0% found this document useful (0 votes)
68 views4 pages

Purines vs Pyrimidines Explained

This document provides an overview of the molecular structures of DNA, RNA, and proteins. It defines key terms like nucleotides, nucleic acids, and nitrogenous bases. It describes the double-helix structure of DNA, composed of deoxyribose, phosphate groups, and complementary nucleotide base pairing. RNA is single-stranded with ribose and uracil replacing thymine. The central dogma of molecular biology explains that DNA codes for RNA, which codes for proteins. There are four levels of protein structure from primary to quaternary. Activities provide practice with DNA/RNA base pairing, transcription, and translation.
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
68 views4 pages

Purines vs Pyrimidines Explained

This document provides an overview of the molecular structures of DNA, RNA, and proteins. It defines key terms like nucleotides, nucleic acids, and nitrogenous bases. It describes the double-helix structure of DNA, composed of deoxyribose, phosphate groups, and complementary nucleotide base pairing. RNA is single-stranded with ribose and uracil replacing thymine. The central dogma of molecular biology explains that DNA codes for RNA, which codes for proteins. There are four levels of protein structure from primary to quaternary. Activities provide practice with DNA/RNA base pairing, transcription, and translation.
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

General Biology 2

Lesson 4: Molecular Structure of DNA, RNA, and Proteins


Learning Objectives:
At the end of the lesson, the learners will be able to:
• describe the building blocks of DNA, RNA and proteins;
• identify the structural and functional differences between DNA and RNA and
• explain the different levels of protein structure
Terms-to-know
• Nucleotides - any member of a class of organic compounds in which the molecular structure
comprises a nitrogen-containing unit (N-base) linked to a five-carbon sugar and a phosphate
group (with negative charges). The nucleotides are of great importance to living organisms, as
they are the building blocks of nucleic acids, the substances that control all hereditary
characteristics.

• Nucleic acid - are the biopolymers, or large biomolecules, essential to all known forms of life.
The term nucleic acid is the overall name for DNA and RNA.
• Nitrogenous bases - are either purines or pyrimidines.
• Purine bases have double-ringed structure. e.g. Adenine (A) and Guanine (G).
• Pyrimidines have single-ringed structure. e.g. Cytosine (C), Thymine (T, in DNA only) and
Uracil (U, found only in RNA)
• The 5' and 3' mean "five prime" and "three prime", which indicate the carbon numbers in the
DNA's sugar backbone. The 5' carbon has a phosphate group attached to it and the 3' carbon a
hydroxyl (-OH) group. This asymmetry gives a DNA strand a "direction".
The Central Dogma of Molecular Biology
- is the basic underlying principle in the field of genetics. This explains that DNA codes for RNA, which
codes for proteins.

DNA or Deoxyribonucleic Acid


-genetic material passed on from parents to offspring. It contains the instructions necessary for survival
of every organism.
-DNA model is a double helix structure that twists spirally, similar to a twisted ladder or a spiral staircase.
- The two helices may coil either clockwise or counter-clockwise.
- Its backbone or building block is nucleotide which is composed of a phosphate group, a pentose sugar
and a nitrogenous base.
- The sugar group is called deoxyribose. The prefix deoxy means that it is a ribose that has lost one
oxygen atom.
- the nucleotides present are Adenine, Thymine, Guanine and Cytosine
- The rule in a complementary nitrogenous base pairing is that a purine should always be paired with a
pyrimidine. So, in the case of DNA guanine will always be paired with cytosine while adenine will always
be paired with thymine. In the case of RNA thymine is replaced by uracil.
- When nucleotides are incorporated into DNA, adjacent nucleotides are linked by a phosphodiester
bond: a covalent bond is formed between the 5’ phosphate group of one nucleotide and the 3’-OH group
of another (see below). In this manner, each strand of DNA has a “backbone” of phosphate-sugar-
phosphate-sugar-phosphate.

RNA or Ribonucleic acid


- information in the form of base sequence is transformed (transcribed) into mRNA, tRNA and rRNA. DNA
is the template copied into RNA by base pairing.
- is a single stranded molecule that is also composed of nucleotides with a few modifications
- The sugar backbone of RNA is ribose
- the nucleotides present are Adenine, Uracil, Guanine and Cytosine
- the complementary base pairing is G with C; A with U.

Transcription
-DNA Transcription in nature is the process of converting a template strand of DNA into RNA. Specifically,
RNA is complementary to the DNA strand. That is Guanines (G’s) are replaced with Cytosines (C’s),
Thymines (T’s) are replaced with Adenines (A’s), and importantly Adenines (A’s) are replaced with Uracil.
- Example:
DNA 5' - ACATAGGCCTAC - 3'
RNA 5' - GUAGGCCUAUGU - 3'
You’ll notice that reading top from bottom, left to right this doesn’t make any sense. It’s a common
mistake. The two complementary strands need to be read from the 5’ to the 3’ end for the DNA strand
and from the 3’ to the 5’ end for the RNA strand. This is very important to remember when using real
datasets. The 5’ to 3’ DNA strand is called the template strand. The 3’ to 5’ complementary DNA strand is
called the non-template strand. In this case our non-template DNA strand would be 3’ – TGTATCCGGATG
– 5’.
Proteins
- amino acids are building blocks of protein
- are the final products in the central dogma of molecular biology. Executes cellular functions.
- they are called the building blocks of life because they have diverse functions in the body
- also aids in transporting molecules around your body, acts as enzymes, and acts as a passage way of
molecules and substances into and out of the cell.

- Amino acids are building blocks of protein. Scientists have identified 20 amino acids so far. These amino
acids can potentially be configured to unique information carrying structures. The property of proteins is
determined by the order of amino acids in the polypeptide.
- The codon alphabet is used to translate the mRNA sequence

- The four structural levels of proteins are:


• Primary- sequence of amino acids in the polypeptide chain;
• Secondary- when the polypeptide chains form a helix or a pleated sheet structure;
• Tertiary- coiling of the polypeptide, combining helices and sheet forms;
• Quaternary- the association of two or more polypeptides in space
Summarized table

The process of central dogma


- DNA codes for proteins through the process of transcription and translation.
- DNA transcription is the first process wherein the important information in the DNA is copied into the
mRNA.
- The next step is DNA translation wherein information sent by the mRNA is analyzed with the help of
ribosomes. The ribosome translate the mRNA code into the proper protein format
Sample Problem:
Given the following coding sequence for DNA, provide the sequence of the complementary (template)
sequence.
Coding sequence:
5’ ATGCATAGATTAGGATATCCCAGATAG 3’
(Answer)
Complementary sequence:
3’ TACGTATCTAATCCTATAGGGTCTATC 5’
Activity 7
Provide the complementary base for each item
DNA RNA
1. A 5. U
2. G 6. G
3. C 7. C
4. T 8. A
Provide the complementary base for each item (DNA)
• CGC GAA TTA ATA TCC GCG
• GGC TCT AAT AGC GAT CAG
• ATA AGG CGA TTT AAC CCG
Activity 8
• Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding/ Template sequence:
3’ TACGTATCTAATCCTATAGGGTCTATC 5’

• Translate the given mRNA transcript into a polypeptide sequence(use the codon alphabet):

Coding sequence ~ mRNA transcript :


5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
-END-

You might also like