statements in sequence. These statements
can attempt to

• Attempt to resolve the error.


• Capture more information about the error.
• Switch on information found in the MException object and respond appropriately.
• Clean up the environment that was left by the failing code.

The catch block often ends with a rethrow command. The rethrow causes MATLAB to exit the
current function, keeping the call stack information as it was when the exception was first thrown. If
this function is at the highest level, that is, it was not called by another function, the program
terminates. If the failing function was called by another function, it returns to that function. Program
execution continues to return to higher level functions, unless any of these calls were made within a
higher-level try block, in which case the program executes the respective catch block.

Suggestions on How to Handle an Exception


The following example reads the contents of an image file. It includes detailed error handling, and
demonstrates some suggested actions you can take in response to an error.

The image-reading function throws and catches errors in several ways.

• The first if statement checks whether the function is called with an input argument. If no input
argument is specified, the program throws an error and suggests an input argument to correct the
error.
• The try block attempts to open and read the file. If either the open or the read fails, the program
catches the resulting exception and saves the MException object in the variable ME1.
• The catch block checks to see if the specified file could not be found. If so, the program allows for
the possibility that a common variation of the filename extension (e.g., jpeg instead of jpg) was

27-7
27 Error Handling

used, by retrying the operation with a modified extension. This is done using a try/catch
statement nested within the original try/catch.
function d_in = read_image(filename)

% Check the number of input arguments.


if nargin < 1
me = MException('MATLAB:notEnoughInputs','Not enough input arguments.');
aac = [Link]('"[Link]"');
me = [Link](aac);
throw(me);
end

% Attempt to read file and catch an exception if it arises.


try
fid = fopen(filename,'r');
d_in = fread(fid);
catch ME1
% Get last segment of the error identifier.
idSegLast = regexp([Link],'(?<=:)\w+$','match');

% Did the read fail because the file could not be found?
if strcmp(idSegLast,'InvalidFid') && ...
~exist(filename,'file')

% Yes. Try modifying the filename extension.


switch ext
case '.jpg' % Change jpg to jpeg
filename = strrep(filename,'.jpg','.jpeg');
case '.jpeg' % Change jpeg to jpg
filename = strrep(filename,'.jpeg','.jpg');
case '.tif' % Change tif to tiff
filename = strrep(filename,'.tif','.tiff');
case '.tiff' % Change tiff to tif
filename = strrep(filename,'.tiff','.tif');
otherwise
fprintf('File %s not found\n',filename);
rethrow(ME1);
end

% Try again, with modified filenames.


try
fid = fopen(filename,'r');
d_in = fread(fid);
catch ME2
fprintf('Unable to access file %s\n',filename);
ME2 = addCause(ME2,ME1);
rethrow(ME2)
end
end
end

This example illustrates some of the actions that you can take in response to an exception.

• Compare the identifier field of the MException object to possible causes of the error. In this
case, the function checks whether the identifier ends in 'InvalidFid', indicating a file could not
be found.
• Use a nested try/catch statement to retry the operation with improved input. In this case, the
function retries the open and read operations using a known variation of the filename extension.
• Display an appropriate message.
• Add the first MException object to the cause field of the second.
• Add a suggested correction to an MException object.
• Rethrow the exception. This stops program execution and displays the error message.

Cleaning up any unwanted results of the error is also advisable. For example, close figures that
remained open after the error occurred.

27-8
Clean Up When Functions Complete

Clean Up When Functions Complete


In this section...
“Overview” on page 27-9
“Examples of Cleaning Up a Program Upon Exit” on page 27-10
“Retrieving Information About the Cleanup Routine” on page 27-11
“Using onCleanup Versus try/catch” on page 27-12
“onCleanup in Scripts” on page 27-12

Overview
A good programming practice is to make sure that you leave your program environment in a clean
state that does not interfere with any other program code. For example, you might want to

• Close any files that you opened for import or export.


• Restore the MATLAB path.
• Lock or unlock memory to prevent or allow erasing MATLAB function or MEX-files.
• Set your working folder back to its default if you have changed it.
• Make sure global and persistent variables are in the correct state.

MATLAB provides the onCleanup function for this purpose. This function, when used within any
program, establishes a cleanup routine for that function. When the function terminates, whether
normally or in the event of an error or Ctrl+C, MATLAB automatically executes the cleanup routine.

The following statement establishes a cleanup routine cleanupFun for the currently running
program:
cleanupObj = onCleanup(@cleanupFun);

When your program exits, MATLAB finds any instances of the onCleanup class and executes the
associated function handles. The process of generating and activating function cleanup involves the
following steps:

1 Write one or more cleanup routines for the program under development. Assume for now that it
takes only one such routine.
2 Create a function handle for the cleanup routine.
3 At some point, generally early in your program code, insert a call to the onCleanup function,
passing the function handle.
4 When the program is run, the call to onCleanup constructs a cleanup object that contains a
handle to the cleanup routine created in step 1.
5 When the program ends, MATLAB implicitly clears all objects that are local variables. This
invokes the destructor method for each local object in your program, including the cleanup
object constructed in step 4.
6 The destructor method for this object invokes this routine if it exists. This perform the tasks
needed to restore your programming environment.

You can declare any number of cleanup routines for a program file. Each call to onCleanup
establishes a separate cleanup routine for each cleanup object returned.

27-9
27 Error Handling

If, for some reason, the object returned by onCleanup persists beyond the life of your program, then
the cleanup routine associated with that object is not run when your function terminates. Instead, it
will run whenever the object is destroyed (e.g., by clearing the object variable).

Your cleanup routine should never rely on variables that are defined outside of that routine. For
example, the nested function shown here on the left executes with no error, whereas the very similar
one on the right fails with the error, Undefined function or variable 'k'. This results from
the cleanup routine's reliance on variable k which is defined outside of the nested cleanup routine:
function testCleanup function testCleanup
k = 3; k = 3;
myFun obj = onCleanup(@myFun);
function myFun function myFun
fprintf('k is %d\n', k) fprintf('k is %d\n', k)
end end
end end

Examples of Cleaning Up a Program Upon Exit


Example 1 — Close Open Files on Exit

MATLAB closes the file with identifier fid when function openFileSafely terminates:
function openFileSafely(fileName)
fid = fopen(fileName, 'r');
c = onCleanup(@()fclose(fid));

s = fread(fid);
.
.
.
end

Example 2 — Maintain the Selected Folder

This example preserves the current folder whether functionThatMayError returns an error or not:
function changeFolderSafely(fileName)
currentFolder = pwd;
c = onCleanup(@()cd(currentFolder));

functionThatMayError;
end % c executes cd(currentFolder) here.

Example 3 — Close Figure and Restore MATLAB Path

This example extends the MATLAB path to include files in the toolbox\images folders, and then
displays a figure from one of these folders. After the figure displays, the cleanup routine
restore_env closes the figure and restores the path to its original state.
function showImageOutsidePath(imageFile)
fig1 = figure;
imgpath = genpath([matlabroot '\toolbox\images']);

% Define the cleanup routine.


cleanupObj = onCleanup(@()restore_env(fig1, imgpath));

27-10
Clean Up When Functions Complete

% Modify the path to gain access to the image file,


% and display the image.
addpath(imgpath);
rgb = imread(imageFile);
fprintf('\n Opening the figure %s\n', imageFile);
image(rgb);
pause(2);

% This is the cleanup routine.


function restore_env(fighandle, newpath)
disp ' Closing the figure'
close(fighandle);
pause(2)

disp ' Restoring the path'


rmpath(newpath);
end
end

Run the function as shown here. You can verify that the path has been restored by comparing the
length of the path before and after running the function:
origLen = length(path);

showImageOutsidePath('[Link]')
Opening the figure [Link]
Closing the figure
Restoring the path

currLen = length(path);
currLen == origLen
ans =
1

Retrieving Information About the Cleanup Routine


In Example 3 shown above, the cleanup routine and data needed to call it are contained in a handle to
an anonymous function:
@()restore_env(fig1, imgpath)

The details of that handle are then contained within the object returned by the onCleanup function:
cleanupObj = onCleanup(@()restore_env(fig1, imgpath));

You can access these details using the task property of the cleanup object as shown here. (Modify
the showImageOutsidePath function by adding the following code just before the comment line
that says, “% This is the cleanup routine.”)
disp ' Displaying information from the function handle:'
task = [Link];
fun = functions(task)
wsp = [Link]{2,1}
fprintf('\n');
pause(2);

Run the modified function to see the output of the functions command and the contents of one of
the workspace cells:

27-11
27 Error Handling

showImageOutsidePath('[Link]')

Opening the figure [Link]


Displaying information from the function handle:
fun =
function: '@()restore_env(fig1,imgpath)'
type: 'anonymous'
file: 'c:\work\g6.m'
workspace: {2x1 cell}
wsp =
imageFile: '[Link]'
fig1: 1
imgpath: [1x3957 char]
cleanupObj: [1x1 onCleanup]
rgb: [300x500x3 uint8]
task: @()restore_env(fig1,imgpath)

Closing the figure


Restoring the path

Using onCleanup Versus try/catch


Another way to run a cleanup routine when a function terminates unexpectedly is to use a try,
catch statement. There are limitations to using this technique however. If the user ends the program
by typing Ctrl+C, MATLAB immediately exits the try block, and the cleanup routine never executes.
The cleanup routine also does not run when you exit the function normally.

The following program cleans up if an error occurs, but not in response to Ctrl+C:

function cleanupByCatch
try
pause(10);
catch
disp(' Collecting information about the error')
disp(' Executing cleanup tasks')
end

Unlike the try/catch statement, the onCleanup function responds not only to a normal exit from
your program and any error that might be thrown, but also to Ctrl+C. This next example replaces the
try/catch with onCleanup:

function cleanupByFunc
obj = onCleanup(@()...
disp(' Executing cleanup tasks'));
pause(10);

onCleanup in Scripts
onCleanup does not work in scripts as it does in functions. In functions, the cleanup object is stored
in the function workspace. When the function exits, this workspace is cleared thus executing the
associated cleanup routine. In scripts, the cleanup object is stored in the base workspace (that is, the
workspace used in interactive work done at the command prompt). Because exiting a script has no
effect on the base workspace, the cleanup object is not cleared and the routine associated with that
object does not execute. To use this type of cleanup mechanism in a script, you would have to
explicitly clear the object from the command line or another script when the first script terminates.

27-12
Issue Warnings and Errors

Issue Warnings and Errors


In this section...
“Issue Warnings” on page 27-13
“Throw Errors” on page 27-13
“Add Run-Time Parameters to Your Warnings and Errors” on page 27-14
“Add Identifiers to Warnings and Errors” on page 27-14

Issue Warnings
You can issue a warning to flag unexpected conditions detected when running a program. The
warning function prints a warning message to the command line. Warnings differ from errors in two
significant ways:

• Warnings do not halt the execution of the program.


• You can suppress any unhelpful MATLAB warnings.

Use the warning function in your code to generate a warning message during execution. Specify the
message as the input argument to the warning function:

warning('Input must be text')

For example, you can insert a warning in your code to verify the software version:

function warningExample1
if ~strncmp(version, '7', 1)
warning('You are using a version other than v7')
end

Throw Errors
You can throw an error to flag fatal problems within the program. Use the error function to print
error messages to the command line. After displaying the message, MATLAB stops the execution of
the current program.

For example, suppose you construct a function that returns the number of combinations of k elements
from n elements. Such a function is nonsensical if k > n; you cannot choose 8 elements if you start
with just 4. You must incorporate this fact into the function to let anyone using combinations know
of the problem:

function com = combinations(n,k)


if k > n
error('Cannot calculate with given values')
end
com = factorial(n)/(factorial(k)*factorial(n-k));
end

If the combinations function receives invalid input, MATLAB stops execution immediately after
throwing the error message:

combinations(4,8)

27-13
27 Error Handling

Error using combinations (line 3)


Cannot calculate with given values

Add Run-Time Parameters to Your Warnings and Errors


To make your warning or error messages more specific, insert components of the message at the time
of execution. The warning function uses conversion characters that are the same as those used by
the sprintf function. Conversion characters act as placeholders for substrings or values, unknown
until the code executes.

For example, this warning uses %s and %d to mark where to insert the values of variables arrayname
and arraydims:

warning('Array %s has %d dimensions.',arrayname,arraydims)

If you execute this command with arrayname = 'A' and arraydims = 3, MATLAB responds:

Warning: Array A has 3 dimensions.

Adding run-time parameters to your warnings and errors can clarify the problems within a program.
Consider the function combinations from “Throw Errors” on page 27-13. You can throw a much
more informative error using run-time parameters:

function com = combinations(n,k)


if k > n
error('Cannot choose %i from %i elements',k,n)
end
com = factorial(n)/(factorial(k)*factorial(n-k));
end

If this function receives invalid arguments, MATLAB throws an error message and stops the program:

combinations(6,9)

Error using combinations (line 3)


Cannot choose 9 from 6 elements

Add Identifiers to Warnings and Errors


An identifier provides a way to uniquely reference a warning or an error.

Enable or disable warnings with identifiers. Use an identifying text argument with the warning
function to attach a unique tag to a message:

warning(identifier_text,message_text)

For example, you can add an identifier tag to the previous MATLAB warning about which version of
software is running:

minver = '7';
if ~strncmp(version,minver,1)
warning('MYTEST:VERCHK','Running a version other than v%s',minver)
end

Adding an identifier to an error message allows for negative testing. However, adding and recovering
more information from errors often requires working with MException objects.

27-14
Issue Warnings and Errors

See Also
MException | lastwarn | warndlg | warning

Related Examples
• “Suppress Warnings” on page 27-16
• “Restore Warnings” on page 27-18
• “Exception Handling in a MATLAB Application” on page 27-2

27-15
27 Error Handling

Suppress Warnings
Your program might issue warnings that do not always adversely affect execution. To avoid confusion,
you can hide warning messages during execution by changing their states from 'on' to 'off'.

To suppress specific warning messages, you must first find the warning identifier. Each warning
message has a unique identifier. To find the identifier associated with a MATLAB warning, reproduce
the warning. For example, this code reproduces a warning thrown if MATLAB attempts to remove a
nonexistent folder:
rmpath('folderthatisnotonpath')

Warning: "folderthatisnotonpath" not found in path.

Note If this statement does not produce a warning message, use the following code to temporarily
enable the display of all warnings, and then restore the original warning state:
w = warning ('on','all');
rmpath('folderthatisnotonpath')
warning(w)

To obtain information about the most recently issued warning, use the warning or lastwarn
functions. This code uses the query state to return a data structure containing the identifier and the
current state of the last warning:
w = warning('query','last')

w =

identifier: 'MATLAB:rmpath:DirNotFound'
state: 'on'

You can save the identifier field in the variable, id:


id = [Link];

Note warning('query','last') returns the last displayed warning. MATLAB only displays
warning messages that have state: 'on' and a warning identifier.

Using the lastwarn function, you can retrieve the last warning message, regardless of its display
state:
lastwarn

ans =

"folderthatisnotonpath" not found in path.

Turn Warnings On and Off


After you obtain the identifier from the query state, use this information to disable or enable the
warning associated with that identifier.

27-16
Suppress Warnings

Continuing the example from the previous section, turn the warning
'MATLAB:rmpath:DirNotFound' off, and repeat the operation.

warning('off',id)
rmpath('folderthatisnotonpath')

MATLAB displays no warning.

Turn the warning on, and try to remove a nonexistent path:

warning('on',id)
rmpath('folderthatisnotonpath')

Warning: "folderthatisnotonpath" not found in path.

MATLAB now issues a warning.

Tip Turn off the most recently invoked warning with warning('off','last').

Controlling All Warnings

The term all refers only to those warnings that have been issued or modified during your current
MATLAB session. Modified warning states persist only through the current session. Starting a new
session restores the default settings.

Use the identifier 'all' to represent the group of all warnings. View the state of all warnings with
either syntax:

warning('query','all')

warning

To enable all warnings and verify the state:

warning('on','all')
warning('query','all')

All warnings have the state 'on'.

To disable all warnings and verify the state, use this syntax:

warning('off','all')
warning

All warnings have the state 'off'.

See Also

Related Examples
• “Restore Warnings” on page 27-18
• “Change How Warnings Display” on page 27-20

27-17
27 Error Handling

Restore Warnings
MATLAB allows you to save the on-off warning states, modify warning states, and restore the
original warning states. This is useful if you need to temporarily turn off some warnings and later
reinstate the original settings.

The following statement saves the current state of all warnings in the structure array called
orig_state:
orig_state = warning;

To restore the original state after any warning modifications, use this syntax:
warning(orig_state);

You also can save the current state and toggle warnings in a single command. For example, the
statement, orig_state = warning('off','all'); is equivalent to the commands:
orig_state = warning;
warning('off','all')

Disable and Restore a Particular Warning


This example shows you how to restore the state of a particular warning.

1 Query the Control:parameterNotSymmetric warning:


warning('query','Control:parameterNotSymmetric')

The state of warning 'Control:parameterNotSymmetric' is 'on'.


2 Turn off the Control:parameterNotSymmetric warning:
orig_state = warning('off','Control:parameterNotSymmetric')

orig_state =

identifier: 'Control:parameterNotSymmetric'
state: 'on'

orig_state contains the warning state before MATLAB turns


Control:parameterNotSymmetric off.
3 Query all warning states:
warning

The default warning state is 'on'. Warnings not set to the default are

State Warning Identifier

off Control:parameterNotSymmetric

MATLAB indicates that Control:parameterNotSymmetric is 'off'.


4 Restore the original state:
warning(orig_state)
warning('query','Control:parameterNotSymmetric')

The state of warning 'Control:parameterNotSymmetric' is 'on'.

27-18
Restore Warnings

Disable and Restore Multiple Warnings


This example shows you how to save and restore multiple warning states.

1 Disable three warnings, and query all the warnings:

w(1) = warning('off','MATLAB:rmpath:DirNotFound');
w(2) = warning('off','MATLAB:singularMatrix');
w(3) = warning('off','Control:parameterNotSymmetric');
warning

The default warning state is 'on'. Warnings not set to the default are

State Warning Identifier

off Control:parameterNotSymmetric
off MATLAB:rmpath:DirNotFound
off MATLAB:singularMatrix
2 Restore the three warnings to their the original state, and query all warnings:

warning(w)
warning

All warnings have the state 'on'.

You do not need to store information about the previous warning states in an array, but doing so
allows you to restore warnings with one command.

Note When temporarily disabling multiple warnings, using methods related to onCleanup might be
advantageous.

Alternatively, you can save and restore all warnings.

1 Enable all warnings, and save the original warning state:

orig_state = warning('on','all');
2 Restore your warnings to the previous state:

warning(orig_state)

See Also
onCleanup | warning

Related Examples
• “Suppress Warnings” on page 27-16
• “Clean Up When Functions Complete” on page 27-9

27-19
27 Error Handling

Change How Warnings Display


You can control how warnings appear in MATLAB by modifying two warning modes, verbose and
backtrace.

Mode Description Default


verbose Display a message on how to suppress off (terse)
the warning.
backtrace Display a stack trace after a warning is on (enabled)
invoked.

Note The verbose and backtrace modes present some limitations:

• prev_state does not contain information about the backtrace or verbose modes in the
statement, prev_state = warning('query','all').
• A mode change affects all enabled warnings.

Enable Verbose Warnings


When you enable verbose warnings, MATLAB displays an extra line of information with each warning
that tells you how to suppress it.

For example, you can turn on all warnings, disable backtrace, and enable verbose warnings:

warning on all
warning off backtrace
warning on verbose

Running a command that produces an error displays an extended message:

rmpath('folderthatisnotonpath')

Warning: "folderthatisnotonpath" not found in path.


(Type "warning off MATLAB:rmpath:DirNotFound" to suppress this warning.)

Display a Stack Trace on a Specific Warning


It can be difficult to locate the source of a warning when it is generated from code buried in several
levels of function calls. When you enable the backtrace mode, MATLAB displays the file name and line
number where the warning occurred. For example, you can enable backtrace and disable verbose:

warning on backtrace
warning off verbose

Running a command that produces an error displays a hyperlink with a line number:

Warning: "folderthatisnotonpath" not found in path.


> In rmpath at 58

Clicking the hyperlink takes you to the location of the warning.

27-20
Use try/catch to Handle Errors

Use try/catch to Handle Errors


You can use a try/catch statement to execute code after your program encounters an error. try/
catch statements can be useful if you:

• Want to finish the program in another way that avoids errors


• Need to clean up unwanted side effects of the error
• Have many problematic input parameters or commands

Arrange try/catch statements into blocks of code, similar to this pseudocode:


try
try block...
catch
catch block...
end

If an error occurs within the try block, MATLAB skips any remaining commands in the try block
and executes the commands in the catch block. If no error occurs within try block, MATLAB
skips the entire catch block.

For example, a try/catch statement can prevent the need to throw errors. Consider the
combinations function that returns the number of combinations of k elements from n elements:
function com = combinations(n,k)
com = factorial(n)/(factorial(k)*factorial(n-k));
end

MATLAB throws an error whenever k > n. You cannot construct a set with more elements, k, than
elements you possess, n. Using a try/catch statement, you can avoid the error and execute this
function regardless of the order of inputs:
function com = robust_combine(n,k)
try
com = factorial(n)/(factorial(k)*factorial(n-k));
catch
com = factorial(k)/(factorial(n)*factorial(k-n));
end
end

robust_combine treats any order of integers as valid inputs:


C1 = robust_combine(8,4)
C2 = robust_combine(4,8)

C1 =

70

C2 =

70

Optionally, you can capture more information about errors if a variable follows your catch statement:
catch MExc

27-21
27 Error Handling

MExc is an MException class object that contains more information about the thrown error. To learn
more about accessing information from MException objects, see “Exception Handling in a MATLAB
Application” on page 27-2.

See Also
MException | onCleanup | try, catch

27-22
28

Program Scheduling

• “Schedule Command Execution Using Timer” on page 28-2


• “Timer Callback Functions” on page 28-4
• “Handling Timer Queuing Conflicts” on page 28-8
28 Program Scheduling

Schedule Command Execution Using Timer

In this section...
“Overview” on page 28-2
“Example: Displaying a Message” on page 28-2

Overview
The MATLAB software includes a timer object that you can use to schedule the execution of MATLAB
commands. This section describes how you can create timer objects, start a timer running, and
specify the processing that you want performed when a timer fires. A timer is said to fire when the
amount of time specified by the timer object elapses and the timer object executes the commands you
specify.

To use a timer, perform these steps:

1 Create a timer object.

You use the timer function to create a timer object.


2 Specify which MATLAB commands you want executed when the timer fires and control other
aspects of timer object behavior.

You use timer object properties to specify this information. To learn about all the properties
supported by the timer object, see timer and set. You can also set timer object properties when
you create them, in step 1.
3 Start the timer object.

After you create the timer object, you must start it, using either the start or startat function.
4 Delete the timer object when you are done with it.

After you are finished using a timer object, you should delete it from memory. See delete for
more information.

Note The specified execution time and the actual execution of a timer can vary because timer objects
work in the MATLAB single-threaded execution environment. The length of this time lag is dependent
on what other processing MATLAB is performing. To force the execution of the callback functions in
the event queue, include a call to the drawnow function in your code. The drawnow function flushes
the event queue.

Example: Displaying a Message


The following example sets up a timer object that executes a MATLAB command character vector
after 10 seconds elapse. The example creates a timer object, specifying the values of two timer object
properties, TimerFcn and StartDelay. TimerFcn specifies the timer callback function. This is the
MATLAB command or program file that you want to execute when the timer fires. In the example, the
timer callback function sets the value of the MATLAB workspace variable stat and executes the
MATLAB disp command. The StartDelay property specifies how much time elapses before the
timer fires.

28-2
Schedule Command Execution Using Timer

After creating the timer object, the example uses the start function to start the timer object. (The
additional commands in this example are included to illustrate the timer but are not required for
timer operation.)

t = timer('TimerFcn', 'stat=false; disp(''Timer!'')',...


'StartDelay',10);
start(t)

stat=true;
while(stat==true)
disp('.')
pause(1)
end

When you execute this code, it produces this output:

.
.
.
.
.
.
.
.
.
Timer!

delete(t) % Always delete timer objects after using them.

See Also
timer

More About
• “Timer Callback Functions” on page 28-4
• “Handling Timer Queuing Conflicts” on page 28-8

28-3
28 Program Scheduling

Timer Callback Functions

In this section...
“Associating Commands with Timer Object Events” on page 28-4
“Creating Callback Functions” on page 28-5
“Specifying the Value of Callback Function Properties” on page 28-6

Note Callback function execution might be delayed if the callback involves a CPU-intensive task such
as updating a figure.

Associating Commands with Timer Object Events


The timer object supports properties that let you specify the MATLAB commands that execute when a
timer fires, and for other timer object events, such as starting, stopping, or when an error occurs.
These are called callbacks. To associate MATLAB commands with a timer object event, set the value
of the associated timer object callback property.

The following diagram shows when the events occur during execution of a timer object and give the
names of the timer object properties associated with each event. For example, to associate MATLAB
commands with a start event, assign a value to the StartFcn callback property. Error callbacks can
occur at any time.

Timer Object Events and Related Callback Function

28-4
Timer Callback Functions

Creating Callback Functions


When the time period specified by a timer object elapses, the timer object executes one or more
MATLAB functions of your choosing. You can specify the functions directly as the value of the callback
property. You can also put the commands in a function file and specify the function as the value of the
callback property.

Specifying Callback Functions Directly

This example creates a timer object that displays a greeting after 5 seconds. The example specifies
the value of the TimerFcn callback property directly, putting the commands in a character vector.

t = timer('TimerFcn',@(x,y)disp('Hello World!'),'StartDelay',5);

Note When you specify the callback commands directly as the value of the callback function
property, the commands are evaluated in the MATLAB workspace.

Putting Commands in a Callback Function

Instead of specifying MATLAB commands directly as the value of a callback property, you can put the
commands in a MATLAB program file and specify the file as the value of the callback property.

When you create a callback function, the first two arguments must be a handle to the timer object
and an event structure. An event structure contains two fields: Type and Data. The Type field
contains a character vector that identifies the type of event that caused the callback. The value of this
field can be any of the following: 'StartFcn', 'StopFcn', 'TimerFcn', or 'ErrorFcn'. The Data
field contains the time the event occurred.

In addition to these two required input arguments, your callback function can accept application-
specific arguments. To receive these input arguments, you must use a cell array when specifying the
name of the function as the value of a callback property. For more information, see “Specifying the
Value of Callback Function Properties” on page 28-6.

Example: Writing a Callback Function

This example implements a simple callback function that displays the type of event that triggered the
callback and the time the callback occurred. To illustrate passing application-specific arguments, the
example callback function accepts as an additional argument a character vector and includes this text
in the display output. To see this function used with a callback property, see “Specifying the Value of
Callback Function Properties” on page 28-6.

function my_callback_fcn(obj, event, text_arg)

txt1 = ' event occurred at ';


txt2 = text_arg;

event_type = [Link];
event_time = datestr([Link]);

msg = [event_type txt1 event_time];


disp(msg)
disp(txt2)

28-5
28 Program Scheduling

Specifying the Value of Callback Function Properties


You associate a callback function with a specific event by setting the value of the appropriate callback
property. You can specify the callback function as a cell array or function handle. If your callback
function accepts additional arguments, you must use a cell array.

The following table shows the syntax for several sample callback functions and describes how you call
them.

Callback Function Syntax How to Specify as a Property Value for


Object t
function myfile(obj, event) [Link] = @myfile
function myfile [Link] = @(~,~)myfile
function myfile(obj, event, arg1, [Link] = {@myfile, 5, 6}
arg2)

This example illustrates several ways you can specify the value of timer object callback function
properties, some with arguments and some without. To see the code of the callback function,
my_callback_fcn, see “Example: Writing a Callback Function” on page 28-5:

1 Create a timer object.

t = timer('StartDelay', 4, 'Period', 4, 'TasksToExecute', 2, ...


'ExecutionMode', 'fixedRate');
2 Specify the value of the StartFcn callback. Note that the example specifies the value in a cell
array because the callback function needs to access arguments passed to it:

[Link] = {@my_callback_fcn, 'My start message'};


3 Specify the value of the StopFcn callback. Again, the value is specified in a cell array because
the callback function needs to access the arguments passed to it:

[Link] = { @my_callback_fcn, 'My stop message'};


4 Specify the value of the TimerFcn callback. The example specifies the MATLAB commands in a
character vector:

[Link] = @(x,y)disp('Hello World!');


5 Start the timer object:

start(t)

The example outputs the following.

StartFcn event occurred at 10-Mar-2004 17:16:59


My start message
Hello World!
Hello World!
StopFcn event occurred at 10-Mar-2004 17:16:59
My stop message
6 Delete the timer object after you are finished with it.

delete(t)

See Also
timer

28-6
Timer Callback Functions

More About
• “Handling Timer Queuing Conflicts” on page 28-8

28-7
28 Program Scheduling

Handling Timer Queuing Conflicts


At busy times, in multiple-execution scenarios, the timer may need to add the timer callback function
(TimerFcn) to the MATLAB execution queue before the previously queued execution of the callback
function has completed. You can determine how the timer object handles this scenario by setting the
BusyMode property to use one of these modes:

In this section...
“Drop Mode (Default)” on page 28-8
“Error Mode” on page 28-9
“Queue Mode” on page 28-10

Drop Mode (Default)


If you specify 'drop' as the value of the BusyMode property, the timer object adds the timer callback
function to the execution queue only when the queue is empty. If the execution queue is not empty,
the timer object skips the execution of the callback.

For example, suppose you create a timer with a period of 1 second, but a callback that requires at
least 1.6 seconds, as shown here for mytimer.m.

function mytimer()
t = timer;

[Link] = 1;
[Link] = 'fixedRate';
[Link] = @mytimer_cb;
[Link] = 'drop';
[Link] = 5;
[Link] = tic;

start(t)
end

function mytimer_cb(h,~)
timeStart = toc([Link])
pause(1.6);
timeEnd = toc([Link])
end

This table describes how the timer manages the execution queue.

Approximate Action
Elapsed Time
(Seconds)
0 Start the first execution of the callback.
1 Attempt to start the second execution of the callback. The first execution is not
complete, but the execution queue is empty. The timer adds the callback to the
queue.

28-8
Handling Timer Queuing Conflicts

Approximate Action
Elapsed Time
(Seconds)
1.6 Finish the first callback execution, and start the second. This action clears the
execution queue.
2 Attempt to start the third callback execution. The second execution is not
complete, but the queue is empty. The timer adds the callback to the queue.
3 Attempt to start the fourth callback execution. The third callback is in the
execution queue, so the timer drops this execution of the function.
3.2 Finish the second callback and start the third, clearing the execution queue.
4 Attempt to start another callback execution. Because the queue is empty, the
timer adds the callback to the queue. This is the fifth attempt, but only the
fourth instance that will run.
4.8 Finish the third execution and start the fourth instance, clearing the queue.
5 Attempt to start another callback. An instance is running, but the execution
queue is empty, so the timer adds it to the queue. This is the fifth instance that
will run.
6 Do nothing: the value of the TasksToExecute property is 5, and the fifth
instance to run is in the queue.
6.4 Finish the fourth callback execution and start the fifth.
8 Finish the fifth callback execution.

Error Mode
The 'error' mode for the BusyMode property is similar to the 'drop' mode: In both modes, the
timer allows only one instance of the callback in the execution queue. However, in 'error' mode,
when the queue is nonempty, the timer calls the function that you specify using the ErrorFcn
property, and then stops processing. The currently running callback function completes, but the
callback in the queue does not execute.

For example, modify mytimer.m (described in the previous section) so that it includes an error
handling function and sets BusyMode to 'error'.
function mytimer()
t = timer;

[Link] = 1;
[Link] = 'fixedRate';
[Link] = @mytimer_cb;
[Link] = @myerror;
[Link] = 'error';
[Link] = 5;
[Link] = tic;

start(t)
end

function mytimer_cb(h,~)
timeStart = toc([Link])

28-9
28 Program Scheduling

pause(1.6);
timeEnd = toc([Link])
end

function myerror(h,~)
disp('Reached the error function')
end

This table describes how the timer manages the execution queue.

Approximate Action
Elapsed Time
(Seconds)
0 Start the first execution of the callback.
1 Attempt to start the second execution of the callback. The first execution is not
complete, but the execution queue is empty. The timer adds the callback to the
queue.
1.6 Finish the first callback execution, and start the second. This action clears the
execution queue.
2 Attempt to start the third callback execution. The second execution is not
complete, but the queue is empty. The timer adds the callback to the queue.
3 Attempt to start the fourth callback execution. The third callback is in the
execution queue. The timer does not execute the third callback, but instead
calls the error handling function.
3.2 Finish the second callback and start the error handling function.

Queue Mode
If you specify 'queue', the timer object waits until the currently executing callback function finishes
before queuing the next execution of the timer callback function.

In 'queue' mode, the timer object tries to make the average time between executions equal the
amount of time specified in the Period property. If the timer object has to wait longer than the time
specified in the Period property between executions of the timer function callback, it shortens the
time period for subsequent executions to make up the time.

See Also
timer

More About
• “Timer Callback Functions” on page 28-4

28-10
29

Performance

• “Measure the Performance of Your Code” on page 29-2


• “Profile Your Code to Improve Performance” on page 29-4
• “Determine Code Coverage Using the Profiler” on page 29-12
• “Techniques to Improve Performance” on page 29-14
• “Preallocation” on page 29-16
• “Vectorization” on page 29-18
29 Performance

Measure the Performance of Your Code


In this section...
“Overview of Performance Timing Functions” on page 29-2
“Time Functions” on page 29-2
“Time Portions of Code” on page 29-2
“The cputime Function vs. tic/toc and timeit” on page 29-2
“Tips for Measuring Performance” on page 29-3

Overview of Performance Timing Functions


The timeit function and the stopwatch timer functions, tic and toc, enable you to time how long
your code takes to run. Use the timeit function for a rigorous measurement of function execution
time. Use tic and toc to estimate time for smaller portions of code that are not complete functions.

For additional details about the performance of your code, such as function call information and
execution time of individual lines of code, use the MATLAB Profiler. For more information, see “Profile
Your Code to Improve Performance” on page 29-4.

Time Functions
To measure the time required to run a function, use the timeit function. The timeit function calls
the specified function multiple times, and returns the median of the measurements. It takes a handle
to the function to be measured and returns the typical execution time, in seconds. Suppose that you
have defined a function, computeFunction, that takes two inputs, x and y, that are defined in your
workspace. You can compute the time to execute the function using timeit.

f = @() myComputeFunction(x,y); % handle to function


timeit(f)

Time Portions of Code


To estimate how long a portion of your program takes to run or to compare the speed of different
implementations of portions of your program, use the stopwatch timer functions, tic and toc.
Invoking tic starts the timer, and the next toc reads the elapsed time.

tic
% The program section to time.
toc

Sometimes programs run too fast for tic and toc to provide useful data. If your code is faster than
1/10 second, consider measuring it running in a loop, and then average to find the time for a single
run.

The cputime Function vs. tic/toc and timeit


It is recommended that you use timeit or tic and toc to measure the performance of your
code. These functions return wall-clock time. Unlike tic and toc, the timeit function calls your
code multiple times, and, therefore, considers first-time costs.

29-2
Measure the Performance of Your Code

The cputime function measures the total CPU time and sums across all threads. This measurement is
different from the wall-clock time that timeit or tic/toc return, and could be misleading. For
example:

• The CPU time for the pause function is typically small, but the wall-clock time accounts for the
actual time that MATLAB execution is paused. Therefore, the wall-clock time might be longer.
• If your function uses four processing cores equally, the CPU time could be approximately four
times higher than the wall-clock time.

Tips for Measuring Performance


Consider the following tips when you are measuring the performance of your code:

• Time a significant enough portion of code. Ideally, the code you are timing should take more than
1/10 second to run.
• Put the code you are trying to time into a function instead of timing it at the command line or
inside a script.
• Unless you are trying to measure first-time cost, run your code multiple times. Use the timeit
function.
• Avoid clear all when measuring performance. For more information, see the clear function.
• Assign your output to a variable instead of letting it default to ans.

See Also
profile | tic | timeit | toc

Related Examples
• “Profile Your Code to Improve Performance” on page 29-4
• “Techniques to Improve Performance” on page 29-14
• MATLAB Performance Measurement White Paper on MATLAB Central File Exchange

29-3
29 Performance

Profile Your Code to Improve Performance

What Is Profiling?
Profiling is a way to measure the time it takes to run your code and identify where MATLAB spends
the most time. After you identify which functions are consuming the most time, you can evaluate
them for possible performance improvements. You also can profile your code to determine which lines
of code do not run. Determining which lines of code do not run is useful when developing tests for
your code, or as a debugging tool to help isolate a problem in your code.

You can profile your code interactively using the MATLAB Profiler or programmatically using the
profile function. For more information about profiling your code programmatically, see profile. If
you are profiling code that runs in parallel, for best results use the Parallel Computing Toolbox™
parallel profiler. For details, see “Profiling Parallel Code” (Parallel Computing Toolbox).

Tip Code that is prematurely optimized can be unnecessarily complex without providing a significant
gain in performance. Make your first implementation as simple as possible. Then, if speed is an issue,
use profiling to identify bottlenecks.

Profile Your Code


To profile your code and improve its performance, use this general process:

1 Run the Profiler on your code.


2 Review the profile summary results.
3 Investigate functions and individual lines of code.

For example, you may want to investigate functions and lines of code that use a significant
amount of time or that are called most frequently.
4 Save the profiling results.
5 Implement potential performance improvements in your code.

For example, if you have a load statement within a loop, you might be able to move the load
statement outside the loop so that it is called only once.
6 Save the files, and run clear all. Run the Profiler again and compare the results to the original
results.
7 Repeat the above steps to continue improving the performance of your code. When your code
spends most of its time on calls to a few built-in functions, you have probably optimized the code
as much as possible.

Run the Profiler on Your Code

To run the Profiler on a line of code:

1
On the Home tab, in the Code section, click Run and Time to open the Profiler. You also
can type profile viewer in the Command Window.
2 Go to the Profiler tab, and in the Profile section, enter the code that you want to profile in the
edit box.

29-4
Profile Your Code to Improve Performance

For example, create a function solvelotka.m that finds the prey and predator population peaks
for the Lotka-Volterra example provided with MATLAB:

function [preypeaks,predatorpeaks] = solvelotka(t0, tfinal, y0)


[~,y] = ode23(@lotka,[t0 tfinal],y0);

preypeaks = calculatepeaks(y(:,1));
predatorpeaks = calculatepeaks(y(:,2));

end

function peaks = calculatepeaks(A)


[TF,P] = islocalmax(A);
peaks = P(TF);
end

Enter this statement in the edit box to profile the solvelotka function:

[preypeaks,predatorpeaks] = solvelotka(0,15,[20;20])

If you previously profiled the statement in the current MATLAB session, you also can select it
from the edit box drop down list.
3
Click Run and Time.

When profiling is complete, the Profiler displays the results in Profile Summary. The statements
you profiled also display as having been run in the Command Window.

To profile a code file open in the Editor, on the Editor tab, in the Run section, click Run and
Time. The Profiler profiles the code file open in the current Editor tab and displays the results in the
Profile Summary.

Review the Profile Summary Results

After running the Profiler on your code, the Profile Summary presents statistics about the overall
execution of your code and provides summary statistics for each function called. For example, the
image below shows the Profile Summary for the solvelotka function.

29-5
29 Performance

At the top of the Profile Summary results, a flame graph shows a visual representation of the time
MATLAB spent running the code. Each function that was run is represented by a bar in the flame
graph. User-defined functions display in blue, and MathWorks functions display in gray.

The functions in the graph display in hierarchical order, with parent functions appearing lower on the
graph, and child functions appearing higher on the graph. The bar that spans the entire bottom of the
graph labeled Profile Summary represents all of the code that ran. The width of a bar on the graph
represents the amount of time it took for the function to run as a percentage of the total run time.

To see the actual percentage and time values as well as the full function name, hover over the bar in
the graph. To display detailed information about a function including information about individual
code lines, click the bar representing that function.

29-6
Profile Your Code to Improve Performance

The function table below the flame frame displays similar information to the flame graph. Initially the
functions appear in order of time they took to process. This table describes the information in each
column.

Column Description
Function Name Name of the function called by the profiled code.
Calls Number of times the profiled code called the function.
Total Time Total time spent in the function, in seconds. The time for the function includes time
spent in child functions. The Profiler itself takes some time, which is included in
the results. The total time can be zero for files whose run time is inconsequential.
Self Time Total time in seconds spent in a function, excluding time spent in any child
functions. Self time also includes some overhead resulting from the process of
profiling.
Total Time Plot Graphic display showing self time compared to total time.

To sort the function table by a specific column, click the arrow in the column header. For example,
click the arrow in the Function Name column to sort the functions alphabetically. Initially the results
appear in order by Total Time. To display detailed information about a function including information
about individual code lines, click the function name.

Investigate Functions and Individual Code Lines

To find potential improvements in your code, look for functions in the flame graph or function table
that use a significant amount of time or that are called most frequently. Click a function name to
display detailed information about the function, including information about individual code lines. For
example, click the solvelotka>calculatepeaks function. The Profiler displays detailed
information for the function.

29-7
29 Performance

At the top of the page, next to the name of the current function, the Profiler displays the number of
times the function was called by a parent function and the total time spent in the function. Use the
displayed links underneath the flame graph to open the function in your default editor or copy the
displayed results to a separate window.

To return to the Profile Summary, in the Profiler tab, click the Profile Summary button. You also
can click the Profile Summary bar at the bottom of the flame graph.

Once you have clicked an individual function, the Profiler displays additional information in these
sections:

29-8
Profile Your Code to Improve Performance

Section Details
Flame Graph Flame graph showing visual representation of the time MATLAB spent
running the profiled function. The graph shows the hierarchy of the
profiled function, including child functions (displayed above the
current function) and parent functions (displayed below the current
function). User-defined functions display in blue ( ), and MathWorks
functions display in gray ( ).

Hover over the bar in the graph to see the actual percentage and time
values as well as the full function name. Click a bar representing a
function to display detailed information about the function.
Parents List of functions that call the profiled function, including the number
of times the parent function called the profiled function.

Click a function name in the list to display detailed information about


the function.
Lines that take the most List of code lines in the profiled function that used the greatest
time amount of processing time.

Click a code line to see it in the Function Listing section, within the
context of the rest of the function code.
Children List of all the functions called by the profiled function.

Click a function name in the list to display detailed information about


the function.
Code Analyzer results List of problems and potential improvements for the profiled function.
Coverage results Code coverage statistics about the lines of code in the function that
MATLAB executed while profiling.

29-9
29 Performance

Section Details
Function listing Source code for the function, if it is a MATLAB code file.

For each line of code, the Function listing includes these columns:

• Execution time for each line of code


• Number of times that MATLAB executed the line of code
• The line number.

Click a line number in the Function listing to open the function


in your default editor.
• The source code for the function. The color of the text indicates
the following:

• Green — Commented lines


• Black — Executed lines of code
• Gray — Non-executed lines of code

By default, the Profiler highlights lines of code with the longest


execution time. The darker the highlighting, the longer the line of
code took to execute. To change the highlighting criteria, go to the
Profiler tab, and in the View section, click Highlight . Select from
the available highlighting options. For example, to highlight lines of
code that did not run, select the Non coverage option.

Save Your Results

To compare the impact of changes after you have made improvements to your code, save your
profiling results. To save your results, use the displayed link underneath the flame graph to copy the
displayed results to a separate window.

You also can print your results from the Profiler by going to the Profiler tab and clicking the Print
button.

Profile Multiple Statements in Command Window


To profile more than one statement in the Command Window:

29-10
Profile Your Code to Improve Performance

1 Go to the Command Window and type profile on.


2 Enter and run the statements that you want to profile.
3 After running all of the statements, type profile off.
4 Open the Profiler by typing profile viewer. You also can go to the Home tab, and in the Code

section, click Run and Time.


5 Review the Profile Summary results.

Profile an App
You can profile apps that you create in App Designer. You also can profile apps that ship with
MathWorks products, such as the Filter Design and Analysis tool included with Signal Processing
Toolbox.

To profile an app:

1
Open the Profiler by going to the Home tab, and in the Code section, click Run and Time.
You also can type profile viewer in the Command Window.
2
In the Profile section of the Profiler toolstrip, click Start Profiling. Make sure that there is
no code in the edit box to the right of the button.
3 Start the app.
4 Use the app.
5 When you are finished, click Stop Profiling in the Profiler toolstrip.
6 Review the Profile Summary results.

Note To exclude the app startup process in the profile, reverse steps 2 and 3. In other words, start

the app before you click Start Profiling.

See Also
profile | profsave

More About
• “Measure the Performance of Your Code” on page 29-2
• “Techniques to Improve Performance” on page 29-14
• “Determine Code Coverage Using the Profiler” on page 29-12

29-11
29 Performance

Determine Code Coverage Using the Profiler


When you run the Profiler on a file, some code might not run, such as a block containing an if
statement.

To determine how much of a file MATLAB executed when you profiled it, run the Coverage Report.

1 Profile your MATLAB code file. For more information, see “Profile Your Code to Improve
Performance” on page 29-4 or the profile function.
2 Ensure that the Profiler is not currently profiling.

• In the Profiler, a Stop Profiling button displays if the Profiler is running. If the Profiler is
running, click the Stop Profiling button.
• At the command prompt, check the Profiler status using profile status. If the
ProfilerStatus is 'on', stop the Profiler by typing profile off.
3 Use the Current Folder browser to navigate to the folder containing the profiled code file.

Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that
is, a path that starts with \\. Instead, use an actual hard drive on your system, or a mapped
network drive.
4 On the Current Folder browser, click , and then select Reports > Coverage Report.

The Profiler Coverage Report opens, providing a summary of coverage for the profiled file. In the
following image, the profiled file is lengthofline2.m.

5 Click the Coverage link to see the Profile Detail Report for the file.

See Also
profile

29-12
Determine Code Coverage Using the Profiler

More About
• “Profile Your Code to Improve Performance” on page 29-4
• “Measure the Performance of Your Code” on page 29-2
• “Techniques to Improve Performance” on page 29-14

29-13
29 Performance

Techniques to Improve Performance


In this section...
“Environment” on page 29-14
“Code Structure” on page 29-14
“Programming Practices for Performance” on page 29-14
“Tips on Specific MATLAB Functions” on page 29-15

To speed up the performance of your code, consider these techniques.

Environment
Be aware of background processes that share computational resources and decrease the performance
of your MATLAB code.

Code Structure
While organizing your code:

• Use functions instead of scripts. Functions are generally faster.


• Prefer local functions over nested functions. Use this practice especially if the function does not
need to access variables in the main function.
• Use modular programming. To avoid large files and files with infrequently accessed code, split
your code into simple and cohesive functions. This practice can decrease first-time run costs.

Programming Practices for Performance


Consider these programming practices to improve the performance of your code.

• Preallocate — Instead of continuously resizing arrays, consider preallocating the maximum


amount of space required for an array. For more information, see “Preallocation” on page 29-16.
• Vectorize — Instead of writing loop-based code, consider using MATLAB matrix and vector
operations. For more information, see “Vectorization” on page 29-18.
• Place independent operations outside loops — If code does not evaluate differently with each for
or while loop iteration, move it outside of the loop to avoid redundant computations.
• Create new variables if data type changes — Create a new variable rather than assigning data of a
different type to an existing variable. Changing the class or array shape of an existing variable
takes extra time to process.
• Use short-circuit operators — Use short-circuiting logical operators, && and || when possible.
Short-circuiting is more efficient because MATLAB evaluates the second operand only when the
result is not fully determined by the first operand. For more information, see Logical
Operators: Short Circuit.
• Avoid global variables — Minimizing the use of global variables is a good programming practice,
and global variables can decrease performance of your MATLAB code.
• Avoid overloading built-ins — Avoid overloading built-in functions on any standard MATLAB data
classes.

29-14
Techniques to Improve Performance

• Avoid using “data as code” — If you have large portions of code (for example, over 500 lines) that
generate variables with constant values, consider constructing the variables and saving them, for
example, in a MAT-file or .csv file. Then you can load the variables instead of executing code to
generate them.

Tips on Specific MATLAB Functions


Consider the following tips on specific MATLAB functions when writing performance critical code.

• Avoid clearing more code than necessary. Do not use clear all programmatically. For more
information, see clear.
• Avoid functions that query the state of MATLAB such as inputname, which, whos, exist(var),
and dbstack. Run-time introspection is computationally expensive.
• Avoid functions such as eval, evalc, evalin, and feval(fname). Use the function handle input
to feval whenever possible. Indirectly evaluating a MATLAB expression from text is
computationally expensive.
• Avoid programmatic use of cd, addpath, and rmpath, when possible. Changing the MATLAB path
during run time results in code recompilation.

See Also

More About
• “Measure the Performance of Your Code” on page 29-2
• “Profile Your Code to Improve Performance” on page 29-4
• “Preallocation” on page 29-16
• “Vectorization” on page 29-18
• “Graphics Performance”

29-15
29 Performance

Preallocation
for and while loops that incrementally increase the size of a data structure each time through the
loop can adversely affect performance and memory use. Repeatedly resizing arrays often requires
MATLAB to spend extra time looking for larger contiguous blocks of memory, and then moving the
array into those blocks. Often, you can improve code execution time by preallocating the maximum
amount of space required for the array.

The following code displays the amount of time needed to create a scalar variable, x, and then to
gradually increase the size of x in a for loop.

tic
x = 0;
for k = 2:1000000
x(k) = x(k-1) + 5;
end
toc

Elapsed time is 0.301528 seconds.

If you preallocate a 1-by-1,000,000 block of memory for x and initialize it to zero, then the code runs
much faster because there is no need to repeatedly reallocate memory for the growing data
structure.

tic
x = zeros(1, 1000000);
for k = 2:1000000
x(k) = x(k-1) + 5;
end
toc

Elapsed time is 0.011938 seconds.

Use the appropriate preallocation function for the kind of array you want to initialize:

• zeros for numeric arrays


• strings for string arrays
• cell for cell arrays
• table for table arrays

Preallocating a Nondouble Matrix


When you preallocate a block of memory to hold a matrix of some type other than double, avoid
using the method

A = int8(zeros(100));

This statement preallocates a 100-by-100 matrix of int8, first by creating a full matrix of double
values, and then by converts each element to int8. Creating the array as int8 values saves time and
memory. For example:

A = zeros(100, 'int8');

29-16
Preallocation

See Also

Related Examples
• “Reshaping and Rearranging Arrays”
• “Preallocate Memory for Cell Array” on page 12-15
• “Access Data Using Categorical Arrays” on page 8-24
• “Preallocate Arrays of Graphics Objects”
• “Construct Object Arrays”

More About
• “Techniques to Improve Performance” on page 29-14

29-17
29 Performance

Vectorization
In this section...
“Using Vectorization” on page 29-18
“Array Operations” on page 29-19
“Logical Array Operations” on page 29-20
“Matrix Operations” on page 29-21
“Ordering, Setting, and Counting Operations” on page 29-22
“Functions Commonly Used in Vectorization” on page 29-23

Using Vectorization
MATLAB is optimized for operations involving matrices and vectors. The process of revising loop-
based, scalar-oriented code to use MATLAB matrix and vector operations is called vectorization.
Vectorizing your code is worthwhile for several reasons:

• Appearance: Vectorized mathematical code appears more like the mathematical expressions found
in textbooks, making the code easier to understand.
• Less Error Prone: Without loops, vectorized code is often shorter. Fewer lines of code mean fewer
opportunities to introduce programming errors.
• Performance: Vectorized code often runs much faster than the corresponding code containing
loops.

Vectorizing Code for General Computing

This code computes the sine of 1,001 values ranging from 0 to 10:
i = 0;
for t = 0:.01:10
i = i + 1;
y(i) = sin(t);
end

This is a vectorized version of the same code:


t = 0:.01:10;
y = sin(t);

The second code sample usually executes faster than the first and is a more efficient use of MATLAB.
Test execution speed on your system by creating scripts that contain the code shown, and then use
the tic and toc functions to measure their execution time.

Vectorizing Code for Specific Tasks

This code computes the cumulative sum of a vector at every fifth element:
x = 1:10000;
ylength = (length(x) - mod(length(x),5))/5;
y(1:ylength) = 0;
for n= 5:5:length(x)
y(n/5) = sum(x(1:n));
end

29-18
Vectorization

Using vectorization, you can write a much more concise MATLAB process. This code shows one way
to accomplish the task:

x = 1:10000;
xsums = cumsum(x);
y = xsums(5:5:length(x));

Array Operations
Array operators perform the same operation for all elements in the data set. These types of
operations are useful for repetitive calculations. For example, suppose you collect the volume (V) of
various cones by recording their diameter (D) and height (H). If you collect the information for just
one cone, you can calculate the volume for that single cone:

V = 1/12*pi*(D^2)*H;

Now, collect information on 10,000 cones. The vectors D and H each contain 10,000 elements, and you
want to calculate 10,000 volumes. In most programming languages, you need to set up a loop similar
to this MATLAB code:

for n = 1:10000
V(n) = 1/12*pi*(D(n)^2)*H(n));
end

With MATLAB, you can perform the calculation for each element of a vector with similar syntax as the
scalar case:

% Vectorized Calculation
V = 1/12*pi*(D.^2).*H;

Note Placing a period (.) before the operators *, /, and ^, transforms them into array operators.

Array operators also enable you to combine matrices of different dimensions. This automatic
expansion of size-1 dimensions is useful for vectorizing grid creation, matrix and vector operations,
and more.

Suppose that matrix A represents test scores, the rows of which denote different classes. You want to
calculate the difference between the average score and individual scores for each class. Using a loop,
the operation looks like:

A = [97 89 84; 95 82 92; 64 80 99;76 77 67;...


88 59 74; 78 66 87; 55 93 85];

mA = mean(A);
B = zeros(size(A));
for n = 1:size(A,2)
B(:,n) = A(:,n) - mA(n);
end

A more direct way to do this is with A - mean(A), which avoids the need of a loop and is
significantly faster.

devA = A - mean(A)

29-19
29 Performance

devA =

18 11 0
16 4 8
-15 2 15
-3 -1 -17
9 -19 -10
-1 -12 3
-24 15 1

Even though A is a 7-by-3 matrix and mean(A) is a 1-by-3 vector, MATLAB implicitly expands the
vector as if it had the same size as the matrix, and the operation executes as a normal element-wise
minus operation.

The size requirement for the operands is that for each dimension, the arrays must either have the
same size or one of them is 1. If this requirement is met, then dimensions where one of the arrays has
size 1 are expanded to be the same size as the corresponding dimension in the other array. For more
information, see “Compatible Array Sizes for Basic Operations” on page 2-25.

Another area where implicit expansion is useful for vectorization is if you are working with
multidimensional data. Suppose you want to evaluate a function, F, of two variables, x and y.

F(x,y) = x*exp(-x2 - y2)

To evaluate this function at every combination of points in the x and y vectors, you need to define a
grid of values. For this task you should avoid using loops to iterate through the point combinations.
Instead, if one of the vectors is a column and the other is a row, then MATLAB automatically
constructs the grid when the vectors are used with an array operator, such as x+y or x-y. In this
example, x is a 21-by-1 vector and y is a 1-by-16 vector, so the operation produces a 21-by-16 matrix
by expanding the second dimension of x and the first dimension of y.

x = (-2:0.2:2)'; % 21-by-1
y = -1.5:0.2:1.5; % 1-by-16
F = x.*exp(-x.^2-y.^2); % 21-by-16

In cases where you want to explicitly create the grids, you can use the meshgrid and ndgrid
functions.

Logical Array Operations


A logical extension of the bulk processing of arrays is to vectorize comparisons and decision making.
MATLAB comparison operators accept vector inputs and return vector outputs.

For example, suppose while collecting data from 10,000 cones, you record several negative values for
the diameter. You can determine which values in a vector are valid with the >= operator:

D = [-0.2 1.0 1.5 3.0 -1.0 4.2 3.14];


D >= 0

ans =

0 1 1 1 0 1 1

You can directly exploit the logical indexing power of MATLAB to select the valid cone volumes,
Vgood, for which the corresponding elements of D are nonnegative:

29-20
Vectorization

Vgood = V(D >= 0);

MATLAB allows you to perform a logical AND or OR on the elements of an entire vector with the
functions all and any, respectively. You can throw a warning if all values of D are below zero:

if all(D < 0)
warning('All values of diameter are negative.')
return
end

MATLAB can also compare two vectors with compatible sizes, allowing you to impose further
restrictions. This code finds all the values where V is nonnegative and D is greater than H:

V((V >= 0) & (D > H))

The resulting vector is the same size as the inputs.

To aid comparison, MATLAB contains special values to denote overflow, underflow, and undefined
operators, such as Inf and NaN. Logical operators isinf and isnan exist to help perform logical
tests for these special values. For example, it is often useful to exclude NaN values from
computations:

x = [2 -1 0 3 NaN 2 NaN 11 4 Inf];


xvalid = x(~isnan(x))

xvalid =

2 -1 0 3 2 11 4 Inf

Note Inf == Inf returns true; however, NaN == NaN always returns false.

Matrix Operations
When vectorizing code, you often need to construct a matrix with a particular size or structure.
Techniques exist for creating uniform matrices. For instance, you might need a 5-by-5 matrix of equal
elements:

A = ones(5,5)*10;

Or, you might need a matrix of repeating values:

v = 1:5;
A = repmat(v,3,1)

A =

1 2 3 4 5
1 2 3 4 5
1 2 3 4 5

The function repmat possesses flexibility in building matrices from smaller matrices or vectors.
repmat creates matrices by repeating an input matrix:

A = repmat(1:3,5,2)
B = repmat([1 2; 3 4],2,2)

29-21
29 Performance

A =

1 2 3 1 2 3
1 2 3 1 2 3
1 2 3 1 2 3
1 2 3 1 2 3
1 2 3 1 2 3

B =

1 2 1 2
3 4 3 4
1 2 1 2
3 4 3 4

Ordering, Setting, and Counting Operations


In many applications, calculations done on an element of a vector depend on other elements in the
same vector. For example, a vector, x, might represent a set. How to iterate through a set without a
for or while loop is not obvious. The process becomes much clearer and the syntax less
cumbersome when you use vectorized code.

Eliminating Redundant Elements

A number of different ways exist for finding the redundant elements of a vector. One way involves the
function diff. After sorting the vector elements, equal adjacent elements produce a zero entry when
you use the diff function on that vector. Because diff(x) produces a vector that has one fewer
element than x, you must add an element that is not equal to any other element in the set. NaN
always satisfies this condition. Finally, you can use logical indexing to choose the unique elements in
the set:

x = [2 1 2 2 3 1 3 2 1 3];
x = sort(x);
difference = diff([x,NaN]);
y = x(difference~=0)

y =

1 2 3

Alternatively, you could accomplish the same operation by using the unique function:

y=unique(x);

However, the unique function might provide more functionality than is needed and slow down the
execution of your code. Use the tic and toc functions if you want to measure the performance of
each code snippet.

Counting Elements in a Vector

Rather than merely returning the set, or subset, of x, you can count the occurrences of an element in
a vector. After the vector sorts, you can use the find function to determine the indices of zero values
in diff(x) and to show where the elements change value. The difference between subsequent
indices from the find function indicates the number of occurrences for a particular element:

29-22
Vectorization

x = [2 1 2 2 3 1 3 2 1 3];
x = sort(x);
difference = diff([x,max(x)+1]);
count = diff(find([1,difference]))
y = x(find(difference))

count =

3 4 3

y =

1 2 3

The find function does not return indices for NaN elements. You can count the number of NaN and
Inf values using the isnan and isinf functions.

count_nans = sum(isnan(x(:)));
count_infs = sum(isinf(x(:)));

Functions Commonly Used in Vectorization


Function Description
all Determine if all array elements are nonzero or true
any Determine if any array elements are nonzero
cumsum Cumulative sum
diff Differences and Approximate Derivatives
find Find indices and values of nonzero elements
ind2sub Subscripts from linear index
ipermute Inverse permute dimensions of N-D array
logical Convert numeric values to logicals
meshgrid Rectangular grid in 2-D and 3-D space
ndgrid Rectangular grid in N-D space
permute Rearrange dimensions of N-D array
prod Product of array elements
repmat Repeat copies of array
reshape Reshape array
shiftdim Shift dimensions
sort Sort array elements
squeeze Remove singleton dimensions
sub2ind Convert subscripts to linear indices
sum Sum of array elements

29-23
29 Performance

See Also

More About
• “Array Indexing”
• “Techniques to Improve Performance” on page 29-14
• “Array vs. Matrix Operations” on page 2-20

External Websites
• MathWorks Newsletter: Matrix Indexing in MATLAB

29-24
30

Memory Usage

• “Strategies for Efficient Use of Memory” on page 30-2


• “Resolve “Out of Memory” Errors” on page 30-6
• “How MATLAB Allocates Memory” on page 30-10
• “Avoid Unnecessary Copies of Data” on page 30-17
30 Memory Usage

Strategies for Efficient Use of Memory


This topic explains several techniques to use memory efficiently in MATLAB.

Use Appropriate Data Storage


MATLAB provides you with different sizes of data classes, such as double and uint8, so you do not
need to use large classes to store your smaller segments of data. For example, it takes 7 KB less
memory to store 1,000 small unsigned integer values using the uint8 class than it does with
double.

Use the Appropriate Numeric Class

The numeric class you should use in MATLAB depends on your intended actions. The default class
double gives the best precision, but requires 8 bytes per element of memory to store. If you intend
to perform complicated math such as linear algebra, you must use a floating-point class such as a
double or single. The single class requires only 4 bytes. There are some limitations on what you
can do with the single class, but most MATLAB Math operations are supported.

If you just need to carry out simple arithmetic and you represent the original data as integers, you
can use the integer classes in MATLAB. The following is a list of numeric classes, memory
requirements (in bytes), and the supported operations.

Class (Data Type) Bytes Supported Operations


single 4 Most math
double 8 All math
logical 1 Logical/conditional operations
int8, uint8 1 Arithmetic and some simple functions
int16, uint16 2 Arithmetic and some simple functions
int32, uint32 4 Arithmetic and some simple functions
int64, int64 8 Arithmetic and some simple functions

Reduce the Amount of Overhead When Storing Data

MATLAB arrays (implemented internally as mxArrays) require room to store meta information about
the data in memory, such as type, dimensions, and attributes. This takes about 104 bytes per array.
This overhead only becomes an issue when you have a large number (e.g., hundreds or thousands) of
small mxArrays (e.g., scalars). The whos command lists the memory used by variables, but does not
include this overhead.

Because simple numeric arrays (comprising one mxArray) have the least overhead, you should use
them wherever possible. When data is too complex to store in a simple array (or matrix), you can use
other data structures.

Cell arrays are comprised of separate mxArrays for each element. As a result, cell arrays with many
small elements have a large overhead.

Structures require a similar amount of overhead per field (see “Array Headers” on page 30-11).
Structures with many fields and small contents have a large overhead and should be avoided. A large

30-2
Strategies for Efficient Use of Memory

array of structures with numeric scalar fields requires much more memory than a structure with
fields containing large numeric arrays.

Also note that while MATLAB stores numeric arrays in contiguous memory, this is not the case for
structures and cell arrays.

Import Data to the Appropriate MATLAB Class

When reading data from a binary file with fread, it is a common error to specify only the class of the
data in the file, and not the class of the data MATLAB uses once it is in the workspace. As a result, the
default double is used even if you are reading only 8-bit values. For example,

fid = fopen('large_file_of_uint8s.bin', 'r');


a = fread(fid, 1e3, 'uint8'); % Requires 8k
whos a
Name Size Bytes Class Attributes

a 1000x1 8000 double

a = fread(fid, 1e3, 'uint8=>uint8'); % Requires 1k


whos a
Name Size Bytes Class Attributes

a 1000x1 1000 uint8

Make Arrays Sparse When Possible

If your data contains many zeros, consider using sparse arrays, which store only nonzero elements.
The following example compares sparse and full storage requirements:

A = eye(1000); % Full matrix with ones on the diagonal


As = sparse(A); % Sparse matrix with only nonzero elements
whos
Name Size Bytes Class Attributes

A 1000x1000 8000000 double


As 1000x1000 24008 double sparse

You can see that this array requires only about 4 KB to be stored as sparse, but approximately 8 MB
as a full matrix. In general, for a sparse double array with nnz nonzero elements and ncol columns,
the memory required is:

• 16 * nnz + 8 * ncol + 8 bytes (on a 64-bit machine)

Note that MATLAB supports most, but not all, mathematical operations on sparse arrays.

Avoid Temporary Copies of Data


You can significantly reduce the amount of memory required by avoiding the creation of unnecessary
temporary copies of data.

Avoid Creating Temporary Arrays

Avoid creating large temporary variables, and also make it a practice to clear temporary variables
when they are no longer needed. For example, this code creates an array of zeros stored as a
temporary variable A, and then converts A to single-precision:

30-3
30 Memory Usage

A = zeros(1e6,1);
As = single(A);

It is more memory efficient to use one command to do both operations:


A = zeros(1e6,1,'single');

Using the repmat function, array preallocation and for loops are other ways to work on non-double
data without requiring temporary storage in memory.

Use Nested Functions to Pass Fewer Arguments

When working with large data sets, be aware that MATLAB makes a temporary copy of an input
variable if the called function modifies its value. This temporarily doubles the memory required to
store the array, which causes MATLAB to generate an error if sufficient memory is not available.

One way to use less memory in this situation is to use nested functions. A nested function shares the
workspace of all outer functions, giving the nested function access to data outside of its usual scope.
In the example shown here, nested function setrowval has direct access to the workspace of the
outer function myfun, making it unnecessary to pass a copy of the variable in the function call. When
setrowval modifies the value of A, it modifies it in the workspace of the calling function. There is no
need to use additional memory to hold a separate array for the function being called, and there also is
no need to return the modified value of A:
function myfun
A = magic(500);

function setrowval(row, value)


A(row,:) = value;
end

setrowval(400, 0);
disp('The new value of A(399:401,1:10) is')
A(399:401,1:10)
end

Reclaim Used Memory


One simple way to increase the amount of memory you have available is to clear large arrays that you
no longer use.

Save Your Large Data Periodically to Disk

If your program generates very large amounts of data, consider writing the data to disk periodically.
After saving that portion of the data, use the clear function to remove the variable from memory and
continue with the data generation.

Clear Old Variables from Memory When No Longer Needed

When you are working with a very large data set repeatedly or interactively, clear the old variable
first to make space for the new variable. Otherwise, MATLAB requires temporary storage of equal
size before overriding the variable. For example,
a = rand(1e5);
b = rand(1e5);
Out of memory.

30-4
Strategies for Efficient Use of Memory

More information

clear a
a = rand(1e5); % New array

See Also

More About
• “Resolve “Out of Memory” Errors” on page 30-6

30-5
30 Memory Usage

Resolve “Out of Memory” Errors


This topic explains several strategies you can use in situations where MATLAB runs out of memory.
MATLAB is a 64-bit application that runs on 64-bit operating systems. It returns an error message
whenever it requests a segment of memory from the operating system that is larger than what is
available.

MATLAB has built-in protection against creating arrays that are too large. By default, MATLAB can
use up to 100% of the RAM (not including virtual memory) of your computer to allocate memory for
arrays, and if an array would exceed that threshold, then MATLAB returns an error. For example, this
statement attempts to create an array with an unreasonable size:
A = rand(1e6,1e6);
Error using rand
Requested 1000000x1000000 (7450.6GB) array exceeds maximum array size preference. Creation of arrays greater than this limit may take a
MATLAB to become unresponsive.

More information

See “Workspace and Variable Preferences” for information on adjusting this array size limit. If you
turn off the array size limit, then MATLAB returns a different error:
A = rand(1e6,1e6);

Out of memory.

More information

No matter how you run into memory limits, there are several resolutions available depending on your
goals. The techniques discussed in “Strategies for Efficient Use of Memory” on page 30-2 can help
you optimize the available memory you have, including:

• “Use Appropriate Data Storage” on page 30-2


• “Avoid Creating Temporary Arrays” on page 30-3
• “Reclaim Used Memory” on page 30-4

If you are already using memory efficiently and the problem persists, then the remaining sections of
this page contain possible solutions.

Leverage tall Arrays


“Tall Arrays for Out-of-Memory Data” are designed to help you work with data sets that are too large
to fit into memory. MATLAB works with small blocks of the data at a time, automatically handling all
of the data chunking and processing in the background. There are two primary ways you can leverage
tall arrays:
1 If you have a large array that fits in memory, but you run out of memory when you try to perform
calculations, you can cast the array to a tall array:
B = tall(A)

This method enables you work with large arrays that can fit in memory, but that consume too
much memory to allow for copies of the data during calculations. For example, if you have 8GB of
RAM and a 5GB matrix, casting the matrix to a tall array enables you to perform calculations on
the matrix without running out of memory. See “Convert In-Memory Arrays to Tall Arrays” for an
example of this usage.

30-6
Resolve “Out of Memory” Errors

2 If you have file or folder-based data, you can create a datastore and then create a tall array on
top of the datastore:

ds = datastore('path/to/[Link]');
tt = tall(ds);

This method gives you the full power of tall arrays in MATLAB: the data can have any number of
rows and MATLAB does not run out of memory. And because datastore works with both local
and remote data locations, the data you work with does not need to be on the computer you use
to analyze it. See “Work with Remote Data” for more information.

Leverage the Memory of Multiple Machines


If you have a cluster of computers, you can use the Parallel Computing Toolbox and “Distributed
Arrays” (Parallel Computing Toolbox) to perform calculations using the combined memory of all the
machines in the cluster. This enables you to operate on the entire distributed array as a single entity.
However, the workers operate only on their part of the array, and automatically transfer data between
themselves when necessary.

Creating a distributed array is very similar to creating a tall array:

ds = datastore('path/to/[Link]');
dt = distributed(ds);

Load Only as Much Data as You Need


Another possible way to fix memory issues is to only import into MATLAB as much of a large data set
as you need for the problem you are trying to solve. This is not usually a problem when importing
from sources such as a database, where you can explicitly search for elements matching a query. But
this is a common problem with loading large flat text or binary files.

The datastore function enables you to work with large data sets incrementally. This function
underpins “Tall Arrays for Out-of-Memory Data” and “Distributed Arrays” (Parallel Computing
Toolbox), but you can use it for other purposes as well. Datastores are useful any time you want to
load small portions of a data set into memory at a time.

To create a datastore, you need to provide the name of a file or a directory containing a collection of
files with similar formatting. For example, with a single file:

ds = datastore('path/to/[Link]')

Or, with a collection of files in a folder:

ds = datastore('path/to/folder/')

You can also use the wildcard character * to select all files of a specific type, as in:

ds = datastore('data/*.csv')

Datastores support a wide variety of common file formats (tabular data, images, spreadsheets, and so
on). See “Select Datastore for File Format or Application” for more information.

Aside from datastores, MATLAB also has several other functions to load parts of files, such as the
matfile function to load portions of MAT-files. This table summarizes partial loading functions by file
type.

30-7
30 Memory Usage

File Type Partial Loading


MAT-file Load part of a variable by indexing into an object
that you create with the matfile function. See
Big Data in MAT Files for an example of this
usage.
Text Use the textscan function to access parts of a
large text file by reading only the selected
columns and rows. If you specify the number of
rows or a repeat format number with textscan,
MATLAB calculates the exact amount of memory
required beforehand.
Binary You can use low-level binary file I/O functions,
such as fread, to access parts of any file that has
a known format. For binary files of an unknown
format, try using memory mapping with the
memmapfile function.
Image, HDF, Audio, and Video Many of the MATLAB functions that support
loading from these types of files allow you to
select portions of the data to read. For details,
see the function reference pages listed in
“Supported File Formats for Import and Export”.

Increase System Swap Space


The total memory available to applications on your computer is composed of physical memory (RAM),
plus a page file, or swap file, on disk. The swap file can be very large (for example, 512 terabytes on
64-bit Windows). The operating system allocates the virtual memory for each process to physical
memory or to the swap file, depending on the needs of the system and other processes. Increasing
the size of the swap file can increase the total available memory, but also typically leads to slower
performance.

Most systems enable you to control the size of your swap file. The steps involved depend on your
operating system:

• Windows Systems — Use the Windows Control Panel to change the size of the virtual memory
paging file on your system. For more information, refer to the Windows help.
• Linux® Systems — Change your swap space by using the mkswap and swapon commands. For
more information, at the Linux prompt type man followed by the command name.

There is no interface for directly controlling the swap space on macOS systems.

Set the Process Limit on Linux Systems


The process limit is the maximum amount of virtual memory a single process (or application) can
address. In the unlikely case you have set this preference, it must be large enough to accommodate:

• All the data to process


• MATLAB program files
• The MATLAB executable itself

30-8
Resolve “Out of Memory” Errors

• Additional state information

64-bit operating systems support a process limit of 8 terabytes. On Linux systems, see the ulimit
command to view and set user limits including virtual memory.

Disable Java VM on Linux Systems


On Linux systems, if you start MATLAB without the Java JVM™, you can increase the available
workspace memory by approximately 400 megabytes. To start MATLAB without Java JVM, use the
command-line option -nojvm. This option also increases the size of the largest contiguous memory
block by about the same amount. By increasing the largest contiguous memory block, you increase
the largest possible matrix size.

Using -nojvm comes with a penalty in that you lose many features that rely on the Java software,
including the entire development environment. Starting MATLAB with the -nodesktop option does
not save any substantial amount of memory.

See Also
memory

Related Examples
• “Strategies for Efficient Use of Memory” on page 30-2
• “Large Files and Big Data”
• “Work with Remote Data”
• “Java Heap Memory Preferences”

30-9
30 Memory Usage

How MATLAB Allocates Memory


In this section...
“Memory Allocation for Arrays” on page 30-10
“Data Structures and Memory” on page 30-13

Memory Allocation for Arrays


This topic provides information on how MATLAB allocates memory when working with arrays and
variables. The purpose is to help you use memory more efficiently when writing code. Most of the
time, however, you should not need to be concerned with these internal operations as MATLAB
handles data storage for you automatically.

• “Creating and Modifying Arrays” on page 30-10


• “Copying Arrays” on page 30-10
• “Array Headers” on page 30-11
• “Function Arguments” on page 30-12

Note Any information on how the MATLAB software handles data internally is subject to change in
future releases.

Creating and Modifying Arrays

When you assign a numeric or character array to a variable, MATLAB allocates a contiguous virtual
block of memory and stores the array data in that block. MATLAB also stores information about the
array data, such as its class and dimensions, in a separate, small block of memory called a header.

If you add new elements to an existing array, MATLAB expands the existing array in memory in a way
that keeps its storage contiguous. This usually requires finding a new block of memory large enough
to hold the expanded array. MATLAB then copies the contents of the array from its original location to
this new block in memory, adds the new elements to the array in this block, and frees up the original
array location in memory.

If you remove elements from an existing array, MATLAB keeps the memory storage contiguous by
removing the deleted elements, and then compacting its storage in the original memory location.
Working with Large Data Sets

If you are working with large data sets, you need to be careful when increasing the size of an array to
avoid getting errors caused by insufficient memory. If you expand the array beyond the available
contiguous memory of its original location, MATLAB must make a copy of the array and set this copy
to the new value. During this operation, there are two copies of the original array in memory. This
temporarily doubles the amount of memory required for the array and increases the risk of your
program running out of memory during execution. It is better to preallocate sufficient memory for the
largest potential size of the array at the start. See “Preallocation” on page 29-16.

Copying Arrays

Internally, multiple variables can point to the same block of data, thus sharing that array's value.
When you copy a variable to another variable (e.g., B = A), MATLAB makes a copy of the array

30-10
How MATLAB Allocates Memory

reference, but not the array itself. As long as you do not modify the contents of the array, there is no
need to store more than one copy of it. If you do modify any elements of the array, MATLAB makes a
copy of the array and then modifies that copy.

This example uses the memory function to demonstrate how MATLAB handles copying arrays.
memory is available only on Windows systems.

Start by creating a simple script memUsed.m to display how much memory is being used by your
MATLAB process. Put these two lines of code in the script.
[usr, sys] = memory;
[Link]

Get an initial reading of how much memory is being used by your MATLAB process:
format short eng;
memUsed
ans =
295.4977e+006

Create a 2000-by-2000 numeric array A. This uses about 32MB of memory:


A = magic(2000);
memUsed
ans =
327.6349e+006

Make a copy of array A in B. As there is no need to have two copies of the array data, MATLAB only
makes a copy of the array reference. This requires no significant additional memory:
B = A;
memUsed
ans =
327.6349e+006

Now modify B by making it one half its original size (that is, set 1000 rows to empty). This requires
that MATLAB make a copy of at least the first 1000 rows of the A array, and assign that copy to B:
B(1001:2000,:) = [];
format short; size(B)
ans =
1000 2000

Check the memory used again. Even though B is significantly smaller than it was originally, the
amount of memory used by the MATLAB process has increased by about 16 MB (1/2 of the 32 MB
originally required for A) because B could no longer remain as just a reference to A:
format short eng; memUsed
ans =
343.6421e+006

Array Headers

When you assign an array to a variable, MATLAB also stores information about the array (such as
class and dimensions) in a separate piece of memory called a header. For most arrays, the memory
required to store the header is insignificant. There is a small advantage to storing large data sets in a
small number of large arrays as opposed to a large number of small arrays. This is because the
former configuration requires fewer array headers.

30-11
30 Memory Usage

Structure and Cell Arrays

For structures and cell arrays, MATLAB creates a header not only for each array, but also for each
field of the structure and for each cell of a cell array. Because of this, the amount of memory required
to store a structure or cell array depends not only on how much data it holds, but also on how it is
constructed.

For example, take a scalar structure array S1 having fields R, G, and B. Each field of size 100-by-50
requires one array header to describe the overall structure, one header for each unique field name,
and one header per field for the 1-by-1 structure array. This makes a total of seven array headers for
the entire data structure:

S1.R(1:100,1:50)
S1.G(1:100,1:50)
S1.B(1:100,1:50)

On the other hand, take a 100-by-50 structure array S2 in which each element has scalar fields R, G,
and B. In this case, you need one array header to describe the overall structure, one for each unique
field name, and one per field for each of the 5,000 elements of the structure, making a total of 15,004
array headers for the entire data structure:

S2(1:100,1:50).R
S2(1:100,1:50).G
S2(1:100,1:50).B

Even though S1 and S2 contain the same amount of data, S1 uses significantly less space in memory.
Not only is less memory required, but there is a corresponding speed benefit to using the S1 format,
as well.

See “Cell Arrays” and “Structures” under “Data Structures and Memory” on page 30-13.
Memory Usage Reported By the whos Function

The whos function displays the amount of memory consumed by any variable. For reasons of
simplicity, whos reports only the memory used to store the actual data. It does not report storage for
the array header, for example.

Function Arguments

MATLAB handles arguments passed in function calls in a similar way. When you pass a variable to a
function, you are actually passing a reference to the data that the variable represents. As long as the
input data is not modified by the function being called, the variable in the calling function and the
variable in the called function point to the same location in memory. If the called function modifies
the value of the input data, then MATLAB makes a copy of the original array in a new location in
memory, updates that copy with the modified value, and points the input variable in the called
function to this new array.

In the example below, function myfun modifies the value of the array passed into it. MATLAB makes a
copy in memory of the array pointed to by A, sets variable X as a reference to this new array, and then
sets one row of X to zero. The array referenced by A remains unchanged:

A = magic(500);
myfun(A);

function myfun(X)
X(400,:) = 0;

30-12
How MATLAB Allocates Memory

If the calling function needs the modified value of the array it passed to myfun, you need to return
the updated array as an output of the called function, as shown here for variable A:

A = magic(500);
A = myfun(A);
sprintf('The new value of A is %d', A)

function Y = myfun(X)
X(400,:) = 0;
Y = X;

Data Structures and Memory


Memory requirements differ for the various types of MATLAB data structures. You might be able to
reduce the amount of memory used for these structures by considering how MATLAB stores them.

Numeric Arrays

MATLAB requires 1, 2, 4, or 8 bytes to store 8-bit, 16-bit, 32-bit, and 64-bit signed and unsigned
integers, respectively. For floating-point numbers, MATLAB uses 4 or 8 bytes for single and double
types. To conserve memory when working with numeric arrays, MathWorks recommends that you use
the smallest integer or floating-point type that contains your data without overflowing. For more
information, see “Numeric Types”.

Complex Arrays

MATLAB uses an interleaved storage representation of complex numbers, where the real and
imaginary parts are stored together in a contiguous virtual block of memory. If you make a copy of a
complex array, and then modify only the real or imaginary part of the array, MATLAB creates an array
containing both real and imaginary parts. For more information, see “MATLAB Support for
Interleaved Complex API in MEX Functions”.

Sparse Matrices

It is best to store matrices with values that are mostly zero in sparse format. Sparse matrices can use
less memory and might also be faster to manipulate than full matrices. You can convert a full matrix
to sparse format using the sparse function.

Compare two 1000-by-1000 matrices: X, a matrix of doubles with 2/3 of its elements equal to zero;
and Y, a sparse copy of X. The following example shows that the sparse matrix requires approximately
half as much memory:

whos
Name Size Bytes Class

X 1000x1000 8000000 double array


Y 1000x1000 4004000 double array (sparse)

Cell Arrays

In addition to data storage, cell arrays require additional memory to store information describing
each cell. This information is recorded in a header, and there is one header for each cell of the array.
You can determine the amount of memory required for a cell array header by finding the number of
bytes consumed by a 1-by-1 cell that contains no data, as shown below for a 64-bit system:

30-13
30 Memory Usage

C = {[]}; % Empty cell array


whos C

Name Size Bytes Class Attributes

C 1x1 104 cell

To predict the size of an entire cell array, multiply the header size by the total number of cells in the
array, and then add to that the number of bytes required for the data you intend to store in the array:
(header_size x number_of_cells) + data

For example, a 10-by-20 cell array that contains 400 bytes of data would require 21,200 bytes of
memory on a 64-bit system:
(104 x 200) + 400 = 21200

Note While numeric arrays must be stored in contiguous memory, structures and cell arrays do not.

Example – Memory Allocation for a Cell Array

This 4-by-1 cell array records the brand name, screen size, price, and on-sale status for three laptop
computers:
Laptops = {['SuperrrFast 89X', 'ReliablePlus G5', ...
'UCanA4dIt 140L6']; ...
[single(17), single(15.4), single(14.1)]; ...
[2499.99, 1199.99, 499.99]; ...
[true, true, false]};

On a 64-bit system, the cell array header alone requires 104 bytes per cell:
4 cells * 104 bytes per cell = 416 bytes for the cell array

Calculate the memory required to contain the data in each of the four cells:
45 characters * 2 bytes per char = 90 bytes
3 singles * 4 bytes per single = 12 bytes
3 doubles * 8 bytes per double = 24 bytes
3 logicals * 1 byte per logical = 3 bytes

90 + 12 + 24 + 3 = 129 bytes for the data

Add the two, and then compare your result with the size returned by MATLAB:
416 + 129 = 545 bytes total

whos Laptops
Name Size Bytes Class Attributes

Laptops 4x1 545 cell

Structures

On a 64-bit system, each field of a structure array requires a 104-byte header. In addition, each
unique field name requires a 64-byte header. For example, a structure with one empty field consumes
168 bytes (104 bytes for the field and 64 bytes for the field name):

30-14
How MATLAB Allocates Memory

S.A = [];
whos S

Name Size Bytes Class Attributes

S 1x1 168 struct

To predict the size of an entire structure array, calculate the total number of header bytes, and then
add to that the number of bytes required for the data you intend to store in the array:
number_of_fields x ((number_of_array_elements x field_header_size) + fieldname_header_size) + data

For example, a 4-by-5 structure Clients with fields Address and Phone uses 4,288 bytes just for
the headers:

2 x ((20 x 104) + 64) = 4288 bytes

To that sum, you must add the memory required to hold the data assigned to each field. If you assign
a 25-character vector to Address and a 12-character vector to Phone in each element of the 4-by-5
Clients array, you need 1,480 bytes for data:

(25+12) characters * 2 bytes per char * 20 elements = 1480 bytes

Add the two and you see that the entire structure consumes 5,768 bytes of memory.
Example – Memory Allocation for a Structure Array

Calculate the amount of memory required on a 64-bit system to store a 6-by-5 structure array with
these field values:

A: 5-by-8-by-6 signed 8-bit integer array


B: 1-by-500 single array
C: 30-by-30 unsigned 16-bit integer array
D: 1-by-23 character array

Construct the array:

A = int8(ones(5,8,6));
B = single(1:500);
C = uint16(magic(30));
D = 'Company Name: MathWorks';

S = struct('f1',A,'f2',B,'f3',C,'f4',D);

for m = 1:6
for n = 1:5
S(m,n) = S(1,1);
end
end

Calculate the amount of memory required for the structure itself, and then for the data it contains:

structure = fields x ((array elements x 104) + 64) =


4 x ((30 x 104) + 64) = 12,736 bytes

data = (field1 + field2 + field3 + field4) x array elements =


(240 + 2000 + 1800 + 46) x 30 = 122,580 bytes

Add the two, and then compare your result with the size returned by MATLAB:

30-15
30 Memory Usage

Total bytes calculated for structure S: 12,736 + 122,580 = 135,316

whos S

Name Size Bytes Class Attributes

S 6x5 135316 struct

30-16
Avoid Unnecessary Copies of Data

Avoid Unnecessary Copies of Data

In this section...
“Passing Values to Functions” on page 30-17
“Why Pass-by-Value Semantics” on page 30-19
“Handle Objects” on page 30-20

Passing Values to Functions


When calling a function with input arguments, MATLAB copies the values from the calling function’s
workspace into the parameter variables in the function being called. However, MATLAB applies
various techniques to avoid making copies of these values when it is not necessary.

MATLAB does not provide a way to define a reference to a value, as in languages like C++. Instead,
MATLAB allows multiple output as well as multiple input parameters so that you know what values
are going into a function and what values are coming out of the function.

Copy-on-Write

If a function does not modify an input argument, MATLAB does not make a copy of the values
contained in the input variable.

For example, suppose that you pass a large array to a function.

A = rand(1e7,1);
B = f1(A);

The function f1 multiplies each element in the input array X by 1.1 and assigns the result to the
variable Y.

function Y = f1(X)
Y = X.*1.1; % X is a shared copy of A
end

Because the function does not modify the input values, the local variable X and the variable A in the
caller's workspace share the data. After f1 executes, the values assigned to A have not changed. The
variable B in the caller's workspace contains the result of the element-wise multiplication. The input
is passed by value. However, no copy is made when calling f1.

The function f2 does modify its local copy of the input variable, causing the local copy to be unshared
with input A. The value of X in the function is now an independent copy of the input variable A in the
caller's workspace. When f2 returns the result to the caller's workspace, the local variable X is
destroyed.

A = rand(1e7,1);
B = f2(A);

function Y = f2(X)
X = X.*1.1; % X is an independent copy of A
Y = X; % Y is a shared copy of X
end

30-17
30 Memory Usage

Passing Inputs as MATLAB Expressions

You can use the value returned from a function as an input argument to another function. For
example, use the rand function to create the input for the function f2 directly.

B = f2(rand(1e7,1));

The only variable holding the value returned by rand is the temporary variable X in the workspace of
the function f2. There is no shared or independent copy of these values in the caller's workspace.
Directly passing function outputs saves the time and memory required to create a copy of the input
values in the called function. This approach makes sense when the input values are not used again.

Assigning In-Place

You can assign the output of a function to the same variable as the input when you do not need to
preserve the original input values.

A = f2(A);

Reassignment to the same variable name follows the copy-on-write behavior described previously:
modifying the input variable values results in a temporary copy of those values. However, MATLAB
can apply memory optimizations under certain conditions.

Consider the following example. The memoryOptimization function creates a large array of random
numbers in the variable A. Then it calls the local function fLocal, passing A as the input, and
assigning the output of the local function to the same variable name.

Because the call to the local function, A = fLocal(A), assigns the output to the variable A, MATLAB
does not need to preserve the original value of A during execution of the function. Within fLocal, the
input X has the only copy of the value originally held by A.

Therefore, modifications made to X inside fLocal do not result in a copy of the data. The assignment,
X = X.*1.1, modifies X in place, without allocating a new array for the result of the multiplication.

function memoryOptimization
A = rand(1e7,1);
A = fLocal(A);
end
function X = fLocal(X)
X = X.*1.1;
end

Eliminating the copy in the local function saves memory and improves execution speed for large
arrays. However, MATLAB cannot apply memory optimization when it is possible to use the variable
after the function throws an error. Therefore, this optimization is not applied in scripts, on the
command line, in calls to eval, or to code inside try/catch blocks.

Also, MATLAB does not apply memory optimization when the original variable can be accessed
directly during execution of the called function. For example, if fLocal was a nested function,
MATLAB could not apply the optimization because variables can be shared with the parent function.

Finally, MATLAB does not apply memory optimization when the assigned variable is declared as
global or persistent.

30-18
Avoid Unnecessary Copies of Data

Debugging Code That Uses In-Place Assignment

When MATLAB applies in-place optimization to an assignment statement, the variable on the left side
of the assignment is set to a temporary state that makes it inaccessible before MATLAB executes the
right side of the assignment statement. If MATLAB stops in the debugger before the result of
executing the right-side of the statement has been assigned to the variable, examining the left-side
variable can produce an error indicating that the variable is unavailable.

For example, this function has a mismatch in the dimensions of variables A and B.

function A = inPlace
A = rand(100);
B = rand(99);
dbstop if error
A = A.*B;
end

Executing the function throws an error and stops in the debugger.

inPlace

Matrix dimensions must agree.

Error in inPlace (line 5)


A = A.*B;

5 A = A.*B;

Attempting to see the value of the variable A while in debug mode results in an error because the
variable is temporarily unavailable.

K>> A

Variable "A" is inaccessible. When a variable appears on both sides of


an assignment statement, the variable may become temporarily
unavailable during processing.

To gain more flexibility when debugging, refactor your code to remove the in-place assignment. For
example, assign the result to another variable.

function A = inPlace
A = rand(100);
B = rand(99);
dbstop if error
% Assign result to C indtead of A
C = A.*B;
A = C;
end

Then the variable A is visible while in the debugger.

Why Pass-by-Value Semantics


MATLAB uses pass-by-value semantics when passing arguments to functions and returning values
from functions. In some cases, pass-by-value results in copies of the original values being made in the
called function. However, pass-by-value semantics provides certain advantages.

30-19
30 Memory Usage

When calling functions, you know that the input variables are not modified in the caller's workspace.
Therefore, you do not need to make copies of inputs inside a function or at a call site just to guard
against the possibility that these values might be modified. Only the variables assigned to returned
values are modified.

Also, you avoid the possibility of corrupting workspace variables if an error occurs within a function
that has been passed a variable by reference.

Handle Objects
There are special kinds of objects called handles. All variables that hold copies of the same handle
can access and modify the same underlying object. Handle objects are useful in specialized
circumstances where an object represents a physical object such as a window, plot, device, or person
rather than a mathematical object like a number or matrix.

Handle objects derive from the handle class, which provides functionality such as events and
listeners, destructor methods, and support for dynamic properties.

For more information about values and handles, see “Comparison of Handle and Value Classes” and
“Which Kind of Class to Use”.

See Also
handle

Related Examples
• “Handle Object Behavior”
• “Avoid Copies of Arrays in MEX Functions”
• “Strategies for Efficient Use of Memory” on page 30-2

30-20
31

Custom Help and Documentation

• “Create Help for Classes” on page 31-2


• “Check Which Programs Have Help” on page 31-8
• “Create Help Summary Files — Contents.m” on page 31-10
• “Customize Code Suggestions and Completions” on page 31-12
• “Display Custom Documentation” on page 31-21
• “Display Custom Examples” on page 31-29
31 Custom Help and Documentation

Create Help for Classes


In this section...
“Help Text from the doc Command” on page 31-2
“Custom Help Text” on page 31-3

Help Text from the doc Command


When you use the doc command to display help for a class, MATLAB automatically displays
information that it derives from the class definition.

For example, create a class definition file named someClass.m with several properties and methods,
as shown.

classdef someClass
% someClass Summary of this class goes here
% Detailed explanation goes here

properties
One % First public property
Two % Second public property
end
properties (Access=private)
Three % Do not show this property
end

methods
function obj = someClass
% Summary of constructor
end
function myMethod(obj)
% Summary of myMethod
disp(obj)
end
end
methods (Static)
function myStaticMethod
% Summary of myStaticMethod
end
end

end

View the help text and the details from the class definition using the doc command.

doc someClass

31-2
Create Help for Classes

Custom Help Text


You can add information about your classes that both the doc command and the help command
include in their displays. The doc command displays the help text at the top of the generated HTML
pages, above the information derived from the class definition. The help command displays the help
text in the Command Window. For details, see:

• “Classes” on page 31-3


• “Methods” on page 31-4
• “Properties” on page 31-5
• “Enumerations” on page 31-5
• “Events” on page 31-6

Classes

Create help text for classes by including comments on lines immediately after the classdef
statement in a file. For example, create a file named myClass.m, as shown.

classdef myClass
% myClass Summary of myClass
% This is the first line of the description of myClass.
% Descriptions can include multiple lines of text.
%
% myClass Properties:
% a - Description of a
% b - Description of b
%
% myClass Methods:

31-3
31 Custom Help and Documentation

% doThis - Description of doThis


% doThat - Description of doThat

properties
a
b
end

methods
function obj = myClass
end
function doThis(obj)
end
function doThat(obj)
end
end

end

Lists and descriptions of the properties and methods in the initial comment block are optional. If you
include comment lines containing the class name followed by Properties or Methods and a colon
(:), then MATLAB creates hyperlinks to the help for the properties or methods.

View the help text for the class in the Command Window using the help command.

help myClass

myClass Summary of myClass


This is the first line of the description of myClass.
Descriptions can include multiple lines of text.

myClass Properties:
a - Description of a
b - Description of b

myClass Methods:
doThis - Description of doThis
doThat - Description of doThat

Methods

Create help for a method by inserting comments immediately after the function definition statement.
For example, modify the class definition file myClass.m to include help for the doThis method.

function doThis(obj)
% doThis Do this thing
% Here is some help text for the doThis method.
%
% See also DOTHAT.

disp(obj)
end

View the help text for the method in the Command Window using the help command. Specify both
the class name and method name, separated by a dot.

help [Link]

31-4
Create Help for Classes

doThis Do this thing


Here is some help text for the doThis method.

See also doThat.

Properties

There are two ways to create help for properties:

• Insert comment lines above the property definition. Use this approach for multiline help text.
• Add a single-line comment next to the property definition.

Comments above the definition have precedence over a comment next to the definition.

For example, modify the property definitions in the class definition file myClass.m.

properties
a % First property of myClass

% b - Second property of myClass


% The description for b has several
% lines of text.
b % Other comment
end

View the help for properties in the Command Window using the help command. Specify both the
class name and property name, separated by a dot.

help myClass.a

a - First property of myClass

help myClass.b

b - Second property of myClass


The description for b has several
lines of text.

Enumerations

Like properties, there are two ways to create help for enumerations:

• Insert comment lines above the enumeration definition. Use this approach for multiline help text.
• Add a single-line comment next to the enumeration definition.

Comments above the definition have precedence over a comment next to the definition.

For example, create an enumeration class in a file named myEnumeration.m.

classdef myEnumeration
enumeration
uno, % First enumeration

% DOS - Second enumeration


% The description for DOS has several
% lines of text.
dos % A comment (not help text)

31-5
31 Custom Help and Documentation

end
end

View the help in the Command Window using the help command. Specify both the class name and
enumeration member, separated by a dot.

help [Link]

uno - First enumeration

help [Link]

dos - Second enumeration


The description for dos has several
lines of text.

Events

Like properties and enumerations, there are two ways to create help for events:

• Insert comment lines above the event definition. Use this approach for multiline help text.
• Add a single-line comment next to the event definition.

Comments above the definition have precedence over a comment next to the definition.

For example, create a class in a file named hasEvents.m.

classdef hasEvents < handle


events
Alpha % First event

% Beta - Second event


% Additional text about second event.
Beta % (not help text)
end

methods
function fireEventAlpha(h)
notify(h,'Alpha')
end

function fireEventBeta(h)
notify(h,'Beta')
end
end
end

View the help in the Command Window using the help command. Specify both the class name and
event, separated by a dot.

help [Link]

Alpha - First event

help [Link]

Beta - Second event


Additional text about second event.

31-6
Create Help for Classes

See Also
doc | help

More About
• “Role of Classes in MATLAB”
• “User-Defined Classes”

31-7
31 Custom Help and Documentation

Check Which Programs Have Help


To determine which of your programs files have help text, you can use the Help Report.

In the Help Report, you specify a set of help components for which you want to search, such as
examples or See Also lines. For each file searched, MATLAB displays the help text for the
components it finds. Otherwise, MATLAB displays a highlighted message to indicate that the
component is missing.

To generate a Help Report, in the Current Folder browser, navigate to the folder you want to check,
click , and then select Reports > Help Report. The Help Report displays in the MATLAB web
browser.

Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that is, a
path that starts with \\. Instead, use an actual hard drive on your system, or a mapped network
drive.

This table describes the available options for Help Reports.

Help Report Option Description


Show class methods Include methods in the report. If you do not select this option, then the
report includes results for classes, but not for methods within a class
definition file.

31-8
Check Which Programs Have Help

Help Report Option Description


Show all help Display all help text found in each file. If you also select individual help
components, such as Description, then help text appears twice in the
report for each file: once for the overall help text, and once for the
component.

If your program has the same name as other programs on the MATLAB
search path, then the help command generates a list of those overloaded
items. MATLAB automatically adds links to the help for those items.
Description Check for an initial, nonempty comment line in the file. This line is
sometimes called the H1 line.
Examples Check for examples in the help text. The Help Report performs a case-
insensitive search for a help line with a single-word variant of example.
The report displays that line and subsequent nonblank comment lines,
along with the initial line number.
See Also Check for a line in the help that begins with the words See also. The
report displays the text and the initial line number.

If the programs listed after See also are on the search path, then the
help command generates hyperlinks to the help for those programs. The
Help Report indicates when a program in the See also line is not on the
path.
Copyright Check for a comment line in the file that begins with the word
Copyright. When there is a copyright line, the report also checks
whether the end year is current. The date check requires that the
copyright line includes either a single year (such as 2012) or a range of
years with no spaces (such as 2001-2012).

The recommended practice is to include a range of years from the year


you created the file to the current year.

See Also

Related Examples
• “Add Help for Your Program” on page 20-5
• “Create Help Summary Files — Contents.m” on page 31-10

31-9
31 Custom Help and Documentation

Create Help Summary Files — Contents.m


In this section...
“What Is a Contents.m File?” on page 31-10
“Create a Contents.m File” on page 31-10
“Check an Existing Contents.m File” on page 31-11

What Is a Contents.m File?


A Contents.m file provides a summary of the programs in a particular folder. The help, doc, and
ver functions refer to Contents.m files to display information about folders.

Contents.m files contain only comment lines. The first two lines are headers that describe the folder.
Subsequent lines list the program files in the folder, along with their descriptions. Optionally, you can
group files and include category descriptions. For example, view the functions available in the
codetools folder:
help codetools
Commands for creating and debugging code
MATLAB Version 9.3 (R2017b) 24-Jul-2017

Editing and publishing


edit - Edit or create a file
grabcode - Copy MATLAB code from published HTML
mlint - Check files for possible problems
publish - Publish file containing cells to output file
snapnow - Force snapshot of image for published document

Directory tools
mlintrpt - Run mlint for file or folder, reporting results in browser
visdiff - Compare two files (text, MAT, or binary) or folders

...

If you do not want others to see a summary of your program files, place an empty Contents.m file in
the folder. An empty Contents.m file causes help foldername to report No help found for
foldername. Without a Contents.m file, the help and doc commands display a generated list of all
program files in the folder.

Create a Contents.m File


When you have a set of existing program files in a folder, the easiest way to create a Contents.m file
is to use the Contents Report. The primary purpose of the Contents Report is to check that an
existing Contents.m file is up-to-date. However, it also checks whether Contents.m exists, and can
generate a new file based on the contents of the folder. Follow these steps to create a file:
1 In the Current Folder browser, navigate to the folder that contains your program files.
2 Click , and then select Reports > Contents Report.
3 In the report, where prompted to make a Contents.m file, click yes. The new file includes the
names of all program files in the folder, using the description line (the first nonempty comment
line) whenever it is available.
4 Open the generated file in the Editor, and modify the file so that the second comment line is in
this form:
% Version xxx dd-mmm-yyyy

31-10
Create Help Summary Files — Contents.m

Do not include any spaces in the date. This comment line enables the ver function to detect the
version information.

Note MATLAB does not include live scripts or functions when creating a Contents Report.

Check an Existing Contents.m File


Verify whether your Contents.m file reflects the current contents of the folder using the Contents
Report, as follows:

1 In the Current Folder browser, navigate to the folder that contains the Contents.m file.
2 Click , and then select Reports > Contents Report.

Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that is, a
path that starts with \\. Instead, use an actual hard drive on your system, or a mapped network
drive.

The Contents Report performs the following checks.

Check Whether the Contents.m File... Details


Exists If there is no Contents.m file in the folder, you
can create one from the report.
Includes all programs in the folder Missing programs appear in gray highlights. You
do not need to add programs that you do not
want to expose to end users.
Incorrectly lists nonexistent files Listed programs that are not in the folder appear
in pink highlights.
Matches the program file descriptions The report compares file descriptions in
Contents.m with the first nonempty comment line
in the corresponding file. Discrepancies appear in
pink highlights. You can update either the
program file or the Contents.m file.
Uses consistent spacing between file names and Fix the alignment by clicking fix spacing at the
descriptions top of the report.

You can make all the suggested changes by clicking fix all, or open the file in the Editor by clicking
edit Contents.m.

See Also
doc | help | ver

31-11
31 Custom Help and Documentation

Customize Code Suggestions and Completions


To customize code suggestions and completions for your functions, provide MATLAB with information
about your function signatures. Function signatures describe the acceptable syntaxes and allowable
data types for a function. MATLAB uses this information to improve interactive features such as tab
completion and function hints. Define this function information in a JSON-formatted file called
[Link].

For MATLAB to detect the function signature information, you must place
[Link] in the folder that contains the function code. If you define information
for a class method or package function, you must place [Link] in the parent
folder of the outermost class or package folder. For example, to define information for a method of
myClass, place [Link] in the folder myFolder for these class and package
structures:
myFolder/+myPackage/@myClass
myFolder/+myPackage/+mySubpackage/@myClass

You can define signatures for multiple functions in the same file.

The [Link] file contains a single JSON object. JSON uses braces to define
objects, and refers to objects as collections of name and value pairs. Since these terms are
overloaded in context of function signatures, "property" is used instead of "name." The JSON object in
[Link] contains an optional schema version and a list of function objects.
Each function object contains a list of signature objects, and each signature object contains an array
of argument objects. JSON uses brackets to define arrays.

To specify the optional schema version use _schemaVersion as the first property and the version
number as its value. Specify the version number as a JSON string in the format
major#.minor#.patch#, with each number specified as a nonnegative integer. The current schema
version is 1.0.0. If the file does not specify a schema version, MATLAB assumes version 1.0.0.

If [Link] contains syntax errors, MATLAB displays an error message in the


Command Window when it reads the file. Use the validateFunctionSignaturesJSON function to

31-12
Customize Code Suggestions and Completions

validate the [Link] file against the JSON schema and the MATLAB function
signature schema.

Function Objects
To define information for a function, create a property that is the same as the function name. Its value
is a signature object on page 31-13.
{
"functionName1": { signatureObj1 },
"functionName2": { signatureObj2 }
}

To define information for a class method or package function, use the full name of the function or
method. For example, define a class method myMethod and a package function myFunction.
{
"[Link]": { signatureObj },
"[Link]": { signatureObj }
}

You can define multiple function signatures for the same function or method by defining multiple
function objects with the same property (function or method name). For more information, see
“Multiple Signatures” on page 31-19.

Signature Objects
A signature object defines the input and output arguments and supported platforms for the function.
The value of each property, except for the platforms property, is an array of argument objects on
page 31-14.
{
"functionName1":
{
"inputs": [ argumentObj1, argumentObj2 ]
}
}

If you specify an instance method such as [Link] in the JSON file, one of the elements
in inputs must be an object of myClass. Typically, this object is the first element. MATLAB supports
code suggestions and completions for a specified method when you call it using either dot notation (b
= [Link](a)) or function notation (b = myMethod(myObj,a)) syntax.

Each signature in the JSON file can include the following properties.

Property Description JSON Data Type of


Value
inputs List of function input arguments. MATLAB uses this Array of argument
property for code suggestions and completions. objects
outputs List of function output arguments. MATLAB uses this Array of argument
property to refine code suggestions and completions. objects

31-13
31 Custom Help and Documentation

Property Description JSON Data Type of


Value
platforms List of platforms that support the function. MATLAB String of comma-
does not present custom code suggestions and separated values
completions if the platform does not support the
function.

The default is all platforms. Elements of the list must


match an archstr returned from the computer
function. The list can be inclusive or exclusive, but not
both. Example values are "win64,maci64" or "-
win64,-maci64".

Argument Objects
Argument objects define the information for each of the input and output arguments.
{
"functionName1":
{
"inputs":
[
{"name":"in1", "kind":"required", "type":["numeric"]},
{"name":"in2", "kind":"required", "type":["numeric","integer","scalar"]}
]
}
}

The order that the inputs appear in the JSON file is significant. For example, in a call to the
functionName1 function, in1 must appear before in2.

Each argument object can include the following properties.

name – Name of argument

The name of the input or output argument, specified as a JSON string. This property and value is
required. The name property does not need to match the argument name in the source code, but it is
a best practice for it to match any help or documentation.

Example: "name":"myArgumentName"

kind – Kind of argument

The kind of argument, specified as a JSON string with one of the following values. MATLAB uses the
value of the kind property to determine if and when to display the arguments within the function
signature.

Value Description
required Argument is required, and its location is relative to other required arguments in
the signature object.
ordered Argument is optional, and its location is relative to the required and preceding
optional arguments in the signature object.
namevalue Argument is an optional name-value pair. Name-value pair arguments occur at
the end of a function signature, but the pairs can be specified in any order.

31-14
Customize Code Suggestions and Completions

Arguments that are required and ordered appear first in the function signature, and are followed
by any namevalue arguments.

required, ordered, and namevalue arguments are most common. You can also specify the
following values for kind.

• positional – Argument is optional if it occurs at the end of the argument list, but becomes
required to specify a subsequent positional argument. Any positional arguments must appear
with the required and ordered arguments, before any namevalue arguments.
• flag – Argument is an optional, constant string, typically used as a switch. For example,
'ascend' or 'descend'. Flags occur at the end of a function signature. All flag arguments
must appear before any namevalue arguments.
• properties – Argument is optional and is used to specify public, settable properties of a different
MATLAB class. Indicate the class using the argument object type property. In code suggestions,
these properties appear as name-value pairs. Any properties arguments must be the last
argument in the signature.

Example: "kind":"required" or "kind":"namevalue"

type – Class and/or attributes of argument

Class or attributes of the argument, specified as a JSON string, list, or list of lists.

The type property can define what class the argument is and what attributes the argument must
have.

• To match one class or attribute, use a single JSON string. For example, if an argument must be
numeric, then specify "type":"numeric".
• To match all classes or attributes, use a list of JSON strings. For example, if an argument must be
both numeric and positive, then specify "type":["numeric", ">=0"].
• To match any of multiple classes or attributes, use a list of lists of JSON strings. For the inner lists,
MATLAB uses a logical AND of the values. For the outer list, MATLAB uses a logical OR of the
values. For example, if an argument must be either a positive number or a [Link]
object, then specify "type":[["numeric", ">=0"],["[Link]"]].

Value Argument Description


"classname" Must be an object of class classname, where classname is the name of the
class returned by the class function. For example, "double" or
"function_handle".
"choices=expressio Must be a case-insensitive match to one of the specified choices.
n" expression is any valid MATLAB expression that returns a cell of character
vectors, string array, or cell of integer values. For example,
"choices={'on','off'}" or "choices={8, 16, 24}".

expression can refer by name to other input arguments that appear in the
argument list. Since expression is evaluated at run time, allowable choices
can vary dynamically with the value of other input arguments.
"file=*.ext,..." Must be a string or character vector that names an existing file with the
specified extension. File names are relative to the current working folder.
For example, to allow all .m and .mlx files in the current folder, use
"file=*.m,*.mlx". To match all files in the current folder, use "file".

31-15
31 Custom Help and Documentation

Value Argument Description


"folder" Must be a string or character vector that is the name of an existing folder
relative to the current working folder.
"matlabpathfile=*. Must be a string or character vector that names an existing file on the
ext,..." MATLAB path. This value requires at least one file extension. For example,
to allow all .mat files on the path, use "matlabpathfile=*.mat".
"size=size1,size2, Must match size constraints. This value requires two or more dimensions.
…,sizeN" Each size dimension must be either a positive integer that indicates the
allowable size of the dimension, or a colon to allow any size. For example,
"size=2,:,2" constrains the argument to have a size of 2 in the 1st and
3rd dimensions.
"numel=integerValu Must have a specified number of elements.
e"
"nrows=integerValu Must have a specified number of rows.
e"
"ncols=integerValu Must have a specified number of columns.
e"
"numeric" Must be numeric. A numeric value is one for which the isa function with
the 'numeric' class category returns true.
"logical" Must be numeric or logical.
"real" Must be a real-valued numeric or a character or logical value.
"scalar" Must be scalar.
"integer" Must be an integer of type double.
"square" Must be a square matrix.
"vector" Must be a column or row vector.
"column" Must be a column vector.
"row" Must be a row vector.
"2d" Must be 2-dimensional.
"3d" Must have no more than three dimensions.
"sparse" Must be sparse.
"positive" Must be greater than zero.
">expression" Must be numeric and satisfy the inequality. expression must return a full
">=expression" scalar double.

"<expression"
"<=expression"
@(args) expression Must satisfy the function handle. For a value to satisfy the function handle,
the handle must evaluate to true.

repeating – Specify argument multiple times

Indicator that an argument can be specified multiple times, specified as a JSON true or false
(without quotes). The default is false. If specified as true, the argument or set of arguments (tuple)

31-16
Customize Code Suggestions and Completions

can be specified multiple times. A required repeating argument must appear one or more times, and
an optional repeating argument can appear zero or more times.

Example: "repeating":true

purpose – Description of argument

Description of argument, specified as a JSON string. Use this property to communicate the purpose of
the argument.

Example: "purpose":"Product ID"

For more complicated function signatures, the following properties are available for each argument
object.

platforms – List of supported platforms

List of platforms that support the argument, specified as a JSON string. The default is all platforms.
Elements of the list must match an archstr returned from the computer function. The list can be
inclusive or exclusive, but not both.

Example: "platforms":"win64,maci64" or "platforms":"-maci64"

tuple – Definition of set of arguments

Definition of a set of arguments that must always appear together, specified as a list of argument
objects. This property is only used to define sets of multiple repeating arguments. For these function
signatures, define tuples and set the repeating property to true.

mutuallyExclusiveGroup – Definition of set of exclusive arguments

Definition of a set of sets of arguments that cannot be used together, specified as a list of argument
objects. This property is used to provide information about functions with multiple function
signatures. However, typically it is easier to define multiple function signatures using multiple
function objects. For more information, see “Multiple Signatures” on page 31-19.

Create Function Signature File


This example describes how to create custom code suggestions and completions for a function.

Create a function whose signature you will describe in a JSON file in later steps. The following
function accepts:

• Two required arguments


• One optional positional argument via varargin
• Two optional name-value pair arguments via varargin

myFunc is presented to demonstrate code suggestions and does not include argument checking.
% myFunc Example function
% This function is called with any of these syntaxes:
%
% myFunc(in1, in2) accepts 2 required arguments.
% myFunc(in1, in2, in3) also accepts an optional 3rd argument.
% myFunc(___, NAME, VALUE) accepts one or more of the following name-value pair
% arguments. This syntax can be used in any of the previous syntaxes.
% * 'NAME1' with logical value

31-17
31 Custom Help and Documentation

% * 'NAME2' with 'Default', 'Choice1', or 'Choice2'


function myFunc(reqA,reqB,varargin)
% Initialize default values
NV1 = true;
NV2 = 'Default';
posA = [];

if nargin > 3
if rem(nargin,2)
posA = varargin{1};
V = varargin(2:end);
else
V = varargin;
end
for n = 1:2:size(V,2)
switch V{n}
case 'Name1'
NV1 = V{n+1};
case 'Name2'
NV2 = V{n+1}
otherwise
error('Error.')
end
end
end
end

In the same folder as myFunc, create the following function signature description in a file called
[Link]. The input names do not match the names in the body of myFunc, but
are consistent with the help text.
{
"_schemaVersion": "1.0.0",
"myFunc":
{
"inputs":
[
{"name":"in1", "kind":"required", "type":["numeric"], "purpose":"ID of item"},
{"name":"in2", "kind":"required", "type":["numeric"], "purpose":"# Items"},
{"name":"in3", "kind":"ordered", "type":["numeric"], "purpose":"Input Value"},
{"name":"Name1", "kind":"namevalue", "type":["logical","scalar"],"purpose":"Option"},
{"name":"Name2", "kind":"namevalue", "type":["char", "choices={'Default','Choice1','Choice2'}"]}
]
}
}

MATLAB uses this function signature description to inform code suggestions and completion.

How Function Signature Information is Used


MATLAB uses the function signature information in the JSON file to display matching syntaxes as you
type (function hints). You can complete partially typed text by pressing the Tab key (tab completion).
In the Command Window or Editor, MATLAB does not use the JSON file to display function hints. The
behavior of function hints and tab completion is summarized in the table.

Tool Function Hints Tab Completion


Live Editor Yes Yes
Editor No Yes
Command Window No Yes

In MATLAB Online, the Editor behaves the same as the Live Editor.

To experiment with code suggestions in the Live Editor, start to call myFunc from a live script. The
names and purposes from the JSON file appear. MATLAB indicates when arguments are optional and
if there are multiple suggestions available (such as the third positional argument or a name-value
pair). Name-value pairs options are listed.

31-18
Customize Code Suggestions and Completions

When adding a name-value pair argument to the function call, MATLAB presents the choices from the
JSON file. Since 'Name1' is defined as a logical scalar, MATLAB populates the choices automatically
(true or false). MATLAB takes the three values for the 'Name2' argument from the JSON file.

Multiple Signatures
If a function has many syntaxes, it can be helpful for code suggestions to group syntaxes as multiple
function signatures (regardless of the implementation of the function). To provide code suggestions
and completions for multiple signatures, create multiple function objects with the same property in
the JSON file.

Consider the following function that follows different code paths depending on the class of the second
input. This function is presented as an example for code suggestions, and, therefore, does not
perform any computations or error checking.

function anotherFunc(arg1,arg2,arg3)
switch class(arg2)
case 'double'
% Follow code path 1
case {'char','string'}
% Follow code path 2
otherwise
error('Invalid syntax.')
end
end

From a code suggestions perspective, consider the function as having two function signatures. The
first signature accepts two required numeric values. The second signature accepts a required
numeric, followed by a character or string, and finally a required numeric. To define multiple function
signatures, define multiple function objects in the JSON file with the same property (function name).
{
"_schemaVersion": "1.0.0",
"anotherFunc":
{

31-19
31 Custom Help and Documentation

"inputs":
[
{"name":"input1", "kind":"required", "type":["numeric"]},
{"name":"input2", "kind":"required", "type":["numeric"]}
]
},
"anotherFunc":
{
"inputs":
[
{"name":"input1", "kind":"required", "type":["numeric"]},
{"name":"input2", "kind":"required", "type":[["char"],["string"]]},
{"name":"input3", "kind":"required", "type":["numeric"]}
]
}
}

Alternatively, you can define multiple function signatures using the mutuallyExclusiveGroup
property of the argument object. Typically, it is easier and more readable to implement multiple
function objects, but using mutually exclusive groups enables reuse of common argument objects,
such as input1.
{
"_schemaVersion": "1.0.0",
"anotherFunc":
{
"inputs":
[
{"name":"input1", "kind":"required", "type":["numeric"]},
{"mutuallyExclusiveGroup":
[
[
{"name":"input2", "kind":"required", "type":["numeric"]}
],
[
{"name":"input2", "kind":"required", "type":[["char"],["string"]]},
{"name":"input3", "kind":"required", "type":["numeric"]}
]
]
}
]
}
}

See Also
validateFunctionSignaturesJSON

More About
• “Check Syntax as You Type”

External Websites
• [Link]

31-20
Display Custom Documentation

Display Custom Documentation


In this section...
“Overview” on page 31-21
“Create HTML Help Files” on page 31-22
“Create [Link] File” on page 31-23
“Create [Link] File” on page 31-24
“Build a Search Database” on page 31-26
“Address Validation Errors for [Link] Files” on page 31-27

Overview
If you create a toolbox that works with MathWorks products, even if it only contains a few functions,
you can include custom documentation in the form of HTML help files. Custom documentation for
your toolbox can include figures, diagrams, screen captures, equations, and formatting to make your
toolbox help more usable.

To display properly, your custom documentation must contain these files:

• HTML help files — These files contain your custom documentation information.
• [Link] file — This file enables MATLAB to find and identify your HTML help files.
• [Link] file — This file contain the Table of Contents for your documentation that displays
in the Contents pane of the Help browser. This file must be stored in the folder that contains your
HTML help files.
• Search database (optional) — These files enable searching in your HTML help files.

To view your custom documentation, open the Help browser and navigate to the home page. At the
bottom of the home page, under Supplemental Software, click the name of your toolbox. Your help
opens in the current window.

31-21
31 Custom Help and Documentation

Create HTML Help Files


You can create HTML help files in any text editor or web publishing software. To create help files in
MATLAB, use either of these two methods:

• Create a live script (*.mlx) and export it to HTML. For more information, see “Share Live Scripts
and Functions” on page 19-63.
• Create a script (*.m), and publish it to HTML. For more information, see “Publish and Share
MATLAB Code” on page 23-2.

Store all your HTML help files in one folder, such as an html subfolder in your toolbox folder. This
folder must be:

• On the MATLAB search path


• Outside the matlabroot folder
• Outside any installed hardware support package help folder

Documentation sets often contain:

31-22
Display Custom Documentation

• A roadmap page (that is, an initial landing page for the documentation)
• Examples and topics that explain how to use the toolbox
• Function or block reference pages

Create [Link] File


The [Link] file describes your custom documentation, including the name to display for your
documentation. It also identifies where to find your HTML help files and the [Link] file.
Create a file named [Link] for each toolbox you document.

To create [Link] to describe your toolbox, you can adapt this template:
<productinfo xmlns:xsi="[Link]
xsi:noNamespaceSchemaLocation="optional">
<?xml-stylesheet type="text/xsl"href="optional"?>

<matlabrelease>R2016b</matlabrelease>
<name>MyToolbox</name>
<type>toolbox</type>
<icon></icon>
<help_location>html</help_location>

</productinfo>

You can also create [Link] by using the template info_template.xml included with the
MATLAB documentation. To create and edit a copy of the template file in your current folder, run this
code in the command window:
copyfile(fullfile(matlabroot,'help','techdoc','matlab_env',...
'examples','templates','info_template.xml'),pwd)
fileattrib('info_template.xml','+w')
edit('info_template.xml')

The following table describes the required elements of the [Link] file.

XML Tag Description Value in Template Notes


<matlabrelease> Release of R2016b Indicates when you added help
MATLAB files. Not displayed in the browser.
<name> Title of toolbox MyToolbox The name to display for your
custom documentation in the
browser Contents pane.
<type> Label for the toolbox Allowable values: matlab,
toolbox toolbox, simulink, blockset,
links_targets, other.
<icon> Icon for the none No longer used, but the <icon>
Start button element is still required for
(not used) MATLAB to parse the [Link]
file.

31-23
31 Custom Help and Documentation

XML Tag Description Value in Template Notes


<help_location> Location of help html Name of the subfolder containing
files [Link] and the HTML help
files for your toolbox. If the help
location is not a subfolder of the
[Link] file location, specify the
path to help_location relative to
the [Link] file. If you provide
HTML help files for multiple
toolboxes, the help_location in
each [Link] file must be a
different folder.
<help_contents_icon> Icon to display none Ignored in MATLAB R2015a and
in Contents later. Does not cause error if it
pane appears in the [Link] file, but is
not required.

You also can include comments in your [Link] file, such as copyright and contact information.
Create comments by enclosing the text on a line between <!-- and -->.

When you create the [Link] file, make sure that:

• You include all required elements.


• The entries are in the same order as in the preceding table.
• File and folder names in the XML exactly match the names of your files and folders and are
capitalized identically.
• The [Link] file is in a folder on the MATLAB search path.

Note MATLAB parses the [Link] file and displays your documentation when you add the
folder that contains [Link] to the path. If you created an [Link] file in a folder already on
the path, remove the folder from the path. Then add the folder again, so that MATLAB parses the
file. Make sure that the folder you are adding is not your current folder.

Create [Link] File


The [Link] file defines the hierarchy of help files displayed in the Contents pane of the
Supplemental Software browser.

You can create a [Link] file by using the template included with the MATLAB documentation.
To create and edit a copy of the template file helptoc_template.xml in your current folder, run
this code in the Command Window:
copyfile(fullfile(matlabroot,'help','techdoc','matlab_env',...
'examples','templates','helptoc_template.xml'),pwd)
fileattrib('helptoc_template.xml','+w')
edit('helptoc_template.xml')

Place the [Link] file in the folder that contains your HTML documentation files. This folder
must be referenced as the <help_location> in your [Link] file.

Each <tocitem> entry in the [Link] file references one of your HTML help files. The first
<tocitem> entry in the [Link] file serves as the initial landing page for your documentation.

31-24
Display Custom Documentation

Within the top-level <toc> element, the nested <tocitem> elements define the structure of your
table of contents. Each <tocitem> element has a target attribute that provides the file name. File
and path names are case-sensitive.

When you create the [Link] file, make sure that:

• The location of the [Link] files is listed as the <help_location> in your [Link] file.
• All file and path names exactly match the names of the files and folders, including capitalization.
• All path names use URL file path separators (/). Windows style file path separators (\) can cause
the table of contents to display incorrectly. For example, if you have an HTML help page
[Link] located in a subfolder called refpages within the main documentation folder, the
<tocitem> target attribute value for that page would be refpages/[Link].

Example [Link] File

Suppose that you have created the following HTML files:

• A roadmap or starting page for your toolbox, [Link].


• A page that lists your functions, [Link].
• Three function reference pages: [Link], [Link], and [Link].
• An example, [Link].

Include file names and descriptions in a [Link] file as follows:


<?xml version='1.0' encoding="utf-8"?>
<toc version="2.0">

<tocitem target="[Link]">My Toolbox


<tocitem target="[Link]">Functions
<tocitem target="[Link]">first</tocitem>
<tocitem target="[Link]">second</tocitem>
<tocitem target="[Link]">third</tocitem>
</tocitem>
<tocitem target="[Link]">My Example
</tocitem>
</tocitem>

</toc>

This [Link] file, paired with a properly formulated [Link] file, produced this display in the
Help browser.

31-25
31 Custom Help and Documentation

Build a Search Database


To make your documentation searchable, create a search database, also referred to as a search index,
using the builddocsearchdb command. When using this command, specify the complete path to
the folder that contains your HTML files.

For example, suppose that your HTML files are in C:\MATLAB\MyToolbox\html. This command
creates a searchable database for those files:

builddocsearchdb('C:\MATLAB\MyToolbox\html')

builddocsearchdb creates a subfolder of C:\MATLAB\MyToolbox\html named helpsearch-v3,


which contains the database files.

To search for terms in your toolbox, open the Help browser, and in the Search Documentation field,
enter the term you want to search for. Then, on the left side of the page, under Refine by Source,
select Supplemental Software to view the results for your toolbox.

Beginning with MATLAB R2014b, you can maintain search indexes side by side. For instance, if you
already have a search index for MATLAB R2014a or earlier, run builddocsearchdb against your

31-26
Display Custom Documentation

help files using MATLAB R2014b. Then, when you run any MATLAB release, the help browser
automatically uses the appropriate index for searching your documentation database.

Address Validation Errors for [Link] Files


What Are XML Validation Errors?

When MATLAB finds an [Link] file on the search path or in the current folder, it automatically
validates the file against the supported schema. If there is an invalid construct in the [Link] file,
MATLAB displays an error in the Command Window. The error is typically of the form:

Warning: File <[Link]> did not validate.


...

An [Link] validation error can occur when you start MATLAB or add folders to the search path.

The primary causes of an XML file validation error are:

• Entities are missing or out of order in the [Link] file.


• An unrelated [Link] file exists.
• Syntax errors in the [Link] file.
• MATLAB is trying to access an outdated [Link] file for a MathWorks product.

Entities Missing or Out of Order in [Link]

If you do not list required XML elements in the prescribed order, you receive an XML validation error:
Often, errors result from incorrect ordering of XML tags. Correct the error by updating
the [Link] file contents to follow the guidelines in the MATLAB help documentation.

For a description of the elements you need in an [Link] file and their required ordering, see
“Create [Link] File” on page 31-23.

Unrelated [Link] File

Suppose that you have a file named [Link] that has nothing to do with custom documentation.
Because this [Link] file is an unrelated file, if it causes an error, you can safely ignore it. To
prevent the error message from reoccurring, rename the unrelated [Link] file. Alternatively,
ensure that the file is not on the search path or in the current folder.

Syntax Errors in the [Link] File.

Use the error message to isolate the problem or use any XML schema validator. For more information
about the structure of the [Link] file, consult its schema at matlabroot/sys/namespace/
info/v1/[Link].

Outdated [Link] File for a MathWorks Product

If you have an [Link] file from a different version of MATLAB, that file could contain constructs
that are not valid with your version. To identify an [Link] file from another version, look at the
full path names reported in the error message. The path usually includes a version number, for
example, ...\MATLAB\R14\.... In this situation, the error is not actually causing any problems, so
you can safely ignore the error message. To ensure that the error does not reoccur, remove the
offending [Link] file. Alternatively, remove the outdated [Link] file from the search path and
out of the current folder.

31-27
31 Custom Help and Documentation

See Also

Related Examples
• “Display Custom Examples” on page 31-29
• “Create and Share Toolboxes” on page 25-11
• “Add Help for Your Program” on page 20-5

31-28
Display Custom Examples

Display Custom Examples


In this section...
“How to Display Examples” on page 31-29
“Elements of the [Link] File” on page 31-30

How to Display Examples


To display examples such as videos, published program scripts, or other files that illustrate the use of
your programs in the MATLAB help browser, follow these steps:

1 Create your example files. Store the files in a folder that is on the MATLAB search path, but
outside the matlabroot folder.

Tip MATLAB includes a feature that converts scripts or functions to formatted HTML files, which
you can display as examples. To create these HTML files in MATLAB, use either of these two
methods:

• Create a live script (*.mlx) and export it to HTML. For more information, see “Share Live
Scripts and Functions” on page 19-63.
• Create a script (*.m), and publish it to HTML. For more information, see “Publish and Share
MATLAB Code” on page 23-2.

2 Create a [Link] file that describes the name, type, and display information for your
examples. Place the file in the folder (or a subfolder of the folder) that contains your [Link]
file. For more information about creating an [Link] file, see “Display Custom Documentation”
on page 31-21.

For example, suppose that you have a toolbox named My Sample, which contains a script named
my_example that you published to HTML. This [Link] file allows you to display
my_example:
<?xml version="1.0" encoding="utf-8"?>
<demos>
<name>My Sample</name>
<type>toolbox</type>
<icon>[Link]</icon>
<description>This text appears on the main page for your examples.</description>
<website><a href="[Link] to your Web site</a></website>

<demosection>
<label>First Section</label>
<demoitem>
<label>My Example Title</label>
<type>M-file</type>
<source>my_example</source>
</demoitem>
</demosection>

</demos>

Note <demosection> elements are optional.


3 View your examples.

31-29
31 Custom Help and Documentation

a In the Help browser, navigate to the home page.


b At the bottom of the page, under Supplemental Software click the link for your example.

Your example opens in the main help window.

Elements of the [Link] File


• “General Information in <demos>” on page 31-30
• “Categories Using <demosection>” on page 31-30
• “Information About Each Example in <demoitem>” on page 31-30

General Information in <demos>

Within the [Link] file, the root tag is <demos>. This tag includes elements that determine the
contents of the main page for your examples.

XML Tag Notes


<name> Name of your toolbox or collection of examples.
<type> Possible values are matlab, simulink, toolbox, or blockset.
<icon> Ignored in MATLAB R2015a and later.

In previous releases, this icon was the icon for your example. In
those releases, you can use a standard icon, [Link]. Or,
you can provide a custom icon by specifying a path to the icon
relative to the location of the [Link] file.
<description> The description that appears on the main page for your examples.
<website> (Optional) Link to a website. For example, MathWorks examples
include a link to the product page at https://
[Link].

Categories Using <demosection>

Optionally, define categories for your examples by including a <demosection> for each category. If
you include any categories, then all examples must be in categories.

Each <demosection> element contains a <label> that provides the category name, and the
associated <demoitem> elements.

Information About Each Example in <demoitem>

XML Tag Notes


<label> Defines the title to display in the browser.
<type> Possible values are M-file, model, M-GUI, video, or other.

Typically, if you published your example using the publish function,


the appropriate <type> is M-file.

31-30
Display Custom Examples

XML Tag Notes


<source> If <type> is M-file, model, M-GUI, then <source> is the name of
the associated .m file or model file, with no extension. Otherwise, do
not include a <source> element, but include a <callback>
element.
<file> Use this element only for examples with a <type> value other than
M-file when you want to display an HTML file that describes the
example. Specify a relative path from the location of [Link].
<callback> Use this element only for examples with a <type> value of video or
other to specify an executable file or a MATLAB command to run
the example.
<dependency> (Optional) Specifies other products required to run the example,
such as another toolbox. The text must match a product name
specified in an [Link] file that is on the search path or in the
current folder.

31-31
32

Projects

• “Create Projects” on page 32-2


• “Automate Startup and Shutdown Tasks” on page 32-8
• “Manage Project Files” on page 32-10
• “Find Project Files” on page 32-12
• “Create Shortcuts to Frequent Tasks” on page 32-14
• “Add Labels to Project Files” on page 32-16
• “Create Custom Tasks” on page 32-18
• “Componentize Large Projects” on page 32-20
• “Share Projects” on page 32-23
• “Upgrade Projects” on page 32-27
• “Analyze Project Dependencies” on page 32-30
• “Clone from Git Repository” on page 32-44
• “Use Source Control with Projects” on page 32-45
• “Create and Edit Projects Programmatically” on page 32-56
• “Explore an Example Project” on page 32-63
32 Projects

Create Projects

What Are Projects?


A project is a scalable environment where you can manage MATLAB files, data files, requirements,
reports, spreadsheets, tests, and generated files together in one place.

Projects can help you organize your work and collaborate. Projects promote productivity and
teamwork by helping you with common tasks.

• Find all the files that belong with your project.


• Create standard ways to set up and shut down the MATLAB environment across a team.
• Create, store, and easily access common operations.
• View and label modified files for peer review workflows.
• Share projects using built-in integration with Git™, Subversion® (SVN), or using external source
control tools.

Create Project
To create a blank project, on the Home tab, click New > Project > Blank Project. To create a
project from an existing folder, on the Home tab, click New > Project > From Folder.

The New Project dialog box opens. Enter a project name, select a project folder, and click Create.

Open Project
To open an existing project, on the Home tab, click Open and browse to an existing project .prj file.
Alternatively, in the Current Folder browser, double-click the project .prj file.

Note To avoid conflicts, you can have only one project open at a time. If you open another project,
any currently open project closes.

To open a recent project, on the Home tab, click the Open arrow and select your project under the
Recent Projects list.

32-2
Create Projects

Set up Project
After you create a project, the Welcome to your project dialog box opens and prompts you to set up
the project.

1 Click Set Up Project to begin setting up your project.

2 In the Set Up Project (Step 1 of 2) dialog box, you can choose folders to add to the project path.
Adding project folders to the project path ensures that all users of the project can access the files
within them. MATLAB adds these folders to the search path when you open the project, and
removes them when you close the project.

To add all the folders in project folder to the project path, click Add with Subfolders and then
select the root project folder containing all your subfolders.

For more information about adding folders to the project path, including how to add them after
completing the project setup, see “Specify Project Path” on page 32-8.

32-3
32 Projects

3 After specifying the project path, click the Next button to continue.
4 In the Set Up Project (Step 2 of 2) dialog box, you can specify startup and shutdown files. Startup
files help you set up the environment for your project. Shutdown files help you clean up the
environment when you are done. Use shutdown files to undo the setup that occurs in startup
files.

Use the Add and Remove buttons to manage the startup and shutdown file lists. The files run
from the top down. If the order in which the files are run is important, use the arrow buttons to
move files up or down in the list.

For more information about specifying startup and shutdown files, including how to specify them
after completing the project setup, see “Specify Startup and Shutdown Files” on page 32-8.

32-4
Create Projects

5 Click Finish to complete the project setup and open your new project.

Add Files to Project


The Files view shows the list of files in the project. Notice that, after creating a new project, the list
is empty. Files in the project root folder are not included in the project until you add them.

To create a new file or folder in the project, in the Files view, right-click in white space and select
New Folder or New File. The new file or folder is created and added to the project.

To add existing files to a project, on the Project tab, in the Tools section, select Run Checks > Add
Files. Then, select from the list of files in the project folder that are not yet added to the project. To
add existing files from the Files view, click All. Then, right-click one or more files and folders, and
select Add to Project or Add Folder to Project (Including Child Files). To add existing files from
a file browser or the Current Folder browser, cut and paste or drag and drop the files into the project
Files view. If you drag a file from outside the project root folder, this moves the file and adds it to
your project. Drag files within the project root to move them.

To add and remove project files programmatically, use the addFile function.

You might not want to include all files in your project. For example, you might want to exclude some
files in the project root folder, such as SVN or CVS source control folders. To determine which files
need to be included in your project, see “Analyze Project Dependencies” on page 32-30.

32-5
32 Projects

Other Ways to Create Projects


There are several alternative ways to create a project. You can:

• Create a project from an archived project.


• Create a project using a Simulink template.
• Create a project using files retrieved from an existing source control repository. For more
information on this last alternative, see “Use Source Control with Projects” on page 32-45.

Create a Project from an Archived Project

Some projects are shared as archived projects. An archived project is useful for sharing with users
who do not have access to a connected source control tool. To view and edit the contents of an
archived project, create a new project from the archived project.

To create a new project from an archived project, in the Current Folder browser, double-click the
archived project file which has an .mlproj extension. The Extract Project dialog box opens. Specify
the location for the new project and click Select Folder. For example, C:\myNewProject.

The new project opens. The current folder (for example, C:\myNewProject) contains the imported
project folders. If the archived project contains referenced projects, MATLAB imports files into two
subfolders, mains and refs. The mains project folder (for example, C:\myNewProject\mains)
contains the project folders. The refs folder (for example C:\myNewProject\refs) contains the
referenced project folders.

Create a Project Using Simulink

If you have Simulink, you can use a Simulink template to create and reuse a standard project
structure.

To create a project from a Simulink template created in R2014b or later:

1 On the Home or Project tab, click New > Project > From Simulink Template. The Simulink
Start Page opens.
2 The start page shows all project templates (*.sltx) on the MATLAB path. Select a template in
the list to read the template description.

If your templates do not appear, locate them by clicking Open. In the Open dialog box, make
*.sltx files visible by setting the file type to All MATLAB files, and browse to your template.
3 Select a template and click Create Project. The Create Project dialog box opens.

Templates created in R2017b or later warn you if required products are missing. Click the links
to open Add-On Explorer and install required products.
4 Specify the root project folder, edit the project name, and click Create Project.

To use project templates created in R2014a or earlier (.zip files), upgrade them to .sltx files using
[Link].

32-6
Create Projects

See Also

More About
• “Manage Project Files” on page 32-10
• “Analyze Project Dependencies” on page 32-30
• “Share Projects” on page 32-23
• “Use Source Control with Projects” on page 32-45
• “Create and Edit Projects Programmatically” on page 32-56

32-7
32 Projects

Automate Startup and Shutdown Tasks


When you open a project, MATLAB adds the project path to the MATLAB search path and then runs
or loads specified startup files. The project path and startup files help you set up the environment for
your project. Similarly, when you close a project, MATLAB removes the project path from the
MATLAB search path and runs specified shutdown files. Shutdown files help you clean up the
environment for your project. Use shutdown files to undo the setup that occurs in startup files.

More specifically, when you open a project, MATLAB changes the current folder to the project startup
folder, and runs (.m and .p files) or loads (.mat files) any specified startup file. For more information
about configuring the startup folder, see “Set Startup Folder” on page 32-8.

Specify Project Path


You can add or remove folders from the project path. Adding a project folder to the project path
ensures that all users of the project can access the files within it.

To add a folder to the project path, on the Project tab, in the Environment section, click Project
Path. Click Add Folder and select the folder that you want to add. To add a folder and all of its
subfolders, click Add with Subfolders.

To remove a folder from the project path, select the folder from the displayed list and click Remove.

You also can add or remove a folder from the project Files view. Right-click the folder, select Project
Path, and select from the available options.

Folders on the project path appear with the project path icon in the Status column of the Files
view.

Set Startup Folder


When you open the project, the current working folder changes to the project startup folder. By
default, the startup folder is set to the project root.

To edit the project startup folder, on the Project tab, in the Environment section, click Details.
Then, in the Start up section, enter a path for the project startup folder.

Specify Startup and Shutdown Files


To configure a file to run when you open your project, right-click the file and select Run at Startup.
To configure a file to run when you close your project, right-click the file and select Run at
Shutdown. The Status column displays an icon indicating whether the file runs at startup or
shutdown.

To stop a file from running at startup or shutdown, right-click the file and select Remove from
Startup or Remove from Shutdown.

Alternatively, go to the Project tab and click Startup Shutdown. Then, in the Manage Project
Startup and Shutdown dialog box, use the Add and Remove buttons to manage the startup and
shutdown file lists. The files run from the top down. If the order in which the files are run is
important, use the arrow buttons to move files up or down in the list.

32-8
Automate Startup and Shutdown Tasks

Note Startup and shutdown files are included when you commit modified files to source control.
When you configure startup and shutdown files, they run for all other project users.

Startup files can have any name except startup.m. A file named startup.m on the MATLAB path
runs when you start MATLAB. If your startup.m file calls the project, an error occurs because the
project is not yet loaded. For more information about using startup.m files, see “Startup Options in
MATLAB Startup File”.

To create new startup and shutdown files programmatically, see addStartupFile and
addShutdownFile.

In Simulink, you can specify additional project startup options. For more information, see “Automate
Startup Tasks” (Simulink).

See Also
addStartupFile

More About
• “Manage Project Files” on page 32-10
• “Create and Edit Projects Programmatically” on page 32-56
• “What Is the MATLAB Search Path?”

32-9
32 Projects

Manage Project Files


This table shows how to add, move, rename, and open project files and folders. Some of these actions
can also lead to automatic updates that affect other files. All can be undone and redone.

Action Procedure
View project files. In the Files view, click Project to display only the files and
folders that are included in the project.
View all files in a project folder. To display all files and folders in the project folder, in the Files
view, click All.

You might not want to include all files in your project. For
example, you might want to exclude SVN or CVS source control
folders. For more information, see “Work with Derived Files in
Projects” on page 32-54.
Create a new project folder. In the Files view, right-click in white space, and then click New
> Folder.
Add files to a project. On the Project tab, in the Tools section, select Run Checks >
Add Files. Select from the list of unmanaged files in the project
folder.

You also can paste or drag files and folders from your operating
system file browser or the Current Folder browser to the
project Files view. When you drag a file to the Files view,
MATLAB adds the file to the project.

To add a file programmatically, use the addFile and


addFolderIncludingChildFiles functions. For example, to
add a file named myfile.m to the proj project object, type
addFile(proj,'myfile.m');.
Remove project files or folders. In the Files view, right-click the file, and then select Remove
from Project.

To remove a file programmatically, use the removeFile


function.
Move project files or folders. Cut and paste or drag the files in the project.
Rename project files or folders. In the Files view, right-click the file, and then click Rename.
Open project files. In the Files view, right-click the file, and then click Open.

You also can double-click the file.


Preview project file contents In the Files view, select the file. The panel in the bottom right
without opening the file. of the Files view displays the file information and labels. To
restore the panel if it is minimized, click the Restore button.
Delete a project file or folder. In the Files view, right-click the file, and then click Delete.

32-10
Manage Project Files

Action Procedure
Undo or redo an action
Click or at the upper right corner of the toolstrip.

If you are using source control, you also can revert to a


particular version of a file or project. For more information, see
“Revert Changes” on page 32-53.

Automatic Updates When Renaming, Deleting, or Removing Files


When you rename, delete, or remove files or folders in a project, the project runs a dependency
analysis to check for effects on other project files. When the analysis is complete, the project displays
the affected files. If you have not yet run a dependency analysis on the project, the analysis may take
some time to run. Subsequent analyses are incremental updates, and so they run faster.

When renaming files, the project offers to automatically update references to the file. Automatically
updating references to a file when renaming prevents errors that result from changing names or
paths manually and overlooking or mistyping the name.

For example:

• When renaming a class, the project offers to automatically update all classes that inherit from it.
• When renaming a .m or .mlx file, the project offers to automatically update any files and
callbacks that call it.
• When renaming a C file, the project prompts you to update the S-function that uses it.

For more information about automatic updates when renaming, deleting, or removing Simulink files
such as library links, model references, and model callbacks, see “Automatic Updates When
Renaming, Deleting, or Removing Files” (Simulink).

See Also

More About
• “Find Project Files” on page 32-12
• “Add Labels to Project Files” on page 32-16
• “Create Custom Tasks” on page 32-18

32-11
32 Projects

Find Project Files


There are several ways to find files and folders in projects. You can:

• Group and sort project files.


• Search for and filter project files.
• Search the content in project files.

Group and Sort Project Files


To change how files and folder are grouped or sorted in the Files view, select from the options in the
Layout field and the Actions menu .

For example, to group files by type, in the Layout field, select List. Then, click the Actions button
and select Group By > Type. To sort the grouped files by size, click the actions button and select
Sort By > Size.

Search for and Filter Project Files


You can search for project files and folders in the Files view.

To search for a file or folder, in the search field at the top of the view, begin typing the file or folder
name. The asterisk character (*) is a wildcard. For example, to show only file names that begin with
coll and have a .m extension, type coll*.m.

To filter the files and folders in the current view, click the Filter button next to the search field. In
the Filter Builder dialog box, select the names, file types, project statuses, and labels to filter by.

The Filter Builder displays the resulting filter. For example:


Filter = type=='MATLAB Code files (*.m, *.mlx)' AND project status=='In project'
AND label=='Classification:Test'

Click Apply to filter the files and folders in the current view. The search field displays the applied
filter.

To clear a search or filter, click the Clear button to the right of the search field.

Search the Content in Project Files


You can search for text inside MathWorks product files (such as MATLAB files, Simulink model files,
and data dictionaries) and some other kinds of project files (such as PDF and Microsoft Word files).
MATLAB only searches in files in the project. To search the content of files in a referenced project,
open the referenced project.

To search the content of project files:

32-12
Find Project Files

1 On the Project tab, click Search. The Search Inside Project Files dialog box opens.

2 Enter the text to search. MATLAB searches the project files for the exact text in the search field
and displays the results.

Avoid using quotes around phrases.


3 Expand a result in the result list to view the match and surrounding context inside the search
window.
4 Double-click the search result to open the file and locate the match.
5 Click Filters at the bottom left of the results to refine the results by file type, status, or label.

See Also

More About
• “Manage Project Files” on page 32-10
• “Create Shortcuts to Frequent Tasks” on page 32-14
• “Add Labels to Project Files” on page 32-16

32-13
32 Projects

Create Shortcuts to Frequent Tasks


You can create shortcuts in projects to perform common project tasks, such as opening important
files and loading data.

Run Shortcuts
To run a shortcut, in the Project Shortcuts tab, click the shortcut. Clicking a shortcut in the Project
Shortcuts tab performs the default action for the file type. For example, MATLAB runs .m shortcut
files and loads .mat shortcut files. If the shortcut file is not on the path, MATLAB changes the current
folder to the parent folder of the shortcut file, runs the shortcut, and then changes the current folder
back to the original folder.

Alternatively, in the Files view, you can right-click the shortcut file and select Run. If the script is not
on the path, then MATLAB asks if you want to change folder or add the folder to the path.

Create Shortcuts
To create a shortcut from an existing project file:
1 In the Files view, right-click the file and select Create Shortcut. Alternatively, on the Project
Shortcuts tab, click New Shortcut and browse to select a file.

The Create New Shortcut dialog box opens.


2 Select an icon and enter a name. If using shortcuts to define steps in a workflow, consider
prefixing their names with numbers.
3 To add the shortcut to an existing group, in the Group field, select a group from the drop-down
list. For more information about shortcut groups, see “Organize Shortcuts” on page 32-14.
4 Click OK.

The shortcut appears with the selected name and icon on the Project Shortcuts tab. In the Files
view, the Status column displays an icon indicating that the file is a shortcut.

Note Shortcuts are included when you commit your modified files to source control, so you can share
shortcuts with other project users.

Organize Shortcuts
You can organize shortcuts by categorizing them into groups. For example, you might create one
group of shortcuts for loading data, another for opening files, another for generating code, and
another for running tests.

To create a shortcut group:


1 On the Project Shortcuts tab, click Organize Groups.
2 Click the Create button.
3 Enter a name for the group and click OK.

The new shortcut group appears on the Project Shortcuts tab.

32-14
Create Shortcuts to Frequent Tasks

To move a shortcut into a group:

1 On the Project Shortcuts tab, right-click a shortcut and select Edit Shortcut. Alternatively, in
the Files view, right-click a file and select Edit Shortcut.

The Create New Shortcut dialog box opens.


2 In the Group field, select a group from the drop-down list and click OK.

Shortcuts are organized by group in the Project Shortcuts tab.

See Also

More About
• “Manage Project Files” on page 32-10
• “Find Project Files” on page 32-12
• “Add Labels to Project Files” on page 32-16

32-15
32 Projects

Add Labels to Project Files


You can use labels to organize project files and communicate information to project users.

Add Labels
To add a label to a project file, in the Files view, select the file. Then, drag the desired label from the
Labels panel at the bottom left of the project into the Label Editor panel for the selected file. The
Label Editor panel is located at the bottom right of the Files view. To restore the panel if it is
minimized, click the icon.

To add a label to multiple project files, in the Files view or in the Dependency Analyzer graph, select
the files, right-click, and select Add Label. Choose a label from the list and click OK.

Note After you add a label to a file, the label persists across file revisions.

To add labels programmatically (for example, in custom task functions) see addLabel.

View and Edit Label Data


When you select a project file in the Files view, the file labels appear in the Label Editor view.

To change a label that belongs to a single-valued category, select the new value from the label list.

You can add additional annotations to labels from categories that you create. In the Label Editor
panel, click a label and insert or modify text. Then, click Apply.

32-16
Add Labels to Project Files

Create Labels
Labels exist in two types of categories:

• Single-valued — You can attach only one label from the category to a file.
• Multi-valued — You can attach multiple labels from the category to a file.

All projects contain a built-in label category called Classification with several built-in labels. These
built-in labels are read-only.

To create your own label categories:

1 In the Labels panel at the bottom left of the project, right-click and select Create New
Category. The Create Category dialog box opens.
2 Enter a name for the new category.
3 To create a single-valued label category, select the Single Valued check box. Otherwise,
MATLAB creates a multi-valued label category.
4 To specify a label data type other than the default String data type, from the Type list, select
from the available options.
5 Click Create.

To create your own labels in a label category:

1 In the Labels panel at the bottom left of the project, right-click the label category and select
Create New Label. The Create Label dialog box opens.
2 Enter a name for the new label and click OK.

To rename or delete a category or label, right-click it and select Rename or Remove.

To create a new label or label category programmatically, see createLabel or createCategory.

See Also

More About
• “Manage Project Files” on page 32-10
• “Find Project Files” on page 32-12

32-17
32 Projects

Create Custom Tasks


Custom tasks are MATLAB functions that allow you to perform a series of operations on one or more
files. You can create a custom task function and then run the custom task on a select set of files in
your project. For example, you can create a custom task to check all the code files for errors or to run
all the tests in the project.

Create a Custom Task Function


To create a custom task function:

1 In the Project tab, click Custom Tasks and then select Manage Custom Tasks. The Manage
Custom Tasks dialog box opens.
2 Click Add and then select Add Using New Function. If you want to add an existing script as a
custom task, select Add Using Existing Function.
3 Specify a file name for the script and save the new file on the MATLAB path. The MATLAB Editor
opens the new file containing an example custom task function.
4 Edit the function to perform the desired action on each file. Use the instructions at the top of the
file to guide you to create a custom task with the correct function signature. Your custom tasks
must accept a full path to a file as the single input argument and return a single output
argument.

For example, this custom task function extracts Code Analyzer information for each file using the
checkcode function.

[~,~,ext] = fileparts(file);
switch ext
case {'.m', '.mlx', '.mlapp'}
result = checkcode(file, '-string');
otherwise
result = [];
end
5 Save the file.

You can use the MATLAB editor to set breakpoints and debug a custom task function, just as with any
other MATLAB function.

Run a Custom Task


To run a custom task on a select set of files in your project:

1 On the Project tab, click Custom Tasks and then select Run Custom Task.
2 In the Include column of the table, select which project files you want to run the custom task on.

To include or exclude multiple files in the table at once, press the Shift or Ctrl key, select the
files, and then right-click and select Include or Exclude. If the custom task function can identify
the files to operate on, include all files.
3 In the Custom task field, select from the available custom task functions. You also can enter the
name of a task directly in the field, or click Browse.
4 Click Run Task to run the task. The Custom Task Report window displays the results.

32-18
Create Custom Tasks

5 Examine the Results column in the table to ensure that the custom task ran correctly on all files.
To view detailed result information for a file, select the file in the table. The results pane at the
bottom of the Custom Task Report displays the details.

Save Custom Task Report


Saving a Custom Task Report is useful if you want to save a record of the custom task results, or if
you want to share the results with others.

To save the Custom Task Report, click the Publish Report button at the bottom of the Custom Task
Report. You can either save the report as an HTML file or a Microsoft Word file. If you have MATLAB
Report Generator™, you also can save the report as a PDF file.

To see the report file and add it to your project, switch to the All files view.

See Also

More About
• “Create Shortcuts to Frequent Tasks” on page 32-14
• “Manage Project Files” on page 32-10

32-19
32 Projects

Componentize Large Projects


MATLAB supports large-scale project componentization by allowing you to reference other projects
from a parent project. Organizing large projects into components facilitates code reuse, modular and
team-based development, unit testing, and independent release of components.

Projects can reference multiple other projects in a hierarchical manner. The project reference
hierarchy appears as a tree in the References view.

From a parent project, you can

• Access the project paths, entry-point shortcuts, and source control information for all referenced
projects.
• View, edit, and run files that belong to a referenced project.
• Detect changes in referenced projects using checkpoints.

Add or Remove Reference to a Project


You can add new components to a project by referencing other projects.

To add a reference to a project:

1
On the Project tab, in the Environment section, click References. The Add Reference
dialog box opens.
2 Browse to select the required project (.prj) file.
3 In the Reference type field, select either Relative or Absolute. Select Relative if your project
hierarchy has a well-defined root relative to your project root. For example, your project root
might be a folder under source control. Select Absolute if the project you want to reference is in
a location accessible to your computer, for example, a network drive.
4 To create a checkpoint when you add the project, select Set a checkpoint to detect future
changes. For more information about checkpoints, see “Manage Changes in Referenced Project
Using Checkpoints” on page 32-21.
5 Click Add.

When the referenced project loads, MATLAB adds the referenced project path to the MATLAB search
path and then runs or loads specified startup files. Similarly, when the referenced project closes,
MATLAB removes the project path from the search path and runs specified shutdown files. MATLAB
loads referenced projects before their parent projects. This allows the parent project to access the
referenced project in startup and shutdown files.

To remove a referenced project from your project hierarchy, in the References tree, right-click the
referenced project and select Remove Reference.

View, Edit, or Run Referenced Project Files


If you have a project that references other projects, you can view, modify, or run the files that belong
to the referenced projects directly from the parent project.

32-20
Componentize Large Projects

To view a referenced project, in the parent project, select the References view. In the References
tree, select a referenced project.

To display the referenced project files, at the top right of the References view, click Show Files.

To modify or run a file, right-click the file and select from the list of available options.

Extract Folder to Create a Referenced Project


You can extract an existing folder in a project to create a referenced project. After extracting a folder,
file and folder contents and shortcuts in the referenced project remain accessible from the parent
project.

To extract a folder from a project and convert the folder into a referenced project:

1 In the Files view, right-click the folder and select Extract to Referenced Project. The Extract
Folder to New Project dialog box opens.
2 Specify a project name and location
3 In the Reference type field, select either Relative or Absolute. Select Relative if you specify
the new project location with reference to the current project root. Select Absolute if you specify
the full path for the new location, which is, for example, on a network drive
4 To disable any of the default content migration actions, click More Options and clear the
corresponding check boxes.
5 Click Extract.
6 In the two Warning dialog boxes that open, click OK.

The selected folder and its contents are removed from the project. On the Project Shortcuts tab, the
Referenced Projects section shows a new shortcut for the referenced project.

Manage Changes in Referenced Project Using Checkpoints


To detect and compare changes in a referenced project, create checkpoints. You then can compare
the referenced project against the checkpoint to detect changes.

By default, MATLAB creates a checkpoint when you add a reference to a project. To create additional
checkpoints:

1 In the parent of the referenced project, select the References view.


2
To create a checkpoint, go to the References tab, and in the Checkpoint section, click
Update. In the Details view, the Checkpoint field displays the timestamp of the latest check
point.

To detect changes in a referenced project, go to the References tab, and in the Checkpoint section,

click Checkpoint Report. The Difference to Checkpoint dialog box displays the files that have
changed on disk since you created the checkpoint.

To remove the checkpoint, in the Checkpoint section of the References tab, click Clear.

32-21
32 Projects

See Also

More About
• “Create Projects” on page 32-2
• “Share Projects” on page 32-23

32-22
Share Projects

Share Projects
You can collaborate with others by packaging and sharing projects. You can also control which files
are included in a shared project by using labels and an export profile. (For more information, see
“Create an Export Profile” on page 32-26.)

This table describes the ways of packaging a project.

Way to Share Projects Procedure


Create an archive to share. You can convert your project to a .mlproj or ZIP archive and
share the archive with collaborators. Sharing an archive is useful
when working with someone who does not have access to a
connected source control tool.

To archive a project:

1 With the project loaded, on the Project tab, click Share >
Archive.
2 If you want to export only a set of specified files, choose an
Export profile. For more information, see “Create an Export
Profile” on page 32-26.
3 If you have referenced projects and want to export the
referenced project files, select Include referenced projects.
4 Click Save As and specify a file path.
5 In the Save as type field, select the archived project file type.
By default, MATLAB archives the project as an .mlproj file.
You can choose to archive the project as a ZIP file.
6 Click Save to create the project archive.

You can now share the archive file the way you would any other
file.

32-23
32 Projects

Way to Share Projects Procedure


Email an .mlproj archive in On Windows systems, you can generate an .mlproj archive and
one step. attach it to an email in one step. Sharing an archive is useful when
working with someone who does not have access to a connected
source control tool.

To email a project as an .mlproj file:

1 With the project loaded, on the Project tab, select Share >
Email.
2 If you want to export only a set of specified files, choose an
Export profile. For more information, see “Create an Export
Profile” on page 32-26.
3 If you have referenced projects and want to export the
referenced project files, select the Include referenced
projects check box.
4 Click Attach to Email. MATLAB opens a new email in your
default email client with the project attached as an .mlproj
file.
5 Edit and send the email.
Create a toolbox to share. You can create a toolbox from your project and share the toolbox
with collaborators.

To create a toolbox from your project:

1 With a project loaded, on the Project tab, select Share >


Toolbox.

The packager adds all project files to the toolbox and opens
the Package a Toolbox dialog box.
2 The Toolbox Information fields are populated with the
project name, author, and description. Edit the information as
needed.
3 To include files not already included in the project files, edit
the excluded files and folders.
4 Click Package.

You can now share the toolbox file the way you would any other
file.

32-24
Share Projects

Way to Share Projects Procedure


®
Publish on GitHub . You can share a project by making it publicly available on GitHub.
You must first have a GitHub account.

Sharing a project on GitHub adds Git source control to the project.


If your project is already under source control, sharing replaces
the source control configuration with Git, and GitHub becomes the
project's remote repository.

Note If you do not want to change your current source control in


the open project, share the project in another way.

To share a project on GitHub:

1 With a project loaded, on the Project tab, select Share >


GitHub. The Create GitHub Repository dialog box opens.

If GitHub is not an option in the Share menu, select Share >


Change Share Options. Then, in the Manage Sharing dialog
box, select GitHub and click Close.
2 Enter your GitHub user name and personal access token, and
edit the name for the new repository. Click Create.

A warning prompts you to confirm that you want to create a


public repository and modify the current project’s remote
repository location. To continue, click Yes.
3 The Create GitHub Repository dialog box displays the URL for
the new repository. Click the link to view the new repository
on the GitHub website. The repository contains the initial
check-in of your project files.
4 The source control in your current project now references the
new repository on GitHub as the remote repository. To use the
project with the new repository, in the Create GitHub
Repository dialog box, click Reload Project.

To view the URL for the remote repository, on the Project tab, in
the Source Control section, click the Git Details button.

You can use Git without any additional installation. To perform


merging operations in Git, additional setup steps are required. For
more information, see “Set Up Git Source Control” on page 33-
23.
Collaborate using source You can collaborate using source control within projects. For more
control. information, see “Use Source Control with Projects” on page 32-
45.

Before sharing a project with others, it can be useful to examine the required toolboxes for your
project by performing a dependency analysis. For more information, see “Find Required Products and
Toolboxes” on page 32-39.

32-25
32 Projects

Create an Export Profile


If you want to exclude files from a project before sharing it, create an export profile. An export profile
allows you to exclude files with particular labels. For more information about creating labels and
adding them to project files, see “Create Labels” on page 32-17.

To create an export profile:

1 On the Project tab, click Share > Manage Export Profiles.


2 Click + and specify a name for the export profile.
3 In the Files pane, click + and select the labels for the files you do not want to export, and then
click OK.
4 In the Labels pane click + and select the custom labels you do not want to export, and then click
OK.
5 Click Apply and close the Manage Export Profiles dialog box.

Note Export profiles do not apply changes to referenced projects. When you share your project,
MATLAB exports the entire referenced projects.

See Also

More About
• “Add Labels to Project Files” on page 32-16
• “Create Projects” on page 32-2
• “Analyze Project Dependencies” on page 32-30

32-26
Upgrade Projects

Upgrade Projects
The Upgrade Project tool helps you check for compatibility issues or upgrade your project to the
current MATLAB release. The tool applies fixes automatically when possible and produces a report.

Tip To perform an upgrade that you can later revert if necessary, add source control to your project
before upgrading. For more information, see “Use Source Control with Projects” on page 32-45.

Run Upgrade Project Tool


• For projects that contain only MATLAB files, you can check for compatibility issues with the
current MATLAB release. On the Project tab, click Run Checks > Upgrade.

Click Upgrade to check for compatibility issues.


• For projects that also contain Simulink models and libraries, you can apply fixes and automatically
upgrade your project to the current release. On the Project tab, click Run Checks > Upgrade.

If you want to run the Project Upgrade tool without applying fixes automatically, clear Apply
upgrades automatically.

If you want to specify which files to upgrade and which checks to run, click Change Options. In
the Upgrade Options dialog box, clear the check box for any file or check that you want to exclude
from the upgrade. For example, you might want to exclude checks that require performing an
update diagram, as this can be time consuming.

32-27
32 Projects

The Upgrade Project tool displays the results of the compatibility check or upgrade in the Upgrade
Project Report.

Examine Upgrade Project Report


After upgrading a project, examine the Upgrade Project Report to ensure that the upgrade occurred
as planned.

The summary shows how many files passed all of the upgrade checks and how many files require
attention. To view the upgrade results for a file, select the file in the left file list. By default, the file
list shows any files that need attention. To change which files are shown, select from the options in
the Show drop-down.

For each file in the Project Upgrade Report, examine the checks marked as needing attention. These
files are marked with an orange circle icon in the Result column. Select a check in the Check Name
column to display the check results and any automatically applied fixes in the lower panel.

32-28
Upgrade Projects

To see the differences before and after the upgrade, in the Upgrade Project Report, click View
Changes. If your project is under source control, you also can see the differences by comparing the
before and after versions of the file.

MATLAB saves an HTML report of the upgrade results in the project root folder. To open the saved
report, click the Report link at the top of the Upgrade Project Report.

See Also

More About
• “Use Source Control with Projects” on page 32-45
• “Analyze Project Dependencies” on page 32-30

32-29
32 Projects

Analyze Project Dependencies


Use the Dependency Analyzer to perform a dependency analysis on your project. You can run a
dependency analysis at any point in your workflow. In a collaborative environment, you typically
check dependencies:

• When you set up or explore a project for the first time


• When you run tests to validate changes to your design
• Before you submit a version of your project to source control
• Before you share or package your project

To explore a project and visualize its structure using different views, see “Explore the Dependency
Graph, Views, and Filters” on page 32-32.

To find and fix problems in your project, see “Investigate and Resolve Problems” on page 32-37.

To assess how a change will affect other project files, see “Find File Dependencies” on page 32-40.

To find toolboxes and products required by your project to run properly, see “Find Required Products
and Toolboxes” on page 32-39.

Run a Dependency Analysis


Before running a dependency analysis on a project, make sure that you have added all your files to
the project. For more information, see “Add Files to Project” on page 32-5.

To start analyzing your project, on the Project tab, in the Tools section, click Dependency
Analyzer. Alternatively, in the project Views pane, select Dependency Analyzer and click Analyze.

To analyze the dependencies of specific files, in the dependency graph, select the files. In the Impact
Analysis section, click All Dependencies or use the context menu and select Find All
Dependencies.

To analyze the dependencies inside external toolboxes, select Analyze > External Toolboxes. For
more details about available options, see “Analysis Scope” (Simulink).

You can also check dependencies directly in Project. In the Project Files view, right-click the project
files you want to analyze and select Find Dependencies.

32-30
Analyze Project Dependencies

The dependency graph shows:

• Your project structure and its file dependencies, including how files such as models, libraries,
functions, data files, source files, and derived files relate to each other.
• Required products and toolboxes.
• Relationships between source and derived files (such as .m and .p files, .slx and .slxp, .ssc
and .sscp, or .c and .mex files), and between C/C++ source and header files. You can see what
code is generated by each model, and find what code needs to be regenerated if you modify a
model.
• Warnings about problem files, such as missing files, files not in the project, files with unsaved
changes, and out-of-date derived files.

You can examine project dependencies and problem files using the File List. In the toolstrip, click
File List.

After you run the first dependency analysis of your project, subsequent analyses incrementally update
the results. The Dependency Analyzer determines which files changed since the last analysis and
updates the dependency data for those files. However, if you update external toolboxes or installed
products and want to discover dependency changes in them, you must perform a complete analysis.
To perform a complete analysis, in the Dependency Analyzer, click Analyze > Reanalyze All.

32-31
32 Projects

For more information about running a dependency analysis on Simulink models and libraries, see
“Perform an Impact Analysis” (Simulink).

Explore the Dependency Graph, Views, and Filters


The dependency graph displays your project structure, dependencies, and how files relate to each
other. Each item in the graph represents a file and each arrow represents a dependency. For more
details, see “Investigate Dependency Between Two Files” on page 32-32.

By default, the dependency graph shows all files required by your project. To help you investigate
dependencies or a specific problem, you can simplify the graph using one of the following filters:

• Use the filtered Views to color the files in the graph by type, class, source control status, and
label. See “Color Files by Type, Status, or Label” on page 32-33.
• Use the check boxes in the Legend pane to filter out a group of files.
• Use the Impact Analysis tools to simplify the graph. See “Find File Dependencies” on page 32-
40.

Select, Pan, and Zoom

• To select an item in the graph, click it.

To select multiple files, press Shift and click the files.

To clear all selection, click the graph background.


• To open a file, double-click it.
• To pan the dependency graph, hold the Space key, click and drag the mouse. Alternatively, press
and hold the mouse wheel and drag.

For large graphs, navigate using the Overview pane.


• To zoom in and out, in the Navigate section, click Zoom In and Zoom Out. Alternatively, use the
mouse wheel.
• To center and fit the dependency graph to view, in the Navigate section, click Fit to View.
Alternatively, press the Space bar.

Investigate Dependency Between Two Files

To see more information about how two files are related, select their dependency arrow. In the
Properties pane, in the Details section, you can see the full paths of the files you are examining, the
dependency type (such as function call, inheritance, and property type), and where the dependency is
introduced.

To open the file and highlight where the dependency is introduced, in the Details section, click the
link under Impacted.

32-32
Analyze Project Dependencies

Color Files by Type, Status, or Label

Explore the different views in the Views section of the Dependency Analyzer toolstrip to explore your
project files dependencies.

• The MATLAB Files view shows only MATLAB files (such as .m, .mlx, .p, .mlapp, .fig, .mat,
and .mex) in the view and colors them by type.

• The Class Hierarchy view shows the class inheritance graph and colors the files by type (class,
enumeration class, or abstract class). If the class is not on the search path, the Dependency
Analyzer cannot determine the class type.

32-33
32 Projects

• The Classification view shows all files in the graph and colors them by file label (such as test,
design, and artifact).

Use the classification view to identify which tests you need to run to validate the changes in your
design. For more information, see “Identify Tests to Run” on page 32-41.

32-34
Analyze Project Dependencies

• The Source Control view shows all files in the graph and colors them by source control status.
This view is only enabled if your project is under source control.

Use the source control view to find modified files in your project and to examine the impact of
these changes on the rest of the project files. For more information, see “Investigate Impact of
Modified Files” on page 32-41.

32-35
32 Projects

• Restore to Default clears all filters.

This is equivalent to manually removing all of the filters. Filters appear at the top of the graph. For
example, if you have the Source Control view selected, you can remove it by clicking

Apply and Clear Filters

In large projects, when investigating problems or dependencies, use the different filters to show only
the files you want to investigate:

• To filter out a subgroup of files from the graph, such as files labeled test or modified files, use the
check boxes in the Legend pane. To remove the legend filter, click the Legend Filter

.
• To color the files in the graph by type, class, label, or source control status, use the Views. To
remove the view filter, click View: viewName at the top of the graph . For example, if you have the

Source Control view selected, you can remove it by clicking .


• To show only the dependencies of a specific file, select the file and, in the Impact Analysis
section, click All Dependencies. The graph shows the selected file and all its dependencies. To

32-36
Analyze Project Dependencies

reset the graph to show all project dependencies, remove the filter at the top of the graph. For
example, if you filtered by all dependencies of [Link], to remove the filter click

.
• To clear all filters and restore the graph to show all analyzed dependencies in the project, click
Restore to Default. Alternatively, manually remove all filters at the top of the graph.

Investigate and Resolve Problems


When you run a dependency analysis, the Dependency Analyzer identifies problems, such as missing
files, files not in the project, unsaved changes, and out-of-date derived files. You can examine problem
files using the dependency graph or the file list. When no file is selected, the Properties pane on the
right shows the toolbox dependencies and a list of problems for the entire project.

Use the graph to investigate problem files graphically.

1 In the Properties pane, in the Problems section, point to a problem, such as Not in project,
and click the magnifying glass icon . The graph highlights the files with this specific problem.

To go through these files, use the arrows in the search box (e.g., Problem: Not in project).

To undo the highlighting, close the search box.

32-37
32 Projects

2 To see more information about a specific problem file, select the file in the graph. In the
Properties pane, in the Problems section, you can see details including the path, type, and the
problems for this file.

For example, if a file is Not in project, right-click the problem file in the graph and select
Add to Project.
3 Investigate the next problem listed in the Problems section. Repeat the steps until you resolve
all problems. For more details on how to fix problems, see “Resolve Problems” on page 32-38.

To update the graph and the Problems list, click Analyze.

Tip For large projects, viewing the results in a list can make navigation easier.

For large projects, use the File List to investigate your project problem files.

1 In the Dependency Analyzer toolstrip, click File List.


2 In the Properties pane, in the Problems section, point to a problem, such as Not in project,
and click the magnifying glass icon .

The File List shows only files with the specific problem. Select all the files in the list and use the
context menu to Add to Project.
3 Investigate the next problem listed in the Problems section, for example Missing file. Repeat
the steps until you resolve all problems.

To update the graph and the Problems list, click Analyze.

Resolve Problems

For each problem file, take actions to resolve the problem. This table lists common problems and
describes how to fix them.

Problem Description Fix


Message
Not in project The file is not in the project. Right-click the problem file in the
graph and select Add to Project.

To remove a file from the problem list


without adding it to the project, right-
click the file and select Hide
Warnings.
Missing file The file is in the project but does not Create the file or recover it using
exist on disk. source control.

32-38
Analyze Project Dependencies

Problem Description Fix


Message
The file or variable cannot be found. If this status is acceptable, right-click
the file and select Hide Warnings.

Depending on the way you call an


object method, the Dependency
Analyzer might confuse a method with
a function and report a missing
dependency. See “Analysis Limitations”
(Simulink).
Outside project The file is outside the project root If this status is acceptable, right-click
root folder. the file and select Hide Warnings.
Otherwise, move it under the project
root.

If required files are outside your


project root, you cannot add these files
to your project. This dependency might
not indicate a problem if the file is on
your path and is a utility or resource
that is not part of your project. Use
dependency analysis to ensure that you
understand the design dependencies.
Unsaved changes The file has unsaved changes in the Save the file.
Simulink editor.
Derived file out of The derived file is older than the source Regenerate the derived file. If it is a .p
date file it was derived from. file, you can regenerate it automatically
by running the project checks. In
MATLAB, on the Project tab, select
Run Checks > Check Project and
follow the prompts to rebuild the files.

If you rename a source file, the project


detects the impact to the derived file
and prompts you to update it.
Product not The project has a dependency on a Install the missing product.
installed missing product.

Find Required Products and Toolboxes


After running a dependency analysis on a project, the graph shows the required toolboxes for the
whole project or for selected files. You can see which products are required to use the project or find
which file is introducing a product dependency.

In the Dependency Analyzer, in the Properties pane, the Product section displays the required
products for the whole project. To view products required by a specific file, select a file by clicking
the graph.

32-39
32 Projects

To find which file is introducing a product dependency, point to the product name and click the
magnifying glass icon . The graph highlights the files that use the selected product.

To go through these files, use the arrows in the search box (e.g., Files using "productName").

To undo the highlighting, close the search box.

To undo the highlighting, close the search box.

To investigate further, you can list the files that use a product and examine where in these files the
dependency is introduced. In the Products section, in the Properties pane, point to product and

click the search folder icon .

If a required product is missing, the products list labels it as missing. The product is also listed in the
Problems section as productName not installed. To resolve a missing product, install the product
and rerun the dependency analysis.

Find File Dependencies


To investigate the dependencies of a file after running a dependency analysis, in the dependency
graph, select a file.

• In the Impact Analysis section, click All Dependencies. The graph shows the selected file and
all its dependencies.
• To show only files needed by the selected file to run properly, click Required.
• To show only files impacted by a potential change to the selected file, click Impacted.

32-40
Analyze Project Dependencies

Finding these dependencies can help you identify the impact of a change and identify the tests you
need to run to validate your design before committing the changes.

To investigate the dependencies of multiple files, click files while holding the Shift key. The Impact
Analysis section displays how many files are selected.

To reset the graph, click the filter at the top of the graph. For example, if you had filtered by files

impacted by [Link], click .

Investigate Impact of Modified Files

To examine the impact of the changes you made on the rest of the project files, perform an impact
analysis on the modified files in your project.

1 In the Views section, select the Source Control view. The graph colors the files by their source
control status. The modified files are in light blue.
2 Select all the modified files in the graph.

Tip If you changed a large number of files, use the file list to select all files instead.

In the Dependency Analyzer toolstrip, click File List. Point to Type and click the arrow to sort
the list by the source control status. Select all the modified files.

3 In the Impact Analysis section, click Impacted. Alternatively, use the context menu and select
Find Impacted.

Identify Tests to Run

To identify the tests you need to run to validate your design before committing the changes, use the
Classification view when you perform an impact analysis on the file you changed.

32-41
32 Projects

1 In the Views section, select the Classification view. The graph colors the files by their project
label.
2 Select the file you changed, for example timesTableGame.m.
3 In the Impact Analysis section, click Impacted. Alternatively, use the context menu and select
Find Impacted.

The example graph shows three tests you need to run to qualify the change made to
timesTableGame.m.

Export Dependency Analysis Results


To export all the files displayed in the dependency graph, click the graph background to clear the
selection on all files. In the Dependency Analyzer toolstrip, in the Export section, click Export. Select
from the available options:

• Export to Workspace — Save file paths to a variable in the workspace.


• Generate Dependency Report — Save dependency analysis results in a printable report (HTML,
Word, or PDF).
• Package As Archive — Export files in the graph as an archive.
• Save As GraphML — Save dependency analysis results as a GraphML file.

Tip You can compare different analysis results without having to repeat the analysis. To compare
previously saved graphs, in MATLAB, in the Current Folder, right-click two GraphML files and
select Compare Selected Files/Folders.

To export a subset of files in the graph, select the files, then click Export.

• Use the Legend check boxes, the filtered Views, or the Impact Analysis tools to simplify the
graph.
• To select multiple files, press Shift and select the files.
• To select all files in the filtered graph, press Ctrl+A.

32-42
Analyze Project Dependencies

The menu displays how many files are selected. The Dependency Analyzer exports only the selected
files.

Note When you use Package As Archive, the Dependency Analyzer includes the selected files and
all their dependencies in the archive.

Send Files to Project Tools

You can send files to other Project tools using the Project menu. The Dependency Analyzer exports
only the selected files in the current filtered view.

Select the desired files. In the Dependency Analyzer toolstrip, in the Export section, click Project.
Select from the available options:

• Show in Project — Switch to the project Files view with the files selected.
• Send to Custom Task — Run a project custom task on the selected files.

See Also

More About
• “Share Projects” on page 32-23
• “Use Source Control with Projects” on page 32-45

32-43
32 Projects

Clone from Git Repository


To create a new project from an existing repository:

1 On the Home tab, click New > Project > From Git. The New Project From Source Control
dialog box opens.
2 Enter your HTTPS repository path into the Repository path field.
3 In the Sandbox field, select the working folder where you want to put the retrieved files for your
new project.
4 Click Retrieve.

If an authentication dialog box for your repository appears, enter the login information for your
Git repository account -- for instance, your GitHub user name and password.

If your repository already contains a project, the project is ready when the tool finishes retrieving
files to your selected sandbox folder.

If your sandbox does not yet contain a project, then a dialog box asks whether you want to create
a project in the folder. To create a project, specify a project name and click OK. The Welcome
screen appears to help you set up your new project. For more information about setting up a
project, see “Set up Project” on page 32-3.

You can now add, delete, and modify your project files. For details on how to commit and push the
modified project files, see “Commit Modified Project Files” on page 32-51.

Tip Alternatively, to prevent frequent login prompts when you interact with your remote repository,
you can clone a remote repository using SSH instead of HTTPS. To avoid problems connecting using
SSH, set the HOME environment variable and use it to store your SSH keys. For more information, see
“Use SSH Authentication with MATLAB” on page 33-23.

If you encounter errors like OutOfMemoryError: Java heap space when cloning large Git
repositories, edit your MATLAB preferences to increase the heap size.

1 On the Home tab, in the Environment section, click Preferences.


2 Select MATLAB > General > Java Heap Memory.
3 Move the slider to increase the heap size, and then click OK.
4 Restart MATLAB.

See Also

Related Examples
• “Use SSH Authentication with MATLAB” on page 33-23
• “Commit Modified Project Files” on page 32-51

32-44
Use Source Control with Projects

Use Source Control with Projects


You can use projects to work with files under source control. Source control stores files in a
repository, lets you check files out of the repository to work on and back into it to preserve changes,
and lets you see the history of the different versions of files that have been checked in. For more
information about using source control in MathWorks products, see “About MathWorks Source
Control Integration” on page 33-2.

Projects integrate with two source control systems, Git and Subversion (SVN).

To set up a project with source control, use any of these workflows:

• Create a new project from an existing repository.


• Add an existing project to source control.
• Create a new project in a folder already under source control.
• Create a new GitHub repository for a new or an existing project.

Then, when your project is under source control, you can perform operations from within MATLAB
such as checking files in and out, running checks, and committing and reverting changes.

Setup Source Control


There are four ways to set up a project with source control.

Create New Project from Existing Repository

Create a new local copy of a project from an existing repository by retrieving files from source
control. You can clone a Git repository, or check out files from an SVN repository, or use another
source control integration.

To create a new project from an existing repository:

1 On the Home tab, click New > Project > From Git or New > Project > From SVN. The New
Project From Source Control dialog box opens.
2 If you know your repository location, paste it into the Repository path field.

Otherwise, to browse for and validate the repository path to retrieve files from, click Change.

a In the dialog box, specify the repository URL by entering or pasting a URL into the field, by

selecting from the list of recent repositories, or by clicking the button.


b Click Validate to check the repository path. If the path is invalid, check the URL against
your source control repository browser.
c If you see an authentication dialog box for your repository, enter login information to
continue.
d If necessary, select a deeper folder in the repository tree. With SVN, you might want to check
out from trunk or a branch folder under tags.
e When you have finished specifying the URL path you want to retrieve, click OK. The dialog
box closes and you return to the New Project From Source Control dialog box.
3 In the Sandbox field, select the working folder where you want to put the retrieved files for your
new project. With SVN, use a local folder for best results, because using a network folder is slow.

32-45
32 Projects

4 Click Retrieve.

If your repository already contains a project, the project is ready when the tool finishes retrieving
files to your selected sandbox folder.

If your sandbox does not yet contain a project, then a dialog box asks whether you want to create
a project in the folder. To create a project, specify a project name and click OK. The Welcome
screen appears to help you set up your new project. For more information about setting up a
project, see “Set up Project” on page 32-3.

If you encounter errors like OutOfMemoryError: Java heap space when cloning large Git
repositories, edit your MATLAB preferences to increase the heap size.

1 On the Home tab, in the Environment section, click Preferences.


2 Select MATLAB > General > Java Heap Memory.
3 Move the slider to increase the heap size, and then click OK.
4 Restart MATLAB.

Add Existing Project to Source Control

If you have an existing project, you can add it to Git or SVN source control.

To add a project to source control:

1 On the Project tab, in the Source Control section, click Use Source Control. The Source
Control Information dialog box opens.
2 Click the Add Project to Source Control button. The Add to Source Control dialog box opens.
3 In the Source control tool list, select the right tool for your repository. If you choose Git, then
skip step 4 and go straight to step 5.
4 If you are using an SVN remote repository, click the Change button to select an existing
repository or create a new one.


To specify an existing repository, click the button to browse for your repository, paste a
URL into the field, or use the list to select a recent repository.

To create a new repository, click the button. For more information about creating a new
repository, see “Create New Repository” on page 33-5.

Click Validate to check the path to the selected repository, and then click OK.
5 Click Convert to finish adding the project to source control.

The project runs integrity checks.


6 After the integrity checks run, click Open Project to return to your project.

The project displays details of the current source control tool and the repository location.
7 If you created a new repository, select the Files > Modified view and click Commit to commit
the first version of your files to the new repository. In the dialog box, enter a comment if you
want, and click Submit.

If you want to merge branches with Git, you need to follow additional setup steps. For more
information, see “Set Up Git Source Control” on page 33-23.

32-46
Use Source Control with Projects

If you want to use a version of SVN other than the built-in version, see “Set Up SVN Source Control”
on page 33-14.

Create New Project in Folder Already Under Source Control

If you create a new project from a folder that is already under source control, MATLAB can
automatically add the new project to source control. After creating the project, click the Detect
button. For more information about creating a project from a folder, see “Create Projects” on page
32-2.

Create New GitHub Repository

Creating a GitHub repository adds Git source control to your new or existing project. The GitHub
repository you create becomes the project remote repository. To create a GitHub repository, you must
have a GitHub account.

To create a blank project and a GitHub remote repository:

1 On the Home tab, click New > Project > From Git.
2 Select New > GitHub Repository. In the GitHub dialog box, enter your User name and
Password. Fill the Repository name and Description fields and click Create.

MATLAB creates a new public GitHub repository and populates the Repository path field with
information in the [Link] format.
3 In the Sandbox field, specify the location for your sandbox. The selected folder must be empty.
Click Retrieve to create the sandbox.

To confirm the project name and creation, click OK.

After creating the GitHub repository and sandbox, add your files to the sandbox. See “Mark Files for
Addition to Source Control” on page 33-8. Commit the first version of your files to your local
repository, then push all modifications to your remote GitHub repository.

Tip If you want to create a remote GitHub repository for an existing project, share your project to
GitHub instead.

With your project loaded, on the Project tab, select Share > GitHub. For detailed instructions, see
Publish on GitHub in “Share Projects” on page 32-23.

Perform Source Control Operations


Retrieve Versions and Checkout Project Files

This table shows how to check for modified project files, update revisions, get and manage file locks,
and tag project files.

32-47
32 Projects

Action Procedure
Refresh status of project files. To check for locally modified files, on the Project tab, in the
Source Control section, click Refresh. Refreshing queries the
local sandbox state and checks for changes made with another tool
outside of MATLAB.

For more information, see “Update SVN File Status and Revision”
on page 33-21 or “Update Git File Status and Revision” on page
33-29.
Check for modifications in To find out if there is a new version of the project in the repository,
project files. in the Files view, right-click the file and select Source Control >
Check for Modifications.

With SVN, this option contacts the repository to check for external
modifications. The project compares the revision numbers of the
local file and the repository version. If the revision number in the
repository is larger than that in the local sandbox folder, then the
project displays (not latest) next to the revision number of the local
file.
Update all project files. Using SVN, to get the latest changes of all project files, go to the
Project tab, and in the Source Control section, click Update. The
project displays a dialog box listing all the files that have changed
on disk. You can control this behavior using the project preference
Show changes on source control update. For more information,
see “Update SVN File Status and Revision” on page 33-21.

Using Git, to get the latest changes for all project files from a
source control repository and merge them into your current
branch, go to the Project tab, and in the Source Control section,
click Pull. To get changes and merge manually, on the Project tab,
in the Source Control section, click Fetch. This updates all of the
origin branches in the local repository. When you click Fetch, your
sandbox files are not changed. To see the changes from others,
merge in the origin changes to your local branches. For more
information, see “Pull, Push and Fetch Files with Git” on page 33-
34.
Update revision for selected To update a selected set of files, in the Files view, right-click the
project files. files, and select the Source Control > Update command for the
source control system you are using. For example, if you are using
SVN, select Source Control > Update from SVN to get fresh
local copies of the selected files from the repository.
Clear SVN login information. To clear any stored login credentials, on the Project tab, in the
Source Control section, click Clear Login.

32-48
Use Source Control with Projects

Action Procedure
Get SVN file locks. To get SVN file locks, in the Files view, select the files that you
want to check out. Right-click the selected files and select Source
Control > Get File Lock. A lock symbol appears in the SVN
source control column. Other users do not see the lock symbol in
their sandboxes, but they cannot get a file lock or check in a
change when you have the lock. To view or break locks, on the
Project tab, click Locks.

Get File Lock is only for SVN. Git does not have locks.
Manage SVN repository locks. To manage global SVN locks for a repository, on the Project tab, in
the Source Control section, click Locks. For more information,
see “Get SVN File Locks” on page 33-22.
Tag versions of project files. To identify specific revisions of all project files, on the Project tab,
in the Source Control section, click Tag. Specify the tag text and
click OK. The tag is added to every project file. Errors appear if
you do not have a tags folder in your repository. For more
information, see “Set Up SVN Source Control” on page 33-14.

Review Changes in Project Files

You can review changes in project files using the Files > Modified view. This table shows how to
view the list of modified project files, review the history of a file, and compare two files' revisions.

Action Procedure
View modified project files. In the Files view, select the Modified (number of files) tab. The
Files > Modified view is visible only if you are using source
control with your project.

Tip Use the List layout to view files without needing to expand
folders.

You can identify modified or conflicted folder contents using the


source control summary status. In the Files view, folders display
rolled-up source control status. This makes it easier to locate
changes in files, particularly conflicted files. You can hover over
the source control status (for instance, the Git or SVN column) for
a folder to view a tooltip displaying how many files inside are
modified, conflicted, added, and deleted.
Update modified files list. To update the modified files list, on the Project tab, in the Source
Control section, click Refresh.

32-49
32 Projects

Action Procedure
View revision history. In the Files view, right-click a file and select Source Control >
Show Revisions.

To browse and compare files within committed SVN change sets,


on the Project tab, in the Source Control section, select Show
Log. In the File Revisions dialog box, select a revision to view a list
of modified files. Right-click files in the lower list to view changes
or save revisions.
Compare revisions. In the Files view, right-click a file and select Compare >
Compare to Ancestor to run a comparison against the local
repository (Git) or against the last checked-out version in the
sandbox (SVN). The Comparison Tool displays a report.

To compare other revisions of a file, select Compare > Compare


to Revision.

To view a comparison report, select the revisions you want to


compare and click Compare Selected. Or, select a revision and
click Compare to Local. For more information, see “Compare
Files and Folders and Merge Files”.

Project Definition Files

The files in the resources/project folder are project definition files generated when you first
create or make changes to your project. The project definition files enable you to add project
metadata to files without checking them out. Some examples of metadata you can change this way
are shortcuts, labels, and project descriptions. Project definition files also specify the files added to
your project. These files are not part of the project.

Any changes you make to your project generate changes in the resources/project folder. These
files store the definition of your project in XML files whose format is subject to change.

You do not need to view project definition files directly, except when the source control tool requires a
merge. The files are shown so that you know about all the files being committed to the source control
system.

Starting in R2020b, the default project definition file type is Use multiple project files (fixed-path
length). To change the project definition file management from the type selected when the project
was created, use [Link].
[Link] preserves the source control history of your project.

Warning To avoid merge issues, do not convert the definition file type more than once for a project.

For releases before R2020b, if you want to change the project definition file management from the
type selected when the project was created:

1 On the Home tab, in the Environment section, click Preferences. Select MATLAB > Project
and in the New Projects section, select one of the options under Project definition files:

• Use multiple project files - Helps to avoid merging issues on shared projects

32-50
Use Source Control with Projects

• Use multiple project files (fixed-path length) - Is better if you need to work with long
paths
• Use a single project file (not recommended for source control) - Is faster but is likely to
cause merge issues when two users submit changes in the same project to a source control
tool
2 Create a project archive file (.mlproj). For more information, see “Share Projects” on page 32-
23 or export.
3 Create a new project from the archived project. For more information, see “Create Projects” on
page 32-2.

To stop managing your folder with a project and delete the resources/project folder, see
[Link].

Run Project Checks

To run checks for a project, go to the Project tab and click Run Checks > Check Project. The
project checks for problems with project integrity such as missing files, unsaved files, or files not
under source control. A dialog box reports the results. You can click for details and follow prompts to
fix problems.

If you want to check for required files, click Dependency Analyzer to analyze the dependencies of
the modified files. Use the dependency tools to analyze the structure of your project.

For details on problems the checks can fix, see “Work with Derived Files in Projects” on page 32-54,
and “Analyze Project Dependencies” on page 32-30.

Commit Modified Project Files

After reviewing changes and running project checks, you are ready to commit your modified project
files to source control. This table shows how to commit modified project files.

Action Procedure
Commit all modified files to In the Files view, select the Modified (number of files) tab. On
source control. the Project tab, in the Source Control section, click Commit.
Enter comments in the dialog box, and click Submit. If you are
using Git source control, this commits to your local repository. If
you are using SVN source control, this commits changes to your
repository.

A message appears if you cannot commit because the repository


has moved ahead. Before you can commit the file, you must update
its revision up to the current HEAD revision. If you are using Git
source control, click Pull. If you are using SVN source control,
click Update. Resolve any conflicts before you commit.
Commit selected files to source In the Files view, select the files, right-click, and select Source
control. Control > Commit.

If you commit individual files, you risk not committing the related
project definition files that keep track of your files. To avoid this,
commit all modified files.

32-51
32 Projects

Action Procedure
Push project files with Git. To send local commits to the remote repository, on the Project tab,
in the Source Control section, click Push. A message appears if
you cannot push your changes directly because the repository has
moved on. Click Fetch to fetch all changes from the remote
repository. Merge branches and resolve conflicts, and then you can
push your changes. For more information, see “Pull, Push and
Fetch Files with Git” on page 33-34.
Push empty project folders with You cannot add empty folders to Git source control, so you cannot
Git. click Push and then clone an empty folder. You can create an
empty folder in a project, but if you push changes and then sync a
new sandbox, the empty folder does not appear in the new
sandbox. Instead, run Check Project, which creates the empty
folder for you.

Alternatively, to push empty folders to the repository for other


users to sync, create a gitignore file in the folder and then push
your changes.
Create Git stashes. Git stashes store uncommitted changes for later use. To create a
stash, on the Project tab, in the Source Control section, click
Stashes. The Stashes dialog box opens. Click New Stash to create
a stash containing your currently modified files. For more
information, see “Use Git Stashes” on page 33-35.
Create a branch with Git. To create a branch, on the Project tab, in the Source Control
section, click Branches. The Branches dialog box appears, where
you can view, switch, create, and merge branches.

Select a source for the new branch. Click a node in the Branch
Browser diagram, or enter a unique identifier in the Source text
box. You can enter a tag, branch name, or a unique prefix of the
SHA1 hash (for example, 73c637) to identify a specific commit.
Leave the default values to create a branch from the head of the
current branch. Enter a name in the Branch name text box and
click Create.
Switch, compare, save, and To switch, compare, save, and merge branches, on the Project tab,
merge branches with Git. in the Source Control section, click Branches. The Branches
dialog box appears, where you can view, switch, create, and merge
branches. For more information, see “Branch and Merge with Git”
on page 33-30.

32-52
Use Source Control with Projects

Action Procedure
Resolve conflicts. If you and another user change the same file in different sandboxes
or on different branches, a conflict message appears when you try
to commit your modified files. Extract conflict markers if
necessary, compare the differences causing the conflict, and
resolve the conflict.

Look for conflicted files in the Files > Modified view. Identify
conflicted folder contents using the source control summary
status. Folders display the rolled-up source control status. This
makes it easier to locate changes in files, particularly conflicted
files. You can hover over the source control status for a folder to
view a tooltip displaying how many files inside are modified,
conflicted, added, and deleted.

Tip Use the List layout to view files without needing to expand
folders.

Check the source control status column (Git or SVN) for files with
a red warning symbol, which indicates a conflict. Right-click the
conflicted file and select View Conflicts to compare versions. A
comparison report opens showing the differences between the
conflicted files.

When you have resolved the changes and want to commit the
version in your sandbox, right-click the file and select Source
Control > Mark Conflict Resolved.

For Git, the Branch status in the Git pane changes from
MERGING to SAFE.

Select the Files > Modified view to check changes.

Revert Changes

This table shows how to revert changes in project files. For more information about reverting
changes, see “Revert Changes in Source Control” on page 33-13.

Action Procedure
Revert local changes. To release locks and revert to the version in the last sandbox
update (that is, the last version you synchronized or retrieved from
the repository), in the Files view, right-click the files to revert and
select Source Control > Discard Local Changes and Release
Locks.

To discard local changes when using Git, right-click a file and


select Source Control > Revert Local Changes. To remove all
local changes, click Branches in the Git pane and click Revert to
Head.

32-53
32 Projects

Action Procedure
Revert a file to a specified To revert a file to a specified revision, right-click a file and select
revision Source Control > Revert using SVN or Source Control >
Revert using Git.

In the Revert Files dialog box, choose a revision to revert to. Select
a revision to view information about the change, such as the
author, date, log message. Click Revert.

If you revert a file to an earlier revision and then make changes,


you cannot commit the file until you resolve the conflict with the
repository history.
Revert a project to a specified To revert a project to a specified revision, on the Project tab, in
revision. the Source Control section, click Revert Project. In the Revert
Files dialog box, choose a revision to revert to.

Each revision in the list is a change set of modified files. Select a


revision to view information about the change such as the author,
date, and the log message.

Once you have chosen a revision and are satisfied that the
information is correct, click Revert.

Work with Derived Files in Projects


In general, it is a best practice to omit derived and temporary files from your project or exclude them
from source control. On the Project tab, select Run Checks > Check Project to check for derived
or temporary files. If you add the slprj folder to a project, the project checks advise you to remove
this from the project and offer to make the fix.

It is also a best practice to exclude derived files such as .mex*, the contents of the slprj folder,
sccprj folder, or other code generation folders from source control, because they can cause
problems. For example:

• With a source control system that can do file locking, you can encounter conflicts. If slprj is
under source control and you generate code, most of the files under slprj change and become
locked. Other users cannot generate code because of file permission errors. The slprj folder is
also used for simulation via code generation, so locking these files can have an impact on a team.
The same problems arise with binaries, such as .mex*.
• Deleting slprj is often required. However, deleting slprj causes problems such as “not a
working copy“ errors if the folder is under some source control tools (for example, SVN).
• If you want to check in the generated code as an artifact of the process, it is common to copy some
of the files out of the slprj cache folder and into a separate location that is part of the project.
That way, you can delete the temporary cache folder when you need to. Use the packNGo function
to list the generated code files, and use the project API to add them to the project with
appropriate metadata.
• The slprj folder can contain many small files. This can affect performance with some source
control tools when each of those files is checked to see if it is up-to-date.

32-54
Use Source Control with Projects

Find Project Files With Unsaved Changes


You can check your project for files with unsaved changes. On the Project tab, in the Files section,
click Unsaved Changes.

In the Unsaved Changes dialog box, you can see the project files with unsaved changes. Project only
detects unsaved changes edited in the MATLAB and Simulink editors. Manually examine changes
edited in other tools. If you have referenced projects, files are grouped by project. You can save or
discard all detected changes.

Manage Open Files When Closing a Project


When you close a project, if there are files with unsaved changes, a message prompts you to save or
discard changes. You can see all files with unsaved changes, grouped by project if you have
referenced projects. To avoid losing work, you can save or discard changes by file, by project, or
globally.

To control this behavior, on the Home tab, in the Environment section, click Preferences. Go to
MATLAB > Project and in the Project Shutdown section, select or clear the check box labeled
Check for open project models and close them, unless they are dirty.

See Also

More About
• “About MathWorks Source Control Integration” on page 33-2
• “Set Up Git Source Control” on page 33-23
• “Set Up SVN Source Control” on page 33-14

32-55
32 Projects

Create and Edit Projects Programmatically


This example shows how to use the Project API to create a new project and automate project tasks for
manipulating files. It covers how to create a project from the command line, add files and folders, set
up the project path, define project shortcuts, and create a reference to the new project in another
project. It also shows how to programmatically work with modified files, dependencies, shortcuts, and
labels.

Set up the Example Files

Create a working copy of the Times Table App example project files and open the project. MATLAB®
copies the files to an examples folder so that you can edit them. The project puts the files under Git™
source control. Use currentProject to create a project object from the currently loaded project.
[Link]
mainProject = currentProject;

Examine Project Files

Examine the files in the project.


files = [Link]

files=1×14 object
1×14 ProjectFile array with properties:

Path
Labels
Revision
SourceControlStatus

Use indexing to access files in this list. For example, get file number 10. Each file has properties
describing its path and attached labels.
[Link](10)

ans =
ProjectFile with properties:

Path: "C:\workSpace\examples\TimesTableApp1\tests\tNewTimesTable.m"
Labels: [1×1 [Link]]
Revision: "51316c67b968d45a17e127003a25143577ec011a"
SourceControlStatus: Unmodified

Get Git latest revision of the tenth file.


[Link](10).Revision

ans =
"51316c67b968d45a17e127003a25143577ec011a"

Examine the labels of the tenth file.


[Link](10).Labels

ans =
Label with properties:

32-56
Create and Edit Projects Programmatically

File: "C:\workSpace\examples\TimesTableApp1\tests\tNewTimesTable.m"
DataType: 'none'
Data: []
Name: "Test"
CategoryName: "Classification"

Get a particular file by name.

myfile = findFile(mainProject,"source/[Link]")

myfile =
ProjectFile with properties:

Path: "C:\workSpace\examples\TimesTableApp1\source\[Link]"
Labels: [1×1 [Link]]
Revision: "51316c67b968d45a17e127003a25143577ec011a"
SourceControlStatus: Unmodified

Create New Project

Create the Times Table Game project. This project will store the game logic behind the Times Table
App. The Times Table Game project will be used by the Times Table App project through a project
reference.

Create the project and set the project name.

timesTableGameFolder = fullfile([Link],"refs","TimesTableGame");
timesTableGame = [Link](timesTableGameFolder);
[Link] = "Times Table Game";

Move the Times Table App game logic from the main project folder to the new project folder, and add
it to the Times Table Game project. Then, remove the file from the Times Table App project.

movefile("..\..\source\timesTableGame.m");
addFile(timesTableGame,"timesTableGame.m");

reload(mainProject);
removeFile(mainProject,"source\timesTableGame.m");

Add the Times Table Game project root folder to the Times Table Game project path. This makes the
timesTableGame.m file available when the Times Table App project or any project that references
the Times Table App project is loaded.

reload(timesTableGame);
addPath(timesTableGame,[Link]);

Add a Project Reference

Add the new Times Table Game project to the Times Table App project as a project reference. This
allows the Time Table App project to view, edit, and run files in the Times Table Game project.

reload(mainProject);
addReference(mainProject,timesTableGame);

32-57
32 Projects

Get Modified Files

Get all the modified files in the Times Table App project. Compare this list with the Files > Modified
view in the project. You can see the files for the new Times Table Game project, as well as the
removed and modified files in the Times Table App project.

modifiedfiles = listModifiedFiles(mainProject)

modifiedfiles=1×8 object
1×8 ProjectFile array with properties:

Path
Labels
Revision
SourceControlStatus

Get the second modified file in the list. Observe that the SourceControlStatus property is Added.
The listModifiedFiles function returns any files that are added, modified, conflicted, deleted,
and so on.

modifiedfiles(2)

ans =
ProjectFile with properties:

Path: "C:\workSpace\examples\TimesTableApp1\refs\TimesTableGame\resources\proj
Revision: ""
SourceControlStatus: Added

Refresh the source control status before querying individual files. You do not need to do this before
calling listModifiedFiles.

refreshSourceControl(mainProject)

Get all the project files that are Unmodified. Use the ismember function to get an array of logicals
stating which files in the Times Table App project are unmodified. Use the array to get the list of
unmodified files.

unmodifiedStatus = ismember([[Link]],[Link].U
[Link](unmodifiedStatus)

ans=1×9 object
1×9 ProjectFile array with properties:

Path
Labels
Revision
SourceControlStatus

Get File Dependencies

Run a dependency analysis to update the known dependencies between project files.

updateDependencies(mainProject)

32-58
Create and Edit Projects Programmatically

Get the list of dependencies in the Times Table App project. The Dependencies property contains
the graph of dependencies between project files, stored as a MATLAB digraph object.

g = [Link]

g =
digraph with properties:

Edges: [5×1 table]


Nodes: [9×1 table]

Get the files required by the [Link] file.

requiredFiles = bfsearch(g, which('source/[Link]'))

requiredFiles = 2×1 cell


{'C:\workSpace\examples\TimesTableApp1\source\[Link]' }
{'C:\workSpace\examples\TimesTableApp1\refs\TimesTableGame\timesTableGame.m'}

Get the top-level files of all types in the graph. The indegree function finds all the files that are not
depended on by any other file.

top = [Link](indegree(g)==0)

top = 7×1 cell


{'C:\workSpace\examples\TimesTableApp1\requirements\[Link]'}
{'C:\workSpace\examples\TimesTableApp1\tests\tAnswerIsCorrect.m' }
{'C:\workSpace\examples\TimesTableApp1\tests\tCurrentQuestion.m' }
{'C:\workSpace\examples\TimesTableApp1\tests\tNewTimesTable.m' }
{'C:\workSpace\examples\TimesTableApp1\utilities\editTimesTable.m' }
{'C:\workSpace\examples\TimesTableApp1\utilities\openRequirementsDocument.m' }
{'C:\workSpace\examples\TimesTableApp1\utilities\runTheseTests.m' }

Get the top-level files that have dependencies. The indegree function finds all the files that are not
depended on by any other file, and the outdegree function finds all the files that have dependencies.

top = [Link](indegree(g)==0 & outdegree(g)>0)

top = 4×1 cell


{'C:\workSpace\examples\TimesTableApp1\requirements\[Link]'}
{'C:\workSpace\examples\TimesTableApp1\tests\tAnswerIsCorrect.m' }
{'C:\workSpace\examples\TimesTableApp1\tests\tCurrentQuestion.m' }
{'C:\workSpace\examples\TimesTableApp1\tests\tNewTimesTable.m' }

Find impacted (or "upstream") files by creating a transposed graph. Use the flipedge function to
reverse the direction of the edges in the graph.

transposed = flipedge(g)

transposed =
digraph with properties:

Edges: [5×1 table]


Nodes: [9×1 table]

32-59
32 Projects

impacted = bfsearch(transposed,which('source/[Link]'))

impacted = 2×1 cell


{'C:\workSpace\examples\TimesTableApp1\source\[Link]' }
{'C:\workSpace\examples\TimesTableApp1\requirements\[Link]'}

Get information on the project files, such as the number of dependencies and orphans.
averageNumDependencies = mean(outdegree(g));
numberOfOrphans = sum(indegree(g)+outdegree(g)==0);

Change the sort order of the dependency graph to show project changes from the bottom up.
ordered = [Link](flip(toposort(g)));

Query Shortcuts

You can use shortcuts to save frequent tasks and frequently accessed files, or to automate startup and
shutdown tasks.

Get the Times Table App project shortcuts.


shortcuts = [Link]

shortcuts=1×4 object
1×4 Shortcut array with properties:

Name
Group
File

Examine a shortcut in the list.


shortcuts(2)

ans =
Shortcut with properties:

Name: "Edit Times Table App"


Group: "Launch Points"
File: "C:\workSpace\examples\TimesTableApp1\utilities\editTimesTable.m"

Get the file path of a shortcut.


shortcuts(3).File

ans =
"C:\workSpace\examples\TimesTableApp1\utilities\openRequirementsDocument.m"

Examine all the files in the shortcuts list.


{[Link]}'

ans=4×1 cell array


{["C:\workSpace\examples\TimesTableApp1\source\[Link]" ]}
{["C:\workSpace\examples\TimesTableApp1\utilities\editTimesTable.m" ]}
{["C:\workSpace\examples\TimesTableApp1\utilities\openRequirementsDocument.m"]}

32-60
Create and Edit Projects Programmatically

{["C:\workSpace\examples\TimesTableApp1\utilities\runTheseTests.m" ]}

Label files

Create a new category of labels of type char. In the Times Table App project, the new Engineers
category appears in the Labels pane.

createCategory(mainProject,'Engineers','char')

ans =
Category with properties:

Name: "Engineers"
SingleValued: 0
DataType: "char"
LabelDefinitions: [1×0 [Link]]

Define a new label in the new category.

category = findCategory(mainProject,'Engineers');
createLabel(category,'Bob');

Get the label definition object for the new label.

ld = findLabel(category,'Bob')

ld =
LabelDefinition with properties:

Name: "Bob"
CategoryName: "Engineers"

Attach a label to a project file. If you select the file in the Times Table App project, you can see this
label in the Label Editor pane.

myfile = findFile(mainProject,"source/[Link]");
addLabel(myfile,'Engineers','Bob');

Get a particular label and attach text data to it.

label = findLabel(myfile,'Engineers','Bob');
[Link] = 'Email: [Link]@[Link]'

label =
Label with properties:

File: "C:\workSpace\examples\TimesTableApp1\source\[Link]"
DataType: 'char'
Data: 'Email: [Link]@[Link]'
Name: "Bob"
CategoryName: "Engineers"

Retrieve the label data and store it in a variable.

mydata = [Link]

32-61
32 Projects

mydata =
'Email: [Link]@[Link]'

Create a new label category with data type double, the type MATLAB commonly uses for numeric
data.

createCategory(mainProject,'Assessors','double');
category = findCategory(mainProject,'Assessors');
createLabel(category,'Sam');

Attach the new label to a specified file and assign data value 2 to the label.

myfile = [Link](10);
addLabel(myfile, 'Assessors', 'Sam', 2)

ans =
Label with properties:

File: "C:\workSpace\examples\TimesTableApp1\utilities"
DataType: 'double'
Data: 2
Name: "Sam"
CategoryName: "Assessors"

Close Project

Close the project to run shutdown scripts and check for unsaved files.

close(mainProject)

See Also
currentProject

More About
• “Create Projects” on page 32-2
• “Manage Project Files” on page 32-10
• “Analyze Project Dependencies” on page 32-30

32-62
Explore an Example Project

Explore an Example Project


This example uses the Times Table App example project to explore how project tools can help you
organize your work.

Using the Times Table App example, we will explore how to:

1 Set up and browse some example project files under source control.
2 Examine project shortcuts to access frequently used files and tasks.
3 Analyze dependencies in the project and locate required files that are not yet in the project.
4 Modify some project files, find and review modified files, compare them to an earlier version, and
commit modified files to source control.
5 Explore views of project files only, modified files, and all files under the project root folder.

Setup the Example Files

Create a working copy of the Times Table App example project files and open the project. MATLAB®
copies the files to an examples folder so that you can edit them. The project puts the files under Git™
source control.

[Link]

View, Search, and Sort Project Files

You can view, search, and sort project files by using the Files view.

To view the files in the project, in the Files view, click Project (number of files). When the view
is selected, only the files in your project are shown.

To see all the files in your project folder, click All. This view shows all the files that are under the
project root, not just the files that are in the project. As a result, this view is useful for adding files to
the project.

To view files as a list instead of a tree, in the Layout field at the top right of the Files view, select
List.

There are several ways to find files and folders in projects:

• To search for particular files or file types by name, in any file view, type in the search box or click
the Filter button. For example, in the search field, enter the text timestable. The project
returns all files and folders that contain the word timestable. Click the to clear the search.
• To search the content of files, go to the Project tab and click the Search button. Enter a value in
the search field and click Enter. For example, enter the word tests. The project displays all files
and folders that contain the word tests. Click the to clear the search.

To change how files are grouped or sorted, and to customize the columns, click the actions
button and select from the available options.

Open and Run Frequently Used Files

You can use shortcuts to make files easier to find in a large project. View and run shortcuts on the
Project Shortcuts tab. You can organize the shortcuts into groups.

32-63
32 Projects

The Times Table App project contains several shortcuts, including a shortcut to open the project
requirements, and another to run all the tests in the project. The shortcuts make these tasks easier
for users of the project.

To perform an action, on the Project Shortcuts tab, click the associated shortcut. For example, to
open project requirements, click Documentation > Requirements. To run tests, click Test > Run
All Tests.

To create a new shortcut, select the Files view, right-click a file, and select Create Shortcut.

Add Folder to Project

Create a new folder and add it to the project path. Adding a project folder to the project path ensures
that all users of the project can access the files within it.
1 Select the Files view.
2 Right-click in white space and then select New > Folder. Enter a name for the folder. The folder
is automatically added to the project.
3 Right-click the new folder and select Project Path > Add to the Project Path (Including
Subfolders).

Review Changes in Modified Files

Open files, make changes, and review the changes.


1 Select the Files view. View folders using the tree layout, and then expand the utilities folder.
2 Right-click source/timesTableGame.m and select Open.
3 Make a change in the Editor, such as adding a comment, and save the file.
4 In the Files view, select the Modified (number of files) tab. After editing the file, you see
Modified (2). The file you changed appears in the list.
5 To review changes, right-click source/timesTableGame.m in the Modified files view and
select Compare > Compare to Ancestor. The MATLAB Comparison Tool opens a report
comparing the modified version of the file in your sandbox to its ancestor stored in version
control. The comparison report type can differ depending on the file you select. If you select a
Simulink® model to compare, this command runs a Simulink model comparison.

* Note - When you open the Times Table App example project, the project shows a modified file in the
resources folder. This is a side effect of opening the example project. When editing files in your own
projects, only changes that affect file metadata, such as adding a label to a file, create modified files
in the resources folder.

Analyze Dependencies

To check that all required files are in the project, run a file dependency analysis on the modified files.
1 On the Project tab, click Dependency Analyzer.
2 The dependency graph displays the structure of all analyzed dependencies in the project. The
right pane lists required toolboxes and any problem files. Observe that there are no problems
files listed.

Now, remove one of the required files. Select the project Files view, right click the source/
timesTableGame.m file, and select Remove from Project. Click Remove in the Remove from
Project dialog box.

32-64
Explore an Example Project

The Dependency Analyzer automatically updates the graph and the Problems section in the
Properties pane.

Check again for problems.

1 In the Dependency Analyzer, in the Properties pane, point to the problem message, Not in
project, under Problems and click the magnifying glass . The graph updates to highlight the
problem file, timesTableGame.m.
2 To view the dependencies of the problem file, in the Impact Analysis section, click All
Dependencies.

Now that you have seen the problem, fix it by returning the missing file to the project. Right-click the
file and select Add to Project. The next time you run a dependency analysis, the file does not appear
as a problem file.

After running a dependency analysis, to investigate the dependencies of modified files, perform an
impact analysis.

1 In the Views section, click Source Control. The graph colors the files by source control status.
2 Select the modified files in the graph or in the File List.
3 To view the dependencies of the modified files, in the Impact Analysis section, click All
Dependencies.

Run Project Integrity Checks

To make sure that your changes are ready to commit, check your project. On the Project tab, click
Run Checks to run the project integrity checks. The checks look for missing files, files to add to
source control or retrieve from source control, and other issues. The Checks dialog box offers
automatic fixes to problems found, when possible. When you click a Details button in the Checks
dialog box, you can view recommended actions and decide whether to make the changes.

Commit Modified Files

After you modify files and you are satisfied with the results of the checks, you can commit your
changes to the source control repository.

1 In the Files view, select the Modified (number of files) tab. The files you changed appear in
the list.
2 To commit your changes to source control, on the Project tab, in the Source Control section,
click Commit.
3 Enter a comment for your submission, and click Submit. Watch the messages in the status bar as
the source control commits your changes. In Git, you can have both local and remote
repositories. These instructions commit to the local repository. To commit to the remote
repository, in the Source Control section, click Pull.

View Project and Source Control Information

To view and edit project details, on the Project tab, in the Environment section, click Details. View
and edit project details such as the name, description, project root, startup folder, and location of
folders containing generated files.

32-65
32 Projects

To view details about the source control integration and repository location, on the Project tab, in
the Source Control section, click Git Details. The Times Table App example project uses Git source
control.

Close the Project

Click the at the top right corner of the project window to close the project.

proj = currentProject;
close(proj);

See Also

More About
• “Create Projects” on page 32-2
• “Manage Project Files” on page 32-10
• “Analyze Project Dependencies” on page 32-30

32-66
33

Source Control Interface

The source control interface provides access to your source control system from the MATLAB
desktop.

• “About MathWorks Source Control Integration” on page 33-2


• “Select or Disable Source Control System” on page 33-4
• “Create New Repository” on page 33-5
• “Review Changes in Source Control” on page 33-7
• “Mark Files for Addition to Source Control” on page 33-8
• “Resolve Source Control Conflicts” on page 33-9
• “Commit Modified Files to Source Control” on page 33-12
• “Revert Changes in Source Control” on page 33-13
• “Set Up SVN Source Control” on page 33-14
• “Check Out from SVN Repository” on page 33-19
• “Update SVN File Status and Revision” on page 33-21
• “Get SVN File Locks” on page 33-22
• “Set Up Git Source Control” on page 33-23
• “Add Git Submodules” on page 33-26
• “Retrieve Files from Git Repository” on page 33-28
• “Update Git File Status and Revision” on page 33-29
• “Branch and Merge with Git” on page 33-30
• “Pull, Push and Fetch Files with Git” on page 33-34
• “Move, Rename, or Delete Files Under Source Control” on page 33-37
• “Customize External Source Control to Use MATLAB for Diff and Merge” on page 33-38
• “MSSCCI Source Control Interface” on page 33-43
• “Set Up MSSCCI Source Control” on page 33-44
• “Check Files In and Out from MSSCCI Source Control” on page 33-49
• “Additional MSSCCI Source Control Actions” on page 33-51
• “Access MSSCCI Source Control from Editors” on page 33-57
• “Troubleshoot MSSCCI Source Control Problems” on page 33-58
33 Source Control Interface

About MathWorks Source Control Integration


You can use MATLAB to work with files under source control. You can perform operations such as
update, commit, merge changes, and view revision history directly from the Current Folder browser.

MATLAB integrates with:

• Subversion (SVN)
• Git

To use source control in your project, use any of these workflows:

• Retrieve files from an existing repository. See “Check Out from SVN Repository” on page 33-19
or “Retrieve Files from Git Repository” on page 33-28.
• Add source control to a folder. See “Create New Repository” on page 33-5.
• Add new files in a folder already under source control. See “Mark Files for Addition to Source
Control” on page 33-8.

Additional source control integrations, such as Microsoft Source-Code Control Interface (MSSCCI),
are available for download from the Add-On Explorer. For more information, see “Get and Manage
Add-Ons”.

Classic and Distributed Source Control


This diagram represents the classic source control workflow (for example, using SVN).

Benefits of classic source control:

• Locking and user permissions on a per-file basis (e.g., you can enforce locking of model files)
• Central server, reducing local storage needs
• Simple and easy to learn

This diagram represents the distributed source control workflow (for example, using Git).

33-2
About MathWorks Source Control Integration

Benefits of distributed source control:

• Offline working
• Local repository, which provides full history
• Branching
• Multiple remote repositories, enabling large-scale hierarchical access control

To choose classic or distributed source control, consider these tips.

Classic source control can be helpful if:

• You need file locks.


• You are new to source control.

Distributed source control can be helpful if:

• You need to work offline, commit regularly, and need access to the full repository history.
• You need to branch locally.

33-3
33 Source Control Interface

Select or Disable Source Control System

Select Source Control System


If you are just starting to use source control in MATLAB, select a source control system that is part of
the MathWorks source control integration with the Current Folder browser, such as Subversion or
Git. Doing so enables you to take advantage of the built-in nature of the integration. MathWorks
source control integration is on by default.

1 On the Home tab, in the Environment section, click Preferences.


2 In the preferences dialog box, navigate to the MATLAB > General > Source Control pane.
3 To use the MathWorks source control integration, which is accessible through the Current Folder
browser, select Enable MathWorks source control integration. Use this option for source
control systems such as Subversion and Git. This is the default option, unless you previously set
up source control with MATLAB.

Disable Source Control


When you disable source control, MATLAB does not destroy repository information. For example, it
does not remove the .svn folder. You can put the folder back under source control by enabling the
source control integration again.

1 On the Home tab, in the Environment section, click Preferences.


2 In the Preferences dialog box, in the MATLAB > General > Source Control pane, select None.

33-4
Create New Repository

Create New Repository

Create Git Repository on Your Local System


If you want to add version control to your files without sharing with another user, it is quickest to
create a Git repository and sandbox on your local system. To instead clone an existing remote Git
repository, see “Retrieve Files from Git Repository” on page 33-28.

Note Before using source control, you must register binary files with your source control tools to
avoid corruption. For more information, see “Register Binary Files with Git” on page 33-24.

To create a Git repository and sandbox on your local system:

1 Right-click in the white space (any blank area) of the MATLAB Current Folder browser and select
Source Control > Manage Files. MATLAB opens the Manage Files Using Source Control dialog
box.
2 In the Source control integration list, select Git.
3 Click the Change button. MATLAB opens the Select a Repository dialog box.
4
Click the Create a Git repository on disk ( ) button.
5 Select an empty folder or create a new folder in which you want to create the repository and then
click Select Folder. MATLAB creates the repository, closes the dialog box and returns to the
Select a Repository dialog box.
6 Click Validate to check the path to the new repository, and then click OK. MATLAB closes the
dialog box and returns to the Manage Files Using Source Control dialog box.
7 In the Sandbox field, specify the location for your sandbox. The selected folder must be empty.
8 Click Retrieve to create the sandbox.

After creating the Git repository and sandbox, add your files to the sandbox. Then, commit the first
version of your files to the new repository. For more information, see “Mark Files for Addition to
Source Control” on page 33-8.

You also can change the repository URL after the repository is created. In the Current Folder
browser, in a folder under source control, right-click, and select Source Control > Remote and
specify a new URL.

To use a Git server for the repository on your local system, you can use a Git server hosting solution
or set up your own Apache™ Git server. If you cannot set up a server and must use a remote
repository via the file system using the [Link] protocol, make sure that it is a bare repository with
no checked out working copy.

Create SVN Repository


You also can add version control to your files by creating an SVN repository. To instead check out an
existing SVN repository, see “Check Out from SVN Repository” on page 33-19.

Note

33-5
33 Source Control Interface

• Before using source control, you must register binary files with your source control tools to avoid
corruption. See “Register Binary Files with SVN” on page 33-14.
• Check that the folder you want to use for your SVN sandbox is on a local hard disk. Using a
network folder with SVN is slow and unreliable.

To create an SVN repository:

1 Right-click in the white space (any blank area) of the MATLAB Current Folder browser and select
Source Control > Manage Files. MATLAB opens the Manage Files Using Source Control dialog
box.
2 In the Source control integration list, select SVN.
3 Click the Change button. MATLAB opens the Specify SVN Repository URL dialog box.
4
Click the Create an SVN repository in a folder ( ) button.
5 Select an empty folder or create a new folder in which you want to create the repository and then
click Select Folder.

MATLAB creates the repository in the selected folder, closes the dialog box and returns to the
Specify SVN Repository URL dialog box. The URL of the new repository is in the Repository box,
and the project automatically selects the trunk folder. Specify file:// URLs and create new
repositories for single users only. For multiple users, see “Share a Subversion Repository” on
page 33-18.
6 Click Validate to check the path to the new repository, and then click OK. MATLAB closes the
dialog box and returns to the Manage Files Using Source Control dialog box.

If your SVN repository has a file URL, a warning appears that file URLs are for single users. Click
OK to continue.
7 In the Sandbox field, specify the location for your sandbox. For example, select the folder that
contains the files that you want to add to source control
8 Click Retrieve to create the sandbox.

After creating the SVN repository and sandbox, you can commit the first version of your files to the
new repository. For more information, see “Mark Files for Addition to Source Control” on page 33-
8.

See Also

Related Examples
• “Set Up Git Source Control” on page 33-23
• “Set Up SVN Source Control” on page 33-14
• “Retrieve Files from Git Repository” on page 33-28
• “Check Out from SVN Repository” on page 33-19
• “Commit Modified Files to Source Control” on page 33-12

33-6
Review Changes in Source Control

Review Changes in Source Control


The files under source control that you have changed display the Modified File symbol in the
Current Folder browser. Right-click the file in the Current Folder browser, select Source Control,
and select:

• Show Revisions to open the File Revisions dialog box and browse the history of a file. You can
view information about who previously committed the file, when they committed it, the log
messages, and the list of files in each change set. You can select multiple files and view revision
history for each file.

With SVN, you can select a revision and browse the lower list of files in the change set. Right-click
files to view changes or save revisions.
• Compare to Revision to open a dialog box where you can select the revisions you want to
compare and view a comparison report. You can either:

• Select a revision and click Compare to Local.


• Select two revisions and click Compare Selected.

With SVN, you can select a revision and browse the lower list of files in the change set. Right-click
files to view changes or save revisions.
• Compare to Ancestor to run a comparison with the last checked-out version in the sandbox
(SVN) or against the local repository (Git). The Comparison Tool displays a report.

If you need to update the status of the modified files, see “Update SVN File Status and Revision” on
page 33-21 or “Update Git File Status and Revision” on page 33-29.

See Also

Related Examples
• “Resolve Source Control Conflicts” on page 33-9
• “Commit Modified Files to Source Control” on page 33-12
• “Revert Changes in Source Control” on page 33-13

33-7
33 Source Control Interface

Mark Files for Addition to Source Control


When you create a new file in a folder under source control, the Not Under Source Control symbol
appears in the status column of the Current Folder browser. To add a file to source control, right-click
the file in the Current Folder browser, and select Source Control and then the Add option
appropriate to your source control system. For example, select Add to Git or Add to SVN.

When the file is marked for addition to source control, the symbol changes to Added .

33-8
Resolve Source Control Conflicts

Resolve Source Control Conflicts

Examining and Resolving Conflicts


If you and another user change the same file in different sandboxes or on different branches, a
conflict message appears when you try to commit your modified files. Follow the procedure “Resolve
Conflicts” on page 33-9 to extract conflict markers if necessary, compare the differences causing
the conflict, and resolve the conflict.

To resolve conflicts you can:

• Use the Comparison Tool to merge changes between revisions.


• Decide to overwrite one set of changes with the other.
• Make changes manually by editing files.

For details on using the Comparison Tool to merge changes, see “Merge Text Files” on page 33-10.

After you are satisfied with the file that is marked conflicted, you can mark the conflict resolved and
commit the file.

Resolve Conflicts
1 Look for conflicted files in the Current Folder browser.
2
Check the source control status column (SVN or Git) for files with a red warning symbol ,
which indicates a conflict.
3 Right-click the conflicted file and select Source Control > View Conflicts to compare versions.
4 Examine the conflict. A comparison report opens that shows the differences between the
conflicted files.

With SVN, the comparison shows the differences between the file and the version of the file in
conflict.

With Git, the comparison shows the differences between the file on your branch and the branch
you want to merge into.
5 Use the Comparison Tool report to determine how to resolve the conflict.

You can use the Comparison Tool to merge changes between revisions, as described in “Merge
Text Files” on page 33-10.
6 When you have resolved the changes and want to commit the version in your sandbox, in the
Current Folder browser, right-click the file and select Source Control > Mark Conflict
Resolved.

With Git, the Branch status in the Source Control Details dialog box changes from MERGING to
SAFE.
7 Commit the modified files.

33-9
33 Source Control Interface

Merge Text Files


When comparing text files, you can merge changes from one file to the other. Merging changes is
useful when resolving conflicts between different versions of files.

If you see conflict markers in a text comparison report like this:


<<<<<<< .mine

then extract the conflict markers before merging, as described in “Extract Conflict Markers” on page
33-10.

Tip When comparing a file to another version in source control, by default the right file is the version
in your sandbox and the left file is either a temporary copy of the previous version or another version
causing a conflict (e.g., filename_theirs). You can swap the position of the files, so be sure to
observe the file paths of the left and right file at the top of the comparison report. Merge differences
from the temporary copy to the version in your sandbox to resolve conflicts.

1 In the Comparison Tool report, select a difference in the report and click Merge. The selected
difference is copied from the left file to the right file.

Merged differences display gray row highlighting and a green merge arrow.

The merged file name at the top of the report displays with an asterisk (filename.m*) to show
you that the file contains unsaved changes.
2 Click Save Merged File to save the file in your sandbox. To resolve conflicts, save the merged
file over the conflicted file.
3 If you want to inspect the files in the editor, click the line number links in the report.

Note If you make any further changes in the editor, the comparison report does not update to
reflect changes and report links can become incorrect.
4 When you have resolved the changes mark them as conflict resolved. Right-click the file in the
Current Folder browser and select Source Control > Mark Conflict Resolved.

Extract Conflict Markers


• “What Are Conflict Markers?” on page 33-10
• “Extract Conflict Markers” on page 33-11

What Are Conflict Markers?

Source control tools can insert conflict markers in files that you have not registered as binary (e.g.,
text files). You can use MATLAB to extract the conflict markers and compare the files causing the
conflict. This process helps you to decide how to resolve the conflict.

Caution Register files with source control tools to prevent them from inserting conflict markers and
corrupting files. See “Register Binary Files with SVN” on page 33-14 or “Register Binary Files with

33-10
Resolve Source Control Conflicts

Git” on page 33-24. If your files already contains conflict markers, the MATLAB tools can help you to
resolve the conflict.

Conflict markers have the following form:

<<<<<<<["mine" file descriptor]


["mine" file content]
=======
["theirs" file content]
<<<<<<<["theirs" file descriptor]

If you try to open a file containing conflict markers, the Conflict Markers Found dialog box opens.
Follow the prompts to fix the file by extracting the conflict markers. After you extract the conflict
markers, resolve the conflicts as described in “Examining and Resolving Conflicts” on page 33-9.

To view the conflict markers, in the Conflict Markers Found dialog box, click Load File. Do not try to
load files, because MATLAB does not recognize conflict markers. Instead, click Fix File to extract the
conflict markers.

MATLAB checks only conflicted files for conflict markers.

Extract Conflict Markers

When you open a conflicted file or select View Conflicts, MATLAB checks files for conflict markers
and offers to extract the conflict markers. MATLAB checks only conflicted files for conflict markers.

However, some files that are not marked as conflicted can still contain conflict markers. This can
happen if you or another user marked a conflict resolved without removing the conflict markers and
then committed the file. If you see conflict markers in a file that is not marked conflicted, you can
extract the conflict markers.

1 In the Current Folder browser, right-click the file, and select Source Control > Extract Conflict
Markers to File.
2 In the Extract Conflict Markers to File dialog box, leave the default option to copy “mine” file
version over the conflicted file. Leave the Compare extracted files check box selected. Click
Extract.
3 Use the Comparison Tool report as usual to continue to resolve the conflict.

33-11
33 Source Control Interface

Commit Modified Files to Source Control


Before you commit modified files, review changes and mark any new files for addition into source
control. The files under source control that you can commit to a repository display the Added to
Source Control symbol or the Modified File symbol in the Current Folder browser.

1 Right-click in the Current Folder browser and select Source Control > View and Commit
Changes. In the View and Commit Changes dialog box, select the files to commit to the
repository.
2 Enter comments in the dialog box, and click Commit.
3 A message appears if you cannot commit because the repository has moved ahead. Before you
can commit the file, you must update the revision up to the current HEAD revision.

• If you are using SVN source control, right-click in the Current Folder browser. Select Source
Control > Update All from SVN.
• If you are using Git source control, right-click in the Current Folder browser. Select Source
Control > Pull.

Resolve any conflicts before you commit.

See Also

Related Examples
• “Mark Files for Addition to Source Control” on page 33-8
• “Review Changes in Source Control” on page 33-7
• “Resolve Source Control Conflicts” on page 33-9
• “Update SVN File Status and Revision” on page 33-21
• “Update Git File Status and Revision” on page 33-29
• “Pull, Push and Fetch Files with Git” on page 33-34

33-12
Revert Changes in Source Control

Revert Changes in Source Control

Revert Local Changes


With SVN, if you want to roll back local changes in a file, right-click the file and select Source
Control > Revert Local Changes and Release Locks. This command releases locks and reverts to
the version in the last sandbox update (that is, the last version you synchronized or retrieved from the
repository). If your file is not locked, the menu option is Source Control > Revert Local Changes.
To abandon all local changes, select all the files in the Current Folder browser before you select the
command.

With Git, right-click a file and select Source Control > Revert Local Changes. Git does not have
locks. To remove all local changes, right-click a blank space in the Current Folder browser and select
Source Control > Branches. In the Branches dialog box, click Revert to Head.

Revert a File to a Specified Revision


1 Right-click a file in the Current Folder browser and select Source Control > Revert using SVN
or Revert using Git.
2 In the Revert Files dialog box, choose a revision to revert to. Select a revision to view information
about the change such as the author, date, and log message.
3 Click Revert.

If you revert a file to an earlier revision and then make changes, you cannot commit the file until you
resolve the conflict with the repository history.

See Also

Related Examples
• “Resolve Source Control Conflicts” on page 33-9

33-13
33 Source Control Interface

Set Up SVN Source Control


MATLAB provides built-in SVN integration for use with Subversion (SVN) sandboxes and repositories.
Because the implementation is built in to MATLAB, you do not need to install SVN. The built-in SVN
integration supports secure logins. This integration ignores any existing SVN installation.

SVN Source Control Options


To use the version of SVN provided with MATLAB, when you retrieve a file from source control, select
SVN in the Source control integration list. For instructions, see “Check Out from SVN Repository”
on page 33-19. When you create a new sandbox using the MATLAB built-in SVN integration, the new
sandbox uses the latest version of SVN provided by MATLAB.

Caution Before using source control, you must register binary files with the source control tools to
avoid corruption. See “Register Binary Files with SVN” on page 33-14.

If you need to use a version of SVN other than the built-in version, you can create a repository using
the Command-Line SVN Integration (compatibility mode) Source control integration
option, but you must also install a command-line SVN client.

Command-line SVN integration communicates with any Subversion (SVN) client that supports the
command-line interface. With Command-Line SVN Integration (compatibility mode), if you
try to rename a file or folder to a name that contains an @ character, an error occurs because
command-line SVN treats all characters after the @ symbol as a peg revision value.

Register Binary Files with SVN


If you use third-party source control tools, you must register your MATLAB and Simulink file
extensions such as .mlx, .mat, .fig, .mlapp, .mdl, .slx, .mdlp, .slxp, .sldd, and .p as binary
formats. If you do not register the extensions, these tools can corrupt your files when you submit
them by changing end-of-line characters, expanding tokens, substituting keywords, or attempting to
automerge. Corruption can occur whether you use the source control tools outside of MATLAB or if
you try submitting files from MATLAB without first registering your file formats.

Also check that other file extensions are registered as binary to avoid corruption at check-in. Check
and register files such as MEX-files, .xlsx, .jpg, .pdf, .docx, etc.

You must register binary files if you use any version of SVN, including the built-in SVN integration
provided by MATLAB. If you do not register your extensions as binary, SVN might add annotations to
conflicted MATLAB files and attempt automerge. To avoid this problem when using SVN, register file
extensions.
1 Locate your SVN config file. Look for the file in these locations:

• C:\Users\myusername\AppData\Roaming\Subversion\config or C:\Documents and


Settings\myusername\Application Data\Subversion\config on Windows
• ~/.subversion on Linux or macOS
2 If you do not find a config file, create a new one. See “Create SVN Config File” on page 33-15.
3 If you find an existing config file, you have previously installed SVN. Edit the config file. See
“Update Existing SVN Config File” on page 33-15.

33-14
Set Up SVN Source Control

Create SVN Config File

1 If you do not find an SVN config file, create a text file containing these lines:

[miscellany]
enable-auto-props = yes
[auto-props]
*.mlx = svn:mime-type=application/octet-stream
*.mat = svn:mime-type=application/octet-stream
*.fig = svn:mime-type=application/octet-stream
*.mdl = svn:mime-type=application/octet-stream
*.slx = svn:mime-type= application/octet-stream
*.mlapp = svn:mime-type= application/octet-stream
*.p = svn:mime-type=application/octet-stream
*.mdlp = svn:mime-type=application/octet-stream
*.slxp = svn:mime-type=application/octet-stream
*.sldd = svn:mime-type=application/octet-stream
*.slxc = svn:mime-type=application/octet-stream
*.mlproj = svn:mime-type=application/octet-stream
*.mldatx = svn:mime-type=application/octet-stream
*.slreqx = svn:mime-type=application/octet-stream
*.sfx = svn:mime-type=application/octet-stream
*.sltx = svn:mime-type=application/octet-stream
2 Check for other file types you use that you also need to register as binary to avoid corruption at
check-in. Check for files such as MEX-files
(.mexa64, .mexmaci64, .mexw64), .xlsx, .jpg, .pdf, .docx, etc. Add a line to the config
file for each file type you need. Examples:

*.mexa64 = svn:mime-type=application/octet-stream
*.mexw64 = svn:mime-type=application/octet-stream
*.mexmaci64 = svn:mime-type=application/octet-stream
*.xlsx = svn:mime-type=application/octet-stream
*.docx = svn:mime-type=application/octet-stream
*.pdf = svn:mime-type=application/octet-stream
*.jpg = svn:mime-type=application/octet-stream
*.png = svn:mime-type=application/octet-stream
3 Name the file config and save it in the appropriate location:

• C:\Users\myusername\AppData\Roaming\Subversion\config or C:\Documents and


Settings\myusername\Application Data\Subversion\config on Windows
• ~/.subversion on Linux or macOS.

After you create the SVN config file, SVN treats new files with these extensions as binary. If you
already have binary files in repositories, see “Register Files Already in Repositories” on page 33-16.

Update Existing SVN Config File

If you find an existing config file, you have previously installed SVN. Edit the config file to register
files as binary.

1 Edit the config file in a text editor.


2 Locate the [miscellany] section, and verify the following line enables auto-props with yes:

enable-auto-props = yes

33-15
33 Source Control Interface

Ensure that this line is not commented (that is, that it does not start with #). Config files can
contain example lines that are commented out. If there is a # character at the beginning of the
line, delete it.
3 Locate the [auto-props] section. Ensure that [auto-props] is not commented. If there is a #
character at the beginning, delete it.
4 Add the following lines at the end of the [auto-props] section:

*.mlx = svn:mime-type=application/octet-stream
*.mat = svn:mime-type=application/octet-stream
*.fig = svn:mime-type=application/octet-stream
*.mdl = svn:mime-type=application/octet-stream
*.slx = svn:mime-type= application/octet-stream
*.mlapp = svn:mime-type= application/octet-stream
*.p = svn:mime-type=application/octet-stream
*.mdlp = svn:mime-type=application/octet-stream
*.slxp = svn:mime-type=application/octet-stream
*.sldd = svn:mime-type=application/octet-stream
*.slxc = svn:mime-type=application/octet-stream
*.mlproj = svn:mime-type=application/octet-stream
*.mldatx = svn:mime-type=application/octet-stream
*.slreqx = svn:mime-type=application/octet-stream
*.sfx = svn:mime-type=application/octet-stream
*.sltx = svn:mime-type=application/octet-stream

These lines prevent SVN from adding annotations to MATLAB and Simulink files on conflict and
from automerging.
5 Check for other file types you use that you also need to register as binary to avoid corruption at
check-in. Check for files such as MEX-files
(.mexa64, .mexmaci64, .mexw64), .xlsx, .jpg, .pdf, .docx, etc. Add a line to the config
file for each file type you use. Examples:

*.mexa64 = svn:mime-type=application/octet-stream
*.mexw64 = svn:mime-type=application/octet-stream
*.mexmaci64 = svn:mime-type=application/octet-stream
*.xlsx = svn:mime-type=application/octet-stream
*.docx = svn:mime-type=application/octet-stream
*.pdf = svn:mime-type=application/octet-stream
*.jpg = svn:mime-type=application/octet-stream
*.png = svn:mime-type=application/octet-stream
6 Save the config file.

After you create or update the SVN config file, SVN treats new files as binary. If you already have
files in repositories, register them as described in “Register Files Already in Repositories” on page
33-16.

Register Files Already in Repositories

Caution Changing your SVN config file does not affect files already committed to an SVN
repository. If a file is not registered as binary, use svn propset to manually register the files as
binary.

To manually register a file in a repository as binary, use the following command with command-line
SVN:

33-16
Set Up SVN Source Control

svn propset svn:mime-type application/octet-stream binaryfilename

Standard Repository Structure


Create your repository with the standard tags, trunk, and branches folders, and check out files
from trunk. The Subversion project recommends this structure. See [Link]
subversion/trunk/doc/user/[Link].

If you use MATLAB to create an SVN repository, it creates the standard repository structure. To
enable tagging, the repository must have the standard trunk/ and tags/ folders. After you create a
repository with this structure, you can click Tag in the Source Control context menu to add tags to
all of your files. For more information, see “Tag Versions of Files” on page 33-17.

Tag Versions of Files


With SVN, you can use tags to identify specific revisions of all files. To use tags with SVN, you need
the standard folder structure in your repository and you need to check out your files from trunk. See
“Standard Repository Structure” on page 33-17.

1 Right-click in the Current Folder browser, and select Source Control > Tag.
2 Specify the tag text and click Submit. The tag is added to every file in the folder. Errors appear if
you do not have a tags folder in your repository.

Note You can retrieve a tagged version of your files from source control, but you cannot tag them
again with a new tag. You must check out from trunk to create new tags.

Enforce Locking Files Before Editing


To require that users remember to get a lock on files before editing, configure SVN to make files with
specified extensions read only. When your files are read only, you need to select Right-click in the
Current Folder browser, and select Source Control > Get File Lock before you can edit them. This
setting prevents editing of files without getting the file lock. When the file has a lock, other users
know the file is being edited, and you can avoid merge issues.

To enforce locking files, modify entries in the SVN config file. To locate your SVN config file, see
“Register Binary Files with SVN” on page 33-14.

1 To make files with a .m extension read only, add a property to your SVN config file in the
[auto-props] section. If there is no entry for files with a .m extension, add one with the
needs-lock property.
*.m = svn:needs-lock=yes

If an entry exists, you can combine properties in any order, but multiple entries must be on a
single line separated by semicolons.
2 To make files with a .mlx extension read only, add a property to your SVN config file in the
[auto-props] section. Since you must register files with a .mlx extension as binary, there is an
entry for the file type. Add the needs-lock property to the entry in any order, but on the same
line and separated by a semicolon.
*.mlx = svn:mime-type=application/octet-stream;svn:needs-lock=yes

33-17
33 Source Control Interface

3 Re-create the sandbox for the configuration to take effect.

With this setting, you need to select Get File Lock before you can edit files with a .m extension. See
“Get SVN File Locks” on page 33-22.

Share a Subversion Repository


You can specify a repository location using the file:// protocol. However, Subversion
documentation strongly recommends that only a single user access a repository directly via file://
URLs. See the Web page:
[Link]

Caution Do not allow multiple users to access a repository directly via file:// URLs or you risk
corrupting the repository. Use file:// URLs only for single-user repositories.

Be aware of this caution if you use MATLAB to create a repository. MATLAB uses the file://
protocol. Creating new repositories is provided for local, single-user access only, for testing and
debugging. Accessing a repository via file:// URLs is slower than using a server.

When you want to share a repository, you need to set up a server. You can use svnserve or the
Apache SVN module. See the Web page references:
[Link]
[Link]

See Also

Related Examples
• “Check Out from SVN Repository” on page 33-19

33-18
Check Out from SVN Repository

Check Out from SVN Repository


Create a new local copy of a repository by retrieving files from source control.

1 Right-click in the white space (any blank area) in the Current Folder browser and select Source
Control > Manage Files.
2 In the Manage Files Using Source Control dialog box, select the source control interface from the
Source control integration list. To use SVN, leave the default SVN.
3 If you know your repository location, paste it into the Repository path field.

Otherwise, to browse for and validate the repository path to retrieve files from, click Change.

a In the Specify SVN Repository URL dialog box, specify the repository URL by entering a URL

in the box, using the list of recent repositories, or by using the Repository button .

Caution Use file:// URLs only for single-user repositories. For more information, see
“Share a Subversion Repository” on page 33-18.
b Click Validate to check the repository path.

If you see an authentication dialog box for your repository, enter the login information to
continue.
c If the path is invalid, check the URL against your source control repository browser.

If necessary, select a deeper folder in the repository tree. You might want to check out from
trunk or from a branch folder under tags, if your repository contains tagged versions of
files. You can check out from a branch, but the built-in SVN integration does not support
branch merging. Use an external tool such as TortoiseSVN to perform branch merging.
d When you have finished specifying the URL path you want to retrieve, click OK. The dialog
box closes and you return to the Manage Files Using Source Control dialog box.
4 In the Manage Files Using Source Control dialog box, select the sandbox folder to store the
retrieved files and click Retrieve.

If you see an authentication dialog box for your repository, enter the login information to
continue.

Caution Use local sandbox folders. Using a network folder with SVN slows source control
operations.

The Manage Files Using Source Control dialog box displays messages as it retrieves the files
from source control.

Note To update an existing sandbox from source control, see “Update SVN File Status and Revision”
on page 33-21.

33-19
33 Source Control Interface

Retrieve Tagged Version of Repository


To use tags with SVN, you need the standard folder structure in your repository. For more
information, see “Standard Repository Structure” on page 33-17.

1 Right-click in the white space in the Current Folder browser, and select Source Control >
Manage Files.
2 In the Manage Files Using Source Control dialog box, select the source control interface from the
Source control integration list. To use SVN, leave the default SVN.
3 Click Change to select the repository path that you want to retrieve files from.
4 In the Specify SVN Repository URL dialog box:

a
Select a recent repository from the Repository list, or click the Repository button to
browse for the repository location.
b Click Validate to show the repository browser.
c Expand the tags folder in the repository tree, and select the tag version you want. Navigate
up a level in the repository if the URL contains the trunk.
d Click OK to continue and return to the Manage Files Using Source Control dialog box.
5 Select the sandbox folder to receive the tagged files. You must use an empty sandbox folder or
specify a new folder.
6 Click Retrieve.

See Also

Related Examples
• “Set Up SVN Source Control” on page 33-14
• “Update SVN File Status and Revision” on page 33-21

33-20
Update SVN File Status and Revision

Update SVN File Status and Revision


In this section...
“Refresh Status of Files” on page 33-21
“Update Revisions of Files” on page 33-21

Refresh Status of Files


To refresh the source control status of files, select one or more files in the Current Folder browser,
right-click and select Source Control > Refresh SVN status.

To refresh the status of all files in a folder, right-click the white space of the Current Folder browser
and select Source Control > Refresh SVN status.

Note For SVN, refreshing the source control status does not contact the repository. To get the latest
revisions, see “Update Revisions of Files” on page 33-21.

Update Revisions of Files


To update the local copies of selected files, select one or more files in the Current Folder browser,
right-click and select Source Control > Update Selection from SVN.

To update all files in a folder, right-click the Current Folder browser and select Source Control >
Update All from SVN.

See Also

Related Examples
• “Check Out from SVN Repository” on page 33-19
• “Review Changes in Source Control” on page 33-7

33-21
33 Source Control Interface

Get SVN File Locks


It is good practice to get a file lock before editing a file. The lock tells other users that the file is being
edited, and you can avoid merge issues. When you set up source control, you can configure SVN to
make files with certain extensions read only. Users must get a lock on these read-only files before
editing.

In the Current Folder browser, select the files you want to check out. Right-click the selected files and

select Source Control > Get File Lock. A lock symbol appears in the source control status
column. Other users cannot see the lock symbol in their sandboxes, but they cannot get a file lock or
check in a change when you have the lock. To view or break locks, right-click in the Current Folder
browser and select Source Control > Locks.

If you see an SVN message reporting a working copy locked error, remove stale locks. In the
Current Folder browser, right-click and select Source Control > SVN Cleanup. SVN uses working
copy locks internally and they are not the file locks you control using Source Control > Get File
Lock.

Note Starting in R2020a Update 5, SVN cleanup only removes stale locks and unfinished
transactions. It does not remove unversioned or ignored files.

You can manually remove unversioned and ignored files.

1 In the Current Folder browser, click the SVN header to sort files by their SVN status.
2 Select the Not Under Source Control files.
3 Right-click and select Delete.

Manage SVN Repository Locks


To manage global SVN locks for a repository, from the top-level repository folder, right-click the white
space (any blank area) in the Current Folder browser and select Source Control > Locks.

In the SVN Repository Locks dialog box, you can:

• View which users have locks on files.


• Right-click to break locks.
• Group locks by user or file.

See Also

Related Examples
• “Enforce Locking Files Before Editing” on page 33-17

33-22
Set Up Git Source Control

Set Up Git Source Control


In this section...
“Configure MATLAB on Windows” on page 33-23
“Use SSH Authentication with MATLAB” on page 33-23
“Register Binary Files with Git” on page 33-24

Note Starting in R2020b, you do not need to install command-line Git to fully use Git with MATLAB.
You can now merge branches using the built-in Git integration.

To setup Git for releases before R2020b, see [Link]


matlab/matlab_prog/[Link].

Configure MATLAB on Windows


Several operations, such as committing, merging, and receiving pushed commits, use Git Hooks. To
use Git Hooks on Windows with MATLAB, install Cygwin and add it to the MATLAB library path:
1 Download the installer from [Link] Run the installer.
2 In the MATLAB Command Window, type
edit(fullfile(matlabroot,"toolbox","local","[Link]")).

Add the Cygwin bin folder location to the end of [Link], for example,
C:\cygwin64\bin.

If you do not have permission to edit the [Link] file, create a copy and save it to
your MATLAB start folder.
3 Restart MATLAB for the changes to take effect.

You can clone a remote repository like GitHub and GitLab using HTTPS or SSH. To prevent frequent
login prompts when you interact with your remote repository using HTTPS, add a new public key and
clone the repository using SSH instead. To avoid problems connecting using SSH, set the HOME
environment variable and use it to store your SSH keys. For more information, see “Use SSH
Authentication with MATLAB” on page 33-23.

For new projects under Git source control, MATLAB automatically registers your binary files to
prevent corruption when merging. For existing projects, register the binary files before using Git to
merge branches. For more information, see “Register Binary Files with Git” on page 33-24.

If you are working with long path files, run this command in MATLAB:
!git config --global [Link] true

Use SSH Authentication with MATLAB


To prevent frequent login prompts when you interact with your remote repository using HTTPS, add a
new public key and clone the repository using SSH instead.

MATLAB Git integration uses the user HOME environment variable to locate the .ssh folder
containing SSH keys. If the HOME environment variable is not set or the SSH keys are not stored

33-23
33 Source Control Interface

properly, you will encounter problems using SSH to connect to remote repositories like GitHub and
GitLab.

To use SSH authentication inside MATLAB:


1 Use ssh-keygen to generate valid SSH keys. In the Command Prompt, enter:
ssh-keygen

Generating public/private rsa key pair.


Enter file in which to save the key (C:\Users\username/.ssh/id_rsa):
Created directory 'C:\Users\username/.ssh'.
Enter passphrase (empty for no passphrase):
Enter same passphrase again:
Your identification has been saved in C:\Users\username/.ssh/id_rsa.
Your public key has been saved in C:\Users\username/.ssh/id_rsa.pub.
The key fingerprint is:
SHA256:/Nc9/tnZ7Dmh77+iJMxmPVrlPqaFd6J1j1YRXEk3Tgs company\username@us-username

ssh-keygen confirms where to save the key (for example, .ssh/id_rsa) and asks for a
passphrase. If you do not want to type a password when you use the key, leave the passphrase
empty. If you already have keys in the specified folder, ssh-keygen asks if you want to override
them.

Note It is not possible to generate SSH keys directly in MATLAB. Generate SSH keys using the
ssh-keygen provided with a command-line Git install.
2 Place your keys in the HOME/.ssh folder. To verify which HOME directory the MATLAB Git
integration is working with, in the MATLAB Command Window, enter:
getenv('HOME')
3 If getenv('HOME') returns nothing, you need to set your HOME environment variable.

To set the HOME environment variable in Windows:

• In the Start Search box, search for and select "advanced system settings".
• On the Advanced tab, click Environment Variables.
• In the User Variables section, click New. Create the HOME environment variable and specify
its value.

The HOME environment variable is always set on Linux and Mac.


4 Configure your GitHub or GitLab account to use the SSH keys:

• Copy the contents of .pub file in the .ssh folder.


• Paste the contents in the Add SSH key field in the SSH keys section of your account settings.

Register Binary Files with Git


If you use third-party source control tools, you must register your MATLAB and Simulink file
extensions such as .mlx, .mat, .fig, .mlapp, .mdl, .slx, .mdlp, .slxp, .sldd, and .p as binary
formats. If you do not register the extensions, these tools can corrupt your files when you submit
them by changing end-of-line characters, expanding tokens, substituting keywords, or attempting to
automerge. Corruption can occur whether you use the source control tools outside of MATLAB or if
you try submitting files from MATLAB without first registering your file formats.

33-24
Set Up Git Source Control

Also check that other file extensions are registered as binary to avoid corruption at check-in. Check
and register files such as MEX-files, .xlsx, .jpg, .pdf, .docx, etc.

You can prevent Git from corrupting your files by registering binary files in your .gitattributes
file.

• For new projects and projects that switched from another source control system, MATLAB
automatically creates a .gitattributes file and populates it with a list of binary files to register.
This specifies that Git should not make automatic line feed, diff, and merge attempts for registered
files.
• For existing projects, create a .gitattributes file and populate it with the list of binary files to
register.

1 In the Command Window, type:

edit .gitattributes
2 Add a line to the attributes file for each file type you need. For example, *.mlapp binary.

Tip You can copy a .gitattributes file that contains the list of common binary files to
register.

copyfile(fullfile(matlabroot,'toolbox','shared','cmlink','git','auxiliary_files','mwgitatt

3 Restart MATLAB so you can start using the Git client.

Tip You can reduce your Git repository size by saving Simulink models without compression. Turning
off compression results in larger SLX files on disk but reduces repository size.

To use this setting with new SLX files, create your models using a model template with SLX
Compression set to none. For existing SLX files, set compression and then save the model. For more
information, see “Set SLX Compression Level” (Simulink).

See Also

Related Examples
• “Clone from Git Repository” on page 32-44

33-25
33 Source Control Interface

Add Git Submodules


To reuse code from another repository, you can specify Git submodules.

To clone an external Git repository as a submodule:

1 Right-click in the MATLAB Current Folder browser, and select Source Control > Submodules.
2 In the Submodules dialog box, click the + button.
3 In the Add Submodule dialog box, in the Remote box, specify a repository location. Optionally,
click Validate.
4 In the Path box, specify a location for the submodule and click OK. The Submodules dialog box
displays the status and details of the submodule.
5 Check the status message, and click Close.

Update Submodules
After using Pull to get the latest changes from a remote repository, check that submodules are up to
date by clicking Submodules and then click Update. If any submodule definition have changed, then
the update ensures that the submodule folder contains the correct files. Update applies to all child
submodules in the submodule hierarchy.

Use Fetch and Merge with Submodules


When you want to manage the added submodule, open the Submodules dialog box.

1 To get the latest version of a submodule, in the Submodules dialog box, click Fetch.
2 After fetching, you must merge. Check the Status message in the Submodules dialog box for
information about your current branch relative to the remote tracking branch in the repository.
When you see the message Behind, you need to merge in changes from the repository to your
local branch.
3 Click Branches and merge in the origin changes to your local branch using the Branches dialog
box. See “Fetch and Merge” on page 33-35.

Use Push to Send Changes to the Submodule Repository


If you make changes in your submodule and want to send changes back to the repository:

1 Perform a local commit in the parent folder.


2 Open the Submodules dialog box and click Push.

If you want other users to obtain your changes in the submodule when they clone the parent folder,
make sure the index and head match.

1 In the Submodules dialog box, check the index and head values. The index points to the head
commit at the time you first cloned the submodule, or when you last committed the parent folder.
If the index and head do not match, you must update the index.
2 To update the index, commit your changes in the parent folder, and then click Push in the
Submodules dialog box. This action makes the index and head the same.

33-26
Add Git Submodules

See Also

Related Examples
• “Retrieve Files from Git Repository” on page 33-28

33-27
33 Source Control Interface

Retrieve Files from Git Repository


You can use source control with projects. For more information, see “Clone from Git Repository” on
page 32-44 and “Use Source Control with Projects” on page 32-45.

Clone a remote Git repository to retrieve repository files.

1 Right-click in the white space (any blank area) in the Current Folder browser, and select Source
Control > Manage Files.
2 In the Manage Files Using Source Control dialog box, select Git from the Source control
integration list.
3 If you know your repository location, paste it into the Repository path field.

Otherwise, to browse for and validate the repository path to retrieve files from, click Change.

a In the Select a Repository dialog box, browse to your repository using the Remote button

.
b Click Validate to check the repository path.

If you see an authentication dialog box for your repository, enter the login information to
continue.
c If the path is valid, click OK. The dialog box closes and you return to the Manage Files Using
Source Control dialog box.
4 In the Manage Files Using Source Control dialog box, select the sandbox folder to store the
retrieved files and click Retrieve.

If you see an authentication dialog box for your repository, enter the login information to
continue.

Troubleshooting
If you encounter errors like OutOfMemoryError: Java heap space, for example when cloning
big Git repositories, then edit your MATLAB preferences to increase the memory size.

1 On the Home tab, in the Environment section, click Preferences.


2 Select MATLAB > General > Java Heap Memory.
3 Move the slider to increase the heap size, and then click OK.
4 Restart MATLAB.

See Also

Related Examples
• “Set Up Git Source Control” on page 33-23
• “Update Git File Status and Revision” on page 33-29
• “Branch and Merge with Git” on page 33-30

33-28
Update Git File Status and Revision

Update Git File Status and Revision


In this section...
“Refresh Status of Files” on page 33-29
“Update Revisions of Files” on page 33-29

Refresh Status of Files


To refresh the source control status of files, select one or more files in the Current Folder browser,
right-click and select Source Control > Refresh Git status.

To refresh the status of all files in the repository, right-click the white space of the Current Folder
browser and select Source Control > Refresh Git status.

Update Revisions of Files


To update all files in a repository, right-click in the Current Folder browser and select Source
Control > Pull.

Caution Ensure you have registered binary files with Git before using Pull. If you do not, conflict
markers can corrupt your files. For more information, see “Register Binary Files with Git” on page 33-
24.

Pull fetches the latest changes and merges them into your current branch. If you are not sure what is
going to come in from the repository, use fetch to examine the changes first and then merge the
changes manually. For more information, see “Pull, Push and Fetch Files with Git” on page 33-34.

Pull might fail if you have conflicts. With a complicated change you might want to create a branch
from the origin, make some compatibility changes, then merge that branch into the main tracking
branch.

See Also

Related Examples
• “Retrieve Files from Git Repository” on page 33-28
• “Review Changes in Source Control” on page 33-7

33-29
33 Source Control Interface

Branch and Merge with Git


In this section...
“Create Branch” on page 33-30
“Switch Branch” on page 33-31
“Compare Branches” on page 33-32
“Merge Branches” on page 33-32
“Revert to Head” on page 33-33
“Delete Branches” on page 33-33

Create Branch
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control > Branches. In the Branches dialog box, you can view, switch,
create, and merge branches.

Tip You can inspect information about each commit node. Select a node in the Branch Browser
diagram to view the author, date, commit message, and changed files.

The Branch Browser in this figure shows an example branch history.

33-30
Branch and Merge with Git

2 Select a source for the new branch. Click a node in the Branch Browser diagram, or enter a
unique identifier in the Source text box. You can enter a tag, branch name, or a unique prefix of
the SHA1 hash (for example, 73c637 to identify a specific commit). Leave the default to create a
branch from the head of the current branch.
3 Enter a name in the Branch name text box and click Create.
4 To work on the files on your new branch, switch your project to the branch.

In the Branches drop-down list, select the branch you want to switch to and click Switch.
5 Close the Branches dialog box and work on the files on your branch.

For next steps, see “Pull, Push and Fetch Files with Git” on page 33-34.

Switch Branch
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control > Branches.
2 In the Branches dialog box, in the Branches drop-down list, select the branch you want to and
click Switch.

33-31
33 Source Control Interface

3 Close the Branches dialog box and work on the files on your branch.

Compare Branches
From within your Git repository folder, right-click the white space of the Current Folder browser and
select Source Control > Branches.

• To examine differences in a file between the current revision and its parent, right-click a file in the
tree under Differences from parent and select Show Difference.
• To examine differences in a file between any two revisions including revisions on two different
development branches, hold the Ctrl key and select the two different revisions. Right-click a file in
the tree under Differences from selection and select Show Difference.

MATLAB opens a comparison report. You can save a copy of the selected file on either revision. Right-
click a file and select Save As to save a copy of the file on the selected revision. Select Save Original
As to save a copy of the file on the prior revision. This is useful if you want to test how the code ran in
previous revisions or on other branches.

Merge Branches
Before you can merge branches, you must register binary files to prevent Git from inserting conflict
markers. See “Register Binary Files with Git” on page 33-24.

Tip After you fetch changes, you must merge. For more information, see “Fetch and Merge” on page
33-35.

To merge any branches:

1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control and Branches.
2 In the Branches dialog box, from the Branches drop-down list, select a branch you want to
merge into the current branch, and click Merge.
3 Close the Branches dialog box and work on the files on your branch.

If the branch merge causes a conflict that Git cannot resolve automatically, an error dialog box
reports that automatic merge failed. Resolve the conflicts before proceeding.

Caution Do not move or delete files outside of MATLAB because this can cause errors on merge.

Keep Your Version

1 To keep your version of the file, right-click the file and select Mark Conflict Resolved.
2 Click Commit Modified Files to commit your change that marks the conflict resolved.

View Conflicts in Branch Versions

If you merge a branch and there is a conflict in a file, Git marks the file as conflicted and does not
modify the contents. Right-click the file and select Source Control > View Conflicts. A comparison

33-32
Branch and Merge with Git

report opens that shows the differences between the file on your branch and the branch you want to
merge into. Decide how to resolve the conflict. See “Resolve Source Control Conflicts” on page 33-9.

Revert to Head
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control > Branches.
2 In the Branches dialog box, click Revert to Head to remove all local changes.

Delete Branches
1 In the Branches dialog box under Branch Browser, expand the Branches drop-down list, and
select the branch you want to delete.
2 On the far right, click the down arrow and select Delete Branch.

Caution You cannot undo branch deletion.

See Also

Related Examples
• “Set Up Git Source Control” on page 33-23
• “Pull, Push and Fetch Files with Git” on page 33-34
• “Resolve Source Control Conflicts” on page 33-9

33-33
33 Source Control Interface

Pull, Push and Fetch Files with Git


Use this workflow to work with a remote repository. With Git, there is a two-step workflow: commit
local changes, and then push to the remote repository. In MATLAB, the only access to the remote
repository is through the Pull, Push and Fetch menu options. All other actions, such as Compare to
Ancestor and Commit, use the local repository. This diagram represents the Git workflow.

Pull and Push


To get the latest changes, right-click the Current Folder browser and select Source Control > Pull.
Pull fetches the latest changes and merges them into your current branch. If you are not sure what is
going to come in from the repository, use fetch to examine the changes first and then merge the
changes manually.

Note Before you can merge, you must register binary files to prevent Git from inserting conflict
markers. See “Register Binary Files with Git” on page 33-24.

Pull might fail if you have conflicts. With a complicated change you might want to create a branch
from the origin, make some compatibility changes, then merge that branch into the main tracking
branch.

To commit changes to the local repository, right-click the Current Folder browser and select Source
Control > View and Commit Changes.

To see if your local changes have moved ahead of the remote tracking branch, right-click the file or
white space of the Current Folder browser and select Source Control > View Details. The Git
information field indicates whether your committed local changes are ahead of, behind, or
coincident with the remote tracking branch.

To send local commits to the remote repository, right-click in the Current Folder browser and select
Source Control > Push. A message appears if you cannot push your changes directly because the
repository has moved on. Right-click in the Current Folder browser and select Source Control >

33-34
Pull, Push and Fetch Files with Git

Fetch to fetch all changes from the remote repository. Merge branches and resolve conflicts, and
then you can push your changes.

Using Git, you cannot add empty folders to source control, so you cannot select Push and then clone
an empty folder. You can create an empty folder in MATLAB, but if you push changes and then sync a
new sandbox, then the empty folder does not appear in the new sandbox. To push empty folders to
the repository for other users to sync, create a gitignore file in the folder and then push your
changes.

Fetch and Merge


Use Fetch to get changes and merge manually. Use Pull instead to fetch the latest changes and
merge them into your current branch.

Note After fetching, you must merge. Before you can merge branches, you must register binary files
to prevent Git from inserting conflict markers. See “Register Binary Files with Git” on page 33-24.

To fetch changes from the remote repository, right-click in the Current Folder browser and select
Source Control > Fetch. Fetch updates all of the origin branches in the local repository. Your
sandbox files do not change. To see others’ changes, you need to merge in the origin changes to your
local branches.

For information about your current branch relative to the remote tracking branch in the repository,
right-click the file or white space of the Current Folder browser and select Source Control > View
Details. The Git information field indicates whether your committed local changes are ahead of,
behind, or coincident with the remote tracking branch. When you see the message Behind, you need
to merge in changes from the repository to your local branch.

For example, if you are on the master branch, get all changes from the master branch in the remote
repository.
1 Right-click in the Current Folder browser and select Source Control > Fetch
2 Right-click in the Current Folder browser and select Source Control > Branches.
3 In the Branches dialog box, select origin/master in the Branches list.
4 Click Merge. The origin branch changes merge into the master branch in your sandbox.

If you right-click the Current Folder browser and select Source Control > View Details, the Git
information field indicates Coincident with /origin/master. You can now view the changes
that you fetched and merged from the remote repository in your local sandbox.

Use Git Stashes


Store uncommitted changes for later use by creating a Git stash. Use stashes to:

• Store modified files without committing them.


• Move changes easily to a new branch.
• Browse and examine the changes within a stash.

To create and manage stashes, in the Current Folder browser, right-click the white space in a folder
managed by Git and select Source Control > Stashes.

33-35
33 Source Control Interface

In the Stashes dialog box:

• To create a stash containing your currently modified files, click New Stash.
• To view modified files in a stash, select the stash under Available Stashes. Right-click modified
files to view changes or save a copy.
• To apply the stash to your current branch and then delete the stash, click Pop.
• To apply the stash and keep it, click Apply.
• To delete the stash, click Drop.

See Also

Related Examples
• “Branch and Merge with Git” on page 33-30
• “Resolve Source Control Conflicts” on page 33-9

33-36
Move, Rename, or Delete Files Under Source Control

Move, Rename, or Delete Files Under Source Control


Move, rename, or delete files using the MATLAB Source Control context menu options or another
source control client application.

To move a file under source control, right-click the file in the Current Folder browser, select Source
Control > Move, and enter a new file location.

To rename a file under source control, right-click the file in the Current Folder browser, select
Source Control > Rename, and enter a new file name.

To delete a file from the repository, mark the file for deletion.

• To mark a file for deletion from the repository and retain a local copy, right-click the file in the
Current Folder browser. Select Source Control and then Delete from SVN or Delete from Git.
When the file is marked for deletion from source control, the symbol changes to Deleted . The
file is removed from the repository at the next commit.
• To mark a file for deletion from the repository and from your disk, right-click the file in the
Current Folder browser. Select Source Control and then Delete from SVN and disk or Delete
from Git and disk. The file disappears from the Current Folder browser and is immediately
deleted from your disk. The file is removed from the repository at the next commit.

See Also

Related Examples
• “Mark Files for Addition to Source Control” on page 33-8
• “Commit Modified Files to Source Control” on page 33-12

33-37
33 Source Control Interface

Customize External Source Control to Use MATLAB for Diff and


Merge
In this section...
“Finding the Full Paths for MATLAB Diff, Merge, and AutoMerge” on page 33-38
“Integration with Git” on page 33-39
“Integration with SVN” on page 33-40
“Integration with Other Source Control Tools” on page 33-41

You can customize external source control tools to use the MATLAB Comparison Tool for diff and
merge. If you want to compare MATLAB files such as live scripts, MAT, SLX, or MDL files from your
source control tool, then you can configure your source control tool to open the MATLAB Comparison
Tool. The MATLAB Comparison Tool provides tools for merging MathWorks files and is compatible
with popular software configuration management and version control systems. You can use the
automerge tool with Git to automatically merge branches that contain changes in different
subsystems in the same SLX file.

To set up your source control tool to use MATLAB as the application for diff and merge, you must first
determine the full paths of the mlDiff, mlMerge, and mlAutoMerge executable files, and then
follow the recommended steps for the source control tool you are using.

Finding the Full Paths for MATLAB Diff, Merge, and AutoMerge
To get the required file paths and enable external source control tools to reuse open MATLAB
sessions, run this command in MATLAB:

[Link]()

This command sets the MATLAB preference, under Comparison, called Allow external source
control tools to use open MATLAB sessions for diffs and merges.

This command also displays the file paths to copy and paste into your source control tool setup:

• On Windows:

Diff: matlabroot\bin\win64\[Link]

Merge: matlabroot\bin\win64\[Link]

AutoMerge: matlabroot\bin\win64\[Link]
• On Linux:

Diff: matlabroot/bin/glnxa64/mlDiff

Merge: matlabroot/bin/glnxa64/mlMerge

AutoMerge: matlabroot/bin/glnxa64/mlAutoMerge
• On Mac:

Diff: matlabroot/bin/maci64/mlDiff

Merge: matlabroot/bin/maci64/mlMerge

33-38
Customize External Source Control to Use MATLAB for Diff and Merge

AutoMerge: matlabroot/bin/maci64/mlAutoMerge

where matlabroot is replaced with the full path to your installation, for example, C:\Program
Files\MATLAB\R2020b.

Note Your diff and merge operations use open MATLAB sessions when available, and only open
MATLAB when necessary. The operations only use the specified MATLAB installation.

Integration with Git


Command Line

To configure MATLAB diff and merge tools with command-line Git:

1 Run this command in MATLAB.

[Link]()

This command displays the full paths of the mlDiff, mlMerge, and mlAutoMerge executable
files. It also automatically populates the global .gitconfig file. For example:
[difftool "mlDiff"]
cmd = \"C:/Program Files/MATLAB/R2020b/bin/win64/[Link]\" $LOCAL $PWD/$REMOTE
[mergetool "mlMerge"]
cmd = \"C:/Program Files/MATLAB/R2020b/bin/win64/[Link]\" $PWD/$BASE $PWD/$LOCAL $PWD/$REMOTE $PWD/$MERGED
[merge "mlAutoMerge"]
driver = \"C:/Program Files/MATLAB/R2020b/bin/win64/[Link]\" %O %A %B %A

Note You need to do step 1 only once for your Git setup.
2 Configure your repository to use the mlAutoMerge executable file. Open the .gitattributes
file in your repository and add:

*.slx binary merge=mlAutoMerge

Now, when you merge branches that contain changes in different subsystems in the same SLX
file, MATLAB handles the merge automatically.

To run the MATLAB diff and merge tools from command-line Git, use git difftool and git
mergetool:

• To compare two revisions of a model using the MATLAB diff tool, type:
git difftool -t mlDiff <revisonID1> <revisionID2> [Link]

If you do not provide revision IDs, git difftool compares the working copy to the repository
copy.

If you do not specify which model you want to compare, command-line Git will go through all
modified files and ask you if you want to compare them one by one.
• To resolve a merge conflict in a model using the MATLAB merge tool, type:
git mergetool -t mlMerge [Link]

If you do not specify which model you want to merge, command-line Git will go through all files
and ask you if you want to merge them one by one.

33-39
33 Source Control Interface

SourceTree

SourceTree is an interactive GUI tool that visualizes and manages Git repositories for Windows and
Mac.

1 Configure the MATLAB diff and merge tools as SourceTree external tools:

a With SourceTree open, click Tools > Options.


b On the Diff tab, under External Diff / Merge, fill the fields with the following information:
External Diff tool: Custom
Diff Command: C:\Program Files\MATLAB\R2020b\bin\win64\[Link]
Arguments: $LOCAL $PWD/$REMOTE
Merge tool: Custom
Merge Command: C:\Program Files\MATLAB\R2020b\bin\win64\[Link]
Arguments: $PWD/$BASE $PWD/$LOCAL $PWD/$REMOTE $PWD/$MERGED
2 Configure your repository to automerge changes in different subsystems in the same SLX file
using the mlAutoMerge executable file:

a Open the global .gitconfig file and add:


[merge "mlAutoMerge"]
driver = \"C:/Program Files/MATLAB/R2020b/bin/win64/[Link]\" %O %A %B %A
b Open the .gitattributes file in your repository and add:

*.slx binary merge=mlAutoMerge

Tip Customize the full path of the mlDiff, mlMerge, and mlAutoMerge executables to match both
the MATLAB installation and the operating system you are using. For more information, see “Finding
the Full Paths for MATLAB Diff, Merge, and AutoMerge” on page 33-38.

To use the MATLAB diff tool from within SourceTree, right-click a modified file under Unstaged files
and select External Diff.

To use the MATLAB merge tool when SourceTree detects a merge conflict, select the Uncommitted
changes branch, right-click a modified file, and select Resolve Conflicts > Launch External
Merge Tool.

Integration with SVN


TortoiseSVN

With TortoiseSVN, you can customize your diff and merge tools based on the file extension. For
example, to use MATLAB diff and merge tools for SLX files:

1 Right-click in any file explorer window and select TortoiseSVN > Settings to open TortoiseSVN
settings.
2 In the Settings sidebar, select Diff Viewer. Click Advanced to specify the diff application based
on file extensions.
3 Click Add and fill the fields with the extension and the mlDiff executable path:
Filename, extension or mime-type: .slx
External Program: "C:\Program Files\MATLAB\R2020b\bin\win64\[Link]" %base %mine

4 Click OK and repeat the same steps to add another file extension.

33-40
Customize External Source Control to Use MATLAB for Diff and Merge

5 In the Settings sidebar, select Diff ViewerMerge Tool. Click Advanced to specify the merge
application based on file extensions.
6 Click Add and fill the fields with the extension and mlMerge executable path:
Filename, extension or mime-type: .slx
External Program: "C:\Program Files\MATLAB\R2020b\bin\win64\[Link]" %base %mine %theirs %merged

7 Click OK and repeat the same steps to add another file extension.

You can now use the MATLAB tools for diff and merge the same way you would use the TortoiseSVN
default diff and merge applications.

Note Automerging binary files with SVN , such as SLX files, is not supported.

Integration with Other Source Control Tools


Perforce P4V

With Perforce® P4V, you can customize your diff and merge tools based on the file extension. To use
MATLAB diff and merge tools for SLX files, for example:

1 In Perforce, click Edit > Preferences.


2 In the Preferences sidebar, select Diff. Under Specify diff application by extension
(overrides default), click Add.
3 In the Add File Type dialog box, enter the following information:
Extension: .slx
Application: C:\Program Files\MATLAB\R2020b\bin\win64\[Link]
Arguments: %1 %2
4 Click Save.
5 In the Preferences sidebar, select Merge. Under Specify merge application by extension
(overrides default), click Add.
6 In the Add File Type dialog box, enter the following information:
Extension: .slx
Application: C:\Program Files\MATLAB\R2020b\bin\win64\[Link]
Arguments: %b %2 %1 %r
7 Click Save and repeat the steps for other file extensions.

Tip Customize the full path of the mlDiff and mlMerge executables to match both the MATLAB
installation and the operating system you are using. For more information, see “Finding the Full
Paths for MATLAB Diff, Merge, and AutoMerge” on page 33-38.

You can now use the MATLAB tools for diff and merge the same way you would use the Perforce
default diff and merge applications.

See Also

Related Examples
• “Compare Files and Folders and Merge Files”

33-41
33 Source Control Interface

• “Compare and Merge MAT-Files”


• “Merge Simulink Models from the Comparison Report” (Simulink)

33-42
MSSCCI Source Control Interface

MSSCCI Source Control Interface

Note MSSCCI support has been removed. Replace this functionality with one of the following
options.

• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.

If you use source control systems to manage your files, you can interface with the systems to perform
source control actions from within the MATLAB, Simulink, and Stateflow products. Use menu items in
the MATLAB, Simulink, or Stateflow products, or run functions in the MATLAB Command Window to
interface with your source control systems.

The source control interface on Windows works with any source control system that conforms to the
Microsoft Common Source Control standard, Version 1.1. If your source control system does not
conform to the standard, use a Microsoft Source Code Control API wrapper product for your source
control system so that you can interface with it from the MATLAB, Simulink, and Stateflow products.

This documentation uses the Microsoft Visual SourceSafe® software as an example. Your source
control system might use different terminology and not support the same options or might use them
in a different way. Regardless, you should be able to perform similar actions with your source control
system based on this documentation.

Perform most source control interface actions from the Current Folder browser. You can also perform
many of these actions for a single file from the MATLAB Editor, a Simulink model window, or a
Stateflow chart window—for more information, see “Access MSSCCI Source Control from Editors” on
page 33-57.

33-43
33 Source Control Interface

Set Up MSSCCI Source Control

Note MSSCCI support has been removed. Replace this functionality with one of the following
options.

• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.

In this section...
“Create Projects in Source Control System” on page 33-44
“Specify Source Control System with MATLAB Software” on page 33-45
“Register Source Control Project with MATLAB Software” on page 33-46
“Add Files to Source Control” on page 33-48

Create Projects in Source Control System


In your source control system, create the projects that your folders and files will be associated with.

All files in a folder must belong to the same source control project. Be sure the working folder for the
project in the source control system specifies the correct path to the folder on disk.

Example of Creating Source Control Project

This example uses the project my_thesis_files in Microsoft Visual SourceSafe. This illustration of
the Current Folder browser shows the path to the folder on disk, D:\my_thesis_files.

33-44
Set Up MSSCCI Source Control

The following illustration shows the example project in the source control system.

To set the working folder in Microsoft Visual SourceSafe for this example, select my_thesis_files,
right-click, select Set Working Folder from the context menu, and specify D:\my_thesis_files in
the resulting dialog box.

Specify Source Control System with MATLAB Software


In MATLAB, specify the source control system you want to access. On the Home tab, in the
Environment section, click Preferences > MATLAB > General > Source Control.

The currently selected system is shown in the Preferences dialog box. The list includes all installed
source control systems that support the Microsoft Common Source Control standard.

Select the source control system you want to interface with and click OK.

33-45
33 Source Control Interface

MATLAB remembers preferences between sessions, so you only need to perform this action again
when you want to access a different source control system.

Source Control with 64-Bit Versions of MATLAB

If you run a 64-bit version of MATLAB and want MATLAB to interface with your source control
system, your source control system must be 64-bit compliant. If you have a 32-bit source control
system, or if you have a 64-bit source control system running in 32-bit compatibility mode, MATLAB
cannot use it. In that event, MATLAB displays a warning about the problem in the Source Control
preference pane.

Register Source Control Project with MATLAB Software


Register a source control system project with a folder in MATLAB, that is, associate a source control
system project with a folder and all files in that folder. Do this only one time for any file in the folder,
which registers all files in that folder:

1 In the MATLAB Current Folder browser, select a file that is in the folder you want to associate
with a project in your source control system. For example, select D:\my_thesis_files
\wind.m. This will associate all files in the my_thesis_files folder.
2 Right-click, and from the context menu, select Source Control > Register
Name_of_Source_Control_System Project with MATLAB. The
Name_of_Source_Control_System is the source control system you selected using preferences
as described in “Specify Source Control System with MATLAB Software” on page 33-45.

The following example shows Microsoft Visual SourceSafe.

33-46
Set Up MSSCCI Source Control

3 In the resulting Name_of_Source_Control_System Login dialog box, provide the user name
and password you use to access your source control system, and click OK.

4 In the resulting Choose project from Name_of_Source_Control_System dialog box, select the
source control system project to associate with the folder and click OK. This example shows
my_thesis_files.

33-47
33 Source Control Interface

The selected file, its folder, and all files in the folder, are associated with the source control
system project you selected. For the example, MATLAB associates all files in
D:\my_thesis_files with the source control project my_thesis_files.

Add Files to Source Control


Add files to the source control system. Do this only once for each file:

1 In the Current Folder browser, select files you want to add to the source control system.
2 Right-click, and from the context menu, select Source Control > Add to Source Control.
3 The resulting Add to source control dialog box lists files you selected to add. You can add text
in the Comments field. If you expect to use the files soon, select the Keep checked out check
box (which is selected by default). Click OK.

If you try to add an unsaved file, the file is automatically saved upon adding.

33-48
Check Files In and Out from MSSCCI Source Control

Check Files In and Out from MSSCCI Source Control

Note MSSCCI support has been removed. Replace this functionality with one of the following
options.

• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.

In this section...
“Check Files Into Source Control” on page 33-49
“Check Files Out of Source Control” on page 33-49
“Undoing the Checkout” on page 33-50

Before checking files into and out of your source control system from the MATLAB desktop, be sure to
set up your system for use with MATLAB as described in “Set Up MSSCCI Source Control” on page
33-44.

Check Files Into Source Control


After creating or modifying files using MATLAB software or related products, check the files into the
source control system by performing these steps:

1 In the Current Folder browser, select the files to check in. A file can be open or closed when you
check it in, but it must be saved, that is, it cannot contain unsaved changes.
2 Right-click, and from the context menu, select Source Control > Check In.
3 In the resulting Check in file(s) dialog box, you can add text in the Comments field. If you want
to continue working on the files, select the check box Keep checked out. Click OK.

If a file contains unsaved changes when you try to check it in, you will be prompted to save the
changes to complete the checkin. If you did not keep the file checked out and you keep the file open,
note that it is a read-only version.

Check Files Out of Source Control


From MATLAB, to check out the files you want to modify, perform these steps:

1 In the Current Folder browser, select the files to check out.


2 Right-click, and from the context menu, select Source Control > Check Out.
3 The resulting Check out file(s) dialog box lists files you selected to check out. Enter comment
text in the Comments field, which appears if your source control system supports comments on
checkout. Click OK.

33-49
33 Source Control Interface

After checking out a file, make changes to it in MATLAB or another product, and save the file. For
example, edit a file in the Editor.

If you try to change a file without first having checked it out, the file is read-only, as seen in the title
bar, and you will not be able to save any changes. This protects you from accidentally overwriting the
source control version of the file.

If you end the MATLAB session, the file remains checked out. You can check in the file from within
MATLAB during a later session, or folder from your source control system.

Undoing the Checkout


You can undo the checkout for files. The files remain checked in, and do not have any of the changes
you made since you last checked them out. To save any changes you have made since checking out a
particular file click Save on the Editor or Live Editor tab, select Save As, and supply a different
file name before you undo the checkout.

To undo a checkout, follow these steps:

1 In the MATLAB Current Folder browser, select the files for which you want to undo the checkout.
2 Right-click, and from the context menu, select Source Control > Undo Checkout.

The MATLAB Undo checkout dialog box opens, listing the files you selected.

3 Click OK.

33-50
Additional MSSCCI Source Control Actions

Additional MSSCCI Source Control Actions

Note MSSCCI support has been removed. Replace this functionality with one of the following
options.

• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.

In this section...
“Getting the Latest Version of Files for Viewing or Compiling” on page 33-51
“Removing Files from the Source Control System” on page 33-52
“Showing File History” on page 33-52
“Comparing the Working Copy of a File to the Latest Version in Source Control” on page 33-53
“Viewing Source Control Properties of a File” on page 33-54
“Starting the Source Control System” on page 33-55

Getting the Latest Version of Files for Viewing or Compiling


You can get the latest version of a file from the source control system for viewing or running. Getting
a file differs from checking it out. When you get a file, it is write protected so you cannot edit it, but
when you check out a file, you can edit it.

To get the latest version, follow these steps:

1 In the MATLAB Current Folder browser, select the folders or files that you want to get. If you
select files, you cannot select folders too.
2 Right-click, and from the context menu, select Source Control > Get Latest Version.

The MATLAB Get latest version dialog box opens, listing the files or folders you selected.

3 Click OK.

You can now open the file to view it, run the file, or check out the file for editing.

33-51
33 Source Control Interface

Removing Files from the Source Control System


To remove files from the source control system, follow these steps:

1 In the MATLAB Current Folder browser, select the files you want to remove.
2 Right-click, and from the context menu, select Source Control > Remove from Source
Control.

The MATLAB Remove from source control dialog box opens, listing the files you selected.

3 Click OK.

Showing File History


To show the history of a file in the source control system, follow these steps:

1 In the MATLAB Current Folder browser, select the file for which you want to view the history.
2 Right-click, and from the context menu, select Source Control > History.

A dialog box, which is specific to your source control system, opens. For Microsoft Visual
SourceSafe, the History Options dialog box opens, as shown in the following example
illustration.

3 Complete the dialog box to specify the range of history you want for the selected file and click
OK. For example, enter my_name for User.

The history presented depends on your source control system. For Microsoft Visual SourceSafe,
the History dialog box opens for that file, showing the file's history in the source control system.

33-52
Additional MSSCCI Source Control Actions

Comparing the Working Copy of a File to the Latest Version in Source


Control
You can compare the current working copy of a file with the latest checked-in version of the file in the
source control system. This highlights the differences between the two files, showing the changes you
made since you checked out the file.

To view the differences, follow these steps:

1 In the MATLAB Current Folder browser, select the file for which you want to view differences.
This is a file that has been checked out and edited.
2 Right-click, and from the context menu, select Source Control > Differences.

A dialog box, which is specific to your source control system, opens. For Microsoft Visual
SourceSafe, the Difference Options dialog box opens.
3 Review the default entries in the dialog box, make any needed changes, and click OK. The
following example is for Microsoft Visual SourceSafe.

33-53
33 Source Control Interface

The method of presenting differences depends on your source control system. For Microsoft
Visual SourceSafe, the Differences for dialog box opens. This highlights the differences between
the working copy of the file and the latest checked-in version of the file.

Viewing Source Control Properties of a File


To view the source control properties of a file, follow these steps:

1 In the MATLAB Current Folder browser, select the file for which you want to view properties.
2 Right-click, and from the context menu, select Source Control > Properties.

A dialog box, which is specific to your source control system, opens. The following example shows the
Microsoft Visual SourceSafe properties dialog box.

33-54
Additional MSSCCI Source Control Actions

Starting the Source Control System


All the MATLAB source control actions automatically start the source control system to perform the
action, if the source control system is not already open. If you want to start the source control system
from MATLAB without performing a specific action source control action,

1 Right-click any folder or file in the MATLAB Current Folder browser


2 From the context menu, select Source Control > Start Source Control System.

The interface to your source control system opens, showing the source control project associated
with the current folder in MATLAB. The following example shows the Microsoft Visual SourceSafe
Explorer interface.

33-55
33 Source Control Interface

33-56
Access MSSCCI Source Control from Editors

Access MSSCCI Source Control from Editors

Note MSSCCI support has been removed. Replace this functionality with one of the following
options.

• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.

You can create or open a file in the Editor, the Simulink or Stateflow products and perform most
source control actions from their File > Source Control menus, rather than from the Current Folder
browser. Following are some differences in the source control interface process when you use the
Editor, Simulink, or Stateflow:

• You can perform actions on only one file at time.


• Some of the dialog boxes have a different icon in the title bar. For example, the Check out file(s)
dialog box uses the MATLAB Editor icon instead of the MATLAB icon.
• You cannot add a new (Untitled) file, but must instead first save the file.
• You cannot register projects from the Simulink or Stateflow products. Instead, register a project
using the Current Folder browser, as described in “Register Source Control Project with MATLAB
Software” on page 33-46.

33-57
33 Source Control Interface

Troubleshoot MSSCCI Source Control Problems

Note MSSCCI support has been removed. Replace this functionality with one of the following
options.

• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.

In this section...
“Source Control Error: Provider Not Present or Not Installed Properly” on page 33-58
“Restriction Against @ Character” on page 33-59
“Add to Source Control Is the Only Action Available” on page 33-59
“More Solutions for Source Control Problems” on page 33-59

Source Control Error: Provider Not Present or Not Installed Properly


In some cases, MATLAB software recognizes your source control system but you cannot use source
control features for MATLAB. Specifically, when you select MATLAB > General > Source Control
in the Preferences dialog box, MATLAB lists your source control system, but you cannot perform any
source control actions. Only the Start Source Control System item is available, and when you
select it, MATLAB displays this error:
Source control provider is not present or not installed properly.

Often, this error occurs because a registry key that MATLAB requires from the source control
application is not present. Make sure this registry key is present:

HKEY_LOCAL_MACHINE\SOFTWARE\SourceCodeControlProvider\
InstalledSCCProviders

The registry key refers to another registry key that is similar to

HKEY_LOCAL_MACHINE\SOFTWARE\Microsoft\SourceSafe\SccServerPath

This registry key has a path to a DLL-file in the file system. Make sure the DLL-file exists in that
location. If you are not familiar with registry keys, ask your system administrator for help.

If this does not solve the problem and you use Microsoft Visual SourceSafe, try running a client setup
for your source control application. When SourceSafe is installed on a server for a group to use, each
machine client can run a setup but is not required to do so. However, some applications that interface
with SourceSafe, including MATLAB, require you to run the client setup. Run the client setup, which
should resolve the problem.

If the problem persists, access source control outside of MATLAB.

33-58
Troubleshoot MSSCCI Source Control Problems

Restriction Against @ Character


Some source control systems, such as Perforce and Synergy™, reserve the @ character. Perforce, for
example, uses it as a revision specifier. Therefore, you might experience problems if you use these
source control systems with MATLAB files and folders that include the @ character in the folder or file
name.

You might be able to work around this restriction by quoting nonstandard characters in file names,
such as with an escape sequence, which some source control systems allow. Consult your source
control system documentation or technical support resources for a workaround.

Add to Source Control Is the Only Action Available


To use source control features for a file in the Simulink or Stateflow products, the file's source control
project must first be registered with MATLAB. When a file's source control project is not registered
with MATLAB, all MATLAB > General > Source Control menu items on the Preferences dialog box
are disabled except Add to Source Control. You can select Add to Source Control, which registers
the project with MATLAB, or you can register the project using the Current Folder browser, as
described in “Register Source Control Project with MATLAB Software” on page 33-46. You can then
perform source control actions for all files in that project (folder).

More Solutions for Source Control Problems


The latest solutions for problems interfacing MATLAB with a source control system appear on the
MathWorks Web page for support at [Link] Search Solutions
and Technical Notes for “source control.”

33-59
34

Unit Testing

• “Write Test Using Live Script” on page 34-3


• “Write Script-Based Unit Tests” on page 34-6
• “Write Script-Based Test Using Local Functions” on page 34-11
• “Extend Script-Based Tests” on page 34-14
• “Run Tests in Editor” on page 34-17
• “Write Function-Based Unit Tests” on page 34-20
• “Write Simple Test Case Using Functions” on page 34-24
• “Write Test Using Setup and Teardown Functions” on page 34-28
• “Extend Function-Based Tests” on page 34-33
• “Author Class-Based Unit Tests in MATLAB” on page 34-37
• “Write Simple Test Case Using Classes” on page 34-40
• “Write Setup and Teardown Code Using Classes” on page 34-43
• “Table of Verifications, Assertions, and Other Qualifications” on page 34-46
• “Tag Unit Tests” on page 34-48
• “Write Tests Using Shared Fixtures” on page 34-52
• “Create Basic Custom Fixture” on page 34-55
• “Create Advanced Custom Fixture” on page 34-57
• “Use Parameters in Class-Based Tests” on page 34-62
• “Create Basic Parameterized Test” on page 34-66
• “Create Advanced Parameterized Test” on page 34-71
• “Use External Parameters in Parameterized Test” on page 34-78
• “Create Simple Test Suites” on page 34-82
• “Run Tests for Various Workflows” on page 34-84
• “Programmatically Access Test Diagnostics” on page 34-87
• “Add Plugin to Test Runner” on page 34-88
• “Write Plugins to Extend TestRunner” on page 34-90
• “Create Custom Plugin” on page 34-93
• “Run Tests in Parallel with Custom Plugin” on page 34-98
• “Write Plugin to Add Data to Test Results” on page 34-106
• “Write Plugin to Save Diagnostic Details” on page 34-111
• “Plugin to Generate Custom Test Output Format” on page 34-115
• “Analyze Test Case Results” on page 34-118
• “Analyze Failed Test Results” on page 34-121
• “Rerun Failed Tests” on page 34-123
• “Dynamically Filtered Tests” on page 34-126
34 Unit Testing

• “Create Custom Constraint” on page 34-132


• “Create Custom Boolean Constraint” on page 34-135
• “Create Custom Tolerance” on page 34-139
• “Overview of App Testing Framework” on page 34-143
• “Write Test for App” on page 34-148
• “Write Test That Uses App Testing and Mocking Frameworks” on page 34-152
• “Overview of Performance Testing Framework” on page 34-157
• “Test Performance Using Scripts or Functions” on page 34-161
• “Test Performance Using Classes” on page 34-165
• “Measure Fast Executing Test Code” on page 34-171
• “Create Mock Object” on page 34-174
• “Specify Mock Object Behavior” on page 34-181
• “Qualify Mock Object Interaction” on page 34-186
• “Ways to Write Unit Tests” on page 34-192
• “Compile MATLAB Unit Tests” on page 34-195
• “Develop and Integrate Software with Continuous Integration” on page 34-198
• “Generate Artifacts Using MATLAB Unit Test Plugins” on page 34-202
• “Continuous Integration with MATLAB on CI Platforms” on page 34-206

34-2
Write Test Using Live Script

Write Test Using Live Script


This example shows how to test a function that you create by writing a live script,
'[Link]'. The example function computes the angles of a right
triangle, and you create a live-script-based unit test to test the function.

A live-script-based test must adhere to the following conventions:

• The name of the test file must start or end with the word 'test', which is case-insensitive. If the file
name does not start or end with the word 'test', the tests in the file might be ignored in certain
cases.
• Place each unit test into a separate section of the live-script file. If a section has a heading in the
Heading 1 style, the heading becomes the name of the test element. Otherwise, MATLAB assigns a
name to the test.
• Consider how you are running your live-script-based test. If you run the test using the Run
buttons in the Live Editor and MATLAB encounters a test failure, then it stops execution of the
script and does not run any remaining tests. If you run the live script using the unit testing
framework, such as with the runtests function, then if MATLAB encounters a test failure, it still
runs remaining tests.
• When a live script runs as a test, variables defined in one test are not accessible within other
tests. Similarly, variables defined in other workspaces are not accessible to the tests.

Outside of this example, in your current MATLAB folder, create a function in a file, rightTri.m. This
function takes lengths of two sides of a triangle as input and returns the three angles of the
corresponding right triangle. The input sides are the two shorter edges of the triangle, not the
hypotenuse.
type rightTri.m

function angles = rightTri(sides)

A = atand(sides(1)/sides(2));
B = atand(sides(2)/sides(1));
hypotenuse = sides(1)/sind(A);
C = asind(hypotenuse*sind(A)/sides(1));

angles = [A B C];

end

Test: Small angle approximation

You can include equations and images in your live script to help document the test. Create the
following test for the small angle approximation. Typically, when you compare floating-point values,
you specify a tolerance for the comparison.

The rightTri function should return values consistent with the small angle approximation, such that
sin(θ) ≈ θ.

34-3
34 Unit Testing

angles = rightTri([1 1500]);


smallAngleInRadians = (pi/180)*angles(1); % convert to radians
approx = sin(smallAngleInRadians);
assert(abs(approx-smallAngleInRadians) <= 1e-10, 'Problem with small angle approximation')

Test: Sum of Angles

∑ ak = 180∘
k

You can have multiple assert statements in the same test. However, if the first assertion fails, the
MATLAB does not evaluate the remaining statements.

The sum of all angles of the resulting right triangle should always be 180 degrees.
angles = rightTri([7 9]);
assert(sum(angles) == 180)

angles = rightTri([4 4]);


assert(sum(angles) == 180)

angles = rightTri([2 2*sqrt(3)]);


assert(sum(angles) == 180)

Test: 30-60-90 triangle

∘ ∘ ∘
Test that the sides of the triangle reduce to 1 and 3. In which case, the angles are 30 , 60 , and 90 .
tol = 1e-10;
angles = rightTri([2 2*sqrt(3)]);
assert(abs(angles(1)-30)<= tol)
assert(abs(angles(2)-60)<= tol)
assert(abs(angles(3)-90)<= tol)

Test: Isosceles Triangles

For isosceles triangles, both of the non-right angles must be 45 degrees; otherwise assert throws an
error.

Test that two sides of the triangle are equal. In which case, the corresponding angles are equal.
angles = rightTri([4 4]);
assert(angles(1) == 45)
assert(angles(1) == angles(2))

To run your tests, best practice is to use the testing framework via the runtests function instead of
the Run button in the Live Editor. The testing framework provides additional diagnostic information.
In the event of a test failure, the framework runs subsequent tests but the Run button in the Live
Editor does not. For example, to run this test at the MATLAB command prompt, type result =
runtests('TestRightTriLiveScriptExample'). For more information, see runtests.

See Also
assert | runtests

34-4
Write Test Using Live Script

Related Examples
• “Write Script-Based Unit Tests” on page 34-6
• “Write Function-Based Unit Tests” on page 34-20

34-5
34 Unit Testing

Write Script-Based Unit Tests


This example shows how to write a script that tests a function that you create. The example function
computes the angles of a right triangle, and you create a script-based unit test to test the function.

Create rightTri Function to Test

Create this function in a file, rightTri.m, in your current MATLAB® folder. This function takes
lengths of two sides of a triangle as input and returns the three angles of the corresponding right
triangle. The input sides are the two shorter edges of the triangle, not the hypotenuse.

function angles = rightTri(sides)

A = atand(sides(1)/sides(2));
B = atand(sides(2)/sides(1));
hypotenuse = sides(1)/sind(A);
C = asind(hypotenuse*sind(A)/sides(1));

angles = [A B C];

end

Create Test Script

In your working folder, create a new script, rightTriTest.m. Each unit test checks a different
output of the rightTri function. A test script must adhere to the following conventions:

• The name of the test file must start or end with the word 'test', which is case-insensitive. If the file
name does not start or end with the word 'test', the tests in the file might be ignored in certain
cases.
• Place each unit test into a separate section of the script file. Each section begins with two percent
signs (%%), and the text that follows on the same line becomes the name of the test element. If no
text follows the %%, MATLAB assigns a name to the test. If MATLAB encounters a test failure, it
still runs remaining tests.
• In a test script, the shared variable section consists of any code that appears before the first
explicit code section (the first line beginning with %%). Tests share the variables that you define in
this section. Within a test, you can modify the values of these variables. However, in subsequent
tests, the value is reset to the value defined in the shared variables section.
• In the shared variables section (first code section), define any preconditions necessary for your
tests. If the inputs or outputs do not meet this precondition, MATLAB does not run any of the
tests. MATLAB marks the tests as failed and incomplete.
• When a script is run as a test, variables defined in one test are not accessible within other tests
unless they are defined in the shared variables section (first code section). Similarly, variables
defined in other workspaces are not accessible to the tests.
• If the script file does not include any code sections, MATLAB generates a single test element from
the full contents of the script file. The name of the test element is the same as the script file name.
In this case, if MATLAB encounters a failed test, it halts execution of the entire script.

In rightTriTest.m, write four tests to test the output of rightTri. Use the assert function to
test the different conditions. In the shared variables section, define four triangle geometries and
define a precondition that the rightTri function returns a right triangle.

34-6
Write Script-Based Unit Tests

% test triangles
tri = [7 9];
triIso = [4 4];
tri306090 = [2 2*sqrt(3)];
triSkewed = [1 1500];

% preconditions
angles = rightTri(tri);
assert(angles(3) == 90,'Fundamental problem: rightTri not producing right triangle')

%% Test 1: sum of angles


angles = rightTri(tri);
assert(sum(angles) == 180)

angles = rightTri(triIso);
assert(sum(angles) == 180)

angles = rightTri(tri306090);
assert(sum(angles) == 180)

angles = rightTri(triSkewed);
assert(sum(angles) == 180)

%% Test 2: isosceles triangles


angles = rightTri(triIso);
assert(angles(1) == 45)
assert(angles(1) == angles(2))

%% Test 3: 30-60-90 triangle


angles = rightTri(tri306090);
assert(angles(1) == 30)
assert(angles(2) == 60)
assert(angles(3) == 90)

%% Test 4: Small angle approximation


angles = rightTri(triSkewed);
smallAngle = (pi/180)*angles(1); % radians
approx = sin(smallAngle);
assert(approx == smallAngle, 'Problem with small angle approximation')

Test 1 tests the summation of the triangle angles. If the summation is not equal to 180 degrees,
assert throws an error.

Test 2 tests that if two sides are equal, the corresponding angles are equal. If the non-right angles are
not both equal to 45 degrees, the assert function throws an error.

Test 3 tests that if the triangle sides are 1 and sqrt(3), the angles are 30, 60, and 90 degrees. If this
condition is not true, assert throws an error.

Test 4 tests the small-angle approximation. The small-angle approximation states that for small angles
the sine of the angle in radians is approximately equal to the angle. If it is not true, assert throws an
error.

34-7
34 Unit Testing

Run Tests

Execute the runtests function to run the four tests in rightTriTest.m. The runtests function
executes each test in each code section individually. If Test 1 fails, MATLAB still runs the remaining
tests. If you execute rightTriTest as a script instead of by using runtests, MATLAB halts
execution of the entire script if it encounters a failed assertion. Additionally, when you run tests using
the runtests function, MATLAB provides informative test diagnostics.

result = runtests('rightTriTest');

Running rightTriTest
..
================================================================================
Error occurred in rightTriTest/Test3_30_60_90Triangle and it did not run to completion.
---------
Error ID:
---------
'MATLAB:assertion:failed'
--------------
Error Details:
--------------
Error using rightTriTest (line 31)
Assertion failed.
================================================================================
.
================================================================================
Error occurred in rightTriTest/Test4_SmallAngleApproximation and it did not run to completion.
---------
Error ID:
---------
''
--------------
Error Details:
--------------
Error using rightTriTest (line 39)
Problem with small angle approximation
================================================================================
.
Done rightTriTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


===========================================================================
rightTriTest/Test3_30_60_90Triangle X X Errored.
---------------------------------------------------------------------------
rightTriTest/Test4_SmallAngleApproximation X X Errored.

The test for the 30-60-90 triangle and the test for the small-angle approximation fail in the
comparison of floating-point numbers. Typically, when you compare floating-point values, you specify
a tolerance for the comparison. In Test 3 and Test 4, MATLAB throws an error at the failed assertion
and does not complete the test. Therefore, the test is marked as both Failed and Incomplete.

To provide diagnostic information (Error Details) that is more informative than 'Assertion
failed' (Test 3), consider passing a message to the assert function (as in Test 4). Or you can also
consider using function-based unit tests.

34-8
Write Script-Based Unit Tests

Revise Test to Use Tolerance

Save rightTriTest.m as rightTriTolTest.m, and revise Test 3 and Test 4 to use a tolerance. In
Test 3 and Test 4, instead of asserting that the angles are equal to an expected value, assert that the
difference between the actual and expected values is less than or equal to a specified tolerance.
Define the tolerance in the shared variables section of the test script so it is accessible to both tests.

For script-based unit tests, manually verify that the difference between two values is less than a
specified tolerance. If instead you write a function-based unit test, you can access built-in constraints
to specify a tolerance when comparing floating-point values.

% test triangles
tri = [7 9];
triIso = [4 4];
tri306090 = [2 2*sqrt(3)];
triSkewed = [1 1500];

% Define an absolute tolerance


tol = 1e-10;

% preconditions
angles = rightTri(tri);
assert(angles(3) == 90,'Fundamental problem: rightTri not producing right triangle')

%% Test 1: sum of angles


angles = rightTri(tri);
assert(sum(angles) == 180)

angles = rightTri(triIso);
assert(sum(angles) == 180)

angles = rightTri(tri306090);
assert(sum(angles) == 180)

angles = rightTri(triSkewed);
assert(sum(angles) == 180)

%% Test 2: isosceles triangles


angles = rightTri(triIso);
assert(angles(1) == 45)
assert(angles(1) == angles(2))

%% Test 3: 30-60-90 triangle


angles = rightTri(tri306090);
assert(abs(angles(1)-30) <= tol)
assert(abs(angles(2)-60) <= tol)
assert(abs(angles(3)-90) <= tol)

%% Test 4: Small angle approximation


angles = rightTri(triSkewed);
smallAngle = (pi/180)*angles(1); % radians
approx = sin(smallAngle);
assert(abs(approx-smallAngle) <= tol, 'Problem with small angle approximation')

Rerun the tests.

34-9
34 Unit Testing

result = runtests('rightTriTolTest');

Running rightTriTolTest
....
Done rightTriTolTest
__________

All the tests pass.

Create a table of test results.

rt = table(result)

rt =

4×6 table

Name Passed Failed Incomplete Durati


_________________________________________________ ______ ______ __________ ______

{'rightTriTolTest/Test1_SumOfAngles' } true false false 0.02


{'rightTriTolTest/Test2_IsoscelesTriangles' } true false false 0.0047
{'rightTriTolTest/Test3_30_60_90Triangle' } true false false 0.0051
{'rightTriTolTest/Test4_SmallAngleApproximation'} true false false 0.0049

See Also
assert | runtests

Related Examples
• “Write Script-Based Test Using Local Functions” on page 34-11
• “Write Function-Based Unit Tests” on page 34-20

34-10
Write Script-Based Test Using Local Functions

Write Script-Based Test Using Local Functions


This example shows how to write a script-based test that uses local functions as helper functions. The
example function approximates the sine and cosine of an angle. The script-based test checks the
approximation using local functions to check for equality within a tolerance.

Create approxSinCos Function to Test

Create this function in a file, approxSinCos.m, in your current MATLAB folder. This function takes
an angle in radians and approximates the sine and cosine of the angle using Taylor series.

function [sinA,cosA] = approxSinCos(x)


% For a given angle in radians, approximate the sine and cosine of the angle
% using Taylor series.
sinA = x;
cosA = 1;
altSign = -1;
for n = 3:2:26
sinA = sinA + altSign*(x^n)/factorial(n);
cosA = cosA + altSign*(x^(n-1))/factorial(n-1);
altSign = -altSign;
end

Create Test Script

In your current MATLAB folder, create a new script, approxSinCosTest.m.

Note: Including functions in scripts requires MATLAB® R2016b or later.

%% Test 0rad
% Test expected values of 0
[sinApprox,cosApprox] = approxSinCos(0);
assertWithAbsTol(sinApprox,0)
assertWithRelTol(cosApprox,1)

%% Test 2pi
% Test expected values of 2pi
[sinApprox,cosApprox] = approxSinCos(2*pi);
assertWithAbsTol(sinApprox,0)
assertWithRelTol(cosApprox,1)

%% Test pi over 4 equality


% Test sine and cosine of pi/4 are equal
[sinApprox,cosApprox] = approxSinCos(pi/4);
assertWithRelTol(sinApprox,cosApprox,'sine and cosine should be equal')

%% Test matches MATLAB fcn


% Test values of 2pi/3 match MATLAB output for the sin and cos functions
x = 2*pi/3;
[sinApprox,cosApprox] = approxSinCos(x);
assertWithRelTol(sinApprox,sin(x),'sin does not match')
assertWithRelTol(cosApprox,cos(x),'cos does not match')

function assertWithAbsTol(actVal,expVal,varargin)

34-11
34 Unit Testing

% Helper function to assert equality within an absolute tolerance.


% Takes two values and an optional message and compares
% them within an absolute tolerance of 1e-6.
tol = 1e-6;
tf = abs(actVal-expVal) <= tol;
assert(tf, varargin{:});
end

function assertWithRelTol(actVal,expVal,varargin)
% Helper function to assert equality within a relative tolerance.
% Takes two values and an optional message and compares
% them within a relative tolerance of 0.1%.
relTol = 0.001;
tf = abs(expVal - actVal) <= relTol.*abs(expVal);
assert(tf, varargin{:});
end

Each unit test uses assert to check different output of the approxSinCos function. Typically, when
you compare floating-point values, you specify a tolerance for the comparison. The local functions
assertWithAbsTol and assertWithRelTol are helper functions to compute whether the actual
and expected values are equal within the specified absolute or relative tolerance.

• Test 0rad tests whether the computed and expected values for an angle of 0 radians are within
an absolute tolerance of 1e-6 or a relative tolerance 0.1%. Typically, you use absolute tolerance to
compare values close to 0.
• Test 2pi tests whether the computed and expected values for an angle of radians are equal
within an absolute tolerance of 1e-6 or a relative tolerance 0.1%.
• Test pi over 4 equality tests whether the sine and cosine of are equal within a relative
tolerance of 0.1%.
• Test matches MATLAB fcn tests whether the computed sine and cosine of are equal to
the values from the sin and cos functions within a relative tolerance of 0.1%.

Run Tests

Execute the runtests function to run the four tests in approxSinCosTest.m. The runtests
function executes each test individually. If one test fails, MATLAB still runs the remaining tests. If you
execute approxSinCosTest as a script instead of using runtests, MATLAB halts execution of the
entire script if it encounters a failed assertion. Additionally, when you run tests using the runtests
function, MATLAB provides informative test diagnostics.

results = runtests('approxSinCosTest');

Running approxSinCosTest
....
Done approxSinCosTest
__________

All the tests pass.

Create a table of test results.

rt = table(results)

34-12
Write Script-Based Test Using Local Functions

rt =

4x6 table

Name Passed Failed Incomplete Duration


_________________________________________ ______ ______ __________ ________ __

{'approxSinCosTest/Test0rad' } true false false 0.33545 {1


{'approxSinCosTest/Test2pi' } true false false 0.025822 {1
{'approxSinCosTest/TestPiOver4Equality' } true false false 0.027844 {1
{'approxSinCosTest/TestMatchesMATLABFcn'} true false false 0.045329 {1

See Also
assert | runtests

Related Examples
• “Write Script-Based Unit Tests” on page 34-6

More About
• “Add Functions to Scripts” on page 18-14

34-13
34 Unit Testing

Extend Script-Based Tests


In this section...
“Test Suite Creation” on page 34-14
“Test Selection” on page 34-14
“Programmatic Access of Test Diagnostics” on page 34-15
“Test Runner Customization” on page 34-15

Typically, with script-based tests, you create a test file, and pass the file name to the runtests
function without explicitly creating a suite of Test objects. If you create an explicit test suite, there
are additional features available in script-based testing. These features include selecting tests and
using plugins to customize the test runner. For additional functionality, consider using “Function-
Based Unit Tests” or “Class-Based Unit Tests”.

Test Suite Creation


To create a test suite from a script-based test directly, use the testsuite function. For a more
explicit test suite creation, use the [Link] method of
TestSuite. Then you can use the run method instead of the runtests function to run the tests. For
example, if you have a script-based test in a file rightTriTolTest.m, these three approaches are
equivalent.

% Implicit test suite


result = runtests('rightTriTolTest.m');

% Explicit test suite


suite = testsuite('rightTriTolTest.m');
result = run(suite);

% Explicit test suite


suite = [Link]('rightTriTolTest.m');
result = run(suite);

Also, you can create a test suite from all the test files in a specified folder using the
[Link] method. If you know the name of a particular test in
your script-based test file, you can create a test suite from that test using
[Link].

Test Selection
With an explicit test suite, use selectors to refine your suite. Several of the selectors are applicable
only for class-based tests, but you can select tests for your suite based on the test name:

• Use the 'Name' name-value pair argument in a suite generation method, such as
[Link].
• Use a selectors instance and optional constraints instance.

Use these approaches in a suite generation method, such as


[Link], or create a suite and filter it using the selectIf
method. For example, in this listing, the four values of suite are equivalent.

34-14
Extend Script-Based Tests

import [Link]
import [Link]
import [Link]

f = 'rightTriTolTest.m';
selector = HasName(ContainsSubstring('Triangle'));

% fromFile, name-value pair


suite = [Link](f,'Name','*Triangle*')

% fromFile, selector
suite = [Link](f,selector)

% selectIf, name-value pair


fullSuite = [Link](f);
suite = selectIf(fullSuite,'Name','*Triangle*')

% selectIf, selector
fullSuite = [Link](f);
suite = selectIf(fullSuite,selector)

If you use one of the suite creation methods with a selector or name-value pair, the testing framework
creates the filtered suite. If you use the selectIf method, the testing framework creates a full test
suite and then filters it. For large test suites, this approach can have performance implications.

Programmatic Access of Test Diagnostics


If you run tests with the runtests function or the run method of TestSuite or TestCase, the test
framework uses a DiagnosticsRecordingPlugin plugin that records diagnostics on test results.

After you run tests, you can access recorded diagnostics via the DiagnosticRecord field in the
Details property on TestResult. For example, if your test results are stored in the variable
results, find the recorded diagnostics for the second test in the suite by invoking records =
result(2).[Link].

The recorded diagnostics are DiagnosticRecord objects. To access particular types of test
diagnostics for a particular test, use the selectFailed, selectPassed, selectIncomplete, and
selectLogged methods of the DiagnosticRecord class.

By default, the DiagnosticsRecordingPlugin plugin records qualification failures and logged


events at the [Link] level of verbosity. For more information, see
DiagnosticsRecordingPlugin and DiagnosticRecord.

Test Runner Customization


Use a TestRunner object to customize the way the framework runs a test suite. With a TestRunner
object you can:

• Produce no output in the command window using the withNoPlugins method.


• Run tests in parallel using the runInParallel method.
• Add plugins to the test runner using the addPlugin method.

For example,use test suite, suite, to create a silent test runner and run the tests with the run
method of TestRunner.

34-15
34 Unit Testing

runner = [Link];
results = [Link](suite);

Use plugins to customize the test runner further. For example, you can redirect output, determine
code coverage, or change how the test runner responds to warnings. For more information, see “Add
Plugin to Test Runner” on page 34-88 and the plugins classes.

See Also
TestRunner | TestSuite | [Link] | plugins | selectors

Related Examples
• “Add Plugin to Test Runner” on page 34-88

34-16
Run Tests in Editor

Run Tests in Editor


When you open a function-based or class-based test file in the MATLAB Editor, you have the option to
run all tests in the file or to run the test at your cursor location. (This functionality is also available
when you open a function-based test file in the Live Editor.) This example shows how to run tests
while working in the Editor.

In the Editor, create a test in a file named sampleTest.m.


function tests = sampleTest
tests = functiontests(localfunctions);
end

function testA(testCase)
verifyEqual(testCase,5,5)
end

function testB(testCase)
verifyGreaterThan(testCase,42,13)
end

function testC(testCase)
verifySubstring(testCase,'hello, world','llo')
end

When you save the test, the Run section in the Editor tab changes to Run Tests.

Click the Run Tests icon. MATLAB displays the command it uses to run the tests in the Command
Window, and the test output follows. MATLAB runs all three tests from sampleTest.m.
runtests('sampleTest')

Running sampleTest
...
Done sampleTest
__________

ans =

1×3 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:

34-17
34 Unit Testing

3 Passed, 0 Failed, 0 Incomplete.


0.0071673 seconds testing time.

In the Editor, place your cursor in the testB function and click Run Current Test. MATLAB runs
testB only.

runtests('sampleTest','ProcedureName','testB')

Running sampleTest
.
Done sampleTest
__________

ans =

TestResult with properties:

Name: 'sampleTest/testB'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 9.9411e-04
Details: [1×1 struct]

Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.00099411 seconds testing time.

In addition to running tests, you can customize the test run using the test options under Run Tests.
(Click the down arrow under Run Tests to access the full option list.) MATLAB uses test options
whether you run all the tests in a file or just the test at your cursor location. When you select a test
option, the selection persists for the duration of your current MATLAB session.

Test Option Description


Clear Command Window Clears the Command Window before running
tests.
Strict Applies strict checks while running tests. For
example, the framework generates a qualification
failure if a test issues a warning.

Tests that run with this option selected have the


'Strict' option of runtests set to true.
Parallel Runs tests in parallel. This option is only
available if Parallel Computing Toolbox is
installed.

Tests that run with this option selected have the


'UseParallel' option of runtests set to
true.

34-18
Run Tests in Editor

Test Option Description


Output Detail Controls the amount of detail displayed for a test
run.

For example, tests that run with Output Detail


specified as 0: None have the 'OutputDetail'
option of runtests set to 0.
Logging Level Displays diagnostics logged by the log method at
the specified verbosity level or lower.

For example, tests that run with Logging Level


specified as 3: Detailed have the
'LoggingLevel' option of runtests set to 3.

You can also run the tests of this example in the Live Editor by saving them in a file with a .mlx
extension and using the Run section in the Live Editor tab.

See Also
runtests

34-19
34 Unit Testing

Write Function-Based Unit Tests


In this section...
“Create Test Function” on page 34-20
“Run the Tests” on page 34-22
“Analyze the Results” on page 34-23

Create Test Function


Your test function is a single MATLAB file that contains a main function and your individual local test
functions. Optionally, you can include file fixture and fresh fixture functions. File fixtures consist of
setup and teardown functions shared across all the tests in a file. These functions are executed once
per test file. Fresh fixtures consist of setup and teardown functions that are executed before and after
each local test function.

Create the Main Function

The main function collects all of the local test functions into a test array. The name of the main
function corresponds to the name of your test file and should start or end with the word 'test', which
is case-insensitive. If the file name does not start or end with the word 'test', the tests in the file
might be ignored in certain cases. In this sample case, the MATLAB file is exampleTest.m. The main
function needs to make a call to functiontests to generate a test array, tests. Use
localfunctions as the input to functiontests to automatically generate a cell array of function
handles to all the local functions in your file. This is a typical main function.

function tests = exampleTest


tests = functiontests(localfunctions);
end

Create Local Test Functions

Individual test functions are included as local functions in the same MATLAB file as the main (test-
generating) function. These test function names must begin or end with the case-insensitive word,
‘test’. Each of the local test functions must accept a single input, which is a function test case object,
testCase. The testing framework automatically generates this object. For more information on
creating test functions, see “Write Simple Test Case Using Functions” on page 34-24 and “Table of
Verifications, Assertions, and Other Qualifications” on page 34-46. This is a typical example of
skeletal local-test functions.

function testFunctionOne(testCase)
% Test specific code
end

function FunctionTwotest(testCase)
% Test specific code
end

Create Optional Fixture Functions

Setup and teardown code, also referred to as test fixture functions, set up the pretest state of the
system and return it to the original state after running the test. There are two types of these
functions: file fixture functions that run once per test file, and fresh fixture functions that run before

34-20
Write Function-Based Unit Tests

and after each local test function. These functions are not required to generate tests. In general, it is
preferable to use fresh fixtures over file fixtures to increase unit test encapsulation.

A function test case object, testCase, must be the only input to file fixture and fresh fixture
functions. The testing framework automatically generates this object. The TestCase object is a
means to pass information between setup functions, test functions, and teardown functions. Its
TestData property is, by default, a struct, which allows easy addition of fields and data. Typical
uses for this test data include paths and graphics handles. For an example using the TestData
property, see “Write Test Using Setup and Teardown Functions” on page 34-28.
File Fixture Functions

Use file fixture functions to share setup and teardown functions across all the tests in a file. The
names for the file fixture functions must be setupOnce and teardownOnce, respectively. These
functions execute a single time for each file. You can use file fixtures to set a path before testing, and
then reset it to the original path after testing. This is a typical example of skeletal file fixture setup
and teardown code.

function setupOnce(testCase) % do not change function name


% set a new path, for example
end

function teardownOnce(testCase) % do not change function name


% change back to original path, for example
end

Fresh Fixture Functions

Use fresh fixture functions to set up and tear down states for each local test function. The names for
these fresh fixture functions must be setup and teardown, respectively. You can use fresh fixtures to
obtain a new figure before testing and to close the figure after testing. This is typical example of
skeletal test function level setup and teardown code.

function setup(testCase) % do not change function name


% open a figure, for example
end

function teardown(testCase) % do not change function name


% close figure, for example
end

Program Listing Template

%% Main function to generate tests


function tests = exampleTest
tests = functiontests(localfunctions);
end

%% Test Functions
function testFunctionOne(testCase)
% Test specific code
end

function FunctionTwotest(testCase)
% Test specific code
end

34-21
34 Unit Testing

%% Optional file fixtures


function setupOnce(testCase) % do not change function name
% set a new path, for example
end

function teardownOnce(testCase) % do not change function name


% change back to original path, for example
end

%% Optional fresh fixtures


function setup(testCase) % do not change function name
% open a figure, for example
end

function teardown(testCase) % do not change function name


% close figure, for example
end

Run the Tests


When you run function-based tests, the testing framework executes these tasks:

1 Create an array of tests specified by local test functions.


2 If the setupOnce function is specified, set up the pretest state of the system by running the
function.
3 For each test, run the corresponding local test function. If the setup function is specified, run it
before running the local test function. If the teardown function is specified, run it after running
the local test function.
4 If the teardownOnce function is specified, return the pretest state of the system to the original
state by running the function.

To run tests from the command prompt, use the runtests function with your MATLAB test file as
input. For example:

results = runtests('exampleTest.m')

Alternatively, you can run tests using the run function.

results = run(exampleTest)

For more information on running tests see runtests and “Run Tests for Various Workflows” on page
34-84.

34-22
Write Function-Based Unit Tests

Analyze the Results


To analyze the test results, examine the output structure from runtests or run. For each test, the
result contains the name of the test function, whether it passed, failed, or did not complete, and the
time it took to run the test. For more information, see “Analyze Test Case Results” on page 34-118
and “Analyze Failed Test Results” on page 34-121.

See Also
functiontests | localfunctions | runtests

Related Examples
• “Write Simple Test Case Using Functions” on page 34-24
• “Write Test Using Setup and Teardown Functions” on page 34-28

34-23
34 Unit Testing

Write Simple Test Case Using Functions


This example shows how to write a unit test for a MATLAB function, quadraticSolver.m.

Create quadraticSolver.m Function

This MATLAB function solves quadratic equations. Create this function in a folder on your MATLAB
path.

function roots = quadraticSolver(a, b, c)


% quadraticSolver returns solutions to the
% quadratic equation a*x^2 + b*x + c = 0.

if ~isa(a,'numeric') || ~isa(b,'numeric') || ~isa(c,'numeric')


error('quadraticSolver:InputMustBeNumeric', ...
'Coefficients must be numeric.');
end

roots(1) = (-b + sqrt(b^2 - 4*a*c)) / (2*a);


roots(2) = (-b - sqrt(b^2 - 4*a*c)) / (2*a);

end

Create solverTest Function

Create this function in a folder on your MATLAB path.

function tests = solverTest


tests = functiontests(localfunctions);
end

A call to functiontests using localfunctions as input creates an array of tests from each local
function in the solverTest.m file. Each test is a local function that follows the naming convention of
having ’test’ at the beginning or end of the function name. Local functions that do not follow this
convention are not included in the test array. Test functions must accept a single input argument into
which the testing framework passes a function test case object. The function uses this object for
verifications, assertions, assumptions, and fatal assertions. It contains a TestData structure that
allows data to be passed between setup, test, and teardown functions.

Create Test Function for Real Solutions

Create a test function, testRealSolution, to verify that quadraticSolver returns the correct
value for real solutions. For example, the equation x2 - 3x + 2 = 0 has real solutions x = 1 and x
= 2. This function calls quadraticSolver with the inputs of this equation. The expected solution,
expSolution, is [2,1].

Use the qualification function, verifyEqual, to compare the output of the function, actSolution,
to the desired output, expSolution. If the qualification fails, the framework continues executing the
test. Typically, when using verifyEqual on floating point values, you specify a tolerance for the
comparison. For more information, see [Link].

Add this function to the solverTest.m file.

function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2 1];

34-24
Write Simple Test Case Using Functions

verifyEqual(testCase,actSolution,expSolution)
end

Create Test Function for Imaginary Solutions

Create a test to verify that quadraticSolver returns the right value for imaginary solutions. For
example, the equation x2 + 2x + 10 = 0 has imaginary solutions x = -1 + 3i and x = -1 -
3i. Typically, when using verifyEqual on floating point values, you specify a tolerance for the
comparison. For more information, see [Link].

Add this function, testImaginarySolution, to the solverTest.m file.

function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i -1-3i];
verifyEqual(testCase,actSolution,expSolution)
end

The order of the tests within the solverTest.m file does not matter because they are fully
independent test cases.

Save solverTest Function

The following is the complete solverTest.m test file. Save this file in a folder on your MATLAB path.

function tests = solverTest


tests = functiontests(localfunctions);
end

function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2 1];
verifyEqual(testCase,actSolution,expSolution)
end

function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i -1-3i];
verifyEqual(testCase,actSolution,expSolution)
end

Run Tests in solverTest Function

Run the tests.

results = runtests('solverTest.m')

Running solverTest
..
Done solverTest
__________

results =

1x2 TestResult array with properties:

Name

34-25
34 Unit Testing

Passed
Failed
Incomplete
Duration

Totals:
2 Passed, 0 Failed, 0 Incomplete.
0.19172 seconds testing time.

Both of the tests passed.

Introduce an Error in quadraticSolver.m and Run Tests

Cause one of the tests to fail by forcing roots in quadraticSolver.m to be real. Before ending the
function, add the line: roots = real(roots);. (Do not change solverTest.m.) Save the file and
run the tests.

results = runtests('solverTest.m')

Running solverTest
.
================================================================================
Verification failed in solverTest/testImaginarySolution.

---------------------
Framework Diagnostic:
---------------------
verifyEqual failed.
--> Complexity does not match.

Actual Complexity:
Real
Expected Complexity:
Complex

Actual Value:
-1 -1
Expected Value:
-1.000000000000000 + 3.000000000000000i -1.000000000000000 - 3.000000000000000i

------------------
Stack Information:
------------------
In C:\work\solverTest.m (testImaginarySolution) at 14
================================================================================
.
Done solverTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


===============================================================================
solverTest/testImaginarySolution X Failed by verification.

results =

1x2 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration

Totals:

34-26
Write Simple Test Case Using Functions

1 Passed, 1 Failed, 0 Incomplete.


0.043751 seconds testing time.

The imaginary test verification failed.

Restore quadraticSolver.m to its previous, correct version by removing the roots =


real(roots); code.

See Also
[Link]

More About
• “Write Function-Based Unit Tests” on page 34-20
• “Table of Verifications, Assertions, and Other Qualifications” on page 34-46

34-27
34 Unit Testing

Write Test Using Setup and Teardown Functions


This example shows how to write a unit test for a couple of MATLAB® figure axes properties using
fresh fixtures and file fixtures.

Create axesPropertiesTest File

Create a file containing the main function that tests figure axes properties and include two test
functions. One function verifies that the x-axis limits are correct, and the other one verifies that the
face color of a surface is correct.

In a folder on your MATLAB path, create axesPropertiesTest.m. In the main function of this file,
have functiontests create an array of tests from each local function in axesPropertiesTest.m
with a call to the localfunctions function.

% Copyright 2015 The MathWorks, Inc.

function tests = axesPropertiesTest


tests = functiontests(localfunctions);
end

Create File Fixture Functions

File fixture functions are setup and teardown code that runs a single time in your test file. These
fixtures are shared across the test file. In this example, the file fixture functions create a temporary
folder and set it as the current working folder. They also create and save a new figure for testing.
After tests are complete, the framework reinstates the original working folder and deletes the
temporary folder and saved figure.

In this example, a helper function creates a simple figure — a red cylinder. In a more realistic
scenario, this code is part of the product under test and is computationally expensive, thus motivating
the intent to create the figure only once and to load independent copies of the result for each test
function. For this example, however, you want to create this helper function as a local function to
axesPropertiesTest. Note that the test array does not include the function because its name does
not start or end with ‘test’.

Write a helper function that creates a simple red cylinder and add it as a local function to
axesPropertiesTest.

% Copyright 2015 The MathWorks, Inc.

function f = createFigure
f = figure;
ax = axes('Parent', f);
cylinder(ax,10)
h = findobj(ax,'Type','surface');
[Link] = [1 0 0];
end

You must name the setup and teardown functions of a file test fixture setupOnce and
teardownOnce, respectively. These functions take a single input argument, testCase, into which

34-28
Write Test Using Setup and Teardown Functions

the test framework automatically passes a function test case object. This test case object contains a
TestData structure that allows data to pass between setup, test, and teardown functions. In this
example, the TestData structure uses assigned fields to store the original path, the temporary folder
name, and the figure file name.

Create the setup and teardown functions as a local functions to axesPropertiesTest.

% Copyright 2015 The MathWorks, Inc.

function setupOnce(testCase)
% create and change to temporary folder
[Link] = pwd;
[Link] = ['tmpFolder' datestr(now,30)];
mkdir([Link])
cd([Link])

% create and save a figure


[Link] = '[Link]';
aFig = createFigure;
saveas(aFig,[Link],'fig')
close(aFig)
end

function teardownOnce(testCase)
delete([Link])
cd([Link])
rmdir([Link])
end

Create Fresh Fixture Functions

Fresh fixtures are function level setup and teardown code that runs before and after each test
function in your file. In this example, the functions open the saved figure and find the handles. After
testing, the framework closes the figure.

You must name fresh fixture functions setup and teardown, respectively. Similar to the file fixture
functions, these functions take a single input argument, testCase. In this example, these functions
create a new field in the TestData structure that includes handles to the figure and to the axes. This
allows information to pass between setup, test, and teardown functions.

Create the setup and teardown functions as a local functions to axesPropertiesTest. Open the
saved figure for each test to ensure test independence.

% Copyright 2015 The MathWorks, Inc.

function setup(testCase)
[Link] = openfig([Link]);
[Link] = findobj([Link],...
'Type','Axes');
end

function teardown(testCase)

34-29
34 Unit Testing

close([Link])
end

In addition to custom setup and teardown code, the Unit Testing Framework provides some classes
for creating fixtures. For more information see [Link].

Create Test Functions

Each test is a local function that follows the naming convention of having ‘test’ at the beginning or
end of the function name. The test array does not include local functions that do not follow this
convention. Similar to setup and teardown functions, individual test functions must accept a single
input argument, testCase. Use this test case object for verifications, assertions, assumptions, and
fatal assertions functions.

The testDefaultXLim function test verifies that the x-axis limits are large enough to display the
cylinder. The lower limit needs to be less than -10, and the upper limit needs to be greater than 10.
These values come from the figure generated in the helper function — a cylinder with a 10 unit radius
centered on the origin. This test function opens the figure created and saved in the setupOnce
function, queries the axes limit, and verifies the limits are correct. The qualification functions,
verifyLessThanOrEqual and verifyGreaterThanOrEqual, takes the test case, the actual value,
the expected value, and optional diagnostic information to display in the case of failure as inputs.

Create the testDefaultXLim function as local function to axesPropertiesTest.

% Copyright 2015 The MathWorks, Inc.

function testDefaultXLim(testCase)
xlim = [Link];
verifyLessThanOrEqual(testCase, xlim(1), -10,...
'Minimum x-limit was not small enough')
verifyGreaterThanOrEqual(testCase, xlim(2), 10,...
'Maximum x-limit was not big enough')
end

The surfaceColorTest function accesses the figure that you created and saved in the setupOnce
function. surfaceColorTest queries the face color of the cylinder and verifies that it is red. The
color red has an RGB value of [1 0 0]. The qualification function, verifyEqual, takes as inputs the
test case, the actual value, the expected value, and optional diagnostic information to display in the
case of failure. Typically when using verifyEqual on floating point-values, you specify a tolerance
for the comparison. For more information, see [Link].

Create the surfaceColorTest function as local function to axesPropertiesTest.

% Copyright 2015 The MathWorks, Inc.

function surfaceColorTest(testCase)
h = findobj([Link],'Type','surface');
co = [Link];
verifyEqual(testCase, co, [1 0 0],'FaceColor is incorrect')
end

34-30
Write Test Using Setup and Teardown Functions

Now the axesPropertiesTest.m file is complete with a main function, file fixture functions, fresh
fixture functions, and two local test functions. You are ready to run the tests.

Run Tests

The next step is to run the tests using the runtests function. In this example, the call to runtests
results in the following steps:

1 The main function creates a test array.


2 The file fixture records the working folder, creates a temporary folder, sets the temporary folder
as the working folder, then generates and saves a figure.
3 The fresh fixture setup opens the saved figure and finds the handles.
4 The testDefaultXLim test is run.
5 The fresh fixture teardown closes the figure.
6 The fresh fixture setup opens the saved figure and finds the handles.
7 The surfaceColorTest test is run.
8 The fresh fixture teardown closes the figure.
9 The file fixture teardown deletes the saved figure, changes back to the original path and deletes
the temporary folder.

At the command prompt, generate and run the test suite.

results = runtests('axesPropertiesTest.m')

Running axesPropertiesTest
..
Done axesPropertiesTest
__________

results =

1x2 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
2 Passed, 0 Failed, 0 Incomplete.
2.7844 seconds testing time.

Create Table of Test Results

To access functionality available to tables, create one from the TestResult object.

rt = table(results)

rt =

34-31
34 Unit Testing

2x6 table

Name Passed Failed Incomplete Duration De


_______________________________________ ______ ______ __________ ________ ____

{'axesPropertiesTest/testDefaultXLim' } true false false 1.8554 {1x1


{'axesPropertiesTest/surfaceColorTest'} true false false 0.92905 {1x1

Export test results to an Excel® spreadsheet.

writetable(rt,'[Link]')

Sort the test results by increasing duration.

sortrows(rt,'Duration')

ans =

2x6 table

Name Passed Failed Incomplete Duration De


_______________________________________ ______ ______ __________ ________ ____

{'axesPropertiesTest/surfaceColorTest'} true false false 0.92905 {1x1


{'axesPropertiesTest/testDefaultXLim' } true false false 1.8554 {1x1

See Also
[Link] | [Link]

More About
• “Write Function-Based Unit Tests” on page 34-20
• “Table of Verifications, Assertions, and Other Qualifications” on page 34-46

34-32
Extend Function-Based Tests

Extend Function-Based Tests


In this section...
“Fixtures for Setup and Teardown Code” on page 34-33
“Test Logging and Verbosity” on page 34-34
“Test Suite Creation” on page 34-34
“Test Selection” on page 34-34
“Test Running” on page 34-35
“Programmatic Access of Test Diagnostics” on page 34-35
“Test Runner Customization” on page 34-36

Typically, with function-based tests, you create a test file and pass the file name to the runtests
function without explicitly creating a suite of Test objects. However, if you create an explicit test
suite, additional features are available in function-based testing. These features include:

• Test logging and verbosity


• Test selection
• Plugins to customize the test runner

For additional functionality, consider using “Class-Based Unit Tests”.

Fixtures for Setup and Teardown Code


When writing tests, use the applyFixture method to handle setup and teardown code for actions
such as:

• Changing the current working folder


• Adding a folder to the path
• Creating a temporary folder
• Suppressing the display of warnings

These fixtures take the place of manually coding the actions in the setupOnce, teardownOnce,
setup, and teardown functions of your function-based test.

For example, if you manually write setup and teardown code to set up a temporary folder for each
test, and then you make that folder your current working folder, your setup and teardown functions
could look like this.

function setup(testCase)
% store current folder
[Link] = pwd;

% create temporary folder


[Link] = ['tmpFolder' datestr(now,30)];
mkdir([Link])

% change to temporary folder


cd([Link])
end

34-33
34 Unit Testing

function teardown(testCase)
% change to original folder
cd([Link])

% delete temporary folder


rmdir([Link])
end

However, you also can use a fixture to replace both of those functions with just a modified setup
function. The fixture stores the information necessary to restore the initial state and performs the
teardown actions.
function setup(testCase)
% create temporary folder
f = [Link]([Link]);

% change to temporary folder


[Link]([Link]([Link]));
end

Test Logging and Verbosity


Your test functions can use the log method. By default, the test runner reports diagnostics logged at
verbosity level 1 (Terse). Use the [Link]
method to respond to messages of other verbosity levels. Construct a TestRunner object, add the
LoggingPlugin, and run the suite with the run method. For more information on creating a test
runner, see “Test Runner Customization” on page 34-36.

Test Suite Creation


Calling your function-based test returns a suite of Test objects. You also can use the testsuite
function or the [Link] method. If you want a particular test and
you know the test name, you can use [Link]. If you want to
create a suite from all tests in a particular folder, you can use
[Link].

Test Selection
With an explicit test suite, use selectors to refine your suite. Several of the selectors are applicable
only for class-based tests, but you can select tests for your suite based on the test name:

• Use the 'Name' name-value pair argument in a suite generation method, such as
[Link].
• Use a selectors instance and optional constraints instance.

Use these approaches in a suite generation method, such as


[Link], or create a suite and filter it using the selectIf
method. For example, in this listing, the four values of suite are equivalent.

import [Link]
import [Link]
import [Link]

f = 'rightTriTolTest.m';
selector = HasName(ContainsSubstring('Triangle'));

34-34
Extend Function-Based Tests

% fromFile, name-value pair


suite = [Link](f,'Name','*Triangle*')

% fromFile, selector
suite = [Link](f,selector)

% selectIf, name-value pair


fullSuite = [Link](f);
suite = selectIf(fullSuite,'Name','*Triangle*')

% selectIf, selector
fullSuite = [Link](f);
suite = selectIf(fullSuite,selector)

If you use one of the suite creation methods with a selector or name-value pair, the testing framework
creates the filtered suite. If you use the selectIf method, the testing framework creates a full test
suite and then filters it. For large test suites, this approach can have performance implications.

Test Running
There are several ways to run a function-based test.

To Run All Tests Use Function


In a file runtests with the name of the test file
In a suite run with the suite
In a suite with a custom test run. (See “Test Runner Customization” on page 34-36.)
runner

For more information, see “Run Tests for Various Workflows” on page 34-84.

Programmatic Access of Test Diagnostics


If you run tests with the runtests function or the run method of TestSuite or TestCase, the test
framework uses a DiagnosticsRecordingPlugin plugin that records diagnostics on test results.

After you run tests, you can access recorded diagnostics via the DiagnosticRecord field in the
Details property on TestResult. For example, if your test results are stored in the variable
results, find the recorded diagnostics for the second test in the suite by invoking records =
result(2).[Link].

The recorded diagnostics are DiagnosticRecord objects. To access particular types of test
diagnostics for a particular test, use the selectFailed, selectPassed, selectIncomplete, and
selectLogged methods of the DiagnosticRecord class.

By default, the DiagnosticsRecordingPlugin plugin records qualification failures and logged


events at the [Link] level of verbosity. For more information, see
DiagnosticsRecordingPlugin and DiagnosticRecord.

34-35
34 Unit Testing

Test Runner Customization


Use a TestRunner object to customize the way the framework runs a test suite. With a TestRunner
object you can:

• Produce no output in the command window using the withNoPlugins method.


• Run tests in parallel using the runInParallel method.
• Add plugins to the test runner using the addPlugin method.

For example,use test suite, suite, to create a silent test runner and run the tests with the run
method of TestRunner.

runner = [Link];
results = [Link](suite);

Use plugins to customize the test runner further. For example, you can redirect output, determine
code coverage, or change how the test runner responds to warnings. For more information, see “Add
Plugin to Test Runner” on page 34-88 and the plugins classes.

See Also
[Link] | [Link] |
[Link] | [Link] |
[Link] | [Link]

Related Examples
• “Run Tests for Various Workflows” on page 34-84
• “Add Plugin to Test Runner” on page 34-88

34-36
Author Class-Based Unit Tests in MATLAB

Author Class-Based Unit Tests in MATLAB


To test a MATLAB program, write a unit test using qualifications that are methods for testing values
and responding to failures.

The Test Class Definition


A test class must inherit from [Link] and contain a methods block with the
Test attribute. The methods block contains functions, each of which is a unit test. A general, basic
class definition follows.

%% Test Class Definition


classdef MyComponentTest < [Link]

%% Test Method Block


methods (Test)
% includes unit test functions
end
end

The Unit Tests


A unit test is a method that determines the correctness of a unit of software. Each unit test is
contained within a methods block. The function must accept a TestCase instance as an input.

%% Test Class Definition


classdef MyComponentTest < [Link]

%% Test Method Block


methods (Test)

%% Test Function
function testASolution(testCase)
%% Exercise function under test
% act = the value from the function under test

%% Verify using test qualification


% exp = your expected value
% testCase.<qualification method>(act,exp);
end
end
end

Qualifications are methods for testing values and responding to failures. This table lists the types of
qualifications.

Verificati Use this qualification to produce [Link]


ons and record failures without
throwing an exception. The
remaining tests run to
completion.

34-37
34 Unit Testing

Assumpti Use this qualification to ensure [Link]


ons that a test runs only when
certain preconditions are
satisfied. However, running the
test without satisfying the
preconditions does not produce a
test failure. When an assumption
failure occurs, the testing
framework marks the test as
filtered.
Assertio Use this qualification to ensure [Link]
ns that the preconditions of the
current test are met.
Fatal Use this qualification when the [Link]
assertion failure at the assertion point able
s renders the remainder of the
current test method invalid or
the state is unrecoverable.

The MATLAB unit testing framework provides approximately 25 qualification methods for each type
of qualification. For example, use verifyClass or assertClass to test that a value is of an
expected class, and use assumeTrue or fatalAssertTrue to test if the actual value is true. For a
summary of qualification methods, see “Table of Verifications, Assertions, and Other Qualifications”
on page 34-46.

Often, each unit test function obtains an actual value by exercising the code that you are testing and
defines the associated expected value. For example, if you are testing the plus function, the actual
value might be plus(2,3) and the expected value 5. Within the test function, you pass the actual
and expected values to a qualification method. For example:
[Link](plus(2,3),5)

For an example of a basic unit test, see “Write Simple Test Case Using Classes” on page 34-40.

Additional Features for Advanced Test Classes


The MATLAB unit testing framework includes several features for authoring more advanced test
classes:

• Setup and teardown methods blocks to implicitly set up the pretest state of the system and return
it to the original state after running the tests. For an example of a test class with setup and
teardown code, see “Write Setup and Teardown Code Using Classes” on page 34-43.
• Advanced qualification features, including actual value proxies, test diagnostics, and a constraint
interface. For more information, see [Link] and
[Link].
• Parameterized tests to combine and execute tests on the specified lists of parameters. For more
information, see “Create Basic Parameterized Test” on page 34-66 and “Create Advanced
Parameterized Test” on page 34-71.
• Ready-to-use fixtures for handling the setup and teardown of frequently used testing actions and
for sharing fixtures between classes. For more information, see [Link]
and “Write Tests Using Shared Fixtures” on page 34-52.

34-38
Author Class-Based Unit Tests in MATLAB

• Ability to create custom test fixtures. For more information see “Create Basic Custom Fixture” on
page 34-55 and “Create Advanced Custom Fixture” on page 34-57.

See Also

Related Examples
• “Write Simple Test Case Using Classes” on page 34-40
• “Write Setup and Teardown Code Using Classes” on page 34-43
• “Create Simple Test Suites” on page 34-82
• “Run Tests for Various Workflows” on page 34-84
• “Analyze Test Case Results” on page 34-118
• “Analyze Failed Test Results” on page 34-121

34-39
34 Unit Testing

Write Simple Test Case Using Classes


This example shows how to write unit tests for a MATLAB® function quadraticSolver.

Create quadraticSolver Function

In a file in your current folder, create the function quadraticSolver, which returns the roots of
quadratic polynomials.

function roots = quadraticSolver(a,b,c)


% quadraticSolver returns solutions to the
% quadratic equation a*x^2 + b*x + c = 0.

if ~isa(a,'numeric') || ~isa(b,'numeric') || ~isa(c,'numeric')


error('quadraticSolver:InputMustBeNumeric', ...
'Coefficients must be numeric.');
end

roots(1) = (-b + sqrt(b^2 - 4*a*c)) / (2*a);


roots(2) = (-b - sqrt(b^2 - 4*a*c)) / (2*a);

end

Create SolverTest Class

To test the quadraticSolver function, create a test class by subclassing the


[Link] class. Add your tests inside a methods block with the Test attribute.
The order of the tests within the block does not matter.

classdef SolverTest < [Link]

methods (Test)

end

end

Create Test Method for Real Solutions

Create a test method testRealSolution to verify that quadraticSolver returns the correct
solutions. For example, the equation x2 − 3x + 2 = 0 has real solutions x = 1 and x = 2. The method
calls quadraticSolver with the coefficients of this equation. Then, it uses the verifyEqual
method of [Link] to compare the output of the function, actSolution, to
the desired output, expSolution. If the qualification fails, test execution continues.

function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2,1];
[Link](actSolution,expSolution)
end

Create Test Method for Imaginary Solutions

Create a test method testImaginarySolution to verify that quadraticSolver returns the


correct imaginary solutions. For example, the equation x2 − 2x + 10 = 0 has imaginary solutions
x = − 1 + 3i and x = − 1 − 3i.

34-40
Write Simple Test Case Using Classes

function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i, -1-3i];
[Link](actSolution,expSolution)
end

Create Test Method for Error Condition

Create a test method testNonNumericInput to verify that quadraticSolver produces an error


for nonnumeric coefficients. Use the verifyError method of [Link] to test
that the function throws the exception specified by the error identifier
'quadraticSolver:InputMustBeNumeric'.
function testNonNumericInput(testCase)
[Link](@()quadraticSolver(1,'-3',2), ...
'quadraticSolver:InputMustBeNumeric')
end

SolverTest Class Definition Summary

This code provides the complete contents of the SolverTest class.


classdef SolverTest < [Link]
methods(Test)
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2,1];
[Link](actSolution,expSolution)
end
function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i, -1-3i];
[Link](actSolution,expSolution)
end
function testNonNumericInput(testCase)
[Link](@()quadraticSolver(1,'-3',2), ...
'quadraticSolver:InputMustBeNumeric')
end
end
end

Run Tests in SolverTest Class

Run all of the tests in the SolverTest class.


testCase = SolverTest;
res = run(testCase)

Running SolverTest
...
Done SolverTest
__________

res =
1×3 TestResult array with properties:

Name
Passed
Failed

34-41
34 Unit Testing

Incomplete
Duration
Details

Totals:
3 Passed, 0 Failed, 0 Incomplete.
1.4335 seconds testing time.

Run Single Test Method

Run the testRealSolution method.

testCase = SolverTest;
res = run(testCase,'testRealSolution')

Running SolverTest
.
Done SolverTest
__________

res =
TestResult with properties:

Name: 'SolverTest/testRealSolution'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0142
Details: [1×1 struct]

Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.01417 seconds testing time.

See Also

Related Examples
• “Author Class-Based Unit Tests in MATLAB” on page 34-37
• “Write Setup and Teardown Code Using Classes” on page 34-43
• “Analyze Test Case Results” on page 34-118
• “Create Simple Test Suites” on page 34-82

34-42
Write Setup and Teardown Code Using Classes

Write Setup and Teardown Code Using Classes


In this section...
“Test Fixtures” on page 34-43
“Test Case with Method-Level Setup Code” on page 34-43
“Test Case with Class-Level Setup Code” on page 34-44

Test Fixtures
Test fixtures are setup and teardown code that sets up the pretest state of the system and returns it
to the original state after running the test. Setup and teardown methods are defined in the TestCase
class by the following method attributes:

• TestMethodSetup and TestMethodTeardown methods run before and after each test method.
• TestClassSetup and TestClassTeardown methods run before and after all test methods in the
test case.

The testing framework guarantees that TestMethodSetup and TestClassSetup methods of


superclasses are executed before those in subclasses.

It is good practice for test authors to perform all teardown activities from within the
TestMethodSetup and TestClassSetup blocks using the addTeardown method instead of
implementing corresponding teardown methods in the TestMethodTeardown and
TestClassTeardown blocks. This guarantees the teardown is executed in the reverse order of the
setup and also ensures that the test content is exception safe.

Test Case with Method-Level Setup Code


The following test case, FigurePropertiesTest, contains setup code at the method level. The
TestMethodSetup method creates a figure before running each test, and TestMethodTeardown
closes the figure afterwards. As discussed previously, you should try to define teardown activities with
the addTeardown method. However, for illustrative purposes, this example shows the
implementation of a TestMethodTeardown block.
classdef FigurePropertiesTest < [Link]

properties
TestFigure
end

methods(TestMethodSetup)
function createFigure(testCase)
[Link] = figure;
end
end

methods(TestMethodTeardown)
function closeFigure(testCase)
close([Link])
end
end

34-43
34 Unit Testing

methods(Test)
function defaultCurrentPoint(testCase)
cp = [Link];
[Link](cp,[0 0], ...
'Default current point is incorrect')
end

function defaultCurrentObject(testCase)
import [Link]
co = [Link];
[Link](co,IsEmpty, ...
'Default current object should be empty')
end
end

end

Test Case with Class-Level Setup Code


The following test case, BankAccountTest, contains setup code at the class level.

To setup the BankAccountTest, which tests the BankAccount class example described in
“Developing Classes — Typical Workflow”, add a TestClassSetup method,
addBankAccountClassToPath. This method adds the path to the BankAccount example file.
Typically, you set up the path using a PathFixture. This example performs the setup and teardown
activities manually for illustrative purposes.
classdef BankAccountTest < [Link]
% Tests the BankAccount class

methods(TestClassSetup)
function addBankAccountClassToPath(testCase)
p = path;
[Link](@path,p)
addpath(fullfile(matlabroot,'help','techdoc','matlab_oop', ...
'examples'))
end
end

methods(Test)
function testConstructor(testCase)
b = BankAccount(1234,100);
[Link]([Link],1234, ...
'Constructor failed to correctly set account number')
[Link]([Link],100, ...
'Constructor failed to correctly set account balance')
end

function testConstructorNotEnoughInputs(testCase)
import [Link]
[Link](@()BankAccount, ...
Throws('MATLAB:minrhs'))
end

function testDesposit(testCase)
b = BankAccount(1234,100);
[Link](25)
[Link]([Link],125)
end

function testWithdraw(testCase)
b = BankAccount(1234,100);
[Link](25)
[Link]([Link],75)
end

function testNotifyInsufficientFunds(testCase)
callbackExecuted = false;
function testCallback(~,~)

34-44
Write Setup and Teardown Code Using Classes

callbackExecuted = true;
end
b = BankAccount(1234,100);
[Link]('InsufficientFunds',@testCallback);
[Link](50)
[Link](callbackExecuted, ...
'The callback should not have executed yet')
[Link](60)
[Link](callbackExecuted, ...
'The listener callback should have fired')
end
end

end

See Also
addTeardown | [Link]

Related Examples
• “Author Class-Based Unit Tests in MATLAB” on page 34-37
• “Write Simple Test Case Using Classes” on page 34-40

34-45
34 Unit Testing

Table of Verifications, Assertions, and Other Qualifications


There are four types of qualifications for testing values and responding to failures: verifications,
assumptions, assertions, and fatal assertions.

• Verifications — Produce and record failures without throwing an exception, meaning the
remaining tests run to completion.
• Assumptions — Ensure that a test runs only when certain preconditions are satisfied and the event
should not produce a test failure. When an assumption failure occurs, the testing framework
marks the test as filtered.
• Assertions — Ensure that the preconditions of the current test are met.
• Fatal assertions — Use this qualification when the failure at the assertion point renders the
remainder of the current test method invalid or the state is unrecoverable.

Type of Test Verification Assumption Assertion Fatal Assertion


Value is true. verifyTrue assumeTrue assertTrue fatalAssertTrue
Value is false. verifyFalse assumeFalse assertFalse fatalAssertFalse
Value is equal to verifyEqual assumeEqual assertEqual fatalAssertEqual
specified value.
Value is not equal verifyNotEqual assumeNotEqual assertNotEqual fatalAssertNotEqua
to specified value. l
Two values are verifySameHandl assumeSameHandle assertSameHandle fatalAssertSameHan
handles to same e dle
instance.
Value is not handle verifyNotSameHa assumeNotSameHan assertNotSameHan fatalAssertNotSame
to specified ndle dle dle Handle
instance.
Function returns verifyReturnsTr assumeReturnsTru assertReturnsTru fatalAssertReturns
true when ue e e True
evaluated.
Test produces verifyFail assumeFail assertFail fatalAssertFail
unconditional
failure.
Value meets given verifyThat assumeThat assertThat fatalAssertThat
constraint.
Value is greater verifyGreaterTh assumeGreaterTha assertGreaterTha fatalAssertGreater
than specified an n n Than
value.
Value is greater verifyGreaterTh assumeGreaterTha assertGreaterTha fatalAssertGreater
than or equal to anOrEqual nOrEqual nOrEqual ThanOrEqual
specified value.
Value is less than verifyLessThan assumeLessThan assertLessThan fatalAssertLessTha
specified value. n
Value is less than verifyLessThanO assumeLessThanOr assertLessThanOr fatalAssertLessTha
or equal to rEqual Equal Equal nOrEqual
specified value.

34-46
Table of Verifications, Assertions, and Other Qualifications

Type of Test Verification Assumption Assertion Fatal Assertion


Value is exact verifyClass assumeClass assertClass fatalAssertClass
specified class.
Value is object of verifyInstanceO assumeInstanceOf assertInstanceOf fatalAssertInstanc
specified type. f eOf
Value is empty. verifyEmpty assumeEmpty assertEmpty fatalAssertEmpty
Value is not empty. verifyNotEmpty assumeNotEmpty assertNotEmpty fatalAssertNotEmpt
y
Value has specified verifySize assumeSize assertSize fatalAssertSize
size.
Value has specified verifyLength assumeLength assertLength fatalAssertLength
length.
Value has specified verifyNumElemen assumeNumElement assertNumElement fatalAssertNumElem
element count. ts s s ents
String contains verifySubstring assumeSubstring assertSubstring fatalAssertSubstri
specified string. ng
Text matches verifyMatches assumeMatches assertMatches fatalAssertMatches
specified regular
expression.
Function throws verifyError assumeError assertError fatalAssertError
specified
exception.
Function issues verifyWarning assumeWarning assertWarning fatalAssertWarning
specified warning.
Function issues no verifyWarningFr assumeWarningFre assertWarningFre fatalAssertWarning
warnings. ee e e Free

See Also
Assertable | Assumable | FatalAssertable | Verifiable |
[Link]

34-47
34 Unit Testing

Tag Unit Tests


You can use test tags to group tests into categories and then run tests with specified tags. Typical test
tags identify a particular feature or describe the type of test.

Tag Tests
To define test tags, use a cell array of meaningful character vectors or a string array. For example,
TestTags = {'Unit'} or TestTags = ["Unit","FeatureA"].

• To tag individual tests, use the TestTags method attribute.


• To tag all the tests within a class, use the TestTags class attribute. If you use the TestTags class
attribute in a superclass, tests in the subclasses inherit the tags.

This sample test class, ExampleTagTest, uses the TestTags method attribute to tag individual
tests.

classdef ExampleTagTest < [Link]


methods (Test)
function testA (testCase)
% test code
end
end
methods (Test, TestTags = {'Unit'})
function testB (testCase)
% test code
end
function testC (testCase)
% test code
end
end
methods (Test, TestTags = {'Unit','FeatureA'})
function testD (testCase)
% test code
end
end
methods (Test, TestTags = {'System','FeatureA'})
function testE (testCase)
% test code
end
end
end

Several of the tests in class ExampleTagTest are tagged. For example, testD is tagged with
'Unit' and 'FeatureA'. One test, testA, is not tagged.

This sample test class, ExampleTagClassTest, uses a TestTags class attribute to tag all the tests
within the class, and a TestTags method attribute to add tags to individual tests.

classdef (TestTags = {'FeatureB'}) ...


ExampleTagClassTest < [Link]
methods (Test)
function testF (testCase)
% test code
end

34-48
Tag Unit Tests

end
methods (Test, TestTags = {'FeatureC','System'})
function testG (testCase)
% test code
end
end
methods (Test, TestTags = {'System','FeatureA'})
function testH (testCase)
% test code
end
end
end

Each test in class ExampleTagClassTest is tagged with 'FeatureB'. Additionally, individual tests
are tagged with various tags including 'FeatureA', 'FeatureC', and 'System'.

Select and Run Tests


There are three ways of selecting and running tagged tests:

• “Run Selected Tests Using runtests” on page 34-49


• “Select Tests Using TestSuite Methods” on page 34-50
• “Select Tests Using HasTag Selector” on page 34-50

Run Selected Tests Using runtests

Use the runtests function to select and run tests without explicitly creating a test suite. Select and
run all the tests from ExampleTagTest and ExampleTagClassTest that include the 'FeatureA'
tag.
results = runtests({'ExampleTagTest','ExampleTagClassTest'},'Tag','FeatureA');

Running ExampleTagTest
..
Done ExampleTagTest
__________

Running ExampleTagClassTest
.
Done ExampleTagClassTest
__________

runtests selected and ran three tests.

Display the results in a table.

table(results)

ans =

3×6 table

Name Passed Failed Incomplete Duration Details


___________________________ ______ ______ __________ __________ ____________

'ExampleTagTest/testE' true false false 0.00039529 [1×1 struct]

34-49
34 Unit Testing

'ExampleTagTest/testD' true false false 0.00045658 [1×1 struct]


'ExampleTagClassTest/testH' true false false 0.00043899 [1×1 struct]

The selected tests are testE and testD from ExampleTagTest, and testH from
ExampleTagClassTest.

Select Tests Using TestSuite Methods

Create a suite of tests from the ExampleTagTest class that are tagged with 'FeatureA'.
import [Link]
sA = [Link](?ExampleTagTest,'Tag','FeatureA');

Create a suite of tests from the ExampleTagClassTest class that are tagged with 'FeatureC'.
sB = [Link]('ExampleTagClassTest.m','Tag','FeatureC');

Concatenate the suite and view the names of the tests.


suite = [sA sB];
{[Link]}'

ans =

3×1 cell array

'ExampleTagTest/testE'
'ExampleTagTest/testD'
'ExampleTagClassTest/testG'

Select Tests Using HasTag Selector

Create a suite of all the tests from the ExampleTagTest and ExampleTagClassTest classes.
import [Link]
sA = [Link](?ExampleTagTest);
sB = [Link]('ExampleTagClassTest.m');
suite = [sA sB];

Select all the tests that do not have tags.


s1 = [Link](~HasTag)

s1 =

Test with properties:

Name: 'ExampleTagTest/testA'
ProcedureName: 'testA'
TestClass: "ExampleTagTest"
BaseFolder: 'C:\work'
Parameterization: [0×0 [Link]]
SharedTestFixtures: [0×0 [Link]]
Tags: {1×0 cell}

Tests Include:
0 Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.

Select all the tests with the 'Unit' tag and display their names.

34-50
Tag Unit Tests

s2 = [Link](HasTag('Unit'));
{[Link]}'

ans =

3×1 cell array

'ExampleTagTest/testD'
'ExampleTagTest/testB'
'ExampleTagTest/testC'

Select all the tests with the 'FeatureB' or 'System' tag using a constraint.

import [Link]
constraint = IsEqualTo('FeatureB') | IsEqualTo('System');
s3 = [Link](HasTag(constraint));
{[Link]}'

ans =

4×1 cell array

'ExampleTagTest/testE'
'ExampleTagClassTest/testH'
'ExampleTagClassTest/testG'
'ExampleTagClassTest/testF'

See Also
[Link] | [Link] |
[Link] | [Link] | runtests

34-51
34 Unit Testing

Write Tests Using Shared Fixtures


This example shows how to use shared fixtures when creating tests. You can share test fixtures across
test classes using the SharedTestFixtures attribute of the TestCase class. To exemplify this
attribute, create multiple test classes in a subdirectory of your current working folder. The test
methods are shown only at a high level.

The two test classes used in this example test the DocPolynom class and the BankAccount class.
You can access both classes in MATLAB, but you must add them to the MATLAB path. A path fixture
adds the directory to the current path, runs the tests, and removes the directory from the path. Since
both classes require the same addition to the path, the tests use a shared fixture.

Create a Test for the DocPolynom Class

Create a test file for the DocPolynom class. Create the shared fixture by specifying the
SharedTestFixtures attribute for the TestCase and passing in a PathFixture.

DocPolynomTest Class Definition File


classdef (SharedTestFixtures={[Link]( ...
fullfile(matlabroot,'help','techdoc','matlab_oop','examples'))}) ...
DocPolynomTest < [Link]
% Tests the DocPolynom class.

properties
msgEqn = 'Equation under test: ';
end

methods (Test)
function testConstructor(testCase)
p = DocPolynom([1, 0, 1]);
[Link](p, ?DocPolynom)
end

function testAddition(testCase)
p1 = DocPolynom([1, 0, 1]);
p2 = DocPolynom([5, 2]);

actual = p1 + p2;
expected = DocPolynom([1, 5, 3]);

msg = [[Link],...
'(x^2 + 1) + (5*x + 2) = x^2 + 5*x + 3'];
[Link](actual, expected, msg)
end

function testMultiplication(testCase)
p1 = DocPolynom([1, 0, 3]);
p2 = DocPolynom([5, 2]);

actual = p1 * p2;
expected = DocPolynom([5, 2, 15, 6]);

msg = [[Link],...
'(x^2 + 3) * (5*x + 2) = 5*x^3 + 2*x^2 + 15*x + 6'];
[Link](actual, expected, msg)
end

34-52
Write Tests Using Shared Fixtures

end
end

Create a Test for the BankAccount Class

Create a test file for the BankAccount class. Create the shared fixture by specifying the
SharedTestFixtures attribute for the TestCase and passing in a PathFixture.

BankAccountTest Class Definition File

classdef (SharedTestFixtures={[Link]( ...


fullfile(matlabroot, 'help', 'techdoc', 'matlab_oop', ...
'examples'))}) BankAccountTest < [Link]
% Tests the BankAccount class.

methods (Test)
function testConstructor(testCase)
b = BankAccount(1234, 100);
[Link]([Link], 1234, ...
'Constructor failed to correctly set account number')
[Link]([Link], 100, ...
'Constructor failed to correctly set account balance')
end

function testConstructorNotEnoughInputs(testCase)
import [Link]
[Link](@()BankAccount, ...
Throws('MATLAB:minrhs'))
end

function testDesposit(testCase)
b = BankAccount(1234, 100);
[Link](25)
[Link]([Link], 125)
end

function testWithdraw(testCase)
b = BankAccount(1234, 100);
[Link](25)
[Link]([Link], 75)
end

function testNotifyInsufficientFunds(testCase)
callbackExecuted = false;
function testCallback(~,~)
callbackExecuted = true;
end

b = BankAccount(1234, 100);
[Link]('InsufficientFunds', @testCallback);

[Link](50)
[Link](callbackExecuted, ...
'The callback should not have executed yet')
[Link](60)
[Link](callbackExecuted, ...
'The listener callback should have fired')

34-53
34 Unit Testing

end
end
end

Build the Test Suite

The classes DocPolynomTest.m and BankAccountTest.m are in your working directory. Create a
test suite from your current working directory. If you have additional tests, they are included in the
suite when you use the [Link] method. Create the test suite at the command
prompt.

import [Link];
suiteFolder = [Link](pwd);

Run the Tests

At the command prompt, run the tests in the test suite.

result = run(suiteFolder);

Setting up PathFixture.
Description: Adds 'C:\Program Files\MATLAB\R2013b\help\techdoc\matlab_oop\examples' to the path.
__________

Running BankAccountTest
.....
Done BankAccountTest
__________

Running DocPolynomTest
...
Done DocPolynomTest
__________

Tearing down PathFixture.


Description: Restores the path to its previous state.
__________

The testing framework sets up the test fixture, runs all the tests in each file, and then tears the
fixture down. If the path fixture was set up and torn down using TestClassSetup methods, the
fixture is set up and torn down twice—once for each test file.

See Also
[Link] | [Link] |
[Link]

34-54
Create Basic Custom Fixture

Create Basic Custom Fixture


This example shows how to create a basic custom fixture that changes the display format to
hexadecimal representation. The example also shows how to use the fixture to test a function that
displays a column of numbers as text. After the testing completes, the framework restores the display
format to its pretest state.

Create FormatHexFixture Class Definition

In a file in your working folder, create a new class, FormatHexFixture that inherits from the
[Link] class. Since we want the fixture to restore the pretest state
of the MATLAB display format, create an OriginalFormat property to keep track of the original
display format.
classdef FormatHexFixture < [Link]
properties (Access = private)
OriginalFormat
end
end

Implement Setup and Teardown Methods

Subclasses of the Fixture class must implement the setup method. Use this method to record the
pretest display format, and set the format to 'hex'. Use the teardown method to restore the
original display format. Define the setup and teardown methods in the methods block of the
FormatHexFixture class.
classdef FormatHexFixture < [Link]
properties (Access = private)
OriginalFormat
end
methods
function setup(fixture)
[Link] = get(0,'Format');
set(0,'Format','hex')
end
function teardown(fixture)
set(0,'Format',[Link])
end
end
end

Apply Custom Fixture

In a file in your working folder, create the following test class, SampleTest.m.
classdef SampleTest < [Link]
methods (Test)
function test1(testCase)
[Link](FormatHexFixture)
actStr = getColumnForDisplay([1;2;3],'Small Integers');
expStr = ['Small Integers '
'3ff0000000000000'
'4000000000000000'
'4008000000000000'];
[Link](actStr,expStr)
end

34-55
34 Unit Testing

end
end

function str = getColumnForDisplay(values,title)


elements = cell(numel(values)+1,1);
elements{1} = title;
for idx = 1:numel(values)
elements{idx+1} = displayNumber(values(idx));
end
str = char(elements);
end

function str = displayNumber(n)


str = strtrim(evalc('disp(n);'));
end

This test applies the custom fixture and verifies that the displayed column of hexadecimal
representation is as expected.

At the command prompt, run the test.

run(SampleTest);

Running SampleTest
.
Done SampleTest
__________

See Also
[Link]

Related Examples
• “Create Advanced Custom Fixture” on page 34-57
• “Write Tests Using Shared Fixtures” on page 34-52

34-56
Create Advanced Custom Fixture

Create Advanced Custom Fixture


This example shows how to create a custom fixture that sets an environment variable. Prior to
testing, this fixture will save the current UserName variable.

Create UserNameEnvironmentVariableFixture Class Definition

In a file in your working folder, create a new class, UserNameEnvironmentVariableFixture that


inherits from the [Link] class. Since you want to pass the fixture a
user name, create a UserName property to pass the data between methods.
classdef UserNameEnvironmentVariableFixture < ...
[Link]

properties (SetAccess=private)
UserName
end

Define Fixture Constructor

In the methods block of the UserNameEnvironmentVariableFixture.m file, create a constructor


method that validates the input and defines the SetupDescription. Have the constructor accept a
character vector and set the fixture’s UserName property.
methods
function fixture = UserNameEnvironmentVariableFixture(name)
validateattributes(name, {'char'}, {'row'}, '','UserName')
[Link] = name;
[Link] = sprintf( ...
'Set the UserName environment variable to "%s".',...
[Link]);
end

Implement setup Method

Subclasses of the Fixture class must implement the setup method. Use this method to save the
original UserName variable. This method also defines the TeardownDescription and registers the
teardown task of setting the UserName to the original state after testing.

Define the setup method within the methods block of the


UserNameEnvironmentVariableFixture.m file.
function setup(fixture)
originalUserName = getenv('UserName');
[Link](originalUserName, ...
'An existing UserName environment variable must be defined.')
[Link](@setenv, 'UserName', originalUserName)
[Link] = sprintf(...
'Restored the UserName environment variable to "%s".',...
originalUserName);
setenv('UserName', [Link])
end
end

Implement isCompatible Method

Classes that derive from Fixture must implement the isCompatible method if the constructor is
configurable. Since you can configure the UserName property through the constructor,
UserNameEnvironmentVariableFixture must implement isCompatible.

34-57
34 Unit Testing

The isCompatible method is called with two instances of the same class. In this case, it is called
with two instances of UserNameEnvironmentVariableFixture. The testing framework considers
the two instances compatible if their UserName properties are equal.

In a new methods block within UserNameEnvironmentVariableFixture.m, define an


isCompatible method which returns logical 1 (true) or logical 0 (false).
methods (Access=protected)
function bool = isCompatible(fixture, other)
bool = strcmp([Link], [Link]);
end
end

Fixture Class Definition Summary

Below are the complete contents of UserNameEnvironmentVariableFixture.m.


classdef UserNameEnvironmentVariableFixture < ...
[Link]

properties (SetAccess=private)
UserName
end

methods
function fixture = UserNameEnvironmentVariableFixture(name)
validateattributes(name, {'char'}, {'row'}, '','UserName')
[Link] = name;
[Link] = sprintf( ...
'Set the UserName environment variable to "%s".',...
[Link]);
end

function setup(fixture)
originalUserName = getenv('UserName');
[Link](originalUserName, ...
'An existing UserName environment variable must be defined.')
[Link](@setenv, 'UserName', originalUserName)
[Link] = sprintf(...
'Restored the UserName environment variable to "%s".',...
originalUserName);
setenv('UserName', [Link])
end
end

methods (Access=protected)
function bool = isCompatible(fixture, other)
bool = strcmp([Link], [Link]);
end
end
end

Apply Custom Fixture to Single Test Class

In a file in your working folder, create the following test class, ExampleTest.m.

classdef ExampleTest < [Link]


methods(TestMethodSetup)
function mySetup(testCase)
[Link](...
UserNameEnvironmentVariableFixture('David'));
end
end

methods (Test)
function t1(~)

34-58
Create Advanced Custom Fixture

fprintf(1, 'Current UserName: "%s"', getenv('UserName'))


end
end
end

This test uses the UserNameEnvironmentVariableFixture for each test in the ExampleTest
class.

At the command prompt, run the test.


run(ExampleTest);

Running ExampleTest
Current UserName: "David".
Done ExampleTest
__________

Apply Custom Fixture as Shared Fixture

In your working folder, create three test classes using a shared fixture. Using a shared fixture allows
the UserNameEnvironmentVariableFixture to be shared across classes.

Create testA.m as follows.


classdef (SharedTestFixtures={...
UserNameEnvironmentVariableFixture('David')}) ...
testA < [Link]
methods (Test)
function t1(~)
fprintf(1, 'Current UserName: "%s"', getenv('UserName'))
end
end
end

Create testB.m as follows.


classdef (SharedTestFixtures={...
UserNameEnvironmentVariableFixture('Andy')}) ...
testB < [Link]
methods (Test)
function t1(~)
fprintf(1, 'Current UserName: "%s"', getenv('UserName'))
end
end
end

Create testC.m as follows.


classdef (SharedTestFixtures={...
UserNameEnvironmentVariableFixture('Andy')}) ...
testC < [Link]
methods (Test)
function t1(~)
fprintf(1, 'Current UserName: "%s"', getenv('UserName'))
end
end
end

At the command prompt, run the tests.

34-59
34 Unit Testing

runtests({'testA','testB','testC'});

Setting up UserNameEnvironmentVariableFixture
Done setting up UserNameEnvironmentVariableFixture: Set the UserName environment variable to "Dav
__________

Running testA
Current UserName: "David".
Done testA
__________

Tearing down UserNameEnvironmentVariableFixture


Done tearing down UserNameEnvironmentVariableFixture: Restored the UserName environment variable
__________

Setting up UserNameEnvironmentVariableFixture
Done setting up UserNameEnvironmentVariableFixture: Set the UserName environment variable to "And
__________

Running testB
Current UserName: "Andy".
Done testB
__________

Running testC
Current UserName: "Andy".
Done testC
__________

Tearing down UserNameEnvironmentVariableFixture


Done tearing down UserNameEnvironmentVariableFixture: Restored the UserName environment variable
__________

Recall that the fixtures are compatible if their UserName properties match. The tests in testA and
testB use incompatible shared fixtures, since 'David' is not equal to 'Andy'. Therefore, the
framework invokes the fixture teardown and setup methods between calls to testA and testB.
However, the shared test fixture in testC is compatible with the fixture in testB, so the framework
does not repeat fixture teardown and setup before testC.

Alternative Approach to Calling addTeardown in setup Method

An alternate approach to using the addTeardown method within the setup method is to implement a
separate teardown method . Instead of the setup method described above, implement the following
setup and teardown methods within UserNameEnvironmentVariableFixture.m.

Alternate UserNameEnvironmentVariableFixture Class Definition


classdef UserNameEnvironmentVariableFixture < ...
[Link]

properties (Access=private)
OriginalUser
end
properties (SetAccess=private)
UserName
end

methods
function fixture = UserNameEnvironmentVariableFixture(name)
validateattributes(name, {'char'}, {'row'}, '','UserName')

34-60
Create Advanced Custom Fixture

[Link] = name;
[Link] = sprintf( ...
'Set the UserName environment variable to "%s".',...
[Link]);
end

function setup(fixture)
[Link] = getenv('UserName');
[Link]([Link], ...
'An existing UserName environment variable must be defined.')
setenv('UserName', [Link])
end

function teardown(fixture)
[Link] = sprintf(...
'Restored the UserName environment variable to "%s".',...
[Link]);
setenv('UserName', [Link])

end
end

methods (Access=protected)
function bool = isCompatible(fixture, other)
bool = strcmp([Link], [Link]);
end
end
end

The setup method does not contain a call to addTeardown or a definition for
TeardownDescription. These tasks are relegated to the teardown method. The alternative class
definition contains an additional property, OriginalUser, which allows the information to be passed
between methods.

See Also
[Link]

Related Examples
• “Create Basic Custom Fixture” on page 34-55
• “Write Tests Using Shared Fixtures” on page 34-52

34-61
34 Unit Testing

Use Parameters in Class-Based Tests


Often, you need to iteratively run tests that are different only in terms of test data. For example, you
might want to test that a function produces the expected outputs for different inputs. In this case, the
test logic is the same and the only difference between tests is the actual and expected values for each
function call. With parameterized testing, you can implement code to iteratively run tests using
different data values. When a method is parameterized, the testing framework automatically invokes
the method for each parameter value. Therefore, you are not required to implement a separate
method for each value.

How to Write Parameterized Tests


Classes that derive from the [Link] class can implement test
parameterization using framework-specific property and method attributes. To provide data as a
parameter in your class-based test, specify the data in a properties block with an appropriate
parameterization attribute. Then, pass the parameterization property as an input argument to one or
more methods.

For example, consider the SampleTest class. The class defines a parameterized test, because it
specifies a property within a properties block with the TestParameter attribute. The property is
passed to the test method and is used to perform qualification:

classdef SampleTest < [Link]


properties (TestParameter)
num = {1,2,'3',4,5};
end
methods(Test)
function testDouble(testCase,num)
[Link](num,'double')
end
end
end

Because num is a cell array with five elements, the test class results in a parameterized test suite with
five elements:

suite = testsuite('SampleTest');
{[Link]}'

ans =

5×1 cell array

{'SampleTest/testDouble(num=value1)'}
{'SampleTest/testDouble(num=value2)'}
{'SampleTest/testDouble(num=value3)'}
{'SampleTest/testDouble(num=value4)'}
{'SampleTest/testDouble(num=value5)'}

When you define a parameterization property, you must specify a default value for the property.
Specify the default value as a nonempty cell array or scalar structure with at least one field. MATLAB
uses the default value to specify parameter names and values in the test suite:

34-62
Use Parameters in Class-Based Tests

• If the property value is a cell array of character vectors, MATLAB generates parameter names
from the values in the cell array. Otherwise, MATLAB specifies parameter names as value1,
value2, …, valueN.
• If the property value is a structure, structure fields represent the parameter names and structure
values represent the parameter values. To include descriptive parameter names in the suite,
define the parameters using a structure instead of a cell array.

You can use local functions in classdef files to assign default values to parameterization properties.
However, the local functions must return a cell array or scalar structure.

The testing framework enables you to specify parameters at different test levels. Additionally, when
you call a test class method with multiple parameters, you can specify how the method should be
invoked for different combinations of the parameters. To get started, see “Create Basic Parameterized
Test” on page 34-66.

Specify Parameterization Level


You can parameterize a test class at class setup, method setup, and test levels. Parameterizing at
each level requires the parameterization properties to have a specific property attribute. For
example, a TestClassSetup method can be parameterized using a property defined in a
properties block with the ClassSetupParameter attribute.

This table shows different parameterization levels and the required method and property attributes
for each level.

Parameterization Parameterization Definition Accessible


Level Method Attribute Property Attribute Parameterization
Properties
Class setup level TestClassSetup ClassSetupParamete ClassSetupParamete
r r
Method setup level TestMethodSetup MethodSetupParamet MethodSetupParamet
er er and
ClassSetupParamete
r
Test level Test TestParameter TestParameter,
MethodSetupParamet
er, and
ClassSetupParamete
r

A parameterized method can access parameterization properties depending on the level at which the
method is defined:

• A parameterized TestClassSetup method can access parameterization properties only with the
ClassSetupParameter attribute.
• A parameterized TestMethodSetup method can access parameterization properties only with the
MethodSetupParameter or ClassSetupParameter attributes.
• A parameterized Test method can access any parameterization properties.

For an example of how to parameterize a test class at different levels, see “Create Advanced
Parameterized Test” on page 34-71.

34-63
34 Unit Testing

Specify How Parameters Are Combined


When you pass more than one parameterization property to a method, you can use the
ParameterCombination method attribute to specify how parameters are combined. The testing
framework invokes the method for the specified combinations.

This table shows different parameter combination strategies.

ParameterCombination Method Invocation


Attribute
'exhaustive' (default) Methods are invoked for all combinations of parameter values. The
testing framework uses this default combination if you do not specify
the ParameterCombination attribute.
'sequential' Methods are invoked with corresponding values from each parameter.
Each parameter must contain the same number of values. For example,
if a method is provided with two parameterization properties and each
property specifies three parameter values, then the framework invokes
the method three times.
'pairwise' Methods are invoked for every pair of parameter values at least one
time. For example, if a method is provided with three parameterization
properties, the testing framework guarantees that the method is
invoked for every combination of parameter values specified by any
two properties.

Compared to 'exhaustive' combination, 'pairwise' combination


typically results in fewer tests and therefore faster test execution.
While the framework guarantees that tests are created for every pair
of values at least one time, you should not rely on the suite size,
ordering, or specific set of test suite elements.

You can combine parameters at class setup, method setup, and test levels. For example, use the
combined method attributes TestMethodSetup, ParameterCombination = 'sequential' to
specify sequential combination of the method setup-level parameters defined in the properties
block with the MethodSetupParameter attribute.

For examples of how to combine test parameters, see “Create Basic Parameterized Test” on page 34-
66 and “Create Advanced Parameterized Test” on page 34-71.

Use External Parameters in Tests


When you create a parameterized test, you can redefine the parameters by injecting inputs into your
class-based test. To provide data that is defined outside of the test file, create a Parameter instance
and use the 'ExternalParameter' option when creating your test suite. For more information, see
“Use External Parameters in Parameterized Test” on page 34-78.

See Also
[Link] | [Link] |
[Link]

34-64
Use Parameters in Class-Based Tests

More About
• “Create Basic Parameterized Test” on page 34-66
• “Create Advanced Parameterized Test” on page 34-71
• “Use External Parameters in Parameterized Test” on page 34-78

34-65
34 Unit Testing

Create Basic Parameterized Test


This example shows how to create a parameterized test to test the output of a function in terms of
value, class, and size.

Create Function to Test

In your current folder, create a function in the file sierpinski.m. This function returns a matrix
representing an image of a Sierpinski carpet fractal. It takes as input the fractal level and an optional
data type.
function carpet = sierpinski(levels,classname)
if nargin == 1
classname = 'single';
end

msize = 3^levels;
carpet = ones(msize,classname);

cutCarpet(1,1,msize,levels) % Begin recursion

function cutCarpet(x,y,s,cl)
if cl
ss = s/3; % Define subsize
for lx = 0:2
for ly = 0:2
if lx == 1 && ly == 1
% Remove center square
carpet(x+ss:x+2*ss-1,y+ss:y+2*ss-1) = 0;
else
% Recurse
cutCarpet(x+lx*ss,y+ly*ss,ss,cl-1)
end
end
end
end
end
end

Create TestCarpet Test Class

In a file in your current folder, create the TestCarpet class to test the sierpinski function. Define
the properties used for parameterized testing in a properties block with the TestParameter
attribute.
classdef TestCarpet < [Link]
properties (TestParameter)
type = {'single','double','uint16'};
level = struct('small',2,'medium',4,'large',6);
side = struct('small',9,'medium',81,'large',729);
end
end

The type property contains the different data types you want to test. The level property contains
the different fractal levels you want to test. The side property contains the number of rows and
columns in the Sierpinski carpet matrix and corresponds to the level property. To provide
meaningful names for each parameter, level and side are defined as structures.

34-66
Create Basic Parameterized Test

Define Test methods Block

In a methods block with the Test attribute, define three test methods:

• The testRemainPixels method tests the output of the sierpinski function by verifying that
the number of nonzero pixels is the same as expected for a particular level. This method uses the
level property and, therefore, results in three test elements—one for each value in level.
• The testClass method tests the class of the output from the sierpinski function with each
combination of the type and level parameter values (that is, exhaustive parameter
combination). The method results in nine test elements.
• The testDefaultL1Output method does not use a TestParameter property and, therefore, is
not parameterized. The method verifies that the level 1 matrix contains the expected values.
Because the test method is not parameterized, it results in one test element.

classdef TestCarpet < [Link]


properties (TestParameter)
type = {'single','double','uint16'};
level = struct('small',2,'medium',4,'large',6);
side = struct('small',9,'medium',81,'large',729);
end

methods (Test)
function testRemainPixels(testCase,level)
expPixelCount = 8^level;
actPixels = find(sierpinski(level));
[Link](actPixels,expPixelCount)
end

function testClass(testCase,type,level)
[Link]( ...
sierpinski(level,type),type)
end

function testDefaultL1Output(testCase)
exp = single([1 1 1; 1 0 1; 1 1 1]);
[Link](sierpinski(1),exp)
end
end
end

Define Test methods Block with ParameterCombination Attribute

Define the testNumel method to ensure that the matrix returned by the sierpinski function has
the correct number of elements. Set the ParameterCombination attribute for the method to
'sequential'. Because the level and side properties each specify three parameter values, the
testNumel method is invoked three times — one time for each of the 'small', 'medium', and
'large' values.

classdef TestCarpet < [Link]


properties (TestParameter)
type = {'single','double','uint16'};
level = struct('small',2,'medium',4,'large',6);
side = struct('small',9,'medium',81,'large',729);
end

methods (Test)

34-67
34 Unit Testing

function testRemainPixels(testCase,level)
expPixelCount = 8^level;
actPixels = find(sierpinski(level));
[Link](actPixels,expPixelCount)
end

function testClass(testCase,type,level)
[Link]( ...
sierpinski(level,type),type)
end

function testDefaultL1Output(testCase)
exp = single([1 1 1; 1 0 1; 1 1 1]);
[Link](sierpinski(1),exp)
end
end

methods (Test, ParameterCombination = 'sequential')


function testNumel(testCase,level,side)
import [Link]
[Link](sierpinski(level), ...
HasElementCount(side^2))
end
end
end

Run All Tests

At the command prompt, create a suite from TestCarpet.m. The suite has 16 test elements.
MATLAB includes parameterization information in the names of the suite elements.

suite = [Link]('TestCarpet.m');
{[Link]}'

ans =

16×1 cell array

{'TestCarpet/testNumel(level=small,side=small)' }
{'TestCarpet/testNumel(level=medium,side=medium)'}
{'TestCarpet/testNumel(level=large,side=large)' }
{'TestCarpet/testRemainPixels(level=small)' }
{'TestCarpet/testRemainPixels(level=medium)' }
{'TestCarpet/testRemainPixels(level=large)' }
{'TestCarpet/testClass(type=single,level=small)' }
{'TestCarpet/testClass(type=single,level=medium)'}
{'TestCarpet/testClass(type=single,level=large)' }
{'TestCarpet/testClass(type=double,level=small)' }
{'TestCarpet/testClass(type=double,level=medium)'}
{'TestCarpet/testClass(type=double,level=large)' }
{'TestCarpet/testClass(type=uint16,level=small)' }
{'TestCarpet/testClass(type=uint16,level=medium)'}
{'TestCarpet/testClass(type=uint16,level=large)' }
{'TestCarpet/testDefaultL1Output' }

Run the tests.

[Link]

34-68
Create Basic Parameterized Test

Running TestCarpet
.......... ......
Done TestCarpet
__________

ans =

1×16 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
16 Passed, 0 Failed, 0 Incomplete.
2.459 seconds testing time.

Run Tests with level Property Named 'small'

Use the selectIf method of TestSuite to select test elements that use a particular
parameterization. Select all test elements that use the parameter name 'small' in the level
parameterization property list. The filtered suite has five elements.
s1 = [Link]('ParameterName','small');
{[Link]}'

ans =

5×1 cell array

{'TestCarpet/testNumel(level=small,side=small)' }
{'TestCarpet/testRemainPixels(level=small)' }
{'TestCarpet/testClass(type=single,level=small)'}
{'TestCarpet/testClass(type=double,level=small)'}
{'TestCarpet/testClass(type=uint16,level=small)'}

Run the filtered test suite.


[Link];

Running TestCarpet
.....
Done TestCarpet
__________

Alternatively, you can create the same test suite directly using the fromFile method of TestSuite.
import [Link]
s1 = [Link]('TestCarpet.m', ...
HasParameter('Name','small'));

See Also
[Link] | [Link] |
[Link]

34-69
34 Unit Testing

Related Examples
• “Create Advanced Parameterized Test” on page 34-71
• “Use Parameters in Class-Based Tests” on page 34-62

34-70
Create Advanced Parameterized Test

Create Advanced Parameterized Test


This example shows how to create a test that is parameterized in the TestClassSetup,
TestMethodSetup, and Test methods blocks. The example test class tests random number
generation.

Create TestRand Test Class

In a file in your current folder, create the TestRand class to test various aspects of random number
generation. Define the properties used for parameterized testing.
classdef TestRand < [Link]
properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end

properties (MethodSetupParameter)
seed = {0,123,4294967295};
end

properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end
end

In the TestRand class, each properties block corresponds to parameterization at a particular


level. The class setup-level parameterization defines the type of random number generator. The
method setup-level parameterization defines the seed for the random number generator, and the test-
level parameterization defines the data type and size of the random values.

Define Test Class and Test Method Setup Methods

Define the setup methods at the test class and test method levels. These methods register the initial
random number generator state. After the framework runs the tests, the methods restore the original
state. The classSetup method defines the type of random number generator, and the methodSetup
method seeds the generator.
classdef TestRand < [Link]
properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end

properties (MethodSetupParameter)
seed = {0,123,4294967295};
end

properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end

methods (TestClassSetup)

34-71
34 Unit Testing

function classSetup(testCase,generator)
orig = rng;
[Link](@rng,orig)
rng(0,generator)
end
end

methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
[Link](@rng,orig)
rng(seed)
end
end
end

Define Test Method with Sequential Parameter Combination

Define the testSize method in a methods block with the Test and ParameterCombination =
'sequential' attributes.

classdef TestRand < [Link]


properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end

properties (MethodSetupParameter)
seed = {0,123,4294967295};
end

properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end

methods (TestClassSetup)
function classSetup(testCase,generator)
orig = rng;
[Link](@rng,orig)
rng(0,generator)
end
end

methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
[Link](@rng,orig)
rng(seed)
end
end

methods (Test, ParameterCombination = 'sequential')


function testSize(testCase,dim1,dim2,dim3)
[Link](rand(dim1,dim2,dim3),[dim1 dim2 dim3])
end

34-72
Create Advanced Parameterized Test

end
end

The method tests the size of the output for each corresponding parameter value in dim1, dim2, and
dim3. For a given TestClassSetup and TestMethodSetup parameterization, the framework calls
the testSize method three times — one time for each of the 'small', 'medium', and 'large'
values. For example, to test with all of the 'medium' values, the framework uses
[Link](rand(2,3,4),[2 3 4]).

Define Test Method with Pairwise Parameter Combination

Define the testRepeatable method in a methods block with the Test and
ParameterCombination = 'pairwise' attributes.
classdef TestRand < [Link]
properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end

properties (MethodSetupParameter)
seed = {0,123,4294967295};
end

properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end

methods (TestClassSetup)
function classSetup(testCase,generator)
orig = rng;
[Link](@rng,orig)
rng(0,generator)
end
end

methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
[Link](@rng,orig)
rng(seed)
end
end

methods (Test, ParameterCombination = 'sequential')


function testSize(testCase,dim1,dim2,dim3)
[Link](rand(dim1,dim2,dim3),[dim1 dim2 dim3])
end
end

methods (Test, ParameterCombination = 'pairwise')


function testRepeatable(testCase,dim1,dim2,dim3)
state = rng;
firstRun = rand(dim1,dim2,dim3);
rng(state)
secondRun = rand(dim1,dim2,dim3);

34-73
34 Unit Testing

[Link](firstRun,secondRun)
end
end
end

The method verifies that the random number generator results are repeatable. For a given
TestClassSetup and TestMethodSetup parameterization, the framework calls the
testRepeatble method 10 times to ensure testing with each pair of parameter values specified by
dim1, dim2, and dim3. If the parameter combination were exhaustive, the framework would call the
method 3³ = 27 times.

Define Test Method with Exhaustive Parameter Combination

Define the testClass method in a methods block with the Test attribute. Because the
ParameterCombination attribute is not specified, the parameter combination is exhaustive by
default.

classdef TestRand < [Link]


properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end

properties (MethodSetupParameter)
seed = {0,123,4294967295};
end

properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end

methods (TestClassSetup)
function classSetup(testCase,generator)
orig = rng;
[Link](@rng,orig)
rng(0,generator)
end
end

methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
[Link](@rng,orig)
rng(seed)
end
end

methods (Test, ParameterCombination = 'sequential')


function testSize(testCase,dim1,dim2,dim3)
[Link](rand(dim1,dim2,dim3),[dim1 dim2 dim3])
end
end

methods (Test, ParameterCombination = 'pairwise')


function testRepeatable(testCase,dim1,dim2,dim3)

34-74
Create Advanced Parameterized Test

state = rng;
firstRun = rand(dim1,dim2,dim3);
rng(state)
secondRun = rand(dim1,dim2,dim3);
[Link](firstRun,secondRun)
end
end

methods (Test)
function testClass(testCase,dim1,dim2,type)
[Link](rand(dim1,dim2,type),type)
end
end
end

The method verifies that the class of the output from rand is the same as the expected class. For a
given TestClassSetup and TestMethodSetup parameterization, the framework calls the
testClass method 3×3×2 = 18 times to ensure testing with each combination of dim1, dim2, and
type parameter values.

Create Suite from Test Class

At the command prompt, create a suite from the TestRand class.

suite = [Link](?TestRand)

suite =

1×279 Test array with properties:

Name
ProcedureName
TestClass
BaseFolder
Parameterization
SharedTestFixtures
Tags

Tests Include:
17 Unique Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.

For a given TestClassSetup and TestMethodSetup parameterization, the framework creates


3+10+18 = 31 test elements. These 31 elements are called for each TestMethodSetup
parameterization (resulting in 3×31 = 93 test elements for each TestClassSetup
parameterization). There are three TestClassSetup parameterizations; therefore, the suite has a
total of 3×93 = 279 test elements.

Query the name of the first test element.

suite(1).Name

ans =

'TestRand[generator=twister]/[seed=value1]testClass(dim1=small,dim2=small,type=single)'

The name of the first element is composed of these parts:

• Test class: TestRand

34-75
34 Unit Testing

• Class setup property and parameter name: [generator=twister]


• Method setup property and parameter name: [seed=value1]
• Test method name: testClass
• Test method property and parameter names: (dim1=small,dim2=small,type=single)

The parameter name for the seed property is not particularly meaningful (value1). The testing
framework provided this name because the seed property is specified as a cell array. For a more
meaningful name, define the seed property as a structure with descriptive field names.

Run Suite Created Using Selector

At the command prompt, create a selector to select test elements that test the 'twister' generator
for 'single' precision. Create a suite by omitting test elements that use properties with the
'large' parameter name.

import [Link]
s = HasParameter('Property','generator','Name','twister') & ...
HasParameter('Property','type','Name','single') & ...
~HasParameter('Name','large');

suite2 = [Link](?TestRand,s)

suite2 =

1×12 Test array with properties:

Name
ProcedureName
TestClass
BaseFolder
Parameterization
SharedTestFixtures
Tags

Tests Include:
9 Unique Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.

If you first generate the full suite from the TestRand class, you can construct the same filtered suite
using the selectIf method.

suite = [Link](?TestRand);
suite2 = selectIf(suite,s);

Run the filtered test suite.

[Link];

Running TestRand
.......... ..
Done TestRand
__________

Run Suite from Method Using Selector

Create a selector that omits test elements that use properties with the 'large' or 'medium'
parameter names. Limit results to test elements from the testRepeatable method.

34-76
Create Advanced Parameterized Test

import [Link]
s = ~(HasParameter('Name','large') | HasParameter('Name','medium'));

suite3 = [Link](?TestRand,'testRepeatable',s);
{[Link]}'

ans =

9×1 cell array

{'TestRand[generator=twister]/[seed=value1]testRepeatable(dim1=small,dim2=small,dim3=small)' }
{'TestRand[generator=twister]/[seed=value2]testRepeatable(dim1=small,dim2=small,dim3=small)' }
{'TestRand[generator=twister]/[seed=value3]testRepeatable(dim1=small,dim2=small,dim3=small)' }
{'TestRand[generator=combRecursive]/[seed=value1]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=combRecursive]/[seed=value2]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=combRecursive]/[seed=value3]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=multFibonacci]/[seed=value1]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=multFibonacci]/[seed=value2]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=multFibonacci]/[seed=value3]testRepeatable(dim1=small,dim2=small,dim3=small)'}

Run the test suite.

[Link];

Running TestRand
.........
Done TestRand
__________

Run All Double Precision Tests

At the command prompt, run all of the test elements from the TestRand class that use the 'double'
parameter name.

runtests('TestRand','ParameterName','double');

Running TestRand
.......... .......... .......... .......... ..........
.......... .......... .......... .
Done TestRand
__________

See Also
[Link] | [Link] |
[Link]

Related Examples
• “Create Basic Parameterized Test” on page 34-66
• “Use Parameters in Class-Based Tests” on page 34-62

34-77
34 Unit Testing

Use External Parameters in Parameterized Test


You can inject variable inputs into your existing class-based test. To provide test data that is defined
outside the test file and that should be used iteratively by the test (via parameterized testing), create
a Parameter and use the 'ExternalParameters' option to TestSuite creation methods such as
[Link].

Create the following function to test. The function accepts an array, vectorizes the array, removes 0,
Nan, and Inf, and then sorts the array.

function Y = cleanData(X)
Y = X(:); % Vectorize array
Y = rmmissing(Y); % Remove NaN
% Remove 0 and Inf
idx = (Y==0 | Y==Inf);
Y = Y(~idx);
% If array is empty, set to eps
if isempty(Y)
Y = eps;
end
Y = sort(Y); % Sort vector
end

Create the following parameterized test for the cleanData function. The test repeats each of the
four test methods for the two data sets that are defined in the properties block.

classdef TestClean < [Link]


properties (TestParameter)
Data = struct('clean',[5 3 9;1 42 5;32 5 2],...
'needsCleaning',[1 13;NaN 0;Inf 42]);
end
methods (Test)
function classCheck(testCase,Data)
act = cleanData(Data);
[Link](act,'double')
end
function sortCheck(testCase,Data)
act = cleanData(Data);
[Link](issorted(act))
end
function finiteCheck(testCase,Data)
import [Link]
act = cleanData(Data);
[Link](act,IsFinite)
end
function noZeroCheck(testCase,Data)
import [Link]
import [Link]
act = cleanData(Data);
[Link](EveryElementOf(act),~IsEqualTo(0))
end
end
end

34-78
Use External Parameters in Parameterized Test

Create and run a parameterized test suite. View the results. The framework runs the eight
parameterized tests using the data defined in the test file.
import [Link]
suite1 = [Link](?TestClean);
results = [Link];
table(results)

Running TestClean
........
Done TestClean
__________

ans =

8×6 table

Name Passed Failed Incomplete Duration


_____________________________________________ ______ ______ __________ _________

{'TestClean/classCheck(Data=clean)' } true false false 0.19182


{'TestClean/classCheck(Data=needsCleaning)' } true false false 0.0037433
{'TestClean/sortCheck(Data=clean)' } true false false 0.0030112
{'TestClean/sortCheck(Data=needsCleaning)' } true false false 0.0023779
{'TestClean/finiteCheck(Data=clean)' } true false false 0.044825
{'TestClean/finiteCheck(Data=needsCleaning)'} true false false 0.0031761
{'TestClean/noZeroCheck(Data=clean)' } true false false 0.73055
{'TestClean/noZeroCheck(Data=needsCleaning)'} true false false 0.0070594

Create a data set external to the test file.


A = [NaN 2 0;1 Inf 3];

Create a parameter with the external data set. The fromData method accepts the name of the
parameterized property from the properties block in TestClean and the new data as a cell array
(or struct).
import [Link]
newData = {A};
param = [Link]('Data',newData);

Create a new test suite and view the suite element names. The fromClass method accepts the new
parameter.
suite2 = [Link](?TestClean,'ExternalParameters',param);
{[Link]}'

ans =

4×1 cell array

{'TestClean/classCheck(Data=value1#ext)' }
{'TestClean/sortCheck(Data=value1#ext)' }
{'TestClean/finiteCheck(Data=value1#ext)'}
{'TestClean/noZeroCheck(Data=value1#ext)'}

34-79
34 Unit Testing

Using the external parameter, the framework creates four suite elements. Since the parameters are
defined as a cell array, MATLAB generates the parameter name (value1). Also, it appends the
characters #ext to the end of the parameter name, indicating the parameter is defined externally.

To assign meaningful parameter names (instead of valueN), define the parameter using a struct.
View the suite element names and run the tests.

newData = struct('commandLineData',A);
param = [Link]('Data',newData);
suite2 = [Link](?TestClean,'ExternalParameters',param);
{[Link]}'
results = [Link];

ans =

4×1 cell array

{'TestClean/classCheck(Data=commandLineData#ext)' }
{'TestClean/sortCheck(Data=commandLineData#ext)' }
{'TestClean/finiteCheck(Data=commandLineData#ext)'}
{'TestClean/noZeroCheck(Data=commandLineData#ext)'}

Running TestClean
....
Done TestClean
__________

Create another data set that is stored in an ASCII-delimited file.

B = rand(3);
B(2,4) = 0;
dlmwrite('[Link]',B)
clear B

Create a parameter with the stored data set and A.

newData = struct('commandLineData',A,'storedData',dlmread('[Link]'));
param2 = [Link]('Data',newData);
suite3 = [Link](?TestClean,'ExternalParameters',param2);

To run the tests using parameters defined in the test file and externally, concatenate test suites. View
the suite element names and run the tests.

suite = [suite1 suite3];


{[Link]}'
results = [Link];

ans =

16×1 cell array

{'TestClean/classCheck(Data=clean)' }
{'TestClean/classCheck(Data=needsCleaning)' }
{'TestClean/sortCheck(Data=clean)' }
{'TestClean/sortCheck(Data=needsCleaning)' }

34-80
Use External Parameters in Parameterized Test

{'TestClean/finiteCheck(Data=clean)' }
{'TestClean/finiteCheck(Data=needsCleaning)' }
{'TestClean/noZeroCheck(Data=clean)' }
{'TestClean/noZeroCheck(Data=needsCleaning)' }
{'TestClean/classCheck(Data=commandLineData#ext)' }
{'TestClean/classCheck(Data=storedData#ext)' }
{'TestClean/sortCheck(Data=commandLineData#ext)' }
{'TestClean/sortCheck(Data=storedData#ext)' }
{'TestClean/finiteCheck(Data=commandLineData#ext)'}
{'TestClean/finiteCheck(Data=storedData#ext)' }
{'TestClean/noZeroCheck(Data=commandLineData#ext)'}
{'TestClean/noZeroCheck(Data=storedData#ext)' }

Running TestClean
........
Done TestClean
__________

Running TestClean
........
Done TestClean
__________

See Also
[Link] | [Link]

Related Examples
• “Create Basic Parameterized Test” on page 34-66
• “Create Advanced Parameterized Test” on page 34-71
• “Use Parameters in Class-Based Tests” on page 34-62

34-81
34 Unit Testing

Create Simple Test Suites


This example shows how to combine tests into test suites, using the SolverTest test case. Use the
static from* methods in the [Link] class to create suites for combinations
of your tests, whether they are organized in packages and classes or files and folders, or both.

Create Quadratic Solver Function

Create the following function that solves roots of the quadratic equation in a file,
quadraticSolver.m, in your working folder.

function roots = quadraticSolver(a, b, c)


% quadraticSolver returns solutions to the
% quadratic equation a*x^2 + b*x + c = 0.

if ~isa(a,'numeric') || ~isa(b,'numeric') || ~isa(c,'numeric')


error('quadraticSolver:InputMustBeNumeric', ...
'Coefficients must be numeric.');
end

roots(1) = (-b + sqrt(b^2 - 4*a*c)) / (2*a);


roots(2) = (-b - sqrt(b^2 - 4*a*c)) / (2*a);

end

Create Test for Quadratic Solver Function

Create the following test class in a file, SolverTest.m, in your working folder.

classdef SolverTest < [Link]


% SolverTest tests solutions to the quadratic equation
% a*x^2 + b*x + c = 0

methods (Test)
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2,1];
[Link](actSolution,expSolution);
end
function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i, -1-3i];
[Link](actSolution,expSolution);
end
end

end

Import TestSuite Class

At the command prompt, add the [Link] class to the current import list.

import [Link]

Make sure the SolverTest class definition file is on your MATLAB path.

34-82
Create Simple Test Suites

Create Suite from SolverTest Class

The fromClass method creates a suite from all Test methods in the SolverTest class.

suiteClass = [Link](?SolverTest);
result = run(suiteClass);

Create Suite from SolverTest Class Definition File

The fromFile method creates a suite using the name of the file to identify the class.

suiteFile = [Link]('SolverTest.m');
result = run(suiteFile);

Create Suite from All Test Case Files in Current Folder

The fromFolder method creates a suite from all test case files in the specified folder. For example,
the following files are in the current folder:

• BankAccountTest.m
• DocPolynomTest.m
• FigurePropertiesTest.m
• IsSupportedTest.m
• SolverTest.m

suiteFolder = [Link](pwd);
result = run(suiteFolder);

Create Suite from Single Test Method

The fromMethod method creates a suite from a single test method.

suiteMethod = [Link](?SolverTest,'testRealSolution')'
result = run(suiteMethod);

See Also
[Link]

Related Examples
• “Write Simple Test Case Using Classes” on page 34-40

34-83
34 Unit Testing

Run Tests for Various Workflows


In this section...
“Set Up Example Tests” on page 34-84
“Run All Tests in Class or Function” on page 34-84
“Run Single Test in Class or Function” on page 34-84
“Run Test Suites by Name” on page 34-85
“Run Test Suites from Test Array” on page 34-85
“Run Tests with Customized Test Runner” on page 34-86

Set Up Example Tests


To explore different ways to run tests, create a class-based test and a function-based test in your
current working folder. For the class-based test file use the DocPolynomTest example test presented
in the [Link] example. For the function-based test file
use the axesPropertiesTest example test presented in “Write Test Using Setup and Teardown
Functions” on page 34-28.

Run All Tests in Class or Function


Use the run method of the TestCase class to directly run tests contained in a single test file. When
running tests directly, you do not need to explicitly create a Test array.
% Directly run a single file of class-based tests
results1 = run(DocPolynomTest);

% Directly run a single file of function-based tests


results2 = run(axesPropertiesTest);

You can also assign the test file output to a variable and run the tests using the functional form or dot
notation.
% Create Test or TestCase objects
t1 = DocPolynomTest; % TestCase object from class-based test
t2 = axesPropertiesTest; % Test object from function-based test

% Run tests using functional form


results1 = run(t1);
results2 = run(t2);

% Run tests using dot notation


results1 = [Link];
results2 = [Link];

Alternatively, you can run tests contained in a single file by using runtests or from the Editor.

Run Single Test in Class or Function


Run a single test from within a class-based test file by specifying the test method as an input
argument to the run method. For example, only run the test, testMultiplication, from the
DocPolynomTest file.

34-84
Run Tests for Various Workflows

results1 = run(DocPolynomTest,'testMultiplication');

Function-based test files return an array of Test objects instead of a single TestCase object. You
can run a particular test by indexing into the array. However, you must examine the Name field in the
test array to ensure you run the correct test. For example, only run the test, surfaceColorTest,
from the axesPropertiesTest file.

t2 = axesPropertiesTest; % Test object from function-based test


t2(:).Name

ans =

axesPropertiesTest/testDefaultXLim

ans =

axesPropertiesTest/surfaceColorTest

The surfaceColorTest test corresponds to the second element in the array.

Only run the surfaceColorTest test.

results2 = t2(2).run; % or results2 = run(t2(2));

Alternatively, you can run a single test from the Editor.

Run Test Suites by Name


You can run a group, or suite, of tests together. To run the test suite using runtests, the suite is
defined as a cell array of character vectors representing a test file, a test class, a package that
contains tests or a folder that contains tests.

suite = {'axesPropertiesTest','DocPolynomTest'};
runtests(suite);

Run all tests in the current folder using the pwd as input to the runtests function.

runtests(pwd);

Alternatively, you can explicitly create Test arrays and use the run method to run them.

Run Test Suites from Test Array


You can explicitly create Test arrays and use the run method in the TestSuite class to run them.
Using this approach, you explicitly define TestSuite objects and, therefore, can examine the
contents. The runtests function does not return the TestSuite object.

import [Link]
s1 = [Link](?DocPolynomTest);
s2 = [Link]('axesPropertiesTest.m');

% generate test suite and then run


fullSuite = [s1 s2];
result = run(fullSuite);

34-85
34 Unit Testing

Since the suite is explicitly defined, it is easy for you to perform further analysis on the suite, such as
rerunning failed tests.

failedTests = fullSuite([[Link]]);
result2 = run(failedTests);

Run Tests with Customized Test Runner


You can specialize the test running by defining a custom test runner and adding plugins. The run
method of the TestRunner class operates on a TestSuite object.

import [Link]
import [Link]
import [Link]

% Generate TestSuite.
s1 = [Link](?DocPolynomTest);
s2 = [Link]('axesPropertiesTest.m');
suite = [s1 s2];

% Create silent test runner.


runner = [Link];

% Add plugin to display test progress.


[Link]([Link](2))

% Run tests using customized runner.


result = run(runner,[suite]);

See Also
run (TestCase) | run (TestRunner) | run (TestSuite) | runtests

More About
• “Run Tests in Editor” on page 34-17

34-86
Programmatically Access Test Diagnostics

Programmatically Access Test Diagnostics


If you run tests with the runtests function or the run method of TestSuite or TestCase, the test
framework uses a DiagnosticsRecordingPlugin plugin that records diagnostics on test results.

After you run tests, you can access recorded diagnostics via the DiagnosticRecord field in the
Details property on TestResult. For example, if your test results are stored in the variable
results, find the recorded diagnostics for the second test in the suite by invoking records =
result(2).[Link].

The recorded diagnostics are DiagnosticRecord objects. To access particular types of test
diagnostics for a particular test, use the selectFailed, selectPassed, selectIncomplete, and
selectLogged methods of the DiagnosticRecord class.

By default, the DiagnosticsRecordingPlugin plugin records qualification failures and events


logged at a Terse level. To configure the plugin to record passing diagnostics or other logged
messages at different verbosity levels, configure an instance of DiagnosticsRecordingPlugin and
add it to the test runner.

See Also
[Link] | [Link]
| [Link]

Related Examples
• “Add Plugin to Test Runner” on page 34-88

34-87
34 Unit Testing

Add Plugin to Test Runner


This example shows how to add a plugin to the test runner. The
[Link] displays progress messages about a test
case. This plugin is part of the [Link] package. MATLAB® uses it for default test
runners.

Create a Test for the BankAccount Class

In a file in your working folder, create a test file for the BankAccount class.

type BankAccountTest.m

classdef BankAccountTest < [Link]


% Tests the BankAccount class.

methods (TestClassSetup)
function addBankAccountClassToPath(testCase)
p = path;
[Link](@path,p);
addpath(fullfile(matlabroot,'help','techdoc','matlab_oop',...
'examples'));
end
end

methods (Test)
function testConstructor(testCase)
b = BankAccount(1234, 100);
[Link]([Link], 1234, ...
'Constructor failed to correctly set account number');
[Link]([Link], 100, ...
'Constructor failed to correctly set account balance');
end

function testConstructorNotEnoughInputs(testCase)
import [Link];
[Link](@()BankAccount, ...
Throws('MATLAB:minrhs'));
end

function testDesposit(testCase)
b = BankAccount(1234, 100);
[Link](25);
[Link]([Link], 125);
end

function testWithdraw(testCase)
b = BankAccount(1234, 100);
[Link](25);
[Link]([Link], 75);
end

function testNotifyInsufficientFunds(testCase)
callbackExecuted = false;
function testCallback(~,~)
callbackExecuted = true;
end

34-88
Add Plugin to Test Runner

b = BankAccount(1234, 100);
[Link]('InsufficientFunds', @testCallback);

[Link](50);
[Link](callbackExecuted, ...
'The callback should not have executed yet');
[Link](60);
[Link](callbackExecuted, ...
'The listener callback should have fired');
end
end
end

Create Test Suite

At the command prompt, create a test suite, ts, from the BankAccountTest test case.

ts = [Link](?BankAccountTest);

Show Results with No Plugins

Create a test runner with no plugins.

runner = [Link];
res = [Link](ts);

No output displayed.

Customize Test Runner

Add the custom plugin, TestRunProgressPlugin.

import [Link]
[Link]([Link](2))
res = [Link](ts);

Running BankAccountTest
.....
Done BankAccountTest
__________

MATLAB displays progress messages about BankAccountTest.

See Also
[Link]

34-89
34 Unit Testing

Write Plugins to Extend TestRunner


In this section...
“Custom Plugins Overview” on page 34-90
“Extending Test Session Level Plugin Methods” on page 34-90
“Extending Test Suite Level Plugin Methods” on page 34-91
“Extending Test Class Level Plugin Methods” on page 34-91
“Extending Test Level Plugin Methods” on page 34-92

Custom Plugins Overview


TestRunnerPlugin methods have four levels: test session, test suite, test class, and test. At each
level, you implement methods to extend the running of tests. Additionally, you implement methods at
the test suite, test class, and test levels to extend the creation, setup, and teardown of tests or test
fixtures.

At the test suite, test class, and test levels, the reportFinalizedResult method enables the
TestRunner to report finalized test results. A test result is finalized when no remaining test content
can modify it. The TestRunner determines if it invokes the reportFinalizedResult method at
each level. At the test session level, the reportFinalizedSuite method enables the TestRunner
to report test results once the test suite is finalized.

The TestRunner runs different methods as shown in the figure.

The creation methods are the only set of TestRunnerPlugin methods with an output argument.
Typically, you extend the creation methods to listen for various events originating from the test
content at the corresponding level. Since both TestCase and Fixture instances inherit from the
handle class, you add listeners using the addlistener method. The methods that set up, run, and
tear down test content extend the way the TestRunner evaluates the test content.

Extending Test Session Level Plugin Methods


The TestRunnerPlugin methods at the test session level extend the running and reporting of the
test suite passed to the TestRunner. These methods fall within the scope of the runSession
method.

34-90
Write Plugins to Extend TestRunner

The run method at this level, runTestSuite, extends the running of a portion of the entire
TestSuite array that the testing framework passes to the TestRunner. The
reportFinalizedSuite method extends the reporting of a test suite that has been finalized by
runTestSuite.

Extending Test Suite Level Plugin Methods


The TestRunnerPlugin methods at the test suite level extend the creation, setup, running, and
teardown of shared test fixtures. These methods fall within the scope of the runTestSuite method.

Type of Method Test Level Falls Within Scope of runTestSuite


creation method createSharedTestFixture
setup method setupSharedTestFixture
run method runTestClass
teardown method teardownSharedTestFixture

At this level, the createSharedTestFixture method is the only plugin method with an output
argument. It returns the Fixture instances for each shared fixture required by a test class. These
fixture instances are available to the test through the getSharedTestFixtures method of
TestCase.

The run method at this level, runTestClass, extends the running of tests that belong to the same
test class or the same function-based test, and incorporates the functionality described for the test
class level plugin methods.

Extending Test Class Level Plugin Methods


The TestRunnerPlugin methods at the test class level extend the creation, setup, running, and
teardown of test suite elements that belong to the same test class or the same function-based test.
These methods apply to a subset of the full TestSuite array that the TestRunner runs.

Type of Method Test Level Falls Within Scope of runTestClass


creation method createTestClassInstance
setup method setupTestClass
run method runTest
teardown method teardownTestClass

At this level, the createTestClassInstance method is the only plugin method with an output
argument. It returns the TestCase instances created at the class level. For each class, the testing
framework passes the instance into any methods with the TestClassSetup or
TestClassTeardown attribute.

A test class setup is parameterized if it contains properties with the ClassSetupParameter


attribute. In this case, the testing framework evaluates the setupTestClass and
teardownTestClass methods as many times as the class setup parameterization dictates.

The run method at this level, runTest, extends the running of a single TestSuite element, and
incorporates the functionality described for the test level plugin methods.

34-91
34 Unit Testing

The testing framework evaluates methods at the test class level within the scope of the
runTestClass method. If the TestClassSetup code completes successfully, it invokes the
runTest method one time for each element in the TestSuite array. Each TestClassSetup
parameterization invokes the creation, setup, and teardown methods a single time.

Extending Test Level Plugin Methods


The TestRunnerPlugin methods at the test level extend the creation, setup, running, and teardown
of a single test suite element. A single Test element consists of one test method or, if the test is
parameterized, one instance of the test parameterization.

Type of Method Test Level Falls Within Scope of runTest


creation method createTestMethodInstance
setup method setupTestMethod
run method runTestMethod
teardown method teardownTestMethod

At this level, the createTestMethodInstance method is the only plugin method with an output
argument. It returns the TestCase instances created for each Test element. The testing framework
passes each of these instances into the corresponding Test methods, and into any methods with the
TestMethodSetup or TestMethodTeardown attribute.

The testing framework evaluates methods at the test level within the scope of the runTest method.
Provided the framework completes all TestMethodSetup work, it invokes the plugin methods at this
level a single time per Test element.

See Also
addlistener | [Link] | [Link] |
[Link] | [Link] |
[Link] | [Link] |
[Link]

Related Examples
• “Create Custom Plugin” on page 34-93
• “Run Tests in Parallel with Custom Plugin” on page 34-98
• “Plugin to Generate Custom Test Output Format” on page 34-115
• “Write Plugin to Save Diagnostic Details” on page 34-111

34-92
Create Custom Plugin

Create Custom Plugin


This example shows how to create a custom plugin that counts the number of passing and failing
assertions when the TestRunner is running a test suite. The plugin prints a brief summary at the
end of the testing. To extend the TestRunner, the plugin subclasses and overrides select methods of
the [Link] class.

Create AssertionCountingPlugin Class

In a file in your current folder, create the custom plugin class AssertionCountingPlugin, which
inherits from the TestRunnerPlugin class. For the complete code for
AssertionCountingPlugin, see AssertionCountingPlugin Class Definition Summary on page 34-
0 .

To keep track of the number of passing and failing assertions, define two read-only properties,
NumPassingAssertions and NumFailingAssertions, within a properties block.

properties (SetAccess = private)


NumPassingAssertions
NumFailingAssertions
end

Extend Running of TestSuite

Implement the runTestSuite method in a methods block with protected access.

methods (Access = protected)


function runTestSuite(plugin, pluginData)
suiteSize = numel([Link]);
fprintf('## Running a total of %d tests\n', suiteSize)

[Link] = 0;
[Link] = 0;

runTestSuite@[Link](...
plugin, pluginData);

fprintf('## Done running tests\n')


[Link]()
end
end

The testing framework evaluates this method one time. It displays information about the total number
of tests, initializes the properties used by the plugin to generate text output, and invokes the
superclass method. After the framework completes evaluating the superclass method, the
runTestSuite method displays the assertion count summary by calling the helper method
printAssertionSummary (see Define Helper Methods on page 34-0 ).

Extend Creation of Shared Test Fixtures and TestCase Instances

Add listeners to AssertionPassed and AssertionFailed events to count the assertions. To add
these listeners, extend the methods used by the testing framework to create the test content. The test
content includes TestCase instances for each Test element, class-level TestCase instances for the
TestClassSetup and TestClassTeardown methods, and Fixture instances used when a
TestCase class has the SharedTestFixtures attribute.

34-93
34 Unit Testing

Invoke the corresponding superclass method when you override the creation methods. The creation
methods return the content that the testing framework creates for each of their respective contexts.
When implementing one of these methods using the incrementPassingAssertionsCount and
incrementFailingAssertionsCount helper methods on page 34-0 , add the listeners required
by the plugin to the returned Fixture or TestCase instance.

Add these creation methods to a methods block with protected access.

methods (Access = protected)


function fixture = createSharedTestFixture(plugin, pluginData)
fixture = createSharedTestFixture@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestClassInstance(plugin, pluginData)


testCase = createTestClassInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestMethodInstance(plugin, pluginData)


testCase = createTestMethodInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end
end

Extend Running of Single Test Suite Element

Extend runTest to display the name of each test at run time. Include this method in a methods
block with protected access. Like all plugin methods, the runTest method requires you to invoke
the corresponding superclass method.

methods (Access = protected)


function runTest(plugin, pluginData)
fprintf('### Running test: %s\n', [Link])

runTest@[Link](...
plugin, pluginData);
end
end

34-94
Create Custom Plugin

Define Helper Methods

In a methods block with private access, define three helper methods. These methods increment the
number of passing or failing assertions, and print the assertion count summary.

methods (Access = private)


function incrementPassingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function incrementFailingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', ...
[Link] + [Link])
fprintf('\t%d Passed, %d Failed\n', ...
[Link], [Link])
end
end

AssertionCountingPlugin Class Definition Summary

The following code provides the complete contents of AssertionCountingPlugin.


classdef AssertionCountingPlugin < ...
[Link]

properties (SetAccess = private)


NumPassingAssertions
NumFailingAssertions
end

methods (Access = protected)


function runTestSuite(plugin, pluginData)
suiteSize = numel([Link]);
fprintf('## Running a total of %d tests\n', suiteSize)

[Link] = 0;
[Link] = 0;

runTestSuite@[Link](...
plugin, pluginData);

fprintf('## Done running tests\n')


[Link]()
end

function fixture = createSharedTestFixture(plugin, pluginData)


fixture = createSharedTestFixture@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestClassInstance(plugin, pluginData)


testCase = createTestClassInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);

34-95
34 Unit Testing

[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestMethodInstance(plugin, pluginData)


testCase = createTestMethodInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function runTest(plugin, pluginData)


fprintf('### Running test: %s\n', [Link])

runTest@[Link](...
plugin, pluginData);
end
end

methods (Access = private)


function incrementPassingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function incrementFailingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', ...
[Link] + [Link])
fprintf('\t%d Passed, %d Failed\n', ...
[Link], [Link])
end
end
end

Create Example Test Class

In your current folder, create a file named ExampleTest.m containing the following test class.
classdef ExampleTest < [Link]
methods(Test)
function testOne(testCase) % Test fails
[Link](5, 4)
end
function testTwo(testCase) % Test passes
[Link](5, 5)
end
function testThree(testCase) % Test passes
[Link](7*2, 14)
end
end
end

Add Plugin to TestRunner and Run Tests

At the command prompt, create a test suite from the ExampleTest class.
import [Link]
import [Link]

suite = [Link](?ExampleTest);

34-96
Create Custom Plugin

Create a TestRunner instance with no plugins. This code creates a silent runner and gives you
control over the installed plugins.

runner = [Link];

Run the tests.

result = [Link](suite);

Add AssertionCountingPlugin to the runner and run the tests.

[Link](AssertionCountingPlugin)
result = [Link](suite);

## Running a total of 3 tests


### Running test: ExampleTest/testOne
### Running test: ExampleTest/testTwo
### Running test: ExampleTest/testThree
## Done running tests
______________________________
Total Assertions: 2
1 Passed, 1 Failed

See Also
addlistener | [Link] | [Link] |
[Link] | [Link] |
[Link]

Related Examples
• “Write Plugins to Extend TestRunner” on page 34-90
• “Run Tests in Parallel with Custom Plugin” on page 34-98
• “Write Plugin to Save Diagnostic Details” on page 34-111

34-97
34 Unit Testing

Run Tests in Parallel with Custom Plugin


This example shows how to create a custom plugin that supports running tests in parallel. The
custom plugin counts the number of passing and failing assertions for a test suite. To extend the
TestRunner, the plugin overrides select methods of the
[Link] class. Additionally, to support running tests in
parallel, the plugin subclasses the [Link] interface. To run
tests in parallel, you need Parallel Computing Toolbox.

Create Plugin Class

In a file in your current folder, create the parallelizable plugin class AssertionCountingPlugin,
which inherits from both the TestRunnerPlugin and Parallelizable classes. For the complete
code for AssertionCountingPlugin, see Plugin Class Definition Summary on page 34-0 .

To keep track of the number of passing and failing assertions, define four read-only properties within
a properties block. Each MATLAB worker on the current parallel pool uses
NumPassingAssertions and NumFailingAssertions to track the number of passing and failing
assertions when running a portion of the TestSuite array. The MATLAB client uses
FinalizedNumPassingAssertions and FinalizedNumFailingAssertions to aggregate the
results from different workers and to report the total number of passing and failing assertions at the
end of the test session.

properties (SetAccess = private)


NumPassingAssertions
NumFailingAssertions
FinalizedNumPassingAssertions
FinalizedNumFailingAssertions
end

Extend Running of Test Session

To extend the running of the entire TestSuite array, override the runSession method of
TestRunnerPlugin in a methods block with protected access. The testing framework evaluates
this method one time on the client.

methods (Access = protected)


function runSession(plugin, pluginData)
suiteSize = numel([Link]);
fprintf('## Running a total of %d tests\n\n', suiteSize);
[Link] = 0;
[Link] = 0;

runSession@[Link](plugin, pluginData);

fprintf('## Done running tests\n')


[Link]()
end
end

runSession displays information about the total number of Test elements, initializes the properties
used by the plugin to generate text output, and invokes the superclass method to trigger the entire
test run. After the framework completes evaluating the superclass method, runSession displays the
assertion count summary by calling the helper method printAssertionSummary (see Define Helper
Methods on page 34-0 ).

34-98
Run Tests in Parallel with Custom Plugin

Extend Creation of Shared Test Fixtures and TestCase Instances

Add listeners to AssertionPassed and AssertionFailed events to count the assertions. To add
these listeners, extend the methods used by the testing framework to create the test content. The test
content includes TestCase instances for each Test element, class-level TestCase instances for the
TestClassSetup and TestClassTeardown method blocks, and Fixture instances used when a
TestCase class has the SharedTestFixtures attribute.

Invoke the corresponding superclass method when you override the creation methods. The creation
methods return the content that the testing framework creates for each of their respective contexts.
When implementing one of these methods using the incrementPassingAssertionsCount and
incrementFailingAssertionsCount helper methods on page 34-0 , add the listeners required
by the plugin to the returned Fixture or TestCase instance.

Add these creation methods to a methods block with protected access.


methods (Access = protected)
function fixture = createSharedTestFixture(plugin, pluginData)
fixture = createSharedTestFixture@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestClassInstance(plugin, pluginData)


testCase = createTestClassInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestMethodInstance(plugin, pluginData)


testCase = createTestMethodInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end
end

Extend Running of Test Suite Portion

The testing framework divides the entire TestSuite array into different groups and assigns them to
workers for processing. Each worker can run one or more test suite portions. To customize the
behavior of workers, override the runTestSuite method of TestRunnerPlugin in a methods
block with protected access.

Extend the TestRunner to display the identifier of each test group that a worker runs along with the
number of Test elements within the group. Additionally, store the number of passing and failing

34-99
34 Unit Testing

assertions in a buffer so that the client can retrieve these values to produce the finalized results. Like
all plugin methods, the runTestSuite method requires you to invoke the corresponding superclass
method at an appropriate point. In this case, invoke the superclass method after initializing the
properties and before storing the worker data. The testing framework evaluates runTestSuite on
the workers as many times as the number of test suite portions.
methods (Access = protected)
function runTestSuite(plugin, pluginData)
suiteSize = numel([Link]);
groupNumber = [Link];
fprintf('### Running a total of %d tests in group %d\n', ...
suiteSize, groupNumber);
[Link] = 0;
[Link] = 0;

runTestSuite@[Link](...
plugin, pluginData);

assertionStruct = struct('Passing', [Link], ...


'Failing', [Link]);
[Link]([Link], assertionStruct);
end
end

To store test-specific data, the implementation of runTestSuite contains a call to the storeIn
method of the Parallelizable interface. Use storeIn along with retrieveFrom when workers
must report to the client. In this example, after returning from the superclass method,
NumPassingAssertions and NumFailingAssertions contain the number of passing and failing
assertions corresponding to a group of tests. Because storeIn accepts the worker data as only one
input argument, assertionStruct groups the assertion counts using two fields.

Extend Reporting of Finalized Test Suite Portion

Extend reportFinalizedSuite to aggregate the assertion counts by retrieving test data for each
finalized test suite portion. To retrieve the stored assertionStruct for a test suite portion, invoke
the retrieveFrom method within the scope of reportFinalizedSuite. Add the field values to the
corresponding class properties, and invoke the superclass method. The testing framework evaluates
this method on the client as many times as the number of test suite portions.
methods (Access = protected)
function reportFinalizedSuite(plugin, pluginData)
assertionStruct = [Link]([Link]);
[Link] = ...
[Link] + [Link];
[Link] = ...
[Link] + [Link];

reportFinalizedSuite@[Link](...
plugin, pluginData);
end
end

Define Helper Methods

In a methods block with private access, define three helper methods. These methods increment the
number of passing or failing assertions within each running test suite portion, and print the assertion
count summary.

34-100
Run Tests in Parallel with Custom Plugin

methods (Access = private)


function incrementPassingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function incrementFailingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', [Link] + ...
[Link])
fprintf('\t%d Passed, %d Failed\n', [Link], ...
[Link])
end
end

Plugin Class Definition Summary

The following code provides the complete contents of AssertionCountingPlugin.


classdef AssertionCountingPlugin < ...
[Link] & ...
[Link]

properties (SetAccess = private)


NumPassingAssertions
NumFailingAssertions
FinalizedNumPassingAssertions
FinalizedNumFailingAssertions
end

methods (Access = protected)


function runSession(plugin, pluginData)
suiteSize = numel([Link]);
fprintf('## Running a total of %d tests\n\n', suiteSize);
[Link] = 0;
[Link] = 0;

runSession@[Link](plugin, pluginData);

fprintf('## Done running tests\n')


[Link]()
end

function fixture = createSharedTestFixture(plugin, pluginData)


fixture = createSharedTestFixture@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestClassInstance(plugin, pluginData)


testCase = createTestClassInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function testCase = createTestMethodInstance(plugin, pluginData)

34-101
34 Unit Testing

testCase = createTestMethodInstance@...
[Link](plugin, pluginData);

[Link]('AssertionPassed', ...
@(~,~)[Link]);
[Link]('AssertionFailed', ...
@(~,~)[Link]);
end

function runTestSuite(plugin, pluginData)


suiteSize = numel([Link]);
groupNumber = [Link];
fprintf('### Running a total of %d tests in group %d\n', ...
suiteSize, groupNumber);
[Link] = 0;
[Link] = 0;

runTestSuite@[Link](...
plugin, pluginData);

assertionStruct = struct('Passing', [Link], ...


'Failing', [Link]);
[Link]([Link], assertionStruct);
end

function reportFinalizedSuite(plugin, pluginData)


assertionStruct = [Link]([Link]);
[Link] = ...
[Link] + [Link];
[Link] = ...
[Link] + [Link];

reportFinalizedSuite@[Link](...
plugin, pluginData);
end
end

methods (Access = private)


function incrementPassingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function incrementFailingAssertionsCount(plugin)
[Link] = [Link] + 1;
end

function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', [Link] + ...
[Link])
fprintf('\t%d Passed, %d Failed\n', [Link], ...
[Link])
end
end
end

Create Example Test Class

In your current folder, create a file named ExampleTest.m containing the following parameterized
test class. This class results in 300 Test elements, 100 of which are assertion tests that compare
pseudorandom integers between 1 and 10.

classdef ExampleTest < [Link]

properties (TestParameter)
num1 = repmat({@()randi(10)}, 1, 10);
num2 = repmat({@()randi(10)}, 1, 10);
end

34-102
Run Tests in Parallel with Custom Plugin

methods(Test)
function testAssert(testCase, num1, num2)
[Link](num1(), num2())
end
function testVerify(testCase, num1, num2)
[Link](num1(), num2())
end
function testAssume(testCase, num1, num2)
[Link](num1(), num2())
end
end
end

Add Plugin to TestRunner and Run Tests

At the command prompt, create a test suite from the ExampleTest class.

import [Link]
import [Link]

suite = [Link](?ExampleTest);

Create a TestRunner instance with no plugins. This code creates a silent runner and gives you
control over the installed plugins.

runner = [Link];

Add AssertionCountingPlugin to the runner and run the tests in parallel. You can also run the
same tests in serial mode if you invoke the run method on the runner.

[Link](AssertionCountingPlugin)
result = [Link](suite);

Starting parallel pool (parpool) using the 'local' profile ...


Connected to the parallel pool (number of workers: 6).
## Running a total of 300 tests

Split tests into 18 groups and running them on 6 workers.


----------------
Finished Group 6
----------------
### Running a total of 18 tests in group 6

----------------
Finished Group 1
----------------
### Running a total of 20 tests in group 1

----------------
Finished Group 2
----------------
### Running a total of 20 tests in group 2

----------------
Finished Group 3
----------------
### Running a total of 19 tests in group 3

34-103
34 Unit Testing

----------------
Finished Group 4
----------------
### Running a total of 19 tests in group 4

----------------
Finished Group 5
----------------
### Running a total of 18 tests in group 5

----------------
Finished Group 7
----------------
### Running a total of 18 tests in group 7

----------------
Finished Group 8
----------------
### Running a total of 17 tests in group 8

----------------
Finished Group 9
----------------
### Running a total of 17 tests in group 9

-----------------
Finished Group 10
-----------------
### Running a total of 17 tests in group 10

-----------------
Finished Group 11
-----------------
### Running a total of 16 tests in group 11

-----------------
Finished Group 12
-----------------
### Running a total of 16 tests in group 12

-----------------
Finished Group 15
-----------------
### Running a total of 15 tests in group 15

-----------------
Finished Group 14
-----------------
### Running a total of 15 tests in group 14

-----------------
Finished Group 17
-----------------
### Running a total of 14 tests in group 17

-----------------
Finished Group 16

34-104
Run Tests in Parallel with Custom Plugin

-----------------
### Running a total of 14 tests in group 16

-----------------
Finished Group 13
-----------------
### Running a total of 15 tests in group 13

-----------------
Finished Group 18
-----------------
### Running a total of 12 tests in group 18

## Done running tests


______________________________
Total Assertions: 100
88 Passed, 12 Failed

See Also
addlistener | [Link] | [Link] |
[Link] | [Link] |
[Link] | [Link] |
[Link] | runInParallel

Related Examples
• “Write Plugins to Extend TestRunner” on page 34-90
• “Create Custom Plugin” on page 34-93

34-105
34 Unit Testing

Write Plugin to Add Data to Test Results


This example shows how to create a plugin that adds data to TestResult objects. The plugin
appends the actual and expected values in an assertion to the Details property of the TestResult
object. To extend the TestRunner, the plugin overrides select methods of the
[Link] class.

Create Plugin Class

In a file in your current folder, create the custom plugin class DetailsRecordingPlugin, which
inherits from the TestRunnerPlugin class. For the complete code for DetailsRecordingPlugin,
see DetailsRecordingPlugin Class Definition Summary on page 34-0 .

To store the actual and expected values in TestResult objects, define two constant properties,
ActField and ExpField, within a properties block. Set the value of ActField to the name of the
field of the Details structure that contains the actual value. Set the value of ExpField to the name
of the field that contains the expected value.
properties (Constant,Access = private)
ActField = 'ActualValue';
ExpField = 'ExpectedValue';
end

Add Fields to Details Property

To add new fields to the Details property of all TestResult objects belonging to the test session,
override the runSession method of TestRunnerPlugin in a methods block with protected
access. runSession adds two empty fields to the Details structure of TestResult objects and
invokes the superclass method to trigger the entire test run.
methods (Access = protected)
function runSession(plugin,pluginData)
resultDetails = [Link];
[Link]([Link],{})
[Link]([Link],{})
runSession@[Link](plugin,pluginData);
end
end

To add the fields, the implementation of runSession contains calls to the append method of the
[Link] class. Each call adds an empty field to
the Details structure.

Extend Creation of Shared Test Fixtures and TestCase Instances

Add listeners for the AssertionPassed and AssertionFailed events by extending the methods
used by the testing framework to create the test content. The test content includes TestCase
instances for each Test element, class-level TestCase instances for the TestClassSetup and
TestClassTeardown method blocks, and Fixture instances used when a TestCase class has the
SharedTestFixtures attribute.

Invoke the corresponding superclass method when you override the creation methods. The listeners
that you add to the returned Fixture or TestCase instances cause the reactToAssertion helper
method on page 34-0 to execute whenever an assertion is performed. To add assertion data to test
results, pass the result modifier instance along with the assertion event listener data to the helper
method.

34-106
Write Plugin to Add Data to Test Results

Add these creation methods to a methods block with protected access.

methods (Access = protected)


function fixture = createSharedTestFixture(plugin, pluginData)
fixture = createSharedTestFixture@...
[Link](plugin, pluginData);
resultDetails = [Link];
[Link]('AssertionPassed',...
@(~,evd)[Link](evd,resultDetails));
[Link]('AssertionFailed',...
@(~,evd)[Link](evd,resultDetails));
end

function testCase = createTestClassInstance(plugin,pluginData)


testCase = createTestClassInstance@...
[Link](plugin,pluginData);
resultDetails = [Link];
[Link]('AssertionPassed',...
@(~,evd)[Link](evd,resultDetails));
[Link]('AssertionFailed',...
@(~,evd)[Link](evd,resultDetails));
end

function testCase = createTestMethodInstance(plugin,pluginData)


testCase = createTestMethodInstance@...
[Link](plugin,pluginData);
resultDetails = [Link];
[Link]('AssertionPassed',...
@(~,evd)[Link](evd,resultDetails));
[Link]('AssertionFailed',...
@(~,evd)[Link](evd,resultDetails));
end
end

Define Helper Method

In a methods block with private access, define the helper method reactToAssertion. This
method uses the QualificationEventData instance to extract the actual and expected values in
assertions based on the IsEqualTo constraint, converts the extracted values to cell arrays, and
appends the cell arrays to the fields of the corresponding TestResult object.

methods (Access = private)


function reactToAssertion(plugin,evd,resultDetails)
if ~isa([Link],'[Link]')
return
end
[Link]([Link],{[Link]})
[Link]([Link],{[Link]})
end
end

DetailsRecordingPlugin Class Definition Summary

This code provides the complete contents of DetailsRecordingPlugin.


classdef DetailsRecordingPlugin < [Link]
properties (Constant, Access = private)
ActField = 'ActualValue';
ExpField = 'ExpectedValue';

34-107
34 Unit Testing

end

methods (Access = protected)


function runSession(plugin,pluginData)
resultDetails = [Link];
[Link]([Link],{})
[Link]([Link],{})
runSession@[Link](plugin,pluginData);
end

function fixture = createSharedTestFixture(plugin, pluginData)


fixture = createSharedTestFixture@...
[Link](plugin, pluginData);
resultDetails = [Link];
[Link]('AssertionPassed',...
@(~,evd)[Link](evd,resultDetails));
[Link]('AssertionFailed',...
@(~,evd)[Link](evd,resultDetails));
end

function testCase = createTestClassInstance(plugin,pluginData)


testCase = createTestClassInstance@...
[Link](plugin,pluginData);
resultDetails = [Link];
[Link]('AssertionPassed',...
@(~,evd)[Link](evd,resultDetails));
[Link]('AssertionFailed',...
@(~,evd)[Link](evd,resultDetails));
end

function testCase = createTestMethodInstance(plugin,pluginData)


testCase = createTestMethodInstance@...
[Link](plugin,pluginData);
resultDetails = [Link];
[Link]('AssertionPassed',...
@(~,evd)[Link](evd,resultDetails));
[Link]('AssertionFailed',...
@(~,evd)[Link](evd,resultDetails));
end
end

methods (Access = private)


function reactToAssertion(plugin,evd,resultDetails)
if ~isa([Link],'[Link]')
return
end
[Link]([Link],{[Link]})
[Link]([Link],{[Link]})
end
end
end

Create Example Test Class

In your current folder, create a file named ExampleTest.m containing the following parameterized
test class. The class results in a test suite with 25 elements, each corresponding to an experiment
performed using a different seed for the random number generator. In each experiment, the testing
framework creates a 1-by-100 vector of normally distributed random numbers and asserts that the
magnitude of the difference between the actual and expected sample means is within 0.1.
classdef ExampleTest < [Link]
properties
SampleSize = 100;
end

properties (TestParameter)
seed = num2cell(randi(10^6,1,25));
end

34-108
Write Plugin to Add Data to Test Results

methods(Test)
function testMean(testCase,seed)
import [Link]
import [Link]
rng(seed)
[Link](mean(randn(1,[Link])),...
IsEqualTo(0,'Within',AbsoluteTolerance(0.1)));
end
end
end

Add Plugin to TestRunner and Run Tests

At the command prompt, create a test suite from the ExampleTest class.

import [Link]
import [Link]

suite = [Link](?ExampleTest);

Create a TestRunner instance with no plugins. This code creates a silent runner and gives you
control over the installed plugins.

runner = [Link];

Add DetailsRecordingPlugin to the runner and run the tests.

[Link](DetailsRecordingPlugin)
result = [Link](suite)

result =

1×25 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
18 Passed, 7 Failed (rerun), 7 Incomplete.
0.12529 seconds testing time.

To retrieve more information about the behavior of random number generation, create a structure
array from the Details structures of the test results.
details = [[Link]]

details =

1×25 struct array with fields:

ActualValue
ExpectedValue

34-109
34 Unit Testing

Create an array containing the difference between the actual and expected values in each test and
then display the error values in a bar graph. The seven bars with a length greater than 0.1
correspond to the failed tests.
errorInMean = cell2mat([[Link]]) - cell2mat([[Link]]);

bar(errorInMean)
xlabel('Experiment')
ylabel('Error')

See Also
addlistener | [Link] | [Link] |
[Link] | [Link] |
[Link] |
[Link]

Related Examples
• “Write Plugins to Extend TestRunner” on page 34-90
• “Create Custom Plugin” on page 34-93

34-110
Write Plugin to Save Diagnostic Details

Write Plugin to Save Diagnostic Details


This example shows how to create a custom plugin to save diagnostic details. The plugin listens for
test failures and saves diagnostic information so you can access it after the framework completes the
tests.

Create Plugin

In a file in your working folder, create a class, myPlugin, that inherits from the
[Link] class. In the plugin class:

• Define a FailedTestData property on the plugin that stores information from failed tests.
• Override the default createTestMethodInstance method of TestRunnerPlugin to listen for
assertion, fatal assertion, and verification failures, and to record relevant information.
• Override the default runTestSuite method of TestRunnerPlugin to initialize the
FailedTestData property value. If you do not initialize value of the property, each time you run
the tests using the same test runner, failed test information is appended to the FailedTestData
property.
• Define a helper function, recordData, to save information about the test failure as a table.

The plugin saves information contained in the PluginData and QualificationEventData objects.
It also saves the type of failure and timestamp.

classdef DiagnosticRecorderPlugin < [Link]

properties
FailedTestData
end

methods (Access = protected)


function runTestSuite(plugin, pluginData)
[Link] = [];
runTestSuite@...
[Link](plugin, pluginData);
end

function testCase = createTestMethodInstance(plugin, pluginData)


testCase = createTestMethodInstance@...
[Link](plugin, pluginData);

testName = [Link];
[Link]('AssertionFailed', ...
@(~,event)[Link](event,testName, 'Assertion'));
[Link]('FatalAssertionFailed', ...
@(~,event)[Link](event,testName, 'Fatal Assertion'));
[Link]('VerificationFailed', ...
@(~,event)[Link](event,testName, 'Verification'));
end
end

methods (Access = private)


function recordData(plugin,eventData,name,failureType)
[Link] = {name};
[Link] = {failureType};
if isempty([Link])

34-111
34 Unit Testing

[Link] = 'TestDiagnostics not provided';


else
[Link] = [Link];
end
[Link] = [Link];
[Link] = [Link];
[Link] = datetime;

[Link] = [[Link]; struct2table(s)];


end
end
end

Create Test Class

In your working folder, create the file ExampleTest.m containing the following test class.
classdef ExampleTest < [Link]
methods(Test)
function testOne(testCase)
[Link](5,10)
end
function testTwo(testCase)
wrongAnswer = 'wrong';
[Link](wrongAnswer,'Not Empty')
[Link](wrongAnswer,'double','Not double')
end

function testThree(testCase)
[Link](7*2,13,'Values not equal')
end
function testFour(testCase)
[Link](3+2,6);
end
end
end

The fatal assertion failure in testFour causes the framework to halt and throw an error. In this
example, there are no subsequent tests. If there was a subsequent test, the framework would not run
it.

Add Plugin to Test Runner and Run Tests

At the command prompt, create a test suite from the ExampleTest class, and create a test runner.
import [Link]
import [Link]

suite = [Link](?ExampleTest);
runner = [Link];

Create an instance of myPlugin and add it to the test runner. Run the tests.
p = DiagnosticRecorderPlugin;
[Link](p)
result = [Link](suite);

Error using ExampleTest/testFour (line 16)


Fatal assertion failed.

34-112
Write Plugin to Save Diagnostic Details

With the failed fatal assertion, the framework throws an error, and the test runner does not return a
TestResult object. However, the DiagnosticRecorderPlugin stores information about the tests
preceding and including the test with the failed assertion.

Inspect Diagnostic Information

At the command prompt, view information about the failed tests. The information is saved in the
FailedTestData property of the plugin.

T = [Link]

T =

5×6 table

Name Type TestDiagnostics


_______________________ _________________ ______________________________ ___________________________________

'ExampleTest/testOne' 'Assertion' 'TestDiagnostics not provided' 'assertGreaterThan failed.↵--> The


'ExampleTest/testTwo' 'Verification' 'Not Empty' 'verifyEmpty failed.↵--> The value
'ExampleTest/testTwo' 'Verification' 'Not double' 'verifyClass failed.↵--> The value'
'ExampleTest/testThree' 'Assertion' 'Values not equal' 'assertEqual failed.↵--> The values
'ExampleTest/testFour' 'Fatal Assertion' 'TestDiagnostics not provided' 'fatalAssertEqual failed.↵--> The v

There are many options to archive or post-process this information. For example, you can save the
variable as a MAT-file or use writetable to write the table to various file types, such as .txt, .csv,
or .xls.

View the stack information for the third test failure

[Link](3)

ans =

struct with fields:

file: 'C:\Work\ExampleTest.m'
name: '[Link]'
line: 9

Display the diagnostics that the framework displayed for the fifth test failure.

celldisp([Link](5))

ans{1} =

fatalAssertEqual failed.
--> The values are not equal using "isequaln".
--> Failure table:
Actual Expected Error RelativeError
______ ________ _____ __________________

5 6 -1 -0.166666666666667

Actual Value:
5

34-113
34 Unit Testing

Expected Value:
6

See Also
addlistener | [Link] | [Link] |
[Link]

Related Examples
• “Write Plugins to Extend TestRunner” on page 34-90
• “Create Custom Plugin” on page 34-93
• “Plugin to Generate Custom Test Output Format” on page 34-115

34-114
Plugin to Generate Custom Test Output Format

Plugin to Generate Custom Test Output Format


This example shows how to create a plugin that uses a custom format to write finalized test results to
an output stream.

Create Plugin

In a file in your working folder, create a class, ExampleCustomPlugin, that inherits from the
[Link] class. In the plugin class:

• Define a Stream property on the plugin that stores the OutputStream instance. By default, the
plugin writes to standard output.
• Override the default runTestSuite method of TestRunnerPlugin to output text that indicates
the test runner is running a new test session. This information is especially useful if you are
writing to a single log file, as it allows you to differentiate the test runs.
• Override the default reportFinalizedResult method of TestRunnerPlugin to write finalized
test results to the output stream. You can modify the print method to output the test results in a
format that works for your test logs or continuous integration system.
classdef ExampleCustomPlugin < [Link]
properties (Access=private)
Stream
end

methods
function p = ExampleCustomPlugin(stream)
if ~nargin
stream = [Link];
end
validateattributes(stream,...
{'[Link]'},{})
[Link] = stream;
end
end

methods (Access=protected)
function runTestSuite(plugin,pluginData)
[Link]('\n--- NEW TEST SESSION at %s ---\n',...
char(datetime))
runTestSuite@...
[Link](plugin,pluginData);
end

function reportFinalizedResult(plugin,pluginData)
thisResult = [Link];
if [Link]
status = 'PASSED';
elseif [Link]
status = 'FAILED';
elseif [Link]
status = 'SKIPPED';
end
[Link](...
'### YPS Company - Test %s ### - %s in %f seconds.\n',...
status,[Link],[Link])

34-115
34 Unit Testing

reportFinalizedResult@...
[Link](plugin,pluginData)
end
end
end

Create Test Class

In your working folder, create the file ExampleTest.m containing the following test class. In this test
class, two of the tests pass and the others result in a verification or assumption failure.
classdef ExampleTest < [Link]
methods(Test)
function testOne(testCase)
[Link](5,1)
end
function testTwo(testCase)
wrongAnswer = 'wrong';
[Link](wrongAnswer,'Not Empty')
[Link](wrongAnswer,'double','Not double')
end
function testThree(testCase)
[Link](7*2,13,'Values not equal')
end
function testFour(testCase)
[Link](3+2,5);
end
end
end

Add Plugin to Test Runner and Run Tests

At the command prompt, create a test suite from the ExampleTest class, and create a test runner.
import [Link]
import [Link]

suite = [Link](?ExampleTest);
runner = [Link];

Create an instance of ExampleCustomPlugin and add it to the test runner. Run the tests.
import [Link]
fname = 'YPS_test_results.txt';
p = ExampleCustomPlugin(ToFile(fname));

[Link](p)
result = [Link](suite);

View the contents of the output file.


type(fname)

--- NEW TEST SESSION at 26-Jan-2015 10:41:24 ---


### YPS Company - Test PASSED ### - ExampleTest/testOne in 0.123284 seconds.
### YPS Company - Test FAILED ### - ExampleTest/testTwo in 0.090363 seconds.
### YPS Company - Test SKIPPED ### - ExampleTest/testThree in 0.518044 seconds.
### YPS Company - Test PASSED ### - ExampleTest/testFour in 0.020599 seconds.

34-116
Plugin to Generate Custom Test Output Format

Rerun the Incomplete tests using the same test runner. View the contents of the output file.

suiteFiltered = suite([[Link]]);
result2 = [Link](suiteFiltered);

type(fname)

--- NEW TEST SESSION at 26-Jan-2015 10:41:24 ---


### YPS Company - Test PASSED ### - ExampleTest/testOne in 0.123284 seconds.
### YPS Company - Test FAILED ### - ExampleTest/testTwo in 0.090363 seconds.
### YPS Company - Test SKIPPED ### - ExampleTest/testThree in 0.518044 seconds.
### YPS Company - Test PASSED ### - ExampleTest/testFour in 0.020599 seconds.

--- NEW TEST SESSION at 26-Jan-2015 10:41:58 ---


### YPS Company - Test SKIPPED ### - ExampleTest/testThree in 0.007892 seconds.

See Also
ToFile | ToStandardOutput | [Link] |
[Link]

Related Examples
• “Write Plugins to Extend TestRunner” on page 34-90
• “Write Plugin to Save Diagnostic Details” on page 34-111

34-117
34 Unit Testing

Analyze Test Case Results


This example shows how to analyze the information returned by a test runner created from the
SolverTest test case.

Create Quadratic Solver Function

Create the following function that solves roots of the quadratic equation in a file,
quadraticSolver.m, in your working folder.

type quadraticSolver.m

function roots = quadraticSolver(a,b,c)


% quadraticSolver returns solutions to the
% quadratic equation a*x^2 + b*x + c = 0.

if ~isa(a,'numeric') || ~isa(b,'numeric') || ~isa(c,'numeric')


error('quadraticSolver:InputMustBeNumeric', ...
'Coefficients must be numeric.');
end

roots(1) = (-b + sqrt(b^2 - 4*a*c)) / (2*a);


roots(2) = (-b - sqrt(b^2 - 4*a*c)) / (2*a);

end

Create Test for Quadratic Solver Function

Create the following test class in a file, SolverTest.m, in your working folder.

type SolverTest.m

classdef SolverTest < [Link]


methods(Test)
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2,1];
[Link](actSolution,expSolution)
end
function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i, -1-3i];
[Link](actSolution,expSolution)
end
function testNonNumericInput(testCase)
[Link](@()quadraticSolver(1,'-3',2), ...
'quadraticSolver:InputMustBeNumeric')
end
end
end

Run SolverTest Test Case

Create a test suite, quadTests.

quadTests = [Link](?SolverTest);
result = run(quadTests);

34-118
Analyze Test Case Results

Running SolverTest
...
Done SolverTest
__________

All tests passed.

Explore Output Argument, result

The output argument, result, is a [Link] object. It contains information


of the two tests in SolverTest.
whos result

Name Size Bytes Class Attributes

result 1x3 7661 [Link]

Display Information for One Test

To see the information for one value, type:


result(1)

ans =
TestResult with properties:

Name: 'SolverTest/testRealSolution'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 1.0125
Details: [1x1 struct]

Totals:
1 Passed, 0 Failed, 0 Incomplete.
1.0125 seconds testing time.

Create Table of Test Results

To access functionality available to tables, create one from the TestResult object.
rt = table(result)

rt=3×6 table
Name Passed Failed Incomplete Duration Detai
____________________________________ ______ ______ __________ ________ _______

{'SolverTest/testRealSolution' } true false false 1.0125 {1x1 st


{'SolverTest/testImaginarySolution'} true false false 0.029232 {1x1 st
{'SolverTest/testNonNumericInput' } true false false 0.46657 {1x1 st

Sort the test results by duration.


sortrows(rt,'Duration')

ans=3×6 table
Name Passed Failed Incomplete Duration Detai

34-119
34 Unit Testing

____________________________________ ______ ______ __________ ________ _______

{'SolverTest/testImaginarySolution'} true false false 0.029232 {1x1 st


{'SolverTest/testNonNumericInput' } true false false 0.46657 {1x1 st
{'SolverTest/testRealSolution' } true false false 1.0125 {1x1 st

Export test results to a CSV file.

writetable(rt,'[Link]','QuoteStrings',true)

See Also

Related Examples
• “Write Simple Test Case Using Classes” on page 34-40

34-120
Analyze Failed Test Results

Analyze Failed Test Results


This example shows how to identify and rerun failed tests.

Create an Incorrect Test Method

Using the SolverTest test case, add a method, testBadRealSolution. This test, based on
testRealSolution, calls the quadraticSolver function with inputs 1,3,2, but tests the results
against an incorrect solution, [2,1].

function testBadRealSolution(testCase)
actSolution = quadraticSolver(1,3,2);
expSolution = [2,1];
[Link](actSolution,expSolution)
end

Run New Test Suite

Save the updated SolverTest class definition and rerun the tests.

quadTests = [Link](?SolverTest);
result1 = run(quadTests);

Running SolverTest
..
================================================================================
Verification failed in SolverTest/testBadRealSolution.

---------------------
Framework Diagnostic:
---------------------
verifyEqual failed.
--> The values are not equal using "isequaln".
--> Failure table:
Index Actual Expected Error RelativeError
_____ ______ ________ _____ _____________

1 -1 2 -3 -1.5
2 -2 1 -3 -3

Actual Value:
-1 -2
Expected Value:
2 1

------------------
Stack Information:
------------------
In C:\work\SolverTest.m ([Link]) at 19
================================================================================
.
Done SolverTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


=============================================================================
SolverTest/testBadRealSolution X Failed by verification.

Analyze Results

The output tells you SolverTest/testBadRealSolution failed. From the Framework


Diagnostic you see the following:

Actual Value:
-1 -2

34-121
34 Unit Testing

Expected Value:
2 1

At this point, you must decide if the error is in quadraticSolver or in your value for expSolution.

Correct Error

Edit the value of expSolution in testBadRealSolution:

expSolution = [-1 -2];

Rerun Tests

Save SolverTest and rerun only the failed tests.

failedTests = quadTests([[Link]]);
result2 = run(failedTests)

Running SolverTest
.
Done SolverTest
__________

result2 =

TestResult with properties:

Name: 'SolverTest/testBadRealSolution'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0108
Details: [1x1 struct]

Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.010813 seconds testing time.

Alternatively, you can rerun failed tests using the (rerun) link in the test results.

See Also

More About
• “Rerun Failed Tests” on page 34-123

34-122
Rerun Failed Tests

Rerun Failed Tests


If a test failure is caused by incorrect or incomplete code, it is useful to rerun failed tests quickly and
conveniently. When you run a test suite, the test results include information about the test suite and
the test runner. If there are test failures in the results, when MATLAB displays the test results there
is a link to rerun the failed tests.
Totals:
1 Passed, 1 Failed (rerun), 0 Incomplete.
0.25382 seconds testing time.

This link allows you to modify your test code or your code under test and quickly rerun failed tests.
However, if you make structural changes to your test class, using the rerun link does not pick up the
changes. Structural changes include adding, deleting, or renaming a test method, and modifying a
test parameter property and its value. In this case, recreate the entire test suite to pick up the
changes.

Create the following function in your current working folder. The function is meant to compute the
square and square root. However, in this example, the function computes the cube of the value
instead of the square.
function [x,y] = exampleFunction(n)
validateattributes(n,{'numeric'},{'scalar'})

x = n^3; % square (incorrect code, should be n^2)


y = sqrt(n); % square root
end

Create the following test in a file exampleTest.m.


function tests = exampleTest
tests = functiontests(localfunctions);
end

function testSquare(testCase)
[sqrVal,sqrRootVal] = exampleFunction(3);
verifyEqual(testCase,sqrVal,9);
end

function testSquareRoot(testCase)
[sqrVal,sqrRootVal] = exampleFunction(100);
verifyEqual(testCase,sqrRootVal,10);
end

Create a test suite and run the tests. The testSquare test fails because the implementation of
exampleFunction is incorrect.
suite = testsuite('ExampleTest.m');
results = run(suite)
Running exampleTest

================================================================================
Verification failed in exampleTest/testSquare.

---------------------
Framework Diagnostic:
---------------------
verifyEqual failed.
--> The values are not equal using "isequaln".

34-123
34 Unit Testing

--> Failure table:


Actual Expected Error RelativeError
______ ________ _____ _____________

27 9 18 2

Actual Value:
27
Expected Value:
9

------------------
Stack Information:
------------------
In C:\Work\exampleTest.m (testSquare) at 7
================================================================================
..
Done exampleTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


=====================================================================
exampleTest/testSquare X Failed by verification.

results =

1×2 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
1 Passed, 1 Failed (rerun), 0 Incomplete.
0.24851 seconds testing time.

Update the code in exampleFunction to fix the coding error.


function [x,y] = exampleFunction(n)
validateattributes(n,{'numeric'},{'scalar'})

x = n^2; % square
y = sqrt(n); % square root
end

Click the (rerun) link in the command window to rerun the failed test. You cannot rerun failed tests
if the variable that stores the test results is overwritten. If the link is no longer in the Command
Window, you can type results at the prompt to view it.
Running exampleTest
.
Done exampleTest
__________

ans =

TestResult with properties:

Name: 'exampleTest/testSquare'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0034

34-124
Rerun Failed Tests

Details: [1×1 struct]

Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.0033903 seconds testing time.

MATLAB stores the TestResult array associated with tests that you rerun in the ans variable.
results is a 1x2 array that contains all the tests in exampleTest.m, and ans is a 1x1 array that
contains the rerun results from the one failed test.

whos
Name Size Bytes Class Attributes

ans 1x1 664 [Link]


results 1x2 1344 [Link]
suite 1x2 96 [Link]

To programmatically rerun failed tests, use the Failed property on the TestResult object to create
and run a filtered test suite.

failedTests = suite([[Link]]);
result2 = run(failedTests);

Running exampleTest
.
Done exampleTest
__________

To ensure that all passing tests continue to pass, rerun the full test suite.

See Also

More About
• “Analyze Failed Test Results” on page 34-121

34-125
34 Unit Testing

Dynamically Filtered Tests


In this section...
“Test Methods” on page 34-126
“Method Setup and Teardown Code” on page 34-128
“Class Setup and Teardown Code” on page 34-129

Assumption failures produce filtered tests. In the [Link] class, such a test
is marked Incomplete.

Since filtering test content through the use of assumptions does not produce test failures, it has the
possibility of creating dead test code. Avoiding this requires monitoring of filtered tests.

Test Methods
If an assumption failure is encountered inside of a TestCase method with the Test attribute, the
entire method is marked as filtered, but MATLAB runs the subsequent Test methods.

The following class contains an assumption failure in one of the methods in the Test block.

classdef ExampleTest < [Link]


methods(Test)
function testA(testCase)
[Link](true)
end
function testB(testCase)
[Link](0,1)
% remaining test code is not exercised
end
function testC(testCase)
[Link](true)
end
end
end

Since the testB method contains an assumption failure, when you run the test, the testing
framework filters that test and marks it as incomplete. After the assumption failure in testB, the
testing framework proceeds and executes testC, which contains a verification failure.

ts = [Link](?ExampleTest);
res = [Link];

Running ExampleTest
.
================================================================================
ExampleTest/testB was filtered.
Details
================================================================================
.
================================================================================
Verification failed in ExampleTest/testC.

---------------------
Framework Diagnostic:
---------------------
verifyFalse failed.
--> The value must evaluate to "false".

34-126
Dynamically Filtered Tests

Actual logical:
1

------------------
Stack Information:
------------------
In C:\work\ExampleTest.m ([Link]) at 11
================================================================================
.
Done ExampleTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


================================================================
ExampleTest/testB X Filtered by assumption.
----------------------------------------------------------------
ExampleTest/testC X Failed by verification.

If you examine the TestResult, you notice that there is a passed test, a failed test, and a test that
did not complete due to an assumption failure.
res

res =

1×3 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
1 Passed, 1 Failed, 1 Incomplete.
2.4807 seconds testing time.

The testing framework keeps track of incomplete tests so that you can monitor filtered tests for
nonexercised test code. You can see information about these tests within the TestResult object.
res([[Link]])

ans =

TestResult with properties:

Name: 'ExampleTest/testB'
Passed: 0
Failed: 0
Incomplete: 1
Duration: 2.2578
Details: [1×1 struct]

Totals:
0 Passed, 0 Failed, 1 Incomplete.
2.2578 seconds testing time.

To create a modified test suite from only the filtered tests, select incomplete tests from the original
test suite.

34-127
34 Unit Testing

tsFiltered = ts([[Link]])

tsFiltered =

Test with properties:


Name: 'ExampleTest/testB'
ProcedureName: 'testB'
TestClass: "ExampleTest"
BaseFolder: 'C:\work'
Parameterization: [0×0 [Link]]
SharedTestFixtures: [0×0 [Link]]
Tags: {1×0 cell}

Tests Include:
0 Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.

Method Setup and Teardown Code


If an assumption failure is encountered inside a TestCase method with the TestMethodSetup
attribute, MATLAB filters the method which was to be run for that instance. If a test uses
assumptions from within the TestMethodSetup block, consider instead using the assumptions in the
TestClassSetup block, which likewise filters all Test methods in the class but is less verbose and
more efficient.

One of the methods in the following TestMethodSetup block within ExampleTest.m contains an
assumption failure.

methods(TestMethodSetup)
function setupMethod1(testCase)
[Link](1,0)
% remaining test code is not exercised
end
function setupMethod2(testCase)
disp('* Running setupMethod2 *')
[Link](1,1)
end
end

Updated ExampleTest Class Definition

classdef ExampleTest < [Link]


methods(TestMethodSetup)
function setupMethod1(testCase)
[Link](1,0)
% remaining test code is not exercised
end
function setupMethod2(testCase)
disp('* Running setupMethod2 *')
[Link](1,1)
end
end

methods(Test)
function testA(testCase)
[Link](true)
end
function testB(testCase)

34-128
Dynamically Filtered Tests

[Link](0,1)
% remaining test code is not exercised
end
function testC(testCase)
[Link](true)
end
end
end

When you run the test, you see that the framework completes executes all the methods in the
TestMethodSetup block that do not contain the assumption failure, and it marks as incomplete all
methods in the Test block.

ts = [Link](?ExampleTest);
res = [Link];
Running ExampleTest

================================================================================
ExampleTest/testA was filtered.
Details
================================================================================
* Running setupMethod2 *
.
================================================================================
ExampleTest/testB was filtered.
Details
================================================================================
* Running setupMethod2 *
.
================================================================================
ExampleTest/testC was filtered.
Details
================================================================================
* Running setupMethod2 *
.
Done ExampleTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


================================================================
ExampleTest/testA X Filtered by assumption.
----------------------------------------------------------------
ExampleTest/testB X Filtered by assumption.
----------------------------------------------------------------
ExampleTest/testC X Filtered by assumption.

The Test methods did not change but all 3 are filtered due to an assumption failure in the
TestMethodSetup block. The testing framework executes methods in the TestMethodSetup block
without assumption failures, such as setupMethod2. As expected, the testing framework executes
setupMethod2 3 times, once before each Test method.

Class Setup and Teardown Code


If an assumption failure is encountered inside of a TestCase method with the TestClassSetup or
TestClassTeardown attribute, MATLAB filters the entire TestCase class.

The methods in the following TestClassSetup block within ExampleTest.m contains an


assumption failure.

methods(TestClassSetup)
function setupClass(testCase)
[Link](1,0)
% remaining test code is not exercised

34-129
34 Unit Testing

end
end

Updated ExampleTest Class Definition

classdef ExampleTest < [Link]


methods(TestClassSetup)
function setupClass(testCase)
[Link](1,0)
% remaining test code is not exercised
end
end

methods(TestMethodSetup)
function setupMethod1(testCase)
[Link](1,0)
% remaining test code is not exercised
end
function setupMethod2(testCase)
disp('* Running setupMethod2 *')
[Link](1,1)
end
end

methods(Test)
function testA(testCase)
[Link](true)
end
function testB(testCase)
[Link](0,1)
% remaining test code is not exercised
end
function testC(testCase)
[Link](true)
end
end
end

When you run the test, you see that the framework does not execute any of the methods in the
TestMethodSetup or Test.

ts = [Link](?ExampleTest);
res = [Link];

Running ExampleTest

================================================================================
All tests in ExampleTest were filtered.
Details
================================================================================

Done ExampleTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


================================================================
ExampleTest/testA X Filtered by assumption.
----------------------------------------------------------------
ExampleTest/testB X Filtered by assumption.

34-130
Dynamically Filtered Tests

----------------------------------------------------------------
ExampleTest/testC X Filtered by assumption.

The Test and TestMethodSetup methods did not change but everything is filtered due to an
assumption failure in the TestClassSetup block.

See Also
[Link] | [Link] |
[Link]

34-131
34 Unit Testing

Create Custom Constraint


This example shows how to create a custom constraint that determines if a given value has the same
size as an expected value.

In a file in your current folder, create a class named HasSameSizeAs that derives from the
[Link] class. The class constructor accepts an expected
value whose size is compared to the size of an actual value. The expected value is stored in the
ValueWithExpectedSize property. The recommended practice is to make Constraint
implementations immutable, so set the property SetAccess attribute to immutable.

classdef HasSameSizeAs < [Link]

properties(SetAccess = immutable)
ValueWithExpectedSize
end

methods
function constraint = HasSameSizeAs(value)
[Link] = value;
end
end

end

In a methods block with private access, define a helper method sizeMatchesExpected that
determines if the actual and expected values have the same size. This method is invoked by other
constraint methods.

methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size([Link]));
end
end

Classes that derive from the [Link] class must override


the satisfiedBy method. This method must contain the comparison logic and return a logical value.
Within a methods block, implement satisfiedBy by invoking the helper method. If the actual size
and the expected size are equal, the method returns true.

methods
function bool = satisfiedBy(constraint,actual)
bool = [Link](actual);
end
end

Classes that derive from the [Link] class must also


override the getDiagnosticFor method. This method must evaluate the actual value against the
constraint and provide a Diagnostic object. In this example, getDiagnosticFor returns a
StringDiagnostic object.

methods
function diag = getDiagnosticFor(constraint,actual)
import [Link]
if [Link](actual)
diag = StringDiagnostic('HasSameSizeAs passed.');

34-132
Create Custom Constraint

else
diag = StringDiagnostic(sprintf(...
'HasSameSizeAs failed.\nActual Size: [%s]\nExpectedSize: [%s]',...
int2str(size(actual)),...
int2str(size([Link]))));
end
end
end

HasSameSizeAs Class Definition

This is the complete code for the HasSameSizeAs class.


classdef HasSameSizeAs < [Link]

properties(SetAccess = immutable)
ValueWithExpectedSize
end

methods
function constraint = HasSameSizeAs(value)
[Link] = value;
end

function bool = satisfiedBy(constraint,actual)


bool = [Link](actual);
end

function diag = getDiagnosticFor(constraint,actual)


import [Link]
if [Link](actual)
diag = StringDiagnostic('HasSameSizeAs passed.');
else
diag = StringDiagnostic(sprintf(...
'HasSameSizeAs failed.\nActual Size: [%s]\nExpectedSize: [%s]',...
int2str(size(actual)),...
int2str(size([Link]))));
end
end
end

methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size([Link]));
end
end

end

Test for Expected Size

At the command prompt, create a test case for interactive testing.

import [Link]
testCase = [Link];

Test a passing case.

[Link](zeros(5),HasSameSizeAs(repmat(1,5)))

Verification passed.

Test a failing case.

[Link](zeros(5),HasSameSizeAs(ones(1,5)))

34-133
34 Unit Testing

Verification failed.
---------------------
Framework Diagnostic:
---------------------
HasSameSizeAs failed.
Actual Size: [5 5]
ExpectedSize: [1 5]

See Also
getDiagnosticFor | [Link] |
[Link] |
[Link] | satisfiedBy

Related Examples
• “Create Custom Boolean Constraint” on page 34-135

34-134
Create Custom Boolean Constraint

Create Custom Boolean Constraint


This example shows how to create a custom Boolean constraint that determines if a given value has
the same size as an expected value.

In a file in your current folder, create a class named HasSameSizeAs that derives from the
[Link] class. The class constructor accepts an
expected value whose size is compared to the size of an actual value. The expected value is stored in
the ValueWithExpectedSize property. The recommended practice is to make
BooleanConstraint implementations immutable, so set the property SetAccess attribute to
immutable.
classdef HasSameSizeAs < [Link]

properties(SetAccess = immutable)
ValueWithExpectedSize
end

methods
function constraint = HasSameSizeAs(value)
[Link] = value;
end
end

end

In a methods block with private access, define a helper method sizeMatchesExpected that
determines if the actual and expected values have the same size. This method is invoked by other
constraint methods.
methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size([Link]));
end
end

The [Link] class is a subclass of the


[Link] class. Therefore, classes that derive from the
BooleanConstraint class must override the methods of the Constraint class. Within a methods
block, override the satisfiedBy and getDiagnosticFor methods. The satisfiedBy
implementation must contain the comparison logic and return a logical value. The
getDiagnosticFor implementation must evaluate the actual value against the constraint and
provide a Diagnostic object. In this example, getDiagnosticFor returns a StringDiagnostic
object.
methods
function bool = satisfiedBy(constraint,actual)
bool = [Link](actual);
end

function diag = getDiagnosticFor(constraint,actual)


import [Link]
if [Link](actual)
diag = StringDiagnostic('HasSameSizeAs passed.');
else
diag = StringDiagnostic(sprintf(...
'HasSameSizeAs failed.\nActual Size: [%s]\nExpectedSize: [%s]',...
int2str(size(actual)),...
int2str(size([Link]))));
end

34-135
34 Unit Testing

end
end

Classes that derive from BooleanConstraint must implement the getNegativeDiagnosticFor


method. This method must provide a Diagnostic object when the constraint is negated.

Override getNegativeDiagnosticFor in a methods block with protected access.


methods(Access = protected)
function diag = getNegativeDiagnosticFor(constraint,actual)
import [Link]
if [Link](actual)
diag = StringDiagnostic(sprintf(...
['Negated HasSameSizeAs failed.\nSize [%s] of '...
'Actual Value and Expected Value were the same '...
'but should not have been.'],int2str(size(actual))));
else
diag = StringDiagnostic('Negated HasSameSizeAs passed.');
end
end
end

In exchange for implementing the required methods, the constraint inherits the appropriate and, or,
and not overloads, so it can be combined with other BooleanConstraint objects or negated.

HasSameSizeAs Class Definition

This is the complete code for the HasSameSizeAs class.


classdef HasSameSizeAs < [Link]

properties(SetAccess = immutable)
ValueWithExpectedSize
end

methods
function constraint = HasSameSizeAs(value)
[Link] = value;
end

function bool = satisfiedBy(constraint,actual)


bool = [Link](actual);
end

function diag = getDiagnosticFor(constraint,actual)


import [Link]

if [Link](actual)
diag = StringDiagnostic('HasSameSizeAs passed.');
else
diag = StringDiagnostic(sprintf(...
'HasSameSizeAs failed.\nActual Size: [%s]\nExpectedSize: [%s]',...
int2str(size(actual)),...
int2str(size([Link]))));
end
end
end

methods(Access = protected)
function diag = getNegativeDiagnosticFor(constraint,actual)
import [Link]
if [Link](actual)
diag = StringDiagnostic(sprintf(...
['Negated HasSameSizeAs failed.\nSize [%s] of '...
'Actual Value and Expected Value were the same '...
'but should not have been.'],int2str(size(actual))));
else
diag = StringDiagnostic('Negated HasSameSizeAs passed.');
end
end

34-136
Create Custom Boolean Constraint

end

methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size([Link]));
end
end

end

Test for Expected Size

At the command prompt, create a test case for interactive testing.

import [Link]
import [Link]
testCase = [Link];

Test a passing case. The test passes because one of the or conditions, HasLength(5), is true.

[Link](zeros(5),HasLength(5) | ~HasSameSizeAs(repmat(1,5)))

Verification passed.

Test a failing case. The test fails because one of the and conditions,
~HasSameSizeAs(repmat(1,5)), is false.

[Link](zeros(5),HasLength(5) & ~HasSameSizeAs(repmat(1,5)))

Verification failed.
---------------------
Framework Diagnostic:
---------------------
AndConstraint failed.
--> + [First Condition]:
| HasLength passed.
|
| Actual Value:
| 0 0 0 0 0
| 0 0 0 0 0
| 0 0 0 0 0
| 0 0 0 0 0
| 0 0 0 0 0
| Expected Length:
| 5
--> AND
+ [Second Condition]:
| Negated HasSameSizeAs failed.
| Size [5 5] of Actual Value and Expected Value were the same but should not have bee
-+---------------------

See Also
getDiagnosticFor | getNegativeDiagnosticFor |
[Link] |
[Link] | [Link]
| [Link] | satisfiedBy

34-137
34 Unit Testing

Related Examples
• “Create Custom Constraint” on page 34-132

34-138
Create Custom Tolerance

Create Custom Tolerance


This example shows how to create a custom tolerance to determine if two DNA sequences have a
Hamming distance within a specified tolerance. For two DNA sequences of the same length, the
Hamming distance is the number of positions in which the nucleotides (letters) of one sequence differ
from the other.

In a file, DNA.m, in your working folder, create a simple class for a DNA sequence.

classdef DNA
properties(SetAccess=immutable)
Sequence
end

methods
function dna = DNA(sequence)
validLetters = ...
sequence == 'A' | ...
sequence == 'C' | ...
sequence == 'T' | ...
sequence == 'G';

if ~all(validLetters(:))
error('Sequence contained a letter not found in DNA.')
end
[Link] = sequence;
end
end
end

In a file in your working folder, create a tolerance class so that you can test that DNA sequences are
within a specified Hamming distance. The constructor requires a Value property that defines the
maximum Hamming distance.

classdef HammingDistance < [Link]


properties
Value
end

methods
function tolerance = HammingDistance(value)
[Link] = value;
end
end
end

In a methods block with the HammingDistance class definition, include the following method so
that the tolerance supports DNA objects. Tolerance classes must implement a supports method.

methods
function tf = supports(~, value)
tf = isa(value, 'DNA');
end
end

34-139
34 Unit Testing

In a methods block with the HammingDistance class definition, include the following method that
returns true or false. Tolerance classes must implement a satisfiedBy method. The testing
framework uses this method to determine if two values are within the tolerance.
methods
function tf = satisfiedBy(tolerance, actual, expected)
if ~isSameSize([Link], [Link])
tf = false;
return
end
tf = hammingDistance([Link],[Link]) <= [Link];
end
end

In the HammingDistance.m file, define the following helper functions outside of the classdef
block. The isSameSize function returns true if two DNA sequences are the same size, and the
hammingDistance function returns the Hamming distance between two sequences.
function tf = isSameSize(str1, str2)
tf = isequal(size(str1), size(str2));
end

function distance = hammingDistance(str1, str2)


distance = nnz(str1 ~= str2);
end

The function returns a Diagnostic object with information about the comparison. In a methods
block with the HammingDistance class definition, include the following method that returns a
StringDiagnostic. Tolerance classes must implement a getDiagosticFor method.
methods
function diag = getDiagnosticFor(tolerance, actual, expected)
import [Link]

if ~isSameSize([Link], [Link])
str = 'The DNA sequences must be the same length.';
else
str = sprintf('%s%d.\n%s%d.', ...
'The DNA sequences have a Hamming distance of ', ...
hammingDistance([Link], [Link]), ...
'The allowable distance is ', ...
[Link]);
end
diag = StringDiagnostic(str);
end
end

HammingDistance Class Definition Summary


classdef HammingDistance < [Link]
properties
Value
end

methods
function tolerance = HammingDistance(value)
[Link] = value;
end

34-140
Create Custom Tolerance

function tf = supports(~, value)


tf = isa(value, 'DNA');
end

function tf = satisfiedBy(tolerance, actual, expected)


if ~isSameSize([Link], [Link])
tf = false;
return
end
tf = hammingDistance([Link],[Link]) <= [Link];
end

function diag = getDiagnosticFor(tolerance, actual, expected)


import [Link]

if ~isSameSize([Link], [Link])
str = 'The DNA sequences must be the same length.';
else
str = sprintf('%s%d.\n%s%d.', ...
'The DNA sequences have a Hamming distance of ', ...
hammingDistance([Link], [Link]), ...
'The allowable distance is ', ...
[Link]);
end
diag = StringDiagnostic(str);
end
end
end

function tf = isSameSize(str1, str2)


tf = isequal(size(str1), size(str2));
end

function distance = hammingDistance(str1, str2)


distance = nnz(str1 ~= str2);
end

At the command prompt, create a TestCase for interactive testing.


import [Link]
import [Link]

testCase = [Link];

Create two DNA objects.


sampleA = DNA('ACCTGAGTA');
sampleB = DNA('ACCACAGTA');

Verify that the DNA sequences are equal to each other.


[Link](sampleA, IsEqualTo(sampleB))

Interactive verification failed.

---------------------
Framework Diagnostic:
---------------------

34-141
34 Unit Testing

IsEqualTo failed.
--> ObjectComparator failed.
--> The objects are not equal using "isequal".

Actual Object:
DNA with properties:

Sequence: 'ACCTGAGTA'
Expected Object:
DNA with properties:

Sequence: 'ACCACAGTA'

Verify that the DNA sequences are equal to each other within a Hamming distance of 1.

[Link](sampleA, IsEqualTo(sampleB,...
'Within', HammingDistance(1)))

Interactive verification failed.

---------------------
Framework Diagnostic:
---------------------
IsEqualTo failed.
--> ObjectComparator failed.
--> The objects are not equal using "isequal".
--> The DNA sequences have a Hamming distance of 2.
The allowable distance is 1.

Actual Object:
DNA with properties:

Sequence: 'ACCTGAGTA'
Expected Object:
DNA with properties:

Sequence: 'ACCACAGTA'

The sequences are not equal to each other within a tolerance of 1. The testing framework displays
additional diagnostics from the getDiagnosticFor method.

Verify that the DNA sequences are equal to each other within a Hamming distance of 2.

[Link](sampleA, IsEqualTo(sampleB,...
'Within', HammingDistance(2)))

Interactive verification passed.

See Also
[Link]

34-142
Overview of App Testing Framework

Overview of App Testing Framework


Use the MATLAB app testing framework to test App Designer apps, or apps built programmatically
using the uifigure function. The app testing framework lets you author a test class that
programmatically performs a gesture on a UI component, such as pressing a button or dragging a
slider, and verifies the behavior of the app.

App Testing
Test Creation – Class-based tests can use the app testing framework by subclassing
[Link]. Because [Link] is a subclass of
[Link], your test has access to the features of the unit testing framework,
such as qualifications, fixtures, and plugins. To experiment with the app testing framework at the
command prompt, create a test case instance using
[Link].

Test Content – Typically, a test of an app programmatically interacts with app components using a
gesture method of [Link], such as press or type, and then performs a
qualification on the result. For example, a test might press one check box and verify that the other
check boxes are disabled. Or it might type a number into a text box and verify the app correctly
computes a result. These types of tests require understanding of the properties of the app being
tested. To verify a button press, you must know where in the app object MATLAB stores the status of
a button. To verify the result of a computation, you must know how to access the result within the
app.

Test Clean Up – It is a best practice to include a teardown action to delete the app after the test.
Typically, the test method adds this action using the addTeardown method of
[Link].

App Locking – When an app test creates a figure, the framework locks the figure immediately to
prevent external interactions with the components. The app testing framework does not lock UI
components if you create an instance of [Link] for
experimentation at the command prompt.

To unlock a figure for debugging purposes, use the [Link] function.

Gesture Support of UI Components


The gesture methods of [Link] support various UI components.

Component Typical [Link] Gesture Method


Creation press choose drag type hover chooseCon
Function textMenu
Axes axes ✔ ✔ ✔ ✔
Button uibutton ✔ ✔
Button uibuttong ✔
Group roup
Check Box uicheckbo ✔ ✔ ✔
x

34-143
34 Unit Testing

Date Picker uidatepic ✔ ✔


ker
Discrete uiknob ✔ ✔
Knob
Drop Down uidropdow ✔ ✔ ✔
n
Edit Field uieditfie ✔ ✔
(Numeric, ld
Text)
Image uiimage ✔ ✔
Knob uiknob ✔ ✔ ✔
List Box uilistbox ✔ ✔
Menu uimenu ✔
Polar Axes polaraxes ✔ ✔ ✔
Push Tool uipushtoo ✔
l
Radio uiradiobu ✔ ✔ ✔
Button tton
Slider uislider ✔ ✔ ✔
Spinner uispinner ✔ ✔ ✔
State uibutton ✔ ✔ ✔
Button
Switch uiswitch ✔ ✔ ✔
(Rocker,
Slider,
Toggle)
Tab uitab ✔
Tab Group uitabgrou ✔
p
Text Area uitextare ✔ ✔
a
Toggle uitoggleb ✔ ✔ ✔
Button utton
Toggle Tool uitogglet ✔ ✔
ool
Tree Node uitreenod ✔
e
UI Axes uiaxes ✔ ✔ ✔ ✔
UI Figure uifigure ✔ ✔ ✔

34-144
Overview of App Testing Framework

Write a Test for an App


This example shows how to write a test for an app that provides options to change the sample size
and colormap of a plot. To programmatically interact with the app and qualify the results, use the app
testing framework combined with the unit testing framework.

At the command prompt, make the app accessible by adding the folder that includes the app to the
MATLAB search path.
addpath(fullfile(matlabroot,'examples','matlab','main'))

To explore the properties of the app prior to testing, create an instance of the app at the command
prompt.
app = ConfigurePlotAppExample;

This step is not necessary for the tests, but it is helpful to explore the properties used by the app
tests. For example, use [Link] to access the Update Plot button within the app
object.

Create a test class that inherits from [Link].


classdef testConfigurePlotAppExample < [Link]

methods (Test)

end

end

Create a test method test_SampleSize to test the sample size. The test method modifies the
sample size, updates the plot, and verifies that the surface uses the specified sample size. The call to
addTeardown deletes the app after the test is complete.
classdef testConfigurePlotAppExample < [Link]

methods (Test)
function test_SampleSize(testCase)
app = ConfigurePlotAppExample;
[Link](@delete,app);

[Link]([Link],12);
[Link]([Link]);

ax = [Link];
surfaceObj = [Link];
[Link]([Link],[12 12]);
end
end

end

Create a second test method test_Colormap to test the colormap. The test method selects a
colormap, updates the plot, and verifies that the plot uses the specified colormap. The full code is
now as follows.
classdef testConfigurePlotAppExample < [Link]

34-145
34 Unit Testing

methods (Test)
function test_SampleSize(testCase)
app = ConfigurePlotAppExample;
[Link](@delete,app);

[Link]([Link],12);
[Link]([Link]);

ax = [Link];
surfaceObj = [Link];
[Link]([Link],[12 12]);
end

function test_Colormap(testCase)
app = ConfigurePlotAppExample;
[Link](@delete,app);

[Link]([Link],'Winter');
[Link]([Link]);

expectedMap = winter;
ax = [Link];
[Link]([Link],expectedMap);
end
end

end

At the command prompt, run the tests.

results = runtests('testConfigurePlotAppExample')

Running testConfigurePlotAppExample
..
Done testConfigurePlotAppExample
__________

results =

1×2 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
2 Passed, 0 Failed, 0 Incomplete.
5.0835 seconds testing time.

See Also
[Link]

34-146
Overview of App Testing Framework

More About
• “Write Test for App” on page 34-148
• “Write Test That Uses App Testing and Mocking Frameworks” on page 34-152
• “App Building Components”

34-147
34 Unit Testing

Write Test for App


This example shows how to write tests for an App Designer app. To interact with the app
programmatically and qualify the results, use the app testing framework and the unit testing
framework.

At the command prompt, make the app accessible by adding the folder that includes the app to the
MATLAB search path.

addpath(fullfile(matlabroot,'examples','matlab','main'))

To explore the properties of this app prior to testing, create an instance of the app at the command
prompt.

app = PatientsDisplay;

This step is not necessary for the tests, but it is helpful to explore the properties used by the app
tests. For example, use [Link] to access the Blood Pressure switch within
the app object.

Create a test class that inherits from [Link]. To test the tab switching
functionality, create a test method test_tab. The test method chooses the Data tab and then verifies
that the selected tab has the correct title. The TestMethodSetup method creates an app for each
test and deletes it after the test is complete.
classdef TestPatientsDisplay < [Link]
properties
App
end

methods (TestMethodSetup)
function launchApp(testCase)
[Link] = PatientsDisplay;
[Link](@delete,[Link]);
end
end

methods (Test)
function test_tab(testCase)
% Choose Data Tab
dataTab = [Link];
[Link](dataTab)

% Verify Data Tab is selected


[Link]([Link],'Data')
end

end
end

Create a test_plottingOptions method that tests various plotting options. The test method
presses the Histogram radio button and verifies that the x-label changed. Then, it changes the Bin
Width slider and verifies the number of bins.
classdef TestPatientsDisplay < [Link]
properties
App
end

methods (TestMethodSetup)
function launchApp(testCase)
[Link] = PatientsDisplay;
[Link](@delete,[Link]);
end
end

methods (Test)
function test_plottingOptions(testCase)

34-148
Write Test for App

% Press the histogram radio button


[Link]([Link])

% Verify xlabel updated from 'Weight' to 'Systolic'


[Link]([Link],'Systolic')

% Change the Bin Width to 9


[Link]([Link],9)

% Verify the number of bins is now 4


[Link]([Link],4)
end

function test_tab(testCase) ...

end
end

Create a test_bloodPressure method that tests blood pressure data and display. The test method
verifies the y-axis label and the values of the scatter points. Then it changes to Diastolic readings,
and verifies the label and data again.
classdef TestPatientsDisplay < [Link]
properties
App
end

methods (TestMethodSetup)
function launchApp(testCase)
[Link] = PatientsDisplay;
[Link](@delete,[Link]);
end
end

methods (Test)
function test_bloodPressure(testCase)
% Extract blood pressure data from app
t = [Link];
[Link] = categorical([Link]);
allMales = t([Link] == 'Male',:);
maleDiastolicData = [Link]';
maleSystolicData = [Link]';

% Verify ylabel and that male Systolic data shows


ax = [Link];
[Link]([Link],'Systolic')
[Link]([Link],maleSystolicData)

% Switch to 'Diastolic' reading


[Link]([Link],'Diastolic')

% Verify ylabel changed and male Diastolic data shows


[Link]([Link],'Diastolic')
[Link]([Link],maleDiastolicData);
end

function test_plottingOptions(testCase) ...

function test_tab(testCase) ...

end
end

Create a test_gender method that tests gender data and display. The test method verifies the
number of male scatter points and then presses the check box to include female data. It verifies that
two data sets are plotted and the color of the female data is red. Finally, it clears the male data check
box and verifies the number of plotted data sets and scatter points. This test fails because there are
53 female scatter points instead of 50. To take a screenshot when the test fails, use a
ScreenshotDiagnostic with the onFailure method.
classdef TestPatientsDisplay < [Link]
properties
App
end

methods (TestMethodSetup)

34-149
34 Unit Testing

function launchApp(testCase)
[Link] = PatientsDisplay;
[Link](@delete,[Link]);
end
end

methods (Test)
function test_gender(testCase)
import [Link]
[Link](ScreenshotDiagnostic);

% Verify 47 male scatter points


ax = [Link];
[Link]([Link],47);

% Enable the checkbox for female data


[Link]([Link]);

% Verify two data sets display and the female data is red
[Link]([Link],2);
[Link]([Link](1).CData,[1 0 0]);

% Disable the male data


[Link]([Link],false);

% Verify one data set displays and number of scatter points


[Link]([Link],1);
[Link]([Link],50);
end

function test_bloodPressure(testCase)
% Extract blood pressure data from app
t = [Link];
[Link] = categorical([Link]);
allMales = t([Link] == 'Male',:);
maleDiastolicData = [Link]';
maleSystolicData = [Link]';

% Verify ylabel and that male Systolic data shows


ax = [Link];
[Link]([Link],'Systolic')
[Link]([Link],maleSystolicData)

% Switch to 'Diastolic' reading


[Link]([Link],'Diastolic')

% Verify ylabel changed and male Diastolic data shows


[Link]([Link],'Diastolic')
[Link]([Link],maleDiastolicData);
end

function test_plottingOptions(testCase)
% Press the histogram radio button
[Link]([Link])

% Verify xlabel updated from 'Weight' to 'Systolic'


[Link]([Link],'Systolic')

% Change the Bin Width to 9


[Link]([Link],9)

% Verify the number of bins is now 4


[Link]([Link],4)
end

function test_tab(testCase)
% Choose Data Tab
dataTab = [Link];
[Link](dataTab)

% Verify Data Tab is selected


[Link]([Link],'Data')
end

end
end

Run the tests.

results = runtests('TestPatientsDisplay');

34-150
Write Test for App

Running TestPatientsDisplay

================================================================================
Verification failed in TestPatientsDisplay/test_gender.
---------------------
Framework Diagnostic:
---------------------
verifyNumElements failed.
--> The value did not have the correct number of elements.

Actual Number of Elements:


53
Expected Number of Elements:
50

Actual Value:
Columns 1 through 49

131 133 119 142 142 132 128 137 129 131 133 117 137 146 123 143 114 126 137 138 137 118

Columns 50 through 53

141 129 124 134


----------------------
Additional Diagnostic:
----------------------
Screenshot captured to:
--> C:\Temp\83292efd-b703-46ef-8c41-00e20167321d\Screenshot_c025020f-[Link]
------------------
Stack Information:
------------------
In C:\Work\TestPatientsDisplay.m (TestPatientsDisplay.test_gender) at 34
================================================================================
....
Done TestPatientsDisplay
__________

Failure Summary:

Name Failed Incomplete Reason(s)


==============================================================================
TestPatientsDisplay/test_gender X Failed by verification.

See Also
[Link]

More About
• “Overview of App Testing Framework” on page 34-143
• “Write Test That Uses App Testing and Mocking Frameworks” on page 34-152

34-151
34 Unit Testing

Write Test That Uses App Testing and Mocking Frameworks


This example shows how to write a test that uses the app testing framework and the mocking
framework. The app contains a file selection dialog box and a label indicating the selected file. To test
the app programmatically, use a mock object to define the behavior of the file selector.

Create App
Create the launchApp app in your current working folder. The app allows a user to select an input
file and displays the name of the file in the app. The file selection dialog box is a blocking modal
dialog box that waits for user input.

function app = launchApp


f = uifigure;
button = uibutton(f,'Text','Input file');
[Link] = @(src,evt)pickFile;
label = uilabel(f,'Text','No file selected');
[Link](1) = [Link](1) + [Link](3) + 25;
[Link](3) = 200;

% Add components to an App struct for output


[Link] = f;
[Link] = button;
[Link] = label;

function file = pickFile()


[file,folder,status] = uigetfile('*.*');
if status
[Link] = file;
end
end
end

To explore the properties of this app prior to testing, create an instance of the app at the command
prompt. This step is not necessary for the tests, but it is helpful to explore the properties used by the
app tests. For example, use [Link] to access the Input file button within the app object.

app = launchApp;

34-152
Write Test That Uses App Testing and Mocking Frameworks

Test App With Manual Intervention


Create the LaunchAppTest class without using mocks. The test assumes the file [Link] exists
in your current working folder. If it does not exist, create it. The test presses the Input file button
programmatically and verifies that the label matches '[Link]'. You must manually select the
file.

classdef LaunchAppTest < [Link]


properties
TestFile = '[Link]';
end
methods(TestClassSetup)
function checkTestFiles(tc)
import [Link]
[Link]([Link],IsFile)
end
end
methods (Test)
function testInputButton(tc)
app = launchApp;
[Link](@close,[Link]);

[Link]([Link]);

34-153
34 Unit Testing

[Link]([Link],[Link])
end
end
end

Run the test. When the file selection dialog box appears, select [Link] to allow MATLAB to
proceed with the test. Selecting any other file results in a test failure.

results = runtests('LaunchAppTest');

Running LaunchAppTest
.
Done LaunchAppTest
__________

Create Fully Automated Test


To test the app without manual intervention, use the mocking framework. Modify the app to accept a
file-choosing service instead of implementing it in the app (dependency injection).

Create a FileChooser service with an Abstract method that implements the file selection
functionality.

classdef FileChooser
% Interface to choose a file
methods (Abstract)
[file,folder,status] = chooseFile(chooser,varargin)
end
end

Create a default FileChooser that uses the uigetfile function for file selection.

classdef DefaultFileChooser < FileChooser


methods
function [file,folder,status] = chooseFile(chooser,varargin)
[file,folder,status] = uigetfile(varargin{:});
end
end
end

Change the app to accept an optional FileChooser object. When called with no inputs, the app uses
an instance of DefaultFileChooser.

function app = launchApp(fileChooser)


if nargin==0
fileChooser = DefaultFileChooser;
end
f = uifigure;
button = uibutton(f,'Text','Input file');
[Link] = @(src,evt)pickFile(fileChooser);
label = uilabel(f,'Text','No file selected');
[Link](1) = [Link](1) + [Link](3) + 25;
[Link](3) = 200;

% Add components to an App struct for output


[Link] = f;
[Link] = button;

34-154
Write Test That Uses App Testing and Mocking Frameworks

[Link] = label;

function file = pickFile(fileChooser)


[file,folder,status] = [Link]('*.*');
if status
[Link] = file;
end
end
end

Make the following modifications to LaunchAppTest.

• Change the test to inherit from both [Link] and [Link].


• Remove the properties block and the TestClassSetup block. Because the mock defines the
output of the chooseFile method call, the test does not rely on the existence of an external file.
• Change the testInputButton test method so that it will do these things.

• Create a mock object of the FileChooser.


• Define mock behavior such that when the chooseFile method is called with the input '*.*',
the outputs are the test file name ('[Link]'), the current working folder, and a selected
filter index of 1. These outputs are analogous to the outputs from the uigetfile function.
• Press the button and verify the selected file name. These steps are the same as in the original
test, but the mock assigns the output values, so you do not need to interact with the app to
continue testing.
• To test the Cancel button, add a test method testInputButton_Cancel so that it will do these
things.

• Create a mock object of the FileChooser.


• Define mock behavior such that when the chooseFile method is called with the input '*.*',
the outputs are the test file name ('[Link]'), the current working folder, and a selected
filter index of 0. These outputs are analogous to the outputs from the uigetfile function if a
user selects a file and then chooses to cancel.
• Press the button and verify that the test calls the chooseFile method and that the label
indicates that no file was selected.
classdef LaunchAppTest < [Link] & [Link]
methods (Test)
function testInputButton(tc)
import [Link]
fname = '[Link]';

[mockChooser,behavior] = [Link](?FileChooser);
when([Link]('*.*'),AssignOutputs(fname,pwd,1))

app = launchApp(mockChooser);
[Link](@close,[Link]);

[Link]([Link]);

[Link]([Link],fname);
end

function testInputButton_Cancel(tc)
import [Link]

[mockChooser, behavior] = [Link](?FileChooser);


when([Link]('*.*'),AssignOutputs('[Link]',pwd,0))

app = launchApp(mockChooser);
[Link](@close,[Link]);

34-155
34 Unit Testing

[Link]([Link]);

[Link]([Link]('*.*'));
[Link]([Link],'No file selected');
end
end
end

Run the tests. The tests run to completion without manual file selection.

results = runtests('LaunchAppTest');

Running LaunchAppTest
..
Done LaunchAppTest
__________

See Also
[Link] | [Link]

More About
• “Overview of App Testing Framework” on page 34-143
• “Write Test for App” on page 34-148
• “Create Mock Object” on page 34-174

34-156
Overview of Performance Testing Framework

Overview of Performance Testing Framework

In this section...
“Determine Bounds of Measured Code” on page 34-157
“Types of Time Experiments” on page 34-158
“Write Performance Tests with Measurement Boundaries” on page 34-158
“Run Performance Tests” on page 34-159
“Understand Invalid Test Results” on page 34-159

The performance test interface leverages the script, function, and class-based unit testing interfaces.
You can perform qualifications within your performance tests to ensure correct functional behavior
while measuring code performance. Also, you can run your performance tests as standard regression
tests to ensure that code changes do not break performance tests.

Determine Bounds of Measured Code


This table indicates what code is measured for the different types of tests.

Type of Test What Is Measured What Is Excluded


Script-based Code in each section of the • Code in the shared variables
script section
• Measured estimate of the
framework overhead
Function-based Code in each test function • Code in the following
functions: setup,
setupOnce, teardown, and
teardownOnce
• Measured estimate of the
framework overhead
Class-based Code in each method tagged • Code in the methods with the
with the Test attribute following attributes:
TestMethodSetup,
TestMethodTeardown,
TestClassSetup, and
TestClassTeardown
• Shared fixture setup and
teardown
• Measured estimate of the
framework overhead
Class-based deriving from Code between calls to • Code outside of the
[Link] startMeasuring and startMeasuring/
and using startMeasuring stopMeasuring in each stopMeasuring boundary
and stopMeasuring methods method tagged with the Test • Measured estimate of the
attribute framework overhead

34-157
34 Unit Testing

Type of Test What Is Measured What Is Excluded


Class-based deriving from Code inside each • Code outside of the
[Link] keepMeasuring-while loop in keepMeasuring-while
and using the keepMeasuring each method tagged with the boundary
method Test attribute • Measured estimate of the
framework overhead

Types of Time Experiments


You can create two types of time experiments.

• A frequentist time experiment collects a variable number of measurements to achieve a specified


margin of error and confidence level. Use a frequentist time experiment to define statistical
objectives for your measurement samples. Generate this experiment using the runperf function
or the limitingSamplingError static method of the TimeExperiment class.
• A fixed time experiment collects a fixed number of measurements. Use a fixed time experiment to
measure first-time costs of your code or to take explicit control of your sample size. Generate this
experiment using the withFixedSampleSize static method of the TimeExperiment class.

This table summarizes the differences between the frequentist and fixed time experiments.

Frequentist time experiment Fixed time experiment


Warm-up measurements 4 by default, but configurable 0 by default, but configurable
through through
[Link] [Link]
amplingError SampleSize
Number of samples Between 4 and 256 by default, Defined during experiment
but configurable through construction
[Link]
amplingError
Relative margin of error 5% by default, but configurable Not applicable
through
[Link]
amplingError
Confidence level 95% by default, but configurable Not applicable
through
[Link]
amplingError
Framework behavior for invalid Stops measuring a test and Collects specified number of
test result moves to the next one samples

Write Performance Tests with Measurement Boundaries


If your class-based tests derive from [Link] instead of
[Link], then you can use the startMeasuring and stopMeasuring
methods or the keepMeasuring method multiple times to define boundaries for performance test
measurements. If a test method has multiple calls to startMeasuring, stopMeasuring and
keepMeasuring, then the performance testing framework accumulates and sums the measurements.

34-158
Overview of Performance Testing Framework

The performance testing framework does not support nested measurement boundaries. If you use
these methods incorrectly in a Test method and run the test as a TimeExperiment, then the
framework marks the measurement as invalid. Also, you still can run these performance tests as unit
tests. For more information, see “Test Performance Using Classes” on page 34-165.

Run Performance Tests


There are two ways to run performance tests:

• Use the runperf function to run the tests. This function uses a variable number of measurements
to reach a sample mean with a 0.05 relative margin of error within a 0.95 confidence level. It runs
the tests four times to warm up the code and between 4 and 256 times to collect measurements
that meet the statistical objectives.
• Generate an explicit test suite using the testsuite function or the methods in the TestSuite
class, and then create and run a time experiment.

• Use the withFixedSampleSize method of the TimeExperiment class to construct a time


experiment with a fixed number of measurements. You can specify a fixed number of warm-up
measurements and a fixed number of samples.
• Use the limitingSamplingError method of the TimeExperiment class to construct a time
experiment with specified statistical objectives, such as margin of error and confidence level.
Also, you can specify the number of warm-up measurements and the minimum and maximum
number of samples.

You can run your performance tests as regression tests. For more information, see “Test Performance
Using Classes” on page 34-165.

Understand Invalid Test Results


In some situations, the MeasurementResult for a test result is marked invalid. A test result is
marked invalid when the performance testing framework sets the Valid property of the
MeasurementResult to false. This invalidation occurs if your test fails or is filtered. Also, if your test
incorrectly uses the startMeasuring and stopMeasuring methods of
[Link], then the MeasurementResult for that test is marked invalid.

When the performance testing framework encounters an invalid test result, it behaves differently
depending on the type of time experiment:

• If you create a frequentist time experiment, then the framework stops measuring for that test and
moves to the next test.
• If you create a fixed time experiment, then the framework continues collecting the specified
number of samples.

See Also
[Link] | [Link] |
runperf | testsuite

Related Examples
• “Test Performance Using Scripts or Functions” on page 34-161

34-159
34 Unit Testing

• “Test Performance Using Classes” on page 34-165

34-160
Test Performance Using Scripts or Functions

Test Performance Using Scripts or Functions


This example shows how to create a script or function-based performance test that times the
preallocation of a vector using four different approaches.

Write Performance Test

Create a performance test in a file, preallocationTest.m, in your current working folder. In this
example, you can choose to use either the following script-based test or the function-based test. The
output in this example is for the function-based test. If you use the script-based test, then your test
names will be different.

Script-Based Performance Test Function-Based Performance Test


vectorSize = 1e7; function tests = preallocationTest
tests = functiontests(localfunctions);
%% Ones Function end
x = ones(1,vectorSize);
function testOnes(testCase)
%% Indexing With Variable vectorSize = getSize();
id = 1:vectorSize; x = ones(1,vectorSize());
x(id) = 1; end

%% Indexing On LHS function testIndexingWithVariable(testCase)


x(1:vectorSize) = 1; vectorSize = getSize();
id = 1:vectorSize;
%% For Loop x(id) = 1;
for i=1:vectorSize end
x(i) = 1;
end function testIndexingOnLHS(testCase)
vectorSize = getSize();
x(1:vectorSize) = 1;
end

function testForLoop(testCase)
vectorSize = getSize();
for i=1:vectorSize
x(i) = 1;
end
end

function vectorSize = getSize()


vectorSize = 1e7;
end

Run Performance Test

Run the performance test using runperf.

results = runperf('preallocationTest.m')

Running preallocationTest
.......... .......... .......... ..
Done preallocationTest
__________

34-161
34 Unit Testing

results =

1×4 TimeResult array with properties:

Name
Valid
Samples
TestActivity

Totals:
4 Valid, 0 Invalid.
10.2561 seconds testing time.

The results variable is a 1-by-4 TimeResult array. Each element in the array corresponds to one of
the tests defined in the code section in preallocationTest.m.

Display Test Results

Display the measurement results for the second test. Your results might vary.

results(2)

ans =

TimeResult with properties:

Name: 'preallocationTest/testIndexingWithVariable'
Valid: 1
Samples: [4×7 table]
TestActivity: [8×12 table]

Totals:
1 Valid, 0 Invalid.
1.2274 seconds testing time.

As indicated by the size of the TestActivity property, the performance testing framework collected
8 measurements. This number of measurements includes four measurements to warm up the code.
The Samples property excludes warm-up measurements.

Display the sample measurements for the second test.

results(2).Samples

>> results(2).Samples

ans =

4×7 table

Name MeasuredTime Timestamp Host


__________________________________________ ____________ ____________________ _______

preallocationTest/testIndexingWithVariable 0.15271 24-Jun-2019 16:13:33 MY-HOST


preallocationTest/testIndexingWithVariable 0.15285 24-Jun-2019 16:13:33 MY-HOST
preallocationTest/testIndexingWithVariable 0.15266 24-Jun-2019 16:13:33 MY-HOST
preallocationTest/testIndexingWithVariable 0.15539 24-Jun-2019 16:13:34 MY-HOST

34-162
Test Performance Using Scripts or Functions

Compute Statistics for Single Test Element

Display the mean measured time for the second test. To exclude data collected in the warm-up runs,
use the values in the Samples field.
sampleTimes = results(2).[Link];
meanTest2 = mean(sampleTimes)

meanTest2 =

0.1534

The performance testing framework collected four sample measurements for the second test. The test
took an average of 0.1534 second.

Compute Statistics for All Test Elements

Determine the average time for all the test elements. The preallocationTest test includes four
different methods for allocating a vector of ones. Compare the time for each method (test element).

Since the performance testing framework returns a Samples table for each test element,
concatenate all these tables into one table. Then group the rows by test element Name, and compute
the mean MeasuredTime for each group.
fullTable = vertcat([Link]);
summaryStats = varfun(@mean,fullTable,...
'InputVariables','MeasuredTime','GroupingVariables','Name')

summaryStats =

4×3 table

Name GroupCount mean_MeasuredTime


__________________________________________ __________ _________________

preallocationTest/testOnes 4 0.041072
preallocationTest/testIndexingWithVariable 4 0.1534
preallocationTest/testIndexingOnLHS 4 0.04677
preallocationTest/testForLoop 4 1.0343

Change Statistical Objectives and Rerun Tests

Change the statistical objectives defined by the runperf function by constructing and running a time
experiment. Construct a time experiment with measurements that reach a sample mean with an 8%
relative margin of error within a 97% confidence level.

Construct an explicit test suite.


suite = testsuite('preallocationTest');

Construct a time experiment with a variable number of sample measurements, and run the tests.
import [Link]
experiment = [Link]('NumWarmups',2,...
'RelativeMarginOfError',0.08, 'ConfidenceLevel', 0.97);
resultsTE = run(experiment,suite);

Running preallocationTest
.......... .......... ....

34-163
34 Unit Testing

Done preallocationTest
__________

Compute the statistics for all the test elements.

fullTableTE = vertcat([Link]);
summaryStatsTE = varfun(@mean,fullTableTE,...
'InputVariables','MeasuredTime','GroupingVariables','Name')

summaryStatsTE =

4×3 table

Name GroupCount mean_MeasuredTime


__________________________________________ __________ _________________

preallocationTest/testOnes 4 0.040484
preallocationTest/testIndexingWithVariable 4 0.15187
preallocationTest/testIndexingOnLHS 4 0.046224
preallocationTest/testForLoop 4 1.0262

See Also
[Link] | [Link] |
[Link] | runperf | testsuite

34-164
Test Performance Using Classes

Test Performance Using Classes


This example shows how to create a performance test and regression test for the fprintf function.

Write Performance Test

Consider the following unit (regression) test. You can run this test as a performance test using
runperf('fprintfTest') instead of runtests('fprintfTest').

classdef fprintfTest < [Link]


properties
file
fid
end
methods(TestMethodSetup)
function openFile(testCase)
[Link] = tempname;
[Link] = fopen([Link],'w');
[Link]([Link],-1,'IO Problem')

[Link](@delete,[Link]);
[Link](@fclose,[Link]);
end
end

methods(Test)
function testPrintingToFile(testCase)
textToWrite = repmat('abcdef',1,5000000);
fprintf([Link],'%s',textToWrite);
[Link](fileread([Link]),textToWrite)
end

function testBytesToFile(testCase)
textToWrite = repmat('tests_',1,5000000);
nbytes = fprintf([Link],'%s',textToWrite);
[Link](nbytes,length(textToWrite))
end
end
end

The measured time does not include the time to open and close the file or the assertion because these
activities take place inside a TestMethodSetup block, and not inside a Test block. However, the
measured time includes the time to perform the verifications. Best practice is to measure a more
accurate performance boundary.

Create a performance test in a file, fprintfTest.m, in your current working folder. This test is
similar to the regression test with the following modifications:

• The test inherits from [Link] instead of [Link].


• The test calls the startMeasuring and stopMeasuring methods to create a boundary around
the fprintf function call.

classdef fprintfTest < [Link]


properties
file
fid

34-165
34 Unit Testing

end
methods(TestMethodSetup)
function openFile(testCase)
[Link] = tempname;
[Link] = fopen([Link],'w');
[Link]([Link],-1,'IO Problem')

[Link](@delete,[Link]);
[Link](@fclose,[Link]);
end
end

methods(Test)
function testPrintingToFile(testCase)
textToWrite = repmat('abcdef',1,5000000);

[Link]();
fprintf([Link],'%s',textToWrite);
[Link]();

[Link](fileread([Link]),textToWrite)
end

function testBytesToFile(testCase)
textToWrite = repmat('tests_',1,5000000);

[Link]();
nbytes = fprintf([Link],'%s',textToWrite);
[Link]();

[Link](nbytes,length(textToWrite))
end
end
end

The measured time for this performance test includes only the call to fprintf, and the testing
framework still evaluates the qualifications.

Run Performance Test

Run the performance test. Depending on your system, you might see warnings that the performance
testing framework ran the test the maximum number of times, but did not achieve a 0.05 relative
margin of error with a 0.95 confidence level.

results = runperf('fprintfTest')

Running fprintfTest
.......... .......... .
Done fprintfTest
__________

results =

1×2 TimeResult array with properties:

Name
Valid

34-166
Test Performance Using Classes

Samples
TestActivity

Totals:
2 Valid, 0 Invalid.
4.1417 seconds testing time.

The results variable is a 1-by-2 TimeResultarray. Each element in the array corresponds to one of
the tests defined in the test file.

Display Test Results

Display the measurement results for the first test. Your results might vary.

results(1)

ans =

TimeResult with properties:

Name: 'fprintfTest/testPrintingToFile'
Valid: 1
Samples: [4×7 table]
TestActivity: [8×12 table]

Totals:
1 Valid, 0 Invalid.
2.7124 seconds testing time.

As indicated by the size of the TestActivity property, the performance testing framework collected
8 measurements. This number includes 4 measurements to warm up the code. The Samples property
excludes warm-up measurements.

Display the sample measurements for the first test.

results(1).Samples

ans =

4×7 table

Name MeasuredTime Timestamp Host Plat


______________________________ ____________ ____________________ ___________ ____

fprintfTest/testPrintingToFile 0.067729 24-Jun-2019 16:22:09 MY-HOSTNAME win


fprintfTest/testPrintingToFile 0.067513 24-Jun-2019 16:22:09 MY-HOSTNAME win
fprintfTest/testPrintingToFile 0.068737 24-Jun-2019 16:22:09 MY-HOSTNAME win
fprintfTest/testPrintingToFile 0.068576 24-Jun-2019 16:22:10 MY-HOSTNAME win

Compute Statistics for Single Test Element

Display the mean measured time for the first test. To exclude data collected in the warm-up runs, use
the values in the Samples field.

sampleTimes = results(1).[Link];
meanTest = mean(sampleTimes)

34-167
34 Unit Testing

meanTest =

0.0681

Compute Statistics for All Test Elements

Determine the average time for all the test elements. The fprintfTest test includes two different
methods. Compare the time for each method (test element).

Since the performance testing framework returns a Samples table for each test element,
concatenate all these tables into one table. Then group the rows by test element Name, and compute
the mean MeasuredTime for each group.

fullTable = vertcat([Link]);
summaryStats = varfun(@mean,fullTable,...
'InputVariables','MeasuredTime','GroupingVariables','Name')

summaryStats =

2×3 table

Name GroupCount mean_MeasuredTime


______________________________ __________ _________________

fprintfTest/testPrintingToFile 4 0.068139
fprintfTest/testBytesToFile 9 0.071595

Both test methods write the same amount of data to a file. Therefore, some of the difference between
the mean values is attributed to calling the fprintf function with an output argument.

Change Statistical Objectives and Rerun Tests

Change the statistical objectives defined by the runperf function by constructing and running a time
experiment. Construct a time experiment with measurements that reach a sample mean with a 3%
relative margin of error within a 97% confidence level. Collect 4 warm-up measurements and up to 16
sample measurements.

Construct an explicit test suite.

suite = testsuite('fprintfTest');

Construct a time experiment with a variable number of sample measurements, and run the tests.
import [Link]
experiment = [Link]('NumWarmups',4,...
'MaxSamples',16,'RelativeMarginOfError',0.03,'ConfidenceLevel',0.97);
resultsTE = run(experiment,suite);

Running fprintfTest
.......... ..........Warning: Target Relative Margin of Error not met after running the MaxSample
........
Done fprintfTest
__________

In this example output, the performance testing framework is not able to meet the stricter statistical
objectives with the specified number of maximum samples. Your results might vary.

Compute the statistics for all the test elements.

34-168
Test Performance Using Classes

fullTableTE = vertcat([Link]);
summaryStatsTE = varfun(@mean,fullTableTE,...
'InputVariables','MeasuredTime','GroupingVariables','Name')

summaryStatsTE =

2×3 table

Name GroupCount mean_MeasuredTime


______________________________ __________ _________________

fprintfTest/testPrintingToFile 16 0.069482
fprintfTest/testBytesToFile 4 0.067902

Increase the maximum number of samples to 32 and rerun the time experiment.
experiment = [Link]('NumWarmups',4,...
'MaxSamples',32,'RelativeMarginOfError',0.03,'ConfidenceLevel',0.97);
resultsTE = run(experiment,suite);

Running fprintfTest
.......... ......
Done fprintfTest
__________

Compute the statistics for all the test elements.

fullTableTE = vertcat([Link]);
summaryStatsTE = varfun(@mean,fullTableTE,...
'InputVariables','MeasuredTime','GroupingVariables','Name')

summaryStatsTE =

2×3 table

Name GroupCount mean_MeasuredTime


______________________________ __________ _________________

fprintfTest/testPrintingToFile 4 0.067228
fprintfTest/testBytesToFile 4 0.067766

The testing framework achieves the statistical objectives for both tests with 4 samples.

Measure First-time Cost

Start a new MATLAB session. A new session ensures that MATLAB has not run the code contained in
your tests.

Measure the first-time cost of your code by creating and running a fixed time experiment with zero
warm-up measurements and one sample measurement.

Construct an explicit test suite. Since you are measuring the first-time cost of the function, run a
single test. To run multiple tests, save the results and start a new MATLAB session between tests.

suite = testsuite('fprintfTest/testPrintingToFile');

Construct and run the time experiment.

34-169
34 Unit Testing

import [Link]
experiment = [Link](1);
results = run(experiment,suite);

Running fprintfTest
.
Done fprintfTest
__________

Display the results. Observe the TestActivity table to ensure there are no warm-up samples.

fullTable = [Link]
fullTable =

1×12 table

Name Passed Failed Incomplete MeasuredTime Objective Timestamp Host


______________________________ ______ ______ __________ ____________ _________ ____________________ ___________

fprintfTest/testPrintingToFile true false false 0.071754 sample 24-Jun-2019 16:31:27 MY-HOSTNAME

The performance testing framework collects one sample for each test.

See Also
[Link] | [Link] |
[Link] |
[Link] | runperf | testsuite

34-170
Measure Fast Executing Test Code

Measure Fast Executing Test Code


Performance tests that execute too quickly for MATLAB to measure accurately are filtered with an
assumption failure. With the keepMeasuring method, the testing framework can measure
significantly faster code by automatically determining the number of times to iterate through code
and measuring the average performance.

In your current working folder, create a class-based test, PreallocationTest.m, that compares
different methods of preallocation. Since the test methods include qualifications, use the
startMeasuring and stopMeasuring methods to define boundaries for the code you want to
measure.
classdef PreallocationTest < [Link]
methods(Test)
function testOnes(testCase)
[Link]
x = ones(1,1e5);
[Link]
[Link](size(x),[1 1e5])
end

function testIndexingWithVariable(testCase)
import [Link]
[Link]
id = 1:1e5;
x(id) = 1;
[Link]
[Link](x,IsSameSetAs(1))
end

function testIndexingOnLHS(testCase)
import [Link]
import [Link]
[Link]
x(1:1e5) = 1;
[Link]
[Link](EveryElementOf(x),IsEqualTo(1))
end

function testForLoop(testCase)
[Link]
for i=1:1e5
x(i) = 1;
end
[Link]
[Link](x,1e5)
end
end
end

Run PreallocationTest as a performance test. Two tests are filtered because the measurements
are too close to the precision of the framework.
results = runperf('PreallocationTest');
Running PreallocationTest
........
================================================================================

34-171
34 Unit Testing

PreallocationTest/testOnes was filtered.


Test Diagnostic: The MeasuredTime should not be too close to the precision of the framework.
Details
================================================================================
.. .......... ....
================================================================================
PreallocationTest/testIndexingOnLHS was filtered.
Test Diagnostic: The MeasuredTime should not be too close to the precision of the framework.
Details
================================================================================
...... ..
Done PreallocationTest
__________

Failure Summary:

Name Failed Incomplete Reason(s)


==================================================================================
PreallocationTest/testOnes X Filtered by assumption.
----------------------------------------------------------------------------------
PreallocationTest/testIndexingOnLHS X Filtered by assumption.

To instruct the framework to automatically loop through the measured code and average the
measurement results, modify PreallocationTest to use a keepMeasuring-while loop instead of
startMeasuring and stopMeasuring.

classdef PreallocationTest < [Link]


methods(Test)
function testOnes(testCase)
while([Link])
x = ones(1,1e5);
end
[Link](size(x),[1 1e5])
end

function testIndexingWithVariable(testCase)
import [Link]
while([Link])
id = 1:1e5;
x(id) = 1;
end
[Link](x,IsSameSetAs(1))
end

function testIndexingOnLHS(testCase)
import [Link]
import [Link]
while([Link])
x(1:1e5) = 1;
end
[Link](EveryElementOf(x),IsEqualTo(1))
end

function testForLoop(testCase)
while([Link])
for i=1:1e5
x(i) = 1;
end
end
[Link](x,1e5)
end
end
end

34-172
Measure Fast Executing Test Code

Rerun the tests. All the tests complete.

results = runperf('PreallocationTest');

Running PreallocationTest
.......... .......... .......... ..
Done PreallocationTest
__________

View the results.

sampleSummary(results)

ans =

4×7 table

Name SampleSize Mean StandardDeviation Min Median


__________________________________________ __________ __________ _________________ __________ ________

PreallocationTest/testOnes 4 3.0804e-05 1.8337e-07 3.0577e-05 3.0843e-


PreallocationTest/testIndexingWithVariable 4 0.00044536 1.7788e-05 0.00042912 0.000443
PreallocationTest/testIndexingOnLHS 4 5.6352e-05 1.8863e-06 5.5108e-05 5.5598e-
PreallocationTest/testForLoop 4 0.0097656 0.00018202 0.0096181 0.00970

See Also
keepMeasuring | runperf

Related Examples
• “Overview of Performance Testing Framework” on page 34-157
• “Test Performance Using Classes” on page 34-165

34-173
34 Unit Testing

Create Mock Object


When unit testing, you are often interested in testing a portion of a complete system, isolated from
the components it depends on. To test a portion of the system, we can substitute mock objects to
replace the depended-on components. A mock object implements at least part of the same interface
as the production object, but often in a manner that is simple, efficient, predictable, and controllable.
When you use the mocking framework, the component under test is unaware of whether its
collaborator is a "real" object or a mock object.

For example, suppose you want to test an algorithm for buying stock, but you do not want to test the
entire system. You could use a mock object to replace the functionality of looking up the stock price,
and another mock object to verify that the trader purchased the stock. The algorithm you are testing
does not know that it is operating on mock objects, and you can test the algorithm isolated from the
rest of the system.

Using a mock object, you can define behavior (a process known as stubbing). For example, you can
specify that an object produces predefined responses to queries. You can also intercept and
remember messages sent from the component under test to the mock object (a process known as
spying). For example, you can verify that a particular method was called or a property was set.

The typical workflow to test a component in isolation is as follows:

1 Create mocks for the depended-on components.


2 Define behaviors of the mocks. For example, define the outputs that a mocked method or
property returns when it is called with a particular set of inputs.
3 Test the component of interest.

34-174
Create Mock Object

4 Qualify interactions between the component of interest and the mocked components. For
example, verify that a mocked method was called with particular inputs, or that a property was
set.

Depended on Components

In this example, the component under test is a simple day-trading algorithm. It is the part of the
system you want to test independent of other components. The day-trading algorithm has two
dependencies: a data service to retrieve the stock price data and a broker to purchase the stock.

In a file DataService.m in your current working folder, create an abstract class that includes a
lookupPrice method.
classdef DataService
methods (Abstract,Static)
price = lookupPrice(ticker,date)
end
end

In production code, there could be several concrete implementations of the DataService class, such
as a BloombergDataService class. This class uses the Datafeed Toolbox™. However, since we
create a mock of the DataService class, you do not need to have the toolbox installed to run the
tests for the trading algorithm.
classdef BloombergDataService < DataService
methods (Static)
function price = lookupPrice(ticker,date)
% This method assumes you have installed and configured the
% Bloomberg software.
conn = blp;
data = history(conn,ticker,'LAST_PRICE',date-1,date);
price = data(end);
close(conn)
end
end
end

In this example, assume that the broker component has not been developed yet. Once it is
implemented, it will have a buy method that accepts a ticker symbol and a specified number of shares
to buy, and returns a status code. The mock for the broker component uses an implicit interface, and
does not derive from a superclass.

Component Under Test

In a file trader.m in your current working folder, create a simple day trading algorithm. The trader
function accepts as inputs a data service object that looks up the price of the stock, a broker object
that defines how the stock is bought, a ticker symbol, and a number of shares to purchase. If the
price from yesterday is less than the price two days ago, instruct the broker to buy the specified
number of shares.
function trader(dataService,broker,ticker,numShares)
yesterday = datetime('yesterday');
priceYesterday = [Link](ticker,yesterday);
price2DaysAgo = [Link](ticker,yesterday-days(1));

if priceYesterday < price2DaysAgo


[Link](ticker,numShares);

34-175
34 Unit Testing

end
end

Mock Objects and Behavior Objects

The mock object is an implementation of the abstract methods and properties of the interface
specified by a superclass. You can also construct a mock without a superclass, in which case the mock
has an implicit interface. The component under test interacts with the mock object, for example, by
calling a mock object method or accessing a mock object property. The mock object carries out
predefined actions in response to these interactions.

When you create a mock, you also create an associated behavior object. The behavior object defines
the same methods as the mock object and controls mock behavior. Use the behavior object to define
mock actions and qualify interactions. For example, use it to define values a mocked method returns,
or verify that a property was accessed.

At the command prompt, create a mock test case for interactive use. Using the mock in a test class
instead of at the command prompt is presented later in this example.

import [Link]
testCase = [Link];

Create Stub to Define Behavior

Create a mock for the data service dependency and examine the methods on it. The data service
mock returns predefined values, replacing the implementation of the service that provides actual
stock prices. Therefore, it exhibits stubbing behavior.

[stubDataService,dataServiceBehavior] = createMock(testCase,?DataService);
methods(stubDataService)

Methods for class [Link]:

Static methods:

lookupPrice

In the DataService class, the lookupPrice method is abstract and static. The mocking framework
implements this method as concrete and static.

Define behavior for the data service mock. For ticker symbol "FOO", it returns the price yesterday as
$123 and anything before yesterday is $234. Therefore, according to the trader function, the broker
always buys stock "FOO". For the ticker symbol "BAR", it returns the price yesterday as $765 and
anything before yesterday is $543. Therefore, the broker never buys stock "BAR".

import [Link]
yesterday = datetime('yesterday');

[Link]([Link](...
"FOO",yesterday),123);
[Link]([Link](...
"FOO",IsLessThan(yesterday)),234);

34-176
Create Mock Object

[Link]([Link](...
"BAR",yesterday),765);
[Link]([Link](...
"BAR",IsLessThan(yesterday)),543);

You can now call the mocked lookupPrice method.

p1 = [Link]("FOO",yesterday)
p2 = [Link]("BAR",yesterday-days(5))

p1 =

123

p2 =

543

While the assignOutputsWhen method on testCase is convenient to specify behavior, there is


more functionality if you use the AssignOutputs action. For more information, see “Specify Mock
Object Behavior” on page 34-181.

Create Spy to Intercept Messages

Create a mock for the broker dependency and examine the methods on it. Since the broker mock is
used to verify interactions with the component under test (the trader function), it exhibits spying
behavior. The broker mock has an implicit interface. While the buy method is not currently
implemented, you can create a mock with it.

[spyBroker,brokerBehavior] = createMock(testCase,'AddedMethods',{'buy'});
methods(spyBroker)

Methods for class [Link]:

buy

Call the buy method of the mock. By default it returns empty.

s1 = [Link]
s2 = [Link]("inputs",[13 42])

s1 =

[]

s2 =

[]

34-177
34 Unit Testing

Since the trader function does not use the status return code, the default mock behavior of
returning empty is acceptable. The broker mock is a pure spy, and does not need to implement any
stubbing behavior.

Call Component Under Test

Call the trader function. In addition to the ticker symbol and the number of shares to buy, the
trader function takes as inputs the data service and the broker. Instead of passing in actual data
service and broker objects, pass in the spyBroker and stubDataService mocks.
trader(stubDataService,spyBroker,"FOO",100)
trader(stubDataService,spyBroker,"FOO",75)
trader(stubDataService,spyBroker,"BAR",100)

Verify Function Interactions

Use the broker behavior object (the spy) to verify that the trader function calls the buy method, as
expected.

Use the [Link] method to verify that the trader function instructed the buy
method to buy 100 shares of the FOO stock.
import [Link];
[Link]([Link]("FOO",100))

Verification passed.

Verify that FOO stock was purchased two times, regardless of the specified number of shares. While
the verifyCalled method is convenient to specify behavior, there is more functionality if you use
the WasCalled constraint. For example, you can verify that a mocked method was called a specified
number of times.
import [Link]
[Link]([Link]("FOO",IsAnything), ...
WasCalled('WithCount',2))

Verification passed.

Verify that the buy method was not called requesting 100 shares of the BAR stock.
[Link]([Link]("BAR",100))

Verification passed.

Although the trader function was called requesting 100 shares of BAR stock, the stub defined
yesterday's price for BAR to return a higher value than all days prior to yesterday. Therefore, the
broker never buys stock "BAR".

Test Class for trader Function

The interactive test case is convenient to experiment with at the command prompt. However, it is
typical to create and use mocks within a test class. In a file in your current working folder, create the
following test class that incorporates the interactive testing from this example.
classdef TraderTest < [Link]
methods(Test)
function buysStockWhenDrops(testCase)
import [Link]

34-178
Create Mock Object

import [Link]
import [Link]
yesterday = datetime('yesterday');

% Create mocks
[stubDataService,dataServiceBehavior] = createMock(testCase,...
?DataService);
[spyBroker,brokerBehavior] = createMock(testCase,...
'AddedMethods',{'buy'});

% Set up behavior
[Link]([Link](...
"FOO",yesterday),123);
[Link]([Link](...
"FOO",IsLessThan(yesterday)),234);

% Call function under test


trader(stubDataService,spyBroker,"FOO",100)
trader(stubDataService,spyBroker,"FOO",75)

% Verify interactions
[Link]([Link]("FOO",100))
[Link]([Link]("FOO",IsAnything),...
WasCalled('WithCount',2))
end
function doesNotBuyStockWhenIncreases(testCase)
import [Link]
yesterday = datetime('yesterday');

% Create mocks
[stubDataService,dataServiceBehavior] = createMock(testCase,...
?DataService);
[spyBroker,brokerBehavior] = createMock(testCase, ...
'AddedMethods',{'buy'});

% Set up behavior
[Link]([Link](...
"BAR",yesterday),765);
[Link]([Link](...
"BAR",IsLessThan(yesterday)),543);

% Call function under test


trader(stubDataService,spyBroker,"BAR",100)

% Verify interactions
[Link]([Link]("BAR",100))
end
end
end

Run the tests and view a table of the results.

results = runtests('TraderTest');
table(results)

Running TraderTest
..
Done TraderTest

34-179
34 Unit Testing

__________

ans =

2×6 table

Name Passed Failed Incomplete Duration


_________________________________________ ______ ______ __________ ________ __

'TraderTest/buysStockWhenDrops' true false false 0.24223 [1


'TraderTest/doesNotBuyStockWhenIncreases' true false false 0.073614 [1

See Also

34-180
Specify Mock Object Behavior

Specify Mock Object Behavior


In this section...
“Define Mock Method Behavior” on page 34-181
“Define Mock Property Behavior” on page 34-182
“Define Repeating and Subsequent Behavior” on page 34-183
“Summary of Behaviors” on page 34-185

When you create a mock, you create an associated behavior object that controls mock behavior. Use
this object to define mock method and property behavior (stub). For more information on creating a
mock, see “Create Mock Object” on page 34-174.

The mock object is an implementation of the abstract methods and properties of the interface
specified by a superclass. You can also construct a mock without a superclass, in which case the mock
has an implicit interface.

Create a mock with an implicit interface. The interface includes Name and ID properties and a
findUser method that accepts an identifier and returns a name. While the interface is not currently
implemented, you can create a mock with it.

testCase = [Link];
[mock,behaviorObj] = [Link]('AddedProperties', ...
{'Name','ID'},'AddedMethods',{'findUser'});

Define Mock Method Behavior


You can specify that a mock method returns specific values or throws an exception in different
situations.

Specify that when the findUser method is called with any inputs, it returns "Unknown". By default,
MATLAB returns an empty array when you call the findUser method.

• The assignOutputsWhen method defines return values for the method call.
• The mocked method call ([Link]) implicitly creates a MethodCallBehavior
object.
• The withAnyInputs method of the MethodCallBehavior object specifies that the behavior
applies to a method call with any number of inputs with any value.

[Link](withAnyInputs([Link]),"Unknown")
n = [Link](1)

n =

"Unknown"

Specify that when the input value is 1701, the mock method returns "Jim". This behavior supersedes
the return of "Unknown" for the input value of 1701 only because it was defined after that
specification.

[Link]([Link](1701),"Jim")
n = [Link](1701)

34-181
34 Unit Testing

n =

"Jim"

Specify that when the findUser method is called with only the object as input, the mock method
returns "Unspecified ID". The withExactInputs method of the MethodCallBehavior object
specifies that the behavior applies to a method call with the object as the only input value.
[Link](withExactInputs([Link]), ...
"Unspecified ID")
n = [Link] % equivalent to n = findUser(mock)

n =

"Unspecified ID"

You can use classes in the [Link] package to help define behavior.
Specify that findUser throws an exception when it is called with an ID greater than 5000.
import [Link]
[Link]([Link](IsGreaterThan(5000)));
n = [Link](5001)

Error using
[Link]/createMockObject/mockMethodCallback (line 323)
The following method call was specified to throw an exception:
findUser([1×1 [Link]], 5001)

You can define behavior based on the number of outputs requested in a method call. If the method
call requests two output values, return "??" for the name and -1 for the ID.
[Link](withNargout(2, ...
withAnyInputs([Link])),"??",-1)
[n,id] = [Link](13)

n =

"??"

id =

-1

Define Mock Property Behavior


When a mock property is accessed, you can specify that it returns specific or stored property values.
When it is set, you can specify when the mock stores the property value. You can also define when the
testing framework throws an exception for mock property set or access activities.

When defining mock property behavior, keep in mind that displaying a property value in the command
window is a property access (get) operation.

Similar to defining mock method behavior, defining mock property behavior requires an instance of
the PropertyBehavior class. The framework returns an instance of this class when you access a
mock property. To define access behavior, use an instance of PropertyGetBehavior by calling the
get method of the PropertyBehavior class. To define set behavior, use an instance of the

34-182
Specify Mock Object Behavior

PropertySetBehavior by calling the set or setToValue method of the PropertyBehavior


class.

Specify that when the Name property is set to any value, the testing framework throws an exception.

• The throwExceptionWhen method instructs the framework to throw an exception for a specified
behavior.
• Accessing a property on the behavior object PropertyBehavior class ([Link])
creates a PropertyBehavior class instance.
• The call to the set method of the PropertyBehavior class creates a PropertySetBehavior.
[Link](set([Link]))
[Link] = "Sue";

Error using [Link]/createMockObject/mockPropertySetCallback (line 368)


The following property set was specified to throw an exception:
<Mock>.Name = "Sue"

Allow the mock to store the value when the property is set to "David".
[Link](setToValue([Link],"David"));
[Link] = "David"

mock =

Mock with properties:

Name: "David"
ID: []

Define Repeating and Subsequent Behavior


The [Link] methods are convenient for defining behavior. However, there is more
functionality when you use a class in the [Link] package instead. Using these
classes, you can define behavior that repeats the same action multiple times and specify subsequent
actions. To define repeating or subsequent behavior, pass an instance of a class in the
[Link] package to the when method of the behavior class.

Assign the value of 1138 to the ID property and then throw an exception for property access.
import [Link]
import [Link]
when(get([Link]),then(AssignOutputs(1138),ThrowException))
id = [Link]
id = [Link]

id =

1138

Error using [Link]/createMockObject/mockPropertyGetCallback (line 346)


The following property access was specified to throw an exception:
<Mock>.ID

Assign the value of 1138 and then 237 to the ID property. Then, throw an exception for property
access. Each call to the then method accepts up to two actions. To specify more subsequent actions,
use multiple calls to then.

34-183
34 Unit Testing

when(get([Link]),then(AssignOutputs(1138), ...
then(AssignOutputs(237),ThrowException)))
id = [Link]
id = [Link]
id = [Link]

id =

1138

id =

237

Error using [Link]/createMockObject/mockPropertyGetCallback (line 346)


The following property access was specified to throw an exception:
<Mock>.ID

If the object is the only input value, specify the findUser function return the value of "Phil" twice.

when(withExactInputs([Link]),repeat(2,AssignOutputs("Phil")))
n = [Link]
n = [Link]

n =

"Phil"

n =

"Phil"

Call the function a third time. If you repeat an action, and do not follow it with a call to the then
method, the mock continues to return the repeated value.

n = [Link]

n =

"Phil"

Define behavior for setting the value of Name. Throw an exception the first two times and then store
the value.

import [Link]
when(set([Link]),then(repeat(2,ThrowException),StoreValue))
[Link] = "John"

Error using [Link]/createMockObject/mockPropertySetCallback (line 368)


The following property set was specified to throw an exception:
<Mock>.Name = "John"

[Link] = "Penny"

Error using [Link]/createMockObject/mockPropertySetCallback (line 368)


The following property set was specified to throw an exception:
<Mock>.Name = "Penny"

34-184
Specify Mock Object Behavior

[Link] = "Tommy"

mock =

Mock with properties:

Name: "Tommy"

Summary of Behaviors
Behavior TestCase Method [Link] Class
(Allows for Definition of
Repeat and Subsequent
Behavior)
Return specified values for assignOutputsWhen AssignOutputs
method call and property
access.
Return stored value when returnStoredValueWhen ReturnStoredValue
property is accessed.
Store value when property is storeValueWhen StoreValue
set.
Throw exception when method throwExceptionWhen ThrowException
is called or when property is set
or accessed.

See Also
[Link] | [Link] |
[Link] | [Link] |
[Link]

Related Examples
• “Create Mock Object” on page 34-174

34-185
34 Unit Testing

Qualify Mock Object Interaction


When you create a mock, you create an associated behavior object that controls mock behavior. Use
this object to access intercepted messages sent from the component under test to the mock object (a
process known as spying). For more information on creating a mock, see “Create Mock Object” on
page 34-174.

In the mocking framework, qualifications are functions used to test interactions with the object.
There are four types of qualifications:

• Verifications — Produce and record failures without throwing an exception. Since verifications do
not throw exceptions, all test content runs to completion even when verification failures occur.
Typically verifications are the primary qualifications for a unit test since they typically do not
require an early exit from the test. Use other qualification types to test for violation of
preconditions or incorrect test setup.
• Assumptions — Ensure that the test environment meets preconditions that otherwise do not result
in a test failure. Assumption failures result in filtered tests, and the testing framework marks the
tests as Incomplete.
• Assertions — Ensure that a failure condition invalidates the remainder of the current test content,
but does not prevent proper execution of subsequent test methods. A failure at the assertion point
marks the current test method as failed and incomplete.
• Fatal Assertions — Abort the test session upon failure. These qualifications are useful when the
failure mode is so fundamental that there is no point in continuing testing. These qualifications are
also useful when fixture teardown does not restore the MATLAB state correctly and it is preferable
to abort testing and start a fresh session.

The mock object is an implementation of the abstract methods and properties of the interface
specified by a superclass. You can also construct a mock without a superclass, in which case the mock
has an implicit interface. Create a mock with an implicit interface for a dice class. The interface
includes Color and NumSides properties and a roll method that accepts a number of dice and
returns a value. While the interface is not currently implemented, you can create a mock with it.

testCase = [Link];
[mock,behaviorObj] = [Link]('AddedProperties', ...
{'NumSides','Color'},'AddedMethods',{'roll'});

Qualify Mock Method Interaction


Since the mock records interactions sent to it, you can qualify that a mock method was called. Roll
one die.

val = [Link](1);

Verify that the roll method was called with 1 die.

[Link]([Link](1))

Interactive verification passed.

Verify that the roll method was called with 3 dice. This test fails.

[Link]([Link](3), ...
'roll method should have been called with input 3.')

34-186
Qualify Mock Object Interaction

Interactive verification failed.

----------------
Test Diagnostic:
----------------
roll method should have been called with input 3.

---------------------
Framework Diagnostic:
---------------------
verifyCalled failed.
--> Method 'roll' was not called with the specified signature.
--> Observed method call(s) with any signature:
out = roll([1×1 [Link]], 1)

Specified method call:


MethodCallBehavior
[...] = roll(<Mock>, 3)

Verify that the roll method was not called with 2 dice.

[Link]([Link](2))

Interactive verification passed.

Since the withAnyInputs, withExactInputs, and withNargout methods of the


MethodCallBehavior class return MethodCallBehavior objects, you can use them in
qualifications. Verify that the roll method was called at least once with any inputs.

[Link](withAnyInputs([Link]))

Interactive verification passed.

Verify that the roll method was not called with 2 outputs and any inputs.

[Link](withNargout(2,withAnyInputs([Link])))

Interactive verification passed.

Qualify Mock Property Interaction


Similar to method calls, the mock records property set and access operations. Set the color of the
dice.

[Link] = "red"

mock =

Mock with properties:

NumSides: []
Color: "red"

Verify that the color was set.

[Link]([Link])

Interactive verification passed.

34-187
34 Unit Testing

Verify the color was accessed. This test passes because there is an implicit property access when
MATLAB displays the object.

[Link]([Link])

Interactive verification passed.

Assert that the number of sides was not set.

[Link]([Link])

Interactive assertion passed.

Use Mock Object Constraints


The [Link] methods are convenient for spying on mock interactions. However,
there is more functionality when you use a class in the [Link] package
instead. To use a constraint, pass the behavior object and constraint to the verifyThat,
assumeThat, assertThat or fatalAssertThat method.

Create a new mock object.

testCase = [Link];
[mock,behaviorObj] = [Link]('AddedProperties', ...
{'NumSides','Color'},'AddedMethods',{'roll'});

Roll 2 dice. Then use a constraint to verify that the roll method was called at least once with two
dice.

val = [Link](2);

import [Link]
[Link]([Link](2),WasCalled)

Interactive verification passed.

Roll one die. Then verify that the roll method was called at least twice with any inputs.

val = [Link](1);

[Link](withAnyInputs([Link]), ...
WasCalled('WithCount',2))

Interactive verification passed.

Verify that NumSides was not accessed.

import [Link]
[Link]([Link],~WasAccessed)

Interactive verification passed.

Set the color of the dice. Then verify the property was set once.

[Link] = "blue";

import [Link]
[Link]([Link],WasSet('WithCount',1))

34-188
Qualify Mock Object Interaction

Interactive verification passed.

Access the Color property. Then verify that it was not accessed exactly once. This test fails.

c = [Link]

[Link]([Link],~WasAccessed('WithCount',1))

c =

"blue"

Interactive verification failed.

---------------------
Framework Diagnostic:
---------------------
Negated WasAccessed failed.
--> Property 'Color' was accessed the prohibited number of times.

Actual property access count:


1
Prohibited property access count:
1

Specified property access:


PropertyGetBehavior
<Mock>.Color

Set the number of sides. Then, verify that the number of sides was set to 22.

[Link] = 22;
[Link]([Link],WasSet('ToValue',22))

Interactive verification passed.

Use a constraint from the [Link] package to assert that the number of
dice sides isn't set to more than 20. This test fails.

import [Link]
[Link]([Link], ...
WasSet('ToValue',IsLessThanOrEqualTo(20)))

Interactive verification failed.

---------------------
Framework Diagnostic:
---------------------
WasSet failed.
--> Property 'NumSides' was not set to the specified value.
--> Observed property set(s) to any value:
<Mock>.NumSides = 22

Specified property set:

34-189
34 Unit Testing

PropertySetBehavior
<Mock>.NumSides = <IsLessThanOrEqualTo constraint>

Summary of Qualifications
Type of TestCase Method [Link] Class
Qualification Use With
[Link] [Link]
e Method ints Class
Method was verifyCalled or verifyThat WasCalled or
called verifyNotCalled Occurred
assumeCalled or assumeThat
assumeNotCalled
assertCalled or assertThat
assertNotCalled
fatalAssertCalled fatalAssertThat
or
fatalAssertNotCal
led
Method was Not applicable verifyThat, assumeThat, WasCalled
called a certain assertThat, or
number of times fatalAssertThat
Property was verifyAccessed or verifyThat WasAccessed or
accessed verifyNotAccessed Occurred
assumeAccessed or assumeThat
assumeNotAccessed
assertAccessed or assertThat
assertNotAccessed
fatalAssertAccess fatalAssertThat
ed or
fatalAssertNotAcc
essed
Property was Not applicable verifyThat, assumeThat, WasAccessed
accessed a assertThat, or
certain number fatalAssertThat
of times
Property was set verifySet or verifyThat WasSet or Occurred
verifyNotSet
assumeSet or assumeThat
assumeNotSet
assertSet or assertThat
assertNotSet
fatalAssertSet or fatalAssertThat
fatalAssertNotSet

34-190
Qualify Mock Object Interaction

Type of TestCase Method [Link] Class


Qualification Use With
[Link] [Link]
e Method ints Class
Property was set Not applicable verifyThat, assumeThat, WasSet
a certain number assertThat, or
of times fatalAssertThat
Property was set Not applicable verifyThat, assumeThat, WasSet or Occurred
to a certain value assertThat, or
fatalAssertThat
Methods were Not applicable verifyThat, assumeThat, Occurred
called and assertThat, or
properties were fatalAssertThat
accessed or set
in a particular
order

See Also

34-191
34 Unit Testing

Ways to Write Unit Tests


To guide software development and monitor for regressions in code functionality, you can write unit
tests for your programs. The MATLAB unit testing framework supports three test authoring schemes:

• Script-based unit tests: Write each unit test as a separate section of a test script file. You can
perform basic qualifications, access the diagnostics that the framework records on test results,
refine the test suite by selecting the tests you want to run, and customize the test run by creating
and configuring a TestRunner object.
• Function-based unit tests: Write each unit test as a local function within a test function file.
Function-based tests subscribe to the xUnit testing philosophy. In addition to supporting the
functionality provided by script-based tests, function-based tests give you access to a rich set of
test authoring features. For example, you can use advanced qualification features, including
constraints, tolerances, and test diagnostics.
• Class-based unit tests: Write each unit test as a Test method within a class definition file. In
addition to supporting the functionality provided by script-based and function-based tests, class-
based tests provide you with several advanced test authoring features and give you access to the
full framework functionality. For example, you can use shared test fixtures, parameterize tests,
and reuse test content.

Script-Based Unit Tests


With script-based tests, you can:

• Define variables to share among tests or preconditions necessary for tests.


• Perform basic qualifications using the assert function. For example, you can use
assert(isequal(actVal,expVal)) to assert that actual and expected values are equal.
(Advanced qualification features are supported only for function-based and class-based tests.)
• Access test diagnostics recorded by the framework. For more information, see “Programmatically
Access Test Diagnostics” on page 34-87. (Advanced diagnostic actions are supported only for
function-based and class-based tests.)

Typically, with script-based tests, you create a test file, and pass the file name to the runtests
function without explicitly creating a suite of Test elements. If you create an explicit test suite (using
the testsuite function or a method of the [Link] class), there are
additional features available in script-based testing. With an explicit test suite, you can:

34-192
Ways to Write Unit Tests

• Refine your suite, for example, using the classes in the [Link] package.
(Several of the selectors are applicable only for class-based tests.)
• Create a TestRunner object and customize it to run your tests. You can add the plugin classes in
the [Link] package to the test runner.

For more information about script-based tests, see “Write Script-Based Unit Tests” on page 34-6 and
“Extend Script-Based Tests” on page 34-14.

Function-Based Unit Tests


Function-based tests support the functionality provided by script-based tests. In addition, with
function-based tests, you can:

• Set up the pretest state of the system and return it to the original state after running the test. You
can perform these tasks once per test file or once per unit test. For more information, see “Write
Test Using Setup and Teardown Functions” on page 34-28.
• Use the fixture classes in the [Link] package (with the applyFixture
method) to handle the setup and teardown of frequently used testing actions.
• Record diagnostic information at a certain verbosity level by using the log method.
• Use the full library of qualifications in the [Link] package. To
determine which qualification to use, see “Table of Verifications, Assertions, and Other
Qualifications” on page 34-46.
• Use advanced qualification features, including constraints, actual value proxies, tolerances, and
test diagnostics. You can use the classes in the [Link] and
[Link] packages in your qualifications.

For more information about function-based tests, see “Write Function-Based Unit Tests” on page 34-
20 and “Extend Function-Based Tests” on page 34-33.

Class-Based Unit Tests


Class-based tests support the functionality provided by script-based and function-based tests. In
addition, with class-based tests, you can:

• Use setup and teardown method blocks to implicitly set up the pretest environment state and
return it to the original state after running the tests. For more information, see “Write Setup and
Teardown Code Using Classes” on page 34-43.
• Share fixtures among classes. For more information, see “Write Tests Using Shared Fixtures” on
page 34-52.
• Group tests into categories and then run the tests with specified tags. For more information, see
“Tag Unit Tests” on page 34-48.
• Write parameterized tests to combine and execute tests on specified lists of parameters. For more
information, see “Use Parameters in Class-Based Tests” on page 34-62.
• Use subclassing and inheritance to share and reuse test content. For example, you can reuse the
parameters and methods defined in a test class by deriving subclasses. For more information, see
“Hierarchies of Classes — Concepts”.

For more information about class-based tests, see “Author Class-Based Unit Tests in MATLAB” on
page 34-37.

34-193
34 Unit Testing

Extend Unit Testing Framework


The unit testing framework provides test tool authors the ability to extend test writing through
custom constraints, diagnostics, fixtures, and plugins. For example, you can create a custom plugin
and use it to extend the test runner when you run your script-based, function-based, or class-based
unit tests. For more information, see “Extend Unit Testing Framework”.

See Also

More About
• “Write Script-Based Unit Tests” on page 34-6
• “Write Function-Based Unit Tests” on page 34-20
• “Author Class-Based Unit Tests in MATLAB” on page 34-37

34-194
Compile MATLAB Unit Tests

Compile MATLAB Unit Tests


When you write tests using the MATLAB unit testing framework, you can create a standalone
application (requires MATLAB Compiler) to run your tests on target machines that do not have
MATLAB installed:

• To compile your MATLAB code, use the Application Compiler app or run the mcc command.
• To run standalone applications, install the MATLAB Runtime. (If you use the Application
Compiler app, you can decide whether to include the MATLAB Runtime installer in the generated
application.) For more information, see “Install and Configure the MATLAB Runtime” (MATLAB
Compiler).

MATLAB Compiler supports only class-based unit tests. (You cannot compile script-based or function-
based unit tests.) In addition, MATLAB Compiler currently does not support tests authored using the
performance testing framework.

Run Tests with Standalone Applications


This example shows how to create a standalone application from your unit tests and run the
generated application from a terminal window (on a Microsoft Windows platform).

In a file named TestRand.m in your current folder, create a parameterized test class that tests the
MATLAB random number generator (see “TestRand Class Definition Summary” on page 34-196).

In your current folder, create the runMyTests function. This function creates a test suite from the
TestRand class, runs the tests, and displays the test results.
function runMyTests
suite = [Link](?TestRand);
runner = [Link];
results = [Link](suite);
disp(results)
end

Compile the runMyTests function into a standalone application by running the mcc command in the
Command Window. MATLAB Compiler generates an application in your current folder.
mcc -m runMyTests

Open a terminal window, navigate to the folder into which you packaged your standalone application,
and run the application.
C:\work>runMyTests
1x1200 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
1200 Passed, 0 Failed, 0 Incomplete.
3.11 seconds testing time.

34-195
34 Unit Testing

For more information on how to create and run standalone applications, see “Create Standalone
Applications from the Command Line” (MATLAB Compiler).

Run Tests in Parallel with Standalone Applications


Starting in R2020b, you can create standalone applications that support running tests in parallel
(requires Parallel Computing Toolbox). This feature requires you to use the directive %#function
[Link] in the file that triggers the test run. The %#function pragma informs MATLAB
Compiler that a [Link] object must be included in the compilation to provide access to the
parallel pool.

For example, consider the tests in the file TestRand.m. You can create a standalone application to
run these tests in parallel by compiling this function.

function runMyTestsInParallel
%#function [Link]
results = runtests('TestRand.m','UseParallel',true);
disp(results)
end

Compile the function into a standalone application using the mcc command. To instruct MATLAB
Compiler to include the test file in the application, specify the file name using the -a option.

mcc -m runMyTestsInParallel -a TestRand.m

TestRand Class Definition Summary


This code provides the complete contents of the TestRand class.

classdef TestRand < [Link]


properties (TestParameter)
dim1 = createDimensionSizes;
dim2 = createDimensionSizes;
dim3 = createDimensionSizes;
type = {'single','double'};
end

methods (Test)
function testRepeatable(testCase,dim1,dim2,dim3)
state = rng;
firstRun = rand(dim1,dim2,dim3);
rng(state)
secondRun = rand(dim1,dim2,dim3);
[Link](firstRun,secondRun);
end
function testClass(testCase,dim1,dim2,type)
[Link](rand(dim1,dim2,type),type)
end
end
end

function sizes = createDimensionSizes


% Create logarithmically spaced sizes up to 100
sizes = num2cell(round(logspace(0,2,10)));
end

34-196
Compile MATLAB Unit Tests

See Also
mcc | run (TestRunner) | run (TestSuite) | runInParallel | runtests

More About
• “Ways to Write Unit Tests” on page 34-192
• “Create Standalone Application from MATLAB” (MATLAB Compiler)
• “Create Standalone Applications from the Command Line” (MATLAB Compiler)

34-197
34 Unit Testing

Develop and Integrate Software with Continuous Integration


Continuous integration (CI) is the practice of integrating code changes into a shared repository on a
frequent basis. It improves team throughput and software quality by automating and standardizing
activities such as building code, testing, and packaging. For example, each time a developer pushes
new committed changes to the remote repository, the continuous integration platform can
automatically run a suite of tests to ensure that the changes do not cause any conflicts in the target
branch of the remote repository.

The benefits of continuous integration include:

• Finding problems in software and fixing them soon after they are introduced.
• Adding more features while reducing the resources required for debugging code.
• Minimizing integration and deployment overheads by performing integration on a continuous
basis.
• Clearly communicating the state of software and the changes that have been made to it.

Continuous Integration Workflow


A typical software development workflow using continuous integration involves several steps:

1 Cloning the remote repository and creating a feature branch


2 Editing files and committing the changes to the local repository
3 Pushing the committed changes to the remote repository (which triggers an automated pipeline
of tasks such as compiling MEX files, packaging toolboxes, and testing on the CI platform)
4 Analyzing the reports generated by the CI platform and fixing the errors within the pipeline
5 Merging the remote feature branch into the master branch through a pull request (which
triggers another automated pipeline of tasks on the CI platform)
6 Analyzing the reports generated by the CI platform and resolving the merge failures

This figure shows an example of the development cycle using the Jenkins™ CI server and open-source
source code management tools such as Git and GitHub. For information on how to interface MATLAB
with Jenkins, see Run MATLAB Tests on Jenkins Server.

34-198
Develop and Integrate Software with Continuous Integration

Phase 1: Develop and Qualify Feature in Local Repository

Develop a feature and commit your changes to the local repository:

1 Clone the GitHub repository and create a new feature branch.


2 Make changes to the existing files or add new files as appropriate.
3 Run MATLAB and Simulink tests to qualify the changes and commit them to the local repository.

Phase 2: Run Automated Pipeline on Continuous Integration Platform

Run an automated pipeline of tasks (including testing) when you push your changes to the remote
repository or when you make a pull request:

1 Trigger an automated pipeline of tasks on Jenkins by pushing the committed changes to GitHub
or by making a pull request to merge the remote feature branch into the master branch.
2 Jenkins runs the automated pipeline, including MATLAB and Simulink tests, and generates
artifacts as specified in the project configuration.

34-199
34 Unit Testing

Phase 3: Investigate and Resolve Failures

If you do not succeed in pushing your changes or making a pull request, follow these steps:

1 Inspect the automated pipeline results and the generated test artifacts. Make appropriate
changes to your code.
2 Trigger a new pipeline on Jenkins by pushing your changes to GitHub or by making a pull
request.

Integration engineers can use Jenkins test artifacts to decide when to merge the feature branch into
the master branch.

Continuous Integration with MathWorks Products


You can perform continuous integration with MATLAB on various continuous integration platforms.
You can run and test your MATLAB code and Simulink models, generate artifacts, and publish your
results to the platforms. For more information, see “Continuous Integration with MATLAB on CI
Platforms” on page 34-206.

In addition to MATLAB, different toolboxes support continuous integration workflows. This table lists
common continuous integration use cases for models and code.

Toolbox Use Case More Information


Simulink • Build and test models and “About Source Control with
projects Projects” (Simulink)
• Cache files for simulation
“Using a Project with Git”
and code generation
(Simulink)

“Share Simulink Cache Files for


Faster Simulation” (Simulink)
Simulink Test™ Run test files on CI platforms “Continuous Integration”
and collect CI-compatible (Simulink Test)
coverage using Simulink
Coverage™
Simulink Check™ Use Jenkins to detect metric “Fix Metric Threshold Violations
threshold violations in a model in a Continuous Integration
Systems Workflow” (Simulink
Check)
Simulink Requirements™ Summarize requirements “Include Results from External
verification results for tests run Sources in Verification Status”
on CI platforms (Simulink Requirements)

34-200
Develop and Integrate Software with Continuous Integration

Toolbox Use Case More Information


®
Polyspace Bug Finder™ • Run a Polyspace analysis on “Run Bug Finder Analysis on
Server™, Polyspace Code Prover™ C/C++ code as part of Server During Continuous
Server continuous integration, for Integration” (Polyspace Bug
instance with Jenkins Finder Server)
• Upload the analysis results
“Run Code Prover Analysis on
(bugs, run-time errors, or
Server During Continuous
coding standard violations)
Integration” (Polyspace Code
for review in the Polyspace
Prover Server)
Access web interface
• Send e-mail notifications
with Polyspace Bug Finder
or Polyspace Code Prover
results

See Also
[Link] Package

More About
• “Set Up Git Source Control” on page 33-23
• “Use Source Control with Projects” on page 32-45
• “Explore an Example Project” on page 32-63
• “Continuous Integration with MATLAB on CI Platforms” on page 34-206

External Websites
• MathWorks Blogs: Developer Zone – Continuous Integration

34-201
34 Unit Testing

Generate Artifacts Using MATLAB Unit Test Plugins


The MATLAB® unit testing framework enables you to customize your test runner using the plugin
classes in the [Link] package. You can use some of these plugin classes to
generate test reports and artifacts compatible with continuous integration (CI) platforms:

• [Link] creates a plugin that directs the test runner


to produce a test result report. Using this plugin, you can produce readable and archivable test
reports.
• [Link] creates a plugin that produces a Test Anything
Protocol (TAP) stream.
• [Link] creates a plugin that produces JUnit-style XML output.
• [Link] creates a plugin that produces a line
coverage report for MATLAB source code.

You also can generate CI-compatible artifacts when you run Simulink® Test™ test cases. For more
information, see “Output Results for Continuous Integration Systems” (Simulink Test).

Run Tests with Customized Test Runner

This example shows how to create a test suite and customize the test runner to report on test run
progress and produce CI-compatible artifacts.

In a file in your current folder, create the function quadraticSolver, which returns the roots of
quadratic polynomials.

function roots = quadraticSolver(a,b,c)


% quadraticSolver returns solutions to the
% quadratic equation a*x^2 + b*x + c = 0.

if ~isa(a,'numeric') || ~isa(b,'numeric') || ~isa(c,'numeric')


error('quadraticSolver:InputMustBeNumeric', ...
'Coefficients must be numeric.');
end

roots(1) = (-b + sqrt(b^2 - 4*a*c)) / (2*a);


roots(2) = (-b - sqrt(b^2 - 4*a*c)) / (2*a);

end

To test quadraticSolver, create the test class SolverTest in your current folder.

classdef SolverTest < [Link]


methods(Test)
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2,1];
[Link](actSolution,expSolution)
end
function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i, -1-3i];
[Link](actSolution,expSolution)
end
function testNonNumericInput(testCase)

34-202
Generate Artifacts Using MATLAB Unit Test Plugins

[Link](@()quadraticSolver(1,'-3',2), ...
'quadraticSolver:InputMustBeNumeric')
end
end
end

At the command prompt, create a test suite from the SolverTest class.

suite = testsuite('SolverTest');

Create a TestRunner instance that produces output using the


[Link] method. This method enables you to set the
maximum verbosity level for logged diagnostics and the display level for test event details. In this
example, the test runner displays test run progress at the
[Link] level (level 3).

import [Link]
runner = [Link]('OutputDetail',3);

Create a TestReportPlugin instance that sends output to the file [Link] and add the
plugin to the test runner.

import [Link]
pdfFile = '[Link]';
p1 = [Link](pdfFile);
[Link](p1)

Create an XMLPlugin instance that writes JUnit-style XML output to the file
[Link]. Then, add the plugin to the test runner.

import [Link]
xmlFile = '[Link]';
p2 = [Link](xmlFile);
[Link](p2)

Create a plugin that outputs a Cobertura code coverage report for the source code in the file
quadraticSolver.m. Instruct the plugin to write its output to the file [Link] and add the
plugin to the test runner.

import [Link]
import [Link]
sourceCodeFile = 'quadraticSolver.m';
reportFile = '[Link]';
reportFormat = CoberturaFormat(reportFile);
p3 = [Link](sourceCodeFile,'Producing',reportFormat);
[Link](p3)

Run the tests.

results = [Link](suite)

Running SolverTest
Setting up SolverTest
Done setting up SolverTest in 0 seconds
Running SolverTest/testRealSolution
Done SolverTest/testRealSolution in 0.66518 seconds
Running SolverTest/testImaginarySolution

34-203
34 Unit Testing

Done SolverTest/testImaginarySolution in 0.020759 seconds


Running SolverTest/testNonNumericInput
Done SolverTest/testNonNumericInput in 0.3622 seconds
Tearing down SolverTest
Done tearing down SolverTest in 0 seconds
Done SolverTest in 1.0481 seconds
__________

Generating test report. Please wait.


Preparing content for the test report.

Adding content to the test report.


Writing test report to file.
Test report has been saved to:
C:\TEMP\Bdoc20b_1527579_6032\ib9F9E2F\19\tp8dc65c48\matlab-ex57066699\[Link]

results =
1x3 TestResult array with properties:

Name
Passed
Failed
Incomplete
Duration
Details

Totals:
3 Passed, 0 Failed, 0 Incomplete.
1.0481 seconds testing time.

List the files in your current folder. The three specified artifacts are stored in your current folder.

dir

.
..
[Link]
SolverTest.m
[Link]
[Link]
quadraticSolver.m
[Link]

You can process the generated artifacts on CI platforms. You also can view the contents of the
generated artifacts. For example, open the PDF test report.

open('[Link]')

See Also
[Link] | [Link] Package |
[Link] | [Link] |
[Link] | [Link]

More About
• “Develop and Integrate Software with Continuous Integration” on page 34-198

34-204
Generate Artifacts Using MATLAB Unit Test Plugins

• “Continuous Integration with MATLAB on CI Platforms” on page 34-206


• “Output Results for Continuous Integration Systems” (Simulink Test)

34-205
34 Unit Testing

Continuous Integration with MATLAB on CI Platforms


You can use different continuous integration (CI) platforms to run MATLAB code and Simulink models
as part of your automated pipeline of tasks. In addition, the MATLAB unit testing framework enables
you to create a test suite and a test runner, and customize your test runner for continuous integration
workflows with the plugin classes in the [Link] package.

To facilitate running and testing software with continuous integration, MATLAB seamlessly integrates
with several CI platforms, such as Azure® DevOps, CircleCI®, and Jenkins. You can use these
platforms to:

• Run MATLAB scripts, functions, and statements in your pipeline.


• Run MATLAB and Simulink tests and generate artifacts, such as JUnit test results and Cobertura
code coverage reports.

Depending on the CI platform, you might:

• Configure your pipeline using a script or user interface.


• Set up the platform to run MATLAB on premises or in the cloud.

Azure DevOps
To perform continuous integration with MATLAB on Azure DevOps, install an extension to your Azure
DevOps organization. To run MATLAB in your pipeline, use the extension to author your pipeline
YAML in a file named [Link] in the root of your repository. You can run your
pipeline using self-hosted or Linux-based Microsoft-hosted agents. For more information, see the
extension on Visual Studio Marketplace.

CircleCI
To perform continuous Integration with MATLAB on CircleCI, opt-in to using third-party orbs in your
organization security settings. To run MATLAB in your pipeline, import the appropriate orb to author
your pipeline YAML in a file named .circleci/[Link] in the root of your repository. CircleCI
runs your pipeline using a Linux machine executor in the cloud. For more information, see the orb on
CircleCI Orb Registry.

Jenkins
To perform continuous integration with MATLAB on Jenkins, install a plugin on your Jenkins agent.
Then, you can use an interface to run MATLAB in freestyle and multi-configuration (matrix) projects.
You also can configure your pipeline as code checked into source control. For more information, see
the plugin on Jenkins Plugins Index.

Other Platforms
To perform continuous integration with MATLAB on other CI platforms, use the matlab command
with the -batch option in your pipeline. You can use matlab -batch to run MATLAB scripts,
functions, and statements noninteractively. For example, matlab -batch "myscript" starts
MATLAB noninteractively and runs the commands in a file named myscript.m. MATLAB terminates
automatically with exit code 0 if the specified script, function, or statement executes successfully
without error. Otherwise, MATLAB terminates with a nonzero exit code.

34-206
Continuous Integration with MATLAB on CI Platforms

See Also
[Link] Package

More About
• “Develop and Integrate Software with Continuous Integration” on page 34-198
• “Generate Artifacts Using MATLAB Unit Test Plugins” on page 34-202

34-207
35

System object Usage and Authoring

• “What Are System Objects?” on page 35-2


• “System Objects vs MATLAB Functions” on page 35-5
• “System Design in MATLAB Using System Objects” on page 35-7
• “Define Basic System Objects” on page 35-11
• “Change the Number of Inputs” on page 35-13
• “Validate Property and Input Values” on page 35-16
• “Initialize Properties and Setup One-Time Calculations” on page 35-18
• “Set Property Values at Construction Time” on page 35-20
• “Reset Algorithm and Release Resources” on page 35-22
• “Define Property Attributes” on page 35-24
• “Hide Inactive Properties” on page 35-26
• “Limit Property Values to Finite List” on page 35-28
• “Process Tuned Properties” on page 35-32
• “Define Composite System Objects” on page 35-34
• “Define Finite Source Objects” on page 35-36
• “Save and Load System Object” on page 35-38
• “Define System Object Information” on page 35-41
• “Handle Input Specification Changes” on page 35-43
• “Summary of Call Sequence” on page 35-45
• “Detailed Call Sequence” on page 35-48
• “Tips for Defining System Objects” on page 35-50
• “Insert System Object Code Using MATLAB Editor” on page 35-53
• “Analyze System Object Code” on page 35-58
• “Use Global Variables in System Objects” on page 35-60
• “Create Moving Average System object” on page 35-64
• “Create New System Objects for File Input and Output” on page 35-69
• “Create Composite System object” on page 35-75
35 System object Usage and Authoring

What Are System Objects?


In this section...
“Running a System Object” on page 35-3
“System Object Functions” on page 35-3

A System object is a specialized MATLAB object. Many toolboxes include System objects. System
objects are designed specifically for implementing and simulating dynamic systems with inputs that
change over time. Many signal processing, communications, and controls systems are dynamic. In a
dynamic system, the values of the output signals depend on both the instantaneous values of the
input signals and on the past behavior of the system. System objects use internal states to store that
past behavior, which is used in the next computational step. As a result, System objects are optimized
for iterative computations that process large streams of data in segments, such as video and audio
processing systems. This ability to process streaming data provides the advantage of not having to
hold large amounts of data in memory. Use of streaming data also allows you to use simplified
programs that use loops efficiently.

For example, you could use System objects in a system that reads data from a file, filters that data
and then writes the filtered output to another file. Typically, a specified amount of data is passed to
the filter in each loop iteration. The file reader object uses a state to track where in the file to begin
the next data read. Likewise, the file writer object tracks where it last wrote data to the output file so
that data is not overwritten. The filter object maintains its own internal states to ensure that the
filtering is performed correctly. This diagram represents a single loop of the system.

These advantages make System objects well suited for processing streaming data.

Many System objects support:

• Fixed-point arithmetic (requires a Fixed-Point Designer™ license)


• C code generation (requires a MATLAB Coder™ or Simulink Coder license)
• HDL code generation (requires an HDL Coder™ license)
• Executable files or shared libraries generation (requires a MATLAB Compiler license)

Note Check the product documentation to confirm fixed-point, code generation, and MATLAB
Compiler support for the specific System objects you want to use.

System objects use a minimum of two commands to process data:

• Creation of the object (such as, fft256 = [Link])


• Running data through the object (such as, fft256(x))

This separation of creation from execution lets you create multiple, persistent, reusable objects, each
with different settings. Using this approach avoids repeated input validation and verification, allows

35-2
What Are System Objects?

for easy use within a programming loop, and improves overall performance. In contrast, MATLAB
functions must validate parameters every time you call the function.

In addition to the System objects provided with System Toolboxes, you can create your own System
objects. See “Create System Objects”.

Running a System Object


To run a System object and perform the operation defined by its algorithm, you call the object as if it
were a function. For example, to create an FFT object that uses the [Link] System object, specifies
a length of 1024, and names it dft, use:

dft = [Link]('FFTLengthSource','Property','FFTLength',1024);

To run this object with the input x, use:

dft(x);

If you run a System object without any input arguments, you must include empty parentheses. For
example, asysobj().

When you run a System object, it also performs other important tasks related to data processing,
such as initialization and handling object states.

Note An alternative way to run a System object is to use the step function. For example, for an
object created using dft = [Link], you can run it using step(dft,x).

System Object Functions


After you create a System object, you use various object functions to process data or obtain
information from or about the object. The syntax for using functions is <object function
name>(<system object name>), plus possible extra input arguments. For example, for
txfourier = [Link], where txfourier is a name you assign, you call the reset function using
reset(txfourier).

Common Object Functions

All System objects support the following object functions. In cases where a function is not applicable
to a particular object, calling that function has no effect on the object.

35-3
35 System object Usage and Authoring

Function Description
Run the object function, or Runs the object to process data using the algorithm defined by that
step object.

Example: For the object dft = [Link];, run the object via:

• y = dft(x)
• y = step(dft,x)

As part of this processing, the object initializes resources, returns


outputs, and updates the object states as necessary. During execution,
you can change only tunable properties. Both ways of running a System
object return regular MATLAB variables.
release Release resources and allow changes to System object property values
and additional characteristics that are limited while the System object is
in use.
reset Resets the System object to the initial values for that object.
nargin Returns the number of inputs accepted by the System object algorithm
definition. If the algorithm definition includes varargin, the nargin
output is negative.
nargout Returns the number of outputs accepted by the System object algorithm
definition. If the algorithm definition includes varargout, the nargout
output is negative.
clone Creates another object of the same type with the same property values
isLocked Returns a logical value indicating whether the object has been called
and you have not yet called release on the object.
isDone Applies only to source objects that inherit from
[Link]. Returns a logical value
indicating whether the end of the data file has been reached. If a
particular object does not have end-of-data capability, this function
value always returns false.

See Also
[Link]

Related Examples
• “System Objects vs MATLAB Functions” on page 35-5
• “System Design in MATLAB Using System Objects” on page 35-7
• “System Design in Simulink Using System Objects” (Simulink)

35-4
System Objects vs MATLAB Functions

System Objects vs MATLAB Functions


In this section...
“System Objects vs. MATLAB Functions” on page 35-5
“Process Audio Data Using Only MATLAB Functions Code” on page 35-5
“Process Audio Data Using System Objects” on page 35-6

System Objects vs. MATLAB Functions


Many System objects have MATLAB function counterparts. For simple, one-time computations, use
MATLAB functions. However, if you need to design and simulate a system with many components, use
System objects. Using System objects is also appropriate if your computations require managing
internal states, have inputs that change over time or process large streams of data.

Building a dynamic system with different execution phases and internal states using only MATLAB
functions would require complex programming. You would need code to initialize the system, validate
data, manage internal states, and reset and terminate the system. System objects perform many of
these managerial operations automatically during execution. By combining System objects in a
program with other MATLAB functions, you can streamline your code and improve efficiency.

Process Audio Data Using Only MATLAB Functions Code


This example shows how to write MATLAB function-only code for reading audio data.

The code reads audio data from a file, filters it, and plays the filtered audio data. The audio data is
read in frames. This code produces the same result as the System objects code in the next example,
allowing you to compare approaches.

Locate source audio file.

fname = 'speech_dft_8kHz.wav';

Obtain the total number of samples and the sampling rate from the source file.

audioInfo = audioinfo(fname);
maxSamples = [Link];
fs = [Link];

Define the filter to use.

b = fir1(160,.15);

Initialize the filter states.

z = zeros(1,numel(b)-1);

Define the amount of audio data to process at one time, and initialize the while loop index.

frameSize = 1024;
nIdx = 1;

Define the while loop to process the audio data.

35-5
35 System object Usage and Authoring

while nIdx <= maxSamples(1)-frameSize+1


audio = audioread(fname,[nIdx nIdx+frameSize-1]);
[y,z] = filter(b,1,audio,z);
sound(y,fs);
nIdx = nIdx+frameSize;
end

The loop uses explicit indexing and state management, which can be a tedious and error-prone
approach. You must have detailed knowledge of the states, such as, sizes and data types. Another
issue with this MATLAB-only code is that the sound function is not designed to run in real time. The
resulting audio is choppy and barely audible.

Process Audio Data Using System Objects


This example shows how to write System objects code for reading audio data.

The code uses System objects from the DSP System Toolbox™ software to read audio data from a file,
filter it, and then play the filtered audio data. This code produces the same result as the MATLAB
code shown previously, allowing you to compare approaches.

Locate source audio file.

fname = "speech_dft_8kHz.wav";

Define the System object to read the file.

audioIn = [Link](fname,'OutputDataType','single');

Define the System object to filter the data.

filtLP = [Link]('Numerator',fir1(160,.15));

Define the System object to play the filtered audio data.

audioOut = audioDeviceWriter('SampleRate',[Link]);

Define the while loop to process the audio data.

while ~isDone(audioIn)
audio = audioIn(); % Read audio source file
y = filtLP(audio); % Filter the data
audioOut(y); % Play the filtered data
end

This System objects code avoids the issues present in the MATLAB-only code. Without requiring
explicit indexing, the file reader object manages the data frame sizes while the filter manages the
states. The audio device writer object plays each audio frame as it is processed.

35-6
System Design in MATLAB Using System Objects

System Design in MATLAB Using System Objects


In this section...
“System Design and Simulation in MATLAB” on page 35-7
“Create Individual Components” on page 35-7
“Configure Components” on page 35-8
“Create and Configure Components at the Same Time” on page 35-8
“Assemble Components Into System” on page 35-9
“Run Your System” on page 35-9
“Reconfiguring Objects” on page 35-10

System Design and Simulation in MATLAB


System objects allow you to design and simulate your system in MATLAB. You use System objects in
MATLAB as shown in this diagram.

1 “Create Individual Components” on page 35-7 — Create the System objects to use in your
system. “Create Individual Components” on page 35-7. In addition to the System objects
provided with System Toolboxes, you can also create your own System objects. See “Create
System Objects”.
2 “Configure Components” on page 35-8 — If necessary, change the objects’ property values to
model your particular system. All System object properties have default values that you may be
able to use without changing them. See “Configure Components” on page 35-8.
3 “Assemble Components Into System” on page 35-9 — Write a MATLAB program that includes
those System objects, connecting them using MATLAB variables as inputs and outputs to
simulate your system. See “Connecting System Objects” on page 35-9.
4 “Run Your System” on page 35-9 — Run your program. You can change tunable properties
while your system is running. See “Run Your System” on page 35-9 and “Reconfiguring
Objects” on page 35-10.

Create Individual Components


The example in this section shows how to use System objects that are predefined in the software. If
you use a function to create and use a System object, specify the object creation using conditional
code. Conditionalizing the creation prevents errors if that function is called within a loop. You can
also create your own System objects, see “Create System Objects”.

This section shows how to set up your system using predefined components from DSP System Toolbox
and Audio Toolbox™:

35-7
35 System object Usage and Authoring

• [Link] — Read the file of audio data


• [Link] — Filter the audio data
• audioDeviceWriter — Play the filtered audio data

First, create the component objects, using default property settings.

audioIn = [Link];
filtLP = [Link];
audioOut = audioDeviceWriter;

Configure Components
When to Configure Components

If you did not set an object's properties when you created it and do not want to use default values,
you must explicitly set those properties. Some properties allow you to change their values while your
system is running. See “Reconfiguring Objects” on page 35-10 for information.

Most properties are independent of each other. However, some System object properties enable or
disable another property or limit the values of another property. To avoid errors or warnings, you
should set the controlling property before setting the dependent property.

Display Component Property Values

To display the current property values for an object, type that object’s handle name at the command
line (such as audioIn). To display the value of a specific property, type
[Link] (such as [Link]).

Configure Component Property Values

This section shows how to configure the components for your system by setting the component
objects’ properties.

Use this procedure if you have created your components separately from configuring them. You can
also create and configure your components at the same time, as described in a later example.

For the file reader object, specify the file to read and set the output data type.

For the filter object, specify the filter numerator coefficients using the fir1 function, which specifies
the low pass filter order and the cutoff frequency.

For the audio device writer object, specify the sample rate. In this case, use the same sample rate as
the input data.

[Link] = "speech_dft_8kHz.wav";
[Link] = "single";
[Link] = fir1(160,.15);
[Link] = [Link];

Create and Configure Components at the Same Time


This example shows how to create your System object components and configure the desired
properties at the same time. Specify each property with a 'Name', Value argument pair.

35-8
System Design in MATLAB Using System Objects

Create the file reader object, specify the file to read, and set the output data type.

audioIn = [Link]("speech_dft_8kHz.wav",...
'OutputDataType',"single");

Create the filter object and specify the filter numerator using the fir1 function. Specify the low pass
filter order and the cutoff frequency of the fir1 function.

filtLP = [Link]('Numerator',fir1(160,.15));

Create the audio player object and set the sample rate to the same rate as the input data.

audioOut = audioDeviceWriter('SampleRate',[Link]);

Assemble Components Into System


Connecting System Objects

After you have determined the components you need and have created and configured your System
objects, assemble your system. You use the System objects like other MATLAB variables and include
them in MATLAB code. You can pass MATLAB variables into and out of System objects.

The main difference between using System objects and using functions is that System objects use a
two-step process. First you create the object and set its parameters and then, you run the object.
Running the object initializes it and controls the data flow and state management of your system. You
typically call a System object within a code loop.

You use the output from an object as the input to another object. For some System objects, you can
use properties of those objects to change the inputs or outputs. To verify that the appropriate number
of inputs and outputs are being used, you can use nargin and nargout on any System object. For
information on all available System object functions, see “System Object Functions” on page 35-3.

Connect Components in a System

This section shows how to connect the components together to read, filter, and play a file of audio
data. The while loop uses the isDone function to read through the entire file.

while ~isDone(audioIn)
audio = audioIn(); % Read audio source file
y = filtLP(audio); % Filter the data
audioOut(y); % Play the filtered data
end

Run Your System


Run your code by either typing directly at the command line or running a file containing your
program. When you run the code for your system, data is processed through your objects.

What You Cannot Change While Your System Is Running

The first call to a System object initializes and runs the object. When a System object has started
processing data, you cannot change nontunable properties.

Depending on the System object, additional specifications might also be restricted:

35-9
35 System object Usage and Authoring

• Input size
• Input complexity
• Input data type
• Tunable property data types
• Discrete state data types

If the System object author has restricted these specifications, you get an error if you try to change
them while the System object is in use.

Reconfiguring Objects
Change Properties

When a System object has started processing data, you cannot change nontunable properties. You
can use isLocked on any System object to verify whether the object is processing data. When
processing is complete, you can use the release function to release resources and allow changes to
nontunable properties.

Some object properties are tunable, which enables you to change them even if the object is in use.
Most System object properties are nontunable. Refer to the object’s reference page to determine
whether an individual property is tunable.

Change Input Complexity, Dimensions, or Data Type

During object usage, after you have called the algorithm, some System objects do not allow changes
in input complexity, size, or data type. If the System object restricts these specifications, you can call
release to change these specifications. Calling release also resets other aspects of the System
object, such as states and Discrete states.

Change a Tunable Property in Your System

This example shows how to change the filter type to a high-pass filter as the code is running by
modifying the Numerator property of the filter object. The change takes effect the next time the
object is called.

reset(audioIn);% Reset audio file


Wn = [0.05,0.1,0.15,0.2];
for x=1:4000
Wn_X = ceil(x/1000);
[Link] = fir1(160,Wn(Wn_X),'high');
audio = audioIn(); % Read audio source file
y = filtLP(audio); % Filter the data
audioOut(y); % Play the filtered data
end

35-10
Define Basic System Objects

Define Basic System Objects


This example shows how to create a basic System object that increments a number by one. The class
definition file used in the example contains the minimum elements required to define a System object.

Create System Object Class


You can create and edit a MAT-file or use the MATLAB Editor to create your System object. This
example describes how to use the New menu in the MATLAB Editor.
1 In MATLAB, on the Editor tab, select New > System Object > Basic. A simple System object
template opens.
2 Subclass your object from [Link]. Replace Untitled with AddOne in the first line of
your file.
classdef AddOne < [Link]

System objects are composed of a base class, [Link] and may include one or more
mixin classes. You specify the base class and mixin classes on the first line of your class definition
file.
3 Save the file and name it AddOne.m.

Define Algorithm
The stepImpl method contains the algorithm to execute when you run your object. Define this
method so that it contains the actions you want the System object to perform.
1 In the basic System object you created, inspect the stepImpl method template.
methods (Access = protected)
function y = stepImpl(obj,u)
% Implement algorithm. Calculate y as a function of input u and
% discrete states.
y = u;
end
end

The stepImpl method access is always set to protected because it is an internal method that
users do not directly call or run.

All methods, except static methods, require the System object handle as the first input argument.
The default value, inserted by MATLAB Editor, is obj. You can use any name for your System
object handle.

By default, the number of inputs and outputs are both one. Inputs and outputs can be added
using Inputs/Outputs. You can also use a variable number of inputs or outputs, see “Change the
Number of Inputs” on page 35-13.

Alternatively, if you create your System object by editing a MAT-file, you can add the stepImpl
method using Insert Method > Implement algorithm.
2 Change the computation in the stepImpl method to add 1 to the value of u.
methods (Access = protected)

35-11
35 System object Usage and Authoring

function y = stepImpl(~,u)
y = u + 1;
end

Tip Instead of passing in the object handle, you can use the tilde (~) to indicate that the object
handle is not used in the function. Using the tilde instead of an object handle prevents warnings
about unused variables.
3 Remove unused methods that are included by default in the basic template.

You can modify these methods to add more System object actions and properties. You can also
make no changes, and the System object still operates as intended.

The class definition file now has all the code necessary for this System object.

classdef AddOne < [Link]


% ADDONE Compute an output value one greater than the input value

% All methods occur inside a methods declaration.


% The stepImpl method has protected access
methods (Access = protected)

function y = stepImpl(~,u)
y = u + 1;
end
end
end

See Also
getNumInputsImpl | getNumOutputsImpl | [Link] | stepImpl

Related Examples
• “Change the Number of Inputs” on page 35-13
• “System Design and Simulation in MATLAB” on page 35-7

35-12
Change the Number of Inputs

Change the Number of Inputs


This example shows how to set the number of inputs for a System object™ with and without using
getNumInputsImpl.

If you have a variable number of inputs or outputs and you intend to use the System object in
Simulink®, you must include the getNumInputsImpl or getNumOutputsImpl method in your class
definition.

These examples show modifications for the number of inputs. If you want to change the number of
outputs, the same principles apply.

As with all System object Impl methods, you always set the getNumInputsImpl and
getNumOutputsImpl method's access to protected because they are internal methods that are
never called directly.

Allow up to Three Inputs

This example shows how to write a System object that allows the number of inputs to vary.

Update the stepImpl method to accept up to three inputs by adding code to handle one, two, or
three inputs. If you are only using this System object in MATLAB, getNumInputsImpl and
getNumOutputsImpl are not required.

Full Class Definition

classdef AddTogether < [Link]


% Add inputs together

methods (Access = protected)


function y = stepImpl(~,x1,x2,x3)
switch nargin
case 2
y = x1;
case 3
y = x1 + x2;
case 4
y = x1 + x2 + x3;
otherwise
y = [];
end
end
end
end

Run this System object with one, two, and three inputs.
addObj = AddTogether;
addObj(2)

ans =

35-13
35 System object Usage and Authoring

addObj(2,3)

ans =

addObj(2,3,4)

ans =

Control the Number of Inputs and Outputs with a Property

This example shows how to write a System object that allows changes to the number of inputs and
outputs before running the object. Use this method when your System object will be included in
Simulink:

• Add a nontunable property NumInputs to control the number of inputs.


• Implement the associated getNumInputsImpl method to specify the number of inputs.

Full Class Definition

classdef AddTogether2 < [Link]


% Add inputs together. The number of inputs is controlled by the
% nontunable property |NumInputs|.

properties (Nontunable)
NumInputs = 3; % Default value
end
methods (Access = protected)
function y = stepImpl(obj,x1,x2,x3)
switch [Link]
case 1
y = x1;
case 2
y = x1 + x2;
case 3
y = x1 + x2 + x3;
otherwise
y = [];
end
end
function validatePropertiesImpl(obj)
if (([Link] < 1) ||...
([Link] > 3))
error("Only 1, 2, or 3 inputs allowed.");
end
end

function numIn = getNumInputsImpl(obj)


numIn = [Link];
end

35-14
Change the Number of Inputs

end
end

Run this System object with one, two, and three inputs.

addObj = AddTogether2;
[Link] = 1;
addObj(2)

ans =

release(addObj);
[Link] = 2;
addObj(2,3)

ans =

release(addObj);
[Link] = 3;
addObj(2,3,4)

ans =

See Also
getNumInputsImpl | getNumOutputsImpl

Related Examples
• “Validate Property and Input Values” on page 35-16
• “Define Basic System Objects” on page 35-11
• “Using ~ as an Input Argument in Method Definitions” on page 35-50

35-15
35 System object Usage and Authoring

Validate Property and Input Values


This example shows how to verify that the inputs and property values given to your System object are
valid.

Validate a Single Property


To validate a property value, independent of other properties, use MATLAB class property validation.
This example shows how to specify a logical property, a positive integer property, and a string
property that must be one of three values.
properties
UseIncrement (1,1) logical = false
WrapValue (1,1) {mustBePositive, mustBeInteger} = 1
Color (1,1) string {mustBeMember(Color, ["red","green","blue"])} = "red"
end

Validate Interdependent Properties


To validate the values of two or more interdependent properties, use the
validatePropertiesImpl. This example shows how to write validatePropertiesImpl to verify
that a logical property (UseIncrement) is true and the value of WrapValue is larger than
Increment.

methods (Access = protected)


function validatePropertiesImpl(obj)
if [Link] && [Link] > [Link]
error("Wrap value must be less than increment value");
end
end
end

Validate Inputs
To validate input values, use the validateInputsImpl method. This example shows how to validate
that the first input is a numeric value.

methods (Access = protected)


function validateInputsImpl(~,x)
if ~isnumeric(x)
error("Input must be numeric");
end
end
end

Complete Class Example


This example is a complete System object that shows examples of each type of validation syntax.

classdef AddOne < [Link]


% ADDONE Compute an output value by incrementing the input value

% All properties occur inside a properties declaration.


% These properties have public access (the default)
properties

35-16
Validate Property and Input Values

UseIncrement (1,1) logical = false


WrapValue (1,1) {mustBePositive, mustBeInteger} = 10
Increment (1,1) {mustBePositive, mustBeInteger} = 1
end

methods (Access = protected)


function validatePropertiesImpl(obj)
if [Link] && [Link] > [Link]
error("Wrap value must be less than increment value");
end
end

% Validate the inputs to the object


function validateInputsImpl(~,x)
if ~isnumeric(x)
error("Input must be numeric");
end
end

function out = stepImpl(obj,in)


if [Link]
out = in + [Link];
else
out = in + 1;
end
end
end
end

See Also
validateInputsImpl | validatePropertiesImpl

Related Examples
• “Define Basic System Objects” on page 35-11
• “Change Input Complexity, Dimensions, or Data Type” on page 35-10
• “Summary of Call Sequence” on page 35-45
• “Property Set Methods”
• “Using ~ as an Input Argument in Method Definitions” on page 35-50

35-17
35 System object Usage and Authoring

Initialize Properties and Setup One-Time Calculations


This example shows how to write code to initialize and set up a System object.

In this example, you allocate file resources by opening the file so the System object can write to that
file. You do these initialization tasks one time during setup, rather than every time you run the object.

Define Public Properties to Initialize

In this example, you define the public Filename property and specify the value of that property as
the nontunable character vector, [Link]. Users cannot change nontunable properties after the
setup method has been called.

properties (Nontunable)
Filename = "[Link]"
end

Define Private Properties to Initialize

Users cannot access private properties directly, but only through methods of the System object. In
this example, you define the pFileID property as a private property. You also define this property as
hidden to indicate it is an internal property that never displays to the user.

properties (Hidden,Access = private)


pFileID;
end

Define Setup

You use the setupImpl method to perform setup and initialization tasks. You should include code in
the setupImpl method that you want to execute one time only. The setupImpl method is called
once the first time you run the object. In this example, you allocate file resources by opening the file
for writing binary data.

methods
function setupImpl(obj)
[Link] = fopen([Link],"wb");
if [Link] < 0
error("Opening the file failed");
end
end
end

Although not part of setup, you should close files when your code is done using them. You use the
releaseImpl method to release resources.

Complete Class Definition File with Initialization and Setup

classdef MyFile < [Link]


% MyFile write numbers to a file

% These properties are nontunable. They cannot be changed


% after the setup method has been called or the object
% is running.
properties (Nontunable)
Filename = "[Link]" % the name of the file to create
end

35-18
Initialize Properties and Setup One-Time Calculations

% These properties are private. Customers can only access


% these properties through methods on this object
properties (Hidden,Access = private)
pFileID; % The identifier of the file to open
end

methods (Access = protected)


% In setup allocate any resources, which in this case
% means opening the file.
function setupImpl(obj)
[Link] = fopen([Link],'wb');
if [Link] < 0
error("Opening the file failed");
end
end

% This System object™ writes the input to the file.


function stepImpl(obj,data)
fwrite([Link],data);
end

% Use release to close the file to prevent the


% file handle from being left open.
function releaseImpl(obj)
fclose([Link]);
end
end
end

See Also
[Link] Constructor | releaseImpl | setupImpl | stepImpl

Related Examples
• “Release System Object Resources” on page 35-22
• “Define Property Attributes” on page 35-24
• “Summary of Call Sequence” on page 35-45

35-19
35 System object Usage and Authoring

Set Property Values at Construction Time


This example shows how to define a System object constructor and allow it to accept name-value
property pairs as input.

Set Properties to Use Name-Value Pair Input

Define the System object constructor, which is a method that has the same name as the class (MyFile
in this example). Within that method, you use the setProperties method to make all public
properties available for input when the user constructs the object. nargin is a MATLAB function that
determines the number of input arguments. varargin indicates all of the object’s public properties.

methods
function obj = MyFile(varargin)
setProperties(obj,nargin,varargin{:});
end
end

Complete Class Definition File with Constructor Setup

classdef MyFile < [Link]


% MyFile write numbers to a file

% These properties are nontunable. They cannot be changed


% after the setup method has been called or while the
% object is running.
properties (Nontunable)
Filename ="[Link]" % the name of the file to create
Access = 'wb' % The file access character vector (write, binary)
end

% These properties are private. Customers can only access


% these properties through methods on this object
properties (Hidden,Access = private)
pFileID; % The identifier of the file to open
end

methods
% You call setProperties in the constructor to let
% a user specify public properties of object as
% name-value pairs.
function obj = MyFile(varargin)
setProperties(obj,nargin,varargin{:});
end
end

methods (Access = protected)


% In setup allocate any resources, which in this case is
% opening the file.
function setupImpl(obj)
[Link] = fopen([Link],[Link]);
if [Link] < 0
error("Opening the file failed");
end
end

% This System object writes the input to the file.

35-20
Set Property Values at Construction Time

function stepImpl(obj,data)
fwrite([Link],data);
end

% Use release to close the file to prevent the


% file handle from being left open.
function releaseImpl(obj)
fclose([Link]);
end
end
end

See Also
nargin | setProperties

Related Examples
• “Define Property Attributes” on page 35-24
• “Release System Object Resources” on page 35-22

35-21
35 System object Usage and Authoring

Reset Algorithm and Release Resources

In this section...
“Reset Algorithm State” on page 35-22
“Release System Object Resources” on page 35-22

Reset Algorithm State


When a user calls reset on a System object, the internal resetImpl method is called. In this
example, pCount is an internal counter property of the Counter System object. When a user calls
reset, pCount resets to 0.

classdef Counter < [Link]


% Counter System object that increments a counter

properties (Access = private)


pCount
end

methods (Access = protected)


% Increment the counter and return
% its value as an output
function c = stepImpl(obj)
[Link] = [Link] + 1;
c = [Link];
end

% Reset the counter to zero.


function resetImpl(obj)
[Link] = 0;
end
end
end

Release System Object Resources


When release is called on a System object, the internal releaseImpl method is called if step or
setup was previously called (see “Summary of Call Sequence” on page 35-45). This example shows
how to implement the method that releases resources allocated and used by the System object. These
resources include allocated memory and files used for reading or writing.

This method allows you to clear the axes on the Whiteboard figure window while keeping the figure
open.

function releaseImpl(obj)
cla([Link]());
hold on
end

For a complete definition of the Whiteboard System object, see “Create a Whiteboard System
object” on page 35-29.

35-22
Reset Algorithm and Release Resources

See Also
releaseImpl | resetImpl

More About
• “Summary of Call Sequence” on page 35-45
• “Initialize Properties and Setup One-Time Calculations” on page 35-18

35-23
35 System object Usage and Authoring

Define Property Attributes


Property attributes, which add details to a property, provide a layer of control to your properties. In
addition to the MATLAB property attributes and property validation, System objects can use
Nontunable or DiscreteState. To specify multiple attributes, separate them with commas.

Specify Property as Nontunable


By default all properties are tunable, meaning the value of the property can change at any time.

Use the Nontunable attribute for a property when the algorithm depends on the value being
constant once data processing starts. Defining a property as nontunable may improve the efficiency
of your algorithm by removing the need to check for or react to values that change. For code
generation, defining a property as nontunable allows the memory associated with that property to be
optimized. You should define all properties that affect the number of input or output ports as
nontunable.

When you use the System object, you can only change nontunable properties before calling the object
or after calling the release function. For example, you define the InitialValue property as
nontunable and set its value to 0.

properties (Nontunable)
InitialValue = 0;
end

Specify Property as DiscreteState


If your algorithm uses properties that hold state, you can assign those properties the
DiscreteState attribute. Properties with this attribute display their state values via the
getDiscreteStateImpl when users call getDiscreteState. The following restrictions apply to a
property with the DiscreteState attribute,

• Numeric, logical, or fi value, but not a scaled double fi value


• Does not have any of these attributes: Nontunable, Dependent, Abstract, Constant.
• No default value
• Not publicly settable
• GetAccess = Public by default
• Value set only via the setupImpl when the System object is called. (See “Summary of Call
Sequence” on page 35-45)

For example, you define the Count property as a discrete state:

properties (DiscreteState)
Count;
end

Example Class with Various Property Attributes


This example shows two nontunable properties, a discrete state property, and also MATLAB class
property validation to set property attributes.

35-24
Define Property Attributes

classdef Counter < [Link]


% Counter Increment a counter to a maximum value

% These properties are nontunable. They cannot be changed


% after the setup method has been called or while the
% object is running.
properties (Nontunable)
% The initial value of the counter
InitialValue = 0
% The maximum value of the counter, must be a positive integer scalar
MaxValue (1, 1) {mustBePositive, mustBeInteger} = 3
end

properties
% Whether to increment the counter, must be a logical scalar
Increment (1, 1) logical = true
end

properties (DiscreteState)
% Count state variable
Count
end

methods (Access = protected)


% Increment the counter and return its value
% as an output

function c = stepImpl(obj)
if [Link] && ([Link] < [Link])
[Link] = [Link] + 1;
else
disp(['Max count, ' num2str([Link]) ' ,reached'])
end
c = [Link];
end

% Setup the Count state variable


function setupImpl(obj)
[Link] = 0;
end

% Reset the counter to one.


function resetImpl(obj)
[Link] = [Link];
end
end
end

See Also

More About
• “Class Attributes”
• “Property Attributes”
• “What You Cannot Change While Your System Is Running” on page 35-9
• “Summary of Call Sequence” on page 35-45

35-25
35 System object Usage and Authoring

Hide Inactive Properties


To display only active System object properties, use the isInactivePropertyImpl method. This
method specifies whether a property is inactive. An inactive property is a property that does not
affect the System object because of the value of other properties. When you pass the
isInactiveProperty method a property and the method returns true, then that property is
inactive and does not display when the disp function is called.

Specify Inactive Property


This example uses the isInactiveProperty method to check the value of a dependent property.
For this System object, the InitialValue property is not relevant if the UseRandomInitialValue
property is set to true. This isInactiveProperty method checks for that situation and if
UseRandomInitialValue is true, returns true to hide the inactive InitialValue property.

methods (Access = protected)


function flag = isInactivePropertyImpl(obj,propertyName)
if strcmp(propertyName,'InitialValue')
flag = [Link];
else
flag = false;
end
end
end

Complete Class Definition File with Inactive Properties Method


classdef Counter < [Link]
% Counter Increment a counter

% These properties are nontunable. They cannot be changed


% after the setup method has been called or when the
% object is running.
properties (Nontunable)
% Allow the user to set the initial value
UseRandomInitialValue = true
InitialValue = 0
end

% The private count variable, which is tunable by default


properties (Access = private)
pCount
end

methods (Access = protected)


% Increment the counter and return its value
% as an output
function c = stepImpl(obj)
[Link] = [Link] + 1;
c = [Link];
end

% Reset the counter to either a random value or the initial


% value.
function resetImpl(obj)

35-26
Hide Inactive Properties

if [Link]
[Link] = rand();
else
[Link] = [Link];
end
end

% This method controls visibility of the object's properties


function flag = isInactivePropertyImpl(obj,propertyName)
if strcmp(propertyName,'InitialValue')
flag = [Link];
else
flag = false;
end
end
end
end

See Also
isInactivePropertyImpl

35-27
35 System object Usage and Authoring

Limit Property Values to Finite List


When you want to create a System object property with a limited set of acceptable values, you can
either use enumerations or property validation.

For a System object that is used in a MATLAB System block in Simulink you can use enumerations or
property validation. If you use enumerations, enumerations can also derive from
[Link]. You use this type of enumeration to add attributes (such as custom
headers) to the input or output of the MATLAB System block. See “Use Enumerated Data in Simulink
Models” (Simulink).

Property Validation with mustBeMember


To limit property values with property validation, you use the mustBeMember validation function.

This example defines a Style property that can have the values solid, dash, or dot. The default
value is solid and the (1,1) defines the property as a scalar.
properties
Style (1,1) string {mustBeMember(Style, ["solid","dash","dot"])} = "solid";
end

To support case-insensitive match, use [Link] instead.


properties
Style (1,:) char {[Link](Style, ["solid","dash","dot"])} = "solid";
end

Enumeration Property
To use enumerated data in a System object, you refer to the enumerations as properties in your
System object class definition and define your enumerated class in a separate class definition file.

To create an enumerated property, you need:

• A System object property set to the enumeration class.


• The associated enumeration class definition that defines all possible values for the property.

This example defines a color enumeration property for a System object. The definition of the
enumeration class ColorValues is:

classdef ColorValues < int32


enumeration
blue (0)
red (1)
green (2)
end
end

The ColorValues class inherits from int32 for code generation compatibility. Enumeration values
must be valid MATLAB identifiers on page 1-4.

In the System object, the Color property is defined as a ColorValues object with blue as the
default. The (1,1) defines the Color property as a scalar:

35-28
Limit Property Values to Finite List

properties
Color (1, 1) ColorValues = [Link]
end

Create a Whiteboard System object


This example shows the class definition of a Whiteboard System object™, two types of finite list
properties, and how to use the object. Each time you run the whiteboard object, it draws a line on a
whiteboard.

Definition of the Whiteboard System object


type Whiteboard.m

classdef Whiteboard < [Link]


% Whiteboard Draw lines on a figure window
%

properties(Nontunable)
Color (1, 1) ColorValues = [Link]
Style (1,1) string {mustBeMember(Style, ["solid","dash","dot"])} = "solid";
end

methods (Access = protected)


function stepImpl(obj)
h = [Link]();
switch [Link]
case "solid"
linestyle = "-";
case "dash"
linestyle = "--";
case "dot"
linestyle = ":";
end
plot(h, randn([2,1]), randn([2,1]), ...
"Color",string([Link]), "LineStyle",linestyle);
end

function releaseImpl(~)
cla([Link]());
hold on
end
end

methods (Static)
function a = getWhiteboard()
h = findobj('tag','whiteboard');
if isempty(h)
h = figure('tag','whiteboard');
hold on
end
a = gca;
end
end
end

Construct the System object.

35-29
35 System object Usage and Authoring

greenInk = Whiteboard;
blueInk = Whiteboard;

Change the color and set the blue line style.

[Link] = "green";
[Link] = "blue";
[Link] = "dot";

Draw a few lines.

for i=1:3
greenInk();
blueInk();
end

Clear the whiteboard

release(greenInk);
release(blueInk);

35-30
Limit Property Values to Finite List

See Also

Related Examples
• “Validate Property Values”
• “Enumerations”
• “Code Generation for Enumerations” (MATLAB Coder)

35-31
35 System object Usage and Authoring

Process Tuned Properties


This example shows how to specify the action to take when a tunable property value changes during
simulation.

The processTunedPropertiesImpl method is useful for managing actions to prevent duplication.


In many cases, changing one of multiple interdependent properties causes an action. With the
processTunedPropertiesImpl method, you can control when that action is taken so it is not
repeated unnecessarily.

Control When a Lookup Table Is Generated

This example of processTunedPropertiesImpl causes the pLookupTable to be regenerated


when either the NumNotes or MiddleC property changes.

methods (Access = protected)


function processTunedPropertiesImpl(obj)
propChange = isChangedProperty(obj,'NumNotes')||...
isChangedProperty(obj,'MiddleC')
if propChange
[Link] = [Link] *...
(1+log(1:[Link])/log(12));
end
endend

Complete Class Definition File with Tuned Property Processing

classdef TuningFork < [Link]


% TuningFork Illustrate the processing of tuned parameters
%

properties
MiddleC = 440
NumNotes = 12
end

properties (Access = private)


pLookupTable
end

methods (Access = protected)


function resetImpl(obj)
[Link] = 440;
[Link] = [Link] * ...
(1+log(1:[Link])/log(12));
end

function hz = stepImpl(obj,noteShift)
% A noteShift value of 1 corresponds to [Link]
hz = [Link](noteShift);
end

function processTunedPropertiesImpl(obj)
propChange = isChangedProperty(obj,'NumNotes')||...
isChangedProperty(obj,'MiddleC')
if propChange
[Link] = [Link] *...

35-32
Process Tuned Properties

(1+log(1:[Link])/log(12));
end
end
end

See Also
processTunedPropertiesImpl

35-33
35 System object Usage and Authoring

Define Composite System Objects


This example shows how to define System objects that include other System objects. Define a
bandpass filter System object from separate highpass and lowpass filter System objects.

Store System Objects in Properties

To define a System object from other System objects, store those other objects in your class definition
file as properties. In this example, the highpass and lowpass filters are the separate System objects
defined in their own class-definition files.

properties (Access = private)


% Properties that hold filter System objects
pLowpass
pHighpass
end

Complete Class Definition File of Bandpass Filter Composite System Object

classdef BandpassFIRFilter < [Link]


% Implements a bandpass filter using a cascade of eighth-order lowpass
% and eighth-order highpass FIR filters.

properties (Access = private)


% Properties that hold filter System objects
pLowpass
pHighpass
end

methods (Access = protected)


function setupImpl(obj)
% Setup composite object from constituent objects
[Link] = LowpassFIRFilter;
[Link] = HighpassFIRFilter;
end

function yHigh = stepImpl(obj,u)


yLow = [Link](u);
yHigh = [Link](yLow);
end

function resetImpl(obj)
reset([Link]);
reset([Link]);
end
end
end

Class Definition File for Lowpass FIR Component of Bandpass Filter

classdef LowpassFIRFilter < [Link]


% Implements eighth-order lowpass FIR filter with 0.6pi cutoff

properties (Nontunable)
% Filter coefficients
Numerator = [0.006,-0.0133,-0.05,0.26,0.6,0.26,-0.05,-0.0133,0.006];
end

35-34
Define Composite System Objects

properties (DiscreteState)
State
end

methods (Access = protected)


function setupImpl(obj)
[Link] = zeros(length([Link])-1,1);
end

function y = stepImpl(obj,u)
[y,[Link]] = filter([Link],1,u,[Link]);
end

function resetImpl(obj)
[Link] = zeros(length([Link])-1,1);
end
end
end

Class Definition File for Highpass FIR Component of Bandpass Filter

classdef HighpassFIRFilter < [Link]


% Implements eighth-order highpass FIR filter with 0.4pi cutoff

properties (Nontunable)
% Filter coefficients
Numerator = [0.006,0.0133,-0.05,-0.26,0.6,-0.26,-0.05,0.0133,0.006];
end

properties (DiscreteState)
State
end

methods (Access = protected)


function setupImpl(obj)
[Link] = zeros(length([Link])-1,1);
end

function y = stepImpl(obj,u)
[y,[Link]] = filter([Link],1,u,[Link]);
end

function resetImpl(obj)
[Link] = zeros(length([Link])-1,1);
end
end
end

See Also
nargin

35-35
35 System object Usage and Authoring

Define Finite Source Objects


This example shows how to define a System object that performs a specific number of steps or
specific number of reads from a file.

In this section...
“Use the FiniteSource Class and Specify End of the Source” on page 35-36
“Complete Class Definition File with Finite Source” on page 35-36

Use the FiniteSource Class and Specify End of the Source


1 Subclass from finite source class.

classdef RunTwice < [Link] & ...


[Link]
2 Specify the end of the source with the isDoneImpl method. In this example, the source has two
iterations.

methods (Access = protected)


function bDone = isDoneImpl(obj)
bDone = [Link]==2
end

Complete Class Definition File with Finite Source


classdef RunTwice < [Link] & ...
[Link]
% RunTwice System object that runs exactly two times
%
properties (Access = private)
NumSteps
end

methods (Access = protected)


function resetImpl(obj)
[Link] = 0;
end

function y = stepImpl(obj)
if ~[Link]()
[Link] = [Link] + 1;
y = [Link];
else
y = 0;
end
end

function bDone = isDoneImpl(obj)


bDone = [Link]==2;
end
end
end

35-36
Define Finite Source Objects

See Also
[Link]

More About
• “Subclassing Multiple Classes”
• “Using ~ as an Input Argument in Method Definitions” on page 35-50

35-37
35 System object Usage and Authoring

Save and Load System Object


This example shows how to load and save a System object.

Save System Object and Child Object


Define a saveObjectImpl method to specify that more than just public properties should be saved
when the user saves a System object. Within this method, use the default
saveObjectImpl@[Link] to save public properties to the struct, s. Use the saveObject
method to save child objects. Save protected and dependent properties, and finally, if the object has
been called and not released, save the object state.

methods (Access = protected)


function s = saveObjectImpl(obj)
s = saveObjectImpl@[Link](obj);
[Link] = [Link]([Link]);
[Link] = [Link];
[Link] = [Link];
if isLocked(obj)
[Link] = [Link];
end
end
end

Load System Object and Child Object


Define a loadObjectImpl method to load a previously saved System object. Within this method, use
the loadObject to load the child System object, load protected and private properties, load the state
if the object was called and not released, and use loadObjectImpl from the base class to load
public properties.

methods (Access = protected)


function loadObjectImpl(obj,s,isInUse)
[Link] = [Link]([Link]);

[Link] = [Link];
[Link] = [Link];

if isInUse
[Link] = [Link];
end

loadObjectImpl@[Link](obj,s,isInUse);
end
end

Complete Class Definition Files with Save and Load


The Counter class definition file sets up an object with a count property. This counter is used in the
MySaveLoader class definition file to count the number of child objects.

classdef Counter < [Link]


properties(DiscreteState)
Count

35-38
Save and Load System Object

end
methods (Access=protected)
function setupImpl(obj, ~)
[Link] = 0;
end
function y = stepImpl(obj, u)
if u > 0
[Link] = [Link] + 1;
end
y = [Link];
end
end
end

classdef MySaveLoader < [Link]

properties (Access = private)


child
pdependentprop = 1
end

properties (Access = protected)


protectedprop = rand;
end

properties (DiscreteState = true)


state
end

properties (Dependent)
dependentprop
end

methods
function obj = MySaveLoader(varargin)
obj@[Link]();
setProperties(obj,nargin,varargin{:});
end

function [Link](obj, value)


[Link] = min(value, 5);
end

function value = [Link](obj)


value = [Link];
end
end

methods (Access = protected)


function setupImpl(obj)
[Link] = 42;
[Link] = Counter;
end
function out = stepImpl(obj,in)
[Link] = in + [Link] + [Link] + ...
[Link];
out = [Link]([Link]);
end

35-39
35 System object Usage and Authoring

end

% Serialization
methods (Access = protected)
function s = saveObjectImpl(obj)
% Call the base class method
s = saveObjectImpl@[Link](obj);

% Save the child System objects


[Link] = [Link]([Link]);

% Save the protected & private properties


[Link] = [Link];
[Link] = [Link];

% Save the state only if object called and not released


if isLocked(obj)
[Link] = [Link];
end
end

function loadObjectImpl(obj,s,isInUse)
% Load child System objects
[Link] = [Link]([Link]);

% Load protected and private properties


[Link] = [Link];
[Link] = [Link];

% Load the state only if object is in use


if isInUse
[Link] = [Link];
end

% Call base class method to load public properties


loadObjectImpl@[Link](obj,s,isInUse);
end
end
end

See Also
loadObjectImpl | saveObjectImpl

35-40
Define System Object Information

Define System Object Information


This example shows how to define information to display for a System object.

Define System Object Info

You can define your own info method to display specific information for your System object. The
default infoImpl method returns an empty struct. This infoImpl method returns detailed
information when info is called using info(x,'details') or only count information if it is called
using info(x).

methods (Access = protected)


function s = infoImpl(obj,varargin)
if nargin>1 && strcmp('details',varargin(1))
s = struct('Name','Counter',
'Properties', struct('CurrentCount',[Link], ...
'Threshold',[Link]));
else
s = struct('Count',[Link]);
end
end
end

Complete Class Definition File with InfoImpl

classdef Counter < [Link]


% Counter Count values above a threshold

properties
Threshold = 1
end

properties (DiscreteState)
Count
end

methods (Access = protected)


function setupImpl(obj)
[Link] = 0;
end

function resetImpl(obj)
[Link] = 0;
end

function y = stepImpl(obj,u)
if (u > [Link])
[Link] = [Link] + 1;
end
y = [Link];
end

function s = infoImpl(obj,varargin)
if nargin>1 && strcmp('details',varargin(1))
s = struct('Name','Counter',...
'Properties', struct('CurrentCount', ...
[Link],'Threshold',[Link]));

35-41
35 System object Usage and Authoring

else
s = struct('Count',[Link]);
end
end
end
end

See Also
infoImpl

35-42
Handle Input Specification Changes

Handle Input Specification Changes


This example shows how to control the input specifications for a System object. You can control what
happens when an input specification changes.

You can also restrict whether the input complexity, data type, or size can change while the object is in
use. Whichever aspects you restrict cannot change until after the user calls release.

React to Input Specification Changes


To modify the System object algorithm or properties when the input changes size, data type, or
complexity, implement the processInputSpecificationChangeImpl method. Specify actions to
take when the input specification changes between calls to the System object.

In this example, processInputSpecificationChangeImpl changes the isComplex property


when either input is complex.
properties(Access = private)
isComplex (1,1) logical = false;
end

methods (Access = protected)


function processInputSpecificationChangeImpl(obj,input1,input2)
if(isreal(input1) && isreal(input2))
[Link] = false;
else
[Link] = true;
end
end
end

Restrict Input Specification Changes


To specify that the input complexity, data type, and size cannot change while the System object is in
use, implement the isInputComplexityMutableImpl, isInputDataTypeMutableImpl, and
isInputSizeMutableImpl methods to return false. If you want to restrict only some aspects of
the System object input, you can include only one or two of these methods.
methods (Access = protected)
function flag = isInputComplexityMutableImpl(~,~)
flag = false;
end
function flag = isInputSizeDataTypeImpl(~,~)
flag = false;
end
function flag = isInputSizeMutableImpl(~,~)
flag = false;
end
end

Complete Class Definition File

This Counter System object restricts all three aspects of the input specification.
classdef Counter < [Link]
%Counter Count values above a threshold

35-43
35 System object Usage and Authoring

properties
Threshold = 1
end

properties (DiscreteState)
Count
end

methods
function obj = Counter(varargin)
setProperties(obj,nargin,varargin{:});
end
end

methods (Access=protected)
function resetImpl(obj)
[Link] = 0;
end

function y = stepImpl(obj, u1)


if (any(u1 >= [Link]))
[Link] = [Link] + 1;
end
y = [Link];
end

function flag = isInputComplexityMutableImpl(~,~)


flag = false;
end

function flag = isInputDataTypeMutableImpl(~,~)


flag = false;
end

function flag = isInputSizeMutableImpl(~,~)


flag = false;
end
end
end

See Also
isInputSizeMutableImpl

Related Examples
• “What You Cannot Change While Your System Is Running” on page 35-9

35-44
Summary of Call Sequence

Summary of Call Sequence

In this section...
“Setup Call Sequence” on page 35-45
“Running the Object or Step Call Sequence” on page 35-45
“Reset Method Call Sequence” on page 35-46
“Release Method Call Sequence” on page 35-47

The diagrams show an abstract view of which actions are performed when you call a System object.
The background color or each action indicates the type of call.

• Grey background — Internal actions


• Green background — Author-implemented method
• White background — User-accessible functions

If you want a more detailed call sequence, see “Detailed Call Sequence” on page 35-48.

Setup Call Sequence


This hierarchy shows the actions performed when you call the setup function.

Running the Object or Step Call Sequence


This hierarchy shows the actions performed when you call the step function.

35-45
35 System object Usage and Authoring

Reset Method Call Sequence


This hierarchy shows the actions performed when you call the reset function.

35-46
Summary of Call Sequence

Release Method Call Sequence


This hierarchy shows the actions performed when you call the release function.

See Also
releaseImpl | resetImpl | setupImpl | stepImpl

Related Examples
• “Release System Object Resources” on page 35-22
• “Reset Algorithm State” on page 35-22
• “Set Property Values at Construction Time” on page 35-20
• “Define Basic System Objects” on page 35-11

35-47
35 System object Usage and Authoring

Detailed Call Sequence


In this section...
“setup Call Sequence” on page 35-48
“Running the Object or step Call Sequence” on page 35-48
“reset Call Sequence” on page 35-49
“release Call Sequence” on page 35-49

The call sequence diagrams show the order in which internal methods are called when you run the
specified method. If your System object does not overwrite a specified method, the default
implementation of that method is used.

If you want a more abstract view of the method calls, see “Summary of Call Sequence” on page 35-45.

setup Call Sequence


When you run a System object for the first time, setup is called to perform one-time set up tasks.
This sequence of methods is called:

1 If the System object is not in use, release on page 35-49


2 validatePropertiesImpl
3 isDiscreteStateSpecificationMutableImpl
4 isInputDataTypeMutableImpl
5 isInputComplexityMutableImpl
6 isInputSizeMutableImpl
7 isTunablePropertyDataTypeMutableImpl
8 validateInputsImpl
9 If the System object uses nondirect feedthrough methods, call
isInputDirectFeedthroughImpl
10 setupImpl

Running the Object or step Call Sequence


When you run a System object in MATLAB, either by calling the object as a function or calling step,
this sequence of methods is called:

1 If the System object is not in use (object was just created or was released),

a release on page 35-47


b setup on page 35-48
c reset on page 35-49

Else, if the object is in use (object was called and release was not called)

a If tunable properties have changed

i validatePropertiesImpl

35-48
Detailed Call Sequence

ii processTunedPropertiesImpl
b If the input size, data type, or complexity has changed

i validateInputsImpl
ii processInputSpecificationChangeImpl

reset Call Sequence


When reset is called, these actions are performed.

1 If the object is in use (object was called and not released), call resetImpl

release Call Sequence


When release is called, these actions are performed.

1 If the object is in use (object was called and not released), call releaseImpl

See Also
releaseImpl | resetImpl | setupImpl | stepImpl

Related Examples
• “Release System Object Resources” on page 35-22
• “Reset Algorithm State” on page 35-22
• “Set Property Values at Construction Time” on page 35-20
• “Define Basic System Objects” on page 35-11

35-49
35 System object Usage and Authoring

Tips for Defining System Objects


A System object is a specialized MATLAB object that is optimized for iterative processing. Use System
objects when you need to run an object multiple times or process data in a loop. When defining your
own System object, use the following suggestions to help your System object run more quickly.

General
• Define all one-time calculations in the setupImpl method and cache the results in a private
property. Use the stepImpl method for repeated calculations.
• Specify Boolean values using true or false instead of 1 or 0, respectively.
• If the variables in a method do not need to retain their values between calls, use local scope for
those variables in that method.

Inputs and Outputs


• Some methods use the stepImpl algorithm inputs as their inputs, such as setupImpl,
updateImpl, validateInputsImpl, isInputDirectFeedThroughImpl, and
processInputSizeChangeImpl. The inputs must match the order of inputs to stepImpl, but
do not need to match the number of inputs. If your implementation does not require any of the
inputs to the System object, you can leave them all off.
• For the getNumInputsImpl and getNumOutputsImpl methods, if you set the return argument
from an object property, that object property must have the Nontunable attribute.

Using ~ as an Input Argument in Method Definitions


All methods, except static methods, expect the System object handle as the first input argument. You
can use any name for your System object handle. The code inserted by the MATLAB Editor menu uses
obj.

In many examples, instead of passing in the object handle, ~ is used to indicate that the object handle
is not used in the function. Using ~ instead of an object handle prevents warnings about unused
variables.

Properties
• For properties that do not change, define them in as Nontunable properties. Tunable properties
have slower access times than Nontunable properties
• Whenever possible, use the protected or private attribute instead of the public attribute for
a property. Some public properties have slower access times than protected and private
properties.
• If properties are accessed more than once in the stepImpl method, cache those properties as
local variables inside the method. A typical example of multiple property access is a loop. Iterative
calculations using cached local variables run faster than calculations that must access the
properties of an object. When the calculations for the method complete, you can save the local
cached results back to the properties of that System object. Copy frequently used tunable
properties into private properties. This best practice also applies to the updateImpl and
outputImpl methods.

35-50
Tips for Defining System Objects

For example, in this code k is accessed multiple times in each loop iteration, but is saved to the
object property only once.

function y = stepImpl(obj,x)
k = [Link];
for p=1:100
y = k * x;
k = k + 0.1;
end
[Link] = k;
end
• Default values of properties are shared across all instances of an object. Two instances of a class
can access the same default value if that property has not been overwritten by either instance.

Text Comparisons
Do not use character vector comparisons or character vector-based switch statements in the
stepImpl method. Instead, create a method handle in setupImpl. This handle points to a method in
the same class definition file. Use that handle in a loop in stepImpl.

This example shows how to use method handles and cached local variables in a loop to implement an
efficient object. In setupImpl, choose myMethod1 or myMethod2 based on a character vector
comparison and assign the method handle to the pMethodHandle property. Because there is a loop
in stepImpl, assign the pMethodHandle property to a local method handle, myFun, and then use
myFun inside the loop.

classdef MyClass < [Link]


function setupImpl(obj)
if strcmp([Link], 'Method1')
[Link] = @myMethod1;
else
[Link] = @myMethod2;
end
end
function y = stepImpl(obj,x)
myFun = [Link];
for p=1:1000
y = myFun(obj,x)
end
end
end
function y = myMethod1(x)
y = x+1;
end
function y = myMethod2(x)
y = x-1;
end
end

Simulink
For System objects being included in Simulink, add the StrictDefaults attribute. This attribute
sets all the MutableImpl methods to return false by default.

35-51
35 System object Usage and Authoring

Code Generation
For information about System objects and code generation, see “System Objects in MATLAB Code
Generation” (MATLAB Coder).

35-52
Insert System Object Code Using MATLAB Editor

Insert System Object Code Using MATLAB Editor


In this section...
“Define System Objects with Code Insertion” on page 35-53
“Create a Temperature Enumeration” on page 35-55
“Create Custom Property for Freezing Point” on page 35-56
“Add Method to Validate Inputs” on page 35-57

Define System Objects with Code Insertion


You can define System objects from the MATLAB Editor using code insertion options. When you select
these options, the MATLAB Editor adds predefined properties, methods, states, inputs, or outputs to
your System object. Use these tools to create and modify System objects faster, and to increase
accuracy by reducing typing errors.

To access the System object editing options, create a new System object, or open an existing one.

To add predefined code to your System object, select the code from the appropriate menu. For
example, when you click Insert Property > Numeric, the MATLAB Editor adds the following code:

properties(Nontunable)
Property
end

The MATLAB Editor inserts the new property with the default name Property, which you can
rename. If you have an existing properties group with the Nontunable attribute, the MATLAB Editor
inserts the new property into that group. If you do not have a property group, the MATLAB Editor
creates one with the correct attribute.

35-53
35 System object Usage and Authoring

Insert Options

Properties Properties of the System object: Numeric, Logical, Enumeration, Positive Integer, Tunable
Numeric, Private, Protected, and Custom. When you select Enumeration or Custom Properties, a
separate dialog box opens to guide you in creating these properties.
Methods Methods commonly used in System object definitions. The MATLAB Editor creates only the
method structure. You specify the actions of that method.

The Insert Method menu organizes methods by categories, such as Algorithm, Inputs and
Outputs, and Properties and States. When you select a method from the menu, the MATLAB
Editor inserts the method template in your System object code. In this example, selecting Insert
Method > Release resources inserts the following code:

function releaseImpl(obj)
% Release resources, such as file handles
end

If a method from the Insert Method menu is present in the System object code, that method is
shown shaded on the Insert Method menu:

States Properties containing the DiscreteState attribute.

35-54
Insert System Object Code Using MATLAB Editor

Inputs / Inputs, outputs, and related methods, such as Validate inputs and Disallow input size
Outputs changes.

When you select an input or output, the MATLAB Editor inserts the specified code in the
stepImpl method. In this example, selecting Insert > Input causes the MATLAB Editor to
insert the required input variable u2. The MATLAB Editor determines the variable name, but
you can change it after it is inserted.

function y = stepImpl(obj,u,u2)
% Implement algorithm. Calculate y as a function of
% input u and discrete states.
y = u;
end

Create a Temperature Enumeration


1 Open a new or existing System object.
2 In the MATLAB Editor, select Insert Property > Enumeration.
3 In the Enumeration dialog box, enter:

a Property Name with TemperatureUnit.


b Enumeration Name with TemperatureUnitValues.
4 Select the Create new enumeration check box.
5 Remove the existing enumeration values with the - (minus) button.
6 Add three an enumeration values with the + (plus) button and the following values:

• Fahrenheit
• Celsius
• Kelvin
7 Select Fahrenheit as the default value by clicking Default.

The dialog box now looks as shown:

35-55
35 System object Usage and Authoring

8 To create this enumeration and the associated class, click Insert.


9 In the MATLAB Editor, an additional class file with the enumeration definition is created. Save
the enumeration class definition file as TemperatureUnitValues.m.

classdef TemperatureUnitValues < int32


enumeration
Fahrenheit (0)
Celsius (1)
Kelvin (2)
end
end

In the System object class definition, the following code was added:
properties(Nontunable)
TemperatureUnit (1, 1) TemperatureUnitValues = [Link]
end

For more information on enumerations, see “Limit Property Values to Finite List” on page 35-28.

Create Custom Property for Freezing Point


1 Open a new or existing System object.
2 In the MATLAB Editor, select Insert Property > Custom Property.
3 In the Custom Property dialog box, under System Object Attributes, select Nontunable.
Under MATLAB Property Attributes, select Constant. Leave GetAccess as public.
SetAccess is grayed out because properties of type constant cannot be set using System object
methods.

35-56
Insert System Object Code Using MATLAB Editor

4 Click Insert and the following code is inserted into the System object definition:

properties(Nontunable, Constant)
Property
end
5 Replace Property with your property.

properties(Nontunable, Constant)
FreezingPointFahrenheit = 32;
end

Add Method to Validate Inputs


1 Open a new or existing System object.
2 In the MATLAB Editor, select Insert Method > Validate inputs.

The MATLAB Editor inserts this code into the System object:

function validateInputsImpl(obj,u)
% Validate inputs to the step method at initialization
end

See Also

Related Examples
• “Analyze System Object Code” on page 35-58

35-57
35 System object Usage and Authoring

Analyze System Object Code


In this section...
“View and Navigate System object Code” on page 35-58
“Example: Go to StepImpl Method Using Analyzer” on page 35-58

View and Navigate System object Code


View and navigate System object code using the Analyzer.

The Analyzer displays all elements in your System object code.

• Navigate to a specific input, output, property, state, or method by clicking the name of that
element.
• Expand or collapse element sections with the arrow buttons.
• Identify access levels for properties and custom methods with the + (public), # (protected), and –
(private) symbols.

Example: Go to StepImpl Method Using Analyzer


1 Open an existing System object.
2 Select Analyze.
3 Click resetImpl.

35-58
Analyze System Object Code

The cursor in the MATLAB Editor window jumps to the resetImpl method.

See Also

Related Examples
• “Insert System Object Code Using MATLAB Editor” on page 35-53

35-59
35 System object Usage and Authoring

Use Global Variables in System Objects


Global variables are variables that you can access in other MATLAB functions or Simulink blocks.

System Object Global Variables in MATLAB


For System objects that are used only in MATLAB, you define global variables in System object class
definition files in the same way that you define global variables in other MATLAB code (see “Global
Variables” on page 20-12).

System Object Global Variables in Simulink


For System objects that are used in the MATLAB System block in Simulink, you also define global
variables as you do in MATLAB. However, to use global variables in Simulink, you must declare global
variables in the stepImpl, updateImpl, or outputImpl method if you have declared them in
methods called by stepImpl, updateImpl, or outputImpl, respectively.

You set up and use global variables for the MATLAB System block in the same way as you do for the
MATLAB Function block (see “Data Stores” (Simulink) and “Share Data Globally” (Simulink)). Like
the MATLAB Function block, you must also use variable name matching with a Data Store Memory
block to use global variables in Simulink.

For example, this class definition file defines a System object that increments the first row of a matrix
by 1 at each time step. You must include getGlobalNamesImpl if the class file is P-coded.

classdef GlobalSysObjMatrix < [Link]


methods (Access = protected)
function y = stepImpl(obj)
global B;
B(1,:) = B(1,:)+1;
y = B;
end

% Include getGlobalNamesImpl only if the class file is P-coded.


function globalNames = getGlobalNamesImpl(~)
globalNames = {"B"};
end
end
end

This model includes the GlobalSysObjMatrix object in a MATLAB System block and the associated
Data Store Memory block.

35-60
Use Global Variables in System Objects

35-61
35 System object Usage and Authoring

35-62
Use Global Variables in System Objects

See Also

35-63
35 System object Usage and Authoring

Create Moving Average System object


This example shows how to create a System object™ that implements a moving average filter.

Introduction

System objects are MATLAB classes that derive from [Link]. As a result, System objects all
inherit a common public interface, which includes standard methods:

• setup — Initialize the object, typically at the beginning of a simulation


• reset — Clear the internal state of the object, bringing it back to its default post-initialization
status
• release — Release any resources (memory, hardware, or OS-specific resources) used internally
by the object

When you create new kinds of System objects, you provide specific implementations for all the
preceding methods to determine its behavior.

In this example, you create and use the movingAverageFilter System object.
movingAverageFilter is a System object that computes the unweighted mean of the previous
WindowLength input samples. WindowLength is the length of the moving average window.
movingAverageFilter accepts single-precision and double-precision 2-D input matrices. Each
column of the input matrix is treated as an independent (1-D) channel. The first dimension of the
input defines the length of the channel (or the input frame size). movingAverageFilter
independently computes the moving average of each input channel over time.

Create the System object File

In the MATLAB Home tab, create a new System object class by selecting New > System Object >
Basic. The basic template for a System object opens in the MATLAB editor to guide you as you create
the movingAverageFilter System object.

Rename the class movingAverageFilter and save the file as movingAverageFilter.m. To ensure
you can use the System object, make sure you save the System object in a folder that is on the
MATLAB path.

For your convenience, a complete movingAverageFilter System object file is available with this
example. To open the completed class, enter:
edit movingAverageFilter.m

Add Properties

This System object needs four properties. First, add a public property WindowLength to control the
length of the moving average window. Because the algorithm depends on this value being constant
once data processing begins, the property is defined as nontunable. Additionally, the property only
accepts real, positive integers. To ensure input satisfies these conditions, add property validators (see
“Validate Property Values”). Set the default value of this property to 5.
properties(Nontunable)
WindowLength (1,1){mustBeInteger,mustBePositive} = 5
end

Second, add two properties called State and pNumChannels. Users should not access either
property, so use the Access = private attribute. State saves the state of the moving average

35-64
Create Moving Average System object

filter. pNumChannels stores the number of channels in your input. The value of this property is
determined from the number of columns in the input.

properties(Access = private)
State;
pNumChannels = -1;
end

Finally, you need a property to store the FIR numerator coefficients. Add a property called
pCoefficients. Because the coefficients do not change during data processing and you do not want
users of the System object to access the coefficients, set the property attributes as Nontunable,
Access = private.

properties(Access = private, Nontunable)


pCoefficients
end

Add Constructor for Easy Creation

The System object constructor is a method that has the same name as the class
(movingAverageFilter in this example). You implement a System object constructor to allow
name-value pair inputs to the System object with the setProperties method. For example, with the
constructor, users can use this syntax to create an instance of the System object: filter =
movingAverageFilter('WindowLength',10). Do not use the constructor for anything else. All
other setup tasks should be written in the setupImpl method.

methods
function obj = movingAverageFilter(varargin)
% Support name-value pair arguments when constructing object
setProperties(obj,nargin,varargin{:})
end
end

Set Up and Initialization in setupImpl

The setupImpl method sets up the object and implements one-time initialization tasks. For this
System object, modify the default setupImpl method to calculate the filter coefficients, the state,
and the number of channels. The filter coefficients are computed based on the specified
WindowLength. The filter state is initialized to zero. (Note that there are WindowLength-1 states
per input channel.) Finally, the number of channels is determined from the number of columns in the
input.

For setupImpl and all Impl methods, you must set the method attribute Access = protected
because users of the System object do not call these methods directly. Instead the back-end of the
System object calls these methods through other user-facing functions.

function setupImpl(obj,x)
% Perform one-time calculations, such as computing constants
[Link] = size(x,2);
[Link] = ones(1,[Link])/[Link];
[Link] = zeros([Link]-1,[Link],'like',x);
end

35-65
35 System object Usage and Authoring

Define the Algorithm in stepImpl

The object's algorithm is defined in the stepImpl method. The algorithm in stepImpl is executed
when the user of the System object calls the object at the command line. In this example, modify
stepImpl to calculate the output and update the object's state values using the filter function.

function y = stepImpl(obj,u)
[y,[Link]] = filter([Link],1,u,[Link]);
end

Reset and Release

The state reset equations are defined in the resetImpl method. In this example, reset states to zero.
Additionally, you need to add a releaseImpl method. From the Editor toolstrip, select Insert
Method > Release resources. The releaseImpl method is added to your System object. Modify
releaseImpl to set the number of channels to -1, which allows new input to be used with the filter.

function resetImpl(obj)
% Initialize / reset discrete-state properties
[Link](:) = 0;
end
function releaseImpl(obj)
[Link] = -1;
end

Validate Input

To validate inputs to your System object, you must implement a validateInputsImpl method. This
method validates inputs at initialization and at each subsequent call where the input attributes (such
as dimensions, data type, or complexity) change. From the toolstrip, select Insert Method >
Validate inputs. In the newly inserted validateInputsImpl method, call validattributes to
ensure that the input is a 2-D matrix with floating-point data.

function validateInputsImpl(~, u)
validateattributes(u,{'double','single'}, {'2d',...
'nonsparse'},'','input');
end

Object Saving and Loading

When you save an instance of a System object, saveObjectImpl defines what property and state
values are saved in a MAT-file. If you do not define a saveObjectImpl method for your System
object class, only public properties and properties with the DiscreteState attribute are saved.
Select Insert Method > Save in MAT-file. Modify saveObjectImpl so that if the object is locked,
the coefficients and number of channels is saved.

function s = saveObjectImpl(obj)
s = saveObjectImpl@[Link](obj);
if isLocked(obj)
[Link] = [Link];
[Link] = [Link];
end
end

loadObjectImpl is the companion to saveObjectImpl because it defines how a saved object


loads. When you load the saved object, the object loads in the same locked state. Select Insert

35-66
Create Moving Average System object

Method > Load from MAT-file. Modify loadObjectImpl so that if the object is locked, the
coefficients and number of channels are loaded.

function loadObjectImpl(obj,s,wasLocked)
if wasLocked
[Link] = [Link];
[Link] = [Link];
end
loadObjectImpl@[Link](obj,s,wasLocked);
end

Use movingAverageFilter in MATLAB

Now that you have defined the System object, you can use the object in MATLAB. For example, use
movingAverageFilter to remove noise from a noisy pulse sequence.

movingAverageFilter = movingAverageFilter('WindowLength',10);

t = (1:250)';
signal = randn(250,1);
smoothedSignal = movingAverageFilter(signal);

plot(t,signal,t,smoothedSignal);
legend(["Input","Smoothed input"])

35-67
35 System object Usage and Authoring

Extend Your System object for Simulink

To use your System object in Simulink, see “Create Moving Average Filter Block with System Object”
(Simulink).

35-68
Create New System Objects for File Input and Output

Create New System Objects for File Input and Output


This example shows how to create and use two different System objects to facilitate the streaming of
data in and out of MATLAB®: TextFileReader and TextFileWriter.

The objects discussed in this example address a number of realistic use cases, and they can be
customized to achieve more advanced and specialized tasks.

Introduction

System objects are MATLAB classes that derive from [Link]. As a result, System objects all
inherit a common public interface, which includes standard methods:

• setup — Initialize the object, typically at the beginning of a simulation


• reset — Clear the internal state of the object, bringing it back to its default post-initialization
status
• release — Release any resources (memory, hardware, or OS-specific resources) used internally
by the object

When you create new kinds of System objects, you provide specific implementations for all the
preceding methods to determine its behavior.

In this example we discuss the internal structure and the use of the following two System objects:

• TextFileReader
• TextFileWriter

To create these System objects for streaming data in and out of MATLAB, this example uses standard
low-level file I/O functions available in MATLAB (like fscanf, fread, fprintf, and fwrite). By
abstracting away most usage details of those functions, they aim to make the task of reading and
writing streamed data simpler and more efficient.

This example includes the use of a number of advanced constructs to author System objects. For a
more basic introduction to authoring System objects, see “Create System Objects”.

Definition of the Class TextFileReader

The TextFileReader class includes a class definition, public and private properties, a constructor,
protected methods overridden from the [Link] base class, and private methods. The
TextFileWriter class is similarly structured.

Class Definition

The class definition states that the TextFileReader class is derived from both [Link] and
[Link].

classdef (StrictDefaults)TextFileReader < [Link] & [Link]

• [Link] is required and is the base class for all System objects
• [Link] indicates this class is a signal source with a finite
number of data samples. For this type of class, in addition to the usual interface, the System
object will also expose the isDone function. When isDone returns true, the object reached the
end of the available data.

35-69
35 System object Usage and Authoring

Public Properties

Public properties can be changed by the user to adjust the behavior of the object to his or her
particular application. TextFileReader has two nontunable public properties (they can only be
changed before the first call to the object) and four tunable public properties. All the public
properties have a default value. Default values are assigned to the corresponding properties when
nothing else is specified by the user.
properties (Nontunable)
Filename = '[Link]'
HeaderLines = 4
end

properties
DataFormat = '%g'
Delimiter = ','
SamplesPerFrame = 1024
PlayCount = 1
end

Private Properties

Private properties are not visible to the user and can serve a number of purposes, including

• To hold values computed only occasionally, then used with subsequent calls to the algorithm. For
example, values used at initialization time, when setup is called or the object is called for the first
time. This can save recomputing them at runtime and improve the performance of the core
functionality
• To define the internal state of the object. For example, pNumEofReached stores the number of
times that the end-of-file indicator was reached:
properties(Access = private)
pFID = -1
pNumChannels
pLineFormat
pNumEofReached = 0
end

Constructor

The constructor is defined so that you can construct a TextFileReader object using name-value
pairs. The constructor is called when a new instance of TextDataReader is created. The call to
setProperties within the constructor allows setting properties with name-value pairs at
construction. No other initialization tasks should be specified in the constructor. Instead, use the
setupImpl method.
methods
function obj = TextFileReader(varargin)
setProperties(obj, nargin, varargin{:});
end
end

Overriding [Link] Base Class Protected Methods

The public methods common to all System objects each have corresponding protected methods that
they call internally. The names of these protected methods all include an Impl postfix. They can be
implemented when defining the class to program the behavior of your System object.

35-70
Create New System Objects for File Input and Output

For more information on the correspondence between the standard public methods and their internal
implementations, please refer to “Summary of Call Sequence” on page 35-45.

For example, TextFileReader overrides these Impl methods:

• setupImpl
• resetImpl
• stepImpl
• releaseImpl
• isDoneImpl
• processTunedPropertiesImpl
• loadObjectImpl
• saveObjectImpl

Private Methods

Private methods are only accessible from within other methods of the same class. They can be used to
make the rest of the code more readable. They can also improve code reusability, by grouping under
separate routines code that is used multiple times in different parts of the class. For
TextFileReader, private methods are created for:

• getWorkingFID
• goToStartOfData
• peekCurrentLine
• lockNumberOfChannelsUsingCurrentLine
• readNDataRows

Write and Read Data

This example shows how you can use TextFileReader and TextFileWriter by:

• Creating a text file containing the samples of two different sinusoidal signals using
TextFileWriter
• Read from the text file using TextFileReader.

Create a Simple Text File

Create a new file to store two sinusoidal signals with frequencies of 50 Hz and 60 Hz. For each signal,
the data stored is composed of 800 samples at a sampling rate of 8 kHz.

Create data samples:

fs = 8000;
tmax = 0.1;
t = (0:1/fs:tmax-1/fs)';
N = length(t);
f = [50,60];
data = sin(2*pi*t*f);

Form a header string to describe the data in a readable way for future use (optional step):

35-71
35 System object Usage and Authoring

fileheader = sprintf(['The following contains %d samples of two ',...


'sinusoids,\nwith frequencies %d Hz and %d Hz and a sample rate of',...
' %d kHz\n\n'], N, f(1),f(2),fs/1000);

To store the signal to a text file, create a TextFileWriter object. The constructor of
TextFileWriter needs the name of the target file and some optional parameters, which can be
passed in as name-value pairs.
TxtWriter = TextFileWriter('Filename','[Link]','Header',fileheader)

TxtWriter =
TextFileWriter with properties:

Filename: '[Link]'
Header: 'The following contains 800 samples of two sinusoids,...'
DataFormat: '%.18g'
Delimiter: ','

TextFileWriter writes data to delimiter-separated ASCII files. Its public properties include:

• Filename — Name of the file to be written. If a file with this name already exists, it is
overwritten. When operations start, the object begins writing to the file immediately following the
header. The object then appends new data at each subsequent call to the object, until it is
released. Calling reset resumes writing from the beginning of the file.
• Header — Character string, often composed of multiple lines and terminated by a newline
character (\n). This is specified by the user and can be modified to embed human-readable
information that describes the actual data.
• DataFormat — Format used to store each data sample. This can take any value assignable as
Conversion Specifier within the formatSpec string used by the built-in MATLAB function
fprintf. DataFormat applies to all channels written to the file. The default value for this
property is '%.18g', which allows saving double precision floating point data in full precision.
• Delimiter — Character used to separate samples from different channels at the same time
instant. Every line of the written file maps to a time instant, and it includes as many samples as
the number of channels provided as input (in other words, the number of columns in the matrix
input passed to the object).

To write all the available data to the file, a single call to can be used.
TxtWriter(data)

Release control of the file by calling the release function.


release(TxtWriter)

The data is now stored in the new file. To visually inspect the file, type:
edit('[Link]')

Because the header takes up three lines, the data starts on line 4.

In this simple case, the length of the whole signal is small, and it fits comfortably on system memory.
Therefore, the data can be created all at once and written to a file in a single step.

There are cases when this approach is not possible or practical. For example, the data might be too
large to fit into a single MATLAB variable (too large to fit on system memory). Alternatively, the data

35-72
Create New System Objects for File Input and Output

might be created cyclically in a loop or streamed into MATLAB from an external source. In all these
cases, streaming the data into the file can be done with an approach similar to the following example.

Use a streamed sine wave generator to create a frame of data per loop. Run the desired number of
iterations to create the data and store it into the file:
frameLength = 32;
tmax = 10;
t = (0:1/fs:tmax-1/fs)';
N = length(t);
data = sin(2*pi*t*f);
numCycles = N/frameLength;

for k = 1:10 % Long running loop when you replace 10 with numCycles.
dataFrame = sin(2*pi*t*f);
TxtWriter(dataFrame)
end

release(TxtWriter)

Read from Existing Text File

To read from the text file, create an instance of TextFileReader.


TxtReader = TextFileReader('Filename','[Link]','HeaderLines',3,'SamplesPerFrame',frameLeng

TxtReader =
TextFileReader with properties:

Filename: '[Link]'
HeaderLines: 3
DataFormat: '%g'
Delimiter: ','
SamplesPerFrame: 32
PlayCount: 1

TextFileReader reads numeric data from delimiter-separated ASCII files. Its properties are similar
to those of TextFileWriter. Some differences follow

• HeaderLines — Number of lines used by the header within the file specified in Filename. The
first call to the object starts reading from line number HeaderLines+1. Subsequent calls to the
object keep reading from the line immediately following the previously read line. Calling reset
will resume reading from line HeaderLines+1.
• Delimiter — Character used to separate samples from different channels at the same time
instant. In this case, the delimiter is also used to determine the number of data channels stored in
the file. When the object is first run, the object counts the number of Delimiter characters at
line HeaderLines+1, say numDel. Then for every time instant, the object reads numChan =
numDel+1 numeric values with format DataFormat. The matrix returned by the algorithm has
size SamplesPerFrame-by-numChan.
• SamplesPerFrame — Number of lines read by each call to the object. This value is also the
number of rows of the matrix returned as output. When the last available data rows are reached,
there might be fewer than the required SamplesPerFrame. In that case, the available data are
padded with zeros to obtain a matrix of size SamplesPerFrame-by-numChan. Once all the data
are read, the algorithm simply returns zeros(SamplesPerFrame,numChan) until reset or
release is called.

35-73
35 System object Usage and Authoring

• PlayCount — Number of times the data in the file is read cyclically. If the object reaches the end
of the file, and the file has not yet been read a number of times equal to PlayCount, reading
resumes from the beginning of the data (line HeaderLines+1). If the last lines of the file do not
provide enough samples to form a complete output matrix of size SamplesPerFrame-by-numChan,
then the frame is completed using the initial data. Once the file is read PlayCount times, the
output matrix returned by the algorithm is filled with zeros, and all calls to isDone return true
unless reset or release is called. To loop through the available data indefinitely, PlayCount
can be set to Inf.

To read the data from the text file, the more general streamed approach is used. This method of
reading data is also relevant to dealing with very large data files. Preallocate a data frame with
frameLength rows and 2 columns.

dataFrame = zeros(frameLength,2,'single');

Read from the text file and write to the binary file while data is present in the source text file. Notice
how the method isDone is used to control the execution of the while loop.

while(~isDone(TxtReader))
dataFrame(:) = TxtReader();
end

release(TxtReader)

Summary

This example illustrated how to author and use System objects to read from and write to numeric
data files. TextFileReader and TextFileWriter can be edited to perform special-purpose file
reading and writing operations. You can also combine these custom System objects with built-in
System objects such as [Link] and [Link].

For more information on authoring System objects for custom algorithms, see “Create System
Objects”.

See Also

More About
• “Create Moving Average System object” on page 35-64
• “Tips for Defining System Objects” on page 35-50
• “Define Basic System Objects” on page 35-11

35-74
Create Composite System object

Create Composite System object


This example shows how to create a System object™ composed of other System objects. This System
object uses two moving average System objects to find the cross-correlation of two independent
samples. The “Create Moving Average System object” on page 35-64 example explains in detail how
to create a System object. This example focuses on how to use a System object within another System
object.

System objects as Private Properties

The ability to create more than one instance of a System object and having each instance manage its
own state is one of the biggest advantages of using System objects over functions. The private
properties MovingAverageFilter1 and MovingAverageFilter2 are used to store the two moving
average filter objects.
properties (Access=private)
% This example class contains two moving average filters (more can be added
% in the same way)
MovingAverageFilter1
MovingAverageFilter2
end

Set Up the Moving Average Filter

In the setupImpl method, create the two moving average System objects and initialize their public
properties.
function setupImpl(obj,~)
% Set up moving average objects with default values
obj.MovingAverageFilter1 = movingAverageFilter('WindowLength',obj.WindowLength1);
obj.MovingAverageFilter2 = movingAverageFilter('WindowLength',obj.WindowLength2);
end

Work with Dependent Properties

The WindowLength public property from the movingAverageFilter System object is implemented
as a dependent property in this example.
properties(Nontunable,Dependent)
% WindowLength Moving window length
WindowLength1;
WindowLength2;
end

Whenever you assign a value to one of the dependent properties, the value is set in the corresponding
moving average filter. When you read one of the dependent properties, the value is read from the
corresponding moving average filter.
function set.WindowLength1(obj,WindowLength1)
% Set the window length of one moving average filter
[Link] = WindowLength1;
end
function WindowLength = get.WindowLength1(obj)
% Read window length from one of the moving average filters
WindowLength = [Link];
end
function set.WindowLength2(obj,WindowLength2)

35-75
35 System object Usage and Authoring

% Set the window length of one moving average filter


[Link] = WindowLength2;
end
function WindowLength = get.WindowLength2(obj)
% Read window length from one of the moving average filters
WindowLength = [Link];
end

Use the Cross-Correlation Object in MATLAB

Create random variables to calculate the cross-correlation of their moving averages, then view the
results in a stem plot.

x = rand(20,1);
y = rand(20,1);
crossCorr = crossCorrelationMovingAverages('WindowLength1',1,'WindowLength2',5);

for iter = 1:100


x = rand(20,1);
y = rand(20,1);
[corr,lags] = crossCorr(x,y);
stem(lags,corr)
end

More About
• “Create Moving Average System object” on page 35-64

35-76
Create Composite System object

• “Tips for Defining System Objects” on page 35-50

35-77

You might also like