0% found this document useful (0 votes)
24 views119 pages

Edger: Differential Analysis of Sequence Read Count Data User'S Guide

Uploaded by

Guilherme Bovi
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
24 views119 pages

Edger: Differential Analysis of Sequence Read Count Data User'S Guide

Uploaded by

Guilherme Bovi
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

edgeR: differential analysis

of sequence read count data

User’s Guide

Yunshun Chen 1,2 , Davis McCarthy 3,4 , Matthew Ritchie 1,2 ,


Mark Robinson 5 , and Gordon Smyth 1,6
1
Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia
2
Department of Medical Biology, University of Melbourne, Victoria, Australia
3
St Vincent’s Institute of Medical Research, Fitzroy, Victoria, Australia
4
Melbourne Integrative Genomics, University of Melbourne, Victoria, Australia
5
Institute of Molecular Life Sciences and SIB Swiss Institute of Bioinformatics, University of
Zurich, Zurich, Switzerland
6
School of Mathematics and Statistics, University of Melbourne, Victoria, Australia

First edition 17 September 2008


Last revised 12 May 2021
Contents

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

1.1 Scope . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

1.2 Citation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

1.3 How to get help . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

1.4 Quick start . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

2 Overview of capabilities . . . . . . . . . . . . . . . . . . . . . . 11

2.1 Terminology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

2.2 Aligning reads to a genome . . . . . . . . . . . . . . . . . . . . . 11

2.3 Producing a table of read counts . . . . . . . . . . . . . . . . . . 11

2.4 Reading the counts from a file . . . . . . . . . . . . . . . . . . . 12

2.5 Pseudoalignment and quasi-mapping . . . . . . . . . . . . . . . 12

2.6 The DGEList data class . . . . . . . . . . . . . . . . . . . . . . . 12

2.7 Filtering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

2.8 Normalization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2.8.1 Normalization is only necessary for sample-specific effects . . . . 14
2.8.2 Sequencing depth . . . . . . . . . . . . . . . . . . . . . . . . 14
2.8.3 Effective library sizes . . . . . . . . . . . . . . . . . . . . . . . 15
2.8.4 GC content . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
2.8.5 Gene length . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.8.6 Model-based normalization, not transformation . . . . . . . . . . 16
2.8.7 Pseudo-counts . . . . . . . . . . . . . . . . . . . . . . . . . . 16

2
edgeR User’s Guide

2.9 Negative binomial models . . . . . . . . . . . . . . . . . . . . . . 17


2.9.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.9.2 Biological coefficient of variation (BCV) . . . . . . . . . . . . . . 17
2.9.3 Estimating BCVs . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.9.4 Quasi negative binomial . . . . . . . . . . . . . . . . . . . . . 19

2.10 The classic edgeR pipeline: pairwise comparisons between


two or more groups . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.10.1 Estimating dispersions . . . . . . . . . . . . . . . . . . . . . . 19
2.10.2 Testing for DE genes . . . . . . . . . . . . . . . . . . . . . . . 20

2.11 More complex experiments (glm functionality) . . . . . . . . . . 20


2.11.1 Generalized linear models . . . . . . . . . . . . . . . . . . . . 20
2.11.2 Estimating dispersions . . . . . . . . . . . . . . . . . . . . . . 21
2.11.3 Testing for DE genes . . . . . . . . . . . . . . . . . . . . . . . 22

2.12 What to do if you have no replicates . . . . . . . . . . . . . . . . 23

2.13 Differential expression above a fold-change threshold . . . . . . 24

2.14 Gene ontology (GO) and pathway analysis . . . . . . . . . . . . 25

2.15 Gene set testing . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

2.16 Clustering, heatmaps etc . . . . . . . . . . . . . . . . . . . . . . 26

2.17 Alternative splicing . . . . . . . . . . . . . . . . . . . . . . . . . . 27

2.18 CRISPR-Cas9 and shRNA-seq screen analysis . . . . . . . . . 27

2.19 Bisulfite sequencing and differential methylation analysis . . . . 27

3 Specific experimental designs . . . . . . . . . . . . . . . . . . 29

3.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

3.2 Two or more groups . . . . . . . . . . . . . . . . . . . . . . . . . 29


3.2.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
3.2.2 Classic approach . . . . . . . . . . . . . . . . . . . . . . . . . 30
3.2.3 GLM approach . . . . . . . . . . . . . . . . . . . . . . . . . . 31
3.2.4 Questions and contrasts . . . . . . . . . . . . . . . . . . . . . 32
3.2.5 A more traditional glm approach. . . . . . . . . . . . . . . . . . 33
3.2.6 An ANOVA-like test for any differences . . . . . . . . . . . . . . 34

3
edgeR User’s Guide

3.3 Experiments with all combinations of multiple factors . . . . . . 35


3.3.1 Defining each treatment combination as a group . . . . . . . . . . 35
3.3.2 Nested interaction formulas . . . . . . . . . . . . . . . . . . . . 36
3.3.3 Treatment effects over all times . . . . . . . . . . . . . . . . . . 37
3.3.4 Interaction at any time . . . . . . . . . . . . . . . . . . . . . . 37

3.4 Additive models and blocking . . . . . . . . . . . . . . . . . . . . 39


3.4.1 Paired samples . . . . . . . . . . . . . . . . . . . . . . . . . . 39
3.4.2 Blocking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
3.4.3 Batch effects . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

3.5 Comparisons both between and within subjects . . . . . . . . . 41

4 Case studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

4.1 RNA-Seq of oral carcinomas vs matched normal tissue . . . . . 44


4.1.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
4.1.2 Reading in the data . . . . . . . . . . . . . . . . . . . . . . . . 44
4.1.3 Annotation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
4.1.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 46
4.1.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . 46
4.1.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . 47
4.1.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 48
4.1.8 Differential expression . . . . . . . . . . . . . . . . . . . . . . 48
4.1.9 Gene ontology analysis . . . . . . . . . . . . . . . . . . . . . . 50
4.1.10 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

4.2 RNA-Seq of pathogen inoculated arabidopsis with batch effects 52


4.2.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
4.2.2 RNA samples . . . . . . . . . . . . . . . . . . . . . . . . . . 52
4.2.3 Loading the data . . . . . . . . . . . . . . . . . . . . . . . . . 52
4.2.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 53
4.2.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . 53
4.2.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . 54
4.2.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 55
4.2.8 Differential expression . . . . . . . . . . . . . . . . . . . . . . 56
4.2.9 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

4.3 Profiles of Yoruba HapMap individuals . . . . . . . . . . . . . . . 59


4.3.1 Background . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

4
edgeR User’s Guide

4.3.2 Loading the data . . . . . . . . . . . . . . . . . . . . . . . . . 59


4.3.3 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 60
4.3.4 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 61
4.3.5 Differential expression . . . . . . . . . . . . . . . . . . . . . . 62
4.3.6 Gene set testing . . . . . . . . . . . . . . . . . . . . . . . . . 63
4.3.7 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

4.4 RNA-Seq profiles of mouse mammary gland . . . . . . . . . . . 65


4.4.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
4.4.2 Read alignment and processing . . . . . . . . . . . . . . . . . . 66
4.4.3 Count loading and annotation . . . . . . . . . . . . . . . . . . . 66
4.4.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 67
4.4.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . 68
4.4.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . 69
4.4.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 69
4.4.8 Differential expression . . . . . . . . . . . . . . . . . . . . . . 71
4.4.9 ANOVA-like testing . . . . . . . . . . . . . . . . . . . . . . . . 73
4.4.10 Gene ontology analysis . . . . . . . . . . . . . . . . . . . . . . 74
4.4.11 Gene set testing . . . . . . . . . . . . . . . . . . . . . . . . . 76
4.4.12 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77

4.5 Differential splicing after Pasilla knockdown . . . . . . . . . . . . 78


4.5.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
4.5.2 RNA-Seq samples . . . . . . . . . . . . . . . . . . . . . . . . 78
4.5.3 Read alignment and processing . . . . . . . . . . . . . . . . . . 80
4.5.4 Count loading and annotation . . . . . . . . . . . . . . . . . . . 80
4.5.5 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 81
4.5.6 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . 82
4.5.7 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . 82
4.5.8 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 83
4.5.9 Differential expression . . . . . . . . . . . . . . . . . . . . . . 84
4.5.10 Alternative splicing . . . . . . . . . . . . . . . . . . . . . . . . 85
4.5.11 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
4.5.12 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . 88

4.6 CRISPR-Cas9 knockout screen analysis . . . . . . . . . . . . . 88


4.6.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
4.6.2 Sequence processing . . . . . . . . . . . . . . . . . . . . . . . 88
4.6.3 Filtering and data exploration . . . . . . . . . . . . . . . . . . . 88
4.6.4 The design matrix and dispersion estimation. . . . . . . . . . . . 90

5
edgeR User’s Guide

4.6.5 Differential representation analysis . . . . . . . . . . . . . . . . 91


4.6.6 Gene set tests to summarize over multiple sgRNAs targeting the
same gene . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92
4.6.7 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
4.6.8 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . 94

4.7 Bisulfite sequencing of mouse oocytes . . . . . . . . . . . . . . 94


4.7.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
4.7.2 Reading in the data . . . . . . . . . . . . . . . . . . . . . . . . 95
4.7.3 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 97
4.7.4 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . 99
4.7.5 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . 99
4.7.6 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 100
4.7.7 Differential methylation analysis at CpG loci . . . . . . . . . . . . 101
4.7.8 Summarizing counts in promoter regions . . . . . . . . . . . . . 103
4.7.9 Differential methylation in gene promoters . . . . . . . . . . . . . 104
4.7.10 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105

4.8 Time course RNA-seq experiments of Drosophila melanogaster


106
4.8.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 106
4.8.2 DEGList object . . . . . . . . . . . . . . . . . . . . . . . . . . 107
4.8.3 Gene annotation . . . . . . . . . . . . . . . . . . . . . . . . . 107
4.8.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . 108
4.8.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . 109
4.8.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . 109
4.8.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . 110
4.8.8 Time course trend analysis . . . . . . . . . . . . . . . . . . . . 112
4.8.9 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114

6
Chapter 1

Introduction

1.1 Scope
This guide provides an overview of the Bioconductor package edgeR for differential expres-
sion analyses of read counts arising from RNA-Seq, SAGE or similar technologies [32]. The
package can be applied to any technology that produces read counts for genomic features.
Of particular interest are summaries of short reads from massively parallel sequencing tech-
nologies such as Illumina™, 454 or ABI SOLiD applied to RNA-Seq, SAGE-Seq or ChIP-Seq
experiments, pooled shRNA-seq or CRISPR-Cas9 genetic screens and bisulfite sequencing
for DNA methylation studies. edgeR provides statistical routines for assessing differential
expression in RNA-Seq experiments or differential marking in ChIP-Seq experiments.
The package implements exact statistical methods for multigroup experiments developed by
Robinson and Smyth [34, 35]. It also implements statistical methods based on generalized
linear models (glms), suitable for multifactor experiments of any complexity, developed by
McCarthy et al. [25], Lund et al. [23], Chen et al. [3] and Lun et al. [22]. Sometimes we
refer to the former exact methods as classic edgeR, and the latter as glm edgeR. However
the two sets of methods are complementary and can often be combined in the course of a
data analysis. Most of the glm functions can be identified by the letters “glm” as part of the
function name. The glm functions can test for differential expression using either likelihood
ratio tests[25, 3] or quasi-likelihood F-tests [23, 22].
A particular feature of edgeR functionality, both classic and glm, are empirical Bayes methods
that permit the estimation of gene-specific biological variation, even for experiments with
minimal levels of biological replication.
edgeR can be applied to differential expression at the gene, exon, transcript or tag level. In
fact, read counts can be summarized by any genomic feature. edgeR analyses at the exon level
are easily extended to detect differential splicing or isoform-specific differential expression.
This guide begins with brief overview of some of the key capabilities of package, and then
gives a number of fully worked case studies, from counts to lists of genes.

1.2 Citation
The edgeR package implements statistical methods from the following publications.

7
edgeR User’s Guide

Robinson, MD, and Smyth, GK (2008). Small sample estimation of negative binomial dis-
persion, with applications to SAGE data. Biostatistics 9, 321–332.
Proposed the idea of sharing information between genes by estimating the negative
binomial variance parameter globally across all genes. This made the use of negative
binomial models practical for RNA-Seq and SAGE experiments with small to moderate
numbers of replicates. Introduced the terminology dispersion for the variance parame-
ter. Proposed conditional maximum likelihood for estimating the dispersion, assuming
common dispersion across all genes. Developed an exact test for differential expression
appropriate for the negative binomially distributed counts. Despite the official publica-
tion date, this was the first of the papers to be submitted and accepted for publication.

Robinson, MD, and Smyth, GK (2007). Moderated statistical tests for assessing differences
in tag abundance. Bioinformatics 23, 2881–2887.
Introduced empirical Bayes moderated dispersion parameter estimation. This is a crucial
improvement on the previous idea of estimating the dispersions from a global model, be-
cause it permits gene-specific dispersion estimation to be reliable even for small samples.
Gene-specific dispersion estimation is necessary so that genes that behave consistently
across replicates should rank more highly than genes that do not.

Robinson, MD, McCarthy, DJ, Smyth, GK (2010). edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140.
Announcement of the edgeR software package. Introduced the terminology coefficient
of biological variation.

Robinson, MD, and Oshlack, A (2010). A scaling normalization method for differential
expression analysis of RNA-seq data. Genome Biology 11, R25.
Introduced the idea of model-based library size normalization (aka “scale normaliza-
tion”) for RNA-Seq data. Proposed the TMM normalization method.
McCarthy, DJ, Chen, Y, Smyth, GK (2012). Differential expression analysis of multifactor
RNA-Seq experiments with respect to biological variation. Nucleic Acids Research 40, 4288-
4297.
Extended negative binomial differential expression methods to glms, making the meth-
ods applicable to general experiments. Introduced the use of Cox-Reid approximate
conditional maximum likelihood for estimating the dispersion parameters, and used this
for empirical Bayes moderation. Developed fast algorithms for fitting glms to thousands
of genes in parallel. Gives a more complete explanation of the concept of biological co-
efficient of variation.

Lun, ATL, Chen, Y, and Smyth, GK (2016). It’s DE-licious: a recipe for differential expres-
sion analyses of RNA-seq experiments using quasi-likelihood methods in edgeR. Methods in
Molecular Biology 1418, 391–416.
This book chapter explains the glmQLFit and glmQLFTest functions, which are alterna-
tives to glmFit and glmLRT. They replace the chisquare approximation to the likelihood
ratio statistic with a quasi-likelihood F-test, resulting in more conservative and rigorous
type I error rate control.

Chen, Y, Lun, ATL, and Smyth, GK (2014). Differential expression analysis of complex
RNA-seq experiments using edgeR. In: Statistical Analysis of Next Generation Sequence
Data, Somnath Datta and Daniel S Nettleton (eds), Springer, New York.
This book chapter explains the estimateDisp function and the weighted likelihood em-
pirical Bayes method.

8
edgeR User’s Guide

Zhou, X, Lindsay, H, and Robinson, MD (2014). Robustly detecting differential expression


in RNA sequencing data using observation weights. Nucleic Acids Research, 42, e91.
Explains estimateGLMRobustDisp, which is designed to make the downstream tests done
by glmLRT robust to outlier observations.
Dai, Z, Sheridan, JM, Gearing, LJ, Moore, DL, Su, S, Wormald, S, Wilcox, S, O’Connor, L,
Dickins, RA, Blewitt, ME, and Ritchie, ME (2014). edgeR: a versatile tool for the analysis
of shRNA-seq and CRISPR-Cas9 genetic screens. F1000Research 3, 95.
This paper explains the processAmplicons function for obtaining counts from the FASTQ
files of shRNA-seq and CRISPR-Cas9 genetic screens and outlines a general workflow
for analyzing data from such screens.

Chen, Y, Lun, ATL, and Smyth, GK (2016). From reads to genes to pathways: differential
expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood
pipeline. F1000Research 5, 1438.
This paper describes a complete workflow of differential expression and pathway analysis
using the edgeR quasi-likelihood pipeline.
Chen, Y, Pal, B, Visvader, JE, and Smyth, GK (2017). Differential methylation analysis
of reduced representation bisulfite sequencing experiments using edgeR. F1000Research 6,
2055.
This paper explains a novel approach of detecting differentially methylated regions
(DMRs) of reduced representation bisulfite sequencing (RRBS) experiments using edgeR.

1.3 How to get help


Most questions about edgeR will hopefully be answered by the documentation or references.
If you’ve run into a question that isn’t addressed by the documentation, or you’ve found
a conflict between the documentation and what the software does, then there is an active
support community that can offer help.
The edgeR authors always appreciate receiving reports of bugs in the package functions or
in the documentation. The same goes for well-considered suggestions for improvements.
All other questions or problems concerning edgeR should be posted to the Bioconductor
support site [Link] Please send requests for general assistance
and advice to the support site rather than to the individual authors. Posting questions to
the Bioconductor support site has a number of advantages. First, the support site includes a
community of experienced edgeR users who can answer most common questions. Second, the
edgeR authors try hard to ensure that any user posting to Bioconductor receives assistance.
Third, the support site allows others with the same sort of questions to gain from the answers.
Users posting to the support site for the first time will find it helpful to read the posting guide
at [Link]
The authors do not regularly answer questions posted to other forums, such as Biostars or
SEQAnswers.
Note that each function in edgeR has its own online help page. For example, a detailed
description of the arguments and output of the estimateDisp function can be read by typing
?estimateDisp or help("estimateDisp") at the Rprompt. If you have a question about any
particular function, reading the function’s help page will often answer the question very
quickly. In any case, it is good etiquette to check the relevant help page first before posting
a question to the support site.

9
edgeR User’s Guide

1.4 Quick start


edgeR offers many variants on analyses. The glm approach is more popular than the clas-
sic approach as it offers great flexibilities. There are two testing methods under the glm
framework: likelihood ratio tests and quasi-likelihood F-tests. The quasi-likelihood method
is highly recommended for differential expression analyses of bulk RNA-seq data as it gives
stricter error rate control by accounting for the uncertainty in dispersion estimation. The
likelihood ratio test can be useful in some special cases such as single cell RNA-seq and
datasets with no replicates. The details of these methods are described in Chapter 2.
A typical edgeR analysis might look like the following. Here we assume there are four RNA-
Seq libraries in two groups, and the counts are stored in a tab-delimited text file, with gene
symbols in a column called Symbol.
> x <- [Link]("[Link]",[Link]="Symbol")
> group <- factor(c(1,1,2,2))
> y <- DGEList(counts=x,group=group)
> keep <- filterByExpr(y)
> y <- y[keep,,[Link]=FALSE]
> y <- calcNormFactors(y)
> design <- [Link](~group)
> y <- estimateDisp(y,design)

To perform quasi-likelihood F-tests:


> fit <- glmQLFit(y,design)
> qlf <- glmQLFTest(fit,coef=2)
> topTags(qlf)

To perform likelihood ratio tests:


> fit <- glmFit(y,design)
> lrt <- glmLRT(fit,coef=2)
> topTags(lrt)

10
Chapter 2

Overview of capabilities

2.1 Terminology
edgeR performs differential abundance analysis for pre-defined genomic features. Although
not strictly necessary, it usually desirable that these genomic features are non-overlapping.
For simplicity, we will hence-forth refer to the genomic features as “genes”, although they
could in principle be transcripts, exons, general genomic intervals or some other type of
feature. For ChIP-seq experiments, abundance might relate to transcription factor binding
or to histone mark occupancy, but we will henceforth refer to abundance as in terms of gene
expression. In other words, the remainder of this guide will use terminology as for a gene-level
analysis of an RNA-seq experiment, although the methodology is more widely applicable than
that.

2.2 Aligning reads to a genome


The first step in an RNA-seq analysis is usually to align the raw sequence reads to a reference
genome, although there are many variations on this process. Alignment needs to allow for the
fact that reads may span multiple exons which may align to well separated locations on the
genome. We find the Subread-featureCounts pipeline [19, 20] to be very fast and effective for
this purpose, but the STAR-featureCounts, STAR-htseq and Bowtie-TopHat-htseq pipelines
are also popular. Subread and featureCounts are particularly convenient because it they
implemented in the Bioconductor R package Rsubread [21].

2.3 Producing a table of read counts


edgeR works on a table of read counts, with rows corresponding to genes and columns to
independent libraries. The counts represent the total number of reads aligning to each gene
(or other genomic locus).
Such counts can be produced from aligned reads by a variety of short read software tools. We
find the featureCounts function of the Rsubread package [20, 21] to be particularly effective
and convenient, but other tools are available such as findOverlaps in the GenomicRanges
package or the Python software htseq-counts.

11
edgeR User’s Guide

Reads can be counted in a number of ways. When conducting gene-level analyses, the counts
could be for reads mapping anywhere in the genomic span of the gene or the counts could be
for exons only. We usually count reads that overlap any exon for the given gene, including
the UTR as part of the first exon [20].
For data from pooled shRNA-seq or CRISPR-Cas9 genetic screens, the processAmplicons
function [7] can be used to obtain counts directly from FASTQ files.
Note that edgeR is designed to work with actual read counts. We not recommend that
predicted transcript abundances are input the edgeR in place of actual counts.

2.4 Reading the counts from a file


If the table of counts has been written to a file, then the first step in any analysis will usually
be to read these counts into an R session.
If the count data is contained in a single tab-delimited or comma-separated text file with
multiple columns, one for each sample, then the simplest method is usually to read the file
into R using one of the standard R read functions such as [Link]. See the quick start
above, or the case study on LNCaP Cells, or the case study on oral carcinomas later in this
guide for examples.
If the counts for different samples are stored in separate files, then the files have to be read
separately and collated together. The edgeR function readDGE is provided to do this. Files
need to contain two columns, one for the counts and one for a gene identifier.

2.5 Pseudoalignment and quasi-mapping


The kallisto and Salmon software tools align sequence reads to the transcriptome instead of
the reference genome and produce estimated counts per transcript. Output from either tool
can be input to edgeR via the tximport package, which produces gene-level estimated counts
and an associated edgeR offset matrix. Alternatively, kallisto or Salmon output can be read
directly into edgeR using the catchSalmon and catchKallisto functions if the intention is to
conduct a transcript-level analysis.

2.6 The DGEList data class


edgeR stores data in a simple list-based data object called a DGEList. This type of object is
easy to use because it can be manipulated like any list in R. The function readDGE makes a
DGEList object directly. If the table of counts is already available as a matrix or a [Link],
x say, then a DGEList object can be made by

> y <- DGEList(counts=x)

A grouping factor can be added at the same time:


> group <- c(1,1,2,2)
> y <- DGEList(counts=x, group=group)

12
edgeR User’s Guide

The main components of an DGEList object are a matrix counts containing the integer counts,
a [Link] samples containing information about the samples or libraries, and a optional
[Link] genes containing annotation for the genes or genomic features. The [Link]
samples contains a column [Link] for the library size or sequencing depth for each sample.
If not specified by the user, the library sizes will be computed from the column sums of
the counts. For classic edgeR the [Link] samples must also contain a column group,
identifying the group membership of each sample.

2.7 Filtering
Genes with very low counts across all libraries provide little evidence for differential expression.
In the biological point of view, a gene must be expressed at some minimal level before it is likely
to be translated into a protein or to be biologically important. In addition, the pronounced
discreteness of these counts interferes with some of the statistical approximations that are
used later in the pipeline. These genes should be filtered out prior to further analysis.
As a rule of thumb, genes are dropped if they can’t possibly be expressed in all the samples
for any of the conditions. Users can set their own definition of genes being expressed. Usually
a gene is required to have a count of 5-10 in a library to be considered expressed in that
library. Users should also filter with count-per-million (CPM) rather than filtering on the
counts directly, as the latter does not account for differences in library sizes between samples.
Here is a simple example. Suppose the sample information of a DGEList object y is shown as
follows:
> y$samples

group [Link] [Link]


Sample1 1 10880519 1
Sample2 1 9314747 1
Sample3 1 11959792 1
Sample4 2 7460595 1
Sample5 2 6714958 1

We filter out lowly expressed genes using the following commands:


> keep <- filterByExpr(y)
> y <- y[keep, , [Link]=FALSE]

The filterByExpr function keeps rows that have worthwhile counts in a minumum number
of samples (two samples in this case because the smallest group size is two). The function
accesses the group factor contained in y in order to compute the minimum group size, but
the filtering is performed independently of which sample belongs to which group so that no
bias is introduced. It is recommended to recalculate the library sizes of the DGEList object
after the filtering, although the downstream analysis is robust to whether this is done or not.
The group factor or the experimental design matrix can also be given directly to the filterBy
Expr function by
> keep <- filterByExpr(y, group=group)

if not already set in the DGEList object. More generally, filterByExpr can be used with any
design matrix:

13
edgeR User’s Guide

> keep <- filterByExpr(y, design)

In this form, the design matrix can be completely general, even including continuous covari-
ates.
The filtering should be based on the grouping factors or treatment factors that will be involved
in the differential expression teststested for, rather than on blocking variables that are not
of scientific interest in themselves. For example, consider a paired comparison experiment in
which the same treatment regimes applied to each of a number of subjects or patients:
> design <- [Link](~ Patient + Treatment)

In this design, Patient is included in the design matrix to correct for baseline differences
between the Patients, but we will not be testing for differential expression between the
Patients. The filtering should therefore be based soley Treatment rather than on Patient, i.e.,

> keep <- filterByExpr(y, group=Treatment)

rather than
> keep <- filterByExpr(y, design)

2.8 Normalization
2.8.1 Normalization is only necessary for sample-specific effects
edgeR is concerned with differential expression analysis rather than with the quantification of
expression levels. It is concerned with relative changes in expression levels between conditions,
but not directly with estimating absolute expression levels. This greatly simplifies the technical
influences that need to be taken into account, because any technical factor that is unrelated
to the experimental conditions should cancel out of any differential expression analysis. For
example, read counts can generally be expected to be proportional to length as well as to
expression for any transcript, but edgeR does not generally need to adjust for gene length
because gene length has the same relative influence on the read counts for each RNA sample.
For this reason, normalization issues arise only to the extent that technical factors have
sample-specific effects.

2.8.2 Sequencing depth


The most obvious technical factor that affects the read counts, other than gene expression
levels, is the sequencing depth of each RNA sample. edgeR adjusts any differential expression
analysis for varying sequencing depths as represented by differing library sizes. This is part of
the basic modeling procedure and flows automatically into fold-change or p-value calculations.
It is always present, and doesn’t require any user intervention.

14
edgeR User’s Guide

2.8.3 Effective library sizes


The second most important technical influence on differential expression is one that is less
obvious. RNA-seq provides a measure of the relative abundance of each gene in each RNA
sample, but does not provide any measure of the total RNA output on a per-cell basis.
In other words, RNA-seq measure relative expression rather than absolute expression. This
becomes important for differential expression analyses when a small number of genes are very
highly expressed in some samples but not in others. If a small proportion of highly expressed
genes consume a substantial proportion of the total library size for a particular sample, this
will cause the remaining genes to be under-sampled for that sample. Unless this effect is
adjusted for, the remaining genes may falsely appear to be down-regulated in that sample
[33].
The calcNormFactors function normalizes the library sizes by finding a set of scaling factors
for the library sizes that minimizes the log-fold changes between the samples for most genes.
The default method for computing these scale factors uses a trimmed mean of M-values
(TMM) between each pair of samples [33]. We call the product of the original library size
and the scaling factor the effective library size. The effective library size replaces the original
library size in all downsteam analyses.
TMM is recommended for most RNA-Seq data where the majority (more than half) of the
genes are believed not differentially expressed between any pair of the samples. If y is a
DGEList object, then the following commands perform the TMM normalization and display
the normalization factors.
> y <- calcNormFactors(y)
> y$samples

group [Link] [Link]


Sample1 1 10880519 1.17
Sample2 1 9314747 0.86
Sample3 1 11959792 1.32
Sample4 2 7460595 0.91
Sample5 2 6714958 0.83

The set of all normalization factors for a DGEList multiply to unity, ensuring that the geomet-
ric mean of the effective library sizes is the same as the geometric mean of the original library
sizes. A normalization factor below one indicates that a small number of high count genes
are monopolizing the sequencing, causing the counts for other genes to be lower than would
be usual given the library size. As a result, the library size will be scaled down, analogous
to scaling the counts upwards in that library. Conversely, a factor above one scales up the
library size, analogous to downscaling the counts.

2.8.4 GC content
The GC-content of each gene does not change from sample to sample, so it can be expected
to have little effect on differential expression analyses to a first approximation. Recent pub-
lications, however, have demonstrated that sample-specific effects for GC-content can be
detected [31, 15]. The EDASeq [31] and cqn [15] packages estimate correction factors that
adjust for sample-specific GC-content effects in a way that is compatible with edgeR. In each
case, the observation-specific correction factors can be input into the glm functions of edgeR
as an offset matrix.

15
edgeR User’s Guide

2.8.5 Gene length


Like GC-content, gene length does not change from sample to sample, so it can be expected
to have little effect on differential expression analyses. Nevertheless, sample-specific effects
for gene length have been detected [15], although the evidence is not as strong as for GC-
content.

2.8.6 Model-based normalization, not transformation


In edgeR, normalization takes the form of correction factors that enter into the statistical
model. Such correction factors are usually computed internally by edgeR functions, but it
is also possible for a user to supply them. The correction factors may take the form of
scaling factors for the library sizes, such as computed by calcNormFactors, which are then
used to compute the effective library sizes. Alternatively, gene-specific correction factors can
be entered into the glm functions of edgeR as offsets. In the latter case, the offset matrix
will be assumed to account for all normalization issues, including sequencing depth and RNA
composition.
Note that normalization in edgeR is model-based, and the original read counts are not them-
selves transformed. This means that users should not transform the read counts in any way
before inputing them to edgeR. For example, users should not enter RPKM or FPKM val-
ues to edgeR in place of read counts. Such quantities will prevent edgeR from correctly
estimating the mean-variance relationship in the data, which is a crucial to the statistical
strategies underlying edgeR. Similarly, users should not add artificial values to the counts
before inputing them to edgeR.
edgeR is not designed to work with estimated expression levels, for example as might be
output by Cufflinks. edgeR can work with expected counts as output by RSEM, but raw
counts are still preferred.

2.8.7 Pseudo-counts
The classic edgeR functions estimateCommonDisp and exactTest produce a matrix of pseudo-
counts as part of the output object. The pseudo-counts are used internally to speed up
computation of the conditional likelihood used for dispersion estimation and exact tests in the
classic edgeR pipeline. The pseudo-counts represent the equivalent counts would have been
observed had the library sizes all been equal, assuming the fitted model. The pseudo-counts
are computed for a specific purpose, and their computation depends on the experimental
design as well as the library sizes, so users are advised not to interpret the psuedo-counts as
general-purpose normalized counts. They are intended mainly for internal use in the edgeR
pipeline.
Disambiguation. Note that some other software packages use the term pseudo-count to
mean something analogous to prior counts in edgeR, i.e., a starting value that is added to a
zero count to avoid missing values when computing logarithms. In edgeR, a pseudo-count is
a type of normalized count and a prior count is a starting value used to offset small counts.

16
edgeR User’s Guide

2.9 Negative binomial models


2.9.1 Introduction
The starting point for an RNA-Seq experiment is a set of n RNA samples, typically associated
with a variety of treatment conditions. Each sample is sequenced, short reads are mapped to
the appropriate genome, and the number of reads mapped to each genomic feature of interest
is recorded. The number of reads from sample i mapped to gene g will be denoted ygi . The
set of genewise counts for sample i makes up the expression profile or library for that sample.
The expected size of each count is the product of the library size and the relative abundance
of that gene in that sample.

2.9.2 Biological coefficient of variation (BCV)


RNA-Seq profiles are formed from n RNA samples. Let πgi be the fraction of all cDNA
fragments P
in the ith sample that originate from
√ gene g. Let G denote the total number of
G
genes, so g=1 πgi = 1 for each sample. Let φg denote the coefficient of variation (CV)
(standard deviation divided by mean) of πgi between the replicates i. We denote the total
number of mapped reads in library i by Ni and the number that map to the gth gene by ygi .
Then
E(ygi ) = µgi = Ni πgi .
Assuming that the count ygi follows a Poisson distribution for repeated sequencing runs of
the same RNA sample, a well known formula for the variance of a mixture distribution implies:

var(ygi ) = Eπ [var(y|π)] + varπ [E(y|π)] = µgi + φg µ2gi .

Dividing both sides by µ2gi gives

CV2 (ygi ) = 1/µgi + φg .

The first term 1/µgi is the squared CV for the Poisson distribution and the second is the
squared CV of the unobserved expression values. The total CV2 therefore is the technical
CV2 with which πgi is measuredp plus the biological CV of the true πgi . In this article, we
2

call φg the dispersion and φg the biological CV although, strictly speaking, it captures
all sources of the inter-library variation between replicates, including perhaps contributions
from technical causes such as library preparation as well as true biological variation between
samples.
Two levels of variation can be distinguished in any RNA-Seq experiment. First, the relative
abundance of each gene will vary between RNA samples, due mainly to biological causes.
Second, there is measurement error, the uncertainty with which the abundance of each gene
in each sample is estimated by the sequencing technology. If aliquots of the same RNA
sample are sequenced, then the read counts for a particular gene should vary according to a
Poisson law [24]. If sequencing variation is Poisson, then it can be shown that the squared
coefficient of variation (CV) of each count between biological replicate libraries is the sum of
the squared CVs for technical and biological variation respectively,

Total CV2 = Technical CV2 + Biological CV2 .

Biological CV (BCV) is the coefficient of variation with which the (unknown) true abundance
of the gene varies between replicate RNA samples. It represents the CV that would remain
between biological replicates if sequencing depth could be increased indefinitely. The technical

17
edgeR User’s Guide

CV decreases as the size of the counts increases. BCV on the other hand does not. BCV
is therefore likely to be the dominant source of uncertainty for high-count genes, so reliable
estimation of BCV is crucial for realistic assessment of differential expression in RNA-Seq
experiments. If the abundance of each gene varies between replicate RNA samples in such
a way that the genewise standard deviations are proportional to the genewise means, a
commonly occurring property of measurements on physical quantities, then it is reasonable
to suppose that BCV is approximately constant across genes. We allow however for the
possibility that BCV might vary between genes and might also show a systematic trend with
respect to gene expression or expected count.
The magnitude of BCV is more important than the exact probabilistic law followed by the true
gene abundances. For mathematical convenience, we assume that the true gene abundances
follow a gamma distributional law between replicate RNA samples. This implies that the read
counts follow a negative binomial probability law.

2.9.3 Estimating BCVs


When a negative binomial model is fitted, we need to estimate the BCV(s) before we carry out
the analysis. The BCV, as shown in the previous section, is the square root of the dispersion
parameter under the negative binomial model. Hence, it is equivalent to estimating the
dispersion(s) of the negative binomial model.
The parallel nature of sequencing data allows some possibilities for borrowing information
from the ensemble of genes which can assist in inference about each gene individually. The
easiest way to share information between genes is to assume that all genes have the same
mean-variance relationship, in other words, the dispersion is the same for all the genes [35].
An extension to this “common dispersion” approach is to put a mean-dependent trend on a
parameter in the variance function, so that all genes with the same expected count have the
same variance.
However, the truth is that the gene expression levels have non-identical and dependent dis-
tribution between genes, which makes the above assumptions too naive. A more general
approach that allows genewise variance functions with empirical Bayes moderation was in-
troduced several years ago [34] and was extended to generalized linear models and thus more
complex experimental designs [25]. Only when using tagwise dispersion will genes that are
consistent between replicates be ranked more highly than genes that are not. It has been
seen in many RNA-Seq datasets that allowing gene-specific dispersion is necessary in order
that differential expression is not driven by outliers. Therefore, the tagwise dispersions are
strongly recommended in model fitting and testing for differential expression.
In edgeR, we apply an empirical Bayes strategy for squeezing the tagwise dispersions towards
a global dispersion trend or towards a common dispersion value. The amount of squeeze
is determined by the weight given to the global value on one hand and the precision of the
tagwise estimates on the other. The relative weights given to the two are determined the prior
and residual degrees of freedom. By default, the prior degrees of freedom, which determines
the amount of empirical Bayes moderation, is estimated by examining the heteroskedasticity
of the data [3].

18
edgeR User’s Guide

2.9.4 Quasi negative binomial


The NB model can be extended with quasi-likelihood (QL) methods to account for gene-
specific variability from both biological and technical sources [23, 22]. Under the QL frame-
work, the variance of the count ygi is a quadratic function of the mean,

var(ygi ) = σg2 (µgi + φµ2gi ),

where φ is the NB dispersion parameter and σg2 is the QL dispersion parameter.


Any increase in the observed variance of ygi will be modelled by an increase in the estimates
for φ and/or σg2 . In this model, the NB dispersion φ is a global parameter whereas the QL
is gene-specific, so the two dispersion parameters have different roles. The NB dispersion
describes the overall biological variability across all genes. It represents the observed variation
that is attributable to inherent variability in the biological system, in contrast to the Poisson
variation from sequencing. The QL dispersion picks up any gene-specific variability above
and below the overall level.
The common NB dispersion for the entire data set can be used for the global parameter.
In practice, we use the trended dispersions to account for the empirical mean-variance re-
lationships. Since the NB dispersion under the QL framework reflects the overall biological
variability, it does not make sense to use the tagwise dispersions.
Estimation of the gene-specific QL dispersion is difficult as most RNA-seq data sets have
limited numbers of replicates. This means that there is often little information to stably
estimate the dispersion for each gene. To overcome this, an empirical Bayes (EB) approach
is used whereby information is shared between genes [38, 23, 28]. Briefly, a mean-dependent
trend is fitted to the raw QL dispersion estimates. The raw estimates are then squeezed
towards this trend to obtain moderated EB estimates, which can be used in place of the raw
values for downstream hypothesis testing. This EB strategy reduces the uncertainty of the
estimates and improves testing power.

2.10 The classic edgeR pipeline: pairwise comparisons


between two or more groups
2.10.1 Estimating dispersions
edgeR uses the quantile-adjusted conditional maximum likelihood (qCML) method for exper-
iments with single factor.
Compared against several other estimators (e.g. maximum likelihood estimator, Quasi-likelihood
estimator etc.) using an extensive simulation study, qCML is the most reliable in terms of bias
on a wide range of conditions and specifically performs best in the situation of many small
samples with a common dispersion, the model which is applicable to Next-Gen sequenc-
ing data. We have deliberately focused on very small samples due to the fact that DNA
sequencing costs prevent large numbers of replicates for SAGE and RNA-seq experiments.
The qCML method calculates the likelihood by conditioning on the total counts for each
tag, and uses pseudo counts after adjusting for library sizes. Given a table of counts or a
DGEList object, the qCML common dispersion and tagwise dispersions can be estimated using
the estimateDisp() function. Alternatively, one can estimate the qCML common dispersion
using the estimateCommonDisp() function, and then the qCML tagwise dispersions using the
estimateTagwiseDisp() function.

19
edgeR User’s Guide

However, the qCML method is only applicable on datasets with a single factor design since it
fails to take into account the effects from multiple factors in a more complicated experiment.
When an experiment has more than one factor involved, we need to seek a new way of
estimating dispersions.
Here is a simple example of estimating dispersions using the qCML method. Given a DGEList
object y, we estimate the dispersions using the following commands.
To estimate common dispersion and tagwise dispersions in one run (recommended):
> y <- estimateDisp(y)

Alternatively, to estimate common dispersion:


> y <- estimateCommonDisp(y)

Then to estimate tagwise dispersions:


> y <- estimateTagwiseDisp(y)

Note that common dispersion needs to be estimated before estimating tagwise dispersions if
they are estimated separately.

2.10.2 Testing for DE genes


For all the Next-Gen squencing data analyses we consider here, people are most interested
in finding differentially expressed genes/tags between two (or more) groups. Once negative
binomial models are fitted and dispersion estimates are obtained, we can proceed with testing
procedures for determining differential expression using the exact test.
The exact test is based on the qCML methods. Knowing the conditional distribution for the
sum of counts in a group, we can compute exact p-values by summing over all sums of counts
that have a probability less than the probability under the null hypothesis of the observed
sum of counts. The exact test for the negative binomial distribution has strong parallels with
Fisher’s exact test.
As we dicussed in the previous section, the exact test is only applicable to experiments with
a single factor. The testing can be done by using the function exactTest(), and the function
allows both common dispersion and tagwise dispersion approaches. For example:
> et <- exactTest(y)
> topTags(et)

2.11 More complex experiments (glm functionality)


2.11.1 Generalized linear models
Generalized linear models (GLMs) are an extension of classical linear models to nonnormally
distributed response data [9]. GLMs specify probability distributions according to their mean-
variance relationship, for example the quadratic mean-variance relationship specified above for
read counts. Assuming that an estimate is available for φg , so the variance can be evaluated
for any value of µgi , GLM theory can be used to fit a log-linear model
log µgi = xTi βg + log Ni

20
edgeR User’s Guide

for each gene [25]. Here xi is a vector of covariates that specifies the treatment conditions
applied to RNA sample i, and βg is a vector of regression coefficients by which the covariate
effects are mediated for gene g. The quadratic variance function specifies the negative
binomial GLM distributional family. The use of the negative binomial distribution is equivalent
to treating the πgi as gamma distributed.

2.11.2 Estimating dispersions


For general experiments (with multiple factors), edgeR uses the Cox-Reid profile-adjusted
likelihood (CR) method in estimating dispersions [25]. The CR method is derived to overcome
the limitations of the qCML method as mentioned above. It takes care of multiple factors by
fitting generalized linear models (GLM) with a design matrix.
The CR method is based on the idea of approximate conditional likelihood [5]. Given a
table counts or a DGEList object and the design matrix of the experiment, generalized linear
models are fitted. This allows valid estimation of the dispersion, since all systematic sources
of variation are accounted for.
The CR method can be used to calculate a common dispersion for all the tags, trended
dispersion depending on the tag abundance, or separate dispersions for individual tags. These
can be done by calling the function estimateDisp() with a specified design. Alternatively, one
can estimate the common, trended and tagwise dispersions separately using estimateGLMCom
monDisp(), estimateGLMTrendedDisp() and estimateGLMTagwiseDisp(), respectively. The tagwise
dispersion approach is strongly recommended in multi-factor experiment cases.
Here is a simple example of estimating dispersions using the GLM method. Given a DGEList
object y and a design matrix, we estimate the dispersions using the following commands.
To estimate common dispersion, trended dispersions and tagwise dispersions in one run
(recommended):
> y <- estimateDisp(y, design)

Alternatively, one can use the following calling sequence to estimate them one by one. To
estimate common dispersion:
> y <- estimateGLMCommonDisp(y, design)

To estimate trended dispersions:


> y <- estimateGLMTrendedDisp(y, design)

To estimate tagwise dispersions:


> y <- estimateGLMTagwiseDisp(y, design)

Note that we need to estimate either common dispersion or trended dispersions prior to
the estimation of tagwise dispersions. When estimating tagwise dispersions, the empirical
Bayes method is applied to squeeze the tagwise dispersions towards a common dispersion or
towards trended dispersions, whichever exists. If both exist, the default is to use the trended
dispersions.
For more detailed examples, see the case study in Section 4.1 (Tuch’s data), Section 4.2
(arabidopsis data), Section 4.3 (Nigerian data) and Section 4.4 (Fu’s data).

21
edgeR User’s Guide

2.11.3 Testing for DE genes


For general experiments, once dispersion estimates are obtained and negative binomial gen-
eralized linear models are fitted, we can proceed with testing procedures for determining
differential expression using either quasi-likelihood (QL) F-test or likelihood ratio test.
While the likelihood ratio test is a more obvious choice for inferences with GLMs, the QL
F-test is preferred as it reflects the uncertainty in estimating the dispersion for each gene. It
provides more robust and reliable error rate control when the number of replicates is small.
The QL dispersion estimation and hypothesis testing can be done by using the functions
glmQLFit() and glmQLFTest().

Given raw counts, NB dispersion(s) and a design matrix, glmQLFit() fits the negative binomial
GLM for each tag and produces an object of class DGEGLM with some new components. This
DGEGLM object can then be passed to glmQLFTest() to carry out the QL F-test. User can select
one or more coefficients to drop from the full design matrix. This gives the null model against
which the full model is compared. Tags can then be ranked in order of evidence for differential
expression, based on the p-value computed for each tag.
As a brief example, consider a situation in which are three treatment groups, each with two
replicates, and the researcher wants to make pairwise comparisons between them. A QL
model representing the study design can be fitted to the data with commands such as:
> group <- factor(c(1,1,2,2,3,3))
> design <- [Link](~group)
> fit <- glmQLFit(y, design)

The fit has three parameters. The first is the baseline level of group 1. The second and third
are the 2 vs 1 and 3 vs 1 differences.
To compare 2 vs 1:
> qlf.2vs1 <- glmQLFTest(fit, coef=2)
> topTags(qlf.2vs1)

To compare 3 vs 1:
> qlf.3vs1 <- glmQLFTest(fit, coef=3)

To compare 3 vs 2:
> qlf.3vs2 <- glmQLFTest(fit, contrast=c(0,-1,1))

The contrast argument in this case requests a statistical test of the null hypothesis that
coefficient3−coefficient2 is equal to zero.
To find genes different between any of the three groups:
> qlf <- glmQLFTest(fit, coef=2:3)
> topTags(qlf)

For more detailed examples, see the case study in Section 4.2 (arabidopsis data), Section 4.3
(Nigerian data) and Section 4.4 (Fu’s data).
Alternatively, one can perform likelihood ratio test to test for differential expression. The
testing can be done by using the functions glmFit() and glmLRT(). To apply the likelihood
ratio test to the above example and compare 2 vs 1:

22
edgeR User’s Guide

> fit <- glmFit(y, design)


> lrt.2vs1 <- glmLRT(fit, coef=2)
> topTags(lrt.2vs1)

Similarly for the other comparisons.


For more detailed examples, see the case study in section 4.1 (Tuch’s data)

2.12 What to do if you have no replicates


edgeR is primarily intended for use with data including biological replication. Nevertheless,
RNA-Seq and ChIP-Seq are still expensive technologies, so it sometimes happens that only
one library can be created for each treatment condition. In these cases there are no replicate
libraries from which to estimate biological variability. In this situation, the data analyst is
faced with the following choices, none of which are ideal. We do not recommend any of
these choices as a satisfactory alternative for biological replication. Rather, they are the best
that can be done at the analysis stage, and options 2–4 may be better than assuming that
biological variability is absent.
1. Be satisfied with a descriptive analysis, that might include an MDS plot and an analysis
of fold changes. Do not attempt a significance analysis. This may be the best advice.
2. Simply pick a reasonable dispersion value, based on your experience with similar data,
and use that for exactTest or glmFit. Typical values for the common BCV (square-root-
dispersion) for datasets arising from well-controlled experiments are 0.4 for human data,
0.1 for data on genetically identical model organisms or 0.01 for technical replicates.
Here is a toy example with simulated data:
> bcv <- 0.2
> counts <- matrix( rnbinom(40,size=1/bcv^2,mu=10), 20,2)
> y <- DGEList(counts=counts, group=1:2)
> et <- exactTest(y, dispersion=bcv^2)

Note that the p-values obtained and the number of significant genes will be very sensi-
tive to the dispersion value chosen, and be aware that less well controlled datasets, with
unaccounted-for batch effects and so on, could have in reality much larger dispersions
than are suggested here. Nevertheless, choosing a nominal dispersion value may be
more realistic than ignoring biological variation entirely.
3. Remove one or more explanatory factors from the linear model in order to create
some residual degrees of freedom. Ideally, this means removing the factors that are
least important but, if there is only one factor and only two groups, this may mean
removing the entire design matrix or reducing it to a single column for the intercept.
If your experiment has several explanatory factors, you could remove the factor with
smallest fold changes. If your experiment has several treatment conditions, you could
try treating the two most similar conditions as replicates. Estimate the dispersion from
this reduced model, then insert these dispersions into the data object containing the
full design matrix, then proceed to model fitting and testing with glmFit and glmLRT.
This approach will only be successful if the number of DE genes is relatively small.
In conjunction with this reduced design matrix, you could try estimateGLMCommonDisp
with method="deviance", robust=TRUE and subset=NULL. This is our current best attempt
at an automatic method to estimate dispersion without replicates, although it will only

23
edgeR User’s Guide

give good results when the counts are not too small and the DE genes are a small
proportion of the whole. Please understand that this is only our best attempt to return
something useable. Reliable estimation of dispersion generally requires replicates.
4. If there exist a sizeable number of control transcripts that should not be DE, then the
dispersion could be estimated from them. For example, suppose that housekeeping is
an index variable identifying housekeeping genes that do not respond to the treatment
used in the experiment. First create a copy of the data object with only one treatment
group:
> y1 <- y
> y1$samples$group <- 1

Then estimate the common dispersion from the housekeeping genes and all the libraries
as one group:
> y0 <- estimateDisp(y1[housekeeping,], trend="none", tagwise=FALSE)

Then insert this into the full data object and proceed:
> y$[Link] <- y0$[Link]
> fit <- glmFit(y, design)
> lrt <- glmLRT(fit)

and so on. A reasonably large number of control transcripts is required, at least a few
dozen and ideally hundreds.

2.13 Differential expression above a fold-change thresh-


old
All the above testing methods identify differential expression based on statistical significance
regardless of how small the difference might be. On the other hand, one might be more
interested in studying genes of which the expression levels change by a certain amount. A
commonly used approach is to conduct DE tests, apply a fold-change cut-off and then rank
all the genes above that fold-change threshold by p-value. In some other cases genes are first
chosen according to a p-value cut-off and then sorted by their fold-changes. These combina-
tions of p-value and fold-change threshold criteria seem to give more biological meaningful
sets of genes than using either of them alone. However, they are both ad hoc and do not
give meaningful p-values for testing differential expressions relative to a fold-change thresh-
old. They favour lowly expressed but highly variable genes and destroy the control of FDR
in general.
edgeR offers a rigorous statistical test for thresholded hypotheses under the GLM framework.
It is analogous to TREAT [26] but much more powerful than the original TREAT method.
Given a fold-change (or log-fold-change) threshold, the thresholded testing can be done by
calling the function glmTreat() on a DGEGLM object produced by either glmFit() or glmQLFit().
In the example shown in Section 2.11.3, suppose we are detecting genes of which the log2-
fold-changes for 1 vs 2 are significantly greater than 1, i.e., fold-changes significantly greater
than 2, we use the following commands:

24
edgeR User’s Guide

> fit <- glmQLFit(y, design)


> tr <- glmTreat(fit, coef=2, lfc=1)
> topTags(tr)

Note that the fold-change threshold in glmTreat() is not the minimum value of the fold-change
expected to see from the testing results. Genes will need to exceed this threshold by some
way before being declared statistically significant. It is better to interpret the threshold as
“the fold-change below which we are definitely not interested in the gene" rather than “the
fold-change above which we are interested in the gene". In the presence of a huge number
of DE genes, a relatively large fold-change threshold may be appropriate to narrow down the
search to genes of interest. In the lack of DE genes, on the other hand, a small or even no
fold-change threshold shall be used.
For more detailed examples, see the case study in Section 4.4 (Fu’s data).

2.14 Gene ontology (GO) and pathway analysis


The gene ontology (GO) enrichment analysis and the KEGG pathway enrichment analysis
are the common downstream procedures to interpret the differential expression results in
a biological context. Given a set of genes that are up- or down-regulated under a certain
contrast of interest, a GO (or pathway) enrichment analysis will find which GO terms (or
pathways) are over- or under-represented using annotations for the genes in that set.
The GO analysis can be performed using the goana() function in edgeR. The KEGG pathway
analysis can be performed using the kegga() function in edgeR. Both goana() and kegga()
take a DGELRT or DGEExact object. They both use the NCBI RefSeq annotation. Therefore, the
Entrez Gene identifier (ID) should be supplied for each gene as the row names of the input
object. Also users should set species according to the organism being studied. The top set
of most enriched GO terms can be viewed with the topGO() function, and the top set of most
enriched KEGG pathways can be viewed with the topKEGG() function.
Suppose we want to identify GO terms and KEGG pathways that are over-represented in
group 2 compared to group 1 from the previous example in Section 2.11.3 assuming the
samples are collected from mice. We use the following commands:
> qlf <- glmQLFTest(fit, coef=2)
> go <- goana(qlf, species="Mm")
> topGO(go, sort="up")
> keg <- kegga(qlf, species="Mm")
> topKEGG(keg, sort="up")

For more detailed examples, see the case study in Section 4.1 (Tuch’s data) and Section 4.4
(Fu’s data).

2.15 Gene set testing


In addition to the GO and pathway analysis, edgeR offers different types of gene set tests
for RNA-Seq data. These gene set tests are the extensions of the original gene set tests in
limma in order to handle DGEList objects.

25
edgeR User’s Guide

The roast() function performs ROAST gene set tests [41]. It is a self-contained gene set
test. Given a gene set, it tests whether the majority of the genes in the set are DE across
the comparison of interest.
The mroast() function does ROAST tests for multiple sets, including adjustment for multiple
testing.
The fry() function is a fast version of mroast(). It assumes all the genes in a set have equal
variances. Since edgeR uses the z-score equivalents of NB random deviates for the gene set
tests, the above assumption is always met. Hence, fry() is recommended over roast() and
mroast() in edgeR. It gives the same result as mroast() with an infinite number of rotations.

The camera() function performs a competitive gene set test accounting for inter-gene corre-
lation. It tests whether a set of genes is highly ranked relative to other genes in terms of
differential expression [42].
The romer() function performs a gene set enrichment analysis. It implements a GSEA ap-
proach [39] based on rotation instead of permutation.
Unlike goana() and kegga(), the gene set tests are not limited to GO terms or KEGG pathways.
Any pre-defined gene set can be used, for example MSigDB gene sets. A common application
is to use a set of DE genes that was defined from an analysis of an independent data set.
For more detailed examples, see the case study in Section 4.3 (Nigerian’s data) and Section 4.4
(Fu’s data).

2.16 Clustering, heatmaps etc


The function plotMDS draws a multi-dimensional scaling plot of the RNA samples in which
distances correspond to leading log-fold-changes between each pair of RNA samples. The
leading log-fold-change is the average (root-mean-square) of the largest absolute log-fold-
changes between each pair of samples. This plot can be viewed as a type of unsupervised
clustering. The function also provides the option of computing distances in terms of BCV
between each pair of samples instead of leading logFC.
Inputing RNA-seq counts to clustering or heatmap routines designed for microarray data is
not straight-forward, and the best way to do this is still a matter of research. To draw a
heatmap of individual RNA-seq samples, we suggest using moderated log-counts-per-million.
This can be calculated by cpm with positive values for [Link], for example
> logcpm <- cpm(y, log=TRUE)

where y is the normalized DGEList object. This produces a matrix of log2 counts-per-million
(logCPM), with undefined values avoided and the poorly defined log-fold-changes for low
counts shrunk towards zero. Larger values for [Link] produce stronger moderation of
the values for low counts and more shrinkage of the corresponding log-fold-changes. The
logCPM values can optionally be converted to RPKM or FPKM by subtracting log2 of gene
length, see rpkm().

26
edgeR User’s Guide

2.17 Alternative splicing


edgeR can also be used to analyze RNA-Seq data at the exon level to detect differential
splicing or isoform-specific differential expression. Alternative splicing events are detected by
testing for differential exon usage for each gene, that is testing whether the log-fold-changes
differ between exons for the same gene.
Both exon-level and gene-level tests can be performed simultaneously using the diffSpliceDGE()
function in edgeR. The exon-level test tests for the significant difference between the exon’s
logFC and the overall logFC for the gene. Two testing methods at the gene-level are pro-
vided. The first is to conduct a gene-level statistical test using the exon-level test statistics.
Whether it is a likelihood ratio test or a QL F-test depends on the pipeline chosen. The
second is to convert the exon-level p-values into a genewise p-value by the Simes’ method.
The first method is likely to be powerful for genes in which several exons are differentially
spliced. The Simes’ method is likely to be more powerful when only a minority of the exons
for a gene are differentially spliced.
The top set of most significant spliced genes can be viewed by the topSpliceDGE() function.
The exon-level testing results for a gene of interest can be visualized by the plotSpliceDGE()
function.
For more detailed examples, see the case study in Section 4.5 (Pasilla’s data).

2.18 CRISPR-Cas9 and shRNA-seq screen analysis


edgeR can also be used to analyze data from CRISPR-Cas9 and shRNA-seq genetic screens
as described in Dai et al. (2014) [7]. Screens of this kind typically involve the comparison of
two or more cell populations either in the presence or absence of a selective pressure, or as a
time-course before and after a selective pressure is applied. The goal is to identify sgRNAs
(or shRNAs) whose representation changes (either increases or decreases) suggesting that
disrupting the target gene’s function has an effect on the cell.
To begin, the processAmplicons function can be used to obtain counts for each sgRNA (or
shRNA) in the screen in each sample and organise them in a DGEList for down-stream analysis
using either the classic edgeR or GLM pipeline mentioned above. Next, gene set testing
methods such as camera and roast can be used to summarize results from multiple sgRNAs
or shRNAs targeting the same gene to obtain gene-level results.
For a detailed example, see the case study in Section 4.6 (CRISPR-Cas9 knockout screen
analysis).

2.19 Bisulfite sequencing and differential methylation anal-


ysis
Cytosine methylation is a DNA modification generally associated with transcriptional silencing[36].
edgeR can be used to analyze DNA methylation data generated from bisulfite sequencing
technology[4]. A DNA methylation study often involves comparing methylation levels at
CpG loci between different experimental groups. Differential methylation analyses can be
performed in edgeR for both whole genome bisulfite sequencing (WGBS) and reduced repre-
sentation bisulfite sequencing (RRBS). This is done by considering the observed read counts

27
edgeR User’s Guide

of both methylated and unmethylated CpG’s across all the samples. Extra coefficients are
added to the design matrix to represent the methylation levels and the differences of the
methylation levels betweeen groups.
See the case study in Section 4.7 (Bisulfite sequencing of mouse oocytes) for a detailed
worked example of a differential methylation analysis. Another example workflow is given by
Chen et al [4].

28
Chapter 3

Specific experimental designs

3.1 Introduction
In this chapter, we outline the principles for setting up the design matrix and forming contrasts
for some typical experimental designs.
Throughout this chapter we will assume that the read alignment, normalization and dispersion
estimation steps described in the previous chapter have already been completed. We will
assume that a DGEList object y has been created containing the read counts, library sizes,
normalization factors and dispersion estimates.

3.2 Two or more groups


3.2.1 Introduction
The simplest and most common type of experimental design is that in which a number of
experimental conditions are compared on the basis of independent biological replicates of each
condition. Suppose that there are three experimental conditions to be compared, treatments
A, B and C, say. The samples component of the DGEList data object might look like:
> y$samples

group [Link] [Link]


Sample1 A 100001 1
Sample2 A 100002 1
Sample3 B 100003 1
Sample4 B 100004 1
Sample5 C 100005 1

Note that it is not necessary to have multiple replicates for all the conditions, although it
is usually desirable to do so. By default, the conditions will be listed in alphabetical order,
regardless of the order that the data were read:
> levels(y$samples$group)

[1] "A" "B" "C"

29
edgeR User’s Guide

3.2.2 Classic approach


The classic edgeR approach is to make pairwise comparisons between the groups. For exam-
ple,
> et <- exactTest(y, pair=c("A","B"))
> topTags(et)

will find genes differentially expressed (DE) in B vs A. Similarly


> et <- exactTest(y, pair=c("A","C"))

for C vs A, or
> et <- exactTest(y, pair=c("C","B"))

for B vs C.
Alternatively, the conditions to be compared can be specified by number, so that
> et <- exactTest(y, pair=c(3,2))

is equivalent to pair=c("C","B"), given that the second and third levels of group are B and C
respectively.
Note that the levels of group are in alphabetical order by default, but can be easily changed.
Suppose for example that C is a control or reference level to which conditions A and B are
to be compared. Then one might redefine the group levels, in a new data object, so that C
is the first level:
> y2 <- y
> y2$samples$group <- relevel(y2$samples$group, ref="C")
> levels(y2$samples$group)

[1] "C" "A" "B"

Now
> et <- exactTest(y2, pair=c("A","B"))

would still compare B to A, but


> et <- exactTest(y2, pair=c(1,2))

would now compare A to C.


When pair is not specified, the default is to compare the first two group levels, so
> et <- exactTest(y)

compares B to A, whereas
> et <- exactTest(y2)

compares A to C.

30
edgeR User’s Guide

3.2.3 GLM approach


The glm approach to multiple groups is similar to the classic approach, but permits more
general comparisons to be made. The glm approach requires a design matrix to describe the
treatment conditions. We will usually use the [Link] function to construct the design
matrix, although it could be constructed manually. There are always many equivalent ways
to define this matrix. Perhaps the simplest way is to define a coefficient for the expression
level of each group:
> design <- [Link](~0+group, data=y$samples)
> colnames(design) <- levels(y$samples$group)
> design

A B C
Sample1 1 0 0
Sample2 1 0 0
Sample3 0 1 0
Sample4 0 1 0
Sample5 0 0 1
attr(,"assign")
[1] 1 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "[Link]"

Here, the 0+ in the model formula is an instruction not to include an intercept column and
instead to include a column for each group.
One can compare any of the treatment groups using the contrast argument of the glmQLFTest
or glmLRT function. For example,
> fit <- glmQLFit(y, design)
> qlf <- glmQLFTest(fit, contrast=c(-1,1,0))
> topTags(qlf)

will compare B to A. The meaning of the contrast is to make the comparison -1*A + 1*B +
0*C, which is of course is simply B-A.

The contrast vector can be constructed using makeContrasts if that is convenient. The above
comparison could have been made by
> BvsA <- makeContrasts(B-A, levels=design)
> qlf <- glmQLFTest(fit, contrast=BvsA)

One could make three pairwise comparisons between the groups by


> [Link] <- makeContrasts(BvsA=B-A, CvsB=C-B, CvsA=C-A, levels=design)
> [Link] <- glmQLFTest(fit, contrast=[Link][,"BvsA"])
> topTags([Link])
> [Link] <- glmQLFTest(fit, contrast=[Link][,"CvsB"])
> topTags([Link])
> [Link] <- glmQLFTest(fit, contrast=[Link][,"CvsA"])
> topTags([Link])

which would compare B to A, C to B and C to A respectively.

31
edgeR User’s Guide

Any comparison can be made. For example,


> qlf <- glmQLFTest(fit, contrast=c(-0.5,-0.5,1))

would compare C to the average of A and B. Alternatively, this same contrast could have
been specified by
> [Link] <- makeContrasts(C-(A+B)/2, levels=design)
> qlf <- glmQLFTest(fit, contrast=[Link])

with the same results.

3.2.4 Questions and contrasts


The glm approach allows an infinite variety of contrasts to be tested between the groups.
This embarassment of riches leads to the question, which specific contrasts should we test?
This answer is that we should form and test those contrasts that correspond to the scientific
questions that we want to answer. Each statistical test is an answer to a particular question,
and we should make sure that our questions and answers match up.
To clarify this a little, we will consider a hypothetical experiment with four groups. The
groups correspond to four different types of cells: white and smooth, white and furry, red
and smooth and red furry. We will think of white and red as being the major group, and
smooth and furry as being a sub-grouping. Suppose the RNA samples look like this:
Sample Color Type Group
1 White Smooth A
2 White Smooth A
3 White Furry B
4 White Furry B
5 Red Smooth C
6 Red Smooth C
7 Red Furry D
8 Red Furry D
To decide which contrasts should be made between the four groups, we need to be clear what
are our scientific hypotheses. In other words, what are we seeking to show?
First, suppose that we wish to find genes that are always higher in red cells than in white
cells. Then we will need to form the four contrasts C-A, C-B, D-A and D-B, and select genes
that are significantly up for all four contrasts.
Or suppose we wish to establish that the difference between Red and White is large compared
to the differences between Furry and Smooth. An efficient way to establish this would be
to form the three contrasts B-A, D-C and (C+D)/2-(A+B)/2. We could confidently make this
assertion for genes for which the third contrast is far more significant than the first two.
Even if B-A and D-C are statistically significant, we could still look for genes for which the fold
changes for (C+D)/2-(A+B)/2 are much larger than those for B-A or D-C.
We might want to find genes that are more highly expressed in Furry cells regardless of color.
Then we would test the contrasts B-A and D-C, and look for genes that are significantly up
for both contrasts.

32
edgeR User’s Guide

Or we want to assert that the difference between Furry over Smooth is much the same
regardless of color. In that case you need to show that the contrast (B+D)/2-(A+C)/2 (the
average Furry effect) is significant for many genes but that (D-C)-(B-A) (the interaction) is
not.

3.2.5 A more traditional glm approach


A more traditional way to create a design matrix in R is to include an intercept term that
represents the first level of the factor. We included 0+ in our model formula above. Had we
omitted it, the design matrix would have had the same number of columns as above, but the
first column would be the intercept term and the meanings of the second and third columns
would change:
> design <- [Link](~group, data=y$samples)
> design

(Intercept) groupB groupC


Sample1 1 0 0
Sample2 1 0 0
Sample3 1 1 0
Sample4 1 1 0
Sample5 1 0 1
attr(,"assign")
[1] 0 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "[Link]"

Now the first coefficient will measure the baseline logCPM expression level in the first treat-
ment condition (here group A), and the second and third columns are relative to the baseline.
Here the second and third coefficients represent B vs A and C vs A respectively. In other
words, coef=2 now means B-A and coef=3 means C-A, so
> fit <- glmQLFit(y, design)
> qlf <- glmQLFTest(fit, coef=2)

would test for differential expression in B vs A. and


> qlf <- glmQLFTest(fit, coef=3)

would test for differential expression in C vs A.


This parametrization makes good sense when the first group represents a reference or control
group, as all comparison are made with respect to this condition. If we releveled the factor
to make level C the first level (see Section 3.2.2), then the design matrix becomes:
> design2 <- [Link](~group, data=y2$samples)
> design2

(Intercept) groupA groupB


Sample1 1 1 0
Sample2 1 1 0
Sample3 1 0 1
Sample4 1 0 1

33
edgeR User’s Guide

Sample5 1 0 0
attr(,"assign")
[1] 0 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "[Link]"

Now
> fit2 <- glmQLFit(y, design2)
> qlf <- glmQLFTest(fit2, coef=2)

compares A to C, and
> qlf <- glmQLFTest(fit2, coef=3)

compares B to C. With this parametrization, one could still compare B to A using


> qlf <- glmQLFTest(fit2, contrast=c(0,-1,1))

Note that
> qlf <- glmQLFTest(fit2, coef=1)

should not be used. It would test whether the first coefficient is zero, but it is not meaningful
to compare the logCPM in group A to zero.

3.2.6 An ANOVA-like test for any differences


It might be of interest to find genes that are DE between any of the groups, without specifying
before-hand which groups might be different. This is analogous to a one-way ANOVA test.
In edgeR, this is done by specifying multiple coefficients to glmQLFTest or glmLRT, when the
design matrix includes an intercept term. For example, with fit as defined in the previous
section,
> qlf <- glmQLFTest(fit, coef=2:3)
> topTags(qlf)

will find any genes that differ between any of the treatment conditions A, B or C. Technically,
this procedure tests whether either of the contrasts B-A or C-A are non-zero. Since at least
one of these must be non-zero when differences exist, the test will detect any differences. To
have this effect, the coef argument should specify all the coefficients except the intercept.
Note that this approach does not depend on how the group factor was defined, or how the
design matrix was formed, as long as there is an intercept column. For example
> qlf <- glmQLFTest(fit2, coef=2:3)

gives exactly the same results, even though fit2 and fit were computed using different design
matrices. Here fit2 is as defined in the previous section.

34
edgeR User’s Guide

3.3 Experiments with all combinations of multiple fac-


tors
3.3.1 Defining each treatment combination as a group
We now consider experiments with more than one experimental factor, but in which every
combination of experiment conditions can potentially have a unique effect. For example,
suppose that an experiment has been conducted with an active drug and a placebo, at three
times from 0 hours to 2 hours, with all samples obtained from independent subjects. The
data frame targets describes the treatment conditions applied to each sample:
> targets

Treat Time
Sample1 Placebo 0h
Sample2 Placebo 0h
Sample3 Placebo 1h
Sample4 Placebo 1h
Sample5 Placebo 2h
Sample6 Placebo 2h
Sample7 Drug 0h
Sample8 Drug 0h
Sample9 Drug 1h
Sample10 Drug 1h
Sample11 Drug 2h
Sample12 Drug 2h

As always, there are many ways to setup a design matrix. A simple, multi-purpose approach
is to combine all the experimental factors into one combined factor:
> Group <- factor(paste(targets$Treat,targets$Time,sep="."))
> cbind(targets,Group=Group)

Treat Time Group


Sample1 Placebo 0h Placebo.0h
Sample2 Placebo 0h Placebo.0h
Sample3 Placebo 1h Placebo.1h
Sample4 Placebo 1h Placebo.1h
Sample5 Placebo 2h Placebo.2h
Sample6 Placebo 2h Placebo.2h
Sample7 Drug 0h Drug.0h
Sample8 Drug 0h Drug.0h
Sample9 Drug 1h Drug.1h
Sample10 Drug 1h Drug.1h
Sample11 Drug 2h Drug.2h
Sample12 Drug 2h Drug.2h

Then we can take the same approach as in the previous section on two or more groups. Each
treatment time for each treatment drug is a group:
> design <- [Link](~0+Group)
> colnames(design) <- levels(Group)

35
edgeR User’s Guide

> fit <- glmQLFit(y, design)

Then we can make any comparisons we wish. For example, we might wish to make the
following contrasts:
> [Link] <- makeContrasts(
+ Drug.1vs0 = Drug.1h-Drug.0h,
+ Drug.2vs0 = Drug.2h-Drug.0h,
+ Placebo.1vs0 = Placebo.1h-Placebo.0h,
+ Placebo.2vs0 = Placebo.2h-Placebo.0h,
+ DrugvsPlacebo.0h = Drug.0h-Placebo.0h,
+ DrugvsPlacebo.1h = (Drug.1h-Drug.0h)-(Placebo.1h-Placebo.0h),
+ DrugvsPlacebo.2h = (Drug.2h-Drug.0h)-(Placebo.2h-Placebo.0h),
+ levels=design)

To find genes responding to the drug at 1 hour:


> qlf <- glmQLFTest(fit, contrast=[Link][,"Drug.1vs0"])

or at 2 hours:
> qlf <- glmQLFTest(fit, contrast=[Link][,"Drug.2vs0"])

To find genes with baseline differences between the drug and the placebo at 0 hours:
> qlf <- glmQLFTest(fit, contrast=[Link][,"DrugvsPlacebo.0h"])

To find genes that have responded differently to the drug and the placebo at 2 hours:
> qlf <- glmQLFTest(fit, contrast=[Link][,"DrugvsPlacebo.2h"])

Of course, it is not compulsory to use makeContrasts to form the contrasts. The coefficients
are the following:
> colnames(fit)

[1] "Drug.0h" "Drug.1h" "Drug.2h" "Placebo.0h" "Placebo.1h" "Placebo.2h"

so
> qlf <- glmQLFTest(fit, contrast=c(-1,0,1,0,0,0))

would find the Drug.2vs0 contrast, and


> qlf <- glmQLFTest(fit, contrast=c(-1,0,1,1,0,-1))

is another way of specifying the DrugvsPlacebo.2h contrast.

3.3.2 Nested interaction formulas


We generally recommend the approach of the previous section, because it is so explicit and
easy to understand. However it may be useful to be aware of more short-hand approach to
form the same contrasts in the previous section using a model formula. First, make sure that
the placebo is the reference level:

36
edgeR User’s Guide

> targets$Treat <- relevel(targets$Treat, ref="Placebo")

Then form the design matrix:


> design <- [Link](~Treat + Treat:Time, data=targets)
> fit <- glmQLFit(y, design)

The meaning of this formula is to consider all the levels of time for each treatment drug
separately. The second term is a nested interaction, the interaction of Time within Treat.
The coefficient names are:
> colnames(fit)

[1] "(Intercept)" "TreatDrug" "TreatPlacebo:Time1h"


[4] "TreatDrug:Time1h" "TreatPlacebo:Time2h" "TreatDrug:Time2h"

Now most of the above contrasts are directly available as coefficients:


> qlf <- glmQLFTest(fit, coef=2)

is the baseline drug vs placebo comparison,


> qlf <- glmQLFTest(fit, coef=4)

is the drug effect at 1 hour,


> qlf <- glmQLFTest(fit, coef=6)

is the drug effect at 2 hours, and finally


> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0-1,1))

is the DrugvsPlacebo.2h contrast.

3.3.3 Treatment effects over all times


The nested interaction model makes it easy to find genes that respond to the treatment at
any time, in a single test. Continuing the above example,
> qlf <- glmQLFTest(fit, coef=c(4,6))

finds genes that respond to the treatment at either 1 hour or 2 hours versus the 0 hour
baseline. This is analogous to an ANOVA F -test for a normal linear model.

3.3.4 Interaction at any time


A very traditional approach taken in many statistics textbooks would be to specify our ex-
periment in terms of a factorial model:
> design <- [Link](~Treat * Time, data=targets)

which is equivalent to

37
edgeR User’s Guide

> design <- [Link](~Treat + Time + Treat:Time, data=targets)


> fit <- glmQLFit(y, design)

While the factorial model has a long history in statistics, the coefficients are more difficult
to interpret than for the design matrices in Sections 3.3.1 or 3.3.2 and the coefficients are
generally less biologically meaningful.
In the factorial model, the coefficient names are:
> colnames(design)

[1] "(Intercept)" "TreatDrug" "Time1h" "Time2h"


[5] "TreatDrug:Time1h" "TreatDrug:Time2h"

Now
> qlf <- glmQLFTest(fit, coef=2)

is again the baseline drug vs placebo comparison at 0 hours, but


> qlf <- glmQLFTest(fit, coef=3)

and
> qlf <- glmQLFTest(fit, coef=4)

are the effects of the reference drug, i.e., the effects of the placebo at 1 hour and 2 hours.
In most experimental studies, none of the above three tests are would be of any particular
scientific interest.
The factorial formula is primarily useful as a way to conduct an overall test for interaction. The
last two coefficients correspond to the interaction contrasts (Drug.1h-Placebo.1h)-(Drug.0h-
Placebo.0h) and (Drug.2h-Placebo.2h)-(Drug.0h-Placebo.0h) respectively, which are the same
as the contrasts DrugvsPlacebo.1h and DrugvsPlacbo.2h defined in Section 3.3.1. Hence
> qlf <- glmQLFTest(fit, coef=5:6)

is useful because it detects genes that respond differently to the drug, relative to the placebo,
at either of the times. In other words, specifying coef=5:6 in the GLM test is a way to test
for interaction between treatment without having to form the interaction contrasts explicitly.
The results will be the same as if we had specified
> qlf <- glmQLFTest(fit, contrast=[Link][,"DrugvsPlacebo.1h","DrugvsPlacebo.2h"])

in Section 3.3.1.

38
edgeR User’s Guide

3.4 Additive models and blocking


3.4.1 Paired samples
Paired samples occur whenever we compare two treatments and each independent subject
in the experiment receives both treatments. Suppose for example that an experiment is
conducted to compare a new treatment (T) with a control (C). Suppose that both the
control and the treatment are administered to each of three patients. This produces the
sample data:
FileName Subject Treatment
File1 1 C
File2 1 T
File3 2 C
File4 2 T
File5 3 C
File6 3 T
This is a paired design in which each subject receives both the control and the active treat-
ment. We can therefore compare the treatment to the control for each patient separately, so
that baseline differences between the patients are subtracted out.
The design matrix is formed from an additive model formula without an interaction term:
> Subject <- factor(targets$Subject)
> Treat <- factor(targets$Treatment, levels=c("C","T"))
> design <- [Link](~Subject+Treat)

The omission of an interaction term is characteristic of paired designs. We are not interested
in the effect of the treatment on an individual patient (which is what an interaction term
would examine). Rather we are interested in the average effect of the treatment over a
population of patients.
As always, the dispersion has to be estimated:
> y <- estimateDisp(y,design)

We proceed to fit a linear model and test for the treatment effect. Note that we can omit
the coef argument to glmQLFTest because the treatment effect is the last coefficient in the
model.
> fit <- glmQLFit(y, design)
> qlf <- glmQLFTest(fit)
> topTags(qlf)

This test detects genes that are differentially expressed in response to the active treatment
compared to the control, adjusting for baseline differences between the patients. This test
can be viewed as a generalization of a paired t-test.
See the oral carcinomas case study of Section 4.1 for a fully worked analysis with paired
samples.

39
edgeR User’s Guide

3.4.2 Blocking
Paired samples are a simple example of what is called “blocking” in experimental design. The
idea of blocking is to compare treatments using experimental subjects that are as similar as
possible, so that the treatment difference stands out as clearly as possible.
Suppose for example that we wish to compare three treatments A, B and C using experimental
animals. Suppose that animals from the same litter are appreciably more similar than animals
from different litters. This might lead to an experimental setup like:
FileName Litter Treatment
File1 1 A
File2 1 B
File3 1 C
File4 2 B
File5 2 A
File6 2 C
File7 3 C
File8 3 B
File9 3 A
Here it is the differences between the treatments that are of interest. The differences between
the litters are not of primary interest, nor are we interested in a treatment effect that occurs
for in only one litter, because that would not be reproducible.
We can compare the three treatments adjusting for any baseline differences between the
litters by fitting an additive model:
> Litter <- factor(targets$Litter)
> Treatment <- factor(targets$Treatment)
> design <- [Link](~Litter+Treatment)

This creates a design matrix with five columns: three for the litters and two more for the
differences between the treatments.
If fit is the fitted model with this design matrix, then we may proceed as follows. To detect
genes that are differentially expressed between any of the three treatments, adjusting for litter
differences:
> qlf <- glmQLFTest(fit, coef=4:5)
> topTags(qlf)

To detect genes that are differentially expressed in treatment B vs treatment A:


> qlf <- glmQLFTest(fit, coef=4)
> topTags(qlf)

To detect genes that are differentially expressed in treatment C vs treatment A:


> qlf <- glmQLFTest(fit, coef=5)
> topTags(qlf)

To detect genes that are differentially expressed in treatment C vs treatment B:


> qlf <- glmQLFTest(fit, contrast=c(0,0,0,-1,1))
> topTags(qlf)

40
edgeR User’s Guide

The advantage of using litter as a blocking variable in the analysis is that this will make the
comparison between the treatments more precise, if litter-mates are more alike than animals
from different litters. On the other hand, if litter-mates are no more alike than animals
from different litters, which might be so for genetically identical inbred laboratory animals,
then the above analysis is somewhat inefficient because the litter effects are being estimated
unnecessarily. In that case, it would be better to omit litter from the model formula.

3.4.3 Batch effects


Another situation in which additive model formulas are used is when correcting for batch
effects in an experiment. The situation here is analogous to blocking, the only difference
being that the batch effects were probably unintended rather than a deliberate aspect of
the experimental design. The analysis is the same as for blocking. The treatments can be
adjusted for differences between the batches by using an additive model formula of the form:

> design <- [Link](~Batch+Treatment)

In this type of analysis, the treatments are compared only within each batch. The analysis is
corrected for baseline differences between the batches.
The Arabidopsis case study in Section 4.2 gives a fully worked example with batch effects.

3.5 Comparisons both between and within subjects


Here is a more complex scenario, posed by a poster to the Bioconductor mailing list. The
experiment has 18 RNA samples collected from 9 subjects. The samples correspond to
3 healthy patients, 3 patients with Disease 1 and 3 patients with Disease 2. Each patient
received two treatments, an active treatment with a hormone and a control treatment without
the hormone. The targets frame looks like this:
> targets

Disease Patient Treatment


1 Healthy 1 None
2 Healthy 1 Hormone
3 Healthy 2 None
4 Healthy 2 Hormone
5 Healthy 3 None
6 Healthy 3 Hormone
7 Disease1 4 None
8 Disease1 4 Hormone
9 Disease1 5 None
10 Disease1 5 Hormone
11 Disease1 6 None
12 Disease1 6 Hormone
13 Disease2 7 None
14 Disease2 7 Hormone
15 Disease2 8 None
16 Disease2 8 Hormone
17 Disease2 9 None
18 Disease2 9 Hormone

41
edgeR User’s Guide

If all the RNA samples were collected from independent subjects, then this would be a
nested factorial experiment, from which we would want to estimate the treatment effect for
each disease group. As it is, however, we have a paired comparison experiment for each
disease group. The feature that makes this experiment complex is that some comparisons
(those between the diseases) are made between patients while other comparisons (hormone
treatment vs no treatment) are made within patients.
This type of experiment is sometimes called a multilevel design or a repeated measures
design. The repeated measures refer to the multiple measurements made on each patient.
The experiment is multilevel in the sense that there are two error levels, one between patients
and one for the repeat measurements within patients. The repeated measurements made on
each patient will typically be more similar to each other than measurements made on different
patients. Hence the variability within patients is typically lower than that between patients.
The easiest way to approach this design is to view it as three paired-comparison experiments,
one for each disease group. We can compare the hormone treatment to the control treatment
separately for each disease group, then contrast how effect the hormone is between the three
disease groups.
For we define the experimental factors:
> Patient <- factor(targets$Patient)
> Disease <- factor(targets$Disease, levels=c("Healthy","Disease1","Disease2"))
> Treatment <- factor(targets$Treatment, levels=c("None","Hormone"))

We need to adjust for baseline differences between the patients, so the first step is to initialize
the design matrix with patient effects:
> design <- [Link](~Patient)

Then we define disease-specific treatment effects and append them to the design matrix:
> [Link] <- Disease== "Healthy" & Treatment=="Hormone"
> [Link] <- Disease=="Disease1" & Treatment=="Hormone"
> [Link] <- Disease=="Disease2" & Treatment=="Hormone"
> design <- cbind(design, [Link], [Link], [Link])

After estimating the dispersions (code not shown), we can fit a linear model:
> fit <- glmQLFit(y, design)

To find genes responding to the hormone in Healthy patients:


> qlf <- glmQLFTest(fit, coef="[Link]")
> topTags(qlf)

To find genes responding to the hormone in Disease1 patients:


> qlf <- glmQLFTest(fit, coef="[Link]")
> topTags(qlf)

To find genes responding to the hormone in Disease2 patients:


> qlf <- glmQLFTest(fit, coef="[Link]")
> topTags(qlf)

42
edgeR User’s Guide

To find genes that respond to the hormone in any disease group:


> qlf <- glmQLFTest(fit, coef=10:12)
> topTags(qlf)

To find genes that respond differently to the hormone in Disease1 vs Healthy patients:
> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0,0,0,0,0,0,-1,1,0))
> topTags(qlf)

To find genes that respond differently to the hormone in Disease2 vs Healthy patients:
> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0,0,0,0,0,0,-1,0,1))
> topTags(qlf)

To find genes that respond differently to the hormone in Disease2 vs Disease1 patients:
> qlf <- glmQLFTest(fit, contrast=c(0,0,0,0,0,0,0,0,0,0,-1,1))
> topTags(qlf)

43
Chapter 4

Case studies

4.1 RNA-Seq of oral carcinomas vs matched normal


tissue
4.1.1 Introduction
This section provides a detailed analysis of data from a paired design RNA-seq experiment,
featuring oral squamous cell carcinomas and matched normal tissue from three patients [40].
The aim of the analysis is to detect genes differentially expressed between tumor and normal
tissue, adjusting for any differences between the patients. This provides an example of the
GLM capabilities of edgeR.
RNA was sequenced on an Applied Biosystems SOLiD System 3.0 and reads mapped to
the UCSC hg18 reference genome [40]. Read counts, summarised at the level of refSeq
transcripts, are available in Table S1 of Tuch et al. [40].

4.1.2 Reading in the data


The read counts for the six individual libraries are stored in one tab-delimited file. To make
this file, we downloaded Table S1 from Tuch et al. [40], deleted some unnecessary columns
and edited the column headings slightly:
> rawdata <- [Link]("[Link]", [Link]=FALSE, stringsAsFactors=FALSE)

> head(rawdata)

RefSeqID Symbol NbrOfExons 8N 8T 33N 33T 51N 51T


1 NM_182502 TMPRSS11B 10 2592 3 7805 321 3372 9
2 NM_003280 TNNC1 6 1684 0 1787 7 4894 559
3 NM_152381 XIRP2 10 9915 15 10396 48 23309 7181
4 NM_022438 MAL 3 2496 2 3585 239 1596 7
_
5 NM 001100112 MYH2 40 4389 7 7944 16 9262 1818
6 NM_017534 MYH2 40 4402 7 7943 16 9244 1815

For easy manipulation, we put the data into a DGEList object:

44
edgeR User’s Guide

> library(edgeR)
> y <- DGEList(counts=rawdata[,4:9], genes=rawdata[,1:3])

4.1.3 Annotation
The study by Tuch et al. [40] was undertaken a few years ago, so not all of the RefSeq IDs
provided by match RefSeq IDs currently in use. We retain only those transcripts with IDs in
the current NCBI annotation, which is provided by the [Link] package:
> library([Link])
> idfound <- y$genes$RefSeqID %in% mappedRkeys([Link])
> y <- y[idfound,]
> dim(y)

[1] 15537 6

We add Entrez Gene IDs to the annotation:


> egREFSEQ <- toTable([Link])
> head(egREFSEQ)

gene_id accession
1 1 NM_130786
2 1 NP_570602
3 2 NM_000014
4 2 NM_001347423
5 2 NM_001347424
6 2 NM_001347425

> m <- match(y$genes$RefSeqID, egREFSEQ$accession)


> y$genes$EntrezGene <- egREFSEQ$gene_id[m]

Now use the Entrez Gene IDs to update the gene symbols:
> egSYMBOL <- toTable([Link])
> head(egSYMBOL)

gene_id symbol
1 1 A1BG
2 2 A2M
3 3 A2MP1
4 9 NAT1
5 10 NAT2
6 11 NATP

> m <- match(y$genes$EntrezGene, egSYMBOL$gene_id)


> y$genes$Symbol <- egSYMBOL$symbol[m]
> head(y$genes)

RefSeqID Symbol NbrOfExons EntrezGene


1 NM_182502 TMPRSS11B 10 132724
2 NM_003280 TNNC1 6 7134
3 NM_152381 XIRP2 10 129446
4 NM_022438 MAL 3 4118

45
edgeR User’s Guide

5 NM_001100112 MYH2 40 4620


6 NM_017534 MYH2 40 4620

4.1.4 Filtering and normalization


Different RefSeq transcripts for the same gene symbol count predominantly the same reads.
So we keep one transcript for each gene symbol. We choose the transcript with highest
overall count:
> o <- order(rowSums(y$counts), decreasing=TRUE)
> y <- y[o,]
> d <- duplicated(y$genes$Symbol)
> y <- y[!d,]
> nrow(y)

[1] 10511

Normally we would also filter lowly expressed genes. For this data, all transcripts already
have at least 50 reads for all samples of at least one of the tissues types.
Recompute the library sizes:
> y$samples$[Link] <- colSums(y$counts)

Use Entrez Gene IDs as row names:


> rownames(y$counts) <- rownames(y$genes) <- y$genes$EntrezGene
> y$genes$EntrezGene <- NULL

TMM normalization is applied to this dataset to account for compositional difference between
the libraries.
> y <- calcNormFactors(y)
> y$samples

group [Link] [Link]


8N 1 7989590 1.146
8T 1 7371094 1.086
33N 1 15754732 0.672
33T 1 14043341 0.973
51N 1 21540545 1.032
51T 1 15193150 1.190

4.1.5 Data exploration


The first step of an analysis should be to examine the samples for outliers and for other
relationships. The function plotMDS produces a plot in which distances between samples
correspond to leading biological coefficient of variation (BCV) between those samples:
> plotMDS(y)

46
edgeR User’s Guide

2.0
51T

1.5
Leading logFC dim 2 (18%)

1.0
0.5
0.0 51N

8T

8N
−1.0

33T
33N

−3 −2 −1 0 1 2

Leading logFC dim 1 (56%)

In the plot, dimension 1 separates the tumor from the normal samples, while dimension 2
roughly corresponds to patient number. This confirms the paired nature of the samples. The
tumor samples appear more heterogeneous than the normal samples.

4.1.6 The design matrix


Before we fit negative binomial GLMs, we need to define our design matrix based on the
experimental design. Here we want to test for differential expression between tumour and
normal tissues within patients, i.e. adjusting for differences between patients. In statistical
terms, this is an additive linear model with patient as the blocking factor:
> Patient <- factor(c(8,8,33,33,51,51))
> Tissue <- factor(c("N","T","N","T","N","T"))
> [Link](Sample=colnames(y),Patient,Tissue)

Sample Patient Tissue


1 8N 8 N
2 8T 8 T
3 33N 33 N
4 33T 33 T
5 51N 51 N
6 51T 51 T

> design <- [Link](~Patient+Tissue)


> rownames(design) <- colnames(y)
> design

(Intercept) Patient33 Patient51 TissueT


8N 1 0 0 0
8T 1 0 0 1
33N 1 1 0 0
33T 1 1 0 1
51N 1 0 1 0
51T 1 0 1 1

47
edgeR User’s Guide

attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Patient
[1] "[Link]"

attr(,"contrasts")$Tissue
[1] "[Link]"

This sort of additive model is appropriate for paired designs, or experiments with batch effects.

4.1.7 Estimating the dispersion


We estimate the NB dispersion for the dataset.
> y <- estimateDisp(y, design, robust=TRUE)
> y$[Link]

[1] 0.159

The square root of the common dispersion gives the coefficient of variation of biological
variation. Here the common dispersion is found to be 0.159, so the coefficient of biological
variation is around 0.4.
The dispersion estimates can be viewed in a BCV plot:
> plotBCV(y)

4.1.8 Differential expression


Now proceed to determine differentially expressed genes. Fit genewise glms:

48
edgeR User’s Guide

> fit <- glmFit(y, design)

Conduct likelihood ratio tests for tumour vs normal tissue differences and show the top genes:

> lrt <- glmLRT(fit)


> topTags(lrt)

Coefficient: TissueT
RefSeqID Symbol NbrOfExons logFC logCPM LR PValue FDR
5737 NM_001039585 PTGFR 4 -5.18 4.74 98.7 2.96e-23 3.11e-19
5744 NM_002820 PTHLH 4 3.97 6.21 92.2 7.93e-22 4.17e-18
3479 NM_001111283 IGF1 5 -3.99 5.71 86.5 1.38e-20 4.84e-17
1288 NM_033641 COL4A6 45 3.66 5.72 77.6 1.29e-18 3.38e-15
10351 NM_007168 ABCA8 38 -3.98 4.94 75.9 2.97e-18 6.24e-15
5837 NM_005609 PYGM 20 -5.48 5.99 75.3 3.97e-18 6.96e-15
487 NM_004320 ATP2A1 23 -4.62 5.96 74.8 5.25e-18 7.88e-15
27179 NM_014440 IL36A 4 -6.17 5.40 72.2 1.94e-17 2.55e-14
196374 NM_173352 KRT78 9 -4.25 7.61 70.8 3.94e-17 4.61e-14
83699 NM_031469 SH3BGRL2 4 -3.93 5.53 67.8 1.85e-16 1.94e-13

Note that glmLRT has conducted a test for the last coefficient in the linear model, which we
can see is the tumor vs normal tissue effect:
> colnames(design)

[1] "(Intercept)" "Patient33" "Patient51" "TissueT"

The genewise tests are for tumor vs normal differential expression, adjusting for baseline
differences between the three patients. The tests can be viewed as analogous to paired
t-tests. The top DE tags have tiny p-values and FDR values, as well as large fold changes.
Here’s a closer look at the counts-per-million in individual samples for the top genes:
> o <- order(lrt$table$PValue)
> cpm(y)[o[1:10],]

8N 8T 33N 33T 51N 51T


5737 49.69 0.875 27.10 0.878 78.10 2.5437
5744 7.32 95.853 11.80 204.168 6.88 116.3454
3479 50.23 3.124 32.39 1.902 211.59 14.2114
1288 12.12 140.217 6.33 94.440 4.86 56.8455
10351 52.63 3.124 39.47 2.121 79.18 6.0827
5837 152.77 2.749 119.63 1.170 97.67 5.6956
487 107.89 3.124 147.11 3.804 102.80 8.9029
27179 40.08 1.250 172.22 3.292 36.08 0.0553
196374 372.16 20.745 581.44 47.768 145.05 4.5344
83699 96.21 5.124 117.18 5.413 48.19 5.4191

We see that all the top genes have consistent tumour vs normal changes for the three patients.
The total number of differentially expressed genes at 5% FDR is given by:
> summary(decideTests(lrt))

49
edgeR User’s Guide

TissueT
Down 938
NotSig 9241
Up 332

Plot log-fold change against log-counts per million, with DE genes highlighted:
> plotMD(lrt)
> abline(h=c(-1, 1), col="blue")

The blue lines indicate 2-fold changes.

4.1.9 Gene ontology analysis


We perform a gene ontology analysis focusing on the ontology of biological process (BP).
The genes up-regulated in the tumors tend to be associated with cell differentiation, cell
migration and tissue morphogenesis:
> go <- goana(lrt)
> topGO(go, ont="BP", sort="Up", n=30, truncate=30)

Term Ont N Up Down [Link] [Link]


GO:0022008 neurogenesis BP 954 70 103 1.02e-11 2.13e-02
GO:0040011 locomotion BP 1089 75 164 3.41e-11 2.08e-12
GO:0048699 generation of neurons BP 883 65 96 5.79e-11 2.18e-02
GO:0006928 movement of cell or subcell... BP 1269 82 195 8.29e-11 1.06e-15
GO:0009888 tissue development BP 1188 78 184 1.29e-10 3.93e-15
GO:0016477 cell migration BP 924 66 145 1.48e-10 2.19e-12
GO:0022610 biological adhesion BP 884 64 151 1.70e-10 4.39e-16
GO:0048869 cellular developmental proc... BP 2429 127 301 2.28e-10 2.49e-11
GO:0007155 cell adhesion BP 879 63 150 3.70e-10 6.13e-16
GO:0030154 cell differentiation BP 2371 124 296 4.31e-10 1.64e-11
GO:0048870 cell motility BP 993 68 149 4.60e-10 3.52e-11

50
edgeR User’s Guide

GO:0051674 localization of cell BP 993 68 149 4.60e-10 3.52e-11


GO:0030198 extracellular matrix organi... BP 259 30 53 6.33e-10 5.94e-09
GO:0043062 extracellular structure org... BP 259 30 53 6.33e-10 5.94e-09
GO:0045229 external encapsulating stru... BP 261 30 54 7.63e-10 2.82e-09
GO:0030182 neuron differentiation BP 793 58 88 9.88e-10 1.71e-02
GO:0007399 nervous system development BP 1358 83 145 9.99e-10 9.80e-03
GO:0009653 anatomical structure morpho... BP 1615 93 223 1.60e-09 9.34e-13
GO:0048513 animal organ development BP 2033 108 279 4.76e-09 5.95e-16
GO:0007275 multicellular organism deve... BP 3052 144 370 1.15e-08 4.80e-13
GO:0060429 epithelium development BP 730 52 95 2.05e-08 8.60e-05
GO:0048731 system development BP 2767 133 351 2.09e-08 3.41e-15
GO:0048468 cell development BP 1210 73 170 2.42e-08 2.65e-10
GO:0008283 cell population proliferati... BP 1131 69 139 4.20e-08 3.40e-05
GO:0048856 anatomical structure develo... BP 3334 151 402 6.88e-08 3.85e-14
GO:0043588 skin development BP 220 24 33 1.11e-07 2.06e-03
GO:0008544 epidermis development BP 237 25 35 1.16e-07 2.01e-03
GO:0032501 multicellular organismal pr... BP 3929 169 501 2.36e-07 9.92e-26
GO:0009887 animal organ morphogenesis BP 593 43 81 2.46e-07 5.71e-05
GO:0032502 developmental process BP 3620 158 415 3.53e-07 4.58e-11

4.1.10 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets
[8] methods base

other attached packages:


[1] [Link].db_3.13.0 AnnotationDbi_1.53.1 IRanges_2.25.11
[4] S4Vectors_0.29.19 Biobase_2.51.0 BiocGenerics_0.37.5
[7] edgeR_3.33.5 _
limma 3.47.15 knitr_1.33
[10] BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 XVector_0.31.1 compiler_4.1.0
[4] BiocManager_1.30.13.1 highr_0.9 zlibbioc_1.37.0
[7] tools_4.1.0 statmod_1.4.36 digest_0.6.27

51
edgeR User’s Guide

[10] bit_4.0.4 evaluate_0.14 RSQLite_2.2.7


[13] memoise_2.0.0 lattice_0.20-44 pkgconfig_2.0.3
[16] png_0.1-7 rlang_0.4.11 DBI_1.1.1
[19] yaml_2.2.1 xfun_0.22 fastmap_1.1.0
[22] stringr_1.4.0 httr_1.4.2 Biostrings_2.59.3
[25] vctrs_0.3.8 locfit_1.5-9.4 bit64_4.0.5
[28] grid_4.1.0 R6_2.5.0 rmarkdown_2.8
[31] GO.db_3.13.0 blob_1.2.1 magrittr_2.0.1
[34] splines_4.1.0 htmltools_0.5.1.1 KEGGREST_1.31.2
[37] stringi_1.6.1 cachem_1.0.4 crayon_1.4.1

4.2 RNA-Seq of pathogen inoculated arabidopsis with


batch effects
4.2.1 Introduction
This case study re-analyses Arabidopsis thaliana RNA-Seq data described by Cumbie et al.
[6]. Summarized count data is available as a data object in the CRAN package NBPSeq
comparing ∆hrcC challenged and mock-inoculated samples [6]. Samples were collected in
three batches, and adjustment for batch effects proves to be important. The aim of the
analysis therefore is to detect genes differentially expressed in response to ∆hrcC challenge,
while correcting for any differences between the batches.

4.2.2 RNA samples


Pseudomonas syringae is a bacterium often used to study plant reactions to pathogens. In
this experiment, six-week old Arabidopsis plants were inoculated with the ∆hrcC mutant of
P. syringae, after which total RNA was extracted from leaves. Control plants were inoculated
with a mock pathogen.
Three biological replicates of the experiment were conducted at separate times and using
independently grown plants and bacteria.
The six RNA samples were sequenced one per lane on an Illumina Genome Analyzer. Reads
were aligned and summarized per gene using GENE-counter. The reference genome was
derived from the TAIR9 genome release ([Link]).

4.2.3 Loading the data


The data is in the NBPSeq package which does not work in R after version 3.5.0. We loaded
an earlier version of NBPSeq and saved the data in an RDS file. The RDS file is available
here. We then read in the RDS file for our analysis.
> library(edgeR)

Loading required package: limma

> arab <- readRDS("[Link]")


> head(arab)

52
edgeR User’s Guide

mock1 mock2 mock3 hrcc1 hrcc2 hrcc3


AT1G01010 35 77 40 46 64 60
AT1G01020 43 45 32 43 39 49
AT1G01030 16 24 26 27 35 20
AT1G01040 72 43 64 66 25 90
AT1G01050 49 78 90 67 45 60
AT1G01060 0 15 2 0 21 8

There are two experimental factors, treatment (hrcc vs mock) and the time that each replicate
was conducted:
> Treat <- factor(substring(colnames(arab),1,4))
> Treat <- relevel(Treat, ref="mock")
> Time <- factor(substring(colnames(arab),5,5))

We then create a DGEList object:


> y <- DGEList(counts=arab, group=Treat)

4.2.4 Filtering and normalization


There is no purpose in analysing genes that are not expressed in either experimental condition,
so genes are first filtered on expression levels.
> keep <- filterByExpr(y)
> table(keep)

keep
FALSE TRUE
12292 13930

> y <- y[keep, , [Link]=FALSE]

The TMM normalization is applied to account for the compositional biases:


> y <- calcNormFactors(y)
> y$samples

group [Link] [Link]


mock1 mock 1882391 0.977
mock2 mock 1870625 1.023
mock3 mock 3227243 0.914
hrcc1 hrcc 2101449 1.058
hrcc2 hrcc 1243266 1.083
hrcc3 hrcc 3494821 0.955

4.2.5 Data exploration


An MDS plot shows the relative similarities of the six samples.
> plotMDS(y, col=rep(1:2, each=3))

53
edgeR User’s Guide

mock2

1.5
Leading logFC dim 2 (29%)

1.0
0.5 mock1
mock3
−0.5 0.0

hrcc2
hrcc1
−1.5

hrcc3

−2.0 −1.5 −1.0 −0.5 0.0 0.5 1.0 1.5

Leading logFC dim 1 (38%)

Distances on an MDS plot of a DGEList object correspond to leading log-fold-change between


each pair of samples. Leading log-fold-change is the root-mean-square average of the largest
log2 -fold-changes between each pair of samples. Each pair of samples extracted at each time
tend to cluster together, suggesting a batch effect. The hrcc treated samples tend to be
below the mock samples for each time, suggesting a treatment effect within each time. The
two samples at time 1 are less consistent than at times 2 and 3.
To examine further consistency of the three replicates, we compute predictive log2-fold-
changes (logFC) for the treatment separately for the three times.
> design <- [Link](~Time+Time:Treat)
> logFC <- predFC(y,design,[Link]=1,dispersion=0.05)

The logFC at the three times are positively correlated with one another, as we would hope:
> cor(logFC[,4:6])

Time1:Treathrcc Time2:Treathrcc Time3:Treathrcc


Time1:Treathrcc 1.000 0.397 0.497
Time2:Treathrcc 0.397 1.000 0.516
Time3:Treathrcc 0.497 0.516 1.000

The correlation is highest between times 2 and 3.

4.2.6 The design matrix


Before we fit GLMs, we need to define our design matrix based on the experimental design.
We want to test for differential expressions between ∆hrcC challenged and mock-inoculated
samples within batches, i.e. adjusting for differences between batches. In statistical terms,
this is an additive linear model. So the design matrix is created as:
> design <- [Link](~Time+Treat)
> rownames(design) <- colnames(y)
> design

54
edgeR User’s Guide

(Intercept) Time2 Time3 Treathrcc


mock1 1 0 0 0
mock2 1 1 0 0
mock3 1 0 1 0
hrcc1 1 0 0 1
hrcc2 1 1 0 1
hrcc3 1 0 1 1
attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Time
[1] "[Link]"

attr(,"contrasts")$Treat
[1] "[Link]"

4.2.7 Estimating the dispersion


Estimate the genewise dispersion estimates over all genes, allowing for a possible abundance
trend. The estimation is also robustified against potential outlier genes.
> y <- estimateDisp(y, design, robust=TRUE)
> y$[Link]

[1] 0.0638

> plotBCV(y)

The square root of dispersion is the coefficient of biological variation (BCV). The common
BCV is on the high side, considering that this is a designed experiment using genetically
identical plants. The trended dispersion shows a decreasing trend with expression level. At
low logCPM, the dispersions are very large indeed.

55
edgeR User’s Guide

Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
The QL dispersions can be estimated using the glmQLFit function, and then be visualized with
the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)

4.2.8 Differential expression


Now we test for significant differential expression in each gene using the QL F-test.
First we check whether there was a genuine need to adjust for the experimental times. We
do this by testing for differential expression between the three times. There is considerable
differential expression, justifying our decision to adjust for the batch effect:
> qlf <- glmQLFTest(fit, coef=2:3)
> topTags(qlf)

Coefficient: Time2 Time3


logFC.Time2 logFC.Time3 logCPM F PValue FDR
AT5G31702 5.87 -2.593 5.98 114.4 1.08e-08 0.000103
AT3G33004 4.85 -1.788 5.67 103.2 1.98e-08 0.000103
AT2G11230 3.54 -1.557 5.64 101.1 2.23e-08 0.000103
AT2G07782 3.53 -1.641 5.32 96.1 2.99e-08 0.000104
AT2G23910 3.64 -0.408 5.17 87.9 5.01e-08 0.000118
AT2G18193 3.10 -2.420 5.11 87.7 5.08e-08 0.000118
AT5G54830 3.12 -0.391 6.11 82.5 7.20e-08 0.000143
AT2G27770 2.52 -1.593 5.46 78.6 9.54e-08 0.000166
AT1G05680 2.12 -1.317 6.02 66.9 2.38e-07 0.000368
AT4G05635 3.21 -2.479 4.80 62.2 3.59e-07 0.000501

> FDR <- [Link](qlf$table$PValue, method="BH")


> sum(FDR < 0.05)

56
edgeR User’s Guide

[1] 1370

Now conduct QL F-tests for the pathogen effect and show the top genes. By default, the
test is for the last coefficient in the design matrix, which in this case is the treatment effect:

> qlf <- glmQLFTest(fit)


> topTags(qlf)

Coefficient: Treathrcc
logFC logCPM F PValue FDR
AT2G19190 4.48 7.38 308 4.22e-10 5.20e-06
AT2G39530 4.32 6.71 280 7.46e-10 5.20e-06
AT2G39380 4.93 5.77 249 1.51e-09 5.97e-06
AT3G46280 4.77 8.10 243 1.72e-09 5.97e-06
AT1G51800 3.95 7.71 232 2.25e-09 6.28e-06
AT1G51850 5.30 5.42 208 4.29e-09 8.31e-06
AT2G44370 5.40 5.20 200 5.42e-09 8.31e-06
AT3G55150 5.76 4.91 198 5.78e-09 8.31e-06
AT1G51820 4.32 6.38 197 5.89e-09 8.31e-06
AT5G48430 6.30 6.74 197 5.97e-09 8.31e-06

Here’s a closer look at the individual counts-per-million for the top genes. The top genes are
very consistent across the three replicates:
> top <- rownames(topTags(qlf))
> cpm(y)[top,]

mock1 mock2 mock3 hrcc1 hrcc2 hrcc3


AT2G19190 16.853 12.54 13.22 341.7 262.2 344.9
AT2G39530 7.067 9.41 13.22 158.3 197.6 238.8
AT2G39380 2.175 3.14 4.75 91.7 86.9 132.8
AT3G46280 19.028 17.77 18.30 385.3 385.5 806.4
AT1G51800 29.357 17.25 30.50 362.8 358.0 455.8
AT1G51850 1.087 1.05 3.73 78.2 57.9 107.0
AT2G44370 2.175 1.05 1.69 57.1 69.1 84.5
AT3G55150 0.544 1.05 1.36 43.2 66.9 63.2
AT1G51820 9.786 7.84 6.10 121.4 161.2 187.9
AT5G48430 4.349 4.70 0.00 189.3 323.9 122.9

The total number of genes significantly up-regulated or down-regulated at 5% FDR is sum-


marized as follows:
> summary(decideTests(qlf))

Treathrcc
Down 919
NotSig 12125
Up 886

We can plot all the logFCs against average count size, highlighting the DE genes:
> plotMD(qlf)
> abline(h=c(-1,1), col="blue")

57
edgeR User’s Guide

The blue lines indicate 2-fold up or down.

4.2.9 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] stats graphics grDevices utils datasets methods base

other attached packages:


[1] edgeR_3.33.5 limma_3.47.15 knitr_1.33 BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 locfit_1.5-9.4 lattice_0.20-44
[4] digest_0.6.27 grid_4.1.0 magrittr_2.0.1
[7] evaluate_0.14 highr_0.9 rlang_0.4.11
[10] stringi_1.6.1 rmarkdown_2.8 splines_4.1.0
[13] statmod_1.4.36 tools_4.1.0 stringr_1.4.0
[16] xfun_0.22 yaml_2.2.1 compiler_4.1.0
[19] BiocManager_1.30.13.1 htmltools_0.5.1.1

58
edgeR User’s Guide

4.3 Profiles of Yoruba HapMap individuals


4.3.1 Background
RNA-Seq profiles were made of cell lines derived from lymphoblastoid cells from 69 different
Yoruba individuals from Ibadan, Nigeria [29] [30]. The profiles were generated as part of
the International HapMap project [16]. RNA from each individual was sequenced on at least
two lanes of an Illumina Genome Analyser 2, and mapped reads to the human genome using
MAQ v0.6.8.
The study group here is essentially an opportunity sample and the individuals are likely to be
genetically diverse. In this analysis we look at genes that are differentially expressed between
males and female.

4.3.2 Loading the data


Read counts summarized by Ensembl gene identifiers are available in the tweeDEseqCount-
Data package:
> library(tweeDEseqCountData)
> data(pickrell1)
> Counts <- exprs([Link])
> dim(Counts)

[1] 38415 69

> Counts[1:5,1:5]

NA18486 NA18498 NA18499 NA18501 NA18502


ENSG00000127720 6 32 14 35 14
ENSG00000242018 20 21 24 22 16
ENSG00000224440 0 0 0 0 0
ENSG00000214453 0 0 0 0 0
ENSG00000237787 0 0 1 0 0

In this analysis we will compare female with male individuals.


> Gender <- [Link]$gender
> table(Gender)

Gender
female male
40 29

> rm([Link])

Annotation for each Ensemble gene is also available from the tweeDEseqCountData package:

> data(annotEnsembl63)
> annot <- annotEnsembl63[,c("Symbol","Chr")]
> annot[1:5,]

Symbol Chr
ENSG00000252775 U7 5

59
edgeR User’s Guide

ENSG00000207459 U6 5
ENSG00000252899 U7 5
ENSG00000201298 U6 5
ENSG00000222266 U6 5

> rm(annotEnsembl63)

Form a DGEList object combining the counts and associated annotation:


> library(edgeR)
> y <- DGEList(counts=Counts, genes=annot[rownames(Counts),])

4.3.3 Filtering and normalization


Keep genes that are expressed in a worthwhilte number of samples:
> isexpr <- filterByExpr(y, group=Gender)
> table(isexpr)

isexpr
FALSE TRUE
20226 18189

Keep only genes with defined annotation, and recompute library sizes:
> hasannot <- rowSums([Link](y$genes))==0
> y <- y[isexpr & hasannot, , [Link]=FALSE]
> dim(y)

[1] 17517 69

The library sizes vary from about 5 million to over 15 million:


> barplot(y$samples$[Link]*1e-6, names=1:69, ylab="Library size (millions)")
Library size (millions)

8 12
4
0

1 3 5 7 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69

Apply TMM normalization to account for the composition biases:


> y <- calcNormFactors(y)
> head(y$samples)

group [Link] [Link]


NA18486 1 7750614 0.929
NA18498 1 13614927 1.096

60
edgeR User’s Guide

NA18499 1 8570996 0.958


NA18501 1 8596932 1.194
NA18502 1 13377004 0.942
NA18504 1 9883172 0.983

4.3.4 Estimating the dispersion


We are interested in the differences between male and female. Hence, we create a design
matrix using the gender factor. We estimate the NB dispersion using estimateDisp. The
estimation is robustified against potential outlier genes.
> design <- [Link](~Gender)
> y <- estimateDisp(y, design, robust=TRUE)
> plotBCV(y)

We then estimate the QL dispersions around the dispersion trend using glmQLFit. The large
number of cases and the high variability means that the QL dispersions are not squeezed very
heavily from the raw values:
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)

61
edgeR User’s Guide

4.3.5 Differential expression


Now find genes differentially expressed between male and females. Positive log-fold-changes
mean higher expression in males. The highly ranked genes are mostly on the X or Y chromo-
somes. Top ranked is the famous XIST gene, which is known to be expressed only in females.

> qlf <- glmQLFTest(fit)


> topTags(qlf,n=15)

Coefficient: Gendermale
Symbol Chr logFC logCPM F PValue FDR
ENSG00000229807 XIST X -9.48 7.249 1209 1.11e-46 1.95e-42
ENSG00000099749 CYorf15A Y 4.28 1.757 858 1.10e-41 9.62e-38
ENSG00000131002 CYorf15B Y 5.63 2.056 584 3.13e-36 1.83e-32
ENSG00000157828 RPS4Y2 Y 3.17 4.208 577 4.65e-36 2.04e-32
ENSG00000233864 TTTY15 Y 4.84 1.254 536 4.71e-35 1.65e-31
ENSG00000198692 EIF1AY Y 2.36 3.247 376 2.84e-30 8.30e-27
ENSG00000165246 NLGN4Y Y 5.09 1.675 305 1.38e-27 3.45e-24
ENSG00000183878 UTY Y 1.86 3.137 254 2.60e-25 5.68e-22
ENSG00000243209 AC010889.1 Y 2.66 0.797 231 3.86e-24 7.51e-21
ENSG00000129824 RPS4Y1 Y 2.53 5.401 229 5.20e-24 9.11e-21
ENSG00000012817 KDM5D Y 1.47 4.949 226 6.64e-24 1.06e-20
ENSG00000213318 RP11-331F4.1 16 3.67 3.688 214 3.71e-23 5.41e-20
ENSG00000067048 DDX3Y Y 1.62 5.621 183 1.89e-21 2.55e-18
ENSG00000146938 NLGN4X X 3.94 1.047 140 1.52e-18 1.90e-15
ENSG00000232928 RP13-204A15.4 X 1.44 3.558 112 2.46e-16 2.87e-13

> summary(decideTests(qlf))

Gendermale
Down 46
NotSig 17450
Up 21

62
edgeR User’s Guide

4.3.6 Gene set testing


The tweeDEseqCountData package includes a list of genes belonging to the male-specific
region of chromosome Y, and a list of genes located in the X chromosome that have been
reported to escape X-inactivation. We expect genes in the first list to be up-regulated in
males, whereas genes in the second list should be up-regulated in females.
> data(genderGenes)
> Ymale <- rownames(y) %in% msYgenes
> Xescape <- rownames(y) %in% XiEgenes

Roast gene set tests by fry() confirm that the male-specific genes are significantly up as a
group in our comparison of males with females, whereas the X genes are significantly down
as a group [41].
> index <- list(Y=Ymale, X=Xescape)
> fry(y, index=index, design=design)

NGenes Direction PValue FDR [Link] [Link]


Y 12 Up 1.00e-45 2.01e-45 6.70e-11 6.70e-11
X 47 Down 6.93e-17 6.93e-17 1.26e-68 2.53e-68

A barcode plot can be produced to visualize the results. Genes are ranked from left to right
by decreasing log-fold-change in the background of the barcode plot. Genes in the set of
msYgenes are represented by red bars whereas genes in the set of XiEgenes are represented by
blue bars. The line above the barcode shows the relative local enrichment of the vertical
bars in each part of the plot. This particular plot suggests that the male-specific genes tend
to have large positive log-fold-changes, whereas the X genes tend to have large negative
log-fold-changes.
> barcodeplot(qlf$table$logFC, index[[1]], index[[2]])
0 Enrichment6.6

Down

Up
3.6Enrichment 0

−9.484

−0.206

−0.120

−0.065

−0.026

0.009

0.042

0.078

0.122

0.195

5.625

Statistic

The results from competitive camera gene sets tests are even more convincing [42]. The
positive intergene correlations here show that the genes in each set tend to be biologically
correlated:

63
edgeR User’s Guide

> camera(y, index, design)

NGenes Direction PValue FDR


Y 12 Up 1.32e-295 2.65e-295
X 47 Down 7.38e-25 7.38e-25

See where the X and Y genes fall on the MA plot:


> with(qlf$table, plot(logCPM,logFC,pch=16,cex=0.2))
> with(qlf$table, points(logCPM[Ymale],logFC[Ymale],pch=16,col="red"))
> with(qlf$table, points(logCPM[Xescape],logFC[Xescape],pch=16,col="dodgerblue"))
> legend("bottomleft",legend=c("Ymale genes","Xescape genes"),
+ pch=16,col=c("red","dodgerblue"))

4.3.7 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats graphics grDevices utils datasets methods

64
edgeR User’s Guide

[8] base

other attached packages:


[1] edgeR_3.33.5 limma_3.47.15
[3] tweeDEseqCountData 1.29.0 Biobase_2.51.0
_
[5] BiocGenerics_0.37.5 knitr_1.33
_
[7] BiocStyle 2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 locfit_1.5-9.4 lattice_0.20-44
_
[4] digest 0.6.27 grid_4.1.0 magrittr_2.0.1
[7] evaluate_0.14 highr_0.9 rlang_0.4.11
[10] stringi_1.6.1 rmarkdown_2.8 splines_4.1.0
[13] statmod_1.4.36 tools_4.1.0 stringr_1.4.0
[16] xfun_0.22 yaml_2.2.1 compiler_4.1.0
[19] BiocManager_1.30.13.1 htmltools_0.5.1.1

4.4 RNA-Seq profiles of mouse mammary gland


4.4.1 Introduction
The RNA-Seq data of this case study is described in Fu et al. [12]. The sequence and count
data are publicly available from the Gene Expression Omnibus (GEO) at the series accession
number GSE60450. This study examines the expression profiles of basal stem-cell enriched
cells (B) and committed luminal cells (L) in the mammary gland of virgin, pregnant and
lactating mice. Six groups are present, with one for each combination of cell type and mouse
status. Each group contains two biological replicates. This is summarized in the table below,
where the basal and luminal cell types are abbreviated with B and L respectively.
> targets <- [Link]("[Link]", header=TRUE)

> targets

FileName GEOAccession CellType Status


1 [Link] GSM1480297 B virgin
2 [Link] GSM1480298 B virgin
3 [Link] GSM1480299 B pregnant
4 [Link] GSM1480300 B pregnant
5 [Link] GSM1480301 B lactate
6 [Link] GSM1480302 B lactate
7 [Link] GSM1480291 L virgin
8 [Link] GSM1480292 L virgin
9 [Link] GSM1480293 L pregnant
10 [Link] GSM1480294 L pregnant
11 [Link] GSM1480295 L lactate
12 [Link] GSM1480296 L lactate

The name of the file containing the read sequences for each library is also shown. Each file
is downloaded from the Sequence Read Archive and has an accession number starting with
SRR, e.g., SRR1552450 for the first library in targets.

65
edgeR User’s Guide

4.4.2 Read alignment and processing


Prior to read alignment, these files are converted into the FASTQ format using the fastq-dump
utility from the SRA Toolkit. See [Link] for how to
download and use the SRA Toolkit.
Before the differential expression analysis can proceed, these reads must be aligned to the
mouse genome and counted into annotated genes. This can be achieved with functions in the
Rsubread package [19]. We assume that an index of the mouse genome is already available -
if not, this can be constructed from a FASTA file of the genome sequence with the buildindex
command. In this example, we assume that the prefix for the index files is mm10. The reads
in each FASTQ file are then aligned to the mouse genome, as shown below.
> library(Rsubread)
> [Link] <- sub(".fastq", ".bam", targets$FileName)
> align("mm10", readfile1=targets$FileName, phredOffset=33,
+ input_format="FASTQ", output_file=[Link])

This produces a set of BAM files, where each file contains the read alignments for each library.
The mapped reads can be counted into mouse genes by using the featureCounts function. It
uses the exon intervals defined in the NCBI annotation of the mm10 genome.
> fc <- featureCounts([Link], [Link]="mm10")
> colnames(fc$counts) <- 1:12

> head(fc$counts)

1 2 3 4 5 6 7 8 9 10 11 12
497097 438 300 65 237 354 287 0 0 0 0 0 0
100503874 1 0 1 1 0 4 0 0 0 0 0 0
100038431 0 0 0 0 0 0 0 0 0 0 0 0
19888 1 1 0 0 0 0 10 3 10 2 0 0
20671 106 182 82 105 43 82 16 25 18 8 3 10
27395 309 234 337 300 290 270 560 464 489 328 307 342

The row names of the matrix represent the Entrez gene identifiers for each gene. In the
output from featureCounts, the column names of fc$counts are the output file names from
align. Here, we simplify them for brevity.

4.4.3 Count loading and annotation


We create a DGEList object as follows
> group <- factor(paste0(targets$CellType, ".", targets$Status))
> y <- DGEList(fc$counts, group=group)
> colnames(y) <- targets$GEO

Human-readable gene symbols can also be added to complement the Entrez identifiers for
each gene, using the annotation in the [Link] package.
> require([Link])
> Symbol <- mapIds([Link], keys=rownames(y), keytype="ENTREZID",
+ column="SYMBOL")
> y$genes <- [Link](Symbol=Symbol)

66
edgeR User’s Guide

4.4.4 Filtering and normalization


Here, a gene is only retained if it is expressed at a minimum level:
> keep <- filterByExpr(y)
> summary(keep)

Mode FALSE TRUE


logical 11210 15969

> y <- y[keep, , [Link]=FALSE]

TMM normalization is performed to eliminate composition biases between libraries.


> y <- calcNormFactors(y)
> y$samples

group [Link] [Link]


GSM1480297 [Link] 23219195 1.238
GSM1480298 [Link] 21769326 1.214
GSM1480299 [Link] 24092719 1.125
GSM1480300 [Link] 22657703 1.071
GSM1480301 [Link] 21522881 1.036
GSM1480302 [Link] 20009184 1.087
GSM1480291 [Link] 20385437 1.368
GSM1480292 [Link] 21699830 1.365
GSM1480293 [Link] 22236469 1.004
GSM1480294 [Link] 21983364 0.923
GSM1480295 [Link] 24720123 0.529
GSM1480296 [Link] 24653390 0.535

The performance of the TMM normalization procedure can be examined using mean-difference
(MD) plots. This visualizes the library size-adjusted log-fold change between two libraries
(the difference) against the average log-expression across those libraries (the mean). The fol-
lowing MD plot is generated by comparing sample 1 against an artificial library constructed
from the average of all other samples.
> plotMD(cpm(y, log=TRUE), column=1)
> abline(h=0, col="red", lty=2, lwd=2)

67
edgeR User’s Guide

Ideally, the bulk of genes should be centred at a log-fold change of zero. This indicates that
any composition bias between libraries has been successfully removed. This quality check
should be repeated by constructing a MD plot for each sample.

4.4.5 Data exploration


The data can be explored by generating multi-dimensional scaling (MDS) plots. This visu-
alizes the differences between the expression profiles of different samples in two dimensions.

> points <- c(0,1,2,15,16,17)


> colors <- rep(c("blue", "darkgreen", "red"), 2)
> plotMDS(y, col=colors[group], pch=points[group])
> legend("topleft", legend=levels(group), pch=points, col=colors, ncol=2)
3

[Link] [Link]
[Link] [Link]
[Link] [Link]
Leading logFC dim 2 (17%)

2
1
0
−1
−2

−3 −2 −1 0 1 2 3

Leading logFC dim 1 (65%)

68
edgeR User’s Guide

Replicate samples from the same group cluster together in the plot, while samples from
different groups form separate clusters. This indicates that the differences between groups
are larger than those within groups, i.e., differential expression is greater than the variance
and can be detected. The distance between basal samples on the left and luminal cells on
the right is about 6 units, corresponding to a leading fold change of about 64-fold (26 = 64)
between basal and luminal. The expression differences between virgin, pregnant and lactating
are greater for luminal cells than for basal.

4.4.6 The design matrix


The experimental design for this study can be parametrized with a one-way layout, whereby
one coefficient is assigned to each group. The design matrix contains the predictors for each
sample and and is constructed using the code below.
> design <- [Link](~ 0 + group)
> colnames(design) <- levels(group)
> design

[Link] [Link] [Link] [Link] [Link] [Link]


1 0 0 1 0 0 0
2 0 0 1 0 0 0
3 0 1 0 0 0 0
4 0 1 0 0 0 0
5 1 0 0 0 0 0
6 1 0 0 0 0 0
7 0 0 0 0 0 1
8 0 0 0 0 0 1
9 0 0 0 0 1 0
10 0 0 0 0 1 0
11 0 0 0 1 0 0
12 0 0 0 1 0 0
attr(,"assign")
[1] 1 1 1 1 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "[Link]"

4.4.7 Estimating the dispersion


The NB dispersion is estimated using the estimateDisp function. This returns the DGEList
object with additional entries for the estimated NB dispersions for all gene. These estimates
can be visualized with plotBCV, which shows the root-estimate, i.e., the biological coefficient
of variation for each gene.
> y <- estimateDisp(y, design, robust=TRUE)
> y$[Link]

[1] 0.0134

> plotBCV(y)

69
edgeR User’s Guide

Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
For the QL dispersions, estimation can be performed using the glmQLFit function. This returns
a DGEGLM object containing the estimated values of the GLM coefficients for each gene, as well
as the fitted mean-QL dispersion trend, the squeezed QL estimates and the prior degrees of
freedom (df). These can be visualized with the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> head(fit$coefficients)

[Link] [Link] [Link] [Link] [Link] [Link]


497097 -11.14 -12.02 -11.23 -19.0 -19.03 -19.0
20671 -12.77 -12.51 -12.15 -14.5 -14.31 -14.1
27395 -11.27 -11.30 -11.53 -10.6 -10.87 -10.9
18777 -10.15 -10.21 -10.77 -10.1 -10.39 -10.4
21399 -9.89 -9.74 -9.79 -10.2 -9.97 -10.0
58175 -16.16 -14.85 -15.99 -13.3 -12.29 -12.1

> plotQLDisp(fit)

70
edgeR User’s Guide

Setting robust=TRUE in glmQLFit is strongly recommended [28]. Setting robust=TRUE in estimate


Disp has no effect on the downstream analysis, but is nevertheless very useful as it identifies
genes that are outliers from the mean-NB dispersion trend.

4.4.8 Differential expression


We test for significant differential expression in each gene, using the QL F-test. The contrast
of interest can be specified using the makeContrasts function. Here, genes are tested for DE
between the basal pregnant and lactating groups. This is done by defining the null hypothesis
as [Link] - [Link] = 0.
> con <- makeContrasts([Link] - [Link], levels=design)
> qlf <- glmQLFTest(fit, contrast=con)

The top set of most significant genes can be examined with topTags. Here, a positive log-fold
change represents genes that are up in [Link] over [Link]. Multiplicity correction is
performed by applying the Benjamini-Hochberg method on the p-values, to control the false
discovery rate (FDR).
> topTags(qlf)

Coefficient: -1*[Link] 1*[Link]


Symbol logFC logCPM F PValue FDR
12992 Csn1s2b -6.09 10.18 423 4.27e-11 6.81e-07
211577 Mrgprf -5.15 2.74 345 1.17e-10 7.15e-07
226101 Myof -2.32 6.44 324 1.74e-10 7.15e-07
381290 Atp2b4 -2.14 6.14 323 1.79e-10 7.15e-07
140474 Muc4 7.17 6.05 307 2.41e-10 7.70e-07
231830 Micall2 2.25 5.18 282 4.12e-10 1.10e-06
24117 Wif1 1.82 6.76 259 6.85e-10 1.56e-06
12740 Cldn4 5.32 9.87 299 8.47e-10 1.60e-06
21953 Tnni2 -5.75 3.86 315 9.00e-10 1.60e-06
231991 Creb5 -2.57 4.87 243 1.03e-09 1.64e-06

71
edgeR User’s Guide

The top gene Csn1s2b has a large negative log2-fold-change, showing that it is far more
highly expressed in lactating than pregnant mice. This gene is known to be a major source
of protein in milk.
The total number of DE genes in each direction at a FDR of 5% can be examined with de
cideTests. There are in fact nearly 4500 DE genes an FDR cut-off of 5% in this comparison:

> summary(decideTests(qlf))

-1*[Link] 1*[Link]
Down 2509
NotSig 10694
Up 2766

The differential expression test results can be visualized using an MD plot. The log-fold
change for each gene is plotted against the average abundance, i.e., logCPM in the result table
above. Significantly DE genes at a FDR of 5% are highlighted.
> plotMD(qlf)

We use glmTreat to narrow down the list of DE genes and focus on genes that are more
biologically meaningful. We test whether the differential expression is significantly above a
log2-fold-change of log2 1.2, i.e., a fold-change of 1.2.
> tr <- glmTreat(fit, contrast=con, lfc=log2(1.2))
> topTags(tr)

Coefficient: -1*[Link] 1*[Link]


Symbol logFC [Link] logCPM PValue FDR
12992 Csn1s2b -6.09 -6.09 10.18 4.51e-11 7.20e-07
211577 Mrgprf -5.15 -5.15 2.74 1.27e-10 8.71e-07
226101 Myof -2.32 -2.32 6.44 2.49e-10 8.71e-07
140474 Muc4 7.17 7.34 6.05 2.67e-10 8.71e-07
381290 Atp2b4 -2.14 -2.15 6.14 2.73e-10 8.71e-07
231830 Micall2 2.25 2.25 5.18 6.06e-10 1.61e-06

72
edgeR User’s Guide

12740 Cldn4 5.32 5.32 9.87 8.98e-10 1.88e-06


21953 Tnni2 -5.75 -5.76 3.86 9.44e-10 1.88e-06
24117 Wif1 1.82 1.82 6.76 1.22e-09 2.17e-06
231991 Creb5 -2.57 -2.58 4.87 1.37e-09 2.19e-06

Around 3000 genes are detected as DE with fold-change significantly above 1.2 at an FDR
cut-off of 5%.
> summary(decideTests(tr))

-1*[Link] 1*[Link]
Down 1434
NotSig 12728
Up 1807

The test results are visualized in the following smear plot. Genes that are significantly DE
above a fold-change of 1.2 at an FDR of 5% are highlighted in red.
> plotMD(tr)

4.4.9 ANOVA-like testing


The differential expression analysis of two-group comparison can be easily extended to com-
parisons between three or more groups. This is done by creating a matrix of contrasts, where
which each column represents a contrast between two groups of interest. In this manner,
users can perform a one-way analysis of variance (ANOVA) for each gene.
As an example, suppose we want to compare the three groups in the luminal population,
i.e., virgin, pregnant and lactating. An appropriate contrast matrix can be created as shown
below, to make pairwise comparisons between all three groups.
> con <- makeContrasts(
+ [Link] = [Link] - [Link],
+ [Link] = [Link] - [Link],

73
edgeR User’s Guide

+ [Link] = [Link] - [Link], levels=design)

The QL F-test is then applied to identify genes that are DE among the three groups. This
combines the three pairwise comparisons into a single F-statistic and p-value. The top set of
significant genes can be displayed with topTags.
> anov <- glmQLFTest(fit, contrast=con)
> topTags(anov)

Coefficient: LR test on 2 degrees of freedom


Symbol [Link] [Link] [Link] logCPM F PValue
19242 Ptn -1.54 7.26 8.800 7.97 2389 3.14e-17
13645 Egf -5.36 -7.22 -1.865 3.67 1123 3.91e-15
52150 Kcnk6 -2.42 -7.00 -4.579 5.91 1016 7.37e-15
12992 Csn1s2b -8.55 -11.36 -2.811 10.18 1055 8.53e-15
15439 Hp 1.08 5.42 4.336 4.93 987 8.88e-15
14183 Fgfr2 -1.15 3.95 5.096 7.38 953 1.11e-14
20856 Stc2 -1.81 3.19 5.005 6.10 914 1.45e-14
11941 Atp2b2 -7.37 -10.56 -3.191 6.60 1135 1.53e-14
13358 Slc25a1 -4.13 -4.91 -0.785 7.49 889 1.73e-14
17068 Ly6d 3.42 9.24 5.819 4.68 887 1.75e-14
FDR
19242 5.01e-13
13645 2.80e-11
52150 2.80e-11
12992 2.80e-11
15439 2.80e-11
14183 2.80e-11
20856 2.80e-11
11941 2.80e-11
13358 2.80e-11
17068 2.80e-11

Note that the three contrasts of pairwise comparisons are linearly dependent. Constructing
the contrast matrix with any two of the contrasts would be sufficient to specify an ANOVA
test. For instance, the contrast matrix shown below produces the same test results but with
a different column of log-fold changes.
> con <- makeContrasts(
+ [Link] = [Link] - [Link],
+ [Link] = [Link] - [Link], levels=design)

4.4.10 Gene ontology analysis


Further analyses are required to interpret the differential expression results in a biological
context. One common downstream procedure is a gene ontology (GO) enrichment analysis.
Suppose we want to identify GO terms that are over-represented in the basal lactating group
compared to the basal pregnancy group. This can be achieved by applying the goana function
to the differential expression results of that comparison. The top set of most enriched GO
terms can be viewed with the topGO function.

74
edgeR User’s Guide

> con <- makeContrasts([Link] - [Link], levels=design)


> qlf <- glmQLFTest(fit, contrast=con)
> go <- goana(qlf, species = "Mm")
> topGO(go, n=30, truncate=30)

Term Ont N Up Down [Link] [Link]


GO:0022613 ribonucleoprotein complex b... BP 398 26 193 1.00e+00 1.46e-47
GO:0042254 ribosome biogenesis BP 289 12 156 1.00e+00 4.04e-46
GO:1990904 ribonucleoprotein complex CC 662 45 257 1.00e+00 4.76e-41
GO:0006364 rRNA processing BP 205 5 115 1.00e+00 2.25e-36
GO:0016072 rRNA metabolic process BP 212 7 115 1.00e+00 1.69e-34
GO:0022626 cytosolic ribosome CC 100 1 72 1.00e+00 2.38e-33
GO:0003723 RNA binding MF 1022 110 320 1.00e+00 9.33e-30
GO:0034470 ncRNA processing BP 351 18 147 1.00e+00 1.03e-27
GO:0034660 ncRNA metabolic process BP 423 28 163 1.00e+00 8.98e-26
GO:0006396 RNA processing BP 817 71 258 1.00e+00 1.39e-24
GO:0005840 ribosome CC 212 4 101 1.00e+00 1.47e-24
GO:0005730 nucleolus CC 791 109 251 9.62e-01 2.95e-24
GO:0003735 structural constituent of r... MF 148 1 79 1.00e+00 1.75e-23
GO:0022625 cytosolic large ribosomal s... CC 53 0 42 1.00e+00 8.99e-23
GO:0044391 ribosomal subunit CC 183 1 89 1.00e+00 1.42e-22
GO:0043043 peptide biosynthetic proces... BP 564 53 192 1.00e+00 1.42e-22
GO:0006412 translation BP 544 52 187 1.00e+00 1.49e-22
GO:0030684 preribosome CC 79 1 52 1.00e+00 1.37e-21
GO:0032991 protein-containing complex CC 4490 673 986 9.82e-01 1.83e-21
GO:0006518 peptide metabolic process BP 693 72 218 1.00e+00 1.27e-20
GO:0043604 amide biosynthetic process BP 656 67 207 1.00e+00 8.57e-20
GO:0031974 membrane-enclosed lumen CC 3863 581 859 9.63e-01 1.13e-19
GO:0043233 organelle lumen CC 3863 581 859 9.63e-01 1.13e-19
GO:0070013 intracellular organelle lum... CC 3857 580 857 9.63e-01 1.64e-19
GO:0065007 biological regulation BP 8881 1611 1573 2.41e-18 9.52e-02
GO:0042273 ribosomal large subunit bio... BP 70 3 45 9.99e-01 2.94e-18
GO:0050794 regulation of cellular proc... BP 8074 1480 1423 1.58e-17 1.89e-01
GO:0031981 nuclear lumen CC 3487 544 776 7.39e-01 1.69e-17
GO:0008150 biological_process BP 14336 2384 2490 6.74e-17 4.79e-01
GO:0050789 regulation of biological pr... BP 8443 1534 1500 6.94e-17 7.63e-02

The row names of the output are the universal identifiers of the GO terms, with one term per
row. The Term column gives the names of the GO terms. These terms cover three domains
- biological process (BP), cellular component (CC) and molecular function (MF), as shown
in the Ont column. The N column represents the total number of genes that are annotated
with each GO term. The Up and Down columns represent the number of genes with the GO
term that are significantly up- and down-regulated in this differential expression comparison,
respectively. The [Link] and [Link] columns contain the p-values for over-representation of the
GO term across the set of up- and down-regulated genes, respectively. The output table is
sorted by the minimum of [Link] and [Link] by default.
The goana function uses the NCBI RefSeq annotation. Therefore, the Entrez Gene identifier
(ID) should be supplied for each gene as the row names of qlf.

75
edgeR User’s Guide

4.4.11 Gene set testing


Another downstream step uses the rotation gene set test (ROAST) [41]. Given a set of
genes, we can test whether the majority of the genes in the set are DE across the contrast
of interest. It is useful when the specified set contains all genes involved in some pathway or
process.
In our case study, suppose we are interested in two GO terms related to cytokinesis. Each
term will be used to define a set containing all genes that are annotated with that term. The
names of these terms can be viewed as shown below.
> library([Link])
> [Link] <- c("GO:0032465", "GO:0000281")
> term <- select([Link], keys=[Link], columns="TERM")
> term

GOID TERM
1 GO:0032465 regulation of cytokinesis
2 GO:0000281 mitotic cytokinesis

We construct a list of two components, each of which is a vector of Entrez Gene IDs for all
genes annotated with one of the GO terms. We then convert the Gene IDs into row indices
of the fit object using the function ids2indices.
> Rkeys([Link].egGO2ALLEGS) <- [Link]
> ind <- ids2indices([Link]([Link].egGO2ALLEGS), [Link](fit))

We proceed to run ROAST on the defined gene sets for the contrast of interest. Suppose
the comparison of interest is between the virgin and lactating groups in the basal population.
We use fry to test for multiple gene sets.
> con <- makeContrasts([Link], levels=design)
> fr <- fry(y, index=ind, design=design, contrast=con)
> fr

NGenes Direction PValue FDR [Link] [Link]


GO:0032465 71 Up 0.00124 0.00249 7.57e-06 1.43e-05
GO:0000281 67 Up 0.03383 0.03383 1.43e-05 1.43e-05

Each row corresponds to a single gene set, i.e., GO term. The NGenes column gives the
number of genes in each set. The net direction of change is determined from the significance
of changes in each direction, and is shown in the Direction column. The PValue provides
evidence for whether the majority of genes in the set are DE in the specified direction, whereas
the [Link] tests for differential expression in any direction. FDRs are computed from
the corresponding p-values across all sets.
A barcode plot can be produced with the barcodeplot function to visualize the results for any
particular set. In this case, visualization is performed for the gene set defined by GO:0032465.
Here, genes are represented by bars and are ranked from left to right by decreasing log-fold
change. This forms the barcode-like pattern. The line above the barcode shows the relative
local enrichment of the vertical bars in each part of the plot. This particular plot suggests
that most genes in this set are up-regulated in the virgin group compared to the lactating
group.

76
edgeR User’s Guide

> res <- glmQLFTest(fit, contrast=con)


> barcodeplot(res$table$logFC, ind[[1]], main=names(ind)[1])

GO:0032465
0 Enrichment 1.8

Down

Up
−8.885

−0.987

−0.579

−0.340

−0.163

−0.001

0.167

0.387

0.695

1.281

10.561
Statistic

4.4.12 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets
[8] methods base

other attached packages:


[1] GO.db_3.13.0 [Link].db_3.13.0 AnnotationDbi_1.53.1
[4] IRanges_2.25.11 S4Vectors_0.29.19 Biobase_2.51.0
[7] BiocGenerics_0.37.5 edgeR_3.33.5 limma_3.47.15
[10] knitr_1.33 BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 XVector_0.31.1 compiler_4.1.0
[4] BiocManager [Link] highr_0.9
_ zlibbioc_1.37.0
[7] tools_4.1.0 statmod_1.4.36 digest_0.6.27
[10] bit_4.0.4 evaluate_0.14 RSQLite_2.2.7
[13] memoise_2.0.0 lattice_0.20-44 pkgconfig_2.0.3

77
edgeR User’s Guide

[16] png_0.1-7 rlang_0.4.11 DBI_1.1.1


[19] yaml_2.2.1 xfun_0.22 fastmap_1.1.0
[22] stringr_1.4.0 httr_1.4.2 Biostrings_2.59.3
[25] vctrs_0.3.8 locfit_1.5-9.4 bit64_4.0.5
[28] grid_4.1.0 R6_2.5.0 rmarkdown_2.8
[31] blob_1.2.1 magrittr_2.0.1 splines_4.1.0
[34] htmltools_0.5.1.1 KEGGREST_1.31.2 stringi_1.6.1
[37] cachem_1.0.4 crayon_1.4.1

4.5 Differential splicing after Pasilla knockdown


4.5.1 Introduction
The RNA-Seq data of this case study was produced by Brooks et al [2]. Drosophila melanogaster
was used as a model system to study the proteins NOVA1 and NOVA2 which are known to
regulate splicing in mammals. In particular, an RNA interference system (RNAi) was used to
knock down the expression of the D. melanogaster ortholog of NOVA1 and NOVA2, which is
Pasilla.
The experiment compared treated and untreated cells from the S2-DRSC cell line. In this
case study we are interested in exons and genes that are differentially expressed after Pasilla
knockdown, as well as genes that are differentially spliced in the knockdown samples as
compared to wildtype.

4.5.2 RNA-Seq samples


The RNA-Seq data of the six samples were deposited on GEO [Link]
geo. The GEO accession numbers and titles were prepared in a csv file:
> library(edgeR)
> GEO <- readTargets("[Link]", sep=",")

> GEO

GEO Title Pasilla


1 GSM461176 S2_DRSC_Untreated-1 Normal
2 GSM461177 S2_DRSC_Untreated-3 Normal
3 GSM461178 S2_DRSC_Untreated-4 Normal
4 GSM461179 S2_DRSC_CG8144_RNAi-1 Down
5 GSM461180 S2_DRSC_CG8144_RNAi-3 Down
6 GSM461181 S2_DRSC_CG8144_RNAi-4 Down

There are three untreated biological samples, in which Pasilla should be expressed at normal
levels, and three treated biological samples, in which Pasilla should be expressed at reduced
levels.
While GEO records the sample information, the sequencing data file are actually held on the
NCBI Short Read Archive (SRA). The RNA samples were sequenced on an Illumina Genome
Analyzer II. Multiple sequencing runs were used for several of the samples, resulting in a total
of 20 SRA files:

78
edgeR User’s Guide

> SRA <- readTargets("[Link]", sep=",")

> SRA

SRA GEO Title RunDate FlowCellID Type


1 SRR031708 GSM461176 S2_DRSC_Untreated-1 7/15/08 308T2AAXX SE
2 SRR031709 GSM461176 S2_DRSC_Untreated-1 7/15/08 308T2AAXX SE
3 SRR031710 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE
4 SRR031711 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE
5 SRR031712 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE
6 SRR031713 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE
7 SRR031714 GSM461177 S2_DRSC_Untreated-3 11/14/08 30MNEAAXX PE
8 SRR031715 GSM461177 S2_DRSC_Untreated-3 12/23/08 30M2BAAXX PE
9 SRR031716 GSM461178 S2_DRSC_Untreated-4 12/23/08 30M2BAAXX PE
10 SRR031717 GSM461178 S2_DRSC_Untreated-4 12/23/08 30M2BAAXX PE
11 SRR031718 GSM461179 S2_DRSC_CG8144_RNAi-1 7/15/08 308T2AAXX SE
12 SRR031719 GSM461179 S2_DRSC_CG8144_RNAi-1 7/18/08 308UEAAXX SE
13 SRR031720 GSM461179 S2_DRSC_CG8144_RNAi-1 8/15/08 30AYWAAXX SE
14 SRR031721 GSM461179 S2_DRSC_CG8144_RNAi-1 8/15/08 30AYWAAXX SE
15 SRR031722 GSM461179 S2_DRSC_CG8144_RNAi-1 8/15/08 30AYWAAXX SE
16 SRR031723 GSM461179 S2_DRSC_CG8144_RNAi-1 8/21/08 308A0AAXX SE
17 SRR031724 GSM461180 S2_DRSC_CG8144_RNAi-3 12/23/08 30M2BAAXX PE
18 SRR031725 GSM461180 S2_DRSC_CG8144_RNAi-3 12/23/08 30M2BAAXX PE
19 SRR031726 GSM461181 S2_DRSC_CG8144_RNAi-4 12/23/08 30M2BAAXX PE
20 SRR031727 GSM461181 S2_DRSC_CG8144_RNAi-4 12/23/08 30M2BAAXX PE
ReadLength
1 45
2 45
3 45
4 45
5 45
6 45
7 37
8 37
9 37
10 37
11 45
12 45
13 45
14 45
15 45
16 45
17 37
18 37
19 37
20 37

The last two columns of the above target file indicate whether the samples are single end
(SE) sequencing with 45 base-pair reads or paired end (PE) sequencing with 37 bp reads.

79
edgeR User’s Guide

4.5.3 Read alignment and processing


The SRA format files were first converted to FASTQ format using the SRA Toolkit. Then an
index file of the D. melanogaster reference genome was built in Rsubread[19] using the FASTA
files downloaded from [Link]
5_48. Finally, reads were aligned to the reference D. melanogaster genome using Rsubread.

Next we counted the number of reads or fragments overlapping each annotated exon of
each gene. GFF files containing gene and exon annotation were downloaded from [Link]
[Link]/genomes/Drosophila_melanogaster/RELEASE_5_48. The five *.gff files, one
for each chromosome, were concatenated into one file, and repeated exons instances of the
same exon (same start and stop position) were removed to create a data frame of start/stop
positions called [Link]. The single end (SE) reads were counted by:
> fc_SE <- featureCounts(SE_bam_files, [Link]="[Link]",
+ isGTFAnnotationFile=TRUE, [Link]="exon", [Link]="ID",
+ useMetaFeatures=FALSE, allowMultiOverlap=TRUE)

where SE_bam_files is a vector of BAM file names for the SE reads. The paired end (PE)
reads were counted by:
> fc_PE <- featureCounts(PE_bam_files, [Link]="[Link]",
+ isGTFAnnotationFile=TRUE, [Link]="exon", [Link]="ID",
+ useMetaFeatures=FALSE, allowMultiOverlap=TRUE, isPairedEnd=TRUE)

where PE_bam_files is a vector of BAM file names for the PE reads.

4.5.4 Count loading and annotation


We create a DGEList object as follows
> [Link] <- DGEList(counts=cbind(fc_SE$counts, fc_PE$counts), genes=fc_SE$annotation)
> dim([Link])

[1] 74184 20

> head([Link]$genes)

GeneID Chr Start End Strand Length


138088 30970 NC_004354.3 138094 139379 - 1286
138087 30970 NC_004354.3 139445 139611 - 167
138089 30970 NC_004354.3 139445 139889 - 445
138086 30970 NC_004354.3 139713 139889 - 177
138091 30971 NC_004354.3 140011 141629 + 1619
138092 30971 NC_004354.3 142415 144271 + 1857

The annotation includes Entrez ID and the length, chromosome and start and stop position
of each exon. We resort the samples back to original SRA order and collapse the data so
that there is a single column for each GEO sample by summing the counts over the technical
replicates:
> [Link] <- [Link][, SRA$SRA]
> y <- sumTechReps([Link], ID=SRA$GEO)
> y$samples

80
edgeR User’s Guide

group [Link] [Link]


GSM461176 1 31007529 1
GSM461177 1 13040952 1
GSM461178 1 15030819 1
GSM461179 1 28143539 1
GSM461180 1 14901292 1
GSM461181 1 16264066 1

> colnames(y) <- c("N1","N3","N4","D1","D3","D4")

Annotation for D. melanogaster genes was downloaded from [Link]


DATA/GENE_INFO/Invertebrates. We now add selected annotation columns to the DGEList
object:
> ncbi.L1 <- readLines("Drosophila_melanogaster.gene_info", n = 1)
> ncbi <- [Link]("Drosophila_melanogaster.gene_info", skip=1,
+ header=FALSE, stringsAsFactors=FALSE)

> [Link] <- unlist(strsplit(substring(ncbi.L1, 10, 234), ' '))


> colnames(ncbi) <- [Link]
> m <- match(y$genes$GeneID, ncbi$GeneID)
> y$genes$Chr <- ncbi$chromosome[m]
> y$genes$Symbol <- ncbi$Symbol[m]
> y$genes$Strand <- NULL
> head(y$genes)

GeneID Chr Start End Length Symbol


138088 30970 X 138094 139379 1286 CG3038
138087 30970 X 139445 139611 167 CG3038
138089 30970 X 139445 139889 445 CG3038
138086 30970 X 139713 139889 177 CG3038
138091 30971 X 140011 141629 1619 G9a
138092 30971 X 142415 144271 1857 G9a

4.5.5 Filtering and normalization


Here, an exon is only retained if it is expressed in a minimum number of samples:
> Pasilla <- factor(GEO$Pasilla, levels=c("Normal","Down"))
> keep <- filterByExpr(y, group=Pasilla)
> table(keep)

keep
FALSE TRUE
34062 40122

> y <- y[keep, , [Link]=FALSE]

TMM normalization is performed to eliminate composition biases between libraries.


> y <- calcNormFactors(y)
> y$samples

81
edgeR User’s Guide

group [Link] [Link]


N1 1 30930664 0.949
N3 1 12991065 1.030
N4 1 14943938 0.978
D1 1 28053939 1.004
D3 1 14799544 1.025
D4 1 16206394 1.016

4.5.6 Data exploration


The data can be explored by generating multi-dimensional scaling (MDS) plots. This visu-
alizes the differences between the expression profiles of different samples in two dimensions.

> plotMDS(y)
1.0

D4 D1
D3
Leading logFC dim 2 (25%)

0.5
0.0
−0.5

N1
N4
−1.0

N3

−1.0 −0.5 0.0 0.5 1.0 1.5 2.0

Leading logFC dim 1 (52%)

The MDS plot shows clear separation of the Pasilla down vs normal samples, but also a batch
effect associated with sequencing type and date.

4.5.7 The design matrix


To account for the batch effect observed from the MDS plot, we create a design matrix as
follows:
> Batch <- factor(c(1,3,4,1,3,4))
> Pasilla <- factor(GEO$Pasilla, levels=c("Normal","Down"))
> design <- [Link](~ Batch + Pasilla)
> design

(Intercept) Batch3 Batch4 PasillaDown


1 1 0 0 0
2 1 1 0 0

82
edgeR User’s Guide

3 1 0 1 0
4 1 0 0 1
5 1 1 0 1
6 1 0 1 1
attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Batch
[1] "[Link]"

attr(,"contrasts")$Pasilla
[1] "[Link]"

4.5.8 Estimating the dispersion


We estimate NB dispersions using the estimateDisp function. The estimated dispersions can
be visualized with plotBCV.
> y <- estimateDisp(y, design, robust=TRUE)
> y$[Link]

[1] 0.0145

> plotBCV(y)

Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
For the QL dispersions, estimation can be performed using the glmQLFit function. The results
can be visualized with the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)

83
edgeR User’s Guide

4.5.9 Differential expression


We test for differentially expressed exons between Pasilla knockdown and normal using the
QL F-test.
> qlf <- glmQLFTest(fit, coef=4)

The top set of most significant exons can be examined with topTags. Here, a positive log-fold
change represents exons that are up in Pasilla knockdown over normal. Multiplicity correction
is performed by applying the Benjamini-Hochberg method on the p-values, to control the false
discovery rate (FDR).
> topTags(qlf)

Coefficient: PasillaDown
GeneID Chr Start End Length Symbol logFC logCPM F
150709 32007 X 10674926 10676128 1203 sesB -3.26 7.21 944
150713 32007 X 10675026 10676128 1103 sesB -3.26 7.21 943
150697 32008 X 10672987 10673728 742 Ant2 2.85 6.14 851
91614 42865 3R 19970915 19971592 678 Kal1 -4.43 3.81 754
107856 44030 3L 2561932 2562843 912 msn -2.46 5.59 601
150702 32008 X 10674230 10674694 465 Ant2 2.96 4.55 570
150695 32008 X 10674230 10674559 330 Ant2 2.95 4.54 569
70750 44258 3R 5271691 5272628 938 ps -2.28 5.95 567
11333 44548 2R 6407125 6408782 1658 lola 2.25 6.14 558
96434 43230 3R 22695915 22696094 180 BM-40-SPARC -2.28 8.54 536
PValue FDR
150709 4.58e-15 9.27e-11
150713 4.62e-15 9.27e-11
150697 9.96e-15 1.33e-10
91614 2.45e-14 2.46e-10
107856 1.32e-13 1.01e-09
150702 1.95e-13 1.01e-09

84
edgeR User’s Guide

150695 1.98e-13 1.01e-09


70750 2.03e-13 1.01e-09
11333 2.27e-13 1.01e-09
96434 3.05e-13 1.15e-09

The total number of DE exons in each direction at a FDR of 5% can be examined with
decideTests.

> [Link] <- decideTests(qlf, [Link]=0.05)


> summary([Link])

PasillaDown
Down 2113
NotSig 36216
Up 1793

4.5.10 Alternative splicing


We detect alternative splicing by testing for differential exon usage between Pasilla knockdown
and normal in each gene.
> sp <- diffSpliceDGE(fit, coef=4, geneid="GeneID", exonid="Start")

Total number of exons: 40122


Total number of genes: 8765
Number of genes with 1 exon: 1786
Mean number of exons in a gene: 5
Max number of exons in a gene: 63

Two testing methods at the gene-level are provided. The Simes’ method is likely to be more
powerful when only a minority of the exons for a gene are differentially spliced. The F-tests
are likely to be powerful for genes in which several exons are differentially spliced.
The top spliced genes under the Simes’ method are shown below:
> topSpliceDGE(sp, test="Simes", n=20)

GeneID Chr Symbol NExons [Link] FDR


141235 45320 X trol 46 4.35e-31 3.03e-27
11214 44548 2R lola 32 2.81e-30 9.80e-27
95956 44448 3R scrib 35 1.36e-20 3.17e-17
107810 44030 3L msn 24 2.34e-18 3.86e-15
19880 36773 2R Dg 15 2.76e-18 3.86e-15
16060 36542 2R shot 38 1.75e-17 2.04e-14
82117 42130 3R osa 17 3.54e-17 3.53e-14
131170 40205 3L CG42674 17 2.05e-15 1.79e-12
32242 37893 2R slik 19 3.43e-15 2.66e-12
163416 32817 X CrebB-17A 13 2.06e-14 1.44e-11
110493 38491 3L ens 17 7.35e-14 4.66e-11
150694 32008 X Ant2 5 1.15e-13 6.66e-11
41795 3771968 2L Msp-300 35 1.22e-12 6.52e-10
115767 38879 3L pbl 12 4.21e-12 2.10e-09
2032 2768716 2R mim 26 4.70e-12 2.19e-09

85
edgeR User’s Guide

166094 33098 X CG32521 9 2.06e-11 8.97e-09


150710 32007 X sesB 7 2.70e-11 1.11e-08
52823 34652 2L vir-1 7 6.88e-11 2.67e-08
526 35494 2R laccase2 10 2.05e-10 7.52e-08
85970 42428 3R Stat92E 14 4.55e-10 1.59e-07

The top spliced genes identified by F-tests are shown below:


> topSpliceDGE(sp, test="gene", n=20)

GeneID Chr Symbol NExons gene.F [Link] FDR


141235 45320 X trol 46 50.44 1.62e-52 1.13e-48
11214 44548 2R lola 32 38.14 4.33e-34 1.51e-30
41795 3771968 2L Msp-300 35 22.22 1.90e-28 4.41e-25
95956 44448 3R scrib 35 16.93 1.86e-24 3.25e-21
16060 36542 2R shot 38 11.08 6.70e-20 9.36e-17
32242 37893 2R slik 19 25.32 1.92e-18 2.23e-15
166094 33098 X CG32521 9 55.87 4.84e-15 4.83e-12
19880 36773 2R Dg 15 21.55 3.21e-14 2.80e-11
2032 2768716 2R mim 26 10.48 4.74e-14 3.67e-11
150694 32008 X Ant2 5 107.73 4.59e-13 3.20e-10
107810 44030 3L msn 24 10.32 5.55e-13 3.49e-10
82117 42130 3R osa 17 15.35 5.99e-13 3.49e-10
150710 32007 X sesB 7 51.72 4.68e-12 2.51e-09
163416 32817 X CrebB-17A 13 18.41 8.51e-12 4.24e-09
131170 40205 3L CG42674 17 12.20 3.05e-11 1.42e-08
110493 38491 3L ens 17 10.63 2.88e-10 1.25e-07
115767 38879 3L pbl 12 15.79 3.03e-10 1.25e-07
134207 40464 3L Ten-m 12 15.45 4.06e-10 1.55e-07
36209 33367 2L CG7337 27 6.62 4.21e-10 1.55e-07
11103 36104 2R G-oalpha47A 13 13.92 4.60e-10 1.61e-07

We plot all the exons for the top two most differentially spliced genes. Exons that are
individually significant are highlighted.
> par(mfrow=c(1,2))
> plotSpliceDGE(sp, geneid="trol", genecol="Symbol")
> plotSpliceDGE(sp, geneid="lola", genecol="Symbol")

86
edgeR User’s Guide

trol lola

1.5
4
logFC (this exon vs the average)

logFC (this exon vs the average)

1.0
3

0.5
2

0.0
1

−0.5
0

−1.5
−1

2364493
2366985
2367693
2369449
2371510
2374767
2375450
2376492
2377519
2378650
2380960
2384489
2385514
2386688
2388437
2389981
2390809
2392055
2393244
2407676
2415567
2417438
2417919

6369712
6374902
6376160
6377019
6377677
6378765
6383800
6387703
6389863
6392364
6394928
6397300
6398030
6402519
6403340
6405418
6406208
6407125
6409533
6409533
6411002
6412310
6414072
6414571
6419253
6419544
6419686
6420623
6421081
6422355
6428850
6430410
Exon Start Exon Start

We can see that a block of five or six exons at the right end of the trol gene are relatively
lost when Pasilla is down. Most exons in the first half of the gene behave similarly to each
other. This gene is on the negative strand, so transcription is from right to left. The gene
trol was identified by Brooks et al [2] to have a novel set of coordinately regulated exons.

4.5.11 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] stats graphics grDevices utils datasets methods base

other attached packages:


[1] edgeR_3.33.5 limma_3.47.15 knitr_1.33 BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 locfit_1.5-9.4 lattice_0.20-44
[4] digest_0.6.27 grid_4.1.0 magrittr_2.0.1
[7] evaluate_0.14 highr_0.9 rlang_0.4.11
[10] stringi_1.6.1 rmarkdown_2.8 splines_4.1.0

87
edgeR User’s Guide

[13] statmod_1.4.36 tools_4.1.0 stringr_1.4.0


[16] xfun_0.22 yaml_2.2.1 compiler_4.1.0
[19] BiocManager_1.30.13.1 htmltools_0.5.1.1

4.5.12 Acknowledgements
Thanks to Yang Liao for mapping the reads and running featureCounts and Yifang Hu for
the initial analysis of the data.

4.6 CRISPR-Cas9 knockout screen analysis


4.6.1 Introduction
Dai et al. (2014) [7] describe the use of edgeR to analyze data from pooled genetic screens
utilizing either shRNAs or CRISPR-Cas9 to disrupt gene expression in a population of cells.
In this case study we analyze data from a pooled screen that uses CRISPR-Cas9 (clustered
regularly interspaced short palindromic repeats-associated nuclease Cas9) knockout technol-
ogy. In this example, a library of around 64,000 sgRNAs (as used in Shalem et al. 2014 [37])
were screened to look for genes that may lead to resistance from a particular drug. This
unpublished data set has been anonymised.

4.6.2 Sequence processing


Multiple single guide RNAs (sgRNAs) per gene (generally between 3-6) were included in the
screen. Below we read in the raw sequences from the paired end fastq files screen4_R1.fastq
and screen4_R2.fastq using the processAmplicons function in edgeR. This screen employed
a dual indexing strategy where the first 8 bases from each pair of reads contained an index
sequence that uniquely identifies which sample a particular sgRNA sequence originated from.
Matches between sample indexes and sgRNAs listed in the files [Link] and [Link]
are identified by processAmplicons to produce a DGEList of counts.
> library(edgeR)
> sampleanno <- [Link]("[Link]", header=TRUE, sep="\t")
> sgseqs <- [Link]("[Link]", header=TRUE, sep="\t")
> x <- processAmplicons("screen4_R1.fastq", readfile2="screen4_R2.fastq",
+ barcodefile="[Link]", hairpinfile="[Link]",
+ verbose=TRUE)

Note that this dual indexing strategy requires an additional column named ‘SequencesRev’ in
the file that contains the sample annotation information. Also, readFile2 must be specified.
The output DGEList is available here.

4.6.3 Filtering and data exploration


We next filter out sgRNAs and samples with low numbers of reads. Need a CPM greater
than 5 in 15 or more samples to keep sgRNAs, and at least 100,000 reads to keep a given
sample.

88
edgeR User’s Guide

> table(x$samples$group)

Drug NoDrug
40 32

> selr <- rowSums(cpm(x$counts)>5)>=15


> selc <- colSums(x$counts)>=100000
> x <- x[selr,selc]

We plot number of sgRNAs that could be matched per sample and total for each sgRNA
across all samples .
> cols <- [Link](x$samples$group)+2
> par(mfrow=c(2,1))
> barplot(colSums(x$counts), las=2, main="Counts per index",
+ col=cols, [Link]=0.5, [Link]=0.8)
> legend("topright", legend=c("Control", "Drug"), col=c(3,4), pch=15)
> barplot(rowSums(x$counts), las=2, main="Counts per sgRNA",
+ axisnames=FALSE, [Link]=0.8)

A multidimensional scaling plot was generated to assess the consistency between replicate
samples. There is a clear separation between the two infections, indicating the need to
incorporate an effect for this in the GLM.
> cols2 <- x$samples$Infection
> par(mfrow=c(1,2))
> plotMDS(x, col=cols, main="MDS Plot: drug treatment colours")
> legend("topleft", legend=c("Control", "Drug"), col=c(3,4), pch=15)
> plotMDS(x, col=cols2, main="MDS Plot: infection colours")
> legend("topleft", legend=c("Inf#1", "Inf#2"), col=c(1,2), pch=15)

89
edgeR User’s Guide

4.6.4 The design matrix and dispersion estimation


A design matrix is set up for the GLM analysis, and the sgRNA-specific variation is estimated
and plotted (while taking into account both drug treatment and infection number).
> treatment <- relevel([Link](x$samples$group), "NoDrug")
> infection <- [Link](x$samples$Infection)
> des <- [Link](~treatment+infection)
> des[1:5,]

(Intercept) treatmentDrug infection2


1 1 0 0
2 1 0 0
3 1 0 0
4 1 0 0
5 1 0 0

> colnames(des)[2:3] <- c("Drug", "Infection2")

We estimate the dispersions and examine them in a BCV plot.


> xglm <- estimateDisp(x, des)
> sqrt(xglm$[Link])

[1] 0.258

> plotBCV(xglm, main="BCV Plot")

90
edgeR User’s Guide

4.6.5 Differential representation analysis


We use the function glmFit to fit the sgRNA-specific models and glmLRT to do the testing
between the drug treated and control samples. The top ranked sgRNAs are listed using the
topTags function.

> fit <- glmFit(xglm, des)


> lrt <- glmLRT(fit, coef=2)
> topTags(lrt)

Coefficient: Drug
ID Sequences Gene logFC logCPM LR PValue
sgRNA816 sgRNA816 TCCGAACTCCCCCTTCCCGA 269 4.36 7.32 699 4.54e-154
sgRNA4070 sgRNA4070 GTTGTGCTCAGTACTGACTT 1252 2.94 8.00 659 2.14e-145
sgRNA6351 sgRNA6351 AAAAACGTATCTATTTTTAC 1957 3.37 6.34 422 8.56e-94
sgRNA12880 sgRNA12880 CTGCACCGAAGAGAGCTGCT 3979 2.83 7.04 322 5.45e-72
sgRNA23015 sgRNA23015 CAATTTGATCTCTTCTACTG 6714 3.16 4.83 233 1.35e-52
sgRNA62532 sgRNA62532 AAACACGTCCAGTGCAGCCC 19612 2.79 4.91 216 6.18e-49
sgRNA38819 sgRNA38819 TACGTTGTCGGGCGCCGCCA 11531 2.42 6.54 204 2.96e-46
sgRNA3887 sgRNA3887 AACGCTGGACTCGAATGGCC 1194 2.28 5.33 203 4.05e-46
sgRNA19299 sgRNA19299 GGGGTCTTACCCGAGGCTCC 5732 1.94 5.63 202 7.67e-46
sgRNA52924 sgRNA52924 CCACCGCGTTCCACTTCTTG 16395 2.87 6.64 193 5.54e-44
FDR
sgRNA816 2.56e-149
sgRNA4070 6.04e-141
sgRNA6351 1.61e-89
sgRNA12880 7.68e-68
sgRNA23015 1.52e-48
sgRNA62532 5.81e-45
sgRNA38819 2.38e-42
sgRNA3887 2.85e-42
sgRNA19299 4.80e-42
sgRNA52924 3.12e-40

91
edgeR User’s Guide

sgRNAs with FDR < 0.0001 [1] and log-fold-change ≥ 1 are highlighted on a plot of log-
fold-change versus log-counts-per-millions by the plotSmear function. Since this is a positive
screen, we highlight over-represented sgRNAs (i.e. those with positive log-fold-changes) since
the model is parameterized to compare drug treatment versus control (coefficient 2 in the
design matrix).
> thresh <- 0.0001
> lfc <- 1
> top4 <- topTags(lrt, n=Inf)
> top4ids <- top4$table[top4$table$FDR<thresh & top4$table$logFC>=lfc,1]
> plotSmear(lrt, [Link]=top4ids, pch=20, cex=0.6,
+ main="Drug treatment vs Control")
> abline(h=c(-1, 0, 1), col=c("dodgerblue","yellow","dodgerblue"), lty=2)

4.6.6 Gene set tests to summarize over multiple sgRNAs targeting


the same gene
We finish this analysis by summarising data across multiple sgRNAs that target the same
gene in order to get a gene-by-gene ranking, rather than a sgRNA-specific one. The camera
gene-set test [42] is used for this purpose. For this analysis, the collection of sgRNAs that
target a specific gene can be regarded as a ‘set’. In the code below, we restrict our analysis to
genes with more than 3 sgRNAs. A barcode plot, highlighting the rank of sgRNAs for a given
gene relative to the entire data set is generated for the top-ranked gene (11531). Abundance
of sgRNAs targeting this gene tend to increase with drug treatment (FDR=0.0003).
> genesymbols <- x$genes[,3]
> genesymbollist <- list()
> unq <- unique(genesymbols)
> unq <- unq[![Link](unq)]
> for(i in unq) {
+ sel <- genesymbols==i & ![Link](genesymbols)
+ if(sum(sel)>3)

92
edgeR User’s Guide

+ genesymbollist[[i]] <- which(sel)


+ }
> [Link] <- camera(xglm, index=genesymbollist, des, contrast=2)
> [Link][1:10,]

NGenes Direction PValue FDR


19612 5 Up 1.44e-08 7.92e-05
8808 4 Up 9.36e-06 2.33e-02
3979 4 Up 1.34e-05 2.33e-02
8370 4 Up 1.69e-05 2.33e-02
11531 4 Up 2.33e-05 2.57e-02
10386 4 Up 1.40e-04 1.14e-01
2005 4 Up 1.45e-04 1.14e-01
4086 4 Up 1.95e-04 1.34e-01
10784 4 Up 2.26e-04 1.38e-01
11412 5 Up 6.93e-04 3.82e-01

We make a barcode plot for an example (Gene 11531) that ranks highly.
> barcodeplot(lrt$table$logFC,index=genesymbollist[[11531]],
+ main="Barcodeplot for Gene 11531",
+ labels=c("Negative logFC", "Positive logFC"),
+ quantile=c(-0.5,0.5))

Barcodeplot for Gene 11531


0 Enrichment 3.7

Negative logFC

Positive logFC
−2.34

−0.47

−0.30

−0.19

−0.10

−0.02

0.06

0.15

0.26

0.43

4.36

Statistic

The raw data from this example and several other case studies for this technology can be
found at [Link]

4.6.7 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

93
edgeR User’s Guide

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] stats graphics grDevices utils datasets methods base

other attached packages:


[1] edgeR_3.33.5 limma_3.47.15 knitr_1.33 BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 locfit_1.5-9.4 lattice_0.20-44
_
[4] digest 0.6.27 grid_4.1.0 magrittr_2.0.1
[7] evaluate_0.14 highr_0.9 rlang_0.4.11
[10] stringi_1.6.1 rmarkdown_2.8 splines_4.1.0
[13] tools_4.1.0 stringr_1.4.0 xfun_0.22
[16] yaml_2.2.1 compiler_4.1.0 BiocManager_1.30.13.1
[19] htmltools_0.5.1.1

4.6.8 Acknowledgements
Thanks to Dr Sam Wormald from the WEHI for providing the data set used in this case
study.

4.7 Bisulfite sequencing of mouse oocytes


4.7.1 Introduction
The bisulfite sequencing (BS-seq) data of this case study is described in Gahurova et al. [13].
The sequence and count data are publicly available from the Gene Expression Omnibus (GEO)
at the series accession number GSE86297.
This study investigates the onset and progression of de novo methylation. Growing oocytes
from pre-pubertal mouse ovaries (post-natal days 7-18) isolated and sorted into the following,
non-overlapping size categories: 40-45, 50-55 and 60-65µm with two biological replicates in
each. Methylation maps were generated by bisulfite conversion of oocyte DNA and Illumina
sequencing. Reduced representation bisulfite sequencing (RRBS [27]) was applied for focusing
coverage of CGIs and other GC-rich sequences in all three size classes of oocytes. RRBS reads
were trimmed to remove poor quality calls and adapters using Trim Galore and mapped to the
mouse genome GRCm38 assembly by Bismark [17]. This is summarized in the table below.
> library(edgeR)
> targets <- [Link]("[Link]", stringsAsFactors=FALSE)

> targets

GEO Sample Group File

94
edgeR User’s Guide

1 GSM2299710 40-45um-A 40um GSM2299710_RRBS_40-45oocyte_LibA.[Link]


2 GSM2299711 40-45um-B 40um GSM2299711_RRBS_40-45oocyte_LibB.[Link]
3 GSM2299712 50-55um-A 50um GSM2299712_RRBS_50-55oocyte_LibA.[Link]
4 GSM2299713 50-55um-B 50um GSM2299713_RRBS_50-55oocyte_LibB.[Link]
5 GSM2299714 60-65um-A 60um GSM2299714_RRBS_60-65oocyte_LibA.[Link]
6 GSM2299715 60-65um-B 60um GSM2299715_RRBS_60-65oocyte_LibB.[Link]

4.7.2 Reading in the data


The Bismark outputs of the data include one coverage file of the methylation in CpG context
for each sample. The coverage file for each of the six samples is available for download at
GEO. The first six rows of the coverage output for the first sample are shown below.
> s1 <- [Link](file="GSM2299710_RRBS_40-45oocyte_LibA.[Link]",
+ header=FALSE, nrows=6)

> s1

V1 V2 V3 V4 V5 V6
1 6 3121266 3121266 0.00 0 17
2 6 3121296 3121296 0.00 0 17
3 6 3179319 3179319 1.28 1 77
4 6 3180316 3180316 4.55 1 21
5 6 3182928 3182928 4.33 22 486
6 6 3182937 3182937 5.37 61 1074

The six columns (from left to right) represent: chromosome, start position, end posi-
tion, methylation proportion in percentage, number of methylated C’s and number of un-
methylated C’s. Since the start and end positions of a CpG site from Bismark are the same,
we can keep only one of them. The last two columns of counts are we will use for the analysis.
We read in the coverage files of all six samples using readBismark2DGE. A DGEList object
is created using the count table, and the chromosome number and positions are used for
annotation.
> files <- targets$File
> yall <- readBismark2DGE(files, [Link]=targets$Sample)

The edgeRpackage stores the counts and associated annotation in a DGEList object. There
is a row for each CpG locus found in any of the files. There are columns of methylated and
unmethylated counts for each sample. The chromosomes and genomic loci are stored in the
genes component.

> yall

An object of class "DGEList"


$counts
40-45um-A-Me 40-45um-A-Un 40-45um-B-Me 40-45um-B-Un 50-55um-A-Me
6-3121266 0 17 0 4 0
6-3121296 0 17 0 4 0
6-3179319 1 77 0 76 2
6-3180316 1 21 0 0 1
6-3182928 22 486 8 953 7

95
edgeR User’s Guide

50-55um-A-Un 50-55um-B-Me 50-55um-B-Un 60-65um-A-Me 60-65um-A-Un


6-3121266 17 0 0 3 3
6-3121296 16 0 0 0 6
6-3179319 52 0 7 10 43
6-3180316 7 0 0 2 4
6-3182928 714 32 1190 10 618
60-65um-B-Me 60-65um-B-Un
6-3121266 0 11
6-3121296 0 11
6-3179319 3 30
6-3180316 1 0
6-3182928 12 651
2271667 more rows ...

$samples
group [Link] [Link]
40-45um-A-Me 1 1231757 1
40-45um-A-Un 1 36263318 1
40-45um-B-Me 1 1719267 1
40-45um-B-Un 1 55600556 1
50-55um-A-Me 1 2691638 1
7 more rows ...

$genes
Chr Locus
6-3121266 6 3121266
6-3121296 6 3121296
6-3179319 6 3179319
6-3180316 6 3180316
6-3182928 6 3182928
2271667 more rows ...

> dim(yall)

[1] 2271672 12

We remove the mitochondrial genes as they are usually of less interest.


> table(yall$genes$Chr)

6 9 17 1 3 13 10 2 4 5 11
111377 120649 101606 140819 108466 95196 116980 173357 157628 159979 161754
18 16 7 8 14 19 X 12 15 Y MT
71737 70964 140225 130786 84974 70614 58361 95580 99646 662 312

> yall <- yall[yall$genes$Chr!="MT", ]

For convenience, we sort the DGEList so that all loci are in genomic order, from chromosome
1 to chromosome Y.
> ChrNames <- c(1:19,"X","Y")
> yall$genes$Chr <- factor(yall$genes$Chr, levels=ChrNames)

96
edgeR User’s Guide

> o <- order(yall$genes$Chr, yall$genes$Locus)


> yall <- yall[o,]

We now annotate the CpG loci with the identity of the nearest gene. We search for the gene
transcriptional start site (TSS) closest to each our CpGs:
> TSS <- nearestTSS(yall$genes$Chr, yall$genes$Locus, species="Mm")
> yall$genes$EntrezID <- TSS$gene_id
> yall$genes$Symbol <- TSS$symbol
> yall$genes$Strand <- TSS$strand
> yall$genes$Distance <- TSS$distance
> yall$genes$Width <- TSS$width
> head(yall$genes)

Chr Locus EntrezID Symbol Strand Distance Width


1-3003886 1 3003886 497097 Xkr4 - -667612 457017
1-3003899 1 3003899 497097 Xkr4 - -667599 457017
1-3020877 1 3020877 497097 Xkr4 - -650621 457017
1-3020891 1 3020891 497097 Xkr4 - -650607 457017
1-3020946 1 3020946 497097 Xkr4 - -650552 457017
1-3020988 1 3020988 497097 Xkr4 - -650510 457017

Here EntrezID, Symbol, Strand and Width are the Entrez Gene ID, symbol, strand and width of
the nearest gene. Distance is the genomic distance from the CpG to the TSS. Positive values
means the TSS is downstream of the CpG and negative values means the TSS is upstream.

4.7.3 Filtering and normalization


We now turn to statistical analysis of differential methylation. Our first analysis will be for
individual CpG loci.
CpG loci that have low coverage are removed prior to downstream analysis as they provide
little information for assessing methylation levels. We sum up the counts of methylated and
unmethylated reads to get the total read coverage at each CpG site for each sample:
> Methylation <- gl(2,1,ncol(yall), labels=c("Me","Un"))
> Me <- yall$counts[, Methylation=="Me"]
> Un <- yall$counts[, Methylation=="Un"]
> Coverage <- Me + Un
> head(Coverage)

40-45um-A-Me 40-45um-B-Me 50-55um-A-Me 50-55um-B-Me 60-65um-A-Me


1-3003886 0 0 0 0 3
1-3003899 0 0 0 0 3
1-3020877 84 77 114 21 86
1-3020891 84 78 116 21 86
1-3020946 146 369 210 165 195
1-3020988 38 91 60 94 50
60-65um-B-Me
1-3003886 0
1-3003899 0
1-3020877 57
1-3020891 57

97
edgeR User’s Guide

1-3020946 168
1-3020988 25

As a conservative rule of thumb, we require a CpG site to have a total count (both methylated
and unmethylated) of at least 8 in every sample before it is considered in the study.
> HasCoverage <- rowSums(Coverage >= 8) == 6

This filtering criterion could be relaxed somewhat in principle but the number of CpGs kept
in the analysis is large enough for our purposes.
We also filter out CpGs that are never methylated or always methylated as they provide no
information about differential methylation:
> HasBoth <- rowSums(Me) > 0 & rowSums(Un) > 0
> table(HasCoverage, HasBoth)

HasBoth
HasCoverage FALSE TRUE
FALSE 1601772 295891
TRUE 118785 254912

The DGEList object is subsetted to retain only the non-filtered loci:


> y <- yall[HasCoverage & HasBoth,, [Link]=FALSE]

A key difference between BS-seq and other sequencing data is that the pair of libraries
holding the methylated and unmethylated reads for a particular sample are treated as a unit.
To ensure that the methylated and unmethylated reads for the same sample are treated on
the same scale, we need to set the library sizes to be equal for each pair of libraries. We set
the library sizes for each sample to be the average of the total read counts for the methylated
and unmethylated libraries:
> TotalLibSize <- y$samples$[Link][Methylation=="Me"] +
+ y$samples$[Link][Methylation=="Un"]
> y$samples$[Link] <- rep(TotalLibSize, each=2)
> y$samples

group [Link] [Link]


40-45um-A-Me 1 20854816 1
40-45um-A-Un 1 20854816 1
40-45um-B-Me 1 39584537 1
40-45um-B-Un 1 39584537 1
50-55um-A-Me 1 22644990 1
50-55um-A-Un 1 22644990 1
50-55um-B-Me 1 25264124 1
50-55um-B-Un 1 25264124 1
60-65um-A-Me 1 18974220 1
60-65um-A-Un 1 18974220 1
60-65um-B-Me 1 20462334 1
60-65um-B-Un 1 20462334 1

Other normalization methods developed for RNA-seq data are not required for BS-seq data.

98
edgeR User’s Guide

4.7.4 Data exploration


The data can be explored by generating multi-dimensional scaling (MDS) plots on the methy-
lation level (M-value) of the CpG sites. The M-value is calcualted by the log of the ratio of
methylated and unmethylated C’s, which is equivalent to the difference between methylated
and unmethylated C’s on the log-scale [8]. A prior count of 2 is added to avoid logarithms
of zero.
> Me <- y$counts[, Methylation=="Me"]
> Un <- y$counts[, Methylation=="Un"]
> M <- log2(Me + 2) - log2(Un + 2)
> colnames(M) <- targets$Sample

Here M contains the empirical logit methylation level for each CpG site in each sample. We
have used a prior count of 2 to avoid logarithms of zero.
Now we can generate a multi-dimensional scaling (MDS) plot to explore the overall differences
between the methylation levels of the different samples.
> plotMDS(M, col=rep(1:3, each=2), main="M-values")

M−values
2

50−55um−A
1

40−45um−A 60−65um−B
60−65um−A
Leading logFC dim 2 (20%)

40−45um−B
0
−1
−2
−3
−4

50−55um−B

−4 −2 0 2 4

Leading logFC dim 1 (60%)

Replicate samples cluster together within the 40-45 and 60-65µm categories but are far apart
in the 50-55µm group. The plot also indicates a huge difference in methylation level between
the 40-45 and 60-65µm groups.

4.7.5 The design matrix


One aim of this study is to identify differentially methylated (DM) loci between the different
cell populations. In edgeR, this can be done by fitting linear models under a specified design
matrix and testing for corresponding coefficients or contrasts. A basic sample-level design
matrix can be made as follows:
> designSL <- [Link](~0+Group, data=targets)
> designSL

99
edgeR User’s Guide

Group40um Group50um Group60um


1 1 0 0
2 1 0 0
3 0 1 0
4 0 1 0
5 0 0 1
6 0 0 1
attr(,"assign")
[1] 1 1 1
attr(,"contrasts")
attr(,"contrasts")$Group
[1] "[Link]"

The we expand this to the full design matrix modeling the sample and methylation effects:
> design <- modelMatrixMeth(designSL)
> design

Sample1 Sample2 Sample3 Sample4 Sample5 Sample6 Group40um Group50um


1 1 0 0 0 0 0 1 0
2 1 0 0 0 0 0 0 0
3 0 1 0 0 0 0 1 0
4 0 1 0 0 0 0 0 0
5 0 0 1 0 0 0 0 1
6 0 0 1 0 0 0 0 0
7 0 0 0 1 0 0 0 1
8 0 0 0 1 0 0 0 0
9 0 0 0 0 1 0 0 0
10 0 0 0 0 1 0 0 0
11 0 0 0 0 0 1 0 0
12 0 0 0 0 0 1 0 0
Group60um
1 0
2 0
3 0
4 0
5 0
6 0
7 0
8 0
9 1
10 0
11 1
12 0

The first six columns represent the sample coverage effects. The last three columns represent
the methylation levels (in logit units) in the three groups.

4.7.6 Estimating the dispersion


For simplicity, we only consider the CpG methylation in chromosome 1. We subset the
coverage files so that they only contain methylation information of the first chromosome.

100
edgeR User’s Guide

> y1 <- y[y$genes$Chr==1, ]

We estimate the NB dispersion for each CpG site using the estimateDisp function. The
mean-dispersion relationship of BS-seq data has been studied in the past and no apparent
mean-dispersion trend was observed [10]. Therefore, we would not consider a mean-dependent
dispersion trend for BS-seq methylation data.
> y1 <- estimateDisp(y1, design=design, trend="none")
> y1$[Link]

[1] 0.384

> summary(y1$[Link])

Min. 1st Qu. Median Mean 3rd Qu. Max.


Inf Inf Inf Inf Inf Inf

The estimated prior degrees of freedom are infinite for all the CpGs, which implies all the
CpG-wise dispersions are exactly the same as the common dispersion. A BCV plot is often
useful to visualize the dispersion estimates, but it is not informative in this case.

4.7.7 Differential methylation analysis at CpG loci


Then we can proceed to testing for differentially methylated CpG sites between different
groups. We fit NB GLMs for all the CpG loci.
> fit <- glmFit(y1, design)

We identify differentially methylated CpG loci between the 40-45 and 60-65µm group using
the likelihood-ratio test. The contrast corresponding to this comparison is constructed using
the makeContrasts function.
> contr <- makeContrasts(
+ Group60vs40 = Group60um - Group40um, levels=design)
> lrt <- glmLRT(fit, contrast=contr)

The top set of most significant DMRs can be examined with topTags. Here, positive log-fold
changes represent CpG sites that have higher methylation level in the 60-65µm group com-
pared to the 40-45µm group. Multiplicity correction is performed by applying the Benjamini-
Hochberg method on the p-values, to control the false discovery rate (FDR).
> topTags(lrt)

Coefficient: -1*Group40um 1*Group60um


Chr Locus EntrezID Symbol Strand Distance Width logFC
1-172206751 1 172206751 18611 Pea15a - -53 10077 13.9
1-141992739 1 141992739 75910 4930590L20Rik - 1336337 86227 11.4
1-131987595 1 131987595 212980 Slc45a3 + -16986 12364 10.8
1-169954561 1 169954561 15490 Hsd17b7 - -14644 19669 12.2
1-74571516 1 74571516 77264 Zfp142 - -16512 21603 13.0
1-36499377 1 36499377 94218 Cnnm3 + 12490 16370 14.9
1-89533694 1 89533694 347722 Agap1 + -78883 440472 12.0
1-172206570 1 172206570 18611 Pea15a - -234 10077 10.3
1-75475455 1 75475455 74241 Chpf - -4016 4903 12.3

101
edgeR User’s Guide

1-51978650 1 51978650 20849 Stat4 + 8498 120042 12.2


logCPM LR PValue FDR
1-172206751 0.2784 46.5 9.32e-12 1.33e-07
1-141992739 0.3304 41.9 9.59e-11 5.43e-07
1-131987595 1.6943 41.6 1.14e-10 5.43e-07
1-169954561 1.3471 40.8 1.73e-10 6.14e-07
1-74571516 -0.0658 40.0 2.60e-10 7.41e-07
1-36499377 -1.0398 39.0 4.22e-10 8.08e-07
1-89533694 1.3383 38.9 4.48e-10 8.08e-07
1-172206570 1.6996 38.7 5.05e-10 8.08e-07
1-75475455 0.1106 38.6 5.11e-10 8.08e-07
1-51978650 0.4010 38.2 6.25e-10 8.90e-07

The total number of DMRs in each direction at a FDR of 5% can be examined with decide
Tests.

> summary(decideTests(lrt))

-1*Group40um 1*Group60um
Down 24
NotSig 12473
Up 1738

The differential methylation results can be visualized using an MD plot. The difference of
the M-value for each CpG site is plotted against the average abundance of that CpG site.
Significantly DMRs at a FDR of 5% are highlighted.
> plotMD(lrt)

It can be seen that most of the DMRs have higher methylation levels in 60-65µm group
compared to the 40-45µm group. This is consistent with the findings in Gahurova et al. [13].

102
edgeR User’s Guide

4.7.8 Summarizing counts in promoter regions


It is usually of great biological interest to examine the methylation level within the gene
promoter regions. For simplicity, we define the promoter of a gene as the region from 2kb
upstream to 1kb downstream of the transcription start site of that gene. We then subset the
CpGs to those contained in a promoter region.
> InPromoter <- yall$genes$Distance >= -1000 & yall$genes$Distance <= 2000
> yIP <- yall[InPromoter,,[Link]=FALSE]

We compute the total counts for each gene promoter:


> ypr <- rowsum(yIP, yIP$genes$EntrezID, reorder=FALSE)
> ypr$genes$EntrezID <- NULL

The integer matrix ypr$counts contains the total numbers of methylated and unmethylated
CpGs observed within the promoter of each gene.
Filtering is performed in the same way as before. We sum up the read counts of both
methylated and unmethylated Cs at each gene promoter within each sample.
> Mepr <- ypr$counts[,Methylation=="Me"]
> Unpr <- ypr$counts[,Methylation=="Un"]
> Coveragepr <- Mepr + Unpr

Since each row represents a 3,000-bps-wide promoter region that contains multiple CpG sites,
we would expect less filtering than before.
> HasCoveragepr <- rowSums(Coveragepr >= 8) == 6
> HasBothpr <- rowSums(Mepr) > 0 & rowSums(Unpr) > 0
> table(HasCoveragepr, HasBothpr)

HasBothpr
HasCoveragepr FALSE TRUE
FALSE 3658 3054
TRUE 85 15047

> ypr <- ypr[HasCoveragepr & HasBothpr,,[Link]=FALSE]

Same as before, we do not perform normalization but set the library sizes for each sample to
be the average of the total read counts for the methylated and unmethylated libraries.
> TotalLibSizepr <- 0.5*ypr$samples$[Link][Methylation=="Me"] +
+ 0.5*ypr$samples$[Link][Methylation=="Un"]
> ypr$samples$[Link] <- rep(TotalLibSizepr, each=2)
> ypr$samples

group [Link] [Link]


40-45um-A-Me 1 8016393 1
40-45um-A-Un 1 8016393 1
40-45um-B-Me 1 11769409 1
40-45um-B-Un 1 11769409 1
50-55um-A-Me 1 9989941 1
50-55um-A-Un 1 9989941 1
50-55um-B-Me 1 8507400 1

103
edgeR User’s Guide

50-55um-B-Un 1 8507400 1
60-65um-A-Me 1 8090161 1
60-65um-A-Un 1 8090161 1
60-65um-B-Me 1 6500575 1
60-65um-B-Un 1 6500575 1

4.7.9 Differential methylation in gene promoters


We estimate the NB dispersions using the estimateDisp function. For the same reason, we
do not consider a mean-dependent dispersion trend as we normally would for RNA-seq data.

> ypr <- estimateDisp(ypr, design, trend="none")


> ypr$[Link]

[1] 0.243

> ypr$[Link]

[1] 10.4

We fit NB GLMs for all the gene promoters using glmFit.

> fitpr <- glmFit(ypr, design)

Then we can proceed to testing for differential methylation in gene promoter regions between
different populations. Suppose the comparison of interest is the same as before. The same
contrast can be used for the testing.
> lrtpr <- glmLRT(fitpr, contrast=contr)

The top set of most differentially methylated gene promoters can be viewed with topTags:

> topTags(lrtpr, n=20)

Coefficient: -1*Group40um 1*Group60um


Chr Symbol Strand logFC logCPM LR PValue FDR
78102 15 8430426J06Rik - 7.80 5.53 84.5 3.87e-20 5.82e-16
210274 7 Shank2 + 7.32 6.56 79.6 4.63e-19 3.48e-15
100038353 18 Gm10532 + 7.76 4.79 74.9 4.83e-18 2.42e-14
102465670 11 Mir7115 + 8.23 4.50 72.3 1.87e-17 7.03e-14
15552 4 Htr1d + 7.02 6.96 68.7 1.13e-16 2.97e-13
246257 11 Ovca2 - 7.62 6.60 68.6 1.18e-16 2.97e-13
30841 5 Kdm2b - 6.64 7.64 67.7 1.89e-16 4.07e-13
226527 1 Cryzl2 + 8.97 4.54 66.6 3.35e-16 6.29e-13
114483644 17 Gm51291 + 8.80 5.81 66.3 3.97e-16 6.63e-13
20410 14 Sorbs3 - 6.43 6.92 64.0 1.25e-15 1.87e-12
104184 11 Blmh + 7.53 5.87 62.0 3.46e-15 4.70e-12
102466776 17 Mir6966 + 7.41 4.43 61.7 3.96e-15 4.70e-12
102466209 14 Mir6947 + 6.92 5.13 61.7 4.06e-15 4.70e-12
72446 2 Prr5l - 7.39 6.54 61.4 4.76e-15 5.12e-12
217198 11 Plekhh3 - 7.03 6.76 59.7 1.10e-14 1.10e-11
18611 1 Pea15a - 7.18 5.79 58.8 1.73e-14 1.62e-11
237336 10 Tbpl1 - 7.09 7.69 58.6 1.96e-14 1.74e-11

104
edgeR User’s Guide

75480 2 1700003F12Rik + 9.15 4.39 58.3 2.23e-14 1.84e-11


19894 5 Rph3a - 6.60 6.14 58.2 2.33e-14 1.84e-11
212307 18 Mapre2 + 6.36 6.96 58.1 2.49e-14 1.88e-11

The total number of DM gene promoters identified at an FDR of 5% can be shown with
decideTests.

> summary(decideTests(lrtpr))

-1*Group40um 1*Group60um
Down 15
NotSig 14334
Up 698

The differential methylation results can be visualized with an MD plot.


> plotMD(lrtpr)

4.7.10 Setup
This analysis was conducted on:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

105
edgeR User’s Guide

attached base packages:


[1] stats graphics grDevices utils datasets methods base

other attached packages:


[1] edgeR_3.33.5 limma_3.47.15 knitr_1.33 BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 XVector_0.31.1 compiler_4.1.0
[4] pillar_1.6.0 BiocManager_1.30.13.1 highr_0.9
[7] zlibbioc_1.37.0 tools_4.1.0 digest_0.6.27
[10] bit_4.0.4 memoise_2.0.0 evaluate_0.14
[13] RSQLite_2.2.7 lifecycle_1.0.0 tibble_3.1.1
[16] lattice_0.20-44 png_0.1-7 pkgconfig_2.0.3
[19] rlang_0.4.11 DBI_1.1.1 parallel_4.1.0
[22] yaml_2.2.1 xfun_0.22 fastmap_1.1.0
[25] [Link].db_3.13.0 httr_1.4.2 stringr_1.4.0
[28] Biostrings_2.59.3 IRanges_2.25.11 S4Vectors_0.29.19
[31] vctrs_0.3.8 hms_1.0.0 locfit_1.5-9.4
[34] stats4_4.1.0 bit64_4.0.5 grid_4.1.0
[37] Biobase_2.51.0 R6_2.5.0 fansi_0.4.2
[40] AnnotationDbi_1.53.1 rmarkdown_2.8 readr_1.4.0
[43] blob_1.2.1 magrittr_2.0.1 BiocGenerics_0.37.5
[46] ellipsis_0.3.2 htmltools_0.5.1.1 KEGGREST_1.31.2
[49] utf8_1.2.1 stringi_1.6.1 cachem_1.0.4
[52] crayon_1.4.1

4.8 Time course RNA-seq experiments of Drosophila


melanogaster
4.8.1 Introduction
The data for this case study was generated by Graveley et al. [14] and was previously analyzed
by Law et al. [18] using polynomial regression. Here we reanalyze the data using smoothing
splines to illustrate a general approach that can be taken to time-course data with many time
points. The approach taken here does not require biological replicates at each time point
— we can instead estimate the magnitude of biological variation from the smoothness or
otherwise of the time-course expression trend for each gene.
Graveley et al. conducted RNA-seq to examine the dynamics of gene expression throughout
developmental stages of the common fruit fly (Drosophila melanogaster ). 30 whole-animal
samples representing 27 distinct stages of development were used for sequencing. These
included 12 embryonic samples collected at 2-hour intervals from 0–2 hours to 22–24 hours
and also six larval, six pupal and three sexed adult stages at 1, 5 and 30 days after eclosion.
Each biological sample was sequenced several times and we view these as technical replicates.
Here we analyze only the data from the 12 embryonic stages.
RNA-seq read counts for this data are available from the ReCount [11] at . [Link]
[Link]. The table of read counts can be read into R directly from the ReCount
website by

106
edgeR User’s Guide

> CountFile <- paste("[Link]


+ "countTables",
+ "modencodefly_count_table.txt", sep="/")
> Counts <- [Link](CountFile, [Link]=1)

The sample information can be read by


> SampleFile <- paste("[Link]
+ "phenotypeTables",
+ "modencodefly_phenodata.txt", sep="/")
> Samples <- [Link](SampleFile, [Link]=1, sep=" ", stringsAsFactors=FALSE)

The data has 127 columns of counts but only 30 biologically independent samples:
> dim(Counts)

[1] 14869 147

We therefore sum the technical replicates to get total genewise read counts for each biological
sample:
> PooledCounts <- sumTechReps(Counts, ID=Samples$stage)
> dim(PooledCounts)

[1] 14869 30

> colnames(PooledCounts)

[1] "Embryos0002" "Embryos0204" "Embryos0406"


[4] "Embryos0608" "Embryos0810" "Embryos1012"
[7] "Embryos1214" "Embryos1416" "Embryos1618"
[10] "Embryos1820" "Embryos2022" "Embryos2224"
[13] "L1Larvae" "L2Larvae" "L3Larvae12hrpostmolt"
[16] "L3LarvaePS12" "L3LarvaePS36" "L3LarvaePS79"
[19] "WPP12hr" "WPP24hr" "adultfemale1d"
[22] "adultfemale30d" "adultfemale5d" "adultmale1d"
[25] "adultmale30d" "adultmale5d" "pupaeWPP2d"
[28] "pupaeWPP3d" "pupaeWPP4d" "whiteprepupae"

4.8.2 DEGList object


The embryonic stages correspond to the first 12 columns of data. We create a DGEList object
from these columns by:
> Hours <- seq(from=2, to=24, by=2)
> Time <- paste0(Hours,"hrs")
> y <- DGEList(counts=PooledCounts[,1:12], group=Time)

4.8.3 Gene annotation


We use the D. melanogaster organism package [Link] to map the flybase gene IDs to
gene symbols. Some flybase IDs map to multiple genes. To handle this possibility, we use
the multiVals argument of mapIds to keep the multiple symbols separated by semicolons:

107
edgeR User’s Guide

> library([Link])
> multiVals <- function(x) paste(x,collapse=";")
> Symbol <- mapIds([Link], keys=rownames(y), keytype="FLYBASE",
+ column="SYMBOL", multiVals=multiVals)
> y$genes <- [Link](Symbol=Symbol, stringsAsFactors=FALSE)
> head(y$genes)

Symbol
FBgn0000003 7SLRNA:CR32864
FBgn0000008 a
FBgn0000014 abd-A
FBgn0000015 Abd-B
FBgn0000017 Abl
FBgn0000018 abo

We will remove flybase IDs that cannot be mapped to gene symbols:


> HasSymbol <- y$genes$Symbol != "NA"
> y <- y[HasSymbol, , [Link]=FALSE]

4.8.4 Filtering and normalization


We filter out lowly expressed genes.
> keep <- filterByExpr(y)
> table(keep)

keep
FALSE TRUE
2597 10995

> y <- y[keep, , [Link]=FALSE]

TMM normalization is performed to estimate effective library sizes:


> y <- calcNormFactors(y)
> y$samples

group [Link] [Link]


Embryos0002 2hrs 48357074 0.929
Embryos0204 4hrs 38900872 0.900
Embryos0406 6hrs 90036132 0.942
Embryos0608 8hrs 55658696 1.018
Embryos0810 10hrs 52648211 1.114
Embryos1012 12hrs 67741086 1.121
Embryos1214 14hrs 83432728 1.172
Embryos1416 16hrs 66802084 0.984
Embryos1618 18hrs 61428450 0.968
Embryos1820 20hrs 62140522 0.922
Embryos2022 22hrs 34005429 0.972
Embryos2224 24hrs 68427067 0.998

108
edgeR User’s Guide

4.8.5 Data exploration


The data can be explored by generating multi-dimensional scaling (MDS) plots. This visual-
izes the differences between the expression profiles of different samples in two dimensions.
The 12 successive embryonic developmental stages are labelled according to number of hours
since fertilization. The MDS plot shows a smooth trend of transition in gene expression
during embryonic development from the start up to 22 hours:
> plotMDS(y, labels=Hours)

2
3

4
Leading logFC dim 2 (19%)

24
22
6
1

20
0

8
−1

10
18
−2

12
16
−3

14

−4 −2 0 2 4

Leading logFC dim 1 (60%)

4.8.6 The design matrix


The aim of a time course experiment is to examine the relationship between gene abundances
and time points. Assuming gene expression changes smoothly over time, we can use a
polynomial or a cubic spline curve with a certain number of degrees of freedom to model
gene expression along time.
To use a polynomial with, say 3 degrees of freedom, a design matrix could be constructed as
follows.
> X <- poly(Hours, degree=3)
> design <- [Link](~ X)
> design

(Intercept) X1 X2 X3
1 1 -0.4599 0.50183 -0.4599
2 1 -0.3763 0.22810 0.0418
3 1 -0.2927 0.00912 0.2927
4 1 -0.2091 -0.15511 0.3484
5 1 -0.1254 -0.26460 0.2648
6 1 -0.0418 -0.31935 0.0976
7 1 0.0418 -0.31935 -0.0976
8 1 0.1254 -0.26460 -0.2648

109
edgeR User’s Guide

9 1 0.2091 -0.15511 -0.3484


10 1 0.2927 0.00912 -0.2927
11 1 0.3763 0.22810 -0.0418
12 1 0.4599 0.50183 0.4599
attr(,"assign")
[1] 0 1 1 1

Then the coefficients X1, X2 and X3 represent the linear, quadratic and cubic time effect,
respectively. Hypotheses can be tested for each one of the coefficients.
To use a cubic regression spline curve with, say 3 degrees of freedom, a design matrix can
be constructed as follows.
> library(splines)
> X <- ns(Hours, df=3)
> design <- [Link](~ X)
> design

(Intercept) X1 X2 X3
1 1 0.0000 0.000 0.000
2 1 -0.0643 0.203 -0.135
3 1 -0.0995 0.380 -0.253
4 1 -0.0764 0.503 -0.335
5 1 0.0334 0.547 -0.365
6 1 0.2199 0.512 -0.333
7 1 0.4134 0.435 -0.247
8 1 0.5391 0.359 -0.114
9 1 0.5281 0.323 0.058
10 1 0.3806 0.332 0.260
11 1 0.1417 0.373 0.482
12 1 -0.1429 0.429 0.714
attr(,"assign")
[1] 0 1 1 1

Here the three coefficients do not have any particular meaning. Hypothesis testing would only
make sense if the three coefficients are assessed together. The advantage of using a cubic
spline curve is that it provides more stable fit at the end points compared to a polynomial.
The spline curve with 3 degrees of freedonm has 2 knots where cubic polynomials are splined
together. In general, choosing a number of degrees of freedom to be in range of 3-5 is
reasonable. Setting the degrees of freedom equal to 1 would be equivalent to simple linear
regression, i.e., a straight line trend.

4.8.7 Estimating the dispersion


The NB dispersion is estimated using the estimateDisp function. This returns the DGEList
object with additional entries for the estimated NB dispersion for each gene. These estimates
can be visualized with plotBCV, which shows the root-estimate, i.e., the biological coefficient
of variation for each gene.
> y <- estimateDisp(y, design)
> sqrt(y$[Link])

110
edgeR User’s Guide

[1] 0.446

> plotBCV(y)

For the QL dispersions, estimation can be performed using the glmQLFit function. This returns
a DGEGLM object containing the estimated values of the GLM coefficients for each gene, as well
as the fitted mean-QL dispersion trend, the squeezed QL estimates and the prior degrees of
freedom (df). These can be visualized with the plotQLDisp function.
> fit <- glmQLFit(y, design, robust=TRUE)
> plotQLDisp(fit)

111
edgeR User’s Guide

4.8.8 Time course trend analysis


In a time course experiment, we are looking for genes that change expression level over time.
Here, the design matrix uses 3 natural spline basis vectors to model smooth changes over
time, without assuming any particular pattern to the trend. We test for a trend by conducting
F-tests on 3 df for each gene:
> fit <- glmQLFTest(fit, coef=2:4)

The topTags function lists the top set of genes with most significant time effects.
> tab <- [Link](topTags(fit, n=30))
> tab

Symbol logFC.X1 logFC.X2 logFC.X3 logCPM F PValue FDR


FBgn0023179 amon 9.08 8.70 9.81 5.00 490 1.96e-12 9.16e-09
FBgn0030747 CG4301 8.93 10.55 8.54 6.05 474 2.37e-12 9.16e-09
FBgn0004169 up 9.85 8.81 8.76 10.53 470 2.50e-12 9.16e-09
FBgn0002773 Mlc2 9.62 9.05 8.56 11.32 420 4.97e-12 9.95e-09
FBgn0027556 CG4928 7.92 9.77 10.92 7.41 415 5.12e-12 9.95e-09
FBgn0001114 Glt 9.33 8.17 8.25 9.47 410 5.43e-12 9.95e-09
FBgn0035293 CG5687 8.23 8.85 10.45 4.99 391 7.15e-12 1.12e-08
FBgn0033958 jef 9.67 7.78 9.47 5.69 369 9.97e-12 1.37e-08
FBgn0004516 Gad1 8.46 8.73 9.72 6.19 355 1.24e-11 1.51e-08
FBgn0037870 CG18577 13.08 1.67 18.19 1.87 347 1.42e-11 1.56e-08
FBgn0033250 CG14762 8.89 9.77 8.92 5.68 335 1.72e-11 1.68e-08
FBgn0038420 CG10311 8.11 7.47 9.56 5.82 331 1.84e-11 1.68e-08
FBgn0031866 Nlg2 8.15 5.97 7.53 5.12 324 2.08e-11 1.73e-08
FBgn0039536 unc80 9.78 8.67 8.93 6.11 317 2.35e-11 1.73e-08
FBgn0004242 Syt1 9.00 9.56 8.40 5.77 317 2.36e-11 1.73e-08
FBgn0002772 Mlc1 9.67 8.90 8.94 9.37 299 3.48e-11 2.32e-08
FBgn0010482 l(2)01289 9.23 9.40 10.29 5.30 294 3.65e-11 2.32e-08
FBgn0031930 CG7025 7.54 8.00 12.47 3.30 292 3.80e-11 2.32e-08
FBgn0000024 Ace 8.64 12.46 7.91 5.01 280 4.83e-11 2.79e-08
FBgn0025837 CG17636 6.84 9.79 9.48 3.82 271 5.80e-11 2.83e-08
FBgn0004117 Tm2 9.58 8.79 8.80 10.01 273 5.99e-11 2.83e-08
FBgn0029814 CG15765 8.75 10.08 8.35 4.37 269 6.00e-11 2.83e-08
FBgn0085427 CG34398 7.68 10.44 5.65 6.06 268 6.12e-11 2.83e-08
FBgn0031908 CG5177 9.67 8.37 7.94 8.29 268 6.30e-11 2.83e-08
FBgn0259896 NimC1 9.69 12.30 9.96 3.88 266 6.44e-11 2.83e-08
FBgn0004575 Syn 8.50 9.24 8.05 6.19 263 6.87e-11 2.90e-08
FBgn0035041 CG13594 9.26 7.59 9.17 3.87 258 7.62e-11 3.02e-08
FBgn0031012 CG8051 6.14 9.91 8.42 5.26 257 7.70e-11 3.02e-08
FBgn0085414 dpr12 8.67 12.12 8.39 4.46 252 8.72e-11 3.21e-08
FBgn0052311 zormin 9.17 10.21 7.28 8.18 252 8.88e-11 3.21e-08

The total number of genes with significant (5% FDR) changes at different time points can
be examined with decideTests.
> summary(decideTests(fit))

X3-X2-X1
NotSig 1850
Sig 9145

112
edgeR User’s Guide

Note that all three spline coefficients should be tested together in this way. It is not meaningful
to replace the F-tests with t-tests for the individual coefficients, and similarly thelogFC columns
of the top table do not have any interpretable meaning. The trends should instead be
interpreted by way of trend plots, as we show now.
Finally, we visualize the fitted spline curves for the top four genes. We start by computing
the observed and fitted log-CPM values for each gene:
> [Link] <- cpm(y, log=TRUE, [Link]=fit$[Link])
> [Link] <- cpm(fit, log=TRUE)

We then loop through the first four genes in the topTags table, plotting the observed and
fitted values for each gene:
> par(mfrow=c(2,2))
> for(i in 1:4) {
+ FlybaseID <- [Link](tab)[i]
+ Symbol <- tab$Symbol[i]
+ [Link].i <- [Link][FlybaseID,]
+ [Link].i <- [Link][FlybaseID,]
+ plot(Hours, [Link].i, ylab="log-CPM", main=Symbol, pch=16)
+ lines(Hours, [Link].i, col="red", lwd=2)
+ }

113
edgeR User’s Guide

amon CG4301
6

6
4

4
log−CPM

log−CPM
2

2
0

0
−2

−2
5 10 15 20 5 10 15 20

Hours Hours

up Mlc2
12

12
10

10
log−CPM

log−CPM
8

8
6

6
4

5 10 15 20 5 10 15 20

Hours Hours

> par(mfrow=c(1,1))

In each plot, the red curve shows the fitted log2-CPM for that genes while the black dots
show the observed log-CPM values. All four of the genes show increased expression during
embryo development, with an up trend especially during the period from 6hrs to 20hrs.

4.8.9 Setup
This analysis was conducted using the following software setup:
> sessionInfo()

R version 4.1.0 beta (2021-05-09 r80275)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 10 x64 (build 19042)

114
edgeR User’s Guide

Matrix products: default

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC MONETARY=English Australia.1252 LC_NUMERIC=C
_ _
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] splines parallel stats4 stats graphics grDevices utils
[8] datasets methods base

other attached packages:


[1] [Link].db_3.13.0 AnnotationDbi_1.53.1 IRanges_2.25.11
[4] S4Vectors_0.29.19 Biobase_2.51.0 BiocGenerics_0.37.5
[7] edgeR_3.33.5 _
limma 3.47.15 knitr_1.33
[10] BiocStyle_2.19.2

loaded via a namespace (and not attached):


[1] Rcpp_1.0.6 XVector_0.31.1 compiler_4.1.0
[4] BiocManager [Link] highr_0.9
_ zlibbioc_1.37.0
[7] tools_4.1.0 statmod_1.4.36 digest_0.6.27
[10] bit_4.0.4 evaluate_0.14 RSQLite_2.2.7
[13] memoise_2.0.0 lattice_0.20-44 pkgconfig_2.0.3
[16] png_0.1-7 rlang_0.4.11 DBI_1.1.1
[19] yaml_2.2.1 xfun_0.22 fastmap_1.1.0
[22] stringr_1.4.0 httr_1.4.2 Biostrings_2.59.3
[25] vctrs_0.3.8 locfit_1.5-9.4 bit64_4.0.5
[28] grid_4.1.0 R6_2.5.0 rmarkdown_2.8
[31] blob_1.2.1 magrittr_2.0.1 htmltools_0.5.1.1
[34] KEGGREST_1.31.2 stringi_1.6.1 cachem_1.0.4
[37] crayon_1.4.1

115
Bibliography

1. Benjamini, Y. and Hochberg, Y. (1995). Controlling the false discovery rate: a


practical and powerful approach to multiple testing. Journal of the Royal Statistical
Society Series B 57, 289–300.
2. Brooks, A.N., Yang, L., Duff, M.O., Hansen, K.D., Park, J.W., Dudoit, S., Brenner,
S.E., and Graveley, B.R. (2011). Conservation of an RNA regulatory map between
Drosophila and mammals. Genome Res 21, 193–202.
3. Chen, Y., Lun, A.T.L., and Smyth, G.K. (2014). Differential expression analysis of
complex RNA-seq experiments using edgeR. In S. Datta and D.S. Nettleton, editors,
Statistical Analysis of Next Generation Sequence Data, pages 51–74. Springer, New
York.
4. Chen, Y., Pal, B., Visvader, J.E., and Smyth, G.K. (2017). Differential methylation
analysis of reduced representation bisulfite sequencing experiments using edgeR.
F1000Research 6, 2055.
5. Cox, D.R. and Reid, N. (1987). Parameter orthogonality and approximate conditional
inference. Journal of the Royal Statistical Society, Series B 49, 1–39.
6. Cumbie, J.S., Kimbrel, J.A., Di, Y., Schafer, D.W., Wilhelm, L.J., Fox, S.E., Sullivan,
C.M., Curzon, A.D., Carrington, J.C., Mockler, T.C., and Chang, J.H. (2011).
Gene-counter: A computational pipeline for the analysis of RNA-Seq data for gene
expression differences. PLoS ONE 6, e25279.
7. Dai, Z., Sheridan, J.M., Gearing, L.J., Moore, D.L., Su, S., Wormald, S., Wilcox, S.,
O’Connor, L., Dickins, R.A., Blewitt, M.E., and Ritchie, M.E. (2014). edgeR: a versatile
tool for the analysis of shRNA-seq and CRISPR-Cas9 genetic screens. F1000Res 3, 95.
8. Du, P., Zhang, X., Huang, C.C., Jafari, N., Kibbe, W.A., Hou, L., and Lin, S.M.
(2010). Comparison of Beta-value and M-value methods for quantifying methylation
levels by microarray analysis. BMC Bioinformatics 11, 587.
9. Dunn, P.K. and Smyth, G.K. (2018). Generalized Linear Models With Examples in R.
Springer-Verlag, New York.
10. Feng, H., Conneely, K.N., and Wu, H. (2014). A Bayesian hierarchical model to detect
differentially methylated loci from single nucleotide resolution sequencing data. Nucleic
Acids Research 42, e69–e69.
11. Frazee, A.C., Langmead, B., and Leek, J.T. (2011). ReCount: a multi-experiment
resource of analysis-ready RNA-seq gene count datasets. BMC Bioinformatics 12, 449.

116
edgeR User’s Guide

12. Fu, N.Y., Rios, A., Pal, B., Soetanto, R., Lun, A.T.L., Liu, K., Beck, T., Best, S.,
Vaillant, F., Bouillet, P., Strasser, A., Preiss, T., Smyth, G.K., Lindeman, G., , and
Visvader, J. (2015). EGF-mediated induction of Mcl-1 at the switch to lactation is
essential for alveolar cell survival. Nature Cell Biology 17, 365–375.
13. Gahurova, L., Tomizawa, S.i., Smallwood, S.A., Stewart-Morgan, K.R., Saadeh, H.,
Kim, J., Andrews, S.R., Chen, T., and Kelsey, G. (2017). Transcription and chromatin
determinants of de novo DNA methylation timing in oocytes. Epigenetics & chromatin
10, 25.
14. Graveley, B.R., Brooks, N., Carlson, J.W., Duff, M.O., Landolin, J.M., Yang, L.,
Artieri, G., van Baren, M.J., Boley, N., Booth, B.W., Brown, J.B., Cherbas, L., Davis,
C.A., Dobin, A., Li, R., Lin, W., Malone, J.H., Mattiuzzo, N.R., Miller, D., Sturgill, D.,
Tuch, B.B., Zaleski, C., Zhang, D., Blanchette, M., and Dudoit, S. (2011). The
developmental transcriptome of drosophila melanogaster. Nature 471, 473–479.
15. Hansen, K.D., Irizarry, R.A., and Zhijin, W. (2012). Removing technical variability in
RNA-seq data using conditional quantile normalization. Biostatistics 13, 204–216.
16. International HapMap Consortium, T. (2005). A haplotype map of the human genome.
Nature 437, 1299–1320.
17. Krueger, F. and Andrews, S.R. (2011). Bismark: a flexible aligner and methylation
caller for Bisulfite-Seq applications. bioinformatics 27, 1571–1572.
18. Law, C.W., Chen, Y., Shi, W., and Smyth, G.K. (2014). Voom: precision weights
unlock linear model analysis tools for RNA-seq read counts. Genome Biology 15, R29.
19. Liao, Y., Smyth, G.K., and Shi, W. (2013). The Subread aligner: fast, accurate and
scalable read mapping by seed-and-vote. Nucleic Acids Research 41, e108.
20. Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general-purpose
read summarization program. Bioinformatics 30, 923–930.
21. Liao, Y., Smyth, G.K., and Shi, W. (2019). The R package Rsubread is easier, faster,
cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic
Acids Research 47, e47.
22. Lun, A.T.L., Chen, Y., and Smyth, G.K. (2016). It’s DE-licious: a recipe for differential
expression analyses of RNA-seq experiments using quasi-likelihood methods in edgeR.
Methods in Molecular Biology 1418, 391–416.
23. Lund, S., Nettleton, D., McCarthy, D., and Smyth, G. (2012). Detecting differential
expression in RNA-sequence data using quasi-likelihood with shrunken dispersion
estimates. Statistical Applications in Genetics and Molecular Biology 11, Article
Number 8.
24. Marioni, J.C., Mason, C.E., Mane, S.M., Stephens, M., and Gilad, Y. (2008). RNA-seq:
An assessment of technical reproducibility and comparison with gene expression arrays.
Genome Res 18, 1509–1517.
25. McCarthy, D.J., Chen, Y., and Smyth, G.K. (2012). Differential expression analysis of
multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids
Research 40, 4288–4297.
26. McCarthy, D.J. and Smyth, G.K. (2009). Testing significance relative to a fold-change
threshold is a TREAT. Bioinformatics 25, 765–771.

117
edgeR User’s Guide

27. Meissner, A., Gnirke, A., Bell, G.W., Ramsahoye, B., Lander, E.S., and Jaenisch, R.
(2005). Reduced representation bisulfite sequencing for comparative high-resolution
DNA methylation analysis. Nucleic acids research 33, 5868–5877.
28. Phipson, B., Lee, S., Majewski, I.J., Alexander, W.S., and Smyth, G.K. (2016). Robust
hyperparameter estimation protects against hypervariable genes and improves power to
detect differential expression. Annals of Applied Statistics 10, 946–963.
29. Pickrell, J.K., Marioni, J.C., Pai, A.A., Degner, J.F., Engelhardt, B.E., Nkadori, E.,
Veyrieras, J.B., Stephens, M., Gilad, Y., and Pritchard, J.K. (2010). Understanding
mechanisms underlying human gene expression variation with RNA sequencing. Nature
464, 768–772.
30. Pickrell, J.K., Pai, A.A., Gilad, Y., and Pritchard, J.K. (2010). Noisy splicing drives
mRNA isoform diversity in human cells. PLoS Genetics 6, e1001236.
31. Risso, D., Schwartz, K., Sherlock, G., and Dudoit, S. (2011). GC-content normalization
for RNA-Seq data. BMC Bioinformatics 12, 480.
32. Robinson, M., McCarthy, D., and Smyth, G. (2010). edgeR: a Bioconductor package
for differential expression analysis of digital gene expression data. Bioinformatics 26,
139–140.
33. Robinson, M.D. and Oshlack, A. (2010). A scaling normalization method for
differential expression analysis of RNA-seq data. Genome Biology 11, R25.
34. Robinson, M.D. and Smyth, G.K. (2007). Moderated statistical tests for assessing
differences in tag abundance. Bioinformatics 23, 2881–2887.
35. Robinson, M.D. and Smyth, G.K. (2008). Small-sample estimation of negative binomial
dispersion, with applications to SAGE data. Biostatistics 9, 321–332.
36. Schübeler, D. (2015). Function and information content of DNA methylation. Nature
517, 321–326.
37. Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl,
D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014). Genome-scale
CRISPR-Cas9 knockout screening in human cells. Science 343, 84–7.
38. Smyth, G.K. (2004). Linear models and empirical Bayes methods for assessing
differential expression in microarray experiments. Statistical Applications in Genetics
and Molecular Biology 3, Article 3.
39. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette,
M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and Mesirov, J.P.
(2005). Gene set enrichment analysis: a knowledge-based approach for interpreting
genome-wide expression profiles. Proc Natl Acad Sci USA 102, 15545–50.
40. Tuch, B.B., Laborde, R.R., Xu, X., Gu, J., Chung, C.B., Monighetti, C.K., Stanley, S.J.,
Olsen, K.D., Kasperbauer, J.L., Moore, E.J., Broomer, A.J., Tan, R., Brzoska, P.M.,
Muller, M.W., Siddiqui, A.S., Asmann, Y.W., Sun, Y., Kuersten, S., Barker, M.A.,
Vega, F.M.D.L., and Smith, D.I. (2010). Tumor transcriptome sequencing reveals allelic
expression imbalances associated with copy number alterations. PLoS ONE 5, e9317.
41. Wu, D., Lim, E., Vaillant, F., Asselin-Labat, M., Visvader, J., and Smyth, G. (2010).
ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics 26,
2176–2182.

118
edgeR User’s Guide

42. Wu, D. and Smyth, G. (2012). Camera: a competitive gene set test accounting for
inter-gene correlation. Nucleic Acids Research 40, e133.

119

You might also like