2/23/2021 PCR primer design guidelines

Genetic Education

Home About us  DNA Extraction Cytogenetics DNA PCR technology

Our Products Meet Dr Tushar Chauhan

Genetic Education PCR technology

PCR primer design guidelines

19/08/2018 10 Comments

[Link] 1/33
2/23/2021 PCR primer design guidelines

PCR primer design guideline: PCR primers are similar as like primer

involved in DNA replication in vivo, however, the PCR primers are DNA

primers (in vivo primers are RNA primers).

The PCR reaction cannot be completed without the primers, why?

Because the DNA primer used in the amplification facilitates the 3′ end to
the Taq DNA polymerase for initiating the amplification.

Once the Primer: DNA junction is recognised by the Taq DNA polymerase, it

starts adding dTNPs to the DNA strand and synthesise the new DNA
strand.

In this article, we are discussing the role of PCR primer and their properties
along with the PCR primer design guidelines as well.

The content of the article is,

What is PCR primer?

Properties of PCR primers

How to design PCR primers

Different types of PCR primers

Conclusion

[Link] 2/33
2/23/2021 PCR primer design guidelines

Key Topics: 
What is PCR primer?
The primer used in PCR:
Properties of PCR primers
Annealing temperature:
Length of the primers:
GC content of primers:
Complementation in forward and reverse primers:
Repeat bases in primers:
How to design PCR primers?
Different types of PCR primers:
Universal primers:
Target specific primers:
Degenerate primers:
Nested primers:
Inverse primers:
Conclusion:

What is PCR primer?

“PCR primers are short single-stranded DNA sequences which
help in the amplification of DNA during PCR reaction.”

PCR technique is one of the most anticipated technique is genetic science,

as it facilitates replication of DNA in vitro, Each and every component of P

CR reaction are equally important.

dNTPs, PCR buffer, primer, water, Taq DNA polymerase and template DNA

are the major ingredient for PCR reaction. 

[Link] 3/33
2/23/2021 PCR primer design guidelines

PCR reaction completes in three steps (denaturation, annealing and

extension). In denaturation, the double-stranded DNA becomes single-

stranded (DNA denatured), in the annealing step, the primer binds with its

complementary sequence and in elongation step, with the help of dNTPs

and Taq DNA polymerase the growing DNA strand expands. 

The figure below,

Generally, PCR primers are DNA primers. As we all know that in replication

short RNA primers are involved instead of DNA primer while in PCR we are

using DNA primer. There are several assumptions that favour the use of
DNA primer in PCR :

[Link] 4/33
2/23/2021 PCR primer design guidelines

1. DNA primers are more temperature stable than RNA primers.

2. The process of DNA polymerization in PCR is unidirectional so there

is no chance of removal of short RNA primer after the polymerization is

completed.

3. Additionally, DNA polymerase I help in removing of short RNA primer

in replication in vivo which is not present in PCR. 

The polymerase used in PCR is thermostable and it does not have

proofreading activity. For more detail on Taq DNA polymerase, read the

article: Function of taq DNA polymerase in PCR

Ultimately, we are interested in studying DNA not RNA that is the reason

we want only DNA primer for PCR.

Before we go in depth to PCR Primer design guidelines, we have to

understand several terminologies.

The first and foremost is melting temperature and annealing temperature

of DNA.

Melting temperature is a temperature at which the half on the DNA

(template DNA) is broken opens.  The melting temperature of DNA

depends on the GC and AT content of DNA. We know why, right.

The primer binds to the DNA has the same melting temperature as its

template. Otherwise, if the temperature is not appropriate then it binds

other than its target site.

[Link] 5/33
2/23/2021 PCR primer design guidelines

Image credit: [Link]/

The annealing temperature is a temperature which required to anneal or

bind primer to its complementary strand. The annealing temperature varies

from primer to primer.

The primer used in PCR:

Each enzyme required a co-factor and a substrate for completion of the

enzymatic reaction, therefore, Taq DNA polymerase required free 3’OH end

for starting the polymerization. The primer provides a free 3’ OH end for

polymerase and it is work as a substrate for the enzyme to work.

Properties of PCR primers

Annealing temperature:

[Link] 6/33
2/23/2021 PCR primer design guidelines

A temperature at which primer can bind to its complementary sequence is

called an annealing temperature.

The annealing temperature is a very important parameter in designing a

DNA primer. Annealing temperature should be 5ºC lower than the melting

temperature. Melting temperature of the primer is calculated using the

formula below,

Tm= 4 (G + C) + 2 (A + T)

An ideal annealing temperature of the primer is ranging between 56ºC to

65ºC. Variation in this range hinders PCR amplification.

If the annealing temperature is too low, the primer can bind to any of the

complementary sequences and gives a non-specific result. The primer

cannot bind if the annealing temperature is too high.

Length of the primers:

Primers are short sequences, generally, 18 to 23 nucleotide long primer

always give the best result in PCR. Shorter primers (>18bp) do not have the

affinity to amplify properly in each cycle.

If the primer is too short, annealing temperature becomes lower and it

reduces amplification capacity.

[Link] 7/33
2/23/2021 PCR primer design guidelines

Long primers are also not recommended because the annealing

temperature of the long primer is too high, it leads to non-specific binding. 

However, a long primer is highly specific in long-range PCR.

GC content of primers:

Another important factor in designing the primer is GC content. GC content

between 40% to 60% is acceptable. The annealing temperature of the

primer between 55ºC  to 65ºC  with 50% GC perform better. 

If GC content is too high, at given annealing temperature primer will

mismatch with other sequences. Additionally, GC reach sequences are

highly non-specific. The chance of non-specific amplification in GC rich

region is very high as compared to the AT-rich region.

It is critical to understand that if 8 to 10 bases of primer will match with

other sequences and the annealing temperature is too low, it definitely

amplifies the DNA but gives the false result.

Complementation in forward and reverse

primers:

While designing primer, keep in mind that both forward and reverse primer

do not match with each other or are not complementary with each other.

Otherwise, instead of binding with target sequences, both primer will bind

with each other and creates a dimer.

[Link] 8/33
2/23/2021 PCR primer design guidelines

See the figure below,

Image description: A. the specific binding of primers, B. The primer-dimer formation and amplification of
primer dimes and C. The non-specific binding of PCR primers.

More than 4 complementary bases and lower annealing temperature

induces dimer formation.  When primers are bind with each other instead
of binding with the target sequence, it creates a dimer. Dimers can easily

be amplified in PCR because it is shorter sequences of up to 50 to 60 bp.

Repeat bases in primers:

Repeated bases can bind within the primer and makes primer non-active. If

some of the dinucleotides or trinucleotide are repeated in primer, it binds

within the primer and creates a hairpin loop.

[Link] 9/33
2/23/2021 PCR primer design guidelines

More specifically, if repeat bases are present on the terminal end of 3’ end

it will create a serious problem in PCR.

Read further,

1. What is in situ PCR?

2. What is gene editing and CRISPR-CAS9?

How to design PCR primers?

During my research works my topics are majorly PCR centred. I want to

share my experience on how we can successfully design a primer.

Firstly, Identify your template sequence.

It is very important to identify which gene or DNA fragment we want to

amplify. Identify that sequence and obtain it from NCBI.

Now go to the primer 3 software which is open access and freely available

primer designing tool and it is widely accepted. However, each primer

designing companies have their own primer design software.

You can go to primer 3 from here: [Link]

Actually, I think you should try it side by side in another tab. I will Give you

one sequence,

[Link] 10/33
2/23/2021 PCR primer design guidelines

This is a beta-globin gene sequence (copy and paste it in a box of primer

3)

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCAT

GGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG

GTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGT

TACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGA

AGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTT

CCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGT

CCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA

GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTG

GACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGC

TGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTT

[Link] 11/33
2/23/2021 PCR primer design guidelines

TCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTA

ACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAA

GTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTT

TTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATAC

TTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAA

GTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAAT
ATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTT

TAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAAT

ATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAA

AATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCC

TAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACC

ATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCT

GCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTG

CTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGAT

AAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATA

CCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGG

CCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAA

AGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGC

TTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTA

CTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAA

AAAACATTTATTTTCATTGC

[Link] 12/33
2/23/2021 PCR primer design guidelines

select your option for forward and reverse primer as indicated by arrow.

Now select the options for forward primer and reverse primer shown as red

arrows. Never select the option given in the middle (labelled as black)

because we want to run the simple PCR hence we do not need a probe.

In the next step just for understanding read the information given on

primer-3 page, read the specification but do not click on any of the boxes

because all the information is automatically or by default set by the

software.

[Link] 13/33
2/23/2021 PCR primer design guidelines

Click on pic primer button

In the next step as shown in the figure, click on the “Pick primer” button

and wait for the result.

[Link] 14/33
2/23/2021 PCR primer design guidelines

The result of primer 3. The red underline line is the length of the PCR product.

The primer 3 output is shown in the figure (above). Analyze first the result

window. You can see that the parameters like the length of the primer, GC

content, annealing temperature and hairpin formation all are under the

standard criteria.

Now take a look at the red line. The primer gives you 231bp fragment so

when you run the PCR based on the criteria of this primer, your product

should be 231.

The arrows (>>>>>> and <<<<<<<) shows the annealing site of primer to

your sequence. Additionally, the software gives you other pairs of possible

[Link] 15/33
2/23/2021 PCR primer design guidelines

primers in the bottom as shown in the figure (Below).

The other sets of primer from primer 3 software.

Your primer is ready for the order. In the next step find out the company

which gives service in your area. Send them the detail or fill the online form

of primer detail. While filling the detail, keep backcrossing your sequence.

If you made a mistake in a single base, you will not get the PCR result or

false result.

You will receive the primers in precipitated form with one primer

specification paper as shown in the figure. 

The primer specification report. The report is from our standard protocol and just for your
understanding.

[Link] 16/33
2/23/2021 PCR primer design guidelines

The specification paper has all the information regarding the primer. It

contains the yield at 260nm OD, a sequence of primer, the yield of primer in

microgram, the yield of primer in nano mol and other specification as

shown in the figure (above).

Our primer is in the form of the solid precipitate. We have to revive it for

further use. Recall the PCR procedure, we need an approximately 10pmol

primer for our PCR reaction.

We have covered an article on DNA precipitation please read the article for
a detailed understanding of DNA precipitation. read the article here: Role o
f alcohol in DNA extraction

Suppose the given concentration of or primer is 29.1nM. When we add PCR

grade water of 291µl to the primer tube, the final concentration of our tube

become 100pM/µl.

Do all the procedure in a sterile area now gently try to dissolve the primer

in water. This concentration is our stock concentration of PCR primer.   

To achieve 10pmol final concentration for PCR reaction, take 1microliter

from the stock primer and add 9µl of water (again PCR grade) to it. Now

our primer with 10 pM/µl concentration is read. We can use 1µl from this

working.

[Link] 17/33
2/23/2021 PCR primer design guidelines

Different types of PCR primers:

For different reaction, different types of PCR primers are used it depends

on which types of polymerase chain reaction we are performing.

Depending upon that, different types of primers are enlisted here,

Universal primers:

Primers that can be used in any types of PCR reaction are called universal

primers. For example, the primer used in the RAPD is universal primers

used in the phylogenetic analysis of plant species.

Less expertise is required to deal with this type of primers because in each

reaction the annealing temperature of the primers remains the same.

Furthermore, universal primers are used in the cloning vector DNA

amplification.


Target specific primers:

 This type of primer is exclusively for the specific sequence or the gene of

 our interest. The specific primers cannot bind to other location into the

gnome. In contrast, universal primers can bind to any location where its

complementary sequences are present.

For designing the target-specific primer, we have to follow the above

guidelines. It is highly sequence-specific, that is why these primers are

[Link] 18/33
2/23/2021 PCR primer design guidelines

more suitable more encountering specific mutations. The success of

amplification reaction depends on the annealing temperature.

Degenerate primers:

For amplification and analysis of microbial samples, the degenerative

primers are highly recommended. The degenerate primers have the same

DNA sequences but are not exactly the same. By using this type of primers,

the same gene in two different organisms can be amplified and variation

among the species can be determined.

Nested primers:

Nested primers are a special type of primers used into the nested PCR reac

tion. Two sets of primers are used to amplify the gene in which one set of

primer is nested. This nested set of primer binds to the amplified product

on the first set of primer.

The nested primer increases the chance of specific amplification by

reducing the non-specific bindings.

[Link] 19/33
2/23/2021 PCR primer design guidelines

Inverse primers:

Inverse primers are the primer having the 3′ end outside of the template

DNA, therefore, it amplified DNA other than the target DNA.

Inverse primers are used majorly into the site-directed mutagenesis and in

vitro mutagenesis. Further, it is widely applicable in plasmid studies.

See the figure below, how inverse primer amplify the DNA.

[Link] 20/33
2/23/2021 PCR primer design guidelines

External resources:

Conclusion:
For long-term use of primer revive all the primer tubes in TE buffer and

make different aliquots of the tubes. Store all tubes in -20°C. 10 pM/µl

concentration is sufficient for the 25µl PCR reaction, excess concentration

of primer results in dimers and non-specific binding.

I have covered all point on PCR primer design guideline. You can comment

below if any point is missing. Conclusively, using our PCR primer design

guidelines, you can successfully obtain a result without any hindrance.  

Article written by: Tushar Chauhan

Article reviewed by: Tushar kachhadiya

[wp_ad_camp_2]

[Link] 21/33
2/23/2021 PCR primer design guidelines

Share this:

 Twitter  Facebook  Print  Pinterest  More

Comparison Between DNA 10 secrets to Prepare a PCR "Primer Dimer": Zones DNA
Primer And RNA Primer:  reaction amplification by pairing with
foe oligo

Share Article:     

[Link]

Tags: DNA primer PCR primer primer design guidelines

Dr Tushar Chauhan

  

[Link] 22/33
2/23/2021 PCR primer design guidelines

16/08/2018
DNA Fingerprinting- Definition, Steps, Methods and
Applications

22/08/2018
DNA Packaging in Eukaryotes

10 Comments

nicholas on 22/11/2020

how are primers synthesized, please tell me full process of synthesis

how to get right amount of primers

Reply

[Link] 23/33
2/23/2021 PCR primer design guidelines

Mari on 26/05/2020

loved the description, that helped me to better understand the concept. Thanks

I have a question please. The primers designed will not amplify the whole gene of
interest but only a portion of it.

Reply

Dr Tushar Chauhan on 26/05/2020

It depends whether you have designed primers covering the whole

gene or some portion of a gene.

Reply

naila on 14/05/2020

[Link] 24/33
2/23/2021 PCR primer design guidelines

best article, i really liked. from theory to practical

everything is there.

Reply

Dr Tushar Chauhan on 16/05/2020

Thank you

Reply

Dr Tushar Chauhan on 22/05/2020

Thank you Naila.

Reply

[Link] 25/33
2/23/2021 PCR primer design guidelines

dr saliha on 05/03/2020

loved the description

Reply

Dr Tushar Chauhan on 05/03/2020

Thank you Dr saliha

Reply

haleema on 06/10/2019

it a good article for clearing the concepts

Reply

[Link] 26/33
2/23/2021 PCR primer design guidelines

Dr Tushar Chauhan on 07/10/2019

thank you haleema

Reply

Leave a Reply
Enter your comment here...

Search in resources... 

Visit [Link]

The karyotypinghub is a place to learn karyotyping and cytogenetics:

[Link] 27/33
2/23/2021 PCR primer design guidelines

Our ebook

Buy our eBook “From DNA extraction to PCR” from here:

[Link] 28/33
2/23/2021 PCR primer design guidelines

Recent Posts

What is Heterochromatin?- Definition, Structure, Types and Function

The Concept of ChIP-Seq (ChIP-sequencing) Explained

Factor Affecting DNA Agarose Gel Electrophoresis Results

Genetic Engineering: Importance and Educational Requirements

Explaining the Ct value (Threshold Cycle) of qPCR

Categories

[Link] 29/33
2/23/2021 PCR primer design guidelines

Books (1)

Chromosomal Aberration (4)

Chromosomes (7)

Comparisons (1)

COVID-19 (3)

CRISPR-CAS9 (1)

Cytogenetics (10)

DNA (42)

DNA Extraction (11)

DNA fingerprinting (2)

DNA packaging (2)

DNA sequencing (10)

DNA topology (2)

Epigenetics (3)

Extrachromosomal inheritance (2)

Gel electrophoresis (8)

Gel electrophoresis (2)

Gene therapy (11)

Genes (15)

[Link] 30/33
2/23/2021 PCR primer design guidelines

Genetic Education (235)

Genetic Engineering (11)

Genetic Test (12)

Genetics (7)

Genome (7)

Immunogenetics (3)

Miscellaneous (14)

Mutation (8)

PCR technology (40)

Real-time PCR (4)

Replication (8)

Reviews (2)

RNA (8)

Stories (1)

Transposons (9)

Trisomy (3)

Home

[Link] 31/33
2/23/2021 PCR primer design guidelines

About Us

Contact Us

Disclaimer

Privacy Policy

Subscribe to Blog via Email

Enter your email address to subscribe to this blog and receive notifications of new posts by email.

Email Address

Subscribe

Archives

Select Month

Genetic Education
 © 2020 Genetic Education Inc. All rights reserved.

[Link]

[Link] 32/33
2/23/2021 PCR primer design guidelines

[Link] 33/33