J Appl Phycol (2007) 19:207–213
DOI 10.1007/s10811-006-9125-8
Increased activity of the non-regulated enzymes fructose-1,
6-bisphosphate aldolase and triosephosphate isomerase
in Anabaena sp. strain PCC 7120 increases
photosynthetic yield
Weimin Ma & Lanzhen Wei & Quanxi Wang &
Dingji Shi & Haibao Chen
Received: 14 June 2006 / Revised and Accepted: 26 August 2006 / Published online: 29 November 2006
# Springer Science + Business Media B.V. 2006
Abstract Non-regulated enzymes in the Calvin cycle roplast triosephosphate isomerase (TPI)—were cloned
are generally presumed to be less important for the and co-expressed in cells of the cyanobacterium
regulation of photosynthetic yield. Here, to investigate Anabaena sp. strain PCC 7120. The activity of FBA
the relationship between the activity of non-regulated and TPI and the photosynthetic yield reflected by
enzymes and photosynthetic yield, two non-regulated photosynthetic O2 evolution and cell dry weight were
enzymes in the Calvin cycle—a rice cytosolic fructose- measured and compared between wild-type and trans-
1,6-bisphosphate aldolase (FBA) and a spinach chlo- genic cells. Our results demonstrated that the activity of
FBA and TPI were increased in transgenic cells relative
W. Ma and L. Wei contributed equally to this work. to wild-type cells, and that activity was further increased
W. Ma : L. Wei : Q. Wang : D. Shi (*) in a transgenic strain harboring two sets of FBA-TPI
College of Life and Environment Sciences, tandem genes relative to cells containing one copy of the
Shanghai Normal University, FBA-TPI tandem gene. The increased activity of FBA
Shanghai 200234, People’s Republic of China
e-mail: cyanoshi@[Link]
and TPI in Anabaena sp. strain PCC 7120 increased
photosynthetic yield, with increased activity levels
W. Ma
e-mail: cyanoma@[Link]
correlating closely with the degree of changes in
photosynthetic yield. This implies that the photosyn-
W. Ma : D. Shi thetic yield is limited by the activity of the non-regulated
Laboratory of Photosynthesis, Institute of Botany, enzymes FBA and TPI, and that the endogenous activity
Chinese Academy of Science,
Beijing 100093, People’s Republic of China
of non-regulated enzymes is not sufficient to increase
photosynthetic yield. We discuss the various roles of
W. Ma FBA and TPI, and regulated and non-regulated
National Laboratory of Plant Molecular Genetics, enzymes, in modulating photosynthetic yield.
Institute of Plant Physiology and Ecology,
Shanghai Institutes for Biological Sciences,
Graduate School of the Chinese Academy of Sciences, Key words Anabaena sp. strain PCC 7120 . enzyme
300 Fenglin Road, Shanghai 200032, activity . fructose-1,6-bisphosphate aldolase .
People’s Republic of China photosynthetic yield . triosephosphate isomerase
H. Chen
State Key Laboratory of Bio-organic and Natural Products
Abbreviations
Chemistry, Institute of Organic Chemistry, CS control strain harboring pRL489
Chinese Academy of Science, DHAP dihydroxyacetone phosphate
Shanghai 200032, People’s Republic of China FBA fructose-1,6-bisphosphate aldolase
208 J Appl Phycol (2007) 19:207–213
FBP fructose-1,6-bisphosphate ribulose-1,5-bisphosphate (RuBP) regeneration cycle.
FBPase fructose-1,6-bisphosphatase It is believed that the rate of turnover in the Calvin
G-3-P D-glyceraldehyde-3-phosphate cycle is determined largely by the substrates RuBP,
RuBP ribulose-1,5-bisphosphate G-3-P and fructose-6-bisphosphate (Fridlyand and
SBPase sedoheptulose-1,7-bisphosphatase Scheibe 1999). Thus, it seems likely that FBA and TPI
TPI triosephosphate isomerase are strategically positioned to determine the pathway
TS1 transgenic strain harboring pRLFT1 and rate of the metabolic flux in the Calvin cycle.
TS2 transgenic strain harboring pRLFT2 The aim of the present study was to investigate the
WT wild-type relationship between the activity of non-regulated
enzymes and the photosynthetic yield. FBA and TPI
were selected as the target enzymes because of their
Introduction important positions within the Calvin cycle. The
activity of FBA and TPI as well as the photosynthetic
The ability to improve photosynthetic carbon fixation yield were analyzed in the wild-type cyanobacterium
in higher plants and algae is a primary goal in Anabaena sp. strain PCC 7120 as well as in trans-
agricultural and environmental research. Many studies genic strains. The results demonstrate the important
have focused on the regulation of the Calvin cycle, a role of non-regulated enzymes in modulating photo-
primary pathway for carbon fixation, in order to produce synthetic yield.
plants with increased photosynthetic yield. It has been
widely assumed that the regulated enzymes that catalyze Materials and methods
irreversible reactions are the major limiting factors in the
Calvin cycle (Spreitzer 1993; Hartman and Harpel Culture conditions
1994), whereas the remaining non-regulated enzymes
that catalyse readily-reversible reactions are present in Wild-type Anabaena 7120 (WT), transgenic Anabaena
excess and, consequently, are ultimately unimportant 7120 harboring pRL489 (control strain, CS), pRLFT1
for regulation of photosynthetic carbon fixation (transgenic strain, TS1) and pRLFT2 (transgenic
(Newsholme and Start 1973; Stitt 1995, 1996). How- strain, TS2) cells were cultured in BG-11 medium
ever, the emphasis of this research has now shifted, due (Allen 1968) buffered with Tris-HCl (5 mM, pH 8.0)
in part to the finding that manipulating the regulated and bubbled with 2% (v/v) CO2 in air. For growth on
enzymes fails to produce plants with high photosyn- plates, the medium was supplemented with 15 g L−1
thetic yield. In addition, studies using transgenic plants agar. All cultures were grown at 30°C with continuous
with reduced (Haake et al. 1998, 1999) or increased illumination by fluorescent lamps (60 μmol photons
(Barry et al. 1998; Kang et al. 2005) enzyme levels m−2s−1). Transgenic strains were supplemented with
have demonstrated that the non-regulated enzymes, 100 μg mL−1 neomycin sulfate (neo).
such as fructose-1,6-bisphosphate aldolase (FBA),
might play a significant role in regulating carbon flux Construction of the shuttle expression plasmid
throughout the cycle. However, little information is
available regarding the relationship between the activity The pDCFAT plasmid harboring the fructose-1,6-
of non-regulated enzymes and photosynthetic yield. bisphophatase (FBPase), FBA and TPI genes and the
Triosephosphate isomerase (EC [Link], TPI) and Ptrc promoter (Tang et al. 2001) was digested with
fructose-1,6-bisphosphate aldolase (EC [Link], FBA) BamHI and ligated into the shuttle plasmid pRL489.
continuously catalyze the rapid and reversible ketose- Standard general methods and protocols were used in
aldose isomerization of dihydroxyacetone phosphate molecular cloning (Sambrook et al. 1989).
(DHAP) and D-glyceraldehyde-3-phosphate (G-3-P),
followed by the reversible aldol condensation of Triparental conjugative transfer
DHAP and G-3-P to fructose-1,6-bisphosphate (FBP).
The metabolic process branches after the TPI and FBA Triparental conjugative transfer was performed as
reactions, and the products either leave the Calvin described by Elhai and Wolk (1988) with slight
cycle and contribute to starch biosynthesis, or enter the modifications (Liu et al. 1999).
J Appl Phycol (2007) 19:207–213 209
Figure 1 Schematic de-
scribing the construction of
the shuttle expression plas-
mids pRLFT1 and pRLFT2.
PCR analysis medium A [10 mM HEPES-NaOH, 5 mM sodium
phosphate (pH 7.5), 10 mM MgCl2 and 10 mM NaCl],
Total DNA was extracted from the cells of WT, CS, TS1 supplemented with 25% glycerol. Cells were disrupted
and TS2 according to the method of Cai and Wolk by five 20 s pulses with a Bead-beater (Biospec, Japan)
(1990), and FBA-TPI tandem genes were PCR followed by a 3 min incubation on ice. The homogenate
amplified from total DNA of WT, CS, TS1 and TS2 was centrifuged at 10,000 × g for 5 min at 4°C to
using forward primer (5′–3′): (a) ATGTCTGCC remove unbroken cells and debris. The supernatant was
TATTGTGGTAAGTAC and reverse primer (5′–3′): immediately subjected to measurement of enzyme
(b) TCAAGCAGCAACTTTCTTTGCTG and the fol- activity.
lowing cycling conditions: 94°C for 5 min, then 30
cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min, Determination of enzyme activity
and a final extension at 72°C for 10 min.
Enzyme activity was determined using standard
methods (Rol et al. 1949; Richards and Rutter
Isolation of whole cell extracts 1961). Briefly, 1 mL reaction solution containing
100 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 μg
WT and transgenic cells harboring pRL489, pRLFT1 or BSA, 8 mM DHAP and 20 μg Anabaena 7120
pRLFT2 (A730 = 0.4 – 0.6) were harvested by centrifu- supernatant protein was incubated at 25°C for 10 min,
gation at 10,000 × g for 5 min, then suspended in and the reaction was stopped by adding 875 μL 30%
210 J Appl Phycol (2007) 19:207–213
Measurement of dry weight
The dry weight of WT, CS, TS1 and TS2 cells was
measured according to the method of Vonshak (1985).
Results
Cloning of a rice cytosolic FBA and a spinach
chloroplast TPI in Anabaena 7120
To clone the two non-regulated enzymes—a rice
cytosolic FBA and a spinach chloroplast TPI—in
cyanobacterium Anabaena 7120, the plasmid
pDCFAT (Tang et al. 2001) was digested with
BamHI. A ∼2 kb fragment containing the FBA and
Figure 2 Identification of the fructose-1,6-bisphosphate aldol- TPI coding region was inserted into the pRL489
ase–triosephosphate isomerase (FBA–TPI) tandem genes on a plasmid downstream of the strong PpsbA promoter to
1.2% agarose gel. Lanes: 1 DL2000 molecular weight marker, 2 generate shuttle expression plasmids pRLFT1 and
Anabaena 7120 harboring pRL489, 3 Anabaena 7120 harbor- pRLFT2, which contained one set and two sets of the
ing pRLFT1, 4 Anabaena 7120 harboring pRLFT2, 5 Wild-
type Anabaena 7120, 6 negative control. FBA–TPI tandem genes, respectively (Figure 1).
Constructs were confirmed by agarose gel electro-
phoresis and direct sequencing (data not shown).
The shuttle expression plasmids pRLFT1 and
pRLFT2 were then transferred into the filamentous
HCl and 125 μL of resorcinol thiourea reagents (0.1% heterocystous cyanobacterium Anabaena 7120 by tri-
resorcinol and 0.25% thiourea in glacial acetic acid). parental conjugation transfer. Cells harboring pRLFT1
The mixture remained at 80°C for 10 min and was or pRLFT2 were screened by growth on neomycin-
then air-cooled to room temperature. The optical containing medium plates (data not shown), and then
density at 520 nm was measured for FBP formation picked and cultivated in BG-11 liquid medium supple-
catalyzed by FBA and TPI with a non-incubated mented with 100 μg mL−1 neomycin.
control as a blank, and the reading was related to FBP PCR amplification of wild-type and transgenic
standards. Protein content was measured using the Anabaena 7120 cells with primers (a) and (b) (see
Lowry method (Markwell et al. 1978). One unit of Materials and methods) revealed no band in WT and
activity was defined as the formation of 1 μmol FBP CS cells, whereas the transgenic cells TS1 and TS2
per minute catalyzed by 1 mg protein. each displayed a ∼2.0 kb band (Figure 2). This result
indicated that one set and two sets of tandem rice
Photosynthetic oxygen evolution cytosolic FBA and spinach chloroplast TPI genes
were successfully transferred into Anabaena 7120.
Oxygen evolution by photosynthesis was measured at
25°C with a Clark-type oxygen electrode (Hansatech, Effect of co-expression of tandem FBA–TPI genes
UK), according to the method of Ma and colleagues in Anabaena 7120 on enzyme activity
(2005). Cells were suspended in BG-11 medium with and photosynthetic yield
a chlorophyll a concentration of 20 μg mL−1. The
NaHCO3 (10 mM final concentration) was added to Enzyme activity
the 2 mL cell suspension 2 min prior to measurement.
The intensity of actinic light used for the measure- The activity of the two non-regulated enzymes, rice
ment of photosynthetic O2 evolution was 600 μmol cytosolic FBA and spinach chloroplast TPI, was
photons m−2s−1. increased in TS1 and TS2 cells to approximately177%
J Appl Phycol (2007) 19:207–213 211
(TS1) and 259% (TS2) of the levels in WT cells
(Figure 3). In contrast, the enzyme activity in CS cells
was only slightly altered as compared with WT cells
(Figure 3). These results indicated that the one and
two set(s) of tandem rice cytosolic FBA and spinach
chloroplast TPI genes were successfully co-expressed
in transgenic Anabaena 7120, and were associated
with increased enzyme activity, with a greater
increase in TS2 than in TS1 cells.
Photosynthetic yield
O2 evolution and cell dry weight were elevated in
TS1 and TS2 cells by approximately 130% (O2
evolution of TS1), 198% (O2 evolution of TS2),
122% (dry weight of TS1) and 171% (dry weight of
TS2) of the corresponding levels in WT cells
(Figure 4a, b). By contrast, changes in the photosyn-
thetic O2 evolution and dry weight of CS cells were
much less robust relative to WT cells (Figure 4a, b).
Therefore, the photosynthetic yield reflected by
photosynthetic oxygen evolution and cell dry weight
was increased in transgenic cells compared to WT
cells, with a greater increase in the TS2 than in the Figure 4 Photosynthetic yield reflected by photosynthetic
TS1 strain. oxygen evolution (a) and dry weight of cells (b) in transgenic
Anabaena 7120 harboring pRL489 (CS), pRLFT1 (TS1) and
pRLFT2 (TS2) and wild-type Anabaena 7120 (WT). Experi-
ments were repeated at least five times and standard errors were
calculated.
The relationship between the increased activity
of the non-regulated enzymes FBA and TPI
and the elevated photosynthetic yield
in Anabaena 7120
To determine whether the elevated photosynthetic yield
in transgenic Anabaena 7120 cells was due to the
increased activity of the non-regulated enzymes FBA
and TPI, we investigated the relationship between the
increased activity levels of the non-regulated enzymes
FBA and TPI and the degree of changes to photosyn-
thetic yield in Anabaena 7120 (Figure 5). The black
Figure 3 Activity of the non-regulated enzymes FBA and TPI and white circles depicting photosynthetic O2 activity
in transgenic Anabaena 7120 harboring pRL489 (CS), pRLFT1 and cell dry weight, respectively, at various enzyme
(TS1) and pRLFT2 (TS2), and wild-type Anabaena 7120 (WT). activities (Figure 5) of the wild-type and transgenic
One unit of activity (1 U) was defined as the formation of
1 μmol fructose-1,6-bisphosphate (FBP) per minute catalyzed Anabaena 7120 strains were close to, or on, a line with
by 1 mg protein. Vertical bars indicate standard errors a slope of 1. These results suggest that the photosyn-
calculated from at least five independent experiments. thetic yield of transgenic cells, as reflected by both O2
212 J Appl Phycol (2007) 19:207–213
suggest that the endogenous activity of the non-
regulated enzymes, at least that of FBA and TPI, is
not sufficient to support increased photosynthetic yield.
The rice cytosolic FBA and spinach chloroplast
TPI were also individually cloned and expressed in
Anabaena 7120 cells. The activities of FBA and TPI
and the photosynthetic yield measured in a transgenic
strains harboring individual genes were much less
robust than those measured in transgenic strains
harboring the FBA–TPI tandem genes (Feng et al.,
unpublished data). This implies that the co-expression
of FBA and TPI in transgenic cells increases the activity
of both enzymes as well as the resultant photosynthetic
yield. On the other hand, we compared the individual
Figure 5 The relationship between the activity of the non-
regulated enzymes FBA and TPI and the elevated photosyn- activity of FBA and TPI and photosynthetic yield in
thetic yield. The line has a slope of 1 and intercepts the axes at transgenic Anabaena 7120 harboring the genes indi-
0%. vidually and found that the increased activity of FBA
and resultant photosynthetic yield were much more
robust than the increased activity of TPI and resultant
evolution and dry weight, is limited by the activity of photosynthetic yield (Feng et al., unpublished data). It
FBA and TPI present in the WT and transgenic cells. may be that FBA exhibits activities of both FBA and
sedoheptulose-1,7-bisphosphatase (SBPase) and thus is
more able to modulate photosynthetic yield than TPI.
Discussion Similarly, it is possible that co-expression of the FBA–
TPI tandem genes in Anabaena 7120 causes increased
The Calvin cycle is the primary pathway of photosyn- activities of the regulated enzyme(s) since FBA
thetic carbon fixation. A major goal of photosynthesis exhibits SBPase activity. However, the effect of co-
research is to identify the limiting steps within the cycle expression of the two non-regulated enzymes on the
in order to increase photosynthetic yield while decreas- activities of the regulated enzyme(s) is worthy of further
ing greenhouse gas emissions. Current efforts to investigation.
improve photosynthetic yield have focused largely on Recent studies indicate that the increased activity
regulating the catalytic enzymes of the Calvin cycle by of SBPase, a regulated enzyme in the Calvin cycle, in
genetic engineering (Leegood et al. 2000), and the transgenic tobacco is not directly proportional to the
emphasis of this research has concentrated primarily change in photosynthetic yield (Lefebvre et al. 2005).
on various regulated enzymes in the Calvin cycle By contrast, the current results not only demonstrate
(Miyagawa et al. 2001; Lefebvre et al. 2005; Ma et al. that the increased activity of the non-regulated enzymes
2005). However, decreased plastid FBA levels in FBA and TPI in the cyanobacterium Anabaena 7120
antisense transgenic potato lead to a dramatic decrease induces elevated photosynthetic yield (Figure 4a, b),
in RuBP, as well as an inhibition of ambient photo- but also that the increased activity levels correlate
synthesis and growth (Haake et al. 1998, 1999). In closely with the degree of the changes in photosyn-
contrast, the increased exogenous rice cytosolic FBA thetic yield (Figure 5). On the other hand, our previous
and spinach chloroplast TPI activity in transgenic results showed that increased activity of wheat chloro-
Anabaena 7120 induces a significant increase in plastic FBPase, a regulated enzyme, in Anabaena 7120
photosynthetic yield (Figures 3, 4, and 5). Thus, current enhanced photosynthetic yield in transgenic cells (Ma
results supported the view that the non-regulated et al. 2005). However, in that study, the increase in
enzymes, catalyzing a freely reversible reaction, exert photosynthetic yield was much less robust than the
a significant amount of control over photosynthetic increase in photosynthetic yield induced by the non-
carbon flux and RuBP regeneration (Barry et al. 1998; regulated enzymes FBA and TPI in the present study
Haake et al. 1998, 1999; Kang et al. 2005), and also (Figure 4a, b). Taken together, the differing influences
J Appl Phycol (2007) 19:207–213 213
of the activity of the regulated and non-regulated Kang R, Shi D, Cong W, Ma W, Cai Z, Ouyang F (2005)
Effects of co-expression of two higher plants genes ALD
enzymes on photosynthetic yield suggest that they may
and TPI in Anabaena sp. PCC7120 on photosynthetic CO2
be modulated by different mechanisms. fixation. Enzyme Microb Technol 36:600–604
In conclusion, the results from the present study Leegood RC, Sharkey TD, von Caemmerer S (2000) Photo-
indicate that the increases in activity of the exogenous synthesis: physiology and metabolism. Kluwer, Dordrecht,
pp 1–8
non-regulated enzymes FBA and TPI in Anabaena Lefebvre S, Lawson T, Fryer M, Zakhleniuk OV, Lloyd
7120 increase the resultant photosynthetic yield and, JC, Raines CA (2005) Increased sedoheptulose-1,7-
furthermore, the increased activity levels correlate bisphosphatase activity in transgenic tobacco plants
closely with the degree of changes in photosynthetic stimulates photosynthesis and growth from an early stage
in development. Plant Physiol 138:451–460
yield. Taken together, these findings suggest that the
Liu F, Zhang H, Shi D, Shang Z, Lin C, Shao N, Peng G,
endogenous activity of non-regulated enzymes is not Zhang X, Zhang H, Wu J, Wang J, Xu X, Jiang Y,
sufficient to induce higher levels of photosynthetic Zhong Z, Zhao S, Wu M, Zeng C (1999) Construction of
yield. The individual activities of FBA and TPI, and the shuttle expression vector of human tumor necrosis factor
alpha (hTNF-α) gene and its expression in a cyanobac-
regulated and non-regulated enzymes from the Calvin
terium, Anabaena sp. PCC 7120. Sci China (Ser C)
cycle may play different roles in regulating photosyn- 42:25–33
thetic yield. Ma W, Shi D, Wang Q, Wei L, Chen H (2005) Exogenous
expression of the wheat chloroplastic fructose-1,6-
Acknowledgements The authors are deeply grateful to Prof. bisphosphatase gene enhances photosynthesis in the
G.L. Tang (Institute of Organic Chemistry, Chinese Academy transgenic cyanobacterium, Anabaena PCC 7120. J Appl
of Sciences) for providing the pDCFAT plasmid and for fruitful Phycol 17:273–280
discussion. The authors also thank Prof. C.P. Wolk (Michigan Markwell MAK, Haas SM, Bieber LL, Tolbert NE (1978) A
State University) for providing the pRL489, RP4 and pRL623 modification of the Lowry procedure to simplify protein
plasmids. determination in membrane and lipoprotein samples. Anal
Biochem 87:206–210
Miyagawa Y, Tamoi M, Shigeoka S (2001) Overexpression
References of a cyanobacterial fructose-1,6-/sedoheptulose-1,7-
bisphosphatase in tobacco enhances photosynthesis and
growth. Nat Biotechnol 19:965–969
Allen MM (1968) Simple conditions for growth of unicellular
Newsholme EA, Start C (1973) Regulation in metabolism.
blue-green algae on plates. J Phycol 4:1–4
Wiley, London
Barry GF, Cheikh N, Kishore GM (1998) Expression of fructose-
Richards OC, Rutter WJ (1961) Preparation and properties of
1, 6-bisphosphate aldolase in transgenic plants for im-
yeast aldolase. J Biol Chem 236:3177–3184
proved crops with better solids uniformity by improving
Rol JH, Epstein JH, Goldstein NP (1949) A photometric
carbon availability. PCT Int Appl WO 9858069 Al 23 Dec
method for the determination of insulin in plasma and
pp77
urine. J Biol Chem 178:839–845
Cai Y, Wolk CP (1990) Use of a conditionally lethal gene in
Anabaena sp. strain PCC 7120 to select for double Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning:
recombinants and to entrap insertion sequences. J a laboratory manual, 2nd ed. Cold Spring Harbor
Bacteriol 172:3138–3145 Laboratory Press, Cold Spring Harbor, NY
Elhai J, Wolk CP (1988) Conjugal transfer of DNA to Spreitzer (1993) Genetic dissection of Rubisco structure and
cyanobacteria. Methods Enzymol 167:747–754 function. Annu Rev Plant Phys Plant Mol Biol 44:
Fridlyand LE, Scheibe R (1999) Regulation of the Calvin cycle 411–434
for CO2 fixation as an example for general control Stitt M (1995) The use of transgenic plants to study the
mechanisms in metabolic cycles. Biosystems 51:79–93 regulation of plant carbohydrate metabolism. Aust J Plant
Haake V, Zrenner R, Sonnerwald U, Stitt M (1998) A moderate Physiol 22:635–646
decrease of plastid aldolase activity inhibits photosynthe- Stitt M (1996) Metabolic regulation of photosynthesis. In:
sis, alters the levels of sugars and starch, and inhibits Baker N (ed) Advances in photosynthesis, vol 3, environ-
growth of potato plants. Plant J 14:147–157 mental stress and photosynthesis. Kluwer, Dordrecht,
Haake V, Geiger M, Walch-Liu P, Engels C, Zrenner R, Stitt M pp 151–190
(1999) Changes in aldolase activity in wild-type potato Tang G, Yang C, Bao J, Wang Y, Chen H, Shi D, Liu F (2001)
plants are important for acclimation to growth irradiance Co-expression of triosephosphate isomerase, fructose-1,
and carbon dioxide concentration, because plastid aldolase 6-bisphosphate aldolase and fructose-1, 6-bisphosphatase
exerts control over the ambient rate of photosynthesis in [Link]. Acta Biochim Biophys Sinica 33:131–136
across a range of growth condition. Plant J 17:479–489 Vonshak A (1985) Culture methods and biomass produce of
Hartman FC, Harpel MR (1994) Structure, function, regulation algae. In: Coombs J, Hall DO, Long SP, Scurlock JMO
and assembly of D-ribulose-1,5-bisphosphate carboxylase (eds) Techniques in bioproductivity and photosynthesis,
oxygenase. Annu Rev Biochem 63:197–234 2nd edn, vol 15. Pergamon, Oxford, pp 196–211