Lab #3 PCR
Objectives:
1. Extract Azotobacter vinelandii genomic DNA.
2. Use polymerase chain reaction (PCR) to amplify a stretch of vnf operon from the
Azotobacter vinelandii genomic DNA.
3. Use agarose gel electrophoresis to separate amplified DNA according to size.
4. Separate and visualize the PCR product using agarose gel electrophoresis.
Introduction:
The Polymerase Chain Reaction (PCR) is a molecular biology technique used to
amplify specific DNA sequences in a complex mixture when the ends of the sequence are
known. Kary Mullis was awarded the 1993 Nobel Prize in Chemistry for his contribution
in developing the PCR technique, which has, since the early 80’s, revolutionized
biochemistry, molecular biology, genetics, medicine, and forensics. There is a wealth of
information available on the topic of PCR.
The technique involves repetitive cycles of annealing (cooling), synthesis
(polymerization), and melting (heating) of the sequence of interest. A small amount of
DNA template (in our case, Genomic DNA isolated from Azotobacter vinelandii) is
mixed with short, synthetic oligonucleotides which are complementary to the 3’ ends of
the target DNA sequence. The mixture is supplied with a source of deoxynucleotides and
a temperature-resistant DNA polymerase, usually Taq polymerase. This enzyme, which
in nature is found in Thermus aquaticus (a hot spring-loving bacterium), can catalyze the
polymerization reaction at temperatures up to 72 ºC. The experiment begins when the
mixture is heated up to 95 ºC to allow for the melting of template, double-stranded DNA.
Then the temperature is lowered to approximately 60 ºC (this temperature depends on the
theoretical primer-DNA target annealing temperature) so as to facilitate the annealing of
the primers to their complementary DNA strand, after which the temperature is increased
to the optimum for Taq polymerase activity. Multiple rounds of this cycle yield billions
of copies of DNA template manufactured at exponential rates.
In today’s lab we will isolate Genomic DNA from Azotobacter vinelandii (strain
DJ995MoFe) so as to be used as a template on a PCR experiment. A stretch of DJ33VFe
vnf operon (1558bp), encompassing the genes vnfD and vnfG, will be the target for
amplification using primers BBP456
(CACATCTATCTGAAGGCGCCCAACGAGGAC) and BBP520
(GAAACGCTCGCGGACATCGTTGGCCATAGCCAGG). This piece of DNA was
genetically modified in Escherichia coli and reinserted back in to the A. vinelandii
genome. As a result, the stretch of wild-type, vnf operon was substituted by a vnf
sequence that now contains a HindIII restriction site not found in the wild-type sequence,
and a series of histidine codons on the 3’ end vnfD (which translate into a VnfD protein
having 6 histidine residues on its C-terminal end). This DNA product will then be
visualized using DNA chromatographic techniques.
Lab Flow Chart:
Laboratory Report:
Refer to the syllabus for general guidelines.
The final report should be 2-3 pages in length.
The results and discussion sections should include the following:
A trimmed photo of the agarose gel with each well properly labeled. The
DNA ladder should also be appropriately labeled with the molecular
weigh marker values.
What variables need to be considered when setting up a PCR reaction (e.g.
temperature, time, DNA concentration, etc.)?
How would you go about optimizing a reaction that gave you little or no
PCR product?
What would you do if you observed a smeared band instead of a single
band on the agarose gel?
Using the sequence of the primers and the BLAST application in
[Link] find the sequence
of the ~ 1550bp, wild-type vnf operon.
Experimental Protocol #3
Day 1
The first step to conduct today’s PCR experiment will be the isolation of
genomic DNA from A. vinelandii strain DJ995MoFe. The cells will be subjected
to a lysis procedure to liberate the cytosolic content. This fraction will be treated
with subsequent alcohol precipitations, after which a crude preparation of
genomic DNA almost-free of protein and lipid impurities is obtained. This DNA
preparation will be used as the template for our PCR experiment.
Materials and Apparatus
Isolation of Genomic DNA PCR Experiment
Triton X-100 10x taq buffer
Sterile Water Sterile Water
Isopropyl Alcohol Crudely Isolated Genomic DNA
Ethanol Primer BBP456
5mM Tris-HCl ph 8.0 Primer BBP520
Azotobacter vinelandii Cell Paste Taq polymerase
Lysozyme PCR tubes
Tris-HCl 1M pH 8.0 Thermocycler
Eppendorf Tubes 10mM dNTPs
Pipettes and Pipette tips 50mM MgCl2
Centrifuge
Hot Water Bath
Isolation of Genomic DNA
1. In an Eppendorf tube, mix these solutions in the following order: 1) 1mL
of sterile water, 2) 100µL of Tris-HCl, and 3) 100µL of Triton X-100.
Dissolve in the mix 5mg of Lysozyme. This is called the Cell Extraction
Buffer.
2. Resuspend the A. vinelandii cell pellet in 400µL of sterile water.
3. Add 150µL of Cell Extraction Buffer to the resuspended cells.
4. Boil the cell suspension for 10 minutes (boil the suspension with the
Eppendorf tube cap open, being careful not to let water splash into the
Eppendorf tube).
5. Then vortex and centrifuge at maximum speed for 2 minutes.
6. Place the green/brown supernatant in a clean Eppendorf tube and add
700µL of isopropyl alcohol. Mix and allow to stand for 5 minutes
7. Centrifuge at maximum speed for 1 minute.
8. Discard the supernatant and keep the pellet. The bulk of the genomic
DNA is on the pellet. Resuspend gently the pellet with 600µL of
isopropyl alcohol. Allow to stand for 3 minutes.
9. Centrifuge at maximum speed for 1 minute.
10. Discard the supernatant and resuspend the pellet with 1mL of ethanol.
11. Centrifuge at maximum speed for 2 minutes.
12. Discard supernatant and let the pellet air-dry for at least 20 minutes.
13. Once the pellet has dried out resuspend it in 200µL of sterile water and
20µL of 5mM Tris-HCl ph 8.0. The DNA is now crudely isolated and
ready for PCR.
The PCR Experiment
1. Add to a PCR tube in the following order: 1) 5µL of 10x taq buffer, 2)
39.25µL of sterile water, 3) 1 µL 10mM dNTPs, 4) 1µL of isolated
genomic DNA, 4) 1µL each of primers BBP456 and BBP520, 5) 1.5 µL
50mM MgCl2, and 6) 0.25µL of taq polymerase.
2. Mix with pipet, close the PCR tube, and spin down for 10 seconds.
3. Place the tube on the thermocycler tray and close the lid tight. The
following scheme resumes the PCR experiment conditions needed to
amplify the vnf operon, 1558bp long region of the Azotobacter genomic
DNA.
4. Program the thermocycler (PCR machine) according to the following
diagram.
5. Start thermocycler. TA will remove product and bring it to the next class
for you.
Experimental Protocol #3
Day 2
Materials and Apparatus:
Agarose 100 mL beaker
TBE buffer Graduated Cylinder
DNA loading buffer scales
PCR product (from previous lab period) Weigh papers
DNA ladder microwave
Ethidium Bromide gel electophoresis aparatus
Eppendorf Tubes
Pipettes and pipette tips
Agarose Gel Electrophoresis
1. Weigh out 0.8g of Agarose. Place the agarose on a 100mL beaker.
2. Add 60mL of TBE buffer and boil in the microwave until the agarose has
been dissolved. After the agarose has been dissolved add 5ul Ethidium
bromide to the solution and gently mix.
3. Assemble the agarose gel tray and pour on it the agarose solution when it
has cooled down to a temperature warmth to the touch. Immediately insert
the comb into the liquid agarose. Let the gel polymerize (reach room
temperature) for at least 30 minutes.
4. As the gel polymerizes, mix 10µL of your PCR product with 10µL of
DNA loading buffer in a 0.6mL Eppendorf tube. As a control we will be
running DNA molecular weight markers in parallel with your PCR
products. Mix 1.5µL of DNA ladder with 10µL of DNA loading buffer.
5. Once the gel has hardened remove the comb carefully and place the
agarose slab (the tray with the slab) on the chromatographic chamber so
that it faces the correct way (wells at the black electrode).
6. Pour in the chamber enough TBE buffer to cover the agarose slab.
7. Load the DNA ladder on well #1. Load a total of 20µL of sample into the
remaining wells.
8. Once the samples have been loaded cover the gel chamber with the lid,
attach the power cords to the power supply and run the gel at 65 volts until
the blue dye has migrated about half way down the length of the gel.
9. Once the DNA chromatography has finished the power supply is turned
off and the electrophoresis chamber taken apart. Your TA will take a
photo of the gel. This photo will be e-mailed to your e-mail account.